Вы находитесь на странице: 1из 27

Preuniversitario Padre Hurtado 2015 Biologa Electivo

Hctor Fuenzalida (hafuenzalida@uc.cl) Recopilacin de preguntas N1


NOMBRE:

EJE TEMTICO: Estructura, organizacin y actividad celular

1 En un experimento se marcaron radiactivamente varios aminocidos, los que fueron suministrados a un cultivo celular. Luego de un tiempo se
encontrar marca en:
I)
La membrana plasmtica.
II)
Los cromosomas.
III)
El retculo endoplsmico liso.
A) Slo I.
B) Slo II.
C) Slo I y II.
D) Slo I y III.
E) I, II y III.
2 De las siguientes opciones, cul de ellas describe una funcin fundamental de la meiosis?
A) Mantener constante el nmero cromosmico de una especie.
B) Ocurrir exclusivamente en rganos reproductores (gnadas).
C) Producir clulas diploides a partir de una haploide.
D) Presentarse en vertebrados.
E) Tener una larga profase I.
3 - Cul de las siguientes afirmaciones resume de manera ms precisa el contenido de la Teora Celular?
A) Toda clula procarionte o eucarionte proviene de otra clula preexistente.
B) Slo las clulas son sistemas vivos que estn en estrecha relacin con el medio.
C) Todos los sistemas vivos estn formados por clulas o por productos de su actividad.
D) La clula es la unidad estructural, funcional y reproductora de los seres vivos.
E) La clula es una unidad organizada que gasta mucha energa para mantenerse como tal.
4 Al analizar la anafase I y la anafase II de la meiosis, se comprueba que:
I)
En la anafase I se separan cromosomas homlogos.
II)
En la anafase II se separan cromtidas hermanas.
III)
En la anafase I cada uno de los conjuntos de cromosomas que migran a los polos provienen exclusivamente del padre o de la
madre.
A) Slo I.
B) Slo II.
C) Slo III.
D) Slo I y II.
E) i, ii Y iii.
5 Si se analiza qumicamente una molcula de origen biolgico y se constata que sta es insoluble en agua y est constituida exclusivamente por C,
H y O, entonces, de las opciones propuestas, esta molcula correspondera a:
A) Un polisacrido.
B) ADN.
C) Un fosfolpido.
D) Una protena.
E) ARN.
6 Si se analiza qumicamente una molcula de origen biolgico y se constate que sta es insoluble en agua y est constituida exclusivamente por C,
H, O y P, entonces esta molcula es:
A) Un polisacrido.
B) ADN.
C) Un fosfolpido.
D) Una protena.
E) ARN.

7 - A travs de qu mecanismo pasa el oxgeno desde los capilares a los tejidos?


A) Osmosis.
B) Difusin.
C) Cotransporte.
D) Transporte activo.
E) Difusin facilitada.
8 Al colocar una clula vegetal en un medio hipertnico se produce un fenmeno denominado:
A) Crenacin.
B) Citlisis.
C) Plasmlisis.
D) Pinocitosis.
E) Presin de turgencia.
9 Las enzimas P y Q fueron agregados a cinco sustratos diferentes. Despus de incubarlas en iguales condiciones, se les midi su actividad,
expresada en porcentaje de sustrato digerido, encontrndose los siguientes valores:

ENZIMA
P
Q

1
0
0

2
80
0

SUSTRATOS
3
0
65

De estos resultados se desprende que:


I)
La enzima P es ms especfica que Q.
II)
La concentracin de sustrato afecta a P.
III)
La reaccin se intensifica con el tiempo.
A) Slo I.
B) Slo II.
C) Slo III.
D) Slo I y II.
E) Slo II y III.
10 La mitosis se define como:
A) La divisin del ncleo celular.
B) La divisin de clulas somticas.
C) El trmino del perodo de crecimiento celular.
D) El mecanismo de disociacin de clulas.
E) El proceso de diferenciacin celular.
11 La siguiente fotografa, obtenida mediante un microscopio ptico, corresponde a una clula en:
A) Interfase.
B) G1.
C) S.
D) G2.
E) Mitosis.

12 Si clulas en reposo proliferativo (G0) son inducidas a entrar en divisin y al mismo tiempo son incubadas
en presencia de un pulso de nucletido de timina marcado, la distribucin de la marca en los cromosomas
metafsicos de la primera mitosis ser:

4
0
75

5
0
0

13 Un investigador observa que una sustancia X ingresa con un flujo constante desde el medio extracelular hacia el interior de la clula. Cul(es)
de los siguientes experimentos debe llevar a cabo este investigador para dilucidar inequvocamente el tipo de transporte (activo o pasivo) que media
en el ingreso de la sustancia X?
I)
Inhibir la produccin de energa metablica (ATP) de la clula.
II)
Inyectar la sustancia X en la clula, hasta equilibrar su concentracin con el medio extracelular.
III)
Aumentar la concentracin de la sustancia X en el medio intracelular.
A) Slo I.
B) Slo II.
C) Slo III.
D) Slo I y II.
E) I, II y III.
14 En la meiosis se separan los cromosomas homlogos para generar dos ncleos haploides. Esto ocurre durante la:
A) Metafase I.
B) Anafase II.
C) Anafase I.
D) Metafase II.
E) Intercinesis.
15 Si a un embrin de mamfero al estado de dos clulas se le destruye una de stas, pero la otra contina el proceso de desarrollo, entonces, ms
adelante se constatar que el feto:
A) Presentar slo a una mitad de su cuerpo.
B) No presentar cabeza o piernas.
C) No presentar ninguna anormalidad.
D) Ser ms pequeo que si se hubiera desarrollado sin perder una clula.
E) Tendr slo la mitad del total de clulas que tendra si no hubiera perdido la clula destruida.
16 Desde un punto de vista estructural y funcional, la membrana plasmtica se define fundamentalmente como:
A) Proteica y permeable.
B) Lipdica y semipermeable.
C) Lipoproteica y permeable.
D) Lipoproteica y semipermeable.
E) Proteica y semipermeable.
17 - Cul(es) de los siguientes procesos ocurre(n) en las clulas animales?
I)
Digestin.
II)
Respiracin.
III)
Sntesis de hidratos de carbono.
A) Slo I.
B) Slo II.
C) Slo I y II.
D) Slo I y III.
E) I, II y III.
18 Con respecto a la gliclisis, es correcto afirmar que:
I)
Puede ocurrir en ausencia de oxgeno.
II)
No produce CO2.
III)
La glucosa es degradada a piruvato.
A) Slo I.
B) Slo II.
C) Slo III.
D) Slo II y III.
E) I, II y III.

19 La exposicin de un individuo a altas dosis de radiaciones ultravioleta (UV) constituye un riesgo para su salud porque stas:
I)
Generan enfermedades hereditarias.
II)
Inducen cambios en la estructura del ADN.
III)
Son potencialmente carcingenas.
A) Slo I.
B) Slo II.
C) Slo III.
D) Slo II y III.
E) I, II y III.
20 Una clula vegetal, a diferencia de una animal, se caracteriza por poseer:
I)
Pared celular.
II)
Cloroplastos.
III)
Membrana plasmtica.
Es (son) correcta(s):
A) Slo I.
B) Slo II.
C) Slo I y II.
D) Slo I y III.
E) I, II y III.
21 De acuerdo con los niveles de organizacin de la materia en los organismos vivos, es correcto afirmar que:
I)
Una poblacin est integrada por ms especies que un ecosistema.
II)
Un rgano posee ms tipos celulares que un tejido.
III)
Un sistema, como el digestivo, posee menos tipos celulares que un rgano.
A) Slo I.
B) Slo II.
C) Slo III.
D) Slo I y II.
E) I, II y III.
22 De los siguientes cinco trminos, el que incluye a los otros cuatro es:
A) Agua.
B) Iones.
C) Enzimas.
D) Organelo.
E) Membrana.
23 En la figura se muestra un experimento en el cual se ha puesto una bolsa membranosa cerrada conteniendo una solucin acuosa de protenas,
en el interior de un vaso que contiene slo agua:

Del experimento, se puede deducir correctamente que:


I)
La membrana es semipermeable.
II)
El movimiento de las molculas es por osmosis.
III)
Las protenas son muy grandes para atravesar los poros de la membrana.
A) Slo I.
B) Slo II.
C) Slo III.
D) Slo I y II.
E) I, II y III.

24 Una de las causas ms frecuentes relacionadas con el Sndrome de Down es:


A) Un cromosoma 21 extra.
B) Un cromosoma 21 ausente.
C) Ausencia del par cromosmico 21.
D) Duplicacin del par cromosmico 21.
E) Destruccin parcial de uno de los cromosomas del par 21.
25 A partir del siguiente cariotipo humano:

Se puede afirmar correctamente que:


I)
La clula a la cual se le extrajeron los cromosomas era haploide.
II)
El nmero cromosmico de los gametos que originar esta clula es 23.
III)
Corresponde a un varn.
A) Slo I.
B) Slo II.
C) Slo III.
D) Slo II y III.
E) I, II y III.
26 - Cul de los siguientes eventos es heredable en la especie humana?
A) Desarrollo cultural de los padres.
B) Mutaciones en las clulas germinativas.
C) Mutaciones en cualquier clula somtica.
D) Desarrollo muscular por prcticas atlticas.
E) Cambios provocados por el procesamiento del ARN.
27 - Cul(es) de los siguientes organelos celulares est(n) delimitado(s) por dobles membranas?
I)
El ncleo.
II)
Las mitocondrias.
III)
El retculo endoplsmico.
A) Slo I.
B) Slo II.
C) Slo I y II.
D) Slo I y III.
E) I, II y III.

28 Al ordenar los trminos que aparecen en la tabla:

Segn la secuencia molcula organelo clula tejido rgano, la opcin correcta es:
A) 3 2 1 5 4.
B) 2 1 3 4 5.
C) 3 4 5 2 1.
D) 2 3 4 1 5.
E) 1 2 4 5 3.
29 Los lpidos que constituyen las membranas de las clulas se caracterizan por:
I)
Tener un extremo hidroflico y otro hidrofbico.
II)
Ser insolubles en detergentes.
III)
Ser apolares.
Es (son) correcta(s):
A) Slo I.
B) Slo II.
C) Slo III.
D) Slo I y II.
E) Slo II y III.
30 El esquema muestra una anafase completa observada en el ovario de un insecto. Cuntos cromosomas tendran los gametos producidos por
esta hembra?
I)
3.
II)
4.
III)
7.
A) Slo I.
B) Slo II.
C) Slo III.
D) Slo I y II.
E) Slo II y III.
31 Cuando se produce la fecundacin entre individuos de una especie con dotacin
= 8, el cigoto resultante es:

cromosmica 2n

A) 4n = 4.
B) 2n = 8.
C) 2n = 16.
D) 4n = 16.
E) 2n = 4.
32 Un investigador est tratando de identificar una macromolcula que aisl de un organismo unicelular. Algunos de los resultados de su
investigacin se muestran en el siguiente cuadro:

Del anlisis de estos resultados, es posible inferir correctamente que la molcula es:
A) Glicgeno.
B) Colesterol.
C) Una protena.
D) Almidn.
E) Celulosa.

33 La siguiente ecuacin representa la respiracin celular:

Qu sucede con la energa producida?


I)
Es utilizada en la sntesis de piruvato.
II)
Es utilizada en la sntesis de ATP.
III)
Para de ella es liberada como calor.
A) Slo I.
B) Slo II.
C) Slo III.
D) Slo I y II.
E) Slo II y III.
34 - Cul(es) de las siguientes vas metablicos es (son) catablicas?
I)
cidos nucleicos Nucletidos.
II)
Aminocido Protenas.
III)
Piruvato Glucosa.
A) Slo I.
B) Slo II.
C) Slo III.
D) Slo I y II.
E) I, II y III.
35 Para determinar el efecto de una enzima sobre una sustancia, se desarroll un experimento cuyo diseo y resultados se muestran en la tabla:
A partir de la informacin de la tabla, se concluye
correctamente que:
A) Slo en el tubo 1 hubo accin enzimtica positiva.
B) El pH neutro es ptimo para la accin de la enzima.
C) La temperatura ptima de accin para la enzima es 37 C.
D) El tiempo ptico para la accin de la enzima es 60 minutos.
E) Ocurre desaparicin del almidn slo en presencia de la
enzima.

36 La frmula cromosmica para un individuo con Sndrome de Klinefelter es:


A) 45 + X0.
B) 45 + XXY.
C) 44 + XXY.
D) 44 + XY.
E) 46 + XY.
37 A final de la profase mittica, el material gentico de un cromosoma se visualiza como:
A) Dos cromtidas.
B) Cuatro cromtidas.
C) Hebras de cromatina.
D) Dos molculas de ADN.
E) Pares homlogos formando ttradas.
38 En eucariontes, las subunidades que forman a los ribosomas son producidas en:
A) El nuclolo.
B) La carioteca.
C) Los lisosomas.
D) El aparato de Golgi.
E) El retculo endoplsmico rugoso.

39 - En cul de los siguientes procesos no participa la mitosis?


A) Generacin de rganos.
B) Regeneracin de tejidos.
C) Reproduccin de bacterias.
D) Formacin de tumores.
E) Crecimiento de metazoos.
40 El esquema representa un segmento de la membrana plasmtica:

Respecto a P, Q y R, es correcto afirmar que:


I)
P est compuesto de carbono e hidrgeno.
II)
Q tiene carga elctrica.
III)
R es una zona de puentes de hidrgeno.
A) Slo I.
B) Slo II.
C) Slo III.
D) Slo I y II.
E) I, II y III.
41 El grfico muestra la variacin de la cantidad de ADN nuclear en un ovocito, a travs del ciclo proliferativo:

De acuerdo con los datos del grfico, cul de los siguientes eventos celulares sucede en los puntos P y Q, respectivamente?
A) Meiosis I y meiosis II.
B) Fecundacin y meiosis I.
C) Fin de interfase y telofase II.
D) Fecundacin y fin de la telofase mittica.
E) Sntesis de ADN y profase mittica.
42 - Cul de las siguientes opciones establece correctamente la relacin entre una de las etapas de la respiracin celular y el lugar donde se realiza?
A) Gliclisis matriz mitocondrial.
B) Fosforilacin oxidativa citoplasma.
C) Formacin de acetil-CoA citoplasma.
D) Fosforilacin oxidativa matriz mitocondrial.
E) Sntesis de ATP membrana mitocondrial interna.

43 La figura muestra cinco arreglos distintos de los cromosomas sexuales humanos (X = cromosoma largo; Y = cromosoma corto).

De acuerdo a la figura, qu arreglo cromosmico presentara un hombre alto, con extremidades largas, escaso vello facial, axilar y pbico,
ginecomastia y genitales pequeos?
A) 1.
B) 2.
C) 3.
D) 4.
E) 5.
44 - Cul de los siguientes eventos ocurre solamente en la segunda divisin meitica?
A) Movimiento de cromosomas con dos cromtidas hacia los polos.
B) Divisin de los centrmeros.
C) Reduccin del nmero de cromosomas.
D) Apareamiento de cromosomas homlogos.
E) Entrecruzamiento o crossing-over.
45 El siguiente esquema muestra la clonacin de un mamfero por transferencia nuclear, como fue el caso de la oveja Dolly:

En este experimento, es correcto deducir que:


I)
El ncleo celular extrado de la clula somtica contiene la informacin para que se establezcan los caracteres biolgicos.
II)
Los ncleos de las clulas somticas tienen toda la informacin gentica para la constitucin del organismo completo.
III)
Al obtenerse un organismo clon, no se cumple la premisa genotipo + ambiente = fenotipo.
A) Slo I.
B) Slo II.
C) Slo III.
D) Slo I y II.
E) Slo I y III.
46 La funcin celular de las mitocondrias es la:
A) Autofagia.
B) Respiracin celular.
C) Reproduccin celular.
D) Sntesis de protenas.
E) Fotosntesis.

47 Las clulas cancerosas se caracterizan por una disminucin en el proceso de:


A) Apoptosis.
B) Necrosis.
C) Mutacin.
D) Metstasis.
E) Proliferacin celular.
48 Los compartimientos 1 y 2 separados por una membrana, contienen inicialmente los volmenes V y 2V de una solucin de concentracin 2X y X,
respectivamente, como se muestra en el esquema.

Si la membrana es impermeable a los solutos, pero permeable al agua, en el equilibrio:


A) Ambos compartimientos tendrn la misma concentracin.
B) La concentracin en 1 ser mayor que en 2.
C) El volumen en 2 ser mayor que en 1.
D) El volumen en 1 se reducir a la mitad.
E) El volumen en 2 aumentar el doble.
49 - Cul de las siguientes opciones indica correctamente la relacin entre el nivel de organizacin y su ejemplo?

A)
B)
C)
D)
E)

Molcula
Centrolo
Centrolo
Miocito
Tubulina
Tubulina

Organelo
Tubulina
Miocito
Centrolo
Centrolo
Miocito

Clula
Miocito
Corazn
Msculo
Miocito
Centrolo

Tejido
Corazn
Msculo
Tubulina
Msculo
Corazn

rgano
Msculo
Tubulina
Corazn
Corazn
Msculo

50 De los 20 aminocidos que forman protenas en humanos, algunos de ellos se denominan aminocidos esenciales porque:
A) Forman parte de la mayora de las protenas.
B) Son sintetizadas por el organismo y no se requieren en la dieta.
C) No se sintetizan en cantidades suficientes y deben estar en la dieta.
D) Son sintetizados por microorganismos simbiontes del tracto digestivo.
E) Son los aminocidos ms simples de los cuales se derivan los dems.
51 - Cul de las siguientes dotaciones cromosmicas humanas corresponde al sndrome de Turner?
A) 44 + X0.
B) 45 + XY.
C) 45 + XX.
D) 44 + XXX.
E) 44 + XXY.

52 Para demostrar la accin enzimtica que ocurre sobre el almidn, se realiz el siguiente diseo experimental:

Al cabo de 30 minutos se agreg a cada tubo 1 mL de reactivo de Fehling, que forma la mezcla de color naranjo en presencia de glucosa,
obtenindose dicha coloracin solo en los tubos 3 y 4. En relacin con estos resultados, es correcto inferir que:
A) La actividad enzimtica es dependiente de la cantidad de enzima en la mezcla.
B) La actividad enzimtica es dependiente de la temperatura.
C) A temperatura superiores a 37C la enzima se denatura.
D) La actividad de la enzima es mayor cuando hay ms almidn.
E) A los 80C se bloquea el sitio activo de la enzima.
53 - Cul de las siguientes opciones NO es una caracterstica de la generacin de clones por reproduccin asexuada?
A) Existe recombinacin gentica.
B) Los clones se multiplican por mitosis.
C) La progenie es siempre del mismo sexo.
D) Toda la progenie es fenotpicamente idntica.
E) Puede ocurrir en forma natural.
54 La figura corresponde al cariotipo de una clula humana:
Basndose en la informacin de la figura, es correcto afirmar que el cariotipo:
A) Pertenece a un individuo con una aberracin cromosmica.
B) Presentan la frmula cromosmica 2n = 23.
C) Es de un gameto.
D) Pertenece a una mujer.
E) Corresponde a una clula somtica.
55 De las siguientes proposiciones, qu ventaja(s) presenta la reproduccin sexual, con respecto a la
reproduccin asexual?
I)
Producir una progenie numerosa.
II)
Producir slo descendientes mejor adaptados.
III)
Favorecer una mayor variabilidad gentica.
A) Slo I.
B) Slo II.
C) Slo III.
D) Slo I y II.
E) I, II y III.
56 - Qu mecanismo utilizan los macrfagos para eliminar grmenes?
A) Osmosis.
B) Fagocitosis.
C) Exocitosis.
D) Difusin simple.
E) Difusin facilitada.
57 Si se trata con un inhibidor de la meiosis a cada uno de los siguientes seres vivos, el que NO experimentar consecuencias en su ciclo
reproductivo ser:
A) La bacteria.
B) La rata.
C) El roble.
D) El lamo.
E) La merluza.

58 El trayecto que seguir un aminocido marcado que formar parte de una glicoprotena de exportacin es:
A) Retculo endoplasmtico liso; retculo endoplasmtico rugoso; complejo de Golgi; endocitosis.
B) Retculo endoplasmtico liso; complejo de Golgi; retculo endoplasmtico rugoso; pinocitosis.
C) Retculo endoplasmtico rugoso; complejo de Golgi; retculo endoplasmtico liso; exocitosis.
D) Retculo endoplasmtico rugoso; retculo endoplasmtico liso; complejo de Golgi; exocitosis.
E) Complejo de Golgi; retculo endoplasmtico liso; retculo endoplasmtico rugoso; pinocitosis.
59 - Qu especie qumica est correctamente asociada a su transporte a travs de la membrana?

60 De las siguientes opciones, cul de ellas representa a un monmero y a un polmero, respectivamente?


A) Aminocido nucletido.
B) Protena aminocido.
C) Glicgeno glucosa.
D) Glucosa almidn.
E) ADN nucletido.
61 Cul de las siguientes opciones asocia correctamente la etapa del ciclo proliferativo con el proceso celular que ocurre en ella?
A) Fase M crecimiento de la masa celular.
B) Fase S mecanismo de control de la proliferacin.
C) Fase G2 unin de microtbulos a los centrmeros.
D) Fase G2 separacin de cromosomas homlogos.
E) Fase M separacin de cromtidas hermanas.
62 Si se bloquea la accin de las enzimas del retculo endoplasmtico liso de una clula animal, a corto plazo, disminuir directamente la sntesis
de:
A) Enzimas.
B) Fosfolpidos.
C) Polisacridos.
D) cidos nucleicos.
E) Protenas de membrana.

63 Ciertos protozoos tienen en su citoplasma una alta concentracin de iones sodio, a pesar de vivir en un medio en el que este ion se encuentra
muy diluido. Esta acumulacin intracelular de iones sodio es posible por la existencia de:
A) Difusin facilitada.
B) Difusin simple.
C) Transporte activo.
D) Exocitosis.
E) Osmosis.
-

64 La figura muestra la concentracin intracelular de iones bicarbonato (HCO3 ) cuando se modifica la concentracin extracelular de iones cloruro
(Cl ).
De la figura, se infiere correctamente que el:
-

A) Transporte de HCO3 depende del Cl extracelular.


B) HCO3 es transportado activamente a la clula.
C) Cl difunde libremente hacia la clula.
D) Cl se cotransporta con HCO3 .
E) Carcter cido de la clula depende de la concentracin de HCO3 .

65 En un organismo con reproduccin sexual y dotacin cromosmica 2n = 4, se prob la accin de un frmaco sobre la ovognesis. La dotacin
cromosmica de la clula ovulada se muestra en la siguiente figura:

A partir de la figura, cul de las siguientes opciones explica correctamente la accin directa del frmaco sobre la ovognesis?
A) Bloquea la mitosis.
B) Suprime el crossing-over.
C) Inhibe la etapa de crecimiento.
D) Elimina los grnulos corticales.
E) Altera la dotacin cromosmcia.
66 Un investigador ha aislado y purificado una molcula y sospecha que se trata de una protena. Un experimento adecuado para confirmar la
naturaleza de esta molcula es estudiar si:
A) Contiene oxgeno.
B) Contiene carbono.
C) Tiene un alto peso molecular.
D) Es soluble en solventes orgnicos.
E) Libera aminocidos despus de un tratamiento con tripsina.
67 Si en una clula se inhibe la transcripcin y al cabo de unas horas sus componentes moleculares se comparan con los de una clula intacta, se
constatar que la primera tendr una menor cantidad de:
I)
ARNt.
II)
ARNm.
III)
Protenas.
A) Slo I.
B) Slo II.
C) Slo III.
D) Slo II y III.
E) I, II y III.

68 Respecto al flujo de informacin gnica en eucariontes es correcto afirmar que:


I)
El gen que codifica para una protena posee ms nucletidos que el ARNm transcrito a partir de l.
II)
Una protena siempre posee menos aminocidos que los tripletes de nucletidos del ARNm a partir del cual fue traducida.
III)
Existen ms tipos de ARNt que los 20 aminocidos utilizados para sintetizar las protenas.
A) Slo I.
B) Slo II.
C) Slo III.
D) Slo I y III.
E) I, II y III.
69 Si la informacin contenida en el siguiente gen es completamente leda y traducida en una protena, entonces, cul es el correcto orden de
anticodones de los ARNt que participaron en la sntesis de esta protena?
Gen = ATGCTTAGCGGTATAGGCCATGCT
A) Anticodones = AUG CUU AGC GGU AUA GGC CAU GCU
B) Anticodones = UAC GAA UCG CCA UAU CCG GUA CGA
C) Anticodones = ATG CTT AGC GGT ATA GGC CAT GCT
D) Anticodones = TAC GAA TCG CCA TAT CCG GTA CGA
E) Anticodones = TUG CUU TGC GGA UAU GGC - CUA
70 Si durante la transcripcin se incorpora adenina marcada radiactivamente, entonces esta marca se encontrar en:
I)
Los ribosomas.
II)
El ARN mensajero.
III)
La protena formada.
A) Slo I.
B) Slo II.
C) Slo III.
D) Slo I y II.
E) I, II y III.
71 Los aminocidos esenciales:
A) Estn presentes en todas las protenas.
B) Son sintetizados por el organismo.
C) Deben ser proporcionados por la dieta.
D) Son necesarios para proveer cantidades adecuadas de energa.
E) Presentan aromas caractersticos que permiten diferenciarlos.
72 A una poblacin celular cultivada in vitro se le agrega adenina marcada al finalizar la etapa G2. Dnde se podr observar la marca en las clulas
que estn en mitosis?
A) En todos los cromosomas.
B) En algunos cromosomas.
C) Slo en las cromtidas.
D) Slo en los telmeros.
E) En ningn cromosoma.
73 Al medir el ADN en varias clulas en un embrin en desarrollo, se encontr que los niveles de ADN oscilan entre 3,2 y 6,4 picogramos por
ncleo. Si un ncleo presenta 4,8 picogramos de ADN, en qu etapa del ciclo celular se encontrara?
A) G0.
B) G2.
C) G1.
D) M.
E) S.

74 Un grupo de clulas en divisin son tratadas con una cierta droga, obtenindose solamente clulas binucleadas. De este resultado se puede
inferir que la droga inhibi la:
A) Citodiresis.
B) Replicacin del ADN.
C) Formacin de bivalentes.
D) Formacin del huso mittico.
E) Condensacin de la cromatina.
75 El centrmero es un sector del cromosoma:
A) Que se ubica en cada extremo de los cromosomas.
B) Que se ubica en el brazo corto de los cromosomas.
C) En el que se producen los entrecruzamientos.
D) En el que se insertan las fibras del huso mittico.
E) Que se ubica en el brazo largo de los cromosomas.
76 Un individuo es capaz de sobrevivir cuando:
I)
Mantiene un intercambio de materia y energa con el medio circundante.
II)
Mantiene la homeostasis de su medio interno.
III)
Responde a cambios del medio circundante.
A) Slo I.
B) Slo II.
C) Slo III.
D) Slo I y II.
E) I, II y III.
77 - Cul de las siguientes opciones define adecuadamente el concepto de genoma humano?
A) Toda la cromatina presente en el ser humano.
B) El total de cidos nucleicos que contiene una persona.
C) El ADN mitocondrial y el de los 23 pares de cromosomas de la especie.
D) La suma de todo el ADN de cada una de las clulas del individuo.
E) El porcentaje total de genes que codifican en cada clula del organismo.
78 - Cul de las siguientes funciones es comn en todos los seres vivos?
A) Control de la mitosis.
B) Ensamblaje de los centriolos.
C) Regulacin del metabolismo mitocondrial.
D) Regulacin de la motilidad de cilios o flagelos.
E) Control de la organizacin de la membrana plasmtica.

79 Ciertas clulas en cultivo, cuya membrana plasmtica es impermeable a iones, fueron colocados en soluciones acuosas (O, P y Q) que contienen
distintas concentraciones de NaCl (sal comn). Durante 1 hora se registraron los efectos de estos medios sobre el volumen celular y los resultados se
muestran en el siguiente grfico:

De acuerdo al grfico, es correcto afirmar que:


I)
El cambio en el volumen celular observado en O y Q, se explica principalmente por difusin del solvente a travs de la membrana
(osmosis).
II)
El efecto que produce la solucin P en el volumen celular, se explica porque el medio extra e intracelular presentan la misma
concentracin de soluto y solvente.
III)
El efecto que produce la solucin Q sobre el volumen celular, se explica porque esta solucin presenta una menor concentracin
de solutos que al medio intracelular.
A) Slo I.
B) Slo II.
C) Slo III.
D) Slo I y II.
E) I, II y III.
80 Considere las siguientes secuencias de oligonucletidos:
Secuencia 1: 5 ACGGCCTTCAAGTCAGG 3
Secuencia 2: 5 ACGGCCTTCAAGGGACT 3
Si la secuencia 1 de ADN mut a la secuencia 2 durante el ciclo de vida de una clula, entonces es correcto afirmar que el nuevo ADN ha sufrido una:
A) Duplicacin.
B) Inversin.
C) Translocacin.
D) Delecin.
E) Insercin.
81 Entre las lombrices hay especies con una alta capacidad de regeneracin, de modo que al seccionar un individuo por la mitad, cada parte
regenera el resto faltante, resultando dos individuos. Respecto a este planteamiento, cul(es) de las siguientes aseveraciones es (son) correcta(s)?
I)
Los individuos resultantes son genticamente iguales.
II)
Este es un proceso de reproduccin asexuada.
III)
Los individuos resultantes son haploides.
A) Slo I.
B) Slo II.
C) Slo III.
D) Slo I y II.
E) I, II y III.
82 Los puentes de hidrgeno que forman parte de las cadenas nucletidas del ADN se establecen entre:
A) Pentosas.
B) Grupo fosfato.
C) Bases nitrogenadas.
D) Aminocidos.
E) Enzimas.

83 La siguiente tabla muestra la composicin aminoacdica (representada por letras) de cinco pptidos y la concentracin requerida para que stos
hagan que las clulas se adhieran a la placa de cultivo.

De acuerdo con esto, es correcto afirmar que:


A) Mientras ms aminocidos tenga el pptido, mayor ser su capacidad de adhesin celular.
B) Resulta fundamental la presencia de los aminocidos R, G y D para aumentar la capacidad adhesiva.
C) Mientras ms pequeo el pptido, mayor ser la capacidad de adherir clulas.
D) La presencia del aminocido K determina la concentracin necesaria para expresar el efecto adhesivo.
E) La mayor capacidad de adhesin se presenta al usar el pptido 5.
84 El ncleo celular es una estructura que:
I)
Se puede observar en cualquier etapa del ciclo celular.
II)
Contiene exclusivamente ADN.
III)
Contiene la mayor parte del ADN celular.
A) Slo III.
B) Slo I y II.
C) Slo I y III.
D) Slo II y III.
E) I, II y III.
85 La cromatina compactada y enrollada corresponde a:
A) Huso mittico.
B) Centriolo.
C) Cromosoma.
D) Nuclolo.
E) Ribosoma.
86 Si una hebra de ADN presenta la secuencia:
5 A C A G C C G T A 3
Su hebra complementaria tundra la secuencia:

87 Para detectar la sntesis de cidos nucleicos totales (ADN y ARN) en un cultivo celular, como respuesta frente a la exposicin a una hormona X,
cul de las siguientes molculas marcadas radiactivamente debe agregar un investigador?
A) Adenina.
B) Ribosa.
C) Uracilo.
D) Timina.
E) Desoxirribosa.

88 Se cultivan dos cepas bacterianas (P y Q) en una misma cpsula de Petri en presencia de penicilina, siendo P resistente al antibitico. Al cabo del
primer da, la mayor parte de las colonias Q han desaparecido y al tercer da, stas vuelven a proliferar. La explicacin que podra dar cuenta de lo
ocurrido es que:
A) El antibitico cambi su estructura qumica.
B) Las bacterias Q sufrieron una transformacin a expensas de los componentes del medio.
C) Las bacterias P metabolizaron el antibitico, permitiendo el posterior desarrollo de las bacterias Q.
D) Las bacterias Q se volvieron resistentes al antibitico al contaminarse el medio de cultivo con un hongo.
E) Las bacterias P transfirieron a las bacterias Q plsmidos que contienen un gen para la resistencia al antibitico.
89 Despus de agregar un compuesto C a un cultivo celular, se hicieron mediciones, en distintos tiempos, de los niveles intracelulares de ADN
(curva 1), ARN mensajero (curva 2) y protenas (curva 3), como se muestra en el grfico:

De acuerdo con los resultados mostrados en la grfica, es posible inferir correctamente que el compuesto C:
A) Favorece la transcripcin.
B) Favorece la duplicacin del ADN.
C) Inhibe la transcripcin.
D) Inhibe la traduccin.
E) Inhibe la sntesis de ADN.
90 El cdigo gentico es universal. Esto implica que:
i)
Todos los seres vivos tienen los mismos genes.
II)
La secuencia de ADN que estructura los genes de cualquier organismo es el mismo.
III)
Un triplete de ARN codifica el mismo aminocido en cualquier organismo.
Es (son) correcta(s):
A) Slo I.
B) Slo II.
C) Slo III.
D) Slo II y III.
E) I, II y III.
91 Al sumergir una clula vegetal en una solucin hipertnica, lo ms seguro es que ocurrir:
I)
Deshidratacin y plasmlisis.
II)
Acercamiento de la membrana celular hacia la pared celular.
III)
Entrada neta de agua desde la solucin hacia la clula.
Es (son) correcta(s):
A) Slo I.
B) Slo II.
C) Slo III.
D) Slo I y II.
E) Slo II y III.

92 Un investigador purifica una molcula de ARN y lleva a cabo algunas pruebas para saber si ste corresponde a un ARN mensajero (ARNm).
Cul(es) de los siguientes resultados de procedimientos experimentales le permiten a este investigador dilucidar, inequvocamente, la identidad
funcional de este ARN?
I)
Introducirlo en una clula y constatar la aparicin de una nueva protena.
II)
Secuenciarlo y constatar que el nmero de nucletidos es mltiplo de tres.
III)
Secuenciarlo y constatar la presencia de un codn de inicio y uno de trmino cercanos a cada uno de los extremos,
respectivamente.
A) Slo I.
B) Slo II.
C) Slo III.
D) Slo I y III.
E) Slo II y III.
93 En la replicacin del ADN, las copias resultantes estn formadas por:
A) Dos hebras nuevas de ADN.
B) Dos hebras de ADN conservadas.
C) Una hebra de ADN conservada y otra nueva.
D) Dos hebras de ADN, cada una con una mitad conservada y otra nueva.
E) Dos hebras de ADN, cada una de las cuales es un mosaico de partes conservadas y nuevas.
94 El modelo de mosaico fluido de la membrana celular implica que:
I)
Los lpidos de una membrana estn en constante movimiento.
II)
Las protenas insertadas en los lpidos pueden moverse y desplazarse dentro de los lpidos.
III)
Las cabezas polares de los fosfolpidos se orientan hacia las caras interna y externa de la membrana.
Es (son) correcta(s):
A) Slo I.
B) Slo II.
C) Slo I y II.
D) Slo II y III.
E) I, II y III.
95 La siguiente figura muestra la relacin entre la velocidad de una reaccin catalizada por una enzima, en funcin de la concentracin de sustrato:

De la interpretacin del grfico, es correcto afirmar que la velocidad de reaccin:


I)
Aumenta en funcin de la concentracin de sustrato.
II)
Entre 0 y Q es variable.
III)
Disminuye a concentraciones de sustrato superiores a Q.
A) Slo I.
B) Slo II.
C) Slo I y II.
D) Slo I y III.
E) I, II y III.

96 - Cul(es) de las siguientes opciones se usa(n) como herramientas(s) biotecnolgica(s) para el procesamiento y la transferencia de material
gentico desde un organismo a otro de diferentes especie?
I)
Virus.
II)
Plasmidios bacterianos.
III)
Enzimas de restriccin bacterianas.
A) Slo I.
B) Slo II.
C) Slo III.
D) Slo I y III.
E) I, II y III.
97 La siguiente secuencia de ADN cambi durante el ciclo de vida de una clula, desde la secuencia 1 a la secuencia 2:

Al respecto, es correcto afirmar que este cambio ocurri por:


A) Delecin.
B) Inversin.
C) Duplicacin.
D) Traslocacin.
E) Duplicacin invertida.
98 La figura muestra una vescula pequea en el interior de otra que tiene un volumen 5 veces mayor. Ambas estn sumergidas en un contenedor
con solucin acuosa de sacarosa 10 mM. Se indica el contenido inicial de cada vescula. Las membranas de estas vesculas son elsticas y permeables
slo al agua.

Al respecto, qu se observar cuando el sistema alcance el equilibrio?


A) Ambas vesculas colapsarn.
B) La vescula pequea se expandir en un 50%.
C) La vescula grande reducir su volumen 5 veces.
D) Ambas vesculas alcanzarn el volumen del contenedor.
E) La vescula pequea alcanzar el volumen de la ms grande.
99 El modelo de Watson y Crick para la estructura del ADN afirma que este polmero es:
A) Una hebra lineal.
B) Una cadena lineal asociada a histonas.
C) Una hebra que forma una estructura helicoidal.
D) Dos hebras que forman una estructura helicoidal.
E) Una doble hebra asociada a histonas.
100 - Cul(es) de las siguientes relaciones es (son) verdadera(s) para el ADN nuclear de cualquier organismo?
I)
El nmero de bases pricas es siempre igual al de las pirimdicas.
II)
El nmero de guaninas es siempre igual al de las citosinas.
III)
La suma de adeninas y timinas es siempre igual a la suma de guaninas y citosinas.
A) Slo I.
B) Slo II.
C) Slo III.
D) Slo I y II.
E) I, II y III.

101 Con respecto a la cantidad de ADN que presentan las clulas somticas durante el ciclo celular, es correcto afirmar que:
I)
En G1 y G2 la clula posee la misma cantidad de ADN.
II)
En G2 la cantidad de ADN es 4c.
III)
Existe la misma cantidad de ADN en la profase y anafase de la mitosis.
A) Slo I.
B) Slo II.
C) slo III.
D) Slo II y III.
E) I, II y III.
102 La enzima peptidil-transferas cataliza la formacin de enlaces peptdicos. Una mutacin en el gen codificante de esta enzima afectara
inicialmente el proceso de:
A) Traduccin.
B) Replicacin.
C) Transcripcin.
D) Reparacin del ADN.
E) Corte de intrones y empalme de exones.
103 El siguiente grfico muestra el curso de una reaccin enzimtica en una reaccin qumica:

A partir de su anlisis, se puede inferir correctamente que:


I)
La enzima disminuye la energa de activacin.
II)
Sin enzima se acelera la reaccin qumica.
III)
Es necesario superar la energa de activacin para obtener productos.
A) Slo I.
B) Slo II.
C) Slo III.
D) Slo I y II.
E) Slo I y III.
104 La siguiente figura est relacionada con el proceso de biosntesis de protenas:

Al respecto, es correcto inferir que:


I)
La estructura 1 corresponde a un ARN de transferencia.
II)
El triplete UUA representa un anticodn para un aminocido.
III)
5 - - - - AAU - - - -3 representa un ARN mensajero.
A) Slo I.
B) Slo II.
C) Slo III.
D) Slo I y III.
E) I, II y III.

105 Un plsmido contiene un gen que confiere resistencia a ampicilina y otro a tetraciclina. Se utiliza una enzima de restriccin, cuyo sitio de corte
est en el gen de resistencia a tetraciclina, para insertar un gen de inters. El plsmido se incorpora al cultivo bacteriano y luego se siembra en 4
placas de Petri, segn muestra la tabla:

Al respecto, las bacterias que incorporaron el plsmido recombinante deberan crecer:


A) En todas las placas.
B) Slo en la placa 3.
C) Slo en la placa 4.
D) Tanto en la placa 1 como en la placa 4.
E) Tanto en la placa 2 como en la placa 4.
106 El cambio de lugar de fragmentos cromosmicos dentro del mismo cromosoma, o de fragmentos entre cromosomas no homlogos, se conoce
como:
A) Translocacin.
B) Duplicacin.
C) Supresin.
D) Inversin.
E) Delecin.
107 La molcula de ADN de una bacteria y la de un ser humano se diferencian en:
A) El esqueleto de fosfatos.
B) La secuencia de nucletidos.
C) El tipo de nucletidos.
D) El tipo de azcar.
E) El tipo de enlaces entre nucletidos.
108 Al comparar una clula de la epidermis de una persona con una de sus neuronas, es correcto afirmar que estos dos tipos celulares:
A) Presentan distintos tipos de ARN polimerasa.
B) Poseen el mismo genoma.
C) Se diferencian por los distintos tipos de ribosomas que poseen.
D) Transcriben exactamente los mismos genes.
E) Se diferencian por tener distintos cdigos genticos.
109 Una molcula de ADN, con sus dos hebras marcadas radiactivamente, experimenta dos ciclos de replicacin en una solucin libre de marcador
radiactivo. De las cuatro molculas resultantes de ADN:
A) Todas presentan radiactividad.
B) Ninguna presenta radiactividad.
C) La mitad presenta radiactividad.
D) Una presenta radiactividad en ambas hebras.
E) La mitad presenta radiactividad en ambas hebras.

110 La siguiente figura est relacionada con el proceso de biosntesis de protenas:

Cul de los siguientes ARNm permite sintetizar un pptido con la secuencia de aminocidos: Met Phe Pro Arg Leu Leu Tyr?
A) AUG CCC CGC UUA UUG UAC
B) AUG UUC CCU CGA UUA UUA UAA
C) AUG UAU UUA UUG CGU CCA UUC UAA
D) AUG UUC CCA CGU UUG UUA UAU UAG
E) UUC CCU UUA UUA UAA UAC
111 En el grfico se representa el efecto que produce la aplicacin de una droga sobre un cultivo de clulas epiteliales en divisin, expresado en
ncleos por clulas en funcin del tiempo.
Del anlisis del grfico, es correcto inferir que la droga inhibe:
A) La despolimerizacin de los microtbulos.
B) La polimerizacin del huso acromtico.
C) La desorganizacin de la carioteca.
D) La migracin de los centriolos.
E) El proceso de citoquinesis.

112 - Cul de los siguientes precursores radiactivos se debera administrar a


una clula si se desea determinar la sntesis de cidos nucleicos totales?
A) Citosina.
B) Uracilo.
C) Timina.
D) Ribosa.
E) Desoxirribosa.
113 - En cul de las siguientes estructuras celulares es posible encontrar membrana celular?
I)
Mitocondrias.
II)
Cloroplastos.
III)
Nuclolo.
A) Slo I.
B) Slo II.
C) Slo III.
D) Slo I y II.
E) I, II y III.
114 - Cul de las siguientes estructuras indica que ha ocurrido crossing-over durante la meiosis?
A) Centrmero.
B) Cinetocoro.
C) Constriccin secundaria.
D) Telmero.
E) Quiasma.

115 Actina y tubulina son protenas globulares que forman parte del citoesqueleto y que intervienen en:
I)
La mantencin de la forma celular.
II)
La segregacin del material gentico.
III)
El metabolismo energtico.
A) Slo I.
B) Slo II.
C) Slo III.
D) Slo I y II.
E) I, II y III.
116 Los ribosomas son complejos macromoleculares que se caracterizan por:
I)
Estar constituidos por subunidades de desigual tamao.
II)
Encontrarse slo asociados al aparato de Golgi.
III)
Participar en la sntesis de protenas.
A) Slo I.
B) Slo II.
C) Slo I y III.
D) Slo II y III.
E) I, II y III.
117 Si a partir de una clula eucarionte se extrae ARNm maduro y se determina su secuencia de nucletidos, entonces se puede(n) encontrar:
I)
Los intrones de este gen.
II)
Los exones de este gen.
III)
El orden de los aminocidos codificantes en este gen.
Es (son) correcta(s):
A) Slo I.
B) Slo II.
C) Slo III.
D) Slo I y III.
E) Slo II y III.
118 La figura representa un cromosoma un cromosoma en meiosis I el que es irradiado con un rayo lser en un proceso preciso, resultando el
quiebre que aparece a la derecha:

Puede predecirse que el ADN del fragmento resultante con el gen 2 perder inmediatamente su capacidad de:
I)
Migrar en anafase.
II)
Segregar mendelianamente.
III)
Replicarse.
IV)
Transcribirse.
Es (son) correcta(s):
A) Slo I.
B) Slo II.
C) Slo I y II.
D) Slo III y IV.
E) I, II, III y IV.

119 Los cloroplastos son organelos presentes en la clula vegetal. De ellos, se seala que:
I)
Poseen pigmentos fotosintticos (clorofila, carotenos) que absorben la luz.
II)
Transforman la energa luminosa en energa qumica, contenida en las molculas de ATP y NADPH.
III)
La transformacin de energa ocurre en los centros fotosintticos, que se encuentran en las membranas que forman la grana del
cloroplasto.
Es (son) correcta(s):
A) Slo I.
B) Slo II.
C) Slo I y II.
D) Slo II y III.
E) I, II y III.
120 Los cilios son estructuras celulares especializadas, cuya presencia en el cuerpo humano se vincula con:
I)
La defensa del organismo ante la entrada de agentes extraos en las vas respiratorias.
II)
El desplazamiento del ovocito a travs de las trompas de Falopio.
III)
La absorcin de nutrientes en el intestino delgado.
Es (son) correcta(s):
A) Slo I.
B) Slo II.
C) Slo III.
D) Slo I y II.
E) I, II y III.
121 La tabla del cdigo gentico muestra la correspondencia entre:
A) ADN y genes.
B) ADN y aminocidos.
C) ARN mensajero y codones.
D) Codones y aminocidos.
E) Codones y anticodones.
122 En ingeniera gentica, qu caracterstica de los virus permite la introduccin de genes a las clulas eucariontes?
A) Capacidad de infeccin.
B) Presencia de transcriptasa inversa.
C) Ausencia de organelos simbiontes.
D) Presencia de un solo tipo de cido nucleico.
E) Capacidad de estimular la respuesta inmunolgica.
123 La produccin de vegetales genticamente modificados, permite obtener:
I)
Plantas resistentes a plagas.
II)
Plantas tolerantes a herbicidas.
III)
Alimentos enriquecidos en algn nutriente.
Es (son) correcta(s):
A) Slo I.
B) Slo II.
C) Slo I y II.
D) Slo II y III.
E) I, II y III.
124 Si el anticodn del ARNt que porta el aminocido leucina es GAG, entonces, la secuencia de nucletidos en el ADN que codifica para este
aminocido es:
A) GAG.
B) CUC.
C) CTC.
D) AUG.
E) UCG.

125 Se necesita realizar un experimento para el cual se requiere que los organismos de una misma especie sean siempre genticamente distintos.
Estos organismos se podran obtener de:
A) Un brazo de estrella de mar.
B) Semillas de alfalfa.
C) Una colonia de bacterias.
D) Trozos de una planaria.
E) Estacas de un pino.
126 Es posible que la estructura de la membrana plasmtica sea afectada por un tratamiento con:
A) Agua.
B) Amilasa.
C) Colesterol.
D) Solventes orgnicos.
E) Solucin de NaCl diluido.
127 En el siguiente grfico se muestra el efecto de la composicin de pares de bases sobre la temperatura de desnaturacin del ADN.

Al respecto, es correcto inferir que:


A) Un mayor contenido GC se refleja en una mayor Tm.
B) No hay relacin entre el contenido GC y el aumento de Tm.
C) Se observa una relacin inversa entre el contenido GC y Tm.
D) Cuando mayor es el contenido GC la hebra de ADN es ms susceptible a la denaturacin por accin de la temperatura.
E) La estabilidad del ADN es independiente del aumento de la temperatura.
128 La vimblastina y la cafena son alcaloides que interfieren con algunas etapas del ciclo celular. La vimblastina despolimeriza a los microtbulos y
la cafena inhibe la formacin de la nueva pared celular en la citodiresis de clulas vegetales. AL agregar estos alcaloides a clulas vegetales
diploides en una etapa temprana de la mitosis, se obtienen:
A) Clulas con 4c y sin pared celular.
B) Clulas con 2c y dos ncleos.
C) Clulas con 4c y un ncleo.
D) Clulas con 4c y dos ncleos.
E) Clulas con 2c y sin pared celular.
129 - Cul de las siguientes afirmaciones es la mejor explicacin de la relacin entre el nmero de cromosomas y el organismo en el que se
encuentran?
A) A mayor nmero de cromosomas, mayor el nmero de genes.
B) A mayor nmero de cromosomas, ms complejo es el organismo resultante, pero posee menos genes en su ADN.
C) A mayor nmero de cromosomas, ms tiempo vive el organismo resultante.
D) No hay una relacin consistente entre el nmero de cromosomas y el nmero de genes o la complejidad del organismo.
E) A mayor nmero de cromosomas, mayor el nmero de genes pero viven menos tiempo.
130 Las protenas de membrana tienen una amplia variedad de funciones, excepto:
A) Transporte de sustancias.
B) Almacenamiento de material.
C) Anclaje de estructuras.
D) Actuar como receptor.
E) Tener actividad enzimtica.

CLAVES
1
E
11
E
21
B
31
B
41
D
51
A
61
E
71
C
81
D
91
A
101
D
111
E
121
D

2
A
12
B
22
D
32
D
42
E
52
B
62
B
72
E
82
C
92
D
102
A
112
A
122
A

3
D
13
D
23
E
33
E
43
D
53
A
63
C
73
E
83
B
93
C
103
E
113
D
123
E

4
D
14
C
24
A
34
A
44
B
54
C
64
A
74
A
84
A
94
E
104
E
114
E
124
A

5
A
15
C
25
D
35
E
45
D
55
C
65
E
75
D
85
C
95
C
105
D
115
D
125
B

6
C
16
D
26
B
36
C
46
B
56
B
66
E
76
E
86
B
96
E
106
A
116
C
126
D

7
B
17
E
27
C
37
A
47
A
57
A
67
E
77
C
87
A
97
C
107
B
117
E
127
A

8
C
18
E
28
D
38
A
48
A
58
D
68
E
78
E
88
E
98
E
108
B
118
C
128
C

9
A
19
D
29
A
39
C
49
D
59
B
69
A
79
D
89
D
99
D
109
C
119
E
129
D

10
A
20
C
30
D
40
D
50
C
60
D
70
D
80
B
90
C
100
D
110
D
120
D
130
B

Похожие интересы