1. Phyol.

33, 286-293

(1997)

PHYLOGENY OF CHLOROMONAS (CHLOROPHYCEAE):

A STUDY OF 185 RIBOSOMAL RNA GENE SEQUENCES
Mark A. Buchheim2
Faculty of Biological Scierice and the Mewin Bovaird Center for Molecular Biology and Biotechnology,
Thc University of Tulsa, 600 South College Avenue, Tulsa, Oklahoma 74104-3189

Julie A. Buchheim
Department of Biological Science, The University of Tulsa, 600 South College Avenue,
Tulsa, Oklahoma 74104-3189

and

Russell L. Chapman
Department of Plant Biology, Louisiana State University, Baton Rouge, Louisiana 70803-1705

For example, several Chloromonas species are found

exclusive$ in cold habitats or as inow algae (Ettl
1970, Hoham 1980). Chloromonas is universally regarded as an ally of Chlamydomonas; however, the
phylogenetic affinities of Chloromonas have not been
explored in any detail. Moreover, phylogenetic
questions have not been examined independent of
morphological and life history criteria. The extent
of variability in the nuclear-encoded small-subunit
(18s)ribosomal RNA (rRNA) gene that has been
observed in comparisons of Chlamydomonas taxa
(Buchheim et al. 1990,1994,1996) and Carteria taxa
(Buchheim and Chapman 1992, Buchheim et al.
1996) raises questions about the taxonomic homogeneity of other chlamydomonad genera including
Chloromonas. Consequently, this investigation addresses three questions. 1) What is the extent of molecular diversity, as estimated by comparisons of 18s
rRNA gene sequences, among species of Chloromonas? 2) Do Chloromonas taxa form a monophyletic
group? 3) What is the relationship of Chloromonas to
other chlamydomonad taxa?

IZBSTRACT

The unicellular, biflagellate genus Chloromonas d$

from its ally, Chlamydomonas, primarib 4 the a b
sence of pyrenoids in the vegetative stage of the former. As
with most green flagellate genera, little is known about
phylogenetic affinities within and among Chloromonas
sfecies. Phylogenetic analyses of nuclear-encoded small-sub
unit ribosomal RiVA gene sequences demonstrate that a
sampling offive Chloromonas taxa, obtainedpom major
culture collections, do not fm a m o n ~ h y l e t igroup.
~
Howmer, on4 three of these isolates, Chloromonas clathrata, Chloromonas serbinowi, and Chloromonas rosae, are diagnosable rngbhologacally as Chloromonas
species b~ the absence of a pyrenoid in the vegetative stage.
The three diagnosable Chloromonas taxa form a n alliance with two pyrenoid-bearingchlumydomonads, Chlamydomonas augustae and Chlamydomonas macrostellata. With the exception of Chloromonas serbinowi,
which represents the basal lineage within the clade, each
of the diagnosable Chloromonas taxa and theirpyrenoidbearing Chlamydomonas allies were isolated originally
from mountain soils, snow, or cold peat. These obserualions suggest that habitat, independent of pyrenoid status,
may be most closely linlted to the natural histmy of this
clade of chlamydomonad flagellates.

fers

MATERIALS AND METHODS

Taxon selection. A total of 28 ingroup taxa were included in the

phylogenetic analyses (Table 1). Five taxa listed in the SAG catalog (Schlosser 1994) and the UTEX catalog (Starr and Zeikus
1993) as Chloromonas species were included in the analyses.
Among these five is Chloromonas (Clm.) clathrata (UTEX L.B 1970),
which was originally identified in the UTEX catalog as Chlunlydomonas (Chl.) yellorustonensis (Starr and Zeikus 1993), and Clm.
st.rDinowz, which was originally identified in the UTEX catalog as
Chl. subinom (Starr and Zeikus 1993). A number of other flagellate taxa included in this analysis have undergone nomenclatural
revisions after reassessment by Schlosser and Ettl (e.g. Ettl and
Schlijsser 1992). The latest versions of the SAG (Schliisser 1994)
and UTEX (Starr and Zeikus 1993) catalogs have incorporated
many of Schlijsser and Ettls unpublished observations. Consequently, the revised names will be used in this discussion. Table
2 lists those isolates that have had nomenclatural changes.
DNA sxtradion and preparation of sequencing templates. Sequence
data from the nuclear-encoded 18s rRNA gene for 10 of 27 ingroup t K d (Table 1 ) are from previous investigations. Genoinic
DNA for 18 new sequences was obtained using extraction protocols described previously (Buchheim and Chapman 1992). Double-stranded DNA sequencing templates were obtained by sym-

Kpr index words: Chlamydomonas; Chloromonas; pyrenoid; rlWA gene sequences

Chloromonas is a unicellular, biflagellate member
of the green algal order Chlamydomonadales (sensu
Mattox and Stewart 1984). Chloromonas differs little
from its sister genus, Chlamydomonas; however, Chloromonas is diagnosed by the absence of pyrenoids in
the chloroplast of the motile vegetative cells (Ettl
1967, 1970, 1983, Iyengar and Desikachary 1980).
From an ecological perspective, the genus Chloromonas has a number of distinctive representatives.
Received 16 August 1996. Accepted 17 November 1996.
Author for correspondencc and email address: buchheimma@centum.utulsa.edu.
L

286

287

PHYLOGENY OF CHLOROMONAS
TABLE1. List of taxa examined in this investigation.
Taxd

Source*

Outgroup
Hydrodictyon Roth
rtticulatum (L.) Lagerh.
Pediastmm Meyen
duplex Meyen
Scenedesmus Meyen
obliquus (Turp.) Kutz.
Ingroup
Asteromonas Artari
gracilis Artari
Chlamydopodium Ettl et Komarek
vacuolatum (Lee et Bold) Floyd et Watanabe
Chlumydomo~asEhrenberg
applanata Pringsheim
asymmetn'ca Korshikov
augustae Skuja
baca Ettl
bipapillata Bourrelly
jmbnata Ettl
macrostellata Lund
momusii Gerloff
noctigama Korshikov
noctigama Korshikov
mutabilzs Gerloff
pitschmannii Ettl
radiata Deason et Bold
rapa Ettl
ra'nhardtii Dangeard
zebra Korshikov
Chlorococcum Meneghini
echinozyptum Starr
Chlwnmonas Gobi emend. Wille
clathrata Korshikov
oogama (Moewus) Gerloff et Ettl
perjorata (Pascher et Jahoda) Gerloff et Ettl
rosae Ettl
serbinowi Wille
Dunaliella Teodorescu
pama Lerche
Haematococcus C. A. Agardh
zimbabwiensis Pocock
Stephanosphaera Coh n
SP,
Volvox Linnaeus
cartm' Iyengar

Citation and Cenbank accession number

CBS

Wilcox et al. 1992 (M74497)

UTEX LB 1364

Wilcox et al. 1992 (M62997)

SAG 2763a

Huss and Sogin 1990 (X56103)

UTEX LB 635

Wilcox et al. 1993 (M95614)

UTEX 21 1

Lewis et al. 1992 (M63001)

UTEX 225
SAG 70.72
UTEX LB 969
SAG 24.87
SAG 11-47
SAG 17.72
SAG 72.81
SAG 11.11
SAG 33.72
SAG 19.73
UTEX 578
SAG 14.73
UTEX 966
SAG 48.72
CC-400
SAG 10.83

Gordon et al. 1995 (U13984)

Present investigation (U70788)
Buchheim et al. 1996 (U57696)
Present investigation (U70781)
Present investigation (U70783)
Present investigation (U70784)
Present investigation (U70785)
Present investigation (U70786)
Present investigation (U70782)
Present investigation (U70787)
Buchheim et al. 1996 (U57695)
Present investigation (U70789)
Buchheim et al. 1996 (U57697)
Present investigation (U70790)
Gunderson et al. 1987 (M32703)
Present investigation (U70792)

UTEX 118

Buchheim et al. 1996 (U57698)

UTEX LB 1970
SAG 9.7gb
SAG l143b
UTEX 1337
UTEX 492

Present
Present
Present
Present
Present

UTEX LB 1983

Lewis et al. 1992 (M62998)

UTEX LB 1758

Present investigation (U70797)

UTEX LB 2409

Present investigation (U70798)

UTEX 1885

Rausch et al. 1989 (X53904)

investigation
investigation
investigation
investigation
investigation

(U70791)
(U70793)
(U70794)
(U70796)
(U70795)

a Source of taxa used to generate the data: CBS = Carolina Biological Supply, CC = Chlamydomonas Genetics Center at Duke University,
SAG = Sammlung von Algenkulturen Gottingen, UTEX = Culture Collection at the University of Texas at Austin.
Microscopical analysis (see text) indicates that this isolate is not diagnosable as a species of Chloromonas.

metrically amplifying genomic DNA using the polymerase chain

reaction (PCR). The flanking primers used to amplify the 18s
rRNA gene, NS1 and ITS2, are described by White et al. (1990).
These two primers amplify a 2.2-kb product that includes most of
the 18s rRNA gene. Products from two or more independent

amplifications were pooled to allow for the detection of heterogeneity in the 18s rRNA gene.
Sequence data: manual methods. New sequence data for most of
the ingroup taxa were obtained by using the protocols and reagents for cycle sequencing that accompany the AmpliCyclem cy-

TABLE
2. Nomenclatural changes among UTEX (Starr and Zeikus 1993) and SAG (Schliisser 1994) isolates ofChlamydomonas and Chloromonas
taxa included in the phylogenetic analysis.
Isolate

Original designation

New designation

UTEX 225
SAG 11-11
SAG 33.72
UTEX LB 1969
SAG 70.72
UTEX LB 1970

Chlamydomonas humicola
Chlamydomonas indica
Chlamydomonas monoica
Chlamydomonas nivalis
Chlamydomonaspeterjii
Chlamydomonasyellowstonensis

Chlamydomonas applanata
Chlamydomonas moewusii
Chlamydomonas noctigama
Chlamydomonas augustae
Chlamydomonas asymmetn'ca
Chloromonas clathrata

MARK A. BUCHHEIM ET AL.

288

TAULE
3. Painmriw comparison of primaly sequence diversity among isolutes o/Chloromonas. Uncorrected distance values ( x h , where x = number of
variable posilions und 7~ = ,number ofpositzons) in painise comparisons are presented ah71e the diagonal. Absolute n u m b s uf nuckolide d@mmces an
painiiise rompnri.vons are pre.sented below the diagonal.
(>'/7Il. f b l h 7 U l U

Clm. clulhrata
Clm. (i(ig~mn
Chi. perfbruta
Clm. rosae
Clm. sprbinowi

64
68

2
38

Clm. oopma

Clm. per/or&

Clm r0.w

Clm. snln'nowi

0.038834
87
60
87

0.041262
0.052781

0.001213
0.036408
0.039441

65
88

0.023058
0.052781
0.053398
0.022451
-

cle-sequencing kit (Perkin-Elmer). All sequencing reactions were

initiated with end-labeled sequencing primers (ssp dATP, NEN
DuPont) iii the presence of dNTPs, template, and thermal-stable
DNA polymerase. Six of eight sequencing primers employed in
these cycle-sequencing protocols arc identical to the sequencing
primers used in previous RTase protocols (18E. 18G, 18H, 18J,
18L, and 18P; Hamhy et al. 1988, Buchheim et al. 1990, 1994,
Buchheim arid Chapmari 1991, 1992). Two additional primers
that anneal ro the noncoding strand (GGGAGGTAGTGACAA'TAAAT [corresponds to sites 459-478 on the coding strand of
Chi. reinhnrdtii] and ATTCCGGTAA(;GAACGAGAC [cori-esponds
to sites 1312-1331 on the coding strand of Chl. reinhardtii]) were
used in the manual sequencing protocols in order to fill gaps in
the sequences (hetween sequences from primers 18G and 18P)
arid to sene as a check of data from the coding strand. Reaction
mixcs were separated on 6% polyacrylamide gels for 6 h followed
by autoradiography for 24-120 h. Manual sequencing methods
permitted construction of complete sequerices for the target region (i.e. a minimum of 1650 bases/taxon or ca. 92% of the
entire 18s gene) on the coding strand. Approximately 50 sites/
taxon of the coding strand are inferred from data derived from
the noricodirig strand. Approximately 50% of sites (ca. 800 sites/
taxon) from the target region of the Iioncodiiig strand were sequenced using manual methods. In addition, overlap of the manual DNA sequences derived from the individual sequencing primers allowed for a check of approximately 80% of the coding
strand. If a reevaluation of autoradiograms could not resolve differences in sequence from different sources (i.e. coding vs. noncoding or overlapping sequences), a new set of sequencing reactions was performed.
.Sequenw datu: untomuted methods. New sequence data from five
of the ingroup taxa (Chl. lnpupillata, Chl. ~momusii,Chl. Pibchmunmii, and CZm.serhn~oriii)were obtained with the protocols arid reagents for cycle sequencing that accompany the four-color
PRISM@@
reagent cyc.le-sequencing kit (Perkin-Elmer) designed
101use in ABI automated DNA sequencing systems. In addition
to the sequencing primers already listed, GATTAAGCCATGCATCTC (corrrsponds to sites 42-59 on the coding strand of
(,%l, reinhurdlii), TCTGCCCTATCAACTTTCGATGGTA (corresponds to sites 306-330 on the coding strand of Chl. reinhardtii),
CWTAGCGTATATTTAA (corresponds to sites 590-607 on the
coding strand of Chi. ra'nhardtii), and ATACCGTCGTAGTCTCAACC (corresponds to sites 1002-1021 on the coding strand of
(Al. reinhardlii) were used to obtain sequence data from the noncoding strand. Reaction mixes were run a n 6% polyacrylamide
gels (45 cm well-to-read) for 12 h using an ABI 373 "Stretch"
Automated DNA Sequencing System. ABI Data Collection Prcgram software (ver-sion 1.2) was used to collect the raw sequence
data. AUI DNA Sequencing software (version 2.1.2) was used to
analyze the raw collection data and to perform the base calling.
Automated base calls were checked against the four-color electrophcrogram. Automated sequencing methods permitted coristruction of completc scquences for the target region (i.e. a minimum
of 1650 bases/taxon or ca. 92% of the entire 18s gene) on both
the coding and noncoding strands. In addition, overlap of automated DNA sequences derived from the individual sequencing
primers allowed for a check of approximately 80% of the coding
strand and approximately 70% of the noncoding strand. If a reevaluation of electropherograms could not resolve differences in
sequence from diffrrent sources (ix. coding vs. rioncoding or

37

overlapping sequences), a new set of sequencing reactions was

performed.
Sequence alipmmts. Previous work (Buchheim et al. 1994, 1996)
served as the starting point for all alignments. The sequences
were edited and stored on a VAX-6320 computer (University of
Oklahoma Genetic Computer Group) using the SEQED program
from the GCG sequence analysis package (version 7.3; Genetics
Computer Group 1991). A total of 222 sites were excluded from
the phylogenetic analyses. The exclusion set is characterized by
blocks of sequence data 1) that are not clearly alignable (i.e. exhibit questionable homology), 2) that correspond to a flanking
primer region, or 3) for which comparable data for all taxa were
not available. The matrix aligrimerit begins at site 42 and ends at
site 1735 of Chl. reinhurdtii (Gunderson et al. 1987). The regions
of alignment with questionable homology exhibit base substitution coupled with length heterogeneity and correspond to sites
74, 132-134, 230, 677-685, 1350-1371, arid 1679-1708 of Chl.
reinhardtii (Gundersori et al. 1987). The alignment, which is available from the authors upon request, has been deposited in
TreeBASE (http://herbaria.harvard.edu/treebase/).
Ilcato analyses. Software in the MEGA data analysis package (ve~:
sion 1.01; Kumar et al. 1993) was used to undertake analyses of
the primaly structure of the sequence data (Table 3 ) . Three
methods of phylogenetic reconstruction were employed: maximum parsimony (MI'), neighborjoining (NJ), and maximum
likelihood (ML). All MP analyses were conducted using PAUP
(version 3.1.1; Swoffard 1993) mounted on a PowerMac 8500.
Bootstrap values (Felsenstein 1985) from 100 resamplings we1-e
calculated for the data. Decay indices (Bremer 1988, Mishler ct
al. 1991) were also calculated and mapped to consensus trees.
Tree searches were conducted heuristically using the tree-bisection reconnectiori (TBK) option with MULPARS. To increase the
probability of finding all islands of most-parsimonious trees, the
order of taxon addition was randomized 50 times. All characters
were regarded as unordered (Fitch 1971). For the NJ aIialysis
(Saitou and Nei 1987). 100 bootstrap resamplings were generated
using SEQBOOT, and pairwise distances were calculated with
DNADIST using the Kimura (1980) two-parameter ( U P ) model
of nucleotide change. Topologies were reconstructed from the
distance matrices using NEIGHBOR. A majority-rule consensus
tree was produced using CONSENSE. All of these analyses were
carried out using the PHYLIP package (version 3 . 5 7 ~Macintosh
;
Executables; Felsenstein 1993) mounted on a PowerMac 8500.
The M1, analysis was conducted using fastDNAni1 software (Olsen
et al. 1994) mounted on a PowerMac 8500. Results of MI. analyses
from 50 jumbles resolved the same topology.
The outgroup method was used to root all trees. Sequence data
from Scmedesmus obliquus were used to root the trees calculated
with the NJ and MI, methods, whereas data from Sr:enede.smus o b
liquus, Pediastrum duplex, and Ilydrodictyon reticulatum were used to
root the MP cladograms. These three taxa are placed in the gI-een
algal order Chlorococcales in more traditional classifications
(Fritsch 1945, G. M. Smith 1950, Bold and Wynne 1985, Melkonian 1990) and in the order Sphaeropleales in a more recent and
revisionist classification of coccoid green algae (Deason et al.
1991). Previous studies (Lewis et al. 1992, Wilcox et al. 1992) have
identified these taxa as a sister group to the chlamydomonad lineage.

289

PHYLOGENY OF CHLOROMONAS

FIG. 1. Phylogram from phylogenetic analysis of 18s rRNA sequence data by the MP method. The MP tree is one of eight equally
parsimonious resolutions. The areas of topological incongruence among the eight competing MP hypotheses, confined to two clades of
four taxa each, are identified by two strict consensus forks. The bootstrap values from 100 resamplings for all unambiguously resolved
nodes are included above each internode; corresponding decay index (DI) values for the MP analysis are included below each internode.
Each of the four principal lineages is identified by bracket and letter (A-D). Characters were optimized to branches under the assumption
of accelerated transformation (ACCTRAN) in reconstructing the branch lengths of the phylogram. Isolates that are microscopically
diagnosable as Chlmomonas taxa are presented in boldface.

RESULTS

Phylogenetic information content. A total of 1648

aligned sites were included in the phylogenetic analyses. Aligned sequence data from all taxa yield a total of 362 variable sites (excluding gaponly sites), of
which 239 are informative. Aligned sequence data
for the ingroup include 299 variable sites (excluding
gap-only sites), of which 218 are phylogeneticallyinformative. The Chloromonas taxa exhibit considerable diversity in primary structure ranging from 2 to
88 nucleotide changes in painvise comparisons (Table 3). Chloromonas rosae and Clm. clathrata show the
least divergence, whereas Clm. serbinowi and Clm. perforata show the greatest level of divergence in pairwise comparisons (Table 3).
Phylogenetic reconstruction. The MP analysis yielded
eight equally parsimonious resolutions (L = 563, CI
[Kluge and Farris 19691 = 0.561, RI [Farris 19891
= 0.772, RC [Farris 19891 = 0.434). One of the
eight most-parsimonious resolutions is presented
(Fig. 1 ) . Topological incongruence among the eight
competing MP hypotheses is confined to two clades
of four taxa each (see Fig. 1 ) . A strict consensus
analysis establishes that each of the MP topologies
can be regarded as a nested set of four principal
lineages that have been labeled with letters (A-D,
Fig. 1 ) . Three of the four principal lineages (A, C,
and D) include Chloromonas ma. The ML and NJ
methods yield optimal topologies that resolve the
same four principal lineages (A-D, Figs. 2, 3) but
differ from the results of the MP analysis in the rel-

ative alliances of the four lineages ([[[A + B] + D]

+ C]) from NJ and ML analyses vs. [[[A + B] + C]
+ D] from the MP analysis). The NJ and ML topologies differ from one another only in the relative
positions of Chl. reinhardtii, Chl. zebra, and Volvox carten.
DISCUSSION

Taxonomic and phylogenetic implications. Although

the taxon sampling is not entirely overlapping, the
constituency of the major clades (A-D) in the MP,
NJ, and ML topologies (Figs. 1-3) is consistent with
results of previous phylogenetic analyses from both
chloroplast and nuclear data (Buchheim et al.
1996). The results from each of the three methods
of phylogenetic reconstruction differ from one another primarily in resolving the relationships among
the four major clades. This principal difference
among competing hypotheses is a consequence of
differences in rooting the networks. Bootstrap analyses (MP and NJ; Figs. 1, 2) and decay analyses (MP;
Fig. 1) indicate that the support for any alliance of
major clades is minimal and/or ambiguous. The MP
analysis (Fig. 1) supports a basal D clade. The NJ
and ML analyses (Figs. 2, 3) support a basal C
clade. A basal D clade is consistent with MP, NJ,
and ML analyses of chloroplast 23s rRNA sequence
data (Buchheim et al. 1996); however, an A + B
alliance, which is supported by all methods of phylogenetic reconstruction used in the present investigation of 18s rRNA data (Figs. 1-3), is inconsistent

290

MARK A. BUCHHEIM ET At.

Chloromonm serblnowf
Chlam omonas bi apillata
Chlam gmonas mu&ilis
Chlamy&onas radiata

61

loo

loo
75

Chlorom6nas oogama
Chiamydomonasrzpa
loo
Chiamvdomonasasvmnnetrka
Chlamydombnasbaca
Chlamydomonas flmbriata

+
91

fl

ID

Dunallellapawa
Chlamydomonas w l a n a f a
Scenedesmus obllquus
FIG. 2. Dendrogram from pliylogerietic analysis of 18s rRNA sequence data by the NJ method using K2P distances. The bootstrap
values from 100 resamplings are incliided above each internode. Each of the four principal lineages is identified by bracket and letter
(A-D). Isolates that are microscopically diagiiosdbk as Chl(womoncw taxa are presented in boldhce.

with the 23s rRNA topologies (Buchheim et al.

1996). Cladistic analyses indicate that traditional
morphological criteria (Ettl 1970, 1983) will not
help resolve the problem of relationships among
major clades (Buchheim, unpubl. observ.). Therefore, the question of relationships among the major
lineages remains unanswered. Given that identifying
the root appears to be a key issue, the addition of
basal ingroup taxa (e.g. Curtma; see Buchheim and

Chapman 1992) represents a logical future approach to addressing this systematic problem.
The two ChZ. noctigama isolates, including an isolate originally regarded as ChZ. monoica (see Table
2), are resolved as sister taxa. This observation is
consistent with the sporangial wall autolysin data
placing both taxa in group 14 (Schlosser 1984).
Three taxa, Chl. rapu, ChZ. asymmetnca, and Chl. baca,
are allied as a sister group to a clade that includes

Chlamydomonas mutabilis
Chlamydomonasradiata
Chlamydomonas b.@apillata

B
Chlamydomonasnoctigama
Chlamydomonasnactigama
Volvox carten

Chlamydomonasreinhardtii
Chbromonas oogama
Chlam domonas rapa
Cf!larnydomonas asymmetdca

Stwhanosphaera SD.
Asterbmonas gracilis
Dunaliella Darva
Chlamydomonas planata
Zenectesmus obliqruus

II

FIG. 3. Dendrogram from phylogeneiic analysis of 18s rKNA sequence data by the ML method. Each of the four principal lineages
is identified by bracket and letter (A-D). Isolates that are microscopically diagnosable as Chloromonns taxa are presented in boldface.

PHYLOGENY OF CHLOROMOht4S

the euchlamydomonad taxa (sensu Ettl 1983) Chl.

zebra and Chl. reinhardtii, in addition to Volvox and
Clm. oogama. All three methods of phylogenetic analysis place Chl. jimbriata at the base of this euchlamydomonad clade. Analysis of the sequence data
indicates that Chl. $mbmata is a close ally of Chl. frankii and Chl. pallidostigmatica (unpubl. observ.; see
also Buchheim et al. 1996).
Chloromonas phylogeny. In our analyses, the five
Chloromonas taxa do not form a monophyletic group
in that 1) Clm. oogama is allied with Chl. reinhardtii
and Volvox cartmi (lineage D) , 2) Clm. perforata is allied with Chlamydopodium and Haematococcus (lineage
C), and 3) Clm. serbinowi, Clm. rosae, and Clm. clathrata are allied with Chl. macrostellata and Chl. augustae (lineage A). Light microscopic examinations of
cultures used in the DNA extractions were undertaken to confirm the generic identification of these
five m a through an assessment of pyrenoid presence or absence. In observations recorded at 1 and
4 weeks following subculture to fresh medium, no
pyrenoids were detected in vegetative cells of Clm.
serbinowi, Clm. rosae, and Clm. clathrata. However,
light microscopical studies of Clm. oogama and Clm.
perforaata demonstrate that these two organisms cannot be regarded as Chlmomonas taxa due to the presence of pyrenoids in vegetative cells. The latter two
taxa apparently have been misidentified as Chlwe
monas taxa or they represent contaminated cultures.
Two of the three diagnosable Chloromonasspecies,
Clm. clathrata and Clm. rosae, plus their chlamydomonad allies, Chl. mamostellata and Chl. augustae, are
reported to have been isolated originally from snow,
cold peat, or mountain soil (Starr and Zeikus 1993,
Schlosser 1994). The third diagnosable species of
Chlmomonas, Clm. serbinowi, was collected from a site
in Indiana that fits none of the previous criteria for
habitat. However, Clm. serbinowi is resolved as the
basal taxon in this morphologically heterogeneous
alliance. Furthermore, Clm. serbinowi exhibits substantial autapomorphic nucleotide substitution with
respect to other members of the Chloromonas clade
(Fig. 1, Table 3). Thus, Clm. serbinowi is also distinctive from a molecular perspective. If the descriptions
of the collecting sites for each of these taxa are accurate, then one can argue that habitat is a strong
correlate of phylogenetic history, independent of
the presence or absence of a pyrenoid.
Ultrastructural studies of freezing-tolerant and
freezing-sensitivechlamydomonads also provide corroborative evidence for a cold unicell alliance of
pyrenoid-bearing and pyrenoid-less taxa inferred on
the basis of molecular characters. Chlamydomonas augustae, Chl. gerlofJii, Clm. rosae, and Clm. clathrata were
shown to have high survivorship (>50%) following
exposure at -10 C (Clarke and Leeson 1985, Leeson cited in Harris 1989). Chlamydomonas komma and
Chl. r~nhardtii,which are characterized as freezingsensitive unicells, exhibited low survivorship
(<30%) following exposure at -10 C (Clarke and

291

Leeson 1985). Studies using freeze-fracture transmission electron microscopy demonstrated that the
preceding freezing-tolerant unicells have distinctive
invaginations of the cell membrane, whereas freezing-sensitive unicells lack these modifications of the
plasmalemma (Clarke and Leeson 1985). Freezingtolerant species also have been characterized as having dispersed starch plates associated with the pyrenoid matrix (if present). In contrast, compact
starch plates are associated with pyrenoids of Chl.
komma, a freezing-sensitive species (Leeson cited in
Harris 1989) that is a close ally of Chl. reinhardtii. As
a test of an hypothesis that freezing-tolerant unicells
form a monophyletic group, PCR sequencing templates were obtained from the freezing-tolerant alga
Chl. gerlofJii (SAG 20.72, Schlosser 1994). A partial
18s rRNA sequence (ca. 1600 bases, unpubl. data)
from Chl. gerlofii was included in a phylogenetic
reanalysis, and this alga is robustly placed within the
Chloromonas or cold unicell clade (data not
shown). Thus, the concept of a cold unicell clade
diagnosed by the presence of invaginations of the
plasmalemma is corroborated by the molecular evidence. No ultrastructural data are available concerning the nature of the plasmalemma in Clrn. serbinowi,
an alga collected in temperate Indiana (Starr and
Zeikus 1993). As the sister taxon to the cold unicell clade, the status of the plasmalemma in Clm.
serbinowi cannot be unambiguously predicted. However, if invaginations of the plasmalemma are correlated with cold habitats, then it is likely that Clm.
serbinowi will be found to lack these distinctive ultrastructural features.
In the context of the phylogenetic reconstruction
based on molecular evidence (Figs. 1-3), the absence of the pyrenoid in the diagnosable Chlmomonas taxa sampled in this investigation can only be interpreted as (multiple) evolutionary loss. What are
the consequences of this apparent loss? Does the
absence of a pyrenoid have a role in adaptation to
unusual habitats (e.g. snow)? Although these questions remain to be addressed, a growing body of evidence links the pyrenoid to mechanisms that enhance uptake of CO,. A large number of green algae have been shown to exhibit an inorganic carbon
(C0,)-concentrating mechanism (CCM), allowing
cells to exhibit C,-like rates of carbon uptake under
low COPconditions (Badger et al. 1980, Aizawa and
Miyachi 1986). Ramazanov et al. (1994) provided
evidence indicating that the activation of an inducible CCM in Chl. reinhardtii is linked to the development of the starch sheath surrounding the pyrenoid. More recently, E. C. Smith and Griffiths
(1996) showed that green algal phycobionts in lichen associations have a demonstrable CCM only if
that phycobiont (e.g. Trebouxia) bears a pyrenoid.
These observations coupled with our molecular phylogeny raise the question of the existence of a CCM
in Chlwomonas. Although the relevant experiments
remain to be completed (and are beyond the scope

292

MARK A. BUCHHEIM ET AL.

of this project), the observations from the literature

demonstrating a suong correlation between presence of a pyrenoid and a CCM suggest that Chlore
monas will be found to lack a CCM or that the CCM
in Chloromonas will be fundamentally different from
that in pyrenoid-bearing Chlamydomonas taxa.
The broader taxon sampling scheme in the present investigation corroborates observations from
previous analyses of 18s and 23s rRNA gene sequences (Buchheim et al. 1996) in identifymg a
new, robustly resolved lineage (lineage A, see Figs.
1-3) of unicellular flagellates that includes all of the
diagnosable species of Chloromonas as well as a number of taxa in the genus Chlamydomonas. Diagnosable isolates from the genus Chloromonas, with the exception of Clm. smbinozu1, are relatively homogeneous in terms of the primary sequence from the
conserved 18s rRNA gene. Two pyrenoid-bearing
taxa (Chl. macrostellata and Chl. augustae) are robustly positioned within this assemblage of Chloromonas
m a , which has Clm. serbinowi as the basal taxon.
Thus, these molecular data do not support the
monophyly of a diagnosable Chloromonas genus. Given that nearly 150 species of Chloromonas have been
described (Ettl 1970), the question of taxon sampling must be raised. Hoham (1975) and Hoham et
al. (1979) describe two Chlormonas species that
clearly exhibit persistent sporangial (parental) flagella during zoosporogenesis. None of the Chloromonas taxa sampled in this investigation exhibits persistent sporangial flagella (unpubl. observ.; Ettl and
Ettl 1959, Ettl 1967, 1970, 1983). The latter is a feature that appears to be associated principally with
Haematococcus and its allies (Buchheim et al. 1996).
Consequently, it is possible that a phylogenetically
distinct set of Chlwomonas taxa remains to be sampled and that the full range of molecular variability
within this genus has not yet been assessed.

,.
1 he Oklahoma University Genetic Computer Group is supported
by grants from the Center of Excellence in Molecular Medicine
and the Oklahoma Center for Arademic Excellence in Science
and Technology. This research was supported by grants from the
National Science Foundation (DEB 9220834 to M.A.B. and
R.L.C., DEB 9408057 to R.L.C., NSF EPSCoR-Louisiana Board of
Regents LaSER ro R L C . ) , the DOE/NSF/USDA Joint Program
on Collaborative Research in Plant Biology (USDA grant
9437105-0173 to M.A.B. and R.L.C.), The University of Tulsa
(Faculty Research and Summer Faculty Development grants to
M.A.R.), and the Mervin Bovaird Center for- Molecular Biology
and Biotechnology (to M.A.B.). Jenny Michalopulos, Karen
Jacohsmeyer, Whitney Palmer, and Tonya Leonard assisted with
DNA extractions and amplifications. We thank Karen Draeger for
preparing and runiiirig reactions for automated DNA sequencing.
We thank,James Moroney for sharing his unpublished data. James
Moroney, Debra Waters, Kami Rynders, and Jenny Michalopulos
provided c o ~ r i i n ~ ithat
i t ~ improved the manuscript.
Ai7awa, K. & Miyachi, S. 1986. Carbonic anhydrase and CO, concentrating mechanisms i n microalgae and cydnobacteria.
FEMS Miff-0.Rpii. 39~215-33.
Badger, M. R., Kaplan, A. & Berry, J. A. 1980. Internal inorganic
carbon pool of Chlamydomonas rpinhnrdtii: evidence for a car-

bon dioxide concentrating mechanism. Plant. Physiol. 66:40713.

Bold, H. J. & Wynne, M. J. 1985. Introduction to the Algae. PrenticeHall, Englewood Cliffs, New Jersey.
Bremer, K. 1988. The limits of amino acid sequence data in angiosperm phylogenetic reconstruction. Evolution 427954303.
Buchheim, M. A. & Chapman, R. L. 1991. Phylogeny of the colonial green flagellates: a study of 18s and 26s rRNA sequence data. BioSystas 25:85-100.
1992. Phylogeny of the genus Cartm'u (Chlorophyceae)
inferred from organismal and molecular evidence. ,I. Phycol.
28:362-74.
Buchheim, M. A., Lemieux, C., Otis, C., Gutell, R. R., Chapman,
R. I.. & Turmel, M. 1996. Phylogeny of the Chlamydomonadales (Chlorophyceae): a comparison of ribosomal RNA
gene sequences from the nucleus and the chloroplast. Mot.
Phyl. End. 5:391-402.
Buchheim, M. A,, McAuley, M. A., Zimmer, E. A,, Theriot, E. C.
& Chapman, R. L. 1994. Multiple origins of colonial green
flagellates from unicells: evidence from molecular arid organismal characters. Mol. Phyl. Evol. 3:322-43.
Buchheim, M. A., Turmel, M., Zimmer, E. A. & Chapman, R. L.
1990. Phylogenetic systematics of Chlumydomonus based on
cladistic analysis of nuclear 18.9 rRNA sequence data. .I. PhyCO~. 26:689-99.
Clarke, K. J. & Leeson, E. A. 1985. Plasmalemma structure in
freezing tolerant unicellular algae. Protoplasma 129:120-6.
Deason, T. R., Silva, P. C., Watanabe, S. & Floyd, G. L. 1991.
Taxonomic status of the species of the green algal genus Nee
chhis. PI. Syst. EuoZ. 177213-9.
Ettl, H. 1967. Die Feinstruktur v o ~ iChluroniorias rosae Ettl. Protoplasma 64:134-46.
1970. Die Gattung Chluromonas Gobi emend. Wille. Nova
Hedrrrigia 34:l-283.
1983. SupwusserJlwa von Mitteleuropa. Band 9: Chlwophyta
I. Phytomonndina. VEB Gustav Fischer Verlag,JeIra.
Ettl, H. & Ettl, 0. 1959. Ziir Kerintnis der Klasse Volvophyceae
11. Arch. Prolistenk. 104:51-113.
Ettl, H. & Schldsser, U. G. 1992. Towards a revisiou of the systematics of the genus Chlumydomonas (Chlorophyta). 1.
Chlamydomonas upplanata Pringsheim. Bot. Acta 105323-30.
Farris, J. S. 1989. The retention index and the rescaled consistency index. Cludistia 5:417-9.
Felsenstein, J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39:66&70.
1993. PHYLIP: Phylogenetic Inference Package, version
3 . 5 ~Distributed
.
by the author, Department of Genetics, University of Washington, Seattle.
Fitch, W. M. 1971. Toward defining the course of evolution: minimal change for a specific tree topology. Syst. Zool. 20:40&
16.
Fritsch, F. E. 1945. The Structure and Reproduction qfthe Algue. Vol.
I. Cambridge University Press, London.
Genetics Computer Group. 1991. Sequence analysis software
package, version 7.3. Genetics Computer GIoup, Madison,
Wisconsin.
Gordon, j.,Rumpf, R., Shank, S. L., Vernon, D. & Birky, C. W.,
Jr. 1995. Sequences of the rm18 genes of Chhnydomonus
humicola and C. dysosmos are identical, in agreement with
their combination in the species C. applanata (Chlorophyta),
I. Phvcol. 31:312-3.
Guiders&, J. H., Elwood, H., Ingold, A., Kindle, K. & Sogin, M.
I.. 1987. Phylogenetic relationships between chlorophytes,
chrysophytes, and oomycetes. Proc. Natl. Arad. Sci. USA 84:
5823-7.
Hamby, R. K., Sims, L., Issel, L. & Zimmer, E. A. 1988. Direct
ribosomal RNA sequencing: optimization of extraction and
sequencing methods for work with higher plants. Hunt Mul.
Bid. Kep. 6:175-92.
Harris, E. A. 1989. The Chlamydomonas Sourcebook. Academic
Press, San Diego, California, pp. 53-7.
Hoham, R. W. 1975. The life history and ecology of the snow

PHYLOGENY OF CHLOROMONAS
alga Chloromonas pichinchae (Chlorophyta, Volvocales). Phycologia 141213-26.
1980. Unicellular chlorophytes-snow algae. In Cox, E. R.
[Ed.] Phyto_flagelhtes.Elsevier North-Holland, Amsterdam, pp.
61-84.
Hoham, R. W., Roemer, S. C. & Mullet, J. E. 1979. The life history and ecology of the snow alga Chloromonas lneuispina
comb. nov. (Chlorophyta, Volvocales). Phycologia 18:55-70.
Huss, V. A. R. & Sogin, M. L. 1990. Phylogenetic position of some
Chlorella species with the Chlorococcales based upon complete small-subunit ribosomal RNA sequences. J. Mol. Evol.
31 1432-42.
Iyengar, M. 0. P. & Desikachary, T. V. 1981. Volvocales. Indian
Council of Agricultural Research, New Delhi.
Kimura, M. 1980. A simple model for estimating evolutionary
rates of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 16:111-20.
Kluge, A. G. & Farris, J. S. 1969. Quantitative phyletics and the
evolution of Anurans. Syst. ZooZ. 18:l-32.
Kumar, S., Tamurd, K. & Nei, M. 1993. MEGA: molecular evolutionary genetics analysis, version 1.01. The Pennsylvania
State University, University Park.
Lewis, L. A,, Wilcox, L. W., Fuerst, P. A. & Floyd, G. L. 1992.
Concordance of molecular and ultrastructural data in the
study of zoosporic chlorococcalean green algae. J. Phycol. 28:
375-80.
Mattox, K. R. & Stewart, K. D. 1984. Classification of the green
algae: a concept based on comparative cytology. In Irvine, D.
E. G. &John, D. M. [Eds.] Systematics ofthe Green Algae. Academic Press, London, pp. 29-72.
Melkonian, M. 1990. Phylum Chlorophyta class Chlorophyceae.
In Margulis, L., Corliss,J. O., Melkonian, M. & Chapman, D.
J. [Eds.] Handbook of Protoctista. Jones and Bartlett, Boston,
pp. 608-16.
Mishler, B. D., Donoghue, M.J. & Albert, V. A. 1991. The decay
index as a measure of relative robustness within a cladogram
(abstract). Willi Hennig Society Meeting, Toronto, Ontario.
Olsen, G. J., Matsuda, H., Hagstrom, R. & Overbeek, R. 1994.
fastDNAml: a tool for construction of phylogenetic trees of
DNA sequences using maximum likelihood. M Z O S 10:41-8.
Ramazanov, Z., Rawat, M., Henk, M. C., Mason, C. B., Matthews,

293

S. W. & Moroney, J. V. 1994. The induction of the C0,concentrating mechanism is correlated with the formation of
the starch sheath around the pyrenoid of Chlumydomonas reinhardtii. PZanta 195:210-6.
Rausch, H., Larsen, N. & Schmitt, R. 1989. Phylogenetic relationships of the green alga Volvox carteri deduced from smallsubunit ribosomal RNA comparisons. J. Mol. Evol. 29:255-65.
Saitou, N. & Nei, M. 1987. The neighbor-joining method: a new
method for reconstructing phylogenetic trees. Mol. Biol. Evol.
4:40625.
Schlosser, U. G. 1984. Species-specific sporangium autolysins
(cell-wall-dissolvingenzymes) in the genus Chlamydomonm. In
Inine, D. E. G. &John, D. M. [Eds.] Systematics ofthe Green
Algae. Academic Press, London, pp. 409-18.
1994. SAGSammlung von Algenkulturen at the University of Gottingen: catalogue of strains 1994. Bot. A d a 107:
11 3-86.
Smith, E. C. & Griffiths, H. 1996. The occurrence of the c h b
roplast pyrenoid is correlated with the activity of a CO,-concentrating mechanism and carbon isotope discrimination in
lichens and bryophytes. Planta 198:&16.
Smith, G. M. 1950. Freshwater Algae of the United States. McGrawHill, New York.
Starr, R. C. & Zeikus, J. A. 1993. UTEX-the culture collection
of algae at the University of Texas at Austin 1993 list of cultures. J. Phycol. 29(Suppl.):1-106.
Swofford, D. L. 1993. PAUP: phylogenetic analysis using parsimony, version 3.1. Computer program distributed by the Illinois Natural History Survey, Champaign.
White, T. J., Bruns, T., Lee, S. & Taylor, J. 1990. Amplification
and direct sequencing of fungal ribosomal RNA genes for
phylogenetics. In Innis, M. A., Gelfand, D. H., Sninsky, J. J.
& White, T. J. [Eds.] PCR Protocols. Academic Press, San Diego, pp. 315-22.
Wilcox, L. W., Fuerst, P. A. & Floyd, G. L. 1993. Phylogenetic
relationships of four charophycean green algae inferred from
complete nuclear-encoded small subunit rRNA gene sequences. Am. J. Bot. 80:1028-33.
Wilcox, L. W., Lewis, L. A., Fuerst, P. A. & Floyd, G. I,. 1992.
Assessing the relationships of autosporic and zoosporic c h l e
rococcalean green algae with 18s rDNA sequence data. J.
Phycol. 28:381-6.