FACULTY OF MEDICINE & HEALTH SCIENCES

SCHOOL OF MOLECULAR MEDICAL SCIENCES

Bachelor of Medical Sciences

Honours Year Project Dissertation

Dissertation Title: An Investigation of C-kit

and PDGFR1A receptor Activating Mutations
in Colorectal Cancer
Name: Rishi Gulati
Student ID: 4068628
Homebase: Molecular and Cellular Pathology

Academic Year 2009/10

DECLARATIONS

This page must be completed and signed by both Student and Supervisor
BEFORE hand in. All copies being handed in must carry this signed declaration
when it is handed in

The work presented in this dissertation by Rishi Gulati is his own work except where
stated in the text. Technical assistance with the project has been acknowledged where
appropriate.

Signature of Supervisor

I, Rishi Gulati, understand the nature of plagiarism outlined in the University of

Nottingham
Quality
Manual
(http://www.nottingham.ac.uk/qualitymanual/assessment/offences.htm#defin) and that it is a serious academic offence. I
confirm that no material in this submission has been plagiarised.

...

Signature of Student

An Investigation of C-kit and PDGF! receptor Activating Mutations

in Colorectal Cancer

Rishi Gulati

Faculty of Medicine and Health Sciences

Department of Clinical Pathology
Queens Medical Centre
Nottingham

Supervisor:

Professor Mohammed Ilyas

Bench Supervisors:

Dr. Salih Ibrahem

Mr. Darryl Jackson
Dr. Wakkas Fadhil

January 21st, 2009

Year 3 Bachelor of Medical Sciences Honours Project 2009-2010

Summary:

149

words

Number of tables:

Main text:

4338

words

Number of figures: 6
2

Table Of Contents
Abstract..4
1. Introduction.5
a. C-kit..5
b. PDGFRa..6
c. Links between PDGFRa and C-kit.7
d. High-Resolution Melting7
i. Benefits.8
ii. Negatives.8
e. DNA Sequencing.8
2. Materials And Methods10
a. Design of Primers..10
b. Polymerase Chain Reaction10
c. Mutation Detection using HRM Analysis (High-Resolution Amplicon
Melting) .11
d. Melting Curves Analysis12
e. Direct DNA Sequencing.12
i. DNA Purification.12
ii. DNA Concentration Measurement..12
iii. Sequencing..12
f. DNA Sequence Analysis13
3. Results.14
a. C-kit...14
i. Exon 915
ii. Exon 11...15
iii. Exon 13.16
iv. Exon 17.16
b. PDGFRa..16
i. Exon 12.16
ii. Exon 18.17
c. Variations within and Between Samples.18
4. Discussion ...........................19
a. The Project..19
b. HRM.............................20
c. Further Study.21
5. Acknowledgements.23
6. References.24

Abstract
Colorectal cancer arises due to mutations in important genes. C-kit and PDGFR1A
are oncogenes that are mutated in a variety of tumours. Mutations of these genes are
mutually exclusive suggesting that they are part of a common pathway. In this study, PCR
followed by High-resolution amplicon melting analysis (HRMAA) was used to screen for
activating C-kit and PDGFR1a mutations in a series of 20 colorectal cancer cell lines.
Primers were designed for known mutation hotspots in mutations in exons 9, 11, 13, and 17
for C-kit and exons 12 and 18 for PDGF1A. HRM analysis revealed aberrant melting of
PCR products in C-kit exon 9, 13, 17 and PDGFR1A exon 12 and 18. However, direct
sequencing of these PCR products showed the presence of polymorphisms but mutations
were not identified. It is therefore unlikely that mutations in these genes play a significant
role in the development of colorectal cancer.

Introduction
Colorectal cancer is the third most common type of cancer. The World Health
Organisation (WHO) estimates that 945 000 new cases occur yearly, with 492 000
deaths, making it the fourth most frequent cause of cancer deaths worldwide (1). The
genetic basis of cancer was first described by Fearson and Vogelstein as a multi-step
process of genetic alterations involved in the development of a common human
neoplasm, exemplified by the transitional shift to metastatic carcinomas from preexisting adenomas (4). Recent studies of the colorectal cancer genome of malignant
tumours suggests that up to 20 genes are mutated during the development of colorectal
cancer (2). It is important to note, however, that it is not solely these individual genes
which determine tumorigenesis, but also the pathways on which they act that leads to
deregulation of cell growth (3). This project looks specifically at two genes, C-kit and
PDGFR!.
C-kit
C-kit is located on the long arm of chromosome 4, between bands q11 and q12.
It consists of 21 exons, 5186 base pairs in length, and encodes a 976 amino acid protein
(ENST00000288135).
C-kit, also called CD117, encodes a transmembrane glycoprotein receptor
tyrosine kinase (5).

One known ligand for this receptor is the stem cell factor which

binds to the receptor, causing it to dimerize and become phosphorlyated, activating

downstream signalling pathways involved in cell proliferation, differentiation, survival,
adhesion and chemotaxis. Ligand-independent gain-of-function mutations can also occur
(6). C-KIT is expressed in haematopoietic precursors, mast cells, melanocytes, germ
cells, and interstitial cells of Cajal (ICC) (7).
Gain-of-function mutations can result in c-kit activation independent of ligand,
resulting in neoplastic growth (7). Mutations in exons 9, 11, 13, and 17 have been
reported in hematopoietic cells, small cell lung cancer, and gastrointestinal stromal
tumours (8). Previous data suggests that tumours containing missense mutations in
5

exon 11 possibly have a better prognosis than those with deletions or insertions (10).
Also, c-kit activating mutations in exon 9 might characterise a highly malignant tumor
(11).

Upregulated

C-kit

mRNA

expression

has

been

detected

in

the

human

adenocarcinoma cell lines HT29 and DLD-1 (9) and protects human colon adenocarinoma
cells against apoptosis and enhance their invasive potential (9). Non tumorigenic
expression has been detected in SK-CO-1. (16).
PDGFR1A
PDGFR1A, (Platelet-Derived Growth Factor Receptor alpha) is located on the long
arm of chromosome 4, on band q12. It consists of 23 exons, 6383 base pairs in length,
and encodes a 1089 amino acid protein (ENST00000257290).
PDGF consists of a family of A, B, C, and D polypeptides which promote cell
migration, proliferation, and survival by binding by disulfide bridges as homodimeric or
heterodimeric tyrosine kinase receptors PDGFR! and PDGFR" (12). The dimer complex
has biological significance as reduction irreversibly inactivates the factor (12). However,
there is interdependibility between the receptors because of their functional redundancy
(13).

It is a prerequisite for activation of the kinase (14). PDGFR1A is an important

factor regulating cell proliferation, cell differentiation, cell growth, development and
cancer. The receptor molecule also undergoes conformational change. All three
mechanisms, including dimerization, kinase activation, and conformational change
enable full enzymatic activity directed towards tyrosine residues in the receptor causing
proliferation (14).
PDGF plays a key role in growth and development of placenta and embryo. It is
also responsible for soft tissue healing. Autocrine or paracrine stimulation of PDGFR have
implications for development of disease (14). For example, overexpression of PDGFR1A
is known to cause gastrointestinal stromal tumors and non-small cell lung cancer.
Mutations in PDGF are known to be partial cause to atherosclerosis, pulmonary fibrosis,
angiogenesis, and tumorigenesis. (13)

Recent studies relate PDGFR!/" expression with the metastatic behavior of

colorectal cancer. It was shown that 83% PDGFR! compared with 60% PDGFR"
expression appeared in colorectal cancer cell lines. Co-expression occurred in 57% of the
cancer cell lines, and 29% of the samples depicted mono-expression for metastasis (15).
Links Between PDGFR! and C-kit
Mutually exclusive gain-of-function C-kit and PDGFR1A mutations have been
documented in a majority of GISTs. C-kit and PDGFR1A are members of the type III
Tyrosine Kinase Family and have extensive sequence and structural homology (34, 35).
Ligand-binding to a group of cell surface growth factor receptors having tyrosine
kinase function, such as those for C-kit and PDGFR!, activates intracellular downstream
signalling pathways controlling cell-proliferation, adhesion, apoptosis, survival, and
differentiation. These pathways include RTK-GRB2-SOS-RAS-RAF-MEK-ERK, PI3K-AKT,
PLC# and STAT pathways. (36) Some GISTs do not contain c-kit activating mutations but
instead have similar activating mutations in PDGFR! gene. The frequency of GISTs with
PDGFR! activating mutations is about 19% (37). Thus, c-kit and PDGFR! are both
mutually exclusive and alternative.
Imatinib is a drug used to treat cancers produced from C-kit and PDGFR
mutations. It binds to the site of tyrosine kinase activity, and prevents its activity. It is a
competitive inhibitor of the tyrosine kinase. This is dependent on the mutation status of
C-kit and PDGFR (8). However, it warrants further preclinical investigation and clinical
trials, studies show it is a good chemotherapeutic agent in colorectal cancer prevention
(8).
The ability to identify activating C-kit and PDGFR1A mutations in colorectal cancer
will help identify those colorectal tumours that may respond to imatinib. This might yield
prognostic and therapeutic information.
High-Resolution Melting
C-kit and PDGFR! mutations are gain-of-function mutations that can be detected
by HRM (High resolution melting). HRM analysis detects sequence changes in DNA due
7

to alterations in the melting behaviour of DNA (which is monitored by the release of a

fluorescent dsDNA binding dye). When compared to a reference sample, an altered
melting curve denotes the possibility of mutation (Figure 1). Heterozygous mutant
amplicon melt curve changes are noticeable because of mismatching that causes
heteroduplex formation. (21)
Figure 1: HRM analysis detects sequences changes between normal and mutatated DNA an example shown below.

Benefits
It is a quick, simple, and inexpensive approach using a saturation dye before PCR,
followed by rapid melting analysis of PCR products. Its sensitivity allows heterozygote
detection accuracy to approach 100%, and specificity can be increased by identifying
polymorphisms - although this may be a confounder in mutation detection (21). HRM
does not require fluorescently labelled oligonucleotides or real-time PCR instruments and
is thus a highly useful method for mutation screening.
Negatives

HRM analysis depends strongly on good PCR, instruments and dyes. For example,
LCGreen detects heterozygotes better than most other dyes (23). In fact, it is specifically
designed for detecting DNA variants, and the presence of heteroduplexes formed during
PCR. However, homozygote mutations can sometimes be missed due to the absence of
heteroduplex formation and may require mixing with wild type DNA (21). These include
A to T and G to C SNPs (HR-1 Manual). Small insertions and deletions are more difficult
to detect than substitutions (22). The HR-1 instrument is affected by amplicon GC
content for amplicons above 400 bps because of domain melting (24).
DNA Sequencing
C-kit and PDGFR! mutations can be confirmed by DNA sequencing. DNA
sequencing is far more sensitive technique than most modern techniques, and allows
recognition of frameshift and deletion mutations thus it is advantageous in that it
allows detecting specific mutations (21).
This project makes an effort to scan for mutations for C-kit and PDGFR! using
HRM analysis. This was done using appropriate primers, running PCRs, and using 20
colorectal cancer cell lines and correlating it against published data.

Materials and Methods

Design of Primers
Primers specific for exons 9,11,13, and 17 for the human c-kit gene, and exons
12,18 for the human PDGFR1A gene were designed in past projects with the use of
Primer3 (Table 2). Their sequences have appeared in previous studies (Table 1, 10).
Polymerase Chain Reaction
A standard polymerase chain reaction consisted of the elements presented in
Table 1.
Table 1: Volumes of
A Standard PCR:
1 reaction
(!L)
Hotshot (2x)

Forward

0.4

Reverse

0.4

LC Dye

H2O

2.2

DNA

TOTAL

10

Each PCR was covered using 10 #L mineral oil to avoid evaporation, which may
lead to change in melting properties. The concentration of magnesium in hotshot was
0.3mM, of primers was 250 nM and quantity of DNA template was 20 ng.
Each PCR was performed on a PEQLAB Advancer Primus 96 thermocycler
(PEQLAB). The initial step was denaturation for 10 minutes at 95 deg. C for denaturation
and enzyme activation. This was followed by 45 cycles that consisted of a denaturation
step at 95 deg. C for 3 seconds, followed by a temperature transition rate of 20 deg.
C/sec to a set annealing temperature. This was 58 deg. C for c-kit 9 and 11, 62 deg. C
for c-kit exon 13 and PDGFRA exons 12 and 18), and 57 deg. C for c-kit exon 17 for 10
seconds. (10,37) This was followed by a temperature transition rate of 2 deg. C to 72
deg. C for 20 seconds, during which elongation occurs (annealing and extension). The
10

samples were momentarily heated to 95 deg. C for heteroduplex formation and brought
to cool to 22 deg. C at a ramp rate of 2.0 deg C/s. They were stored in the PCR machine
at a temperature of 8 deg. C until the machine was stopped manually. All samples were
run in either duplicate or triplicate, depending on the credibility of the results, including
the quality of the amplicon product as determined by the LED fluorescence level, and the
shape of the melt curve from high resolution melting.
Table 2: A summary of the primers sequences used, the PCR products lengths, optimal annealing
temperatures, and melting profiles used for each reaction.

Oligonucleotide

Sequence (5' to 3')

Length

Name
CKIT

Exon 9 - F

GATGCTCTGCTTCTGTACTG

20

Exon 9 - R

GCCTAAACATCCCCTTAAATTGG

23

Exon 11 - F

CTCTCCAGAGTGCTCTAATGAC

22

Exon 11 - R

AGCCCCTGTTTCATACTGACC

21

Exon 13 - F

CGGCCATGACTGTCGCTGTAA

21

Exon 13 - R

CTCCAATGGTGCAGGCTCCAA

21

Exon 17 - F

TCTCCTCCAACCTAATAGTG

20

Exon 17 - R

GGACTGTCAAGCAGAGAAT

19

PDGFR

Exon 18 - F

GCTACAGATGGCTTGATCCTGAGT

24

Exon 18 - R

AGCCTGACCAGTGAGGGAAGT

21

PDGFR

Exon 12 - F

CTGGTGCACTGGGACTTTGGTAAT

24

Exon 12 - R

GTGTGCAAGGGAAAAGGGAGTCT

23

CKIT

CKIT

CKIT

Product

Annealing

Size

Temperature

235

58oC

219

58oC

227

62oC

170

57oC

200

62oC

235

62oC

Mutation Detection using HRM Analysis (High-Resolution Amplicon Melting)

After PCR, the PCR products were transferred to the HR-1, a high-resolution DNA
melting analysis instrument (Idaho Technology, Salt Lake City, UT). A melting analysis
was performed.
20 Colorectal cancer cell lines were studied for each exon. These cell lines were:
C125, C32, C80, C84, Caco2, DLD1, GP2D, HCA7, HCT116, HRA-19, HT29, LoVo,
LS1034, RKO, SK-CO-1, SW1116, SW480, SW837, SW948. For each cell line, each exon
was amplified at its optimal annealing temperature using 20 ng of previously extracted
DNA as template. PCR products were subsequently transferred to Roche LightCycler

11

glass capillary tubes specific for the HR-1 instrument. They were subject to a melting
profile to generate heteroduplexes and fully base-paired wild types.
Samples were also transferred to the 7500 Fast Real-Time PCR instrument to
confirm potential mutants with wild types. A melting analysis was performed during PCR
in real-time.
Melting Curves Analysis
The melting curve of each reaction, for each particular exon, were created and
compared. The accumulation of melting curves were normalized, based on linear regions
for each curve before and after melting points, and upper fluorescence and lower
baseline values common for all curves. A temperature shift was applied along the X-axis
for a common temperature to cluster the melting curves into groups. As a standard, this
is usually the temperature that heteroduplexes melt.
Difference plots were subsequently produced. Obvious differences in curve shapes
and melting temperatures become visible if they exist.
Derivative plots, which plot the rate of change of fluorescence versus temperature,
display the melting peaks at which the DNA heteroduplexes denature at the greatest rate.
Direct DNA Sequencing
DNA Purification
PCR was usually performed in a final volume of 25 #L, except for exon 13 HT29
and DLD which were performed in 10 #L. The PCR products were purified using the
QIAquick purification kit (by Qiagen). Enzyme contamination of DNA samples can
interfere with subsequent applications. Silica-membrane based purification of the PCR
products using a bind-wash-elute procedure was used to prevent this.
DNA Concentration Measurement
A ThermoScientific NanoDrop Spectrophotometer was used to measure DNA
concentration in 1 #L samples. It was used to measure intensity as a function of
wavelength of light to determine concentration of the samples.
Sequencing
12

The PCR amplicons were sent for DNA sequencing using the appropriate PCR
primers.
DNA sequencing was performed at the DNA sequencing facility at the University
of Nottingham. Previous work indicates a normal melting curve represents a normal DNA
sequence (33). As such, only abnormal curves were evaluated by direct sequencing. DNA
sequencing was performed by the Biopolymer Synthesis and Analysis Unit.
DNA Sequence Analysis
Analysis of the sequence was performed using Finch TV, ensemble.org SNPcheck
v2.0 (http://ngrl.manchester.ac.uk/SNPCheckV2/snpcheck.htm).

13

Results
All 20 cell lines were tested for each
exon

of each gene using

annealing

temperatures,

the primers,
and

melting

thermal profiles listed in table 2.

The first set of PCR products were
run on 2% agarose gels to verify the correct
product size. For this, a 100 bp size ladder

DNA LADDER 100 bp

NTC

GP2D

C80

HCA7

VAC020

C125

NTC

C-KIT

C84

SKCO-1

GP2D

Figure 2: An example of PCR products separated

on 2% agarose gel. PDGFR1A exon 18 and C-kit
exon 11 primers were used at annealing
temperatures of 58iiC and 62oC respectively to
produce the PCR products.

HCA7

PDGFRA

was used (Figure 2).

CKIT
Exon 9

a)

b)

c)

d)

Figure 3: (a) C-kit exon 9 PCR derivative plot for test reaction for 5 cell lines (b) Normalized and
temperature shifted c-kit exon 9 melting curves for 20 cells lines (c) Difference plots for c-kit exon

14

9 products normalised against one cell line product (d) Derivative plot for c-kit exon 9 products for
20 cell lines

Exon 9 showed a different melting curve shape for GP2D when compared to other

cell lines (Figure 3). The analysis was repeated twice and the same melting curve was
obtained. There are two melting peaks in the melting curve plot. The presence of two
peaks is explained by CG-rich regions, and thus two melting domains which make them
melt in two parts. GP2D was, as such, sent to be sequenced. Sequencing results showed
GP2D has C to T polymorphism at codon 488 (ACG>ATG, threonine to methionine, SNP
rs56225530).
Exon 11

a)

b)

c)

d)

Figure 4: (a) C-kit exon 11 PCR derivative plot for test reaction for 7 cell lines (b) Normalized and
temperature shifted c-kit exon 11 melting curves for 20 cells lines (c) Difference plots for c-kit exon
11 products normalised against one cell line product (d) Derivative plot for c-kit exon 9 products
for 20 cell lines

There were no differences in melting curve shapes for any cell line in exon 11
(Figure 4).
Exon 13

15

A nested PCR of exon 13 was divided into two parts for PCR because a smaller
product size means a greater sensitivity for HRM. A smaller amplicon will have a greater
sensitivity due to the effect of the change on the melting, and improved specificity as
there will be a smaller chance of including SNPs. Exon 13 showed a different melting
curve shape for HT29 and DLD when compared to other cell lines. The analysis was
repeated twice and the same melting curve was obtained. HT29 and DLD were, as such,
sent to be sequenced. Sequencing results showed HT29 showed no evidence of mutation.
DLD also came back as a false-positive sample from DNA sequencing (it did not generate
reliable data).
Exon 17
Exon 17 showed a different melting curve shape for GP2D when compared to
other cell lines. Exon 17 was amplified in one reaction. The analysis was repeated twice
and the same melting curve was obtained. GP2D was, as such, sent to be sequenced.
Sequencing results showed GP2D has C to T polymorphism at codon 798 (ATC>ATT,
isoleucine). This makes it a synonymous polymorphism, and evidently, there is no amino
acid change.
PDGFRA
Exon 12

a)

b)

16

c)

d)

Figure 5: (a) PDGFRa exon 12 PCR derivative plot for test reaction for 5 cell lines (b) Normalized
and temperature shifted PDGFRa exon 12 melting curves for 20 cells lines (c) Difference plots for
PDGFRa exon 12 products normalised against one cell line product (d) Derivative plot for PDGFRa
exon 12 products for 20 cell lines

Exon 12 showed a different melting curve shape for SK-CO-1 when compared to
other cell lines (Figure 5). Exon 12 was amplified in one reaction. The analysis was
repeated twice and the same melting curve was obtained. SK-CO-1 was consequently
sequenced. Sequencing results showed SK-CO-1 did not have a heteroduplex mutation.
The primers were inserted into In-Silico PCR, which searches a database and returns a
sequence output containing all sequences that lie between and include the primer pair.
This predicted amplicon product was then blasted against the sequence obtained from
DNA sequencing. A homozygous polymorphism became evident at codon 567 (CCA>CCG,
proline). This makes it a synonymous polymorphism, and there is no nucleotide base
change (Figure 6).
Figure 6: Blast analysis compared the output from direct DNA sequencing to the published
sequence. For PDGFR1A exon 12, the result from blasting shown below with SNP indicated in blue.
The query sample is the sample from sequencing and the subject sequence is that which is
expected.

Exon 18
Exon 18 showed a different melting curve shape for SK-CO-1 and SW837 when
compared to other cell lines. Exon 12 was amplified in two reactions. The analysis was
repeated four times and the same melting curve was obtained. SK-CO-1 and SW837
were, as such, sent to be sequenced. Sequencing results showed SK-CO-1 and SW837
both had a heteroduplex mutation. Sequencing results showed SK-CO-1 has C to T
17

polymorphism at codon 824 (GTC>GTT,

valine).

This makes it a

synonymous

polymorphism, and evidently, there is no amino acid change. Sequencing results also
showed SW837 has C to T polymorphism at codon 824 (GTC>GTT, valine). This makes it
a synonymous polymorphism, and evidently, there is no amino acid change.
Table 3: Summary of mutated cell lines using
high-resolution melting and sequencing results

1
2
3
4
5
6
7

Cell lines
C125*
C32
C80*
C84*
Caco2
DLD1*
GP2D

8
9
10
11
12
13
14
15

HCA7*
HCT116
HRA-19
HT29
LoVo
LS1034*
RKO
SK-CO-1

16
17
18
19
20

SW1116*
SW480*
SW837
SW948
VACO10MS*

Detected Mutation and

Sequencing Result

Exon 13 -> false positive sample

Exon 9, codon 488, C :T (hetero)
Exon 17, codon 798, C:T (hetero)

Exon 13 => false positive sample

Exon 12, codon 567, A:G (homo)

Exon 18, codon 824, C:T (hetero)

Exon 18, codon 824, C:T (hetero)

Variations within and Between Samples

Different melting curves showed normal variation, even between wild types.
Variations

can

be

seen

through

the

difference

plots

generated.

The

accepted

fluorescence background noise in the difference plot was agreed to be -2 to 2. This was
the expected up and down variations in each analysis for the wild type cell lines.

18

Discussion:
In the present study it was clearly shown that c-kit for exons 9,11,13, and 17 and
PDGFR1A receptor activating mutations in exons 12 and 18 do not exist in colorectal
cancer cell lines.
The Project
High-resolution melting curve analysis was used to screen for exon 9, 11, 13, and
17 in c-kit and exons 12 and 18 for PDGFR1A. Cases showing abnormal melt curves were
subject to direct DNA sequencing. Abnormal melt curves correlated with variations in
DNA sequences. There were no activating mutations in any of these exons.
HRM analysis proved to be a reliable method of detection mutations. This may be
a reason for which, without forming a heteroduplex or being mixed with wild type DNA,
the melt curve of the SK-CO-1 cell line for exon 12 of PDGFR indicated the presence of a
potential mutation, confirmed to be a homozygous SNP.
One false-positive result was obtained from this project for DLD-1 of exon 13 for Ckit. This can possibly be due to poor DNA quality (25). The C125 cell line for C-kit exon
11 is suspected as poor quality DNA and was not further tested. Concurrent with findings
from Idaho Technologies, this confirms a sensitivity and specificity of more than 98%.
These findings are comparable with other available data, using other screening
techniques (26).
Discrepancies in HT29 were confirmed by validating results with DNA sequencing.
SK-CO-1 and SW837 cell lines had the same polymorphism. The HR-1 machine is not
governed by a defined set of rules for the upper limit of amplicon size that can be
analyzed. It is presumed that product sizes in the range of 100-250 bases can be
routinely analyzed. However, localized regions rich or poor In G:C base pair content can
experience domain melting, which melts at a temperature above that of the remaining
portion of the fragment. Domain melting is most likely to be seen in amplicon PCR
products over 200 bases, but can be seen in fragments as small as 100 bases in length.
A domain melting profile existed for C-kit exon 9, which is 235 bp in length. C-kit exon
19

11,13 and PDGFR! exon 12 did not present with domain melting, even though their
amplicons were greater than 200 bps in length.
HRA19, HT29, CACO2 and SK-CO-1, DLD-1 showed abnormal curves on separate
occasions in repeated high-resolution analysis for C-kit exon 13. This can be due to
differences chemical composition, or constituent aberrations that might affect LC Green
binding. Samples showing similar melting patterns had similar changes in DNA sequence
- this was true only for heteroduplex SNPs (27).
HRM
Several screen methods have been described which could be used to screen DNA
isolated from colorectal cancers for activating mutations. However, there are limitations
to each. Single-stranded conformation polymorphism is unable to detect specific
mutations and is deemed unreliable (28). PCR product-length analysis has a likelihood of
missing point mutations (29). Capillary electrophoresis cannot detect point mutations
(30). High performance Liquid Chromatography is considered useful, bar its complexity
and cost. High Resolution melting is a powerful technique to detect mutations,
polymorphisms and epigenetic differences in dsDNA.
High-resolution melting analysis scans for sequence variations in a target gene.
The shape of the melting curve appears as fluorescence as a function of temperature.
In this investigation, high-resolution melting curve analysis was used. As a
standard principle, high-resolution melting is only as effective as the quality of the PCR
amplification product. Determining the best concentration for individual reaction
components,

and

the

best

thermal-cycling

parameters

that

will

optimise

the

amplifications is crucial.
The HR-1 machine is useful in that it allows mutation scanning in fragments of
amplified DNA, which are analysed for homoduplexes and heteroduplexes. Modern
scanning techniques require a separate step to identify heteroduplexes. Melting curve
analysis allows easy detection of heteroduplex mutant alleles because of its low melting

20

temperature. However, homozygotes are more difficult to detect. Furthermore, HRM

cannot discriminate between SNPs and mutations as both represent sequence changes.
The HR-1 instrument requires the PCR products be transferred from the normal
plastic tubes to special capillaries for melting. This limits the usefulness of the
instrument as it increases the chance of contamination. Newer more advanced machines,
(such as the Roche thermal cycler) allow PCR and HRM to be carried out in the same
tube.
It is a lot more labor intensive to analyze multiple exons with several annealing
temperature PCRs, where each PCR has to be run separately according to its optimal
annealing temperature. However this problem will be common to most PCR based
methods.
The 7500 Fast-Real Time machine performs real-time PCR and melt curve
analysis simultaneously. It avoids post-PCR processing and allows fast PCR processing
and melting analysis in real-time. However, it lacks precise temperature control, and
high resolution scanning cannot be performed on this machine. (HR-1 manual)
Further Study
It is understood that some homozygous mutations can only be detected when
heteroduplexes are formed. As such, the SK-CO-1 cell line for C-kit exon 12 should have
been tested by mixing with wild type DNA. It is important to note that HT29 has in the
past, although not for C-kit and PDGFR! genes, remained highly unpredictable. For
example, for the case of P53 mutations, it appears as a homozygous mutant in exon 8
for one study (31) and wild type in another (32). Perhaps this is reason for further study
of this cell line as a determinant of colorectal cancer.
As a final note, a consistent melting profile for genes would have helped in clarity
of analyzing data. This study employed HRM analysis to detect mutations in C-kit and
PDGFR!. It is a useful technique with upto 98% specificity. Real-time PCR is far more
accurate, but lacks temperature control. The purity of the cell lines ensured consistency
of results. C106, COLO201, COLO205, COLO320DM, HCA46, HT55, HuTu80, SW1222,
21

SW620 and VAC05 could also be tested with the specified genes. Other extonic data,
such as that for PDGFR1A exon 14 can also be tested. Without doubt, high-resolution
melting analysis remains a versatile component in detecting gene mutations that are
biologically and clinically important.
C-kit and PDGFR1A have been shown to be up-regulated in colonic tumours, and
these changes in expression seem to be related to some sort of functional effect. The
purpose of this study was to look for aberrant melts to detect mutations in these genes,
but these proved to be SNPs rather than activating mutations for colorectal cancer.
Perhaps there are mutations in other genes upstream that are causing up-regulation of
C-kit and PDGFR1A.

22

Acknowledgements
I thank my supervisors (Clinical Pathology, QMC) including Professor Mohammed Ilyas for
his aura of knowledge, Dr. Salih Ibrahem of course, who is my bench supervisor, Mr. Darryl
Jackson, the one and only, Dr. Wakkas Fadhil, for his motivational speeches, Ms. Karin Kindle for
her expertise in gel electropheresis, Ms. Sonia Ouadi whom I have never met but am thankful for
the DNA sequencing (!) (Biopolymer Synthesis and Analysis Unit), and, on a more serious note, Dr.
Sally Chappell (Clinical Chemistry, QMC) for her help with DNA sequence analysis.

23

References
1. Colorectal Cancer. In: Steward BW, Kleihues P, eds. World Cancer Report. Lyon:
IARC Press, 2003: 198202
2. T. Sjoblom, S. Jones, L.D. Wood, D.W. Parsons, J. Lin, T.D. Barber, D. Mandelker,
R.J. Leary, J. Ptak, N. Silliman, S. Szabo, P. Buckhaults, C. Farrell, P. Meeh, S.D.
Markowitz, J. Willis, D. Dawson, J.K. Willson, A.F. Gazdar, J. Hartigan, L. Wu,
C.Liu, G. Parmigiani, B.H. Park, K.E. Bachman, N. Papadopoulos, B. Vogelstein,
K.W.
3. Kinzler, V.E. Velculescu, The consensus coding sequences of human breast and
4. colorectal cancers, Science 314 (2006) 268274
5. B. Vogelstein, K.W. Kinzler, Cancer gene and the pathways they control, Nat.Med.
10 (2004) 789799
6. E.R. Fearon, B. Vogelstein, A genetic model for colorectal tumorigenesis, Cell 61
7. (1990) 759767
8. J. Hornick, C. Fletcher. Immunohistochemical Staining for KIT(CD117) in Soft
Tissue Sarcomas Is Very Limited in Distribution. American Journal of Clinical
Pathology 117(2002).
9.O $ scar Fuster, Eva Barraga $ n, Pascual Bolufer, Jose $ Cervera, Maria Jose $ Larra $
yoz,, Antonio Jime $ nez-Velasco, Joaqun Martnez-Lo $ pez, Ana Valencia,
Federico Moscardo $ , and Miguel A $ ngel Sanz. Rapid Detection of KIT mutations
in Core-binding Factor Acute Myeloid Leukemia Using High-Resolution Melting
Analysis. Journal of Molecular Diagnostics. 11(2009) 458-463.
10. C. Willmore, J Holden, L. Zhou, S. Tripp, C. Wittwer, L. Layfield. Detection of ckit-Activating mutations in Gastrointestinal Stromal Tumors by High-Resolution
Amplicon Melting Analysis. American Journal of Clinical Pathology 122 (2004)
206-216.
11. S. Attoub, C. Rivat, S. Rodrigues, S. Van Bocxlaer, M. Bedlin, E. Bruyneel, C.
Louvet, M. Kornprobst, T. Andre, M. Mareel, J. Mester, C. Gespach. The c-kit
Tyrosine Kinase Inhibitor STI571 for Colorectal Cancer Therapy. Cancer Research
62(2002) 4879-4883.
12. Bellone, G., Carbone, A., Sibona, N., Bosco, O., Tibaudi, D., Smirne, C., Martone,
T.,
13. Gramigni, C., Camandona, M., Emanuelli, G., and Rodeck, U. Aberrant activation
of c-kit protects colon carcinoma cells against apoptosis and enhances their
invasive potential. Cancer Res., 61(2001) 2200 2206.
14. Singer S, Rubin BP, Lux ML, et al. Prognostic value of kit mutation type, mitotic
activity, and histologic subtype in gastrointestinal stromal tumors. J Clin Oncol.
2002;18:3898- 3905.
15. Heinrich MC, Corless CL, Demetri GD, et al. Kinase mutations and imatinib
response in patients with metastatic gastrointestinal stromal tumor. J Clin Oncol.
2003;21:4342- 4349.
16. Heldin CH, Johnsson A, Wennergren S, Wernstedt C, Betsholtz C, Westermark B.
A human osteosarcoma cell line secretes a growth factor structurally related to a
homodimer of PDGF A-chains. Nature. 319(1986) 511-4 .
17. Levitzki A. PDGF receptor kinase inhibitors for the treatment of PDGF driven
diseases. Cytokine Growth Factor Rev. 2004;15:229235
18. Claesson-Welsh, Lena. Platelet-derived Growth Factor Receptor Signals. Journal
of Biological Chemistry. 269(1994) 32023-32026.
19. WEHLER Thomas C. ; FRERICHS Kirsten (1 2) ; GRAF Claudine ; DRESCHER
Daniel (2 3) ; SCHIMANSKI Katrin (2) ; BIESTERFELD Stefan (4) ; BERGER Martin
R. (5) ; KANZLER Stephan (1) ; JUNGINGER Theodor (3) ; GALLE Peter R. (1) ;
MOEHLER Markus (1) ; GOCKEL Ines (2 3) ; SCHIMANSKI Carl C. (1 2).
24

PDGFRa/" expression correlates with the metastatic behavior of human colorectal

cancer: A possible rationale for a molecular targeting strategy. Oncology Reports
19(2008) 697-704.
20. M. Anzano, D. Rieman, W. Prichett, D. Bowen-Pope, R. Greig. Growth Factor
Production by Human Colon Carcinoma Cell Lines. Cancer Research 49 (1989)
2898-2904.
21. Wittwer, Carl. High-Resolution DNA Melting Analysis: Advancements and
Limitations. Human Mutation 30(2009) 857859.
22. van der Stoep N, van Paridon CDM, Janssens T, Krenkova P, Stambergova A,
Macek M, Matthijs G, Bakker E. 2009. Diagnostic guidelines for high resolution
melting curve analysis: an interlaboratory validation of BRCA1 mutation scanning
using the 96- well LightScanner (IT). Human Mutation 30 (2009) 899909.
23. Farrar JS, Reed GH, Wittwer CT. 2009. High resolution melting curve analysis for
molecular diagnositics. In: Patrinos GP, Ansorge W, editors. Molecular Diagnostics,
2nd Ed. Burlington: Elsevier, in press.
24. Reed GH, Wittwer CT. Sensitivity and specificity of single-nucleotide
polymorphism scanning by high-resolution melting analysis. Clinical Chemistry 50
(2004) 17481754.
25. Sheng ZM, Przygodzki RM, OLeary TJ. Rapid screening for kit mutations by
capillary electrophoresis [letter]. Clin Chem.2001;47:1325-1326.
26. R. Yorke, M. Chirala, M. Younes. Journal of Clinical Oncology, 21 (2003) 38853889.
27. Graham, R., Liew, M., Meadows, C.,Lyon, E., and Wittwer, C. T. (2005) Clinical
Chemistry 51(7), 1295-1298
28. Kinoshita K, Isozaki K, Hirota S, et al. Gene mutation and gastrointestinal tumors:
c-kit gene mutation at exon 17 or 13 is very rare in sporadic gastrointestinal
stromal tumors. J Gastroenterol Hepatol. 2003;118:147-150.
29. Sheng ZM, Przygodzki RM, OLeary TJ. Rapid screening for kit mutations by
capillary electrophoresis [letter]. Clin Chem.2001;47:1325-1326.
30. Emile JF, Lemoine A, Bienfait N, et al. Length analysis of polymerase chain
reaction products: a sensitive and reliable technique for the detection of
mutations in kit exon 11 in gastrointestinal stromal tumors. Diagn Mol Pathol.
2002;11:107-112
31. Rodrigues, N. R., Rowan, A., Smith, M. E. F., Kerr, I. B., Bobmer, W. F., Gannon,
J. V., and Lane. D. P. (1990) Proc. Natl. Acad. Sci. 87, 7555-7559
32. Liu, Y., and Bodmer, W. F. (2006) PNAS 103(4), 976981
33. Willmore C, Holden JA, Zhou L, et al. Detection of ckitactivating mutations in
gastrointestinal stromal tumors by high-resolution amplicon melting analysis. Am
J Clin Pathol.2004;122:206-216.
34. Hirota S, Isozaki K, Moriyama Y, et al. Gain-of-function mutations of c-kit in
human gastrointestinal stromal tumors. Science 1998;279:577580.
35. Heinrich MC, Corless CL, Duensing A, et al. PDGFRA activating mutations in
gastrointestinal stromal tumors. Science 2003;299:708710.
36. Gschwind A, Fisher O, Ullrich A. The discovery of receptor tyrosine kinases:
targets for cancer therapy. Nature 4 361-370 (2004)
37. Holden J, Willmore-Payne C, Coppola, et al. High-Resolution Melting Amplicon
Analysis as a Method to Detect c-kit and Platelet-Derived Growth Factor Receptor
!! Activating Mutations in Gastrointestinal Stromal Tumors . Am J Clin
Pathol2007;128:230-238
25