Int J Enteric Pathog. 2015 February; 3(1): e21829.

Research Article

Published online 2015 February 20.

Isolation of Listeria monocytogenes of Karun River (Enviromental Sources

Rural and Urban) by Culture and PCR Assay
1,*

Nerssy Nassirabady ; Hossein Meghdadi ; Ameneh Alami

1Department of Biology, Faculty of Science, Shahid Chamran University, Ahvaz, IR Iran

2Department of Microbiology, School of Medicine, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, IR Iran

*Corresponding author: Nerssy Nassirabady, Department of Biology, Faculty of Science, Shahid Chamran University, Ahvaz, IR Iran Tel: +98-6113331045, Fax: +98-6113331045, E-mail:
researcherirany@yahoo.com

Received: July 7, 2014; Revised: August 17, 2014; Accepted: August 30, 2014

Background: Listeria monocytogenes is a facultative intracellular pathogen thought to be widely distributed in the environment.
Listeriolysin O (LLO) and internalin A are two major pathogenesis factors in this bacterium.
Objectives: The purpose of this research was to isolate of Listeria from different parts of the Karun river in Iran. The bacteria were identified
based on cultural characteristics, biochemical tests and by PCR assay.
Materials and Methods: A total of 150 water samples from Karun river (rural and urban environment) were collected. The bacteria were
identified based on cultural characteristics, biochemical tests and by PCR assay.
Results: From total 150 samples, twenty L. monocytogenes were isolated and identified and amplification of two pathogenicity genes: hlyA
and inlA in twenty L. monocytogenes were positive.
Conclusions: Detection of Listeria monocytogenes with hlyA and inlA genes suggest that these strains may have the potential to invade host
cells, and consumption of water contaminated with L. monocytogenes, can cause human disease.
Keywords:Listeria monocytogenes; Cultural; Method; River

1. Background

Listeria spp. are facultative anaerobic, Gram-positive,

non-spore-forming, small rods bacteria. This bacterium
infects a wide variety of animal hosts including human,
sheep, cattle, goats, pigs, rabbits, and mice. Listeria monocytogenes can cause listeriosis, encephalitis and abortions (1-3). Controlling this parasite is still a challenge for
food business operators. L. monocytogenes is a facultative
intracellular pathogen that uptake into phagocytic and
non-phagocytic cells. Internalins such as inlA (encoded
by inlA gene) and B (inlB), important pathogenesis genes
mediating adhesion and invasion to eukaryotic cells (4).
The pathogenicity of the L. monocytogenes is associated
with factors like listeriolysin O (LLO) (5-7). There are many
target genes such as inlA, 16S rRNA, iap gene, inlB and hlyA
that can be use for detection and pathogenesis of this
bacterium (8-10). The hly product, was also the first virulence factor for which a precise role in the pathogenesis
of Listeria infection was demonstrated (5-7).

2. Objectives
Based on this, the aim of this study was isolation and
identification of Listeria monocytogenes from different
parts of the Karun river, Iran by culture, biochemical
identification and proving to be invasive by PCR assay.

3. Materials and Methods

3.1. Sample Sites
As seen in Table 1, during three months period (March to
May 2014), 150 water samples from different parts of Karun river were collected to analyze for the presence of Listeria monocytogenes according to MFHPB-30 method (11).

3.2. Isolation of Listeria monocytogenes

250 mL of water sample were filtered through 0.45 m

pore size, of which 1 mL was transferred into 9 mL of Listeria Enrichment Broth (LEB), and incubated at 37C for 24
hours. Following inoculation 1 mL of culture into 10 mL of
Fraser Listeria Selective Enrichment Broth, incubation at
37C for 24 hours, and plated on CHROM agar (Merck, Germany) incubated at 37C for 24 hours. The blue colonies
with white halos were selected. Isolation and identification of the Listeria monocytogenes was done according to
standard procedure such as catalase, oxidase, haemolysis, the CAMP assay, mobility test at 25C and Acid production from xylose and rhamnose (12). The presence of hlyA
and inlA genes were detected by PCR.

3.3. PCR Amplification

The colonies on CHROM agar medium was transferred

into microtubes containing distilled water then boiled

Copyright 2015, Alborz University of Medical Sciences. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

Nassirabady N et al.
for 10 minutes at 95C and centrifuged for 10 minutes at
13,000 g. Supernatant included DNA was used as template in PCR. A set of primers (F:5'-GAATGTAAACTTCGGCGCAATCAG-3') and (R: 5'-GCCGTCGATGATTTGAACTTCATC-3')
was used to amplify hlyA (388bp) DNA fragment (13).
The reaction volume (25 L) composed of 50 mM KCl, 10
mmoL Tris-HCl (pH 8.3), 1.5 mM MgCl2, 0.2 mM of each
dNTP (deoxynucleoside triphosphate), 0.5 mM of each
primer, 1 units of Taq polymerase (Cinnagen Co., Tehran,
Iran), 14 L of sterile distilled water and 5 L of processed
sample. Amplification was performed with an initial denaturation of 94C for 4 minutes followed by 30 cycles
each of denaturationat 94C for 45 seconds, annealing at
56C for 45s, and extension at 72C for 1 minutes, followed
by 7 minutes of final extension at 72C was performed.
A set of Primers (seq01: 5' AATCTAGCACCACTGTCGGG 3')
and (seq02: 5' TGTGACCTTCTTTTACGGGC 3') was used to
amplify inlA (733 bp) DNA fragment (14). The PCR was carried out in a 25 L reaction using the 50 mM KCl, 10 mmoL
Tris-HCl (pH 8.3), 1.5 mM MgCl2, 0.5 mM of each primer,
0.2 mM of each dNTP, 1 units of Taq polymerase (Cinnagen Co.,Tehran, Iran), 14 L of sterile distilled water and
5 L of processed sample. The conditions of PCR were as
follows 4 minutes at 94C followed by 30 cycles (95C
for 30 seconds, 52C for 1 minutes, 72C for 2.5 minutes),
and then 7 min at 72C was performed. For analysis of the
PCR products of each PCR assay performed, 12 mL of the
reaction solutions from of amplification were resolved
on 2% agarose gels containing safe stain (Cinnagen Co.,
Tehran,Iran), and the PCR products were visualized by UV
transillumination after staining.

and acid production from rhamnosus were positive and

oxidase and acid production from xylose tests were negative).The presence of hlyA gene and inlA genes was positive for 13.3% of the isolates(Figures 1 and 2). The results of
this study by PCR method are presented in (Table 2).
Figure 1. Electrophoresis of PCR Products on a 2% Agarose Gel

lane M is the Molecular Weight marker; Lane 1 shows amplification of a

388 bp fragment from the positive control DNA; Lane 2 shows negative
control (The reaction volume (20 L) without DNA) and Lanes 3 to 12, results from Listeria monocytogenes isolates.
Figure 2. Electrophoresis of PCR Products on a 1.5% Agarose Gel

4. Results

A total of 150 (45 rural environment and 105 urban environment) water samples were collected from March to
May 2014 from the Karun river region, Khozestan province, Iran. Of which 4 samples (rural environment) and 16
(urban environment) has blue colonies with a white halo.
All the 20 samples were positive as Listeria monocytogenes
(Tests of hemolysis, CAMP, catalase, mobility at 25C

lane M is the molecular weight marker, Lane 1 shows amplification of a 733

bp fragment from the positive control DNA, Lane 2 shows negative control
(The reaction volume (20 L) without DNA) and Lanes 3 to 12, results from
Listeria monocytogenes isolates.

Table 1. Isolation of Listeria monocytogenes From Different Parts of the Karun River
Site

Shushtar (Jam Kanar)-urban

Shushtar (Islan park)-urban
Shushtar (SikaPark)-urban

Molasani (Ahvaz junction)-rural environment

Zergan (Ahvaz functions)-rural environment
Karoun river in Ahvaz (Naderi) - urban

Water channels Shahid Chamran University-urban

Khorramshahr (North Park saheli) urban
Khorramshahr (South Park saheli) urban
Abadan-rural environment

Geographical Coordinates

Depth Line, m

Number of Samples

3297' N; 4877' E

15

3131 'N; 4846' E

15

3298' N; 4875' E

15

3197' N; 4871' E

15

3100' N; 4828' E

15

3178' N; 4874' E

15

3120' N; 4840' E

0.5

15

3025' N; 4810' E

15

3029' N; 4815' E

15

3022' N; 4820' E

15

Int J Enteric Pathog. 2015;3(1):e21829

Nassirabady N et al.
Table 2. Origin and Number of Analysed and Positive Samples for L. monocytogenes
Origin of Samples

Environment (rural)
Environment (urban)
Total

Sites

Number of
Samples

Number of pos
(hlyA gene)

Number of pos
(inlA gene)

Zergan (Ahvaz functions, Abadan, Molasani

(Ahvaz junction)

45

Shushtar (SikaPark), Water channels Shahid

Chamran University, Karoun river in Ahvaz
(Naderi), Khorramshahr (South Park saheli)

105

16

16

150

20

20

5. Discussion

Funding/Support

Water can play an important role in transmission of the

bacteria such as Listeria monocytogenes, which causes
dangerous disease like listeriosis (15, 16). Although, L.
monocytogenes has been isolated from a variety of sources, but its isolation from waters has been rarely reported
(17, 18). In our study, 20 (13.3%) L. monocytogenes was isolated from 150 water samples from different parts of the
Karun river in Iran, which is more than other report (15).
In another study which is more than our study, 17.4% L.
monocytogenes isolated from samples of milk, bulk tank
swabs, cheese, feed, water, faeces and the environment
(19). In the present study, hlyA and inlA in twent L. monocytogenes were positive, which is more than other report
(91.7%) (20). The positive CAMP and haemolysis assay and
the presence of hlyA and inlA genes by PCR in all positive
isolates suggest that these virulent strains may have the
potential to invade host cells and cause listeriosis (21).
The results obtained have confirmed that the environment is a source of potentially pathogenic L. monocytogenes strains that carry a basic set of virulence genes and
have the potential for invading the host epithelial cells.
Consumption of water contaminated with L. monocytogenes, can cause human disease. The bacteria can cross
the intestinal barrier and disseminate from the mesenteric lymph nodes to the spleen and the liver, from which
they may reach the brain or the placenta, as a result in
meningitis or encephalitis in immune compromized patients and abortions in pregnant women. Therefore consumption of the Karun river water contaminated with L.
monocytogenes by livestock and, also use it for irrigation,
eventually can cause human disease through consumption of contaminated agricultural products and dairy.

The research was supported by a grant from Ahvaz

Jundishapur University of Medical Sciences, Iran.

References
1.
2.
3.

4.
5.

6.
7.
8.
9.

10.

11.

Acknowledgements

12.

This research was supported by a grant from Ahvaz

Jundishapur University of Medical Sciences, Iran. This
paper is part of a dissertation for M.Sc. in Microbiology
from Shahid Chamran University of Ahvaz.

13.

Authors Contributions

All authors participated equally in this article, especially in design, work, statistical analysis and manuscript
writing.
Int J Enteric Pathog. 2015;3(1):e21829

14.

15.

16.

Allerberger F, Wagner M. Listeriosis: a resurgent foodborne infection. Clin Microbiol Infect. 2010;16(1):1623.
Goulet V, Hedberg C, Le Monnier A, de Valk H. Increasing incidence of listeriosis in France and other European countries.
Emerg Infect Dis. 2008;14(5):73440.
McLauchlin J, Mitchell RT, Smerdon WJ, Jewell K. Listeria monocytogenes and listeriosis: a review of hazard characterisation for
use in microbiological risk assessment of foods. Int J Food Microbiol. 2004;92(1):1533.
Vazquez-Boland JA, Kuhn M, Berche P, Chakraborty T, DominguezBernal G, Goebel W, et al. Listeria pathogenesis and molecular
virulence determinants. Clin Microbiol Rev. 2001;14(3):584640.
Barbuddhe SB, Malik SVS, Bhilegaonkar KN, Kumar P, Gupta
LK. Isolation of< i> Listeria monocytogenes</i> and antilisteriolysin O detection in sheep and goats. Small Rumin Res.
2000;38(2):1515.
Aznar R, Alarcon B. On the specificity of PCR detection of Listeria monocytogenes in food: a comparison of published primers.
Syst Appl Microbiol. 2002;25(1):10919.
Dmen E, Baca AU. Comparative detection of Listeria monocytogenes in raw milk by microbiological method and PCR. Med
Weter. 2008;64(1):5963.
Call DR, Borucki MK, Loge FJ. Detection of bacterial pathogens in
environmental samples using DNA microarrays. J Microbiol Methods. 2003;53(2):23543.
Schmid M, Walcher M, Bubert A, Wagner M, Wagner M, Schleifer
KH. Nucleic acid-based, cultivation-independent detection of
Listeria spp and genotypes of L monocytogenes. FEMS Immunol
Med Microbiol. 2003;35(3):21525.
Ingianni A, Floris M, Palomba P, Madeddu MA, Quartuccio
M, Pompei R. Rapid detection of Listeria monocytogenes in
foods, by a combination of PCR and DNA probe. Mol Cell Probes.
2001;15(5):27580.
RPEANU G, PARFENE G, HORINCAR V, POLCOVNICU C, IONESCU
L, BAHRIM G. . Confirmation and identification of Listeria species
from fresh lettuce. Roum Biotechnol Lett. 2008;13(6).
Clark AG, McLaughlin J. Simple color tests based on an alanyl
peptidase reaction which differentiate Listeria monocytogenes
from other Listeria species. J Clin Microbiol. 1997;35(8):21556.
Aznar R, Alarcon B. PCR detection of Listeria monocytogenes: a
study of multiple factors affecting sensitivity. J Appl Microbiol.
2003;95(5):95866.
Olier M, Pierre F, Lemaitre JP, Divies C, Rousset A, Guzzo J. Assessment of the pathogenic potential of two Listeria monocytogenes human faecal carriage isolates. Microbiology. 2002;148(Pt
6):185562.
Lyautey E, Lapen DR, Wilkes G, McCleary K, Pagotto F, Tyler K, et al.
Distribution and characteristics of Listeria monocytogenes isolates from surface waters of the South Nation River watershed,
Ontario, Canada. Appl Environ Microbiol. 2007;73(17):540110.
Arvanitidou M, Papa A, Constantinidis TC, Danielides V, Katsouy-

Nassirabady N et al.

17.
18.

19.

annopoulos V. The occurrence of Listeria spp. and Salmonella

spp. in surface waters. Microbiol Res. 1997;152(4):3957.
Fenlon DR. Listeria monocytogenes in the natural environment.New
York: Marcel Dekker; 1999.
Sauders BD, Durak MZ, Fortes E, Windham K, Schukken Y, Lembo AJ Jr., et al. Molecular characterization of Listeria monocytogenes from natural and urban environments. J Food Prot.
2006;69(1):93105.
Atil E, Ertas HB, Ozbey G. Isolation and molecular characteriza-

20.
21.

tion of Listeria spp. from animals, food and environmental samples. Vet Med. 2011;56(8):38694.
Kargar M, Ghasemi A. Role of Listeria monocytogenes hlyA gene
isolated from fresh cheese in human habitual abortion in Marvdasht. Arch clin infect Dis . 2009;4(4):2148.
Bohnert M, Dilasser F, Dalet C, Mengaud J, Cossart P. Use of specific oligonucleotides for direct enumeration of Listeria monocytogenes in food samples by colony hybridization and rapid
detection by PCR. Res Microbiol. 1992;143(3):27180.

Int J Enteric Pathog. 2015;3(1):e21829