Вы находитесь на странице: 1из 110

Biologa II

Luis Antonio Mendoza Sierra y Enrique Mendoza Sierra


Editorial Trillas
ISBN 978-607-17-0078-0

Examen resuelto de la

Parte 1. Genes
D.R. 2011, Luis Antonio Mendoza Sierra
Este documento electrnico puede utilizarse libremente con fines acadmicos,
siempre que no sea modificado de ninguna manera.
Toda referencia documental debe citar la pgina fuente: www.mendoza-sierra.org.
Prohibida la reproduccin total o parcial de este documento, sin la autorizacin por escrito del autor.

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
1.

Relacione las siguientes columnas:


a.

1.
2.
3.
4.
5.

Friedrich Miescher
Erwin Chargaff
James Watson y Francis Crick
Alfred Hershey y Martha Chase
Maurice Wilkins y Rosalind Franklin

b.
c.

d.
e.

A.
B.
C.
D.
E.

1a, 2b, 3e, 4d, 5c


1c, 2a, 3c, 4d, 5b
1b, 2a, 3d, 4e, 5c
1d, 2c, 3a, 4e, 5b
1b, 2a, 3c, 4d, 5e

Descubri una regla de equivalencia


matemtica al analizar las cantidades de
bases nitrogenadas en el ADN procedente de
diferentes organismos.
Aisl por primera vez el ADN de ncleos de
diferentes clulas.
Obtuvieron por cristalografa de rayos X
patrones de difraccin que revelaron la
estructura helicoidal del ADN.
Propusieron la estructura de doble hlice
para la molcula de ADN.
Demostraron por experimentacin con
radioistopos de fsforo-32 como marcador
de ADN, y de azufre-35 como marcador de
protenas, que el ADN es la molcula
portadora de la informacin gentica, y no
las protenas.

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
2.

Cmo se le llama a la unidad bsica de la herencia?


A.
B.
C.
D.
E.

3.

Los genes estn conformados por:


A.
B.
C.
D.
E.

4.

Gen
Fenotipo
ARN
Genotipo
Carcter

Protenas
Carbohidratos
Lpidos
cidos nucleicos
Aminocidos

En 1950, Erwin Chargaff descubri una regla de equivalencia matemtica al analizar las cantidades de bases
nitrogenadas en el ADN procedente de diferentes organismos, y encontr que:
A.
B.
C.
D.
E.

Adenina = Timina
Timina = Uracilo
Guanina = Citosina
Adenina = Guanina
Los incisos A y C son correctos

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
5.

Qu son los genes?


A.
B.
C.
D.
E.

6.

Gen es a nucletidos como protena es a ________________.


A.
B.
C.
D.
E.

7.

ADN
Protenas
ARN
Carbohidratos
Lpidos

ADN
Aminocidos
Genoma
Clula
Organismo

El genoma humano est constituido por poco menos de ________________ genes.


A.
B.
C.
D.
E.

5 000
15 000
30 000
90 000
150 000

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
8.

Indique cules de los siguientes puntos corresponden al ADN:


1.
2.
3.
4.
5.
6.
7.
8.
9.
10.

A.
B.
C.
D.
E.

Contiene desoxirribosa
Contiene ribosa
Su estructura es de cadena corta
Su estructura es de cadena larga
Su estructura es una sola cadena
Su estructura es una doble cadena
Contiene timina
Contiene uracilo
Es parte del proceso de traduccin
Es el principal sustento de la informacin gentica

1, 3, 5, 7, 9
1, 4, 6, 7, 10
1, 4, 6, 8, 10
2, 3, 5, 8, 9
2, 3, 6, 8, 10

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
9.

Indique cules de los siguientes puntos corresponden al ARN:


1.
2.
3.
4.
5.
6.
7.
8.
9.
10.

A.
B.
C.
D.
E.

Contiene desoxirribosa
Contiene ribosa
Su estructura es de cadena corta
Su estructura es de cadena larga
Su estructura es una sola cadena
Su estructura es una doble cadena
Contiene timina
Contiene uracilo
Es parte del proceso de traduccin
Es el principal sustento de la informacin gentica

1, 3, 5, 7, 9
1, 4, 6, 7, 10
1, 4, 6, 8, 10
2, 3, 5, 8, 9
2, 3, 6, 8, 10

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
10.

Ordene las siguientes palabras en un enunciado verdadero:


(1) denomina / (2) de / (3) investigacin / (4) genmica / (5) genomas / (6) La / (7) se / (8) los
A.
B.
C.
D.
E.

11.

1, 2, 3, 4, 5, 6, 7, 8
6, 3, 2, 8, 5, 7, 1, 4
5, 6, 2, 7, 3, 8, 1, 2
7, 5, 8, 6, 2, 3, 4, 1
8, 4, 3, 1, 2, 5, 6, 7

Seale el inciso que da continuidad a la serie:


Nucletido
ADN
gen
________________
A.
B.
C.
D.
E.

Genoma
Ncleo
Clula
Tejido
rgano

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
12.

Complete el mapa conceptual:


1

3
A.
B.
C.
D.
E.

Bases pirimdicas

Guanina

Citosina

(1) Bases nitrogenadas / (2) Bases pricas / (3) Adenina / (4) Timina / (5) Uracilo
(1) Bases nitrogenadas / (2) Bases pricas / (3) Uracilo / (4) Timina / (5) Adenina
(1) Bases pricas / (2) Bases nitrogenadas / (3) Adenina / (4) Timina / (5) Uracilo
(1) Bases pricas / (2) Bases nitrogenadas / (3) Uracilo / (4) Adenina / (5) Timina
(1) Adenina / (2) Timina / (3) Bases nitrogenadas / (4) Uracilo / (5) Bases pricas

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
13.

Es una base nitrogenada que constituye parte de la secuencia del ARN, pero no del ADN:
A.
B.
C.
D.
E.

14.

Las bases nitrogenadas adenina y guanina:


A.
B.
C.
D.
E.

15.

Adenina
Guanina
Citosina
Timina
Uracilo

Poseen dos anillos


Son bases pricas
Forman parte de los cidos nucleicos
Los incisos A, B y C son ciertos
Los incisos A, B y C son falsos

Las bases pirimdicas son:


A.
B.
C.
D.
E.

Timina
Citosina
Uracilo
Los incisos A, B y C son ciertos
Los incisos A, B y C son falsos

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
16.

Una molcula formada por una base nitrogenada, una pentosa y un grupo fosfato constituye:
A.
B.
C.
D.
E.

17.

Indique cul de las siguientes molculas rompe la regularidad:


A.
B.
C.
D.
E.

18.

Una clula
Una molcula de ADN
Una molcula de ARN
Una protena
Un nucletido

Prolina
Adenina
Guanina
Citosina
Timina

En una molcula de ADN, el carbono _____ est unido a un nitrgeno de la base nitrogenada:
A.
B.
C.
D.
E.

1'
2'
3'
4'
5'

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
19.

En una molcula de ADN, el fosfato est unido al carbono _____ de la desoxirribosa:


A.
B.
C.
D.
E.

20.

En el ADN, las bases nitrogenadas forman pares complementarios unidos por:


A.
B.
C.
D.
E.

21.

1'
2'
3'
4'
5'

Enlaces covalentes
Enlaces inicos
Puentes de hidrgeno
Enlaces metlicos
Fuerzas de Van der Waals

La adenina se une con la timina mediante _____ puentes _______________, y la guanina con la citosina
mediante _____ puentes _______________.
A.
B.
C.
D.
E.

2 / de hidrgeno / 3 / inicos
3 / inicos / 2 / de hidrgeno
2 / de hidrgeno / 3 / de hidrgeno
3 / inicos / 3 / covalentes
2 / tipo Van der Waals / 3 / metlicos

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
22.

En cada cadena de ADN, el carbono 3' de un nucletido se une al carbono 5' del siguiente nucletido por
un enlace _______________. De modo que el extremo 5' de una cadena termina en fosfato, mientras que el
extremo 3' termina en el grupo hidroxilo (-OH) libre del azcar.
A.
B.
C.
D.
E.

23.

El material gentico en forma de ADN circular generalmente se encuentra en:


A.
B.
C.
D.
E.

24.

Fosfodister
Tipo fuerzas de Van der Waals
Covalente
Metlico
Inico

Animales
Vegetales
Hongos
Protistas
Bacterias

Seleccione el grupo de palabras que exprese mejor una relacin semejante a sta:
GAMETOS
CIGOTO
MRULA
A.
B.
C.
D.
E.

Purinas
pirimidinas
cidos nucleicos
ADN
ARN
protenas
Adenina
guanina
timina
Clula
organelo
biomolcula
Enzima
ARN
ADN

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
25.

El azcar de los nucletidos de ADN es una desoxirribosa; y el del ARN, una ribosa. Cul es la diferencia
entre ambos azcares?
A.
B.
C.
D.
E.

26.

Seale la palabra cuyo significado sea ms cercano o sinnimo de CODN:


A.
B.
C.
D.
E.

27.

La desoxirribosa es una hexosa; y la ribosa, una pentosa


La desoxirribosa es una pentosa; y la ribosa, una triosa
El carbono 2' de la ribosa tiene un enlace con oxgeno, lo que no sucede con la desoxirribosa
La desoxirribosa es un disacrido; y la ribosa, un monosacrido
La desoxirribosa se une a la timina; y la ribosa, al uracilo

Tres pares de bases nitrogenadas


Combinacin de ARNm, ARNr y ARNt
Secuencia de tres nucletidos
Conjunto de tres ribosomas
Secuencia de tres aminocidos

Cul de los componentes de la siguiente serie rompe la regularidad?


A.
B.
C.
D.
E.

Desoxirribonucletidos
ADN
Genes
Cromosomas
ARN

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
28.

Indique cul secuencia de bases de ARN complementa esta secuencia de bases de ADN:
5'-ATG-CCA-CTG-CTG-ATT-3'
A.
B.
C.
D.
E.

29.

Un caracterstica de la estructura de doble hlice del ADN es que ambas cadenas estn en posicin:
A.
B.
C.
D.
E.

30.

3'-GAC-TTG-TAC-GAC-GAA-5'
3'-UAC-GGU-CAC-GAC-TAA-5'
3'-UAC-GGU-GAC-GAC-UAA-5'
5'-TAC-GGT-GAC-GAC-TAA-3'
5'-UAC-GGU-GAC-GAC-UAA-3'

Horizontal
Vertical
Perpendicular
Antiparalela
Circular

Nucletidos es a cidos nucleicos como aminocidos es a _______________.


A.
B.
C.
D.
E.

Codones
Tripletes
ARN
Protenas
Nucletidos

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
31.

32.

Relacione corectamente ambas columnas:

1.
2.
3.

ARNm
ARNr
ARNt

A.
B.
C.
D.
E.

1a / 2b / 3c
1b / 2c / 3a
1c / 2a / 3b
1c / 2b / 3a
1b / 2a / 3c

El ARNt est "cargado" cuando:


A.
B.
C.
D.
E.

Porta un aminocido
Carga una protena
Es funcional
Se une al ARNm
Se une al ARNr

a.
b.
c.

Sus extremos son un brazo anticodn y un brazo aceptor de


aminocido.
Contiene informacin codificada en forma de tripletes.
Se asocia con protenas y forma complejos denominados
ribosomas.

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
33.

En el ARNm, la informacin est codificada en secuencias de tres bases, y cada uno de estos tripletes se
denomina:
A.
B.
C.
D.
E.

34.

Es la secuencia complementaria de un codn:


A.
B.
C.
D.
E.

35.

Triosa
Bases nitrogenadas
Codn
Cdigo gentico
Anticodn

Par de bases
Unidad de transcripcin
Secuencia de inicio
Secuencia de alto
Anticodn

Cada aminocido contiene un grupo amino y un grupo carboxilo en el carbono alfa, y difieren entre s por
el grupo:
A.
B.
C.
D.
E.

A
P
E
R
S

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
36.

Cul de las siguientes molculas no es un aminocido?


A.
B.
C.
D.
E.

37.

La secuencia de codones determina la secuencia de _______________ en la sntesis de protenas.


A.
B.
C.
D.
E.

38.

Fenilalanina
Timina
Triptofano
Glutamina
cido asprtico

tomos
Aminocidos
Pptidos
Nucletidos
cidos nucleicos

El ARN de transferencia transfiere un _______________ especfico del citoplasma a un _______________


durante la sntesis de protenas.
A.
B.
C.
D.
E.

Triplete / codn
Aminocido / segmento de ADN
Electrn / tomo
Aminocido / ribosoma
Nucletido / cido nucleico

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
39.

Los aminocidos son las unidades estructurales de las protenas. Cul de las siguientes figuras representa
la estructura molecular del aminocido fenilalanina?

1.

4.

2.

3.

A.
B.
C.
D.
E.

5.
1
2
3
4
5

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
40.

Las siguientes aseveraciones respecto de los ribosomas son verdaderas, excepto:


A.
B.
C.
D.
E.

41.

Es un aminocido:
A.
B.
C.
D.
E.

42.

Estn formados por ARNr y protenas


En procariontes estn formados por dos subunidades: 30 S y 50 S
Estn rodeados por una membrana
En eucariontes estn formados por dos subunidades: 40 S y 60 S
Son los sitios de sntesis de las protenas

Lisina
Biotina
cido acetilsaliclico
Adenosina
Uridina

Los codones CCA, CCG, CCC y CCU codifican para un solo aminocido: prolina. El trmino tcnico que se
emplea para indicar que hay ms de un codn para la mayora de aminocidos, es que el cdigo gentico es:
A.
B.
C.
D.
E.

Polifactico
Degenerado
Verstil
Cambiante
Inespecfico

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
43.

Las protenas estn formadas por:


A.
B.
C.
D.
E.

44.

Cmo se denominan especficamente los enlaces entre aminocidos en la sntesis de protenas?


A.
B.
C.
D.
E.

45.

Carbohidratos
Bases pricas y pirimdicas
cidos nucleicos
Lpidos
Cadenas no ramificadas de aminocidos

Covalentes
Peptdicos
Inicos
De hidrgeno
Fosfodister

La conformacin de una protena es necesaria para que sta realice su funcin; si pierde su conformacin,
pierde su funcin. Por su conformacin, las protenas se clasifican en:
A.
B.
C.
D.
E.

Primarias y secundarias
De cadena corta y de cadena larga
Esenciales y no esenciales
Protenas y enzimas
Globulares y fibrosas

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
46.

Cul de las siguientes protenas es globular?


A.
B.
C.
D.
E.

47.

Las inmunoglobulinas son protenas:


A.
B.
C.
D.
E.

48.

Colgena
Elastina
Hemoglobina
Actina
Miosina

Globulares
Fibrosas
Enzimticas
Tubulares
Contrctiles

Las protenas:
A.
B.
C.
D.
E.

Pueden considerarse como genes que han sido transcritos y traducidos


Estn constituidas por aminocidos
Tambin se conocen como polipptidos
Pueden ser fibrosas o globulares
Los incisos A, B, C y D son ciertos

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
49.

50.

Relacione las protenas con sus funciones:


1.
2.
3.
4.
5.
6.
7.

ARN polimerasa
Colgena
Ovoalbmina
Hemoglobina
Actina y miosina
Insulina
Anticuerpos

A.
B.
C.
D.
E.

1a / 2c / 3b / 4g / 5f / 6d / 7e
1d / 2b / 3e / 4a / 5g / 6c / 7f
1b / 2c / 3e / 4a / 5d / 6g / 7f
1c / 2a / 3e / 4g / 5f / 6b / 7d
1d / 2c / 3a / 4b / 5g / 6f / 7e

La hexocinasa es una protena cuya funcin es:


A.
B.
C.
D.
E.

De proteccin
De almacenamiento
Estructural
De comunicacin
Enzimtica

a.
b.
c.
d.
e.
f.
g.

De transporte
Estructural
De comunicacin
Enzimtica
De almacenamiento
De proteccin
Contrctil

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
51.

Cmo se denomina el proceso de copia de una molcula de ADN, que resulta en dos molculas de ADN
exactamente iguales?
A.
B.
C.
D.
E.

52.

En la _______________, cada una de las cadenas de la doble hlice sirve de molde para sintetizar la cadena
complementaria. Es comn denominar el proceso replicacin _______________, porque cada molcula de
_______________ posee una cadena antigua y una nueva.
A.
B.
C.
D.
E.

53.

Mitosis
Meiosis
Replicacin
Transcripcin
Traduccin

Traduccin / especial / ARN


Replicacin / semiconservativa / ADN
Transcripcin / tpica / protena
Sntesis de protenas / simplificada / protena
Reproduccin / gentica / ADN

En la clula eucaritica, en dnde se realiza el proceso de replicacin?


A.
B.
C.
D.
E.

En la membrana celular
En el ncleo
En el retculo endoplasmico
En los ribosomas
En el complejo de Golgi

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
54.

En el proceso de replicacin semiconservativa, cada molcula de ADN posee:


A.
B.
C.
D.
E.

55.

Dos cadenas nuevas


Una cadena antigua y una nueva
Dos cadenas antiguas
Una cadena antigua y dos nuevas
Una cadena nueva y dos antiguas

Relacione las siguientes columnas referentes al proceso de replicacin:


a.

1.
2.
3.

Iniciacin
Elongacin
Terminacin

b.
c.

A.
B.
C.
D.
E.

1a / 2b / 3c
1b / 2a / 3b
1c / 2a / 3b
1b / 2c / 3a
1a / 2c / 3b

En eucariontes, ocurre cuando las burbujas de replicacin


se encuentran y llegan a los extremos del cromosoma
lineal, o cuando el proceso se detiene por una protena de
terminacin.
Se forma una burbuja de replicacin, cuyos extremos son
dos horquillas.
En cada burbuja de replicacin, holoenzimas ADN
polimerasas sintetizan las cadenas complementarias.

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
56.

Cules son las enzimas que en el proceso de replicacin separan a las cadenas de ADN rompiendo los
puentes de hidrgeno que las mantienen unidas?
A.
B.
C.
D.
E.

57.

La _______________ se refiere a todos los procesos por los cuales una clula convierte la informacin de los
genes en ARN y protenas.
A.
B.
C.
D.
E.

58.

Topoisomerasas
Ligasas
Helicasas
Primasas
Polimerasas

Replicacin
Codificacin
Expresin gentica
Traslocacin
Traduccin

En la mayora de los casos, la transferencia de la informacin gentica ocurre de ADN a ARN; sin embargo, en
algunas ocasiones, tambin se presenta el fenmeno contrario, es decir, la transferencia de informacin de
ARN a ADN. Cmo se denomina este proceso?
A.
B.
C.
D.
E.

Transcripcin inversa
Traduccin
Replicacin
Entrecruzamiento
Apoptosis

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
59.

Los polisomas son un conjunto de:


A.
B.
C.
D.
E.

60.

Los retrovirus y los retrotransposones realizan el proceso de transcripcin inversa, lo cual significa que la
transferencia de informacin sigue este sentido:
A.
B.
C.
D.
E.

61.

Clulas
Cuerpos neuronales
Mitocondrias
Cromosomas
Ribosomas

ADN
ARN
ADN
Protena
ARN

ARN
protena
protena
ARN
ADN

En qu parte de la clula eucaritica se realiza la transcripcin?


A.
B.
C.
D.
E.

Retculo endoplsmico
Complejo de Golgi
Ribosoma
Ncleo
Citoplasma

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
62.

Relacione correctamente las siguientes columnas referentes a procesos de expresin gentica.:


a.
1.
2.
3.

Replicacin
Transcripcin
Traduccin

b.

c.

A.
B.
C.
D.
E.
63.

Proceso de sntesis de una cadena de ARN, cuya


secuencia es idntica a la de una cadena de ADN.
Es la sntesis de protena, en la que una secuencia de
codones en el ARNm se expresa como una secuencia
de aminocidos.
Proceso de copia de una molcula de ADN, que resulta
en dos molculas de ADN exactamente iguales.

1a / 2b / 3c
1b / 2c / 3a
1c / 2a / 3b
1a / 2c / 3b
1b / 2a / 3c

En qu sitio se realiza el proceso celular de traduccin?


A.
B.
C.
D.
E.

Membrana celular
Ncleo
Nucleolo
Ribosoma
Lisosoma

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
64.

Relacione correctamente ambas columnas referentes a la etapa de iniciacin del proceso de replicacin:
a.
1.
2.
3.
4.
5.

Protenas iniciadoras
Helicasas
Topoisomerasas
Protenas de unin a
cadena sencilla
Enzima primasa

A.
B.
C.
D.
E.

1a / 2b / 3c / 4d / 5e
1b / 2e/ 3c / 4d / 5a
1c / 2b / 3d / 4a / 5e
1b / 2c / 3e / 4d / 5a
1b / 2a / 3c / 4d / 5e

b.
c.
d.
e.

Sintetiza una cadena corta de ARN, llamada cebador,


que proporciona un extremo 3'-OH sobre el que
puede iniciar la sntesis de ADN.
Localizan el sitio denominado origen de replicacin.
Separan las cadenas de ADN rompiendo los puentes
de hidrgeno que las mantienen unidas.
Evitan la reformacin de una doble hlice y
permiten el acceso del aparato de sntesis.
Mediante corte y reenlace relajan el enrollamiento
adicional producido por la separacin de las
cadenas.

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
65.

En la etapa de elongacin del proceso de replicacin, la sntesis de ADN ocurre nicamente en la direccin
5'
3'. Cmo se denomina la enzima que sintetiza el ADN?
A.
B.
C.
D.
E.

66.

ADN sintasa
ADN polimerasa
ADN replicasa
ADN ligasa
ADN nucletido transferasa

En una cadena de la burbuja de replicacin, la sntesis es continua y se le denomina cadena adelantada; pero
en la otra la sntesis es discontinua y se le denomina cadena atrasada. Cmo se llaman los segmentos de
ADN que se van sintetizando en la cadena atrasada?
A.
B.
C.
D.
E.

Unidades de transcripcin
Exones
Intrones
Precursores
Fragmentos de Okazaki

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
67.

Relacione correctamente ambas columnas referentes al proceso de transcripcin:


a.
1.
2.
3.
4.
5.

Transcrito primario
Gen interrumpido
Exones
Intrones
ARN maduro

b.
c.

d.
e.

A.
B.
C.
D.
E.

1a / 2b / 3c / 4d / 5e
1b / 2e/ 3c / 4d / 5a
1d / 2e / 3a / 4c / 5b
1b / 2c / 3e / 4d / 5a
1b / 2a / 3c / 4d / 5e

Secuencias de ADN que se transcriben y estn


representadas en el producto ARN final.
Se exporta al citoplasma para sntesis de protenas.
Secuencias de ADN que se transcriben y no estn
representadas en el producto ARN final, por haber
sido eliminadas.
El ARN que resulta de la transcripcin en clulas
eucariticas.
Consiste en exones e intrones alternados.

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
68.

En eucariontes, el ARN que resulta de la transcripcin se denomina transcrito primario, el cual se modifica
en el ncleo para convertirse en ARN maduro, tales modificaciones consisten en:
A.
B.
C.
D.
E.

69.

El ARN maduro:
A.
B.
C.
D.
E.

70.

Cap en 5' (el extremo 5' del ARN se protege por formacin de un enlace 5'-5' con un nucletido en
posicin invertida)
Corte y poliadenilacin en el extremo 3'
Empalme (unin de exones y eliminacin de intrones, en caso de existir, para obtener un ARN
maduro)
Los incisos A, B y C son ciertos
Los incisos A, B y C son falsos

Se denomina transcrito primario


Se exporta al citoplasma para sntesis de protenas
Se forma en los ribosomas
Contiene timina
Se conoce tambin como ARN de transferencia

En dnde se realiza el proceso de modificacin postranscripcional?


A.
B.
C.
D.
E.

Membrana celular
Citoplasma
Ncleo
Mitocondria
Ribosoma

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
71.

Qu es el cdigo gentico?
A.
B.
C.
D.
E.

72.

Es la sntesis de protena, en la que una secuencia de codones en el ARN mensajero se expresa como una
secuencia de aminocidos:
A.
B.
C.
D.
E.

73.

El orden de los genes en los cromosomas


La secuencia de bases nitrogenadas en el ADN
La correspondencia entre codones en el ARN (o ADN) y aminocidos en una protena determinada
El sistema de herencia propuesto por Mendel
El genoma humano

Replicacin
Iniciacin
Transcripcin
Gnesis
Traduccin

En la etapa de iniciacin del proceso de traduccin en clulas eucariontes, el codn iniciador es AUG, que
codifica para:
A.
B.
C.
D.
E.

Prolina
Metionina
Alanina
Valina
Leucina

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
74.

Complete el mapa conceptual referente a la sntesis de protenas:


1

se realiza la

2
que consiste en estas tres etapas sucesivas:

3
A.
B.
C.
D.
E.

(1) Traduccin / (2) en los ribosomas / (3) terminacin / (4) elongacin / (5) iniciacin
(1) Iniciacin / (2) terminacin / (3) en los ribosomas / (4) elongacin / (5) traduccin
(1) Iniciacin / (2) en los ribosomas / (3) traduccin / (4) elongacin / (5) terminacin
(1) En los ribosomas / (2) traduccin / (3) iniciacin / (4) elongacin / (5) terminacin
(1) Traduccin / (2) en los ribosomas / (3) terminacin / (4) elongacin / (5) iniciacin

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
75.

Cmo se denomina el conjunto de cambios fsicos y qumicos que transforman a una protena recin
sintetizada en una protena biolgicamente activa?
A.
B.
C.
D.
E.

76.

La modificacin postraduccional de las protenas recin sintetizadas puede consistir en:


A.
B.
C.
D.
E.

77.

Sntesis de protenas
Modificacin postranscripcional
Modificacin postraduccional
Iniciacin
Terminacin

Eliminacin de grupo N-formil, metionina y oligopptidos


Acetilacin, fosforilacin, formacin de puentes disulfuro y diversos cambios qumicos
Asociacin con iones o coenzimas
Los incisos A, B y C son ciertos
Los incisos A, B y C son falsos

El plegamiento que por lo general experimentan las protenas recin formadas para adquirir su
conformacin natural, en ocasiones requiere la ayuda de protenas de ensamble llamadas:
A.
B.
C.
D.
E.

Globulares
Fibrosas
Transportadoras
Lipoprotenas
Chaperonas

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
78.

Respecto de las chaperonas, las siguientes aseveraciones son falsas, excepto:


A.
B.
C.
D.
E.

79.

Participan en el plegamiento de las protenas recin formadas


Enlazan a los aminocidos para formar protenas
Requieren el auxilio de ARNt
Son molculas formadas por carbohidratos y lpidos
Se hallan en el ncleo celular

Seale cul debe ser la secuencia para formar un texto verdadero.


1.
2.
3.
4.
5.

La informacin gentica en ARN y protenas


La regulacin de la expresin gentica
De todos los procesos por los cuales
Es el control a travs del tiempo
Una clula convierte

A.
B.
C.
D.
E.

5, 1, 3, 2, 4
1, 3, 2, 4, 5
2, 4, 3, 5, 1
3, 5, 1, 2, 4
4, 2, 3, 5, 1

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
80.

Cul es la funcin de un gen regulador?


A.
B.
C.
D.
E.

81.

Cmo se le llama al gen que codifica para un producto, ya sea ARN o protena, cuya funcin no regula
expresin de genes?
A.
B.
C.
D.
E.

82.

Codificar protenas que no regulan la expresin de genes


Enlazar aminocidos para formar protenas
Degradar protenas
Activar o desactivar la expresin de al menos un gen
Sintetizar protenas

Estructural
Regulador
Dominante
Recesivo
Alelo

En un organismo multicelular, todas las clulas somticas contienen los mismos genes, y por consiguiente la
misma red de regulacin de la expresin gentica. Al proceso por el que una clula puede volverse por
ejemplo una neurona mientras que otra puede convertirse por ejemplo en un eritrocito, se denomina:
A.
B.
C.
D.
E.

Diferenciacin celular
Clonacin
Apoptosis
Ingeniera gentica
Estado de equilibrio

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
83.

Son organismos cuya reproduccin es asexual:


A.
B.
C.
D.
E.

84.

Son organismos cuya reproduccin es exclusivamente asexual:


A.
B.
C.
D.
E.

85.

Procariontes
Muchas plantas
Algunos hongos
Todos los anteriores
Ninguno de los anteriores

Bacterias
Protistas
Hongos
Plantas
Animales

Una caracterstica de todos los procariontes, muchas plantas y diversos hongos que se reproducen
asexualmente, es su:
A.
B.
C.
D.
E.

Amplia diversidad genmica


Nula diversidad genmica
Escasa diversidad genmica
Rpida reproduccin
Dinmica actividad meitica

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
86.

La diversidad genmica en los organismos de reproduccin asexual depende bsicamente de:


A.
B.
C.
D.
E.

87.

Su gran cantidad de genes


Su perfecta adaptacin al medio
Su intercambio de segmentos de ADN
Su dinmica reproduccin mittica
Las mutaciones

Es el conjunto completo de fases a travs de las cuales una clula progresa desde una divisin celular a la
siguiente:
A.
B.
C.
D.
E.

El ciclo celular
La mitosis
La meiosis
La replicacin
La transcripcin

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
88.

Relacione cronolgicamente las columnas de las fases del ciclo celular:


G1

a.

S
b.
G2
c.
M

A.
B.
C.
D.
E.

d.

Cuando la clula ha alcanzado ciertas magnitudes de masa y tamao, entra en una


fase de sntesis de ADN, que dura desde el inicio de la replicacin del ADN hasta que
todo el ADN se ha replicado. Tambin hay transcripcin y traduccin activas, por lo
que la clula contina creciendo. Al final de esta fase, la clula es tetraploide (4n).
El ADN se compacta densamente y estructura cromosomas, luego la clula se divide,
repartiendo equitativamente los cromosomas entre dos clulas hijas (2n).
Virtualmente todas las actividades de sntesis se detienen en esta fase.
La clula (2n) es inicialmente pequea, comienza a transcribir y a traducir genes, y
progresivamente crece, aumentando de masa y tamao.
La clula sigue creciendo y se prepara para dividirse.

G1a, Sb, G2c, Md


G1d, Sa, G2b, Mc
G1c, Sb, G2d, Ma
G1c, Sa, G2d, Mb
G1d, Sb, G2a, Mc

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
89.

Los errores en el ciclo celular pueden resultar en:


A.
B.
C.
D.
E.

90.

Cuando las clulas se multiplican indefinidamente por divisin celular y han perdido la capacidad de
bloquear el ciclo celular, se produce:
A.
B.
C.
D.
E.

91.

Clulas defectuosas
Clulas programadas para morir
Cncer
Las respuestas A, B y C son ciertas
Solamente las respuestas A y C son ciertas

Mitosis
Meiosis
Cncer
Cariocinesis
Un organismo completo

A la muerte celular programada se le conoce como:


A.
B.
C.
D.
E.

Isquemia
Necrosis
Cariocinesis
Fin del ciclo celular
Apoptosis

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
92.

Las siguientes son protenas que regulan la actividad de las enzimas CDK (cinasas dependientes de ciclinas)
y, en conjunto, controlan la progresin a travs de las fases del ciclo celular:
A.
B.
C.
D.
E.

93.

En qu fase del ciclo celular se encuentran las clulas que abandonan el ciclo celular?
A.
B.
C.
D.
E.

94.

Hormonas
Ciclinas
Segundos mensajeros
Receptores de membrana
Integrinas

G0
G1
S
G2
M

Las siguientes clulas permanecen en la fase G0, pues en una determinada etapa de su desarrollo
abandonan definitivamente el ciclo celular y, por consiguiente, ya no se dividen:
A.
B.
C.
D.
E.

Neuronas
Eritrocitos
Celulas musculares
Todas las anteriores
Solamente A y B son correctas

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
95.

Complete el siguiente prrafo para construir un enunciado verdadero:


El mecanismo de control del ciclo celular se ha conservado a travs de la __________________. Es
bsicamente el mismo en todos los __________________, desde las __________________ hasta las
__________________.
A.
B.
C.
D.
E.

96.

historia / casos / nubes / piedras


evolucin / libros de texto / ilustraciones / conclusiones
evolucin / eucariontes / levaduras / clulas humanas
evolucin / procariontes / bacterias / plantas
historia / seres vivos / pocas antiguas / actuales

Las siguientes afirmaciones son caractersticas de la apoptosis, excepto:


A.
B.
C.
D.
E.

Hay necrosis celular


El crecimiento se suprime totalmente
El citoesqueleto se desintegra
El tamao de la clula se reduce
Los cromosomas se compactan y el ADN se fragmenta

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
97.

Complete el siguiente prrafo para construir un enunciado verdadero:


La __________________ permite reciclar el material celular de clulas no utilizadas para diferenciacin o de
clulas defectuosas, y es tambin un mecanismo de defensa contra el cncer.
A.
B.
C.
D.
E.

98.

Evolucin
Replicacin
Transcripcin
Apoptosis
Traduccin

Elija las palabras que completen mejor el enunciado:


__________________ es la proliferacin celular __________________, en la que el ciclo celular ha perdido
la capacidad de bloquearse por estar daado el __________________.
A.
B.
C.
D.
E.

La mitosis / controlada / ADN


El cncer / incontrolada / genoma
La meiosis / de los gametos / genoma
La evolucin / de los seres vivos / proceso de replicacin
La apoptosis / programada / ADN

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
99.

El cncer se produce por ciertas alteraciones en:


A.
B.
C.
D.
E.

El retculo endoplsmico rugoso


El ADN
El complejo de Golgi
Los ribosomas
La membrana celular

100. Cul de los siguientes no es un factor que produzca cncer?


A.
B.
C.
D.
E.

Exposicin a materiales radioactivos


Exposicin a reactivos txicos
Exposicin a humo del tabaco
Ataque por virus oncognicos
Tener contacto con una persona cancerosa

101. Complete el siguiente prrafo para formar un enunciado verdadero:


La proliferacin celular incontrolada produce masas celulares sin funcin fisiolgica denominadas
__________________, cuyas clulas pueden propagarse e invadir tejido normal en otra parte del cuerpo.
A.
B.
C.
D.
E.

Ganglios
Tumores
Ncleos
Tejidos
rganos

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
102. Son genes cuyos productos transforman clulas normales en clulas proliferantes (cancerosas):
A.
B.
C.
D.
E.

Oncogenes
Protooncogenes
Gen p53 y gen Rb
Genes recesivos
Todos los anteriores

103. Relacione correctamente ambas columnas:


a.
1.
2.
3.

Oncogenes
Gen p53
Gen Rb

A.
B.
C.
D.
E.

1a, 2b, 3c
1b, 2c, 3a
1c, 2a, 3b
1a, 2c, 3b
1b, 2a, 3c

b.
c.

Mantiene secuestrado el factor de la transcripcin E2F, y por


consiguiente bloquea el ciclo celular en la fase G1. Su producto
protenico activa genes que suprimen la proliferacin celular.
Sus productos transforman clulas normales en clulas proliferantes.
Participa en el control del ciclo celular. Ante la presencia de daos en
el ADN, bloquea el proceso de divisin celular hasta que la
maquinaria de reparacin sea capaz de corregir los daos y la clula
pueda replicarse sin errores tras desbloquearse el proceso de
divisin.

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
104. La protena p53 tiene estas funciones:
A.
B.
C.
D.
E.

Detecta ADN daado y bloquea el ciclo celular


Activa la reparacin de ADN
Dispara la apoptosis si el ADN daado es irreparable
Las respuestas A, B y C son ciertas
Las respuestas A, B y C son falsas

105. Los siguientes son factores de riesgo en la produccin de cncer:


A.
B.
C.
D.
E.

Virus de la hepatitis B
Virus del papiloma humano
Humo del cigarro
Radiaciones
Todos los anteriores

106. La inestabilidad gentica es un evento clave en el cncer, y las clulas cancerosas son identificables por:
A.
B.
C.
D.
E.

Inmortalizacin (superacin del lmite normal en el nmero de divisiones celulares)


Transformacin (independencia de los factores que normalmente son necesarios para crecer y
sobrevivir)
Metstasis (invasin de tejido en sitios diferentes del de origen)
Las respuestas A, B y C son ciertas
Las respuestas A, B y C son falsas

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
107. En condiciones adecuadas para su supervivencia, las clulas cancerosas se vuelven inmortales, ya que
evitan el acortamiento de los telmeros al activar la enzima:
A.
B.
C.
D.
E.

Topoisomerasa
Helicasa
Lipasa
Amilasa
Telomerasa

108. Complete el siguiente prrafo para formar un enunciado verdadero:


Al llegar a un punto crtico de __________________ de telmeros, las clulas entran en un proceso
llamado __________________ y pierden la capacidad de dividirse.
A.
B.
C.
D.
E.

Acortamiento / senescencia
Sntesis / mitosis
Alargamiento / citocinesis
Maduracin / meiosis
Degradacin / apoptosis

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
109. Elija la palabra que complete correctamente el prrafo:
Durante cada ciclo de divisin celular se produce un acortamiento de los extremos de los cromosomas,
llamados __________________, en el que se pierden de 50 a 200 nucletidos en cada divisin celular. Al
llegar a un punto crtico de acortamiento de telmeros, las clulas entran en un proceso llamado
senescencia celular y pierden la capacidad de dividirse.
A.
B.
C.
D.
E.

Complejos protenicos
Microtbulos
Telmeros
Cromtidas
Centrmeros

110. Ordene cronolgicamente las fases de la mitosis:


1. Anafase, 2. Prometafase, 3. Telofase, 4. Citocinesis, 5. Metafase, 6. Profase
A.
B.
C.
D.
E.

4, 3, 1, 5, 2, 6
6, 2, 5, 1, 3, 4
1, 2, 3, 4, 5, 6
2, 4, 6, 1, 3, 5
3, 1, 5, 2, 6, 4

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
111. Cul de los siguientes enunciados respecto de la mitosis es falso?
A.
B.
C.
D.
E.

La mitosis es la separacin del genoma celular duplicado (p. ej. 4n) en dos conjuntos de
cromosomas idnticos (2n)
La mitosis se realiza nicamente en clulas eucariticas
Al final de la fase G2, la clula ha crecido y ha duplicado sus cromosomas
Las bacterias se reproducen por mitosis
La citocinesis es la divisin de una clula en dos clulas hijas

112. Seale la opcin que no corresponde al conjunto:


A.
B.
C.
D.
E.

Interfase
Profase
Metafase
Anafase
Telofase

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
113. Relacione ambas columnas:
a.

b.
1.
2.
3.
4.
5.
6.

Profase
Prometafase
Metafase
Anafase
Telofase
Citocinesis

c.
d.
e.

f.

A.
B.
C.
D.
E.

1a, 2b, 3c, 4d, 5e, 6f


1e, 2c, 3f, 4a, 5b, 6d
1b, 2c, 3d, 4e, 5f, 6a
1f, 2e, 3c, 4d, 5b, 6a
1c, 2e, 3f, 4b, 5a, 6d

La protena separina libera a la cohesina y las cromtidas hermanas


se separan. Los cinetocoros remolcan a los cromosomas hermanos
(ya no son cromtidas hermanas) hacia centrosomas opuestos.
Se forman nuevas membranas nucleares a partir de fragmentos de
membrana nuclear parental. Los cromosomas se desempacan y los
nucleosomas se extienden parcialmente. Las fibras del huso se
dispersan.
La membrana nuclear se fragmenta. Ciertas protenas se unen a los
centrmeros y forman dos cinetocoros, uno unido a cada cromtida.
La clula se divide en dos clulas hijas, cada una con un ncleo.
Los nucleosomas se compactan densamente y estructuran
cromosomas. Cada cromosoma ya est duplicado, y consiste en dos
cromtidas hermanas unidas por la protena cohesina. Los dos
centrosomas se desplazan hacia polos opuestos de la clula y desde
ah organizan a los microtbulos que forman el huso.
Los cinetocoros y microtbulos del huso alinean a los cromosomas
en la placa metafsica, en el plano medio del ncleo.

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
114. Cul es la fase de divisin celular en que, en clulas animales, un anillo de protena actina contrae a la
membrana celular en el plano medio y divide a la clula en dos clulas hijas, cada una con un ncleo?
A.
B.
C.
D.
E.

Profase
Metafase
Anafase
Telofase
Citocinesis

115. En cul de las siguientes fases los cinetocoros y microtbulos del huso alinean a los cromosomas en la
placa metafsica, en el plano medio del ncleo?
A.
B.
C.
D.
E.

Profase
Prometafase
Metafase
Anafase
Telofase

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
116. En la profase, los nucleosomas se compactan y forman cromosomas. En esta etapa, cada cromosoma ya
est duplicado y consiste en dos cromtidas hermanas unidas. Cmo se llama la protena que las
mantiene adheridas?
A.
B.
C.
D.
E.

Miosina
Cohesina
Actina
Separina
Tubulina

117. Cmo se llama la protena que separa a las cromtidas hermanas en la anafase, para ser remolcadas hacia
los centrmeros opuestos?
A.
B.
C.
D.
E.

Miosina
Cohesina
Actina
Separina
Tubulina

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
118. Lo siguiente es cierto respecto de la telofase:
A.
B.
C.
D.
E.

Se forman nuevas membranas nucleares a partir de fragmentos de la membrana nuclear parental


Los cromosomas se desempacan y los nucleosomas se extienden parcialmente
Las fibras del huso se dispersan
Las respuestas A, B y C son ciertas
Las respuestas A, B y C son falsas

119. Seale cul es la protena que en la citocinesis, en las clulas animales, contrae a la membrana celular en el
plano medio y divide a la clula en dos clulas hijas:
A.
B.
C.
D.
E.

Miosina
Cohesina
Actina
Separina
Tubulina

120. En los vegetales, en cul etapa de la divisin celular se sintetiza una pared que habr de dividir y separar a
las dos clulas hijas?
A.
B.
C.
D.
E.

Profase
Metafase
Anafase
Telofase
Citocinesis

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
121. La produccin de descendientes idnticos a un organismo original, por no haber intercambio de ADN con
otro organismo, se denomina:
A.
B.
C.
D.
E.

Reproduccin asexual
Replicacin
Transcripcin
Traduccin
Sntesis de protenas

122. Los siguientes organismos se multiplican mediante reproduccin asexual, excepto:


A.
B.
C.
D.
E.

Animales
Bacterias
Arqueas
Todos los anteriores
Ninguno de los anteriores

123. Los organismos del reino animal se reproducen mediante:


A.
B.
C.
D.
E.

Fisin binaria
Reproduccin sexual
Gemacin
Esporulacin
Reproduccin vegetativa

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
124. Relacione ambas columnas:
1.
2.
3.
4.

Esporulacin
Reproduccin vegetativa
Gemacin
Fisin binaria (biparticin)

A.
B.
C.
D.
E.

1a, 2b, 3c, 4d


1b, 2c, 3d, 4a
1c, 2d, 3b, 4a
1d, 2a, 3c, 4b
1c, 2d, 3a, 4b

a.
b.
c.
d.

Una clula se divide en dos clulas hijas


Formacin de brotes en la membrana plasmtica
Formacin de esporas
Una parte de la planta es capaz de regenerar una
planta completa

125. Cuando una levadura se va a dividir, en la clula se produce un brote que contiene un ncleo mittico y
una pequea porcin de citoplasma. Tal brote se alimenta de la clula parental, luego crece y cuando
alcanza cierto tamao se separa y se vuelve un organismo independiente. Cmo se denomina este tipo
de reproduccin?
A.
B.
C.
D.
E.

Sexual
Esporulacin
Reproduccin vegetativa
Gemacin
Fisin binaria

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
126. Complete el siguiente prrafo con la palabra correcta:
Reproduccin vegetativa es una forma de reproduccin __________________ en la que una parte de la
planta es capaz de regenerar una planta completa.
A.
B.
C.
D.
E.

Sexual
Desconocida
Hermafrodita
Universal
Asexual

127. A la capacidad de que surja una nueva planta a partir de un estoln en la fresa, de un bulbo en la cebolla,
de un tubrculo en la papa, de rizomas en gramneas y, en general, de una sola clula, un acodo, una
estaca, un esqueje, un tallo y otros fragmentos vegetales, se le conoce como:
A.
B.
C.
D.
E.

Mitosis
Meiosis
Esporulacin
Reproduccin vegetativa
Gemacin

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
128. Cules de los siguientes organismos realizan meiosis?
A.
B.
C.
D.
E.

Bacterias
Arqueas
Procariontes en general
Levaduras
Eucariontes

129. Cuntas clulas resultan al final de la divisin meitica de una clula eucaritica diploide (2n)?
A.
B.
C.
D.
E.

Una
Dos
Tres
Cuatro
Cinco

130. Una caracterstica de la divisin meitica de una clula eucaritica diploide es que las clulas haploides
resultantes:
A.
B.
C.
D.
E.

Han intercambiado segmentos de ADN


Son genticamente idnticas
Siempre suman 2 al final del proceso
Al final, 2 clulas son viables y 2 no lo son
Siempre suman 23 pares al final del proceso

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
131. Cmo se llama el proceso de divisin de una clula eucaritica diploide en cuatro clulas haploides?
A.
B.
C.
D.
E.

Meiosis
Mitosis
Fisin binaria
Gemacin
Esporulacin

132. En una clula especializada en reproduccin, cul es la divisin celular que sigue a las fases G1, S G2?
A.
B.
C.
D.
E.

G3
G0
Mitosis
Meiosis I
Meiosis II

133. En cul fase de la meiosis se realiza la recombinacin de segmentos de ADN?


A.
B.
C.
D.
E.

Profase I
Prometafase I
Metafase I
Anafase I
Telofase I

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
134. Seale la etapa en la que se realiza la recombinacin?
A.
B.
C.
D.
E.

G1
S
G2
Meiosis I
Meiosis II

135. Relacione correctamente ambas columnas:


a.
1.
2.
3.
4.
5.
6.

Profase I
Prometafase I
Metafase I
Anafase I
Telofase I
Citocinesis I

b.
c.
d.
e.

f.
A.
B.
C.
D.
E.

1a, 2b, 3c, 4d, 5e, 6f


1b, 2c, 3d, 4a, 5e, 6f
1c, 2d, 3f, 4a, 5b, 6e
1d, 2b, 3a, 4f, 5e, 6c
1b, 2d, 3f, 4a, 5e, 6c

Los cinetocoros remolcan a los cromosomas homlogos hacia


centrosomas opuestos.
Cada cromosoma se ha replicado, y consiste en dos cromtidas
hermanas. Se presenta el proceso de recombinacin.
La clula se divide en dos.
La membrana nuclear se fragmenta. Los cinetocoros se unen a
microtbulos del huso, y los cromosomas comienzan a alinearse.
Los microtbulos del huso se dispersan y una membrana nuclear
se forma alrededor de cada conjunto haploide. Los cromosomas se
desempacan y los nucleosomas se extienden parcialmente.
Los cromosomas homlogos se alinean en la placa metafsica.

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
136. Elija la palabra que complete correctamente el enunciado:
En la profase I se presenta un fenmeno llamado __________________, que consiste en el intercambio de
segmentos de ADN entre regiones homlogas de dos cromtidas no hermanas por cada par de
cromosomas homlogos.
A.
B.
C.
D.
E.

Meiosis I
Mutacin
Citocinesis
Recombinacin
Trisoma

137. Seale el inciso que da continuidad correcta a la serie:


Profase I
A.
B.
C.
D.
E.

Profase II
Mitosis
Citocinesis I
Meiosis I
Meiosis II

Metafase I

Anafase I

Telofase I

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
138. En la meiosis I se separan:
A.
B.
C.
D.
E.

Los cromosomas homlogos


Las cromtidas hermanas
Los genes paternos
Los genes maternos
Los alelos dominantes

139. Qu es una cromtida?


A.
B.
C.
D.
E.

Una clula haploide


Un organismo del dominio Archaea
Un cromosoma sexual
Una clula en proceso de divisin
Una de las unidades longitudinales de un cromosoma duplicado, unida a su cromtida hermana
por el centrmero

140. Lo siguiente es verdad respecto de una cromtida:


A.
B.
C.
D.
E.

Es una de las unidades longitudinales de un cromosoma duplicado


Est unida a su cromtida hermana por el centrmero
Un par de cromtidas hermanas son genticamente idnticas, ya que se han formado una a partir
de la otra
En la anafase de la mitosis, las cromtidas se separan
Las respuestas A, B, C y D son ciertas

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
141. Relacione correctamente ambas columnas:
a.
1.
2.
3.
4.
5.
6.

Profase II
Prometafase II
Metafase II
Anafase II
Telofase II
Citocinesis II

A.
B.
C.
D.
E.

1a, 2b, 3c, 4d, 5e, 6f


1b, 2c, 3d, 4e, 5f, 6a
1c, 2e, 3a, 4b, 5d, 6f
1d, 2a, 3f, 4e, 5b, 6c
1b, 2e, 3f, 4a, 5d, 6c

b.
c.
d.
e.
f.

Los centrmeros se dividen y los cinetocoros remolcan a las


cromtidas hermanas hacia polos opuestos.
Los cromosomas se compactan.
La clula se divide en dos.
Los microtbulos del huso se dispersan, y una membrana nuclear
se forma alrededor de cada conjunto haploide.
La membrana nuclear se fragmenta.
Las cromtidas se alinean en la placa metafsica.

142. En cul fase de la meiosis II se alinean los cromosomas en el plano ecuatorial?


A.
B.
C.
D.
E.

Profase II
Metafase II
Anafase II
Telofase II
Citocinesis II

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
143. Cul es el resultado final de la meiosis?
A.
B.
C.
D.
E.

Cuatro clulas tetraploides


Cuatro clulas diploides
Cuatro clulas haploides
Cuatro cromosomas diploides
Cuatro cromosomas haploides

144. Cmo estn constituidos los cromosomas haploides?


A.
B.
C.
D.
E.

Por cuatro cromosomas homlogos


Por dos cromosomas homlogos
Por un cromosoma con dos cromtidas hermanas
Por un cromosoma que posee una sola cromtida
Por un cromosoma bivalente

145. En cul de las siguientes etapas los centrmeros se dividen y los cinetocoros remolcan a las cromtidas
hermanas hacia polos opuestos?
A.
B.
C.
D.
E.

Profase II
Prometafase II
Metafase II
Anafase II
Telofase II

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
146. Complete el siguiente prrafo para formar un enunciado verdadero:
La __________________ es el tipo de reproduccin en el que intervienen clulas haploides originadas por
meiosis.
A.
B.
C.
D.
E.

Reproduccin sexual
Mitosis
Reproduccin asexual
Fisin binaria
Gemacin

147. Con cul otro nombre se denomina a las clulas haploides?


A.
B.
C.
D.
E.

Somticas
Gametos
Procariticas
Eucariticas
Indiferenciadas

148. Los vulos son:


A.
B.
C.
D.
E.

Clulas diploides
Clulas procariticas
Clulas somticas
Clulas poliploides
Gametos femeninos

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
149. Los gametos se forman por:
A.
B.
C.
D.
E.

Mitosis
Gemacin
Esporulacin
Meiosis
Fisin binaria

150. Complete el siguiente prrafo para formar un enunciado verdadero:


La gametognesis es el proceso de formacin de gametos por meiosis, a partir de clulas ______________.
A.
B.
C.
D.
E.

Haploides
Germinales
Procariticas
Tetraploides
Somticas

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
151. Complete el siguiente prrafo para formar un enunciado verdadero:
__________________ es el proceso de formacin y diferenciacin de vulos (n), a partir de clulas
germinales (2n).
A.
B.
C.
D.
E.

Ovognesis
Espermatognesis
Meiosis
Gametognesis
Ovulacin

152. Cmo se les llama a las clulas germinales (2n) de los ovarios, que proliferan activamente por mitosis?
A.
B.
C.
D.
E.

vulos
Gametos
Ovogonias
Clulas
Oviductos

153. A qu edad se forman los ovocitos primarios en el ovario de la mujer?


A.
B.
C.
D.
E.

Primeros meses
Cinco aos
Diez aos
Doce aos
Catorce aos

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
154. En dnde se realiza la espermatognesis?
A.
B.
C.
D.
E.

Prstata
Ovarios
Conductos deferentes
Testculos
Vesculas seminales

155. La espermatognesis consiste en el proceso de formacin y diferenciacin de espermatozoides (n), a partir


de clulas germinales (2n). Este proceso inicia en la pubertad y termina:
A.
B.
C.
D.
E.

En la fase conocida como andropausia


A los 40 aos de edad
A los 60 aos de edad
los 80 aos de edad
No declina con la edad

156. Cmo se denomina a las clulas germinales en los testculos?


A.
B.
C.
D.
E.

Espermatogonias
Ovogonias
Espermatocitos
Ovocitos
Espermtidas

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
157. Complete el siguiente prrafo para formar un enunciado verdadero:
Los espermatocitos primarios (4n), mediante la __________________ originan __________________ (2n),
los cuales por __________________ se transforman en espermtidas (n). stas a su vez se diferencian en
__________________.
A.
B.
C.
D.
E.

Mitosis / clulas haploides / meiosis / espermatozoides


Meiosis I / espermatozoides / meiosis II / espermatocitos secundarios
Cariocinesis / ovocitos secundarios / meiosis / ovocitos primarios
Mitosis / espermatozoides / meiosis / espermatocitos secundarios
Meiosis I / espermatocitos secundarios / meiosis II / espermatozoides

158. Ordene cronolgicamente el desarrollo de las clulas sexuales masculinas en el proceso de


espermatognesis:
1.
2.
3.
4.
5.

Espermatozoides (n)
Espermatocitos primarios (4n)
Espermatogonias (2n)
Espermtidas (n)
Espermatocitos secundarios (2n)

A.
B.
C.
D.
E.

1, 2, 3, 4, 5
5, 4, 3, 2, 1
5, 3, 2, 1, 4
3, 2, 5, 4, 1
2, 5, 4, 1, 3

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
159. A la fusin de un vulo (n) y un espermatozoide (n) para formar un cigoto (2n) se le llama:
A.
B.
C.
D.
E.

Ovognesis
Espermatognesis
Embriognesis
Fecundacin
Meiosis

160. Cuando la cabeza de un espermatozoide se une a la matriz extracelular de un ovocito secundario,


denominada zona pelcida, en el espermatozoide ocurre un proceso en el que se liberan enzimas
contenidas en la vescula acrosmica, facilitando la penetracin por la zona pelcida hasta lograr que la
cabeza del espermatozoide se una a la membrana plasmtica del ovocito. Cmo se denomina este
proceso?
A.
B.
C.
D.
E.

Fecundacin
Fertilizacin
Ovulacin
Espermatognesis
Reaccin acrosmica

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
161. Cmo se le llama a la matriz extracelular del ovocito secundario a la que se une la cabeza del
espermatozoide en el proceso de fecundacin?
A.
B.
C.
D.
E.

Zona pelcida
Membrana plasmtica
Citoplasma
Proncleo del ovocito
Pared celular

162. Los organismos cuya reproduccin es sexual, tienen la siguiente caracterstica:


A.
B.
C.
D.
E.

Dependen de un solo progenitor


Poseen gran diversidad genmica
Son en conjunto altamente vulnerables a las condiciones ambientales adversas
La semejanza genmica entre ellos es total
Tienen poca diversidad genmica

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
163. Postul la teora cromosmica de la herencia:
A.
B.
C.
D.
E.

Gregor Mendel
Thomas Hunt Morgan
Charles Darwin
James Watson, con la colaboracin de Francis Crick
Hugo de Vries

164. Los genes son:


A.
B.
C.
D.
E.

Segmentos de ADN
Fragmentos de ARN
Protenas
Carbohidratos
Lpidos

165. Descubri patrones de herencia gentica por anlisis estadstico de caracteres trasmitidos a la progenie:
A.
B.
C.
D.
E.

Theodore Schwann
Gregor Mendel
Thomas Hunt Morgan
Robert Hooke
Charles Darwin

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
166. Relacione el autor con su aportacin a la biologa:
AUTOR
1.
2.
3.
4.

Thomas Hunt Morgan


Gregor Mendel
James Watson y Francis Crick
Barbara McClintock

A.
B.
C.
D.
E.

1a, 2b, 3c, 4d


1b, 2c, 3a, 4d
1a, 2c, 3d, 4b
1b, 2d, 3a, 4c
1d, 2b, 3a, 4c

APORTACIN
a.
b.
c.
d.

Estructura del ADN


Teora cromosmica de la herencia
Patrones de herencia gentica
Transposicin gentica

167. Los principios de la gentica mendeliana se aplican en los siguientes organismos:


A.
B.
C.
D.
E.

Virus
Bacterias
Arqueas
Procariontes
Eucariontes

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
168. Mendel llam caracteres dominantes a los rasgos plenamente trasmitidos a toda la progenie de hbridos, y
simboliz cada uno de ellos con:
A.
B.
C.
D.
E.

Los trminos gnero y especie


Una letra mayscula
El nombre de gen
Una letra minscula
El nombre de ADN

169. Seleccione el par de palabras que exprese mejor una relacin semejante a la expresada aqu:
CLULA / TEJIDO.
A.
B.
C.
D.
E.

Mendel / herencia
Energa / mitocondria
Gen / ADN
Ncleo / cromosomas
ARN / ribosoma

170. Seale la opcin que no corresponde al conjunto:


A.
B.
C.
D.
E.

Gen
ADN
Alelo
Cromosoma
Mitocondria

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
171. En gentica, a los organismos de raza pura tambin se les conoce como:
A.
B.
C.
D.
E.

Alelos
Genes
Genotipo
Fenotipo
Homocigotos

172. Seale la secuencia para formar un texto breve verdadero:


1.
2.
3.
4.
5.
6.

y por anlisis estadstico de caracteres trasmitidos a la progenie,


denominados actualmente principios de herencia mendeliana.
principalmente con Pisum sativum (chcharo),
descubri patrones de herencia
Mendel realiz experimentos de hibridacin con leguminosas selectas,
como color y textura de semillas y vainas, longitud de tallo y caractersticas florales,

A.
B.
C.
D.
E.

1, 3, 5, 6, 4, 2
1, 4, 5, 2, 3, 6
5, 4, 2, 1, 3, 6
2, 4, 1, 6, 5, 3
5, 3, 1, 6, 4, 2

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
173. Lo siguiente es cierto respecto de los caracteres recesivos:
A.
B.
C.
D.
E.

Nunca se manifiestan, pero permanecen ocultos


Se manifiestan nicamente cuando estn acompaados de un gen dominante
Se manifiestan slo en ausencia del alelo dominante
Se representan con una letra mayscula
Se manifiestan aun cuando slo estn presentes en uno de los dos alelos

174. Seale la opcin que ordene las siguientes palabras en una frase verdadera:
(1) ADN / (2) secuencia / (3) cambios / (4) en / (5) mutaciones / (6) las / (7) del / (8) son / (9) la
A.
B.
C.
D.
E.

6, 3, 8, 2, 9, 3, 4, 1, 5
4, 1, 6, 5, 7, 3, 8, 2, 9
6, 5, 8, 1, 4, 3, 2, 7, 9
9, 2, 7, 1, 4, 5, 8, 3, 6
6, 5, 8, 3, 4, 9, 2, 7, 1

175. A las versiones diferentes de un mismo gen se les denomina:


A.
B.
C.
D.
E.

Clulas
Caracteres
Alelos
Cigotos
Fenotipos

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
176. Un individuo con genotipo AA se conoce como:
A.
B.
C.
D.
E.

Homocigoto dominante
Homocigoto recesivo
Dihbrido
Heterocigoto
Haploide

177. Los caracteres dominantes:


A.
B.
C.
D.
E.

Se expresan nica y exclusivamente en individuos homocigotos dominantes


Se manifiestan slo en sujetos homocigotos recesivos
Nunca se expresan
Por lo regular no se presentan
Se ven siempre en individuos heterocigotos

178. El fenotipo es:


A.
B.
C.
D.
E.

Un cromosoma
Una base nitrogenada
La manifestacin del genotipo
Un nucletido
Una clula

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
179. Los caracteres recesivos se manifiestan fenotpicamente cuando el genotipo es de la siguiente forma:
A.
B.
C.
D.
E.

AA
Aa
aa
AABB
AaBa

180. Cuando se afirma que un individuo es homocigoto recesivo se est haciendo referencia a:
A.
B.
C.
D.
E.

Carcter dominante del individuo


Fenotipo
Carcter recesivo del individuo
Genotipo
Los incisos C y D son correctos

181. El principio 1 (de la uniformidad de hbridos en F1) o primera ley de Mendel establece que al cruzar dos
variedades de plantas de raza pura (AA x aa) para un determinado carcter, todos los hbridos de la
primera generacin son iguales. A cul de los siguientes ejemplos corresponde?
A.
B.
C.
D.
E.

100 % AA
100 % Aa
50 % AA; 50 % Aa
50 % AA; 50 % aa
100 % aa

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
182. El siguiente esquema muestra el cuadrado de Punnett para representar la cruza de plantas de raza pura
dominantes (AA) con otras de raza pura recesivas (aa), realizada por Mendel en el primer experimento de
hibridacin. Seleccione la opcin faltante.

A.
B.
C.
D.
E.

Aa

Aa

Aa

a
A
aa
Aa
AA

183. Si uno de los progenitores posee un genotipo AA, que corresponde al fenotipo de pelo castao, y el otro
progenitor tiene un genotipo aa, que corresponde al fenotipo de pelo rubio, qu color de pelo tendrn
los individuos de la F1?
A.
B.
C.
D.
E.

Rubio
Castao
Entre rubio y castao
Pelirrojo
Negro

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
184. Roberto tiene los ojos azules y su esposa tambin; todos los hijos del matrimonio tienen los ojos azules.
Aos ms tarde, Robertito se casa con una joven que tiene los ojos negros, y todos sus hijos tienen los
ojos negros. Si asumimos que estos dos colores de ojos son determinados por un par de genes alelos,
cul de los colores est regulado por un gen dominante y cul por un gen recesivo?
A.
B.
C.
D.
E.

Azul dominante y negro dominante


Azul dominante y negro recesivo
Azul recesivo y negro recesivo
Azul recesivo y negro dominante
Azul y negro codominantes

185. Un progenitor tiene ojos color marrn y genotipo AA; su pareja tiene ojos de color azul y genotipo aa.
Qu porcentaje de los hijos tendr ojos azules?
A.
B.
C.
D.
E.

0%
25 %
50 %
75 %
100 %

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
186. El hecho de que los ojos de un individuo sean semejantes a los de su madre se debe a:
A.
B.
C.
D.
E.

La gentica
La evolucin
La taxonoma
La ecologa
Una mutacin

187. De acuerdo con la gentica mendeliana, la cruza de F1 x F1 (Aa x Aa) da como resultado individuos que se
conocen como segunda generacin filial o F2. Estadsticamente, de cada cuatro plantas, tres son de semilla
amarilla (AA + 2 Aa) y una de semilla verde (aa); por consiguiente, la relacin fenotpica es de 3:1. A qu
patrn de herencia fundamenta este hecho?
A.
B.
C.
D.
E.

Principio 1 (o primera ley) de Mendel


Principio 2 (o segunda ley) de Mendel
Principio 3 (o tercera ley) de Mendel
Dominancia incompleta
Codominancia

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
188. Complete la siguiente afirmacin: Si las dos versiones de un gen son diferentes, se les refiere como dos
alelos (Aa), y el organismo es _______________ o hbrido para ese carcter.
A.
B.
C.
D.
E.

Homocigoto
Dominante
Recesivo
Heterocigoto
Codominante

189. Mendel encontr que los chcharos hbridos (Aa) tenan semillas de color amarillo. Esto significa que:
A.
B.
C.
D.
E.

El genotipo est representado por Aa


El genotipo se refiere al color de las semillas
El fenotipo se representa con las letras Aa
El fenotipo se refiere al color de las semillas
A y D son los incisos correctos

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
190. Al cruzar dos plantas de chcharos, una de tallo largo y otra de tallo corto, se obtuvo una F2 con los
siguientes fenotipos: 3/4 tallo largo y 1/4 tallo corto. El carcter dominante es el tallo largo. Cul es el
genotipo de los progenitores (P1) Cul es el genotipo de F1 y F2?
A.
B.
C.
D.
E.

P1: AA x aa; F1: 100 % Aa; F2: 25 % AA, 50 % Aa, 25 % aa


P1: AA x Aa; F1: Aa x Aa; F2; 75 % Aa, 25 % aa
P1: Aa x Aa; F1: 25 % AA, 50 % Aa, 25 % aa; F2: 50 % AA, 50 % aa
P1: Aa x aa; F1: 75 % Aa, 25 % aa; F2: 25 % AA, 50 % Aa, 25 % aa
P1: AA x aa; F1: 100 % Aa; F2: 50 % AA, 50 % aa

191. El siguiente esquema muestra el cuadrado de Punnet para representar la autofecundacin de plantas F1
(Aa), con base en el principio 2 (segunda ley) de Mendel. Seleccione la opcin faltante.

A.
B.
C.
D.
E.

A
a
aa
Aa
AA

AA

Aa

Aa

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
192. Varios gatos negros con el mismo genotipo son apareados y producen 27 descendientes negros y 9
blancos. Su prediccin en cuanto a los genotipos de los padres sera:
A.
B.
C.
D.
E.

AA x Aa
aa x Aa
Aa x Aa
aa x aa
AA x AA

193. Se desea saber si una planta de chcharos de semillas amarillas es homocigota (AA) o heterocigota (Aa).
Qu cruza habr que realizar para averiguarlo?
A.
B.
C.
D.
E.

AA
Aa
aa
BB
Bb

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
194. El color negro de la piel de una especie de ratn depende del alelo dominante (A), y el color blanco de su
alelo recesivo (a). Si una hembra de color negro tiene 50 % de descendientes con piel blanca, cul es el
genotipo de la hembra? Cul es el genotipo y el fenotipo del macho que se cruz con ella?
A.
B.
C.
D.
E.

Hembra AA negra; macho AA negro


Hembra AA negra; macho aa blanco
Hembra Aa negra; macho Aa negro
Hembra Aa negra; macho aa blanco
Hembra Aa negra; macho AA negro

195. Cul ser el genotipo de un cobayo que al cruzarse con uno de color blanco produjo 50 % de cobayos
negros y 50 % de cobayos blancos?
A.
B.
C.
D.
E.

AA x AA
Aa x aa
Aa x Aa
aa x aa
AA x aa

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
196. En el ganado vacuno, la ausencia de cuernos (A) es dominante sobre la presencia de cuernos (a). Un toro
(T) sin cuernos se cruz con dos vacas: con la vaca 1 (V1), que tena cuernos, tuvo un ternero sin cuernos;
y con la vaca 2 (V2), que no tena cuernos, tuvo un ternero con cuernos. Cules son los genotipos del
toro y de las vacas 1 y 2?
A.
B.
C.
D.
E.

T: Aa; V1: aa; V2: Aa


T: AA; V1: Aa; V2: Aa
T: aa; V1: aa; V2: Aa
T: Aa; V1: AA; V2: Aa
T: AA; V1: aa; V2: Aa

197. Al realizarse autofecundacin de plantas F1 (AaBb), lo que equivale a una cruza F1 x F1, se obtiene en F2
la relacin 9:3:3:1. Este patrn de herencia es el fundamento de:
A.
B.
C.
D.
E.

Teora de la evolucin
Principio 3 (tercera ley) de Mendel o de la distribucin independiente de los alelos
Teora de la biognesis
Primera ley de Newton
Teora celular

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
198. El siguiente esquema muestra el cuadrado de Punnett para representar el patrn de herencia de dos
caracteres, correspondiente a la autofecundacin de plantas F1 (AaBb), equivalente a cruzar F1 x F1.
Seleccione las opciones faltantes (1, 2, 3, 4).

AB

A.
B.
C.
D.
E.

AB

Ab

ab

aB

AABb

AaBb

AaBB

Ab

AABb

Aabb

AaBb

ab

AaBb

Aabb

aaBb

aB

AaBB

AaBb

aaBb

1 = AABB, 2 = AABb, 3 = aaBb, 4 = aaBB


1 = aaBB, 2 = aabb, 3 = AAbb, 4 = AABB
1 = AABB, 2 = AAbb, 3 = aabb, 4 = aaBB
1 = aabb, 2 = AAbb, 3 = aabb, 4 = aaBB
1 = AABb, 2 =AABb, 3 = aaBB, 4 = aabb

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
199. La investigacin en el campo de la gentica fue descubriendo progresivamente patrones de herencia
diferentes de aquellos formulados por Mendel, como dominancia incompleta, codominancia, alelos
mltiples, herencia polignica y herencia ligada al sexo, los cuales se clasifican en conjunto como
herencia no mendeliana. Por lo anterior, se puede establecer que la ______________ no mendeliana es la
______________ de ______________ hereditarios a la progenia, que no sigue los principios de la
herencia ____________________________.
A.
B.
C.
D.
E.

Gentica / ciencia / los genes / actual


Biologa / disciplina / conocimientos / cientfica
Dominancia / trasmisin / caracteres / postulada por Thomas Hunt Morgan
Herencia / trasmisin / caracteres / mendeliana
Teora / explicacin / cromosomas / mendeliana

200. La expresin de un carcter en un heterocigoto puede ser intermedia entre ______________ y recesivo.
En el rosal, por ejemplo, tanto las flores rojas como las flores blancas muestran dominancia
______________. Un rosal hbrido produce flores rosas, que es el color ______________.
A.
B.
C.
D.
E.

Codominante / completa / ms comn


Alelo / incompleta / menos esperado
Dominante / incompleta / intermedio
Un gen simple / total / intermedio
Homocigoto / imperceptible / normal

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
201. En un organismo heterocigoto, ambos alelos pueden expresarse plenamente sin mezclarse. En la cruza,
por ejemplo, de un toro caf rojizo de raza pura con una vaca blanca de raza pura, hay ______________
porque ambos ______________ se expresan sin mezclarse. En F1, la _____________ es 100 % de pelaje
manchado.
A.
B.
C.
D.
E.

Herencia ligada al sexo / alelos / vaca


Codominancia / caracteres / progenie
Herencia polignica / descendientes / diferencia
Alelos mltiples / alelos / mezcla
Dominancia incompleta / progenitores / vaca

202. Un organismo ______________ es portador de dos alelos de un solo gen (o de un solo alelo si ambas
versiones del gen son iguales en los dos ______________ homlogos), pero en la poblacin de ese
organismo puede haber alelos mltiples, es decir, ms de dos alelos de ese ______________. En la
poblacin humana hay por ejemplo tres alelos (A, B y O) de un gen, cuya combinacin determina cuatro
diferentes grupos sanguneos (A, B, AB y O).
Entre los ______________ A y B hay codominancia, y ambos son dominantes sobre O.
A.
B.
C.
D.
E.

Haploide / cromosomas / cromosoma / cromosomas


Hetertrofo / genes / carcter / alelos
Pluricelular / genes / carcter / cromosomas
Diploide / cromosomas / gen / alelos
Triploide / cromosomas / gen / cromosomas

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
203. La herencia ligada al sexo ocurre en organismos en los que uno de los gneros contiene un par de
______________ desiguales (X y Y), que participan en la reproduccin ______________. Herencia ligada
al sexo se refiere a la expresin de genes en el cromosoma X, por no haber otra versin de esos mismos
genes en el cromosoma Y, y viceversa. En la mosca Drosophila melanogaster, por ejemplo, el
______________ w que determina el color de ojos est en el cromosoma X, y ese carcter fenotpico es
recesivo. Todos los machos (XY) portadores de ese ______________ son de ojos blancos.
A.
B.
C.
D.
E.

Cromosomas / sexual / alelo / gen


Alelos / sexual / cromosoma / gen
Caracteres / asexual / alelo / gen
Clulas / diploide / gen / cromosoma
Cromosomas / sexual / cromosoma / gen

204. Diversos rasgos ______________ de un organismo como estatura, peso, color de ojos, pigmentacin de la
piel, capacidad intelectual y muchsimos otros, son el resultado de herencia polignica, o sea, de la
expresin selectiva de diversos ______________, por haber alcanzado a nivel celular diferentes estados
de equilibrio en redes de regulacin ______________ tan extensas como el genoma. Cada clula
contribuye a los rasgos fenotpicos del organismo.
A.
B.
C.
D.
E.

Genotpicos / genes / gentica


Fenotpicos / genes / gentica
Fenotpicos / organismos / celular
Genotpicos / organismos / desconocida
Especiales / genes / hormonal

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
205. Los siguientes son ejemplos de herencia gentica no mendeliana, excepto:
A.
B.
C.
D.
E.

AA x aa = 100 % Aa
Rosal de flores blancas por rosal de flores rojas = rosal de flores rosas
Toro caf de raza pura x vaca blanca de raza pura = progenie de pelaje manchado
Madre AO (grupo sanguneo) x padre BO = hijo AB
Herencia ligada al sexo

206. Diferentes rasgos fenotpicos como la estatura y la capacidad intelectual son el resultado de la expresin
selectiva de diversos genes, por haber sido alcanzado a nivel celular diferentes estados de equilibrio en
redes de regulacin gentica tan extensas como el genoma. A este tipo de herencia se le llama:
A.
B.
C.
D.
E.

Herencia polignica
Herencia ligada al sexo
Herencia por alelos mltiples
Codominancia
Dominancia incompleta

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
207. La cruza de un rosal de flores rojas con otro de flores blancas da como resultado un hbrido de flores rosas.
A este tipo de herencia se le llama:
A.
B.
C.
D.
E.

Herencia polignica
Herencia ligada al sexo
Herencia por alelos mltiples
Codominancia
Dominancia incompleta

208. El tipo de herencia no mendeliana llamado dominancia incompleta se presenta, por ejemplo, cuando se
realiza la cruza de un rosal de flores rojas con otro de flores blancas. Cul ser el fenotipo del hbrido
resultante de esta cruza?
A.
B.
C.
D.
E.

Flores rojas
Flores blancas
Flores rosas
Flores rayadas
Flores manchadas

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
209. En los casos de codominancia, en un individuo heterocigoto ambos alelos se pueden expresar
plenamente sin mezclarse. Cul ser el fenotipo resultante de la cruza de un toro caf de raza pura con
una vaca blanca de raza pura?
A.
B.
C.
D.
E.

Pelaje caf
Pelaje blanco
Pelaje negro
Pelaje manchado
Pelaje color caf con leche

210. En el tipo de herencia gentica por alelos mltiples, un organismo diploide es portador de dos alelos de
un solo gen (o de un solo alelo si ambas versiones del gen son iguales en los dos cromosomas
homlogos), pero en la poblacin de ese organismo puede haber alelos mltiples, es decir, ms de dos
alelos de ese gen. Es el caso de los grupos sanguneos humano. Cul ser el grupo sanguneo de un hijo,
si el genotipo del padre es AA y el de la madre es BB?
A.
B.
C.
D.
E.

O
A
B
AB
Ninguno de los anteriores

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
211. Se cruzaron dos plantas, una de color desconocido con otra de flores blancas. La mitad de las plantas hijas
(F1) producen flores blancas y la otra mitad flores rosas. De qu color son las flores de la planta paterna
no identificada?
A.
B.
C.
D.
E.

Blancas
Rosas
Rojas
Amarillas
Verdes

212. Como resultado de la cruza de dos plantas se obtuvo 1/4 de plantas con flores blancas, 2/4 con flores
rosas y 1/4 con flores rojas. Cul es el genotipo y cul el fenotipo de las plantas que les dieron origen?
A.
B.
C.
D.
E.

Aa x Aa: 100 % rosas


AA x aa: 50 % rojas y 50 % blancas
AA x Aa: 50 % rojas y 50 % rosas
Aa x aa: 50 % rosas y 50 % blancas
aa x aa: 100 % blancas

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
213. Un hombre del grupo sanguneo A se casa con una mujer del grupo sanguneo B y tienen un hijo del
grupo sanguneo O. El genotipo de los padres es:
A.
B.
C.
D.
E.

AO x BO
AA x BB
OO x AB
AB x BO
AO x BB

214. Si mediante transferencia de ncleos procedentes de clulas de un mismo individuo se obtuvieran dos
individuos clnicos, cmo seran el genotipo y el fenotipo de uno respecto de los del otro?
A.
B.
C.
D.
E.

Tendran el mismo fenotipo, pero diferente genotipo


Poseeran el mismo genotipo, pero diferente fenotipo
Tendran el mismo genotipo y el mismo fenotipo
Seran diferentes tanto su genotipo como su fenotipo
Existe la posibilidad de que fueran ciertos A, B, C y D

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
215. Ordene cronolgicamente:
1.
2.
3.
4.
5.

Wilhelm Johannsen denomin genes a las unidades hereditarias


Gregor Mendel descubri patrones de herencia gentica por anlisis estadstico
Thomas Hunt Morgan postul la teora cromosmica
Watson y Crick descubrieron la estructura del ADN
William Bateson acu el trmino gentica

A.
B.
C.
D.
E.

1, 3, 5, 2, 4
2, 5, 1, 3, 4
4, 2, 5, 1, 3
2, 3, 4, 1, 5
5, 4, 3, 1, 2

216. El siguiente inciso es falso respecto de la teora cromosmica, portulada por Morgan:
A.
B.
C.
D.
E.

Los genes estn en los cromosomas


Descubri la estructura del ADN
El orden de los genes en los cromosomas es lineal
Hay recombinacin gentica por intercambio de segmentos de cromosomas
Experiment con la mosca Drosophila melanogaster

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
217. Los heterocromosomas son:
A.
B.
C.
D.
E.

Cromosomas homlogos
Autosomas
Cromosomas sexuales
Cromosomas diploides
Cromosomas mutados

218. En los humanos, los cromosomas sexuales que identifican a un individuo masculino son:
A.
B.
C.
D.
E.

XY
XX
YY
XXY
XYY

219. El sitio especfico del cromosoma en donde se encuentra un gen se denomina:


A.
B.
C.
D.
E.

Ncleo
Mitocondria
Locus
Alelo
ADN

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
220. Seale la opcin que ordene las siguientes palabras en una frase verdadera:
(1) lineal / (2) los / (3) genes / (4) orden / (5) el / (6) de / (7) es
A.
B.
C.
D.
E.

5, 3, 2, 3, 4, 1, 7
2, 3, 7, 5, 4, 6, 1
4, 1, 6, 2, 3, 5, 7
5, 4, 6, 2, 3, 7, 1
6, 5, 3, 4, 2, 7, 1

221. Despus de haber determinado que los genes estn en los cromosomas y que el orden de los genes en
los cromosomas es lineal, Morgan descubri que hay recombinacin gentica en la meiosis por
intercambio de segmentos de cromosomas, lo que tambin se denomina ______________.
A.
B.
C.
D.
E.

Transcripcin
Mutacin
Descomposicin
Traduccin
Entrecruzamiento

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
222. Los alelos causantes de hemofilia y daltonismo estn en el cromosoma X, y se trasmiten a los
descendientes por el patrn de:
A.
B.
C.
D.
E.

Herencia polignica
Herencia ligada al sexo
Herencia por alelos mltiples
Codominancia
Dominancia incompleta

223. La hemofilia A es una enfermedad hemorrgica causada por un alelo defectuoso h del gen que codifica
para el factor VIII de coagulacin de la sangre. Todos los hombres portadores del alelo h desarrollan
hemofilia. Por estar el alelo h en el cromosoma X:
A.
B.
C.
D.
E.

Lo heredan a todos sus hijos varones


Lo heredan a 50 % de hijos y 50 % de hijas
No lo heredan a ningn hijo, pero s a todas sus hijas
No se hereda, pues es un gen recesivo
Lo heredan a todos los hijos y a todas las hijas

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
224. Al cambio espontneo o inducido en la secuencia del ADN se le llama:
A.
B.
C.
D.
E.

Mutacin
Transcripcin
Seleccin
Sntesis de protenas
Traduccin

225. A la sustitucin de una base por otra en la secuencia de nucletidos del ADN se le llama:
A.
B.
C.
D.
E.

Mutacin puntual
Insercin
Prdida
Alteracin de secuencias
Transcripcin

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
226. A qu tipo de mutacin corresponde el siguiente cambio en la secuencia de ADN?
AGCTACGTCACG
TCGATGCAGTGC
A.
B.
C.
D.
E.

AGCTACGTAACG
TCGATGCATTGC

Insercin
Prdida
Sustitucin
Rearreglo de secuencias
Cambio total de genoma

227. Un medio muy frecuente por el que una secuencia de ADN puede cambiar de manera drstica, son las
______________ de segmentos de ADN, como en el siguiente cambio en la secuencia:
AGCTACGTCACG
TCGATGCAGTGC
A.
B.
C.
D.
E.

Prdidas
Inserciones
Translocaciones
Transposiciones
Reparaciones

AGCTACATTTCGGATGGTTGCGGCATGGTCACG
TCGATGTAAAGCCTACCAACGCCGTACCAGTGC

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
228. Una mutacin puede consistir en prdida o ______________ de un segmento de ADN, por ejemplo:
AGCTACATTTCGGATGGTTGCGGCATGTCACG
TCGATGTAAAGCCTACCAACGCCGTACAGTGC
A.
B.
C.
D.
E.

AGCTACGTCACG
TCGATGCAGTGC

Conversin
Insercin
Translocacin
Aumento
Delecin

229. Morgan experiment con cruzas de Drosophila melanogaster y supuso que si varios genes estaban en
un mismo cromosoma, tendran que heredarse juntos, como genes ligados, y estadsticamente
determin que el orden de los genes en los cromosomas es:
A.
B.
C.
D.
E.

Variable
Aleatorio
Lineal
Universal
Incomprensible

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
230. Cmo se denomina una molcula de ADN cuya secuencia proviene de dos o ms fuentes?
A.
B.
C.
D.
E.

Clonacin
ADN recombinante
Protena
ADN mitocondrial
Cdigo gentico

231. Mediante la tecnologa del ADN recombinante ha sido posible:


A.
B.
C.
D.
E.

Aislar genes especficos


Cortar ADN en regiones predeterminadas
Hacer mutaciones en sitios especficos
Insertar en el genoma de un organismo fragmentos de ADN de otra especie
Las opciones A, B, C y D son ciertas

232. Con la gentica como plataforma, el desarrollo de la tecnologa del ADN recombinante dio origen a dos
campos cientficos, que son:
A.
B.
C.
D.
E.

Ingeniera gentica y genmica


Gentica y evolucin
Evolucin y clonacin
Genmica y embriologa
Paleontologa y evolucin

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
233. Es la coleccin de metodologas aplicadas a la manipulacin de genes:
A.
B.
C.
D.
E.

Embriologa
Antropologa
Evolucin
Ingeniera gentica
Biogeografa

234. La introduccin de un rasgo novedoso en un organismo (p. ej. la insercin del gen humano de la insulina
en el genoma de la bacteria Escherichia coli) es un ejemplo de:
A.
B.
C.
D.
E.

Genmica
Regeneracin
Evolucin
Reproduccin asexual
Ingeniera gentica

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
235. Ordene las siguientes etapas en un procedimiento normal de la ingeniera gentica:
1.
2.
3.

Manipulacin del gen para hacer alguna modificacin


Aislamiento del gen
Introduccin del gen modificado en algn organismo

A.
B.
C.
D.
E.

1, 2, 3
2, 3, 1
3, 1, 2
2, 1, 3
3, 1, 2

236. Complete el siguiente prrafo y forme un enunciado verdadero:


La comparacin de __________________ de diferentes especies nos revela su historia evolutiva.
La genmica comparada est resolviendo el origen y la evolucin de las especies. La identidad que
comparten los genomas entre s est en funcin de su ________________________, y esta informacin
permite ubicar con precisin a cada especie en el rbol filogentico.
A.
B.
C.
D.
E.

Mutaciones / cercana evolutiva


Genomas / dominio
Genomas / cercana evolutiva
La forma de respiracin / tipo celular
Organismos / tipo de reproduccin

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
237. Complete el siguiente mapa conceptual:
El ADN recombinante
La ingeniera gentica

dio origen a

que es

que es

El estudio de genomas

Por ejemplo

Por ejemplo

La insercin del gen humano de la insulina


en el genoma de la bacteria Escherichia coli

A.
B.
C.
D.
E.

1: La genmica / 2: La coleccin de metodologas aplicadas a la manipulacin de genes / 3: La


comparacin de genomas de especies diferentes
1: La gentica / 2: El estudio de sndromes genticos / 3: La clonacin
1: El estudio de genomas / 2: La identificacin de genomas de especies diferentes / 3: La genmica
1: Proyecto del Genoma Humano / 2: La secuenciacin de genomas / 3: La genmica
1: La genmica / 2: La comparacin de genomas de especies diferentes / 3: La coleccin de
metodologas aplicadas a la manipulacin de genes

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
238. El uso de organismos vivos o sus derivados en la elaboracin o modificacin de procesos o productos se
denomina:
A.
B.
C.
D.
E.

Biotecnologa
Domesticacin
Agricultura
Ganadera
Apicultura

239. Los siguientes son procesos de biotecnologa, excepto:


A.
B.
C.
D.
E.

Elaboracin de pan, cerveza y vino


Sntesis de insulina por medio de bacterias
Elaboracin de vacunas mediante el uso de frutas
Desarrollo de ganado transgnico
Obtencin del azcar de caa

240. Cul de los siguientes es un ejemplo de lo que ha logrado la biotecnologa en la industria?


A.
B.
C.
D.
E.

Vacunas y frmacos en alimentos


Pruebas de deteccin de virus en la sangre
Cultivos resistentes a insecticidas
Microbios degradadores de reactivos contaminantes del suelo
Las opciones A, B, C y D son ciertas

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
241. La modificacin gentica de una planta es un ejemplo de:
A.
B.
C.
D.
E.

Aplicacin de las leyes de Mendel


Biotecnologa en la agricultura
Evolucin por seleccin natural
Reproduccin asexual
La forma en que se reproducen los organismos unicelulares

242. En el arroz dorado, las plantas han sido modificadas por insercin de dos genes que tienen por efecto
final la produccin y acumulacin del beta-caroteno en los granos. El proceso mediante el cual se
consigue esto se llama:
A.
B.
C.
D.
E.

Pigmentacin
Gentica no mendeliana
Agricultura
Ecologa
Ingeniera gentica

243. La cruza selectiva, el congelamiento de esperma y de embriones, la inseminacin artificial y la creacin de


madres sustitutas son prcticas comerciales rutinarias efectuadas en mamferos que han permitido a los
ganaderos criar -y literalmente crear- especmenes de alta calidad y productividad. Estas actividades son
ejemplos de:
A.
B.
C.
D.
E.

Tecnologa de alimentos
Evolucin por seleccin natural
Biotecnologa en la ganadera
Gentica mendeliana
Biotecnologa en la agricultura

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
244. Complete el siguiente prrafo para formar un enunciado verdadero:
Los animales transgnicos se producen por inyeccin de ADN con una microjeringa en clulas de
embriones. Por lo general se utilizan ___________________ recin fertilizados, antes de la primera divisin
celular. Las clulas pueden obtenerse por procedimientos de fertilizacin in vitro. Si el ADN inyectado se
integra en el genoma del embrin en estado de una clula, todas las clulas del animal desarrollado
estarn genticamente modificadas.
A.
B.
C.
D.
E.

Espermatozoides
Animales
Organismos procariticos
Genes
Ovocitos

245. Es una tcnica experimental para reparar genes defectuosos causantes de enfermedades:
A.
B.
C.
D.
E.

Antibioticoterapia
Ciruga
Terapia gnica
Cariotipo
Genoma humano

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
246. Cmo se denomina el estudio sistemtico de la conducta humana, respecto de valores y principios
morales en la biologa?
A.
B.
C.
D.
E.

Biotica
Esttica
Semntica
Moralidad
Religin

247. Qu es la biotica?
A.
B.
C.
D.
E.

El estudio sistemtico de la conducta humana, respecto de valores y principios morales en la


biologa
El seguimiento de las leyes civiles
La tica aplicada a las ciencias
El estudio de los seres vivos
El respeto a la Constitucin poltica de un pas

Mendoza, L. et al., BIOLOGA II, Trillas, Mxico, 2009


Examen resuelto de la parte 1. Genes
248. A qu rea corresponden los siguientes postulados?

A.
B.
C.
D.
E.

Respeto a la dignidad humana y a los derechos humanos


Acceso a una atencin mdica de calidad
Acceso a los conocimientos cientficos y tecnolgicos
Proteccin de las generaciones futuras
Proteccin del medio ambiente, la biosfera y la biodiversidad

Libertad de expresin
Religin
Biotica
Moral
Libre albedro