Industrial Crops and Products 49 (2013) 380385

Contents lists available at SciVerse ScienceDirect

Industrial Crops and Products

journal homepage: www.elsevier.com/locate/indcrop

Promotion of artemisinin biosynthesis in transgenic Artemisia annua

by overexpressing ADS, CYP71AV1 and CPR genes
Xu Lu a,b , Qian Shen a , Ling Zhang a , Fangyuan Zhang a , Weimin Jiang a , Zongyou Lv a ,
Tingxiang Yan a , Xueqing Fu a , Guofeng Wang a , Kexuan Tang a,
a
Plant Biotechnology Research Center, Fudan-SJTU-Nottingham Plant Biotechnology R&D Center, School of Agriculture and Biology, Shanghai Jiao Tong
University, Shanghai 200240, PR China
b
State Key Laboratory of Natural Medicines, China Pharmaceutical University, Nanjing 210009, PR China

a r t i c l e

i n f o

Article history:
Received 17 November 2012
Received in revised form 8 April 2013
Accepted 27 April 2013
Keywords:
Artemisinin biosynthesis pathway
Overexpression of ADS, CYP71AV1 and CPR
Southern blot
Real-time quantitative PCR
High-performance liquid chromatography

a b s t r a c t
Artemisinin is an effective anti-malarial drug isolated from A. annua, which has an enormous commercialization demand all over the world. However, the low artemisinin content of A. annua greatly limits
the commercialization of artemisinin. In this study, we report the results of our experiments, where
for the rst time we have achieved the overexpression of ADS, CYP71AV1 and CPR genes in A. annua.
Eight transgenic A. annua plants were obtained through Agrobacterium tumefaciens-mediated transformation, which was conrmed by PCR. Southern-blot analyses showed that some of the transgenic lines
had low copies of the integration transgenes. The results of real time-qPCR showed that the expression
levels of ADS, CYP71AV1 and CPR genes were signicantly increased, too. The HPLC analyses showed that
the artemisinin contents were signicantly increased in these transgenic plants. One of the transgenic
plants, ACR16, was found to contain 2.4-fold higher (15.1 mg/g DW) artemisinin than the control plants
(pCAMBIA2300 transgenic plants). All above results showed that overexpression of ADS, CYP71AV1 and
CPR genes in A. annua could promoted the metabolic ux ows toward biosynthesis of artemisinin and
effectively increase the level of artemisinin content in transgenic A. annua plants.
2013 Elsevier B.V. All rights reserved.

1. Introduction
Artemisia annua is an annual herbaceous plant in the family Asteraceae, which is capable of producing a wide range of
terpenoids including artemisinin. Artemisinin, a sesquiterpene lactone, is currently the best therapeutic against both drug-resistant
and cerebral malaria-causing strains of Plasmodium falciparum
(Weathers et al., 2006). Malaria is a global health problem with
more than 1 billion people living in areas with a high risk of the
disease (Graham et al., 2010). So, there is an enormous demand
for the supply of artemisinin all over the world. However, the
artemisinin content of A. annua is very low (0.010.8% dry wt) and
this limits the commercialization of artemisinin greatly (Lei et al.,
2011).
With the elucidation of the biosynthetic pathway of
artemisinin, several key enzymatic genes involved in artemisinin

Abbreviations: ADS, amorpha-4,11-diene synthase; CYP71AV1, cytochrome

P450 dependent hydroxylase; CPR, cytochrome P450 oxidoreductase; DBR2, double
bond reductase 2; ALDH1, aldehyde dehydrogenase; RT-Q-PCR, real-time quantitative PCR; HPLC, high-performance liquid chromatography.
Corresponding author. Tel.: +86 021 34206916; fax: +86 021 34206916.
E-mail addresses: kxtang@sjtu.edu.cn, kxtang1@yahoo.com (K. Tang).
0926-6690/$ see front matter 2013 Elsevier B.V. All rights reserved.
http://dx.doi.org/10.1016/j.indcrop.2013.04.045

biosynthesis have been cloned and characterized from A. annua

(Fig. 1). Amorpha-4,11-diene synthase (ADS) is the rst committed
step in artemisinin biosynthesis which produce the amorpha4,11-diene (Bouwmeester et al., 1999; Mercke et al., 2000). In
the following step, amorpha-4,11-diene is hydroxylated to yield
artemisinic alcohol. This reaction is catalyzed by a cytochrome
P450 dependent hydroxylase (CYP71AV1) and NADPH: cytochrome
P450 oxidoreductase (CPR) as the native redox partner (Ro et al.,
2006; Teoh et al., 2006). These two enzymes can also oxidize the
alcohol to artemisinic aldehyde and then further on to artemisinic
acid (Ro et al., 2006). Artemisinic acid can be used as the substance
to synthesis the artemisinin by semi-chemical synthesis (Dietrich
et al., 2009). Then, this route is completed by the discovery of
double bond reductase 2 (DBR2) and aldehyde dehydrogenase 1
(ALDH1) (Zhang et al., 2008; Teoh et al., 2009). The conversion of
dihydroartemisinic acid to artemisinin has been suggested to be
the enzyme-independent reactions (Sy and Brown, 2002; Brown
and Sy, 2004). In a similar way, artemisinic acid is converted to
arteannuin B via enzyme-independent reactions, too (Brown and
Sy, 2007).
All above researches provided the theoretical possibility
to improve artemisinin yield in transgenic A. annua through
regulating the artemisinin biosynthetic pathway. Recently,
some efforts have been made to try to increase artemisinin

X. Lu et al. / Industrial Crops and Products 49 (2013) 380385

381

Table 1
Primers used in this study.
Primers

Purpose

Primer sequence (5 3 )

1304F
1304R
P35S
ADSR2
CYPR2
CPRR2
NPTIIR2
ADSF4
ADSR4
CYPF4
CYPR4
CPRF4
CPRR4
Actin-F
Actin-R

PCR
PCR
PCR
PCR
PCR
PCR
PCR
RT-Q-PCR
RT-Q-PCR
RT-Q-PCR, Probe
RT-Q-PCR, Probe
RT-Q-PCR
RT-Q-PCR
RT-Q-PCR
RT-Q-PCR

ATTTAAATCAGGAGTCAAAGATCAAA
GCTGCAGCCCCGGGGCCCGATCTAGTAACATAGAT
TTCGTCAACATGGTGGAGCA
AGTGCCCGTTGTATTTCG
GGAAGGCTTTTTTTGGTGGATTTG
CTTCCGTCCGTCATCAACCTCA
CCCTGATGCTCTTCGTCCA
AATGGGCAAATGAGGGACAC
TTTCAAGGCTCGATGAACTATG
CACCCTCCACTACCCTTG
GACACATCCTTCTCCCAGC
AGCCTCTTTGCCACCTCCT
GAACAGACTCCCTTGTGAACG
CCAGGCTGTTCAGTCTCTGTAT
CGCTCGGTAAGGATCTTCATCA

In this study, we choose wild-type A. annua plants, which have

the high artemisinin content, to do the heredity transformed experiment and hope to get the high content transgenic A. annua plants.
Here, we report the results of our experiments, where for the rst
time we have achieved the overexpression of ADS, CYP71AV1 and
CPR genes together in A. annua and obviously increased the level of
artemisinin content.
2. Methods and materials
2.1. Plant materials
The seeds of A. annua were obtained from the School of Life Sciences, Southwest University in Chongqing, PR China. Leaves from
A. annua plants were collected for RNA extraction using plant RNA
isolation reagent (Tiangen Biotech, Beijing, China) following the
manufacturers instructions.
2.2. Vector construction

Fig. 1. The biosynthesis pathway of artemisinin. ADS, amorpha-4,11-diene synthase; CYP71AV1, cytochrome P450 dependent hydroxylase; CPR, cytochrome P450
oxidoreductase; DBR2, double bond reductase 2; ALDH1, aldehyde dehydrogenase.

production. Overexpression of farnesyl pyrophosphate synthase

(FPS) gene exhibited higher artemisinin content (13.3 mg/g) and
yield, of 2.5- and 3.6-fold, respectively, than that detected in wildtype plants (Banyai et al., 2010). Recent research indicated that
multi-genes overexpression could regulate the expression levels
of multi-genes simultaneously, and was the optimum strategy to
improve the biosynthetic ability of plant secondary metabolites
(Zhang et al., 2004; Alam and Abdin, 2011). One of the transgenic lines by over-expressing of HMG-CoA reductase gene and
amorpha-4,11-diene synthase gene was found to contain 7.65-fold
higher (1.73 mg/gDW) artemisinin than the non-transgenic in A.
annua plants (Alam and Abdin, 2011).

The ORF of ADS (AF138959), CYP71AV1 (DQ268763) and CPR

(DQ318192) genes, with the SpeI digesting site and the BstEII digesting site attached, were respectively cloned in pMD18-T simple
vectors. The ORF of the three genes were digested with SpeI and the
BstEII and ligated into the pCAMBIA1304 to replace the GUS gene.
The expression cassettes containing the 35S promoter and nos terminator were respectively amplied with the primers of p1304-F
(with SwaI) and p1304-R (with SmaI and PstI) and ligated into the
pMD18-T vectors. All the primers used were in Table 1. The middle
vectors were named as pMD18T-p35S-ADS-nos, pMD18T-p35SCYP71AV1-nos and pMD18T-p35S-CPR-nos, respectively. By cutting
and ligation, the three expression cassettes were respectively
ligated into the pCAMBIA2300 (with Swa1 and Pst1 restriction
sites). The expression vector containing ADS, CYP71AV1 and CPR
genes were named pCAMBIA2300-ADS-CYP71AV1-CPR(ACR) (supplementary Fig. 1). After conrmation by sequencing, the plasmid
was introduced into the Agrobacterium tumefaciens strain EHA105,
and the positive clone was used for plant transformation.
Supplementary material related to this article found, in the
online version, at http://dx.doi.org/10.1016/j.indcrop.2013.04.045.
2.3. Plant transformation
Seeds of A. annua were surfaced sterilized in 70% ethanol for
1 min and then treated with 10% (v/v) NaOCl (sodium hypochlorite) for 10 min. After rinsing 5 times thoroughly with sterile
distilled water, the seeds were placed on Murashige and Skoog (MS)
medium (SigmaAldrich, MO, USA) with 88 mM sucrose and 0.7%

382

X. Lu et al. / Industrial Crops and Products 49 (2013) 380385

agar (pH5.8) (Murashige and Skoog, 1962). Cultured in a chamber,

the temperature was at 25 2 with 16 h light/8 h dark and light at
8000 lx photoperiod. After 2 weeks, the leaves of the seedings were
used as transformation. The leaves of seedings were cut into 0.5cm-diameter discs used as the explants in A. tumefaciens-mediated
leaf disk transformation (McCormick et al., 1986). The leaves and
A. tumefaciens strain EHA105 were co-cultivated at 25 for 3 days.
Then the leaves discs were transferred to kanamycin selection
medium MS1 (MS + 2.5 mg/L 6-benzoyladenine (6-BA) + 0.3 mg/L
naphthalene-1-acetic acid (NAA) + 50 mg/L kanamycin + 250 mg/L
carbenicillin). After subcultured 30 days of the kanamycin selection
(every 10 days for 3 times) some kanamycin-resistant buds were
regenerated. Then the kanamycin-resistant buds were transferred
into rooting medium MS2 (half-strength MS + 250 mg/L carbenicillin). After roots were formed (about 1215 days), the plantlets
were transferred into soil. After 12 months of growth they were
transplanted into the greenhouse for further growth.
2.4. PCR analysis in transgenic A. annua
The genomic DNA for PCR detective was isolated from 30
to 40 mg fresh leaves from 4 months old plantlet grown in the
greenhouse by using the modied CTAB (cetylmethylammonium
bromide) method (Stewart and Via, 1993). For the presence of
introduced CYP71AV1 gene (the CPR were in the same T-DNA border
with ADS, CYP71AV1, CPR and KAN gene were respectively detected
by PCR method) by using primers P35S, ADSR2, CYPR2, CPRR2 and
KANR2. The PCR reaction was carried out in a 20 l nal reaction
volume containing approximate 50 ng DNA template using Premix
Taq Version2.0 (TaKaRa, Dalian) followed its instruction. The thermal cycling conditions was 94 for 4 min, followed by 30 cycles of
amplication (94 for 30 s, 56 for 30 s and 72 for 1 min) and by 72 for
additional 10 min. A 10 l aliquot PCR solution was electrophoresed
in 1.0% agarose gel (with 0.25 g ml1 ethidium bromide) at 140 V
for 10 min then visualized under Gel Image System (Tanon 3500,
Shanghai, China). The PCR analysis with right length DNA fragments
was used for rapid screening of putative transformanted A. annua
and then conrmed as transgenic regenerates by Southern blotting.

conrm changes in gene expression. For each reaction, 2 l of

diluted cDNA (corresponding to 0.8 ng of total RNA), 2.5 l of EASY
dilution, 12.5 l of 2 SYBR Premix ExTaqTM , 0.25 M of forward
primer, 0.25 M of reverse primer, and nuclease-free water were
added to a nal volume of 25 l. The thermal cycle conditions
used were 1 min at 95 C followed by 40 cycles of amplication
(15 s at 95 C, 30 s at 56 C, and 30 s at 72 C). Melt curve analysis and agarose gel electrophoresis following each RT-Q-PCR were
performed to assess product specicity. Quantication of the target gene expression was carried out with comparative CT method
(Livak and Schmittgen, 2001). Average CT values for the target gene
from at least three PCRs were normalized to average CT values
for actin from the same cDNA preparations and analyzed using
Microsoft Excel. The relative expression of ADS, CYP71AV1 and CPR
indicated the increasing fold of the gene expression over the control
(0 h before treatment).
2.7. Analysis of artemisinin contents by high-performance liquid
chromatography (HPLC)
Five months after transplanted to soil, the leaves from A.
annua were dried at 45 C and grounded. The dried-leaf powder
(0.1 g/sample) was extracted with methanol (1 ml) using a Shanghai
Zhisun Instrument Co. Ltd. model JYD-650 ultrasonic processor
under the condition of 37 C 50 W for 30 min. Then the samples
were centrifuged for 10 min at 3910 g to remove the suspended
particles. The nal supernatant was ltrated through a 0.45 m
Sartorious membrane.
The samples were analyzed using a Waters Alliance 2695 HPLC
system coupled with a Waters 2420 ELSD detector. The HPLC
conditions were as follows: column, Waters C18; mobile phase,
water/methanol (40:60, v/v) for artemisinin; owrate, 1 ml/min.
The ELSD conditions were optimized at a nebulizer-gas pressure of
345 kPa (50 lbf/in.2 ) and drift-tube temperature of 45 C, and the
gains were set at 7 for artemisinin. Authentic artemisinin from
Sigma were used as the standard. For each sample, the injection
volume was 20 l, and the results were analyzed using Empower
(Waters chromatography data software). The measurement was
repeated three times.

2.5. Southern blot analysis

3. Results and discussion
The genomic DNA of transgenic and wild type plants was isolated and puried by the modied CTAB method. Approximate
60 g of each sample genomic DNA was digested by EcoRI at 37
for 16 h and separated by electrophoresis in 0.8% agarose gel and
then transferred on to a positively charged Hybond-N + nylon membrane (GE Healthcare, England). An alkaline-phosphatase-labeled
partial cDNA sequence of CYP71AV1 as the probe was prepared by
using Amersham AlkPhos Direct Labeling Reagents (GE Healthcare,
England) according to the manufacturers instructions. Hybridization of the probe with the membrane was carried out overnight in
hybrid-oven at 55. Hybridization signals were detected by CDP-Star
Detection Module (GE Healthcare, England) following the manufacturers instructions. The hybridized signals were visualized by
exposure to Fuji X-ray lm at room temperature for 5 h.
2.6. Real-time quantitative PCR analysis
All RNA samples were digested with DNase I (RNase-free) prior
to use. Aliquots of 0.4 g total RNA were employed in the reverse
transcriptase reaction using random hexamer primers for the synthesis of rst strand cDNA.
The amplication reactions of RT-Q-PCR were performed on
an iCycler iQTM Real-Time PCR Machines (Bio-Rad, Watford, UK)
with gene-specic primers, Actin primers Actin-F and Actin-R, and
the SYBR ExScript RT-PCR kit (Takara, Shiga, Japan) protocol to

3.1. Obtainment of transgenic A. annua plants

The young leaves of A. annua were transformed with A. tumefaciens strain EH105 harboring pCAMBIA2300-ADS-CYP71AV1CPR (pCAMBIA2300-ACR) plasmid and EHA105 (pCAMBIA2300)
respectively by A. tumefaciens-mediated transformation. After a 30day selection, the untransgenic tissues could not survive on the
selection medium containing 50 mg/l kanamycin (Fig. 2A). After the
kanamycin selection, some kanamycin-resistant buds were regenerated (Fig. 2B). Two to three centimeter long transgenic buds
were transferred into the rooting medium and grown to normal
morphology after approximately 15-day cultivation (Fig. 2C). Wellrooted transgenic plants were transplanted to the soil (Fig. 2D).
After the growth of 12 months, the transgenic plants were transplanted into the greenhouse for further growth. There were no
obvious morphological differences between pCAMBIA2300-ACR
and EHA105 (pCAMBIA2300) transgenic plants.
3.2. PCR analysis of target genes in transgenic plants
Genomic PCR was used to detect if exogenous ADS, CYP71AV1,
CPR and NPTII genes have integrated into the genome of A. annua.
Using forward primer F35S and ADS-specic primer ADSR2, a 1027bp product was amplied with pMD18T-p35S-ADS-nos as positive

X. Lu et al. / Industrial Crops and Products 49 (2013) 380385

383

Fig. 2. Obtainment of transgenic A. annua plants. (A) Obtainment of kanamycin-resistant plants through selecting on MS medium with 50 mg/L kanamycin. (B) Regeneration
of transgenic A. annua plants. (C) Rooting of transgenic A. annua plants. (D) Transplantation of partial transgenic A. annua plants.

template. Under the same condition, eight transgenic lines ACR1, ACR-8, ACR-10, ACR-16, ACR-30, ACR-31, ACR-52 and ACR-53
could generate the 1027-bp products after PCR amplication, which
did not show up with transgenic plants of empty vector and nontransgenic plants as template (Fig. 3A). Likewise, using F35S and
CYP71AV1-specic primer CYPR2, CPR-specic primer CPRR2, the
580-bp and 729-bp products were amplied, respectively. The
aimed products were amplied respectively in all the eight transgenic lines (Fig. 3B and C). A 635-bp product could be amplied
from all the transgenic A. annua with F35S and NPTIIR2 as primers,
which could not be amplied from non-transgenic plants under the
same amplication condition (Fig. 3D). The above results validated
the existence of NPTII gene and 35S-promoted ADS, CYP71AV1 and
CPR genes in transgenic A. annua.

3.3. Southern blot analysis

In order to investigate the inserted copies in the transgenic
plants, Southern blot analysis was performed under high stringency condition. The alkaline- phosphatase-labeled partial cDNA
sequence of CYP71AV1 was used as the probe. The examined
transgenic lines showed different sizes of hybridized bands which
conrmed that they were from independent transformation events
(Fig. 4). The results also showed that ACR1, ACR10, ACR31 and
ACR52 had low inserted copies in the genomes (Fig. 4).

Fig. 3. Polymerase chain reaction detection of ADS, CYP71AV1, CPR and NPTII gene
in transgenic A. annua plants. Primers used for detecting were F35S, ADSR2, CYPR2,
CPRR2 and NPTIIR2. Total genomic DNA was isolated from young leaves by CTAB
method. Plasmid DNA from the Agrobacterium carrying pCAMBIA2300 + ACR was
used as a positive control. M, DNA size marker DL2000; V, A. annua plant transformed with blank pCAMBIA2300; C, wild-type A. annua; , water control; +, positive
control. Numbers indicate the lines of transgenic A. annua (e.g. 1 indicates ACR1).

384

X. Lu et al. / Industrial Crops and Products 49 (2013) 380385

Fig. 4. Southern blot analysis of CYP71AV1 in transgenic A. annua plants. Total

genomic DNA was isolated from young leaves by CTAB method. Plasmid DNA from
the Agrobacterium carrying pCAMBIA2300 + ACR was used as a positive control.
Genomic DNA samples (60 mg per sample) of four transgenic A. annua plants (ACR1,
ACR10, ACR31 and ACR52) were used for Southern blot were digested overnight at
37 C with EcoRI.

3.4. Expression of ADS, CYP71AV1 and CPR in transgenic A. annua

The eight transgenic lines were subjected to further examination. The mRNA expressions of ADS, CYP71AV1 and CPR in leaves
of these transgenic lines were analyzed by RT-Q-PCR. The result
indicated that expression prole of three target genes varied from
different transgenic lines. Compared to control lines, except individual gene-silenced lines, most of the transgenic lines exhibited
high expression level (Fig. 5). The results showed that the expression of ADS was increased from 1.1- to 2.5-fold in the transgenic
plants, respectively (Fig. 5A). The expression levels of ADS in these
six overexpressed lines, especially ACR52, were signicantly higher
than that in the control lines (Fig. 5A). The expression of CYP71AV1
was increased from 1.1- to 2.2-fold in the transgenic plants, respectively (Fig. 5B). The expression of CPR was increased from 1.1- to
1.7-fold in the transgenic plants, respectively (Fig. 5C).
The mRNA expression of each target gene was varied in different transgenic lines. There are some individual gene-silenced lines
which may be due to DNA methylation or co-suppression (Van der
Krol et al., 1990; Tang et al., 2007). The expression of ADS, CYP71AV1
and CPR were increased from 1.1- to 2.5-fold in the transgenic A.
annua plants, which could be due to their positional effect (Meyer,

Fig. 5. Expression prole analysis of ADS, CYP71AV1 and CPR by RT-Q-PCR. Transgenic lines: ACR1, ACR8, ACR10, ACR16, ACR30, ACR31, ACR51 and ACR52; vector,
blank pCAMBIA2300 transgenic plants. RT-Q-PCR analysis was performed with Actin
as internal control.

1995; Spiker and Thompson, 1996). The mRNA expression of ADS,

CYP71AV1 and CPR were also difference in the same transgenic
A. annua line. The expression of ADS and CYP71AV1 were highest
in the ACR52 line, however, the expression of CPR in ACR52 was
much lower than other lines. The artemisinin content of ACR52 was
also not the highest in all the transgenic lines. So, the artemisinin
content of the transgenic lines should be affected by the complex
functions of ADS, CYP71AV1 and CPR genes.
3.5. Artemisinin contents in transgenic A. annua
Above all, the content of artemisinin was the central focus
of this study. Artemisinin contents in all the pCAMBIA2300ACR and pCAMBIA2300 transgenic plants were analyzed after 5
months of growth in the greenhouse by HPLCELSD. The content of
artemisinin were improved varying from 9.4 mg/g DW to 15.1 mg/g
DW which were 1.5- to 2.4-fold in all eight transgenic lines compared to control plants (artemisinin content is about 6.4 mg/g DW)
(Fig. 6). Artemisinin accumulation was highest in transgenic line

X. Lu et al. / Industrial Crops and Products 49 (2013) 380385

Fig. 6. Artemisinin content in different lines. Artemisinin content analysis was performed by HPLC. Transgenic lines: ACR1, ACR8, ACR10, ACR16, ACR30, ACR31, ACR51
and ACR52; vector, blank pCAMBIA2300 transgenic plants. Data are the means of
determinations of the three copies of each transgenic line. Vertical bars represent
standard deviation.

ACR16 at 15.1 mg/g DW, which was 2.4-fold than that of control
plants (pCAMBIA2300 transgenic plants).
4. Conclusions
In the study, the transgenic A. annua plants accumulating in
excess of 50140% artemisinin from a commercially cultivated crop
were achieved. Artemisinin accumulation was highest in transgenic
line ACR16 at 15.1 mg/g DW. Although the biosynthetic ability of
artemisinin were varied in different transgenic plants, the higher
accumulation trend of artemisinin which was resulted from the
overexpression of ADS, CYP71AV1 and CPR genes in transgenic
plants should not be denied. In a word, this study suggested that
the overexpression of ADS, CYP71AV1 and CPR genes were able to
break the limited enzymatic steps in artemisinin biosynthesis pathway, and promoted the metabolic ux ows toward biosynthesis
of artemisinin in transgenic plants.
Acknowledgments
This work was funded by China 863 Program (Grant no.
2011AA100605), China Transgenic Research Program (Grant no.
2011ZX08002-001), Ministry of Education.
References
Alam, P., Abdin, M.Z., 2011. Over-expression of HMG-CoA reductase and amorpha4,11-diene synthase genes in Artemisia annua L. and its inuence on artemisinin
content. Plant Cell Rep. 30, 19191928.
Banyai, W., Kirdmanee, C., Mii, M., Supaibulwatana, K., 2010. Overexpression of
farnesyl pyrophosphate synthase (FPS) gene affected artemisinin content and
growth of Artemisia annua L. Plant Cell Tiss. Organ Cult. 103, 255265.
Bouwmeester, H.J., Wallaart, T.E., Janssen, M.H., Van Loo, B., Jansen, B.J., Posthumus,
M.A., Schmidt, C.O., De Kraker, J.W., Konig, W.A., Franssen, M.C., 1999. Amorpha4,11-diene synthase catalyses the rst probable step in artemisinin biosynthesis.
Phytochemistry 52, 843854.

385

Brown, G.D., Sy, L.K., 2004. In vivo transformations of dihydroartemisinic acid in

Artemisia annua plants. Tetrahedron 60, 11391159.
Brown, G.D., Sy, L.K., 2007. In vivo transformations of artemisinic acid in Artemisia
annua plants. Tetrahedron 63, 95489566.
Dietrich, J.A., Yoshikuni, Y., Fisher, K.J., Woolard, F.X., Ockey, D., McPhee, D.J.,
Renninger, N.S., Chang, M.C.Y., Baker, D., Keasling, J.D., 2009. A novel
semi-biosynthetic route for artemisinin production using engineered substratepromiscuous P450BM3. ACS Chem. Biol. 4, 261267.
Graham, I.A., Besser, K., Blumer, S., Branigan, C.A., Czechowski, T., Elias, L., Guterman,
I., Harvey, D., Isaac, P.G., Khan, A.M., Larson, T.R., Li, Y., Pawson, T., Peneld, T.,
Rae, A.M., Rathbone, D.A., Reid, S., Ross, J., Smallwood, M.F., Segura, V., Townsend,
T., Vyas, D., Winzer, T., Bowles, D., 2010. The genetic map of Artemisia annua L.
identies loci affecting yield of the antimalarial drug artemisinin. Science 327,
328331.
Lei, C.Y., Ma, D.M., Pu, G.B., Qiu, X.F., Dua, Z.G., Wang, H., Li, G.F., Ye, H.C., Liu,
B.Y., 2011. Foliar application of chitosan activates artemisinin biosynthesis in
Artemisia annua L. Ind. Crop Prod. 33 (1), 176182.
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data
using real-time quantitative PCR and the 2CT method. Methods 25,
402408.
McCormick, S., Niedermeyer, J., Fry, J., Barnason, A., Horsch, R., Fraley, R., 1986. Leaf
disc transformation of cultivated tomato (L. esculentum) using Agrobacterium
tumefaciens. Plant Cell Rep. 5, 8184.
Mercke, P., Bengtsson, M., Bouwmeester, H.J., Posthumus, M.A., Brodelius, P.E., 2000.
Molecular cloning, expression, and characterization of amorpha-4,11-diene synthase a key enzyme of artemisinin biosynthesis in Artemisia annua L. Arch.
Biochem. Biophys. 381, 173180.
Meyer, P., 1995. Understanding and controlling transgene expression. Trends
Biotechnol. 13, 332337.
Murashige, T., Skoog, F., 1962. A revised medium for rapid growth and bioassays
with tobacco tissue cultures. Physiol. Plant. 15, 473497.
Ro, D.K., Paradise, E.M., Ouellet, M., Fisher, K.J., Newman, K.L., Ndungu, J.M., Ho, K.A.,
Eachus, R.A., Ham, T.S., Kirby, J., Chang, M.C., Withers, S.T., Shiba, Y., Sarpong, R.,
Keasling, J.D., 2006. Production of the antimalarial drug precursor artemisinic
acid in engineered yeast. Nature 440, 940943.
Spiker, S., Thompson, W.F., 1996. Nuclear matric attachment regions and transgene
expression in plants. Plant Physiol. 110, 1521.
Sy, L.K., Brown, G.D., 2002. The mechanism of the spontaneous autoxidation of
dihydroartemisinic acid. Tetrahedron 58, 897908.
Stewart Jr., C.N., Via, L.E., 1993. A rapid CTAB DNA isolation technique useful for RAPD ngerprinting and other PCR applications. Biotechniques 14,
748749.
Tang, W., Ronald, J., Newton, D., Weidner, A., 2007. Genetic transformation and gene
silencing mediated by multiple copies of a transgene in eastern white pine. J.
Exp. Bot. 58, 545554.
Teoh, K.H., Polichuk, D.R., Reed, D.W., Covello, P.S., 2009. Molecular cloning of an
aldehyde dehydrogenase implicated in artemisinin biosynthesis in Artemisia
annua. Botany 87, 635642.
Teoh, K.H., Polichuk, D.R., Reed, D.W., Nowak, G., Covello, P.S., 2006. Artemisia annua
L. (Asteraceae) trichome-specic cDNAs reveal CYP71AV1 a cytochrome P450
with a key role in the biosynthesis of the antimalarial sesquiterpene lactone
artemisinin. FEBS Lett. 580, 14111416.
Van der Krol, A., Mur, L., Beld, M., Mol, J.N.M., Stuitje, A.R., 1990. Flavonoid genes in
petunia: addition of a limited number of gene copies may lead to a suppression
of gene expression. Plant Cell 2, 291299.
Weathers, P.J., Elkholy, S., Wobbe, K.K., 2006. Artemisinin: the biosynthetic pathway
and its regulation in Artemisia annua, a terpenoid-rich species. In Vitro Cell Dev.
Biol. Plant 42, 309317.
Zhang, L., Ding, R.X., Chai, Y.R., Bonll, M., Moyano, E., Oksman-Caldentey, K.M.,
Xu, T.F., Pi, Y., Wang, Z.N., Zhang, H.M., Kai, G.Y., Liao, Z.H., Sun, X.F., Tang, K.X.,
2004. Engineering tropane biosynthetic pathway in Hyoscyamus niger hairy root
cultures. PNAS 101, 67866791.
Zhang, Y.S., Teoh, K.H., Reed, D.W., Maes, L., Goossens, A., Olson, D.J., Ross, A.R.,
Covello, P.S., 2008. The molecular cloning of artemisinic aldehyde 11(13)
reductase and its role in glandular trichome-dependent biosynthesis of
artemisinin in Artemisia annua. J. Biol. Chem. 283, 2150121508.