RESEARCH REPORTS
Biological
K. Iohara1,2, M. Nakashima1*, M. Ito3,
M. Ishikawa1, A. Nakasima2,
and A. Akamine1
1Department
of Clinical Oral Molecular Biology, Division
of Oral Rehabilitation, 2 Department of Orthodontics,
Division of Oral Health, Growth and Development, Faculty
of Dental Science, Kyushu University, 3-1-1 Maidashi,
Higashiku, Fukuoka 812-8582, Japan; and 3Department of
First Anatomy, National Defense Medical College,
Tokorozawa 359-8513, Japan; *corresponding author,
misako@dent.kyushu-u.ac.jp
J Dent Res 83(8):590-595, 2004
ABSTRACT
Regenerative medicine is based on stem cells,
signals, and scaffolds. Dental pulp tissue has the
potential to regenerate dentin in response to
noxious stimuli, such as caries. The
progenitor/stem cells are responsible for this
regeneration. Thus, stem cell therapy has
considerable promise in dentin regeneration.
Culture of porcine pulp cells, as a three-
dimensional pellet, promoted odontoblast
differentiation compared with monolayers. The
expression of dentin sialophosphoprotein (Dspp)
and enamelysin/matrix metalloproteinase 20
(MMP20) mRNA confirmed the differentiation of
pulp cells into odontoblasts and was stimulated by
the morphogenetic signal, bone morphogenetic
protein 2 (BMP2). Based on the in vitro
experiments, an in vivo evaluation of pulp
progenitor/stem cells in the dog was performed.
The autogenous transplantation of the BMP2-
treated pellet culture onto the amputated pulp
stimulated reparative dentin formation. In
conclusion, BMP2 can direct pulp progenitor/stem
cell differentiation into odontoblasts and result in
dentin formation. Abbreviations: BMP2, bone
morphogenetic protein 2; Dspp, dentin
sialophosphoprotein; Dmp1, dentin matrix protein
1; ALPase, alkaline phosphatase; MMP20, matrix
metalloproteinase 20; Phex, phosphate-regulating
gene with homologies to endopeptidases on X-
chromosome.
KEY WORDS: dentin regeneration, stem cell
therapy, BMP2, dental pulp-capping, pellet
culture.
Received January 15, 2004; Last revision June 5, 2004;
Accepted June 14, 2004
590
Dentin Regeneration by Dental
Pulp Stem Cell Therapy with
Recombinant Human Bone
Morphogenetic Protein 2
INTRODUCTION
TGronthos
he dental pulp contains progenitor/stem cells, which can proliferate and
differentiate into dentin-forming odontoblasts (Nakashima et al., 1994;
et al., 2000, 2002). Damaged odontoblasts can be replaced by
newly generated populations of odontoblasts derived from stem cells from
pulp (Tziafas et al., 2000). Following physiological stimulation or injury,
such as caries and operative procedures, stem cells in pulp may be
mobilized to proliferate and differentiate into odontoblasts by morphogens
released from the surrounding dentin matrix (Tziafas et al., 2000). Tissue
engineering with the triad of dental pulp progenitor/stem cells, morphogens,
and scaffolds may provide a useful alternative method for pulp-capping and
root canal treatment (Nakashima and Reddi, 2003). In pulp cell therapy, the
technique for manipulation of the growth of the isolated pulp
progenitor/stem cells and induction of three-dimensional tissue formation in
vitro needs to be developed. Naturally derived collagen or synthetic
materials such as polyglycolic acid (PGA) are used as a scaffold for
attachment and guidance of cells (Putnam and Mooney, 1996). The pulp-
derived fibroblasts adhering to the PGA fibers can proliferate and form a
new tissue similar to that of native pulp (Mooney et al., 1996). The synthetic
matrices, however, must undergo degradation simultaneously with the new
tissue formation by the cultured cells. An alternative to the use of synthetic
matrix with variable degradation rate is the use of three-dimensional
cultures with an assembly of endogenous extracellular matrix or scaffold. A
three-dimensional in vitro culture system has been developed for
chondrocytes (Kato et al., 1988; Ballock and Reddi, 1994), bone marrow
stromal cells (Yoo et al., 1998), and intervertebral disc cells (Lee et al.,
2001). This system involves formation of cell pellets or aggregates by a one-
step centrifugation method, allowing for three-dimensional interaction
between the neighboring cells, and is followed by synthesis of extracellular
matrix in the pellet. Cell-cell interactions and environmental cues are
important in modulation of the phenotype of cells grown in vitro.
Bone morphogenetic proteins (BMPs) have been implicated in tooth
development, and the expression of BMP2 is increased during the terminal
differentiation of odontoblasts (Nakashima et al., 1994; Nakashima and
Reddi, 2003). Beads soaked in human recombinant BMP2 induce the
mRNA expression of Dspp, the differentiation marker of odontoblasts after
implantation onto dental papilla in organ culture. BMP2 also induces a large
amount of reparative dentin on the amputated pulp in vivo (Nakashima,
1994a). It has been suggested that BMP2 may regulate the differentiation of
pulp cells into odontoblastic lineage and stimulate reparative dentin
formation (Nakashima and Reddi, 2003). We have compared three-
dimensional pellet culture system with monolayer cultures. The efficacy of
BMP2 on the differentiation of pulp cells into odontoblasts was also
J Dent Res 83(8) 2004 BMP2 Cell Therapy for Dentin Regeneration 591

examined with the use of this pellet culture system. In addition, reagent (Invitrogen, Carlsbad, CA, USA). First-strand cDNA
we investigated cell therapy in vivo for dentin regeneration. syntheses were performed by reverse transcription with the
SuperScript pre-amplification system (Invitrogen). The design of
the oligonucleotide primers was based on published cDNA
MATERIALS & METHODS
sequences (Table). Real-time PCR for -actin, 1(I)collagen,
Three-dimensional Pellet Culture of the Pulp Cells dentin matrix protein 1, dentin sialophosphoprotein, Osterix,
The porcine premolar pulp was isolated, and the pulp cells were enamelysin/MMP20, phosphate-regulating gene with homologies
separated enzymatically as previously described (Nakashima, 1991). to endopeptidases on the X-chromosome (Phex), Cbfa1, and
The pellet culture of the porcine pulp cells was then performed Cbfa3 was performed with Light Cycler-Fast Start DNA master
(Kato et al., 1988; Ballock and Reddi, 1994). Briefly, 1-mL aliquots SYBR Green I (Roche Diagnostics, Tokyo, Japan) by Light
containing 2 x 10 5 cells were centrifuged in a 15-mL conical Cycler 330 (Roche Diagnostics). Those RT-PCR products were
polypropylene tube (Asahi techno glass corp., Tokyo, Japan) at 1000 subcloned into pCR2.1-TOPO vector (Invitrogen) and confirmed
rpm for 5 min. Pellets were maintained in Dulbecco's modified by sequencing.
essential medium (Life Technologies, Rockville, MD, USA) Transplantation of the Pellet
supplemented with 10% heat-inactivated bovine calf serum (JRH on the Canine Amputated Pulp
Biosciences, Lenexa, KS, USA) and 50
g/mL L-ascorbic acid Twenty-four teeth from 6 young adult dogs were used. Surgical
phosphate (Wako pure chemical industries, LTD, Osaka, Japan), and anesthesia was obtained in the dogs by intraveneous administration
penicillin-streptomycin. The medium was changed two times per of pentobarbital sodium. The upper incisor pulp was extracted and
wk. From day 28 on, the medium was supplemented with Pi to a 1- autogenous pellets were prepared as described earlier for porcine
mM final concentration. For comparison, a traditional monolayer pulp. A surgical exposure was made in the canine, and the
culture was performed at a density of 1 x 105 cells/mL in a 35-mm amputation was carried out. Pellet cultures were applied to the
dish. In some experiments, recombinant human BMP2 (10, 25, 50, amputated pulp on day 14, and the cavity was filled with glass-
100, and 200 ng/mL) (kindly provided by Yamanouchi ionomer cement and composite resin. Four wks after
Pharmaceutical Co., Ltd., Tokyo, Japan) was added to the medium 1 transplantation, dentin formation was examined in the serial
hr before centrifugation after enzymatic isolation. paraffin sections. Our animal use protocols (porcine and canine)
Total Cell Number and Alkaline Phosphatase Activity were reviewed and approved by the Kyushu University
The cells were dispersed by trypsin and counted at each time point Institutional Review Board.
during pellet culture and monolayer culture. For analysis of alkaline
phosphatase activity, the pellet or the cells at each time points were RESULTS
sonicated and assayed by the method of Lowry et al. (1954).
Comparison of the Pellet Culture
Tissue Morphology with the Normal Monolayer Culture
Pellets on days 7, 14, and 21 were fixed in 4% paraformaldehyde First, the sequential morphological changes in the pellet were
overnight and processed for paraffin-embedding. The sections of examined. The pulp cells were oval or polygonal, and the
4.5-
m thickness were stained in hematoxylin and eosin (H&E). nuclei contained a few round or ovoid nucleoli. The pellet
The mineralization was confirmed by Alizarin Red staining. progressively became spherical on days 14 and 21. On day
Quantification of
Collagen Type I and Table. Primers for Real-time RT-PCR
Type III Syntheses
To determine the effect of Name 5 → Sequence → 3 Product Size Accession Number
BMP on collagen type I
and type III syntheses, we -actin Forward CTGGGGCCTAACGTTCTCAC 198 bp BI118314
stained the paraffin- Reverse GTCCTTTCTTCCCCGATGTT
embedded sections of the 1(I)collagen Forward AAGGACAAGAGGCACGTCTG 166 bp BI233976
pellet with Picro-sirius red Reverse CGCTGTTCTTGCAGTGGTAG
(Junqueira et al., 1979) on Dentin matrix protein 1 Forward TGGGGATTATCCTGTGCTCT 177 bp AY524986
day 21 and observed them Reverse GCTGTCACTGGGGTCTTCAT
by light microscopy with Dentin sialophosphoprotein Forward GGAATGGAGAGAGGACTGCT 174 bp AF332578
polarizing filters. Surface Reverse AGGTGTTGTCTCCGTCAGTG
areas of collagen fibers Osterix Forward ACCAATGGGCTCCTGTCAC 163 bp AY514037
were measured, and Reverse CACTGGGCAGACAGTCAGAA
quantitative analysis was Enamelysin/MMP20 Forward CACTGTTGCTGCTCACGAAT 182 bp SSU54825
performed with the use of Reverse CAGTGGGCTTTCCTGTGAAT
Image J 1.30 software. Phex Forward GTGGATACTGCCGTGCTTTT 182 bp AY514036
Reverse CAGTCGAACTGGGGAATCAT
Real-time RT-PCR
Cbfa1 Forward AAGCTGAAACGGTTCCTCAC 188 bp BE234439
For each time point on
Reverse GCCTTCAAAAATGGGATGAC
days 10, 14, and 21, total
Cbfa3 Forward CAGAAGCTGGAGGACCAGAC 170 bp AY515225
cellular RNA was isolated
Reverse GGGTTCAGGTCCGAGGTG
with the use of Trizol
592 Iohara et al. J Dent Res 83(8) 2004

indicating extracellular matrix

accumulation. The expression of
Dmp1, Dspp, enamelysin, and Phex,
differentiation markers, was much
increased on day 21, compared with
expression in the monolayer culture
(Fig. 1D).
Effect of BMP2
on Differentiation
and Mineralization
in the Pellet Culture
We performed morphological and
molecular biological evaluations to
examine the efficacy of BMP2 in
pellet cultures. BMP2 did not affect
cell proliferation (Fig. 2A). Alkaline
phosphatase activity was increased
by BMP2 in a dose-dependent
manner (Fig. 2B) on day 14.
Extensive osteodentin formation was
observed in the recombinant human
BMP2-treated pellet on day 21 (Fig.
2C). Collagenous matrix
accumulation was more in the
BMP2-treated pellet compared with
control pellets on day 21 (Fig. 2D).
The quantitative analyses
demonstrated that the amount of
collagen fibers was significantly
higher in the BMP2-treated pellet
compared with the non-treated pellet
on day 21 (Fig. 2E). The expression
of 1(I)collagen, Osterix, and Cbfa1
was higher on day 10 in the BMP2-
treated pellet than that in the non-
Figure 1. The three-dimensional pellet culture for porcine primary pulp cells compared with the treated pellet. The expression of
monolayer culture. (A) Morphological changes in the pellet during culture on day 7, day 14, and day Dmp1, enamelysin, and Phex was
21 (H-E stain). Note the decrease of cell number and increased matrix on day 21. (B) The changes in increased in the BMP2-treated pellet
cell numbers during pellet cultures of porcine pulp cells compared with monolayer culture in 35-mm on day 14. Relative expressions of
dish. Each point is expressed as the mean ± SD of 6 determinations. Note the lack of proliferation of
cells in pellet cultures. (C) The changes in alkaline phosphatase activity. Each point is expressed as the Dmp1, Dspp, enamelysin, Phex, and
mean ± SD of 6 determinations. (D) Real-time RT-PCR analysis of 1(I)collagen, Dmp1, Dspp, Cbfa3 in the BMP2-treated pellet
enamelysin/MMP20, and Phex expression in pellet cultures compared with monolayer cultures. The were 7.4, 2.4, 6.0, 11.7, and 5.5
experiment was repeated 3 times, and 1 representative experiment is presented. The relative times more, respectively, compared
percentage of expression was shown in relation to the highest value as 100% after normalization
against -actin. Solid lines represent pellet cultures and dashed lines monolayer cultures.
with expressions in the non-treated
pellet on day 21 (Fig. 2F). The
mineralization was intense in the
BMP2-treated pellet on day 35
compared with that in the non-
14, the cell density decreased, the cells became basophilic, treated pellet (Fig. 2G). These findings demonstrated that BMP2
and the extracellular matrix accumulated. On day 21, pellet stimulated differentiation of pulp cells into the odontoblastic
cultures contained cells surrounded by newly formed matrix, lineage.
osteodentin. The cells were faintly basophilic, and their
nuclei were round or oval and darkly staining (Fig. 1A). Effect of BMP2 on Reparative Dentin Formation
In general, there was minimal cell proliferation in pellet in the Pulp Cells
cultures compared with monolayers as enumerated by cell Autogenous transplantation of the pellet was performed on the
numbers (Fig. 1B). In contrast, the cells in the monolayer canine amputated pulp. Pulp cells labeled by transfection with
culture proliferated. The alkaline phosphatase activity gradually adenovirus delivering CMV-lacZ cDNA before the pellet was
increased and was significantly higher on day 10 and day 14 in made showed transgene lacZ expression in the pulp cells 14
the pellet compared with the monolayer culture (Fig. 1C). The days after transplantation (Figs. 3A, 3B), indicating successful
mRNA expression of 1(I)collagen was much higher on days transduction. We examined the feasibility of therapeutic
10 and 14 in pellet cultures than that in monolayer cultures, reparative dentinogenesis using the pellet on the amputated
J Dent Res 83(8) 2004 BMP2 Cell Therapy for Dentin Regeneration 593

pulp. In the control group,

fibrodentin formation was not
observed (Fig. 3C). Fibrous
osteodentin matrix was observed
in the cavity on the amputated
pulp 4 wks after transplantation of
the non-treated pellet (Fig. 3D).
Tissue necrosis and inflammation
were not observed. This suggested
that the transplanted pellet was
involved in reparative dentin
formation in vivo. The
osteodentinoblasts produced
extracellular matrix around them
(Fig. 3F). Large amounts of
osteodentin were seen in the
BMP2-treated pellet (Fig. 3E),
compared with the non-treated
pellet. A few osteodentinocytes
were observed in the osteodentin
(Fig. 3G). Odontoblast-like cells
with long processes attached to the
osteodentin to form tubular dentin
(Fig. 3H).

DISCUSSION
Cell therapy utilizing pulp
progenitor/stem cells has the
Figure 2. The effect of rhBMP2 treatment in the
potential to improve on pellet culture. (A) The changes in cell numbers in
conventional pulp-capping with the pellet culture with and without rhBMP2 (100
calcium hydroxide or other ng/mL). (B) Dose-dependent changes in alkaline
artificial materials that can induce phosphatase activity supplemented with rhBMP2
only a small amount of reparative (0 to 200 ng/mL). Each point is expressed as the
mean ± SD of 5 determinations. rhBMP2
dentin beneath the exposed or treatment at the final concentration of 25 ng to
amputated site of the pulp. As a 200 ng/mL significantly (p < 0.001) increased
first step toward the goal of alkaline phosphatase activity compared with
successful development of cell controls. (C) Morphological changes of the
rhBMP2 (100 ng/mL)-treated pellet compared
therapy in clinical dentistry, we with the non-treated pellet on day 21 (H-E stain).
developed the three-dimensional (D) Picrosirius red stain showing collagenous
pellet culture system using porcine matrix formation of rhBMP2-supplemented pellet
dental pulp cells. This method on day 21. (E) The histomorphometric evaluation
results in an endogenous scaffold of surface area of collagen fibers stained by
Picrosirius red. Digital pictures of the stained
of collagenous extracellular matrix sections were converted into gray scale in Adobe
after treatment with BMP2. When Photoshop ver. 5.01. From 9 to 12 non-
human pulp progenitor/stem cells overlapped square areas of 100
m 2 from
with hydroxyapatite/tricalcium sections of the pellets of each group were
phosphate as a scaffold were analyzed. The pixels of the bright areas of collagen fibers were counted, and the surface areas were
calculated. The values are expressed as average ± standard deviations. Statistical analysis was
implanted into immunocom- performed by the non-paired t test. Note significant increase by rhBMP2 treatment. (F) Real-time RT-PCR
promised mice, tubular dentin was analysis of 1(I)collagen, Dmp1, Dspp, enamelysin/MMP20, Phex, Osterix, Cbfa1 , and Cbfa3
formed (Gronthos et al., 2000, expression in the pellet culture with rhBMP2 (100 ng) compared with cultures without rhBMP2. The
2002). The porcine pulp cells experiment was repeated 4 times, and 1 representative experiment is presented. Solid lines represent
grown in the monolayer culture pellet cultures and dashed lines monolayer cultures. (G) Alizarin Red staining showing mineralization of
rhBMP2-supplemented pellet on day 35.
underwent a characteristic process
of dedifferentiation and rediffer-
entiation, marked by a loss of
1(I)collagen on day 10 and by an
increase of 1(I)collagen and ALPase activity on day 14 the pellet, as analyzed by total cell number, correlating well
following proliferation and differentiation. The expression of with previous studies with other cells (Chiba et al., 1998; Lee
Dspp, the differentiation marker of odontoblasts, was increased et al., 2001). The enhanced expression of enamelysin/MMP20
later, but not that of enamelysin/MMP20 and Phex. In this and Phex on day 21 in pellet cultures, compared with
study, the dental pulp cells exhibited minimal proliferation in monolayer cultures, suggested that the differentiation of pulp
594 Iohara et al. J Dent Res 83(8) 2004

the pellet, however, has shown that

these cells formed osteodentin-like
structure but not tubular dentin. In
contrast to other studies (Couble et
al., 2000; Yokose et al., 2000),
differentiation was enhanced
without the addition of
dexamethasone and organic
phosphate/inorganic phosphate. A
potential reason for this may be the
result of the optimal cell-to-cell
interaction and cell-to-matrix
interaction, providing a favorable
micro-environment/scaffold in
pellet cultures.
Next, the effects of rhBMP2 on
differentiation were examined. We
have previously reported that
treatment of monolayer cultures of
bovine pulp cells with rhBMP2
significantly increased the
expression of  1(I)collagen and
ALPase activity (Nakashima et al.,
1994). The increase in ALPase
activity by rhBMP2 was higher in
pellet cultures than in monolayer
culture on day 14. The expression of
Dmp1, Dspp, enamelysin, and Phex
was more increased by rhBMP2 in
pellet cultures than in monolayer
cultures. The pellet culture system
allowed for better responsiveness of
pulp cells to rhBMP2. This may be
the result of optimal cell-to-cell
interaction in the pellet culture
system. The expression of Cbfa3
transcription factor has been
reported in the dental papillae of
mouse tooth germ at cap and bell
stages, and later is limited in the
odontoblastic layer. Cbfa1 is
expressed in the dental papillae at
Figure 3. The autogenous transplantation of the pellet culture on the canine amputated pulp. (A) Canine the early stage, then disappears at
pulp cells transduced with adenovirus lacZ before the pellet culture began and stained by - the late bell stage (Yamashiro et al.,
galactosidase on day 14. (B) The implanted pellet on the amputated pulp showing lacZ transgene 2002). The decreased expression of
expression on day 28. The amputated site (arrow). (C) The amputated pulp without transplantation of
the pulp cell pellet. Note no osteodentin matrix formation after 4 wks. (D) The in vivo transplantation of
Cbfa1 and the enhanced expression
the pellet without rhBMP2. (E) The transplantation with rhBMP2. Note the formation of the thicker of Cbfa3 in the pellet of porcine
osteodentin matrix (OD) beneath the amputated site (arrows) in response to cell therapy with rhBMP2 pulp cells treated with rhBMP2 on
compared with cultures without rhBMP2. (F-H) Higher magnification of osteodentin. Fewer cells and day 21 in the present investigation
more homogenous matrix surrounding cells in rhBMP2-supplemented implantation (G) compared with are consistent with in vivo findings
that without rhBMP2 (F). Note the dentinal tubes (arrows) in the matrix (H).
in mice.
Finally, the utility of this pellet
culture system treated with BMP2
for dentin regeneration in vivo was
cells into odontoblastic lineage was more advanced. investigated. Since the cells in the pellets were surrounded by
Enamelysin/MMP20 is a matrix metalloprotease detected collagenous matrix, it allowed for convenient manipulation and
during predentin secretion by odontoblasts (Bègue-Kirn et al., implantation for cell therapy. Human pulp cells with PGA
1998). A phosphatase-regulating gene with homologies to which were cultured for 24 hrs and implanted into
endopeptidases on the X-chromosome (PHEX) is an enzyme immunocompromised mice expressed BMP2, BMP4, and
involved in phosphate homeostasis during odontoblast BMP7 mRNA (Buurma et al., 1999). In vivo protein therapy
differentiation (Ruchon et al., 1998). Histological analysis of with BMP2 (Nakashima, 1994a,b) and BMP7 (Rutherford et al.,
J Dent Res 83(8) 2004 BMP2 Cell Therapy for Dentin Regeneration
1993, 1994) and in vivo gene therapy with Bmp11/Gdf11 by
ultrasound-mediated gene delivery stimulated reparative dentin
formation on the amputated dental pulp (Nakashima et al.,
2003). Ex vivo cell therapy may have an advantage, in that the
cultured tissue stem/progenitor cells can be implanted after
differentiation into odontoblasts and might result in copious
amounts of reparative dentin formation. Skin fibroblasts
transduced with BMP7-adenovirus induce reparative dentin
formation (Rutherford, 2001). The present investigation
demonstrated larger amounts of reparative dentin formation on
the amputated pulp with a BMP2-supplemented pellet compared
with a control pellet. The extracellular matrix of the pellet
functions as a natural scaffold, which retains and releases
BMPs. Techniques to isolate human pulp stem cells and
manipulate their growth under defined in vitro conditions have
to be established and optimized before cell therapy with BMP2
can become a clinical reality for caries and endodontic therapy.
This investigation is a first step toward that long-term goal of
biological regenerative endodontic therapy.
ACKNOWLEDGMENTS
We are grateful to Yamanouchi Pharmaceutical Co., Ltd. for
providing recombinant human BMP2. This work was supported
by a Grant-in-Aid for Scientific Research (#13470403) from
the Ministry of Education, Science, Sports and Culture, Japan.
REFERENCES
Ballock RT, Reddi AH (1994). Thyroxine is the serum factor that
regulates morphogenesis of columnar cartilage from isolated
chondrocytes in chemically defined medium. J Cell Biol
126:1311-1318.
Bègue-Kirn C, Krebsbach PH, Bartlett JD, Butler WT (1998). Dentin
sialoprotein, dentin phosphoprotein, enamelysin and ameloblastin:
tooth-specific molecules that are distinctively expressed during
murine dental differentiation. Eur J Oral Sci 106:963-970.
Buurma B, Gu K, Rutherford RB (1999). Transplantation of human
pulpal and gingival fibroblasts attached to synthetic scaffolds. Eur
J Oral Sci 107:282-289.
Chiba K, Andersson GB, Masuda K, Momohara S, Williams JM,
Thonar EJ (1998). A new culture system to study the metabolism
of the intervertebral disc in vitro. Spine 23:1821-1828.
Couble ML, Farges JC, Bleicher F, Perrat-Mabillon B, Boudeulle M,
Magloire H (2000). Odontoblast differentiation of human dental
pulp cells in explant cultures. Calcif Tissue Int 66:129-138.
Gronthos S, Mankani M, Brahim J, Robey PG, Shi S (2000). Postnatal
human dental pulp stem cells (DPSCs) in vitro and in vivo. Proc
Natl Acad Sci USA 97:13625-13630.
Gronthos S, Brahim J, Li W, Fisher LW, Cherman N, Boyde A, et al.
(2002). Stem cell properties of human dental pulp stem cells. J
Dent Res 81:531-535.
Junqueira LC, Bignolas G, Brentani RR (1979). Picrosirius staining
plus polarization microscopy, a specific method for collagen
detection in tissue sections. Histochem J 11:447-455.
Kato Y, Iwamoto M, Koike T, Suzuki F, Takano Y (1988). Terminal
differentiation and calcification in rabbit chondrocyte cultures
grown in centrifuge tubes: regulation by transforming growth factor
beta and serum factors. Proc Natl Acad Sci USA 85:9552-9556.
595
Lee JY, Hall R, Pelinkovic D, Cassinelli E, Usas A, Gilbertson L, et al.
(2001). New use of a three-dimensional pellet culture system for
human intervertebral disc cells: initial characterization and
potential use for tissue engineering. Spine 26:2316-2322.
Lowry OH, Roberts NR, Wu ML, Hixon WS, Crawford EJ (1954).
The quantitative histochemistry of brain. II. Enzyme
measurement. J Biol Chem 207:19-37.
Mooney DJ, Powell C, Piana J, Rutherford B (1996). Engineering
dental pulp-like tissue in vitro. Biotechnol Prog 12:865-868.
Nakashima M (1991). Establishment of primary cultures of pulp cells
from bovine permanent incisors. Arch Oral Biol 36:655-663.
Nakashima M (1994a). Induction of dentin formation on canine
amputated pulp by recombinant human bone morphogenetic
protein (BMP)-2 and -4. J Dent Res 73:1515-1522.
Nakashima M (1994b). Induction of dentine in amputated pulp of the
dogs by recombinant human bone morphogenetic proteins-2 and -
4 with collagen matrix. Arch Oral Biol 39:1085-1089.
Nakashima M, Reddi AH (2003). The application of bone
morphogenetic protein to dental tissue engineering . Nat Biotech
21:1025-1031.
Nakashima M, Nagasawa H, Yamada Y, Reddi AH (1994). Regulatory
role of transforming growth factor-  , bone morphogenetic
protein-2, and protein-4 on gene expression of extracellular matrix
proteins and differentiation of dental pulp cells. Dev Biol 162:18-
28.
Nakashima M, Tachibana K, Iohara K, Ito M, Ishikawa M, Akamine A
(2003). Induction of reparative dentin formation by ultrasound-
mediated gene delivery of growth/differentiation factor 11. Human
Gene Therapy 14:591-597.
Putnam AJ, Mooney DJ (1996). Tissue engineering using synthetic
extracellular matrices. Nat Med 2:824-826.
Ruchon AF, Marcinkiewicz M, Siegfried G, Tenenhouse HS,
DesGroseillers L, Crine P, et al. (1998). Pex mRNA is localized in
developing mouse osteoblasts and odontoblasts. J Histochem
Cytochem 46:459-468.
Rutherford RB (2001). BMP-7 gene transfer to inflamed ferret dental
pulps. Eur J Oral Sci 109:422-424.
Rutherford RB, Wahle J, Tucker M, Rueger D, Charette M (1993).
Induction of reparative dentine formation in monkeys by
recombinant human osteogenic protein-1. Arch Oral Biol 38:571-
576.
Rutherford RB, Spangberg L, Tucker M, Rueger D, Charette M
(1994). The time-course of the induction of reparative dentine
formation in monkeys by recombinant human osteogenic protein-
1. Arch Oral Biol 39:833-838.
Tziafas D, Smith AJ, Lesot H (2000). Designing new treatment
strategies in vital pulp therapy. J Dent 28:77-92.
Yamashiro T, Aberg T, Levanon D, Groner Y, Thesleff I (2002).
Expression of Runx1, -2 and -3 during tooth, palate and
craniofacial bone development. Gene Exp Patterns 2:109-112.
Yokose S, Kadokura H, Tajima Y, Fujieda K, Katayama I, Matsuoka
T, et al. (2000). Establishment and characterization of a culture
system for enzymatically released rat dental pulp cells. Calcif
Tissue Int 66:139-144.
Yoo JU, Barthel TS, Nishimura K, Solchaga L, Caplan AI, Goldberg
VM, et al. (1998). The chondrogenic potential of human bone-
marrow-derived mesenchymal progenitor cells. J Bone Jt Surg Am
80:1745-1757.