1.

INTRODUCTION
Infectious diseases pose a major threat to human health and are the leading cause of death
worldwide (Cohen et al.; 2000; Avila et al.; 2008).An infection begins when a diseases
causing microorganism successfully colonizes by entering the body, growing and
multiplying. Infectious diseases are caused as a result of infection by pathogenic microbes
including species of bacteria, parasites, viruses or fungi. Communicable diseases like
tuberculosis is caused by a bacterial species of Mycobacterium tuberculosis, while infectious
diseases like AIDS and Aspergillosis are caused by Human immunovirus (HIV) and
Aspergillus species(Avila et al.,2008). Communicable diseases like diarrhoea, respiratory
tract infections and urinary tract infections commonly caused by Klebsiella spp., Esherichia
coli and Staphylococcus spp. are major disease burden in India (Roy et al., 2013).

Infectious diseases are transmissible and can be spread from one person to another or from an
animal to a person.The spread often happen via airborne viruses or bacteria, but also through
blood or other bodily fluid. It is transmitted through the contact with microorganisms and the
common carriers of the microorganisms that transmit the disease from one host to another
include humans, animals, food, water, surfaces and air.
A reservoir of infection is basically an environment in which the pathogen can be
permanently maintained and from which infection is transmitted to the defined target
population(Vianaet al., 2014) .It can be an animate or inanimate object on which pathogens
multiply and survive and is of great importance in the epidemiology of any bacterial disease
(Wayne et al., 2002).Many epidemiological studies have confirmed that many contaminated
surfaces play a major role in the spread of infectious diseases. The reservoir plays a major
role in disease transmission and depending upon the pathogen, the reservoir can be humans,
animals or the environment.
Plant, soil and water mostly serve as a reservoir of infection for a variety of infectious
diseases .Most fungal pathogens live in soil and bacteria responsible for Legionnaires
disease lives inwater. Agents that cause tetanus, anthrax and botulism are also transmitted
through soil. Examples of environmentally transmitted pathogens exist for viruses, for
example avian influenza in water , parvovirus in faeces ,hanta virus in nesting material
;bacteria, for example bovine tuberculosis and fungi, for example Geomyces species.(Dobson,
A et al., 2001; Frick et al., 2010)

Humans also prove to be very important carriers of infection, they have a tendency to pick up
microorganisms from environmental objects mostly by dermal contact and hand has been
shown to play a major role in the transmission of organisms(Nworie et al., 2012
).Hand serves as a very important vehicle for transmission of several microbes including the
Enterobactericeae family(Kapdi M et al., 2008). Moreover the microbial population of the
hand is extremely complex and variable, consisting of gram positive organisms like
Staphylococcus aureus or gram negative bacteria like Pseudomonas aeruginosa which may
survive on the hand for quite a period of time and may hence act as a reservoir or shelter of
infection (Nester EWet al., 2004).Studies have shown that even at low concentrations
Salmonella species and Escherichia coli can be transferred from hands to raw processed and
cooked foods(Humphreyet al., 1994; Rusinet al.,2002) .Staphylococcus aureus can cause
illness from pimples, boils to meningitis and is a close relative of MRSA (Methicillin
resistant Staphylococcus aureus).Studies also show that the main reservoir of Staphylococcus
aureus is the hand from where it is introduced into food during handling and preparation [15].

Pathogens live on fomites and epidemiological studies have shown that contaminated
surfaces are mainly responsible for infectious disease transmission (Hendleyet al.,
1997).Moreover these pathogens tend to persist on the environmental surfaces for quite some
time, ranging from a few hours to a few months. Hence cross infection between the microbes
and a host is equally established (Frenchet al., 2004; Hardyet al., 2006).Pathogenic bacteria
are most commonly found on nonporous surfaces like telephones, taps doorknobs etc, so
public utility devices like telephone booths, cell phones, ATMs, public restrooms are the
most common media for transmission of bacterial pathogens.
Bacteria from public restroom are of public health importance when they enter the body
through hand to mouth contact or hand to food contact (Nesteret al., 2004).Sinks, toilet seats
and the floor are found to be the major reservoirs of the microbes. Studies show that infants
shed a lot of bacteria in their faeces and these are transmitted to another individual mainly
through improperly washed hands and hand washing is the primary line of defence to prevent
the spread of the disease (Danceret al., 2007).However research shows that many people do
not wash their hands properly after using the restrooms, they tend to simply run water over
their hands without the use of soap. In recent years there have been outbreaks of SARS,
Salmonella etc. that could be transmitted through flushing toilet (Greedet al., 2006).Urinary

tract infections, diarrhoea, venereal diseases, SARS are among the most common diseases
spread through public restrooms.
Public telephone booths are another common media for spread of disease causing
microorganisms since they are constantly used by a wide range users .Studies have also
confirmed that the door knobs, the mouth piece, key pad harbour many microbes including
pathogens like S. epidermidis, S. aureus, S. alpha haemolyticus, E. faecalis, B. subtilis,
coryneforms, P. aeruginosa, E. coli and A. calcoaceticus (Mujkiet al., 2006).
Convenient hand held devices like mobile phones are found to be sources of infection. Many
mobile phone users do not have regard for their personal hygiene and the constant handling
of phones by users in all places and occasions makes phones an open array for microbes and
a breeding ground for potential pathogenic microbes and become a source of infection and
public health hazard. (Kapdiet al., 2008;Guranget al., 2008)
Studies have also proved computer keyboards and mouse to be highly contaminated by
microorganisms. The ability of a computer to act as fomites has been previously documented
in healthcare and hospital environment (Huber et al., 2005; Buers et al., 2000). In work place,
contamination of the office environment (including the computer keyboard and mouse) with
bacteria is also recognized (Hirsch et al., 2005).Since the computers are not cleaned or
disinfected on a regular basis the chance of transmission of the contaminating microbes is
potentially great (Enemuoret al., 2012).Several works also report that computer keyboards
and mouse showed positive for Streptococcus, Clostridium perfingens, Enterococcus,
Staphylococcus aureus and fungi.

The Automated teller machines (ATM) also serve as a vehicle for disease transmission since
they are most likely to be contaminated with various microorganisms due to vast dermal
contact (Nworie et al., 2012).According to a survey conducted, in India 95% of people prefer
modern channel to traditional mode of banking and 60% of the people use ATMs at least
once a week. Hence ATMs are also known as any time microbes, as ATM centres are usually
air conditioned and the cold and damp environment favours the growth of a wide range of
microorganisms from pathogens to harmless microbes.

There is a possibility that the ATMs may be contaminated with MDR strains of bacteria,
however very few works have been reported on the same .Hence our study was conducted to
find out the prevalence of Multi drug resistance strains on the touch screen of ATMs.
1.1 Antibiotics
Antibiotics are substances that kill or inhibit the growth of other microorganisms and are used
in the treatment of external or internal infections.Penicillin, the first antibiotic, was
discovered in 1929 by Sir Alexander Fleming. In 1939, penicillin was isolated by Ernst Chain
and Howard Florey and it was used to treat infections in the Second World War. New
antibiotics such as streptomycin, chloramphenicol and tetracycline etc. were introduced in
late 1940s and early 1950s and the age of antibiotics came into full being.
Most of the natural antibiotics are produced by eukaryotic moulds and spore forming
bacteria. Penicillium and Cephalosporium moulds produce beta-lactam antibiotics such as
penicillin and cephalosporin. They also produce the base molecule for development of
semisynthetic beta-lactam antibiotics like ampicillin and amoxicillin. Actinomycetes,
mainlyStreptomyces

species

produce

tetracyclines,

aminoglycosides,

macrolides,

chloramphenicol and most other clinically useful antibiotics that are not beta-lactams.Bacillus
species, such as B.polymyxa and B.subtilis produce polypeptide antibiotics such as polymyxin
and bacitracin. B.cereus produces zwittermicin.
Most of the microorganisms that produce antibiotics are resistant to the action of their own
antibiotic, although the organisms are affected by other antibiotics, and their antibiotic may
be effective against closely-related strains.
Antibiotics are classified according to site of action or mechanism, such as inhibitors of cell
wall synthesis (Penicillins, cephalosporins, vanomycin, carbapenems, aztreonam, polymycin
and bacitracin), protein synthesis inhibitors (Aminoglycosides, tetracyclines, macrolides,
chloramphenicol, and linezolid), DNA synthesis inhibitors (Fluoroquinolones),RNA
synthesis inhibitors (Rifampin), Mycolic Acid synthesis inhibitors(Isoniazid) and Folic Acid
synthesis inhibitors (Sulfonamides).
They can also be classified according to their spectrum of action. A broad spectrum antibiotic
is one that is affective against a wide range of disease causing bacteria and it acts against both
gram- negative and gram-positive bacteria. Few examples of broad spectrum antibiotics are:
carbapenams, chloramphenicol, tetracyclines etc.Broad spectrum antibiotics are usually used
4

prior to the formal identification of the causative bacteria and when there is a wide range of
possible illnesses and a potential serious illness would result if treatment is delayed. They are
also used for drug-resistant bacteria that do not respond to other, narrow spectrum antibiotics,
and in the case of superinfections, where there are multiple types of bacteria causing illness.
The narrow spectrum antibiotics on the other hand are effective against only specific families
of bacteria.An extended spectrum antibiotic is one, which as a result of chemical
modification, affects additional types of bacteria, usually those that are gram-negative. They
are fourth generation antibiotic that functions well in the presence of beta-lactamse.This
allows it to be affective against a number of gram-positive and gram-negative bacteria that
third generation antibiotics are not as good against.
Another way of classifying Antibiotics is according to their type of action bactericidal, that
kills the bacteria and bacteriostatic, that inhibits the growth of bacteria.
1.2 Antibiotic Resistance

Antibiotic resistance is resistance of microorganisms to antibiotics to which it was originally

sensitive. The global spread of microbial resistance is a predominant reason why infectious
diseases have not been conquered. After acquiring antibiotic resistance microorganisms, are
able to survive after exposure to one or more antibiotics.It is a natural phenomenon.
According to laws of Darwinian evolution, use of antibiotics creates selection pressure on
microorganisms. The weak ones, i.e. the ones susceptible to antibiotics, die whereas the ones
that adapt and become resistant to it survive (Davies et al., 1996)

With each passing decade the bacteria that defy multiple antibiotics have become
increasingly common(Stuart B. Levy). The standard treatments become ineffective against
resistant organisms and infections persist increasing risk of spread to others.It increases the
cost of treatment and also the rate of morbidity and mortality from such diseases (Breathnach
et al., 1998).

Some level of antibiotic resistance occurs without human action. However the current higher
levels of emergence of resistant organisms is due to over use and abuse of antibiotics. The
unrestrained use of antibiotics in human health, agriculture and animal husbandry has played
a major role in increase of antibiotic resistant organisms worldwide.

When an antibiotic attacks a group of bacteria, cells that are highly susceptible to the
medicine will die. But cells that have resistance or have acquired resistance through mutation
or gene exchange will survive especially if too little drug is given. Thus the resistant cells
will survive and proliferate. Also when the antibiotic is attacking the pathogenic bacteria,
they also affect the benign bacteria in their path. Thus they eliminate drug susceptible
bystanders, which could otherwise limit the expansion of pathogens, and encourage the
growth of resistant bystanders. This becomes a problem when the growing population of
bystanders themselves become agents of disease and this also increases the reservoir of
resistance traits in the bacterial population.

A number of corrective measures can be taken to prevent the antibiotic resistance such as
prescribing antibiotics only when needed. Non-antibiotic therapies should be considered for
minor conditions. Also the causative pathogen should be identified before the beginning of
the therapy so that antibiotic targeted specifically to that microbe can be prescribed instead of
a broad spectrum antibiotic which may kill other non-pathogenic bystanders as well. When
antibiotics are prescribed for an infection, proper dosage should be taken and care must be
taken to ensure that the full course of antibiotic therapy is completed. Proper hand washing
also plays a role in curbing the spread of antibiotic resistance (Stuart B. Levy).

1.3 Multi Drug Resistance

Some organisms have even developed resistance to multiple drugs. This condition called
Multiple drug resistance (MDR) enables disease-causing microorganisms (bacteria, viruses,
fungi or parasites) to resist distinct antimicrobials, such as antibiotics, antifungal drugs,
antiviral medications, antiparasitic drugs etc targeted at eradicating the organism (Siegelet al.,
2006)

Some

common

multidrug

resistant

organisms

are:-

Vanomycin-resistant

Enterococci(VRE),Methicillin resistant Staphylococcus aureus(MRSA),Extended spectrum

beta-lactamase(ESBLs) producing gram-negative bacteria and Klebsiella pneumonia
carbapenemase(KPC) producing gram-negative bacteria.

There are two mechanisms by which multidrug resistance can be acquired in bacteria.
Bacteria can become multi drug resistant by accumulation of genes coding resistance to a
single drug on the R plasmid. This is achieved by mechanisms provided by integrons,

transposons and ISCR elements. These R plasmids are maintained well and often transferred
from cell to cell (Lewis et al., 2005).

Another mechanism of multidrug resistance in bacteria is active pumping out of drugs by

multidrug efflux pump. The RND(resistance-nodulation-division) superfamily pumps are
present in gram negative bacteria. They are usually coded by chromosomal genes and they
can pump out most of the antibiotics currently in use (Revet al., 2009).

Multidrug resistance can also be caused due to altered physiological states of the
bacteria.Some bacterial population can survive even at high antibiotic concentration. These
are known as the persister population and are genetically identical with the susceptible cell
(Lewis et al., 2005). The presence of persisters is a strategy whereby bacteria naturally
generate mixtures of phenotypically different populations, so that one of them can be
advantageous to a changing environmental demand (Dhar et al., 2007). Persisters limit the
efficacy of antibiotic therapy.

There is a continuing need to understand the mechanism of resistance as this may lead to
useful inhibitors of multidrug efflux pumps or to inhibitors of the R plasmid transfer process.
Various steps also need to be taken to prevent the further increase in multidrug resistant
bacteria. Because the usage of antibiotics was the cause of natural selection of these bacteria,
one logical conclusion is to minimize antibiotic usage. Also simultaneous administration of
more than one drug as is done with tuberculosis should be considered (Revet al., 2009).

1.4 Resistant pathogens found around the globe

Antibiotic resistance has become a growing problem globally. The appearance and spread of
bacteria that are resistant to most or all commonly available antibiotics has raised the
spectrum

of

untreatable

bacterial

infections.

For

example,

methicillin

resistant

Staphylococcus aureus (MRSA) that causes skin and wound infections is resistant to most
antibiotics including - lactams (ampicillin, methicillin, oxacillin, cephalosporin,
carbapenems, etc. It was one of the earliest bacteria in which penicillin resistance was found.
By 1950s, almost half of Staphylococcus aureus strains became resistant to penicillin and by
1970s methicillin resistant Staphylococcus aureus (MRSA) also developed. Vancomysin was
developed to kill this superbug. By in 1996 the first case of vancomysin resistant
7

Staphylococcus aureus (VRSA) was reported. In 2000, another antibiotic, linezolid was
developed to combat both MRSA and VRSA but a year later linezolid resistant
Staphylococcus aureus was reported (Tsiodras et al., 2001).

Mycobacterium tuberculosis is another major pathogen which causes Tuberculosis in

humans. Streptomycin and isoniazid were the drugs used in the treatment of TB but it has
developed resistance to these drugs. Treatment regimen on TB includes a cocktail of anti-TB
drugs but multi drug resistance of Mycobacterium tuberculosisstillcompromisesthe TB
therapy. Strains resistant to four or more front line antibiotics called Extremely drug resistant
strains (XDR) have appeared recently (Shah et al., 2007; Sotgiu et al.,2009). Totally drug
resistant (TDR) strains have also been reported recently (Velayatiet al.,2009).

Another example is vancomycin resistant enterococci (VRE). Enterococci bacteria live in our
intestines and on our skin, usually without causing any problems. But if they become resistant
to antibiotics, they can cause serious infections like bloodstream infection(sepsis), urinary
infection, abscesses, wound infections, pneumonia and heart infections like meningitis or
endocarditis. To become vanomycin resistant, vanomycin-sensitive enterococci typically
obtain new DNA in the form of transposons or plasmids which encodes genes that confer
vanomycin resistance. There are only a few antibiotics that are able to treat it.Quinipristindalfopristin, tigecycline and daptomycin still retain some activity against VRE. Linezolid is
effective only when given orally. However there have been reports suggesting resistance to
these antibiotics (Leavis et al., 2006). A new antibiotic molecule, Platensimycin has been
reported to be active against VRE and MRSA (Wang et al., 2006).

Another prevalent pathogen is Pseudomonas aeruginosa. It is highly persistent and can avoid
human

immune

Fluoroquinolones

system.

Antipseudomonad

are

drugs

the

commonly

beta-lactams,
used

to

aminoglycosides,
cure

the

and

Pseudomonas

aeruginosainfection. But most of the MDR stains are resistant to these antibiotics(Reinhardt
et al., 2007). It is a concern for patients suffering from cystic fibrosis and it develops
resistance with the lengthy antibiotic treatment of cystic fibrosis patients (Horrevortset
al.,1990) Colistin has been reported to be active against
aeruginosa(Reinhardt et al., 2007).

MDR Pseudomonas

Another pathogenic group of big concern is extended spectrum beta lactamase (ESBL)
producing gram-negative bacteriasuch as Escherichia coli, Salmonella enterica, and
Klebsiella pneumonia(Dahbi et al., 2013).They produce beta-lactamases that are capable of
hydrolysing penicillins,broad spectrum cephalosporins and monobactams. Currently,
carbapenems such as imipenem and meropenem are the treatment of choice for serious
infections due to ESBL-producing organism, yet carbapenem-resistant isolates have been
reported (Pitout et al., 2008).

Klebsiella pneumoniae carbapenemase (KPC)-producing bacteria are a group of emerging,

highy drug-resistant Gram-negative bacilli. The best therapeutic approach to KPC-producing
organisms is yet to be defined: however common treatments are the polymyxins, tigecycline,
and aminoglycoside antibiotics.

The most common bacteria that make the enzyme, New Delhi metallo beta-lactamase (NDM1) are gram-negative Escherichia coli and Klebsiella pneumonia. This enzyme makes the
bacteria resistant to a broad range of beta-lactam antibiotics, which includes the carbapenem
family, which are a mainstay for the treatment of antibiotic-resistant bacterial infections.

MDR
ORGANISMS

AGENT

MRSA

Methicillinresistant

VRSA

VRE

ESBL

MDRSP

MODE OF

COMMENTS

TRANSMISSION

S.aureus

VISA

RESERVOIR

Vanomycinintermediate/
resistant)
S.aureus

Vancomycinresistant
Enterococcus
faecalis or
faecium
Extended spectrum beta
lactamase
producing gram
negative
bacteria
Multidrug
resistant
S.pneumoniae

Colonized and
infected patients.
Colonized health
care workers.
Environment and
fomites.

Person to person
Health care workers
hands
Environment.

CA-MRSA
infections as most
often present as
skin infections.
HA-MRSA- most
invasive
infections.
Colonized
and Person to person
Prolonged
infected patients.
Health care workers vancomycin use
Colonized health hands
is a risk factor.
care workers.
Environment.
Environment and
fomites.
Person to person
Often multi-drug
Gastrointestinal,
Health care workers resistant to
Genitourinary
hands
penicillins and
Environment.
aminoglycosides
Environment
Gastrointestinal
Long term care
facility particular
concern as
reservoir for acute
care facilities.
Nasopharynx

Person to person
Health care workers
hands
Environment.

Direct contact
Droplet spread

Table 1 :Examples of clinically relevant MDR organisms

10

Important ESBL
gram
negative
bacteria include
Klebsiella,
Pseudomonas,Ser
ratia.
MDRSP is often
resistant to
penicillin,
erythromycin,
trimethroprim,
sulfamethoxazole,
fluoroquinolones

1.5 Preventing the spread of antibiotic resistant pathogens

Preventing spread of antibiotic resistant pathogens a necessary step. A well-documented

approach to prevent transmission of antibiotic resistant pathogens in hospitals is through
active surveillance that involves testing of patients to detect the presence of antibiotic
resistant pathogens. This helps in identifying colonized patients. Early detection of the
reservoir can prevent spread as contact and droplet precaution can be taken and the patient
can be kept in an isolated ward (Jernigan et al., 1996).

Hand hygiene is another important measure that can prevent the transmission of multidrug
resistance as hand is often the responsible for transmission. Although hand hygiene will help
prevent transmission, it by itself will not result in control of antibiotic resistant pathogens
such as MRSA, VRE and VRSA.

Since excessive use of antibiotics is one of the major reasons of development of antibiotic
resistance, inappropriate and excessive use of antibiotic should be avoided. Also correct
dosage and duration of antibiotic therapy should be carried on (Kunin et al., 1973).But
limiting the antimicrobial use alone cannot control multi drug resistance. Care should be
taken to ensure that the infections and not contaminates that are treated, also using narrow
spectrum and not broad spectrum antibiotics for serious infections when the pathogen is not
known or other effective drugs are unavailable. The antimicrobial utilisation and local
susceptibility patterns should be studied. And should try to avoid excessive duration of
treatment. Strategies for influencing antimicrobial prescribing patterns should also be looked
in to.

11

2. REVIEW OF LITERATURE
According to the research paper by Nworie et al.,2013, ATMs are likely to be contaminated
by a number of microorganisms due to the large number of people using this facility on a
daily basis. They examined the metallic keypads of 20 ATMs for source of bacterial
contamination and the antibiogram of isolated organisms were identified. They found the
keypads contaminated with Staphylococcus aureus , Klebsiella and Escherichia coli.

Study bySaroja et al.,2013, involved collection of samples from ATM centres in Chennai
using cotton swabs. Out of the 65 samples analysed, 27 were found to contain Escherichia
coli, 25 for Klebsiella , 8 for Shigella sp, and 6 for Vibrio sp. The obtained results were
confirmed by using Amplification of target genes Lac z and Lam b and were performed by
using Lac z and Lam b primers.
The potential infection risk originated from ATMs is the focus of the study by Tekerekolu et
al., 2012. Samples were collected from 100 ATMs from Malatya city. Antimicrobial
susceptibility of the pathogens was investigated .All devices were found positive for Bacillus
sp and coagulase negative Staphylococci (CNS) were isolated from nine devices.
Staphyloccocus aureus grew in two devices, where one of them was identified as methicillin
resistant (MRSA). Three devices were found positive for Escherichia coli.

A similar study was conducted by Mabel et al., 2013 involved collection of samples from
ATM centres in Madurai city, Tamil Nadu. A total of 200 samples (ATM button (50), screen
(50) and floor (50), users hands (20) from each location and direct plate exposure (20) in
ATM, and from ladies toilets (10)) were collected. Ten species of microorganisms:
Staphylococcus,

Serratia,

Escherichia,

Klebsiella,

Pseudomonas,

and

Salmonella,

Micrococcus, Mucor Fusarium and Aspergillus were found to contaminate the fingers of
people withdrawing cash from ATMs. Staphylococcus and fungal isolates such as Mucor,
Penicillin and Aspergillus were found on the ATM screens, floor as well as ATM keypads.
The results of Antibiogram study of bacteria showed that most of the organisms were
resistant.

12

According to study conducted by Chairman et al.,2011, surfaces of public utility devices are
likely to be contaminated by pathogenic organism. For the study, samples were collected
from public computers, ATMs, public telephone booths etc. The samples were found to
contain Salmonella typhi, Klebsiella pneumonia, Escherichia coli, Vibrio sp and
Staphylococcus aureus. These organisms were then tested for sensitivity to 6 types of
antibiotics and Escherichia coliwere observed to be resistant.

Identification and quantification of bacterial contamination on the surface of ATM counters

in Vellore was the aim of the study conducted by Chandrasekharet al .Thirteen ATM
counters of different Banks were chosen for the study and sample was collected from ATM
surfaces such as door, touch screen and key pad. Staphylococcus aureus, Staphylococcus
epidermidis and Klebsiella pneumonia were the main isolates identified. Staphylococcus
aureus and Staphylococcus epidermidis was found to be resistant to penicillin and
ciprofloxacin. Klebsiella pneumoniae was found to be resistant to chloramphenicol.

A study conducted by Abban et al., 2011, focuses on potential sources of food-borne

pathogens present on ATM machines. Five automatic teller machines of three different banks,
situated on the University of Ghana main campus were used for the study. Seven species of
microorganisms: Aeromonas,Bacillus, Enterobacter, Escherichia, Klebsiella, Pseudomonas
and Salmonella, were isolated from keypad of ATMs.

Onuoha et al., 2014 conducted a study to assess bacterial contamination of ATMs and public
health risk associated with the spread of infections from the ATMs in Ebonyi State, Nigeria.
The results of this study indicated that Automated Teller Machines were positive for the
presence Staphylococcus auerus 4 (28.57%), Coagulase-negative staphylococcus 3 (21.43%),
Streptococcus species 2 (14.29%), Pseudomonas species 1 (7.14%), Enterobacter species 1
(7.14%) and Escherichia coli 3 (21.43%). Staphylococcus. aureus, Streptoccus spp and P.
aeruginosa showed 68.75% resistance to the antibiotics, whilst E. coli (56.25%),
Enterobacter spp (50%) and CNS showed 18.75% susceptibility each.

13

A study conducted by Mujkic et al., 2013, focuses on the pathogens present on public
telephones. Sixty samples were collected from the area of Sarajevo and the microbes were
isolated and identified using microbiological, biochemical and serological methods. The
samples were found to be contaminated with Staphylococcus epidermis (73.3%), Bacillus
subtilis(40%),Pseudomonas aeruginosa(3.3%), Escherichia coli(1.67%), Acinetobacter
calcoaceticus(1.67%).

Microorganisms associated with public restrooms were investigated byAgbagwa et al., 2010.
Hundred samples were collected from sink taps, flush handles, ,toilet seats and door handles
in the University of Port Harcourt campus .The isolated bacteria that included Staphylococcus
sp(45%),Escherichia coli(26.25%),Pseudomonas sp(18.75%)and Streptococcus sp(45%)
were subjected to antibiotic sensitivity tests .The gram negative bacteria were found to show
more resistance to Ampicillin , Norfloxacin ,Ciprofloxacin and Floxacin, while the gram
negative bacteria showed more resistance Malidixic ,Ampicillin and Septrin.

The main aim of the study conducted by Yeh et al., 2011, was to screen for antibiotic
resistant Staphylococcus spp. in a public transportation system. A total of 70 samples were
collected from seven different areas in buses and trains from Portland, USA.A range of
pathogenic Staphylococcus species were isolated from the samples. Six different strains of
Staphylococcus species were identified. Eleven isolates were found to be sensitive to
Trimethoprim-sulfamethoxazole, vanomycin and tetracycline. Five isolates showed resistance
to ampicillin and penicillin and two isolates showed intermediate resistance to bacitracin.

A study was conducted by Famurewa et al., 2009 on isolation of bacteria from cell phones.
150 samples were collected from the cell phones of the volunteers in the university premises,
commercial centres, hospital personnel (doctors and nurses) and hospitalized patients. Out of
the 150 phones screened in this study, 124 showed bacterial growth. The isolated bacteria,
Escherichia coli (28.2%), Pseudomonas aeruginosa (22.6%), Klebsiella sp (14.5%), Serratia
sp (13.7), Staphylococcus aureus (12.9%) and Proteus vulgaris (8.1%) were subjected to

14

antibiotic sensitivity tests. It was found that all the isolates were resistant to more than three
antibiotics.

Bacterial contamination of mobile phones and their antimicrobial susceptibility pattern was
investigated in the study conducted by Tagoe et al., 2011.Samples were collected from the
surfaces of 100 mobiles and all samples were found to show 100% bacterial contamination.
Bacteria isolates include Klebsiella pneumonia (10%), Staphylococcusaureus (4%),
Coagulase negative Staphylococci (15%), Pseudomonas aeruginosa (4%), Bacillus cereus
(23%), Proteus mirabilis (19%), Escherichia coli (8%), Streptocccus pneumonia( 10%),
Salmonella spp. (3%) and Shigella spp. (2%).The isolated bacteria showed complete
resistance to Ampicillin ,Penicillin, Cloxacillin and Cefuroxime. While Gentamycin (27.3%),
Cotrimoxazole (27.3%), Amikacin (14.3%) were the most effective bacteria.

Another similar study was conducted by Roy et al., 2013. This study focuses on isolation and
identification of bacteria from mobile phones of fish and animal handlers of Kashmir, India.
150 samples were collected from mobile phones of veterinarians, students (veterinary
sciences), laboratory attendants, shepherds, meat and fish handlers of Kashmir valley.96.66%
of the samples collected were found to harbour pathogenic bacteria. Escherichia coli,
Bacillus cereus, Proteus spp., Streptococcus spp., Staphylococcus spp., Klebsiella were
isolated from the mobile phones. All the isolates were found to be highly resistant to
Amoxycillin/ Clavulonic acid, Amoxycillin, Ampicillin and Gentamicin.

The effect of constant handling of public handsets by various users was studied in the work
done by Ekrakene et al., 2007. Fifteen samples in total were collected from public call centers
along the Benin-Sapele Expressway. The major bacterial species isolated from the samples
included Staphylococcus aureus (60%),Bacillus subtilis(100%),Enterobacter aerogenes
(40%).Fungal isolates including Apergillis niger(100%) and Rhizopus spp(60%) were also
obtained from the samples.

Study conducted by Bhat et al., 2011also focuses on determining the incidence of bacterial
colonization on mobile phones of Healthcare workers. Out of the 204 samples screened, 201
samples showed bacterial growth. Coagulase negative Staphylococcus obtained from 154
samples was the most commonly isolated organism. The samples were also found to contain

15

isolates

of

Pseudomonas

aeruginosa(43),Escherichia

coli(34),Methicillin

sensitive

Staphylococcus aureus (29),Klebsiella pneumonia(16),Methicillin resistant Staphylococcus

aureus(10).Pathogens

isolated

also

included

Acinetobacter

spp(12),Enterococcus

spp(10),Citrobacter spp(1) and Proteus spp(1).

A similar work was done by Arora et al., 2009, to study the microbial population on cell
phones belonging to do doctors, paramedical staff working at governments, medical college
and hospitals. Samples were collected from 160 cell phones. Bacterial growth was obtained
on 65 mobile phones ,out of the total number of organisms isolated, coagulase negative
Staphylococcus(27) was the most common followed by Staphylococcus aureus(22) and
Escherichia coli (15).Species of Klebsiella(7),Micrococcus (7),Bacillus (5) ,Acinetobacter (2)
and Citrobacter(1) were also isolated from the samples.

Isolation and identification of microbes present on computer keyboards and mouse was of
primary focus in the study carried out by Kumar et al., 2012 .Fifty samples were collected
from five computer labs in Himachal Institutes Paonta Sahib. Five bacterial isolates were
identified, which included Staphylococcus aureus,Staphylococcus epidermis, Micrococcus
sp, Streptococcus sp and Escherichia coli.

According to the study conducted by Eltablawy et al., 2009, computer keyboards and mouse
are likely to be contaminated by pathogenic microorganisms. For this study, samples were
collected from 24 computers (keyboard and mouse). All the tested computer mouse and
keyboard were found positive for microbial contamination. The isolated pathogens which
included Bacillus cereus (60% susceptible and 10% resistant); Pseudomonas putida (90%
susceptible and 10% resistant) and Escherichia tarda (90% susceptible and 0% resistant)
were tested against the 10 different antibiotics.

The aim of the study by Tagoe et al., 2010, was to investigate and compare the level, types
and antibiotic susceptibility of bacterial contaminants of keyboards and mice in general
offices and internet cafs. A total of 100 samples were collected for the study. All surfaces of
keyboard and mice were contaminated. Eight (8) different bacteria were isolated from the
samples of which seven (7) were pathogenic (Bacillus cereus, P. mirabilis, K. pneumonia, S.
aureus, E. coli, S. pneumoniae, Enterococcus spp) and one, Coagulase Negative
Staphylococcus was non-pathogenic.
16

In a study conducted by Kassem et al., 2007, it was determined that computer keyboards used
by students of a metropolitan university are reservoirs ofantibiotic-resistant staphylococci. 24
computer keyboards in three, open-access, student computer facilities were sampled for
bacteria. Of the 24 keyboards surveyed, 17 were contaminated with staphylococci that grew
in the presence of oxacillin (2mgl_1). Methicillin (oxacillin)-resistant Staphylococcus aureus
(MRSA), -S. epidermidis (MRSE) and -S. hominis (MRSH) were present on two, five and
two keyboards, respectively, while all three staphylococci co-contaminated one keyboard.

Microbial contamination of laptop or keyboards in dental settings was investigated by

Anjumn et al., 2011. Specimens were collected from 25 laptops that were located in the
clinical section of a dental college in Andra Pradesh, India. The laptops selected were those
which were in use for a minimum period of one year and above.Potential pathogens were
cultured from more than 80% of the computers which included

coagulase-negative

staphylococci (88% of keyboards), diphtheroids (80% of keyboards), Micrococcus species

(40% of keyboards), and Bacillus species (60% of keyboards), Oxacillin Resistant
Staphylococcus Aureus (ORSA) (8% of keyboards), Oxacillin Susceptible Staphylococcus
Aureus (OSSA) (4% of keyboards), vancomycin-susceptible Enterococcus species (16% of
keyboards), Streptococci (29% of keyboards) and Aspergillus (36% of keyboards).

In a study carried out by Anderson et al., 2009, the keyboards of multiple-user (student) and
single-user (staff) computers located on a Hawthorn campus of Swinburne University of
Technology in Melbourne, Australia, were sampled to assess microbial contamination. Ten
keyboards were sampled at random from 3 separate multiple-user student computer
laboratories. The samples were collected at least at least 12 hours after the laboratories were
last occupied by students. Five single-user computer keyboards (located in staff offices) were
also sampled. All computers had been in use for a period of 1 to 3 years. The average number
of microorganisms present as well as the number of potential pathogens present was found to
be more on multiple-user computer keyboards than on single-user keyboards. They
isolatedStaphylococcus aureus, Escherichia coli and Enterococcus faecalis. The isolation of
Bacillus cereus, a common soil bacterium, is evidence of environmental contamination.

17

The presence of pathogenic bacteria in different public environmental sites in Mecca City
was the reported in a study conducted by Ashgar et al., 2012. Samples were collected
fromshopping trolleys in supermarkets, the handles of the doors of ATM, refrigerated water
taps in the streets. Samples were also collected from mike, pens and keyboards in the public
halls; and from surface of cans of carbonated drinks.Bacillus spp. recorded the highest
percentage as compared to other isolated bacteria. Acinetobacter haemolyticus,Morganella
morganii, multidrug resistant Pseudomonas aeruginosa, E. coli, Enterobacter aerogenes and
Citrobacter freundii were also isolated from the environmental sites.

Chimezie et al., 2013, carried out bacteriological examination of computer keyboards and
mouse and their susceptibility pattern to disinfectants. Samples were collected from surfaces
of 250 computer keyboards and mouse. It was found that all the tested computer keyboards
and mouse devices, were positive for microbial contamination. They isolated Staphylococcus
spp., Escherichia spp., Pseudomonas spp. and Bacillus spp from these computer keyboards
and mouse. The isolated bacteria were tested against the 6 different disinfectants (Dettol, Isol,
Izal, JIK, Purit and Septol). The overall result of this study showed that Dettol, followed
by JIK was highly effective against all the bacterial isolates tested while Septol and Izal
were least effective. Isol and Purit showed moderate antibacterial effects.

The study carried out by Oluduro et al., 2011 was conducted to assess the bacterial
contaminants associated with open access user interfaces (mouse, computer keyboards,
ATMs) in various establishments in the town of Ile-Ife , Nigeria. A total of 313 swab samples
were collected from various interfaces. A number of 669 samples comprising of 11 distinct
bacterial species were isolated. The isolates included Aerococcus viridians(9.4%),Bacillus
spp. (8.4%), Enterobacter aerogenes (4.9%), Gaffkya tetragena (2.1%), Klebsiella
pneumoniae (11.1%), Micrococcus luteus (10.9%), Moraxella catarrhalis (1.6%), Proteus
spp. (10.6%), Pseudomonas aeruginosa (16.0%), Staphylococcus aureus (16.7%) and
Staphylococcus epidermidis (8.2%). The Antibiogram indicated that most isolates were found
to be resistant to Amoxicillin,Augmentin,Nitrofurantoin and Ceftriazone and multiple
antibiotic resistance was observed in 89.1% of the bacterial isolates.
Bacterial contamination of computer keyboards and mouse devices was reported in the study
undertaken by Chukwudi et al., 2013.A total number of 250 samples were collected from the
surfaces of computer keyboards and mouse devices from cyber cafes of three campuses
18

(Presco ,CAS ,Ishieke).158 bacterial isolates were identified which included Staphylococcus
spp.(63),Bacillus spp.(11),Escherichia spp.(47),Pseudomonas spp.(27).The isolated bacteria
were tested against 6 different disinfectants(Dettol, Isol, Izal, JIK, Purit and Septol).The
results indicated that Dettol and JIK were highly effective against bacterial isolates, while
Isol and Purit showed moderate antibacterial effects .Septol and Izal found to be least
effective.
The study carried out by Enemuor et al., 2012, involves the isolation and identification of
microorganisms associated with computer keyboards and mouse devices in computer centres
and cyber cafes in Kogi University, Nigeria. A total of 30 samples were collected from the
surfaces of the keyboards and mice. The microorganisms obtained included bacterial isolates
such as Staphylococcus aureus, Staphylococcus epidermis, Enterococcus spp., Streptococcus
spp.fungal isolates including Mucor spp., Pencillium spp., Aspergillus niger, Rhizopus spp.

19

3. MATERIALS AND METHODS

3.1 Study Area
This study was conducted in Vellore, Tamil Nadu.The study was undertaken for a period of
three months from January 2014 to March 2014.

3.2 Sample Collection

Forty seven Automated Teller Machines (ATMs) of 12different banks (City Union Bank,
State Bank of India, Union bank, Lakshmi vilas bank, Denabank, Indian bank, Federal
bank,ICICI bank,TMB bank, HDFC bank,IOB, Canara bank) was used for the study.The
ATM on main roads having most of the people visiting was selected for the present
study.Verbal permission for procedure was obtained from the concerned authority.

Samples were collected from the touch screen and keypad of ATM with sterileswabs. These
swabs were then immediately transferred back to the microbiology laboratory within one
hour of collection in tubes. The test tubes containing the swab were then incubated overnight
to allow the growth of organisms (Nworie et al., 2012).

3.3 Standardization of Test Organisms

0.5 Mac Farlands were used as a reference to adjust the turbidity of bacterial suspensions.
McFarland standards were prepared from suspensions of latex particles and they were
adjusted to an acceptable transmission range using a spectrophotometer at a wave length of
either 600 or 625 nm. The bacterial suspension was adjusted to the same turbidity of a
McFarland Standard to produce expected bacterial plate count (Nworie et al.,2012).
McFarland Standard

Approximate Cell Count

8

Density (x10 cells)

0.5

1.5

1.0

3.0

2.0

6.0

3.0

9.0

4.0

12.0

Table 2: McFarland Standard and cell density count

20

3.4 Sample processing

All samples were collected processed in the research laboratory according to the standard
microbiological methods under complete aseptic conditions. The swabs were inoculated on
appropriate media and incubated at 37C under aerobic conditions for 24 - 48 h. To
determine the types of microorganisms present, the remainder of the was sampled with a
moistened sterile cotton swab, which was then placed into 4 ml of Nutrient broth and
incubated at 37C for 48 hours. A variety of selective and differential microbiological media
was used for presumptive identification of contaminating microorganisms (Joshaline et al.,
2014)

3.5 Characterization of samples

Bacterial

isolates

were

examined

for

colony

morphology

and

gram

reaction as per the standard procedures given by Bergeys Manual, 2009.

Isolates

Cultural Characteristics

Gram positive

Escherichia coli

Flat and smooth colonies on Negative

MacConkey agar

Klebsiella species

Round mucoid colonies on Negative

MacConkey agar

Pseudomonas species

Colourless

and

irregular Negative

colonies in MacConkey agar

Acinetobacter species

Colourless

colony

irregular

shape

and Negative
in

MacConkey agar
Proteus species

Colourless

in Negative

MacConkeyagar
Table 3: Colony morphology of isolates (Nworie et al.,2012)
3.6 Susceptibility Testing
The isolates were tested for antimicrobial susceptibility using Kirby Bauer agar disc diffusion
method (Cheesbroughet al., 2006) on Mueller-Hilton agar. Various antimicrobial agents used
were ampicillin, cefotaxime, ceftazidime, ceftriaxone and meropenem. The diameter of the
zones of inhibition surrounding the antimicrobial disc was measured to the nearest
millimetre. Isolates were considered resistant only when the zone of inhibition was less or
equal to the resistance breakpoint.

21

3.7 Plate Assay Method

In the plate assay we have amended 2g/ml concentration of Cefotaxime and 4g/ml
concentration of Meropenem in MH agar. If the isolates grown in the plate it is considered as
resistance Suresh et al., 2007.
3.8 Genomic DNA Isolation
DNA isolation was carried out by Ausubel Method, 1995. LB broth was inoculated with the
culture surrounding different antibiotic disc and allowed to grow overnight at room
temperature. The culture grown in the LB broth was centrifuged and TE buffer, 10% SDS
and Proteinase K were added to the pellet. Then 5M NaCl was added after an hour of
incubation. After addition of CTAB/NaCl solution, it was kept in water bath at 65C for 10
minutes. Equal volume of chloroform/isoamyl alcohol was added in the ratio of 24:1 and it
was centrifuged.Aqueous viscous supernatant was transferred to fresh tube and equal volume
of phenol/chloroform/isoamyl alcohol was added and centrifuged. To the supernatant ice
isopropanol was added and tube was inverted until stringy white DNA precipitate became
very clear. DNA was then washed with 70% ethanol and centrifuged. The supernatant was
discarded and the pellet was air dried. The pellet was then resuspended in TE buffer and gel
electrophoresis was carried out and DNA bands were observed under the UV illuminator.
3.5 Polymerase chain reaction
3.6
PCR for the Detection of NDM-1 Genes
PCR amplification for NDM-1 gene was carried out on the isolates with an Applied
Biosystem 9902 Thermo Cycler instrument using PCR conditions and primers as previously
described (Suresh et al., 2012). Reaction was accomplished in 50l reaction, approximately
10ng of genomic DNA as a template, reaction volume containing: 10pmol of each primer,
200m dNTP, 1.5mM MgCl2, 1X Taq buffer and 2U of Taq polymerase (Genei, Bangalore,
India).

22

Stage

Temperature

Duration

Initial Denaturation

95C

5 minutes

Denaturation

95C

30 seconds

Annealing

65C

1 minute

Extension

72C

1 minute

Final Extension

72C

1 minute

Store at 4C. These steps are carried out for 35 cycles.

Table 4 : PCR conditions followed for the detection of the NDM-1 gene

Multiplex PCR for the Detection of CTX-M Group Genes

PCR amplification for blaCTX-M group genes was carried out on the isolates with an
Applied Biosystem 9902 ThermoCycler instrument using PCR conditions and primers as
previously described (Woodford et al., 2006). The primers used are listed in the Table 1

Primer Name

Primer Sequence (5'-3')

Product Size

CTX-M group 1 f

AAAAATCACTGCGCCAGTTC

415-bp

CTX-M group 1 r

AGCTTATTCATCGCCACGTT

415-bp

CTX-M group 2 f

CGA CGC TAC CCC TGC TAT T

552-bp

CTX-M group 2 r

CCA GCG TCA GAT TTT TCA GG

552-bp

CTX-M group 9 f

CAAAGAGAGTGCAACGGATG

205-bp

CTX-M group 9 r

ATTGGAAAGCGTTCATCACC

205-bp

CTX-M group 26 f

GCA CGA TGA CAT TCG GG

327-bp

CTX-M group 8/26 r

AAC CCA CGA TGT GGG TAG C

327-bp or 666-bp

CTXM group 8 fwdII

TCG CGT TAA GCG GAT GAT GC

666-bp

Table 5 : CTX-M group genes primers

23

Stage

Temperature

Duration

Initial Denaturation

94

3 minutes

Denaturation

94

20 seconds

Annealing

62

30 seconds

Extension

72

40 seconds

Final Extension

72

5 minutes

Store at 4C. These steps are carried out for 30 cycles.

Table 4 : PCR conditions followed for the detection of the CTX-M group gene

Agarose Gel Electrophoresis

Amplified products were analysed by agarose gel electrophoresis according to the procedure
described by Sambrook et al., 1989. 1.5 per cent Agarose gel was prepared in 0.5X TBE
buffer using Agarose. Required quantity of agarose was suspended in TBE, dissolved by
heating in a microwave oven, cooled to about 50C, then about 2-4l of ethidium bromide
(Et-Br) was added and poured into a gel casting tray fitted with the required comb. The
solidified gel was immersed in an electrophoresis tank containing 0.5X TBE buffer. The PCR
products were mixed with a 1X loading dye (1 per cent bromophenol blue and 40 per cent
sucrose in water) and the mixture was loaded into the gel. Electrophoresis was carried out at
50V for about 2 hour until the tracking dye reached the end of the gel. Amplified DNA was
visualized under the UV trans-illuminator. The molecular sizes of the DNA samples were
analysed using a 100-3000k bp DNA ladder. The gel image was captured using a
GelDocumentation System.

24

4. RESULTS

A total of 47 samples were collected from touch screen of ATMs. On culturing of these
samples on MacConkey agar plates, 488strains were identified. Among 488 strains, 239
Escherichia coli (48.97%) strains, 148 Klebsiella sp(30.32%), 77 Pseudomonas sp.(15.77%),
17 Acinetobacter sp.(3.48%) and 7 Proteus sp. (1.43%) were identified (Refer Table 4 :
Frequency of bacterial occurrence in ATMs).

Isolates

Frequency of occurrence in ATMs

Escherichia coli

239(48.97%)

Klebsiella species

148(30.32%)

Pseudomonas sp.

77(15.77%)

Acinetobacter sp.

17(3.48%)

Proteus sp.

7(1.43%)

TOTAL

488

Table 7: Frequency of bacterial occurrence in ATMs

These strains were subjected to antibiotic disc sensitivity by Kirby Bauer disc sensitivity
method. Samples were screened for resistance to six antibiotics which included Cefotaxime,
Ceftriaxone, Ceftazidime, Ampicillin and Meropenem. The zone of inhibition of the
antibiotics was measured in millimetre. Among the 488 strains, 120 of them showed
phenotypic resistance to these drugs. Out of these 120 strains we selected 46 strains that
showed high level of resistance. These 46 strains were then subjected to Plate assay method.

25

Name of
isolates
E.coli

Total
Ampicillin Cefotaxime Ceftriaxone Ceftizidime Meropenem
no.of
isolates
239
74.89%
60.87%
71.96%
75.73%
10.04%

Klebsiella

148

72.97%

69.59%

75.67%

74.32%

9.45%

Pseudomonas 77

74.02%

76.62%

80.51%

83.11%

11.68%

Acinetobacter 17

70.58%

82.35%

70.5%

64.70%

17.64%

Proteus

72.42%

74.02%

71.42%

85.71%

14.28%

Table 8 : Antibiotic Resistance Percentage of Isolates

Fig 1 : Antibiotic Sensitivity Pattern of Escherichia Coli

Fig 2 : Antibiotic Sensitivity Pattern of Klebsiella sp

26

Fig 3 : Antibiotic Sensitivity Pattern of Pseudomonas sp

Fig 4 : Antibiotic Sensitivity Pattern of Acetobacter sp

Fig 5 :Antibiotic Sensitivity Pattern of Proteus sp

27

Fig 6 : Antibiotic Susceptibility Test by Kirby Bauer Disc

Diffusion Method
28

Fig 7 : Plate Assay Method

29

Genomic DNA was isolated from the 46 strains that showed high level of phenotypic
resistance. Then these samples were subjected to polymerase chain reaction (PCR). For each
of the 46 samples, PCR was performed using NDM-1 and CTX-M group gene primers. All
the 46 strains were not amplified for NDM-1 and CTX-M 1,2,8,9,25/26 group genes.

Fig 8: Gel Electrophoresis showing genomic DNA bands

30

Fig 9: PCR screening of NDM-1 gene

Fig 10 : PCR screening for samples using CTX-M primer

31

5. DISCUSSION
An Automated Teller Machine (ATM) is a computerized telecommunications device that
enables the clients of a financial institution to perform financial transactions without the need
for cashier, human clerk or bank teller (Rasiah et al., 2010). It is a public utility device which
is used by millions of people in a day. Like all surfaces, colonization of surface of ATMs
such as touch screens, metallic keypad etc by microorganisms is inevitable. The cold and
damp environment of air conditioned ATM centers favours the growth of a wide variety of
microorganisms, both pathogens and harmless microbes (Sarojaet al., 2012). The ATM
machine is also likely to be contaminated with various microorganisms due to their vast
contact by multiple users. There is no restriction as to who has access to the facility and no
guideline to ensure hygienic usage. Hence ATMs are reservoir of pathogens.

The literature search has revealed that very few studies have been carried out in India on
isolation and identification of microbes on ATM. Hence the present study was designed to
isolate and identify the bacteria present on ATM surfaces and also to determine the presence
of multi drug resistant strains on these ATM within the town of Vellore, Tamil Nadu. The
aim of the study is to create awareness to the general public and ATM users on the possible
spread of diseases due to the presence of pathogens, especially multi drug resistant pathogens
on ATM touch screen and keypads.

The results of this study showed high level of contamination on the surface of ATMs with
Escherichia coli, Klebsiella spp., Pseudomonas spp., Acinetobacter and Proteus spp.The
percentage distribution of the bacterial isolates showed that Escherichia coli was the most
common isolate with percentage occurrence of 48.97% followed byKlebsiella spp., 30.32%,
Pseudomonas spp., 15.77%, Acinetobacter spp., 3.48% and Proteus spp., 1.43%.

The number of microorganism present on the surface as well as the type of microorganism
present will determine the possibility of occurrence of infection (Neelyet al., 2002 ;
Oluduroet al., 2011). Although the counts of these microorganisms on the ATM surfaces
were not determined, but there is a good chance of spread of infection as even low levels of
Escherichia coli strains can easily be transferred from the fingers to food surfaces. Klebsiella
spp. and Pseudomonas spp. are highly pathogenic, and can even cause death in some major

32

outbreaks and infections.Microbial transmission can occur from the hands of users to the
touch screen and keypad, or vice versa.

Although phenotypic resistance was observed during Kirby Bauer disc susceptibility method,
all the isolates did not show amplification during PCR using NDM-1 and CTX-M primers.

The bacterial contaminants seen in this study is similar to bacteria that have been recovered
from surfaces and objects by other investigators. Nworie et al;2012 , reported the presence of
Klebsiella spp. and Escherichia coli on the key pad of ATMs.Besides these, Staphylococcus
aureus, was also isolated by them. According to this study, ATMs are likely to be
contaminated by a number of microorganisms due to large number of people using this
facility on a daily basis. Our study is also in agreement with the study bySaroja et al;2012
who reported the presence pathogenic bacterium such as E.coli, Klebsiella spp.Shigella spp..
and Vibrio spp were also isolated by them in ATM centers in Chennai. But these microbes
were not present in the ATMs screened in this study.

High rates of microbial contamination were found on other public utility devices such as
telephone booths, mobile phones and computers keypad and mouse. Anesa et al;2013 ,
reported that a variety of pathogens are present on public telephones such as Staphylococcus
epidermis, Bacillus subtilis, Pseudomonas aeruginosa, Escherichia coli, Acinetobacter
calcoaceticus. Ashok et al; 2012, identified and isolated microbes present on computer
keyboards and mouse. The bacterial strains isolated included Staphylococcus epidermis,
Bacillus subtilis, Pseudomonas aeruginosa, Escherichia coli, Acinetobacter calcoaceticus.
Thus, similar to the results found in our study, Escherichia coli and Pseudomonas sp were the
major contaminants found on public telephones and computers.

Escherichia coli are the commonest isolates recovered in our study. Escherichia coli is an
enteric pathogen that spread diseases through touch, improper sanitary activities of
individuals. Escherichia coli can cause diseases like gastroenteritis, urinary tract infection,
septicaemia, dysentery, vomiting, stomach cramps and flatulence. Other bacteria like
Acinetobacter and Proteus spp., were the least frequent bacterial contaminants.

Antibiotic susceptibility of bacterial isolates has been observed to be dynamic and it varies
with time and environment (Rahman et al., 2007). There is the need for periodic screening of
33

common bacterial pathogens for their antibiotic susceptibility profiles in different

communities (Joshaline et al., 2013). The antibiogram result of this study revealed that
majority of the bacteria is highly resistant to standard antibiotics. A total of 5 standard
antibiotics were used with the predominant isolates. And the results showed that organisms
showed mostly resistant.

Escherichia coli showed resistance to ampicillin (74.89%),

cefotaxime (60.87%), ceftriazone (71.96%),ceftizidime (75.73%) and meropenem (10.04%).

Whereas, Klebsiella spp. showed resistance to ampicillin (72.97%), cefotaxime (69.59%),
ceftriazone (75.67%), ceftizidime (74.32%) and meropenem (9.45%). Pseudomonas spp.
showed resistance to ampicillin (74.02%),cefotaxime (76.62%), ceftriaxone (80.51%),
ceftizidime (83.11%) and meropenem (11.68%). Acinetobacter spp. showed resistance to
ampicillin (70.58%), cefotaxime (82.35%), ceftriazone (70.5%), ceftizidime (64.70%) and
meropenem(17.64%). Proteus spp.showedresistance to ampicillin (72.42%), cefotaxime
(74.02%), ceftriaxone (71.42%), ceftizidime (85.71%) and meropenem (14.28%).This
indicates that species of E.coli, Klebsiella spp., Pseudomonas spp. and Acinetobacter spp.
showed high level resistance to the tested antibiotics. While Proteus spp. were found to be
susceptible to cefotaxime, ceftriaxone and meropenem and showed comparatively less
resistance to ampicillin and ceftizidime. This indicates that the isolated bacterial strains
showed multiple antibiotic resistance patterns. This result is in agreement with the results of
the study conducted by Olduro et al., 2011 where multiple antibiotic resistance patterns were
observed in the isolates from samples collected from user interfaces like ATMs, computer
keyboards and mouse devices.Klebsiella spp. showed 100% resistance to erythromycin,
tetracycline (83%), ampicillin (83%), penicillin (83%), gentamycin (54%), cefixime (50%),
cloxacilline (50%) and tarivid acid (50%), but showed high level susceptibility to
cotrimoxazole (65%), followed by ciprofloxacin (64%),augmentine (64%), peflacine (50%)
and ceporex (50%).Escherichia coli were 100% resistant to tetracycline and penicillin,
followed by augmentine (90%),

ampicillin (85%), cefixime (65%), cloxacilline

(65%),cotrimoxazole (65%)erythromycin (65%) and nalidixicacid (65%), but 70%

susceptible to ceporex, followed by peflacine (65%) and ciprofloxacin (65%).

This study is also found to be similar to the study conducted by Nworie et al., 2013, who
isolated Staphylococcus aureus, Klebsiella spp. and Escherichia coli from the metallic
keypads of ATMs. All the organisms showed resistance to certain drugs while the results
indicated that the isolated Staphylococcus aureus were multiple drug resistant.

34

Staphylococcus aureus was 89% resistant to ampicillin followed by penicillin (78%),

nalidixicacid (78%),augmentine (70%), cefixime (68%), tetracycline (68%), erythromycin
(68%), ceporex (65%), gentamycin (60%), ciprofloxacin (60%), peflacin (57%), cloxacilline
(55%) and tarivid (55%).

Similarly, Famurewa et al.;2009, also reported the presence of multi drug resistant bacteria
on the surfaces of mobile phones.The occurrence of resistance in pathogens may reduce the
effectiveness of previously efficient antibiotics (Torogluet al., 2008) .And our research
reveals that the ATMs are potential carriers of dangerous pathogens including drug resistant
ones.

Moreover clinically relevant

bacteria like E.coli

can grow in

different

environments(Joshaline et al., 2013) where in the presence of environmental concentrations

of antibiotics may face a selective pressure and may gradually lead to the increase in
prevalence of resistance (Torogluet al., 2008).Hence theres great risk of transmitting
antibiotic resistant bacteria through contact with such highly contaminated public devices like
the ATM machines. Maintaining personal hygiene like washing hands regularly using soap or
alcohol based sanitizers and wiping the screens and keypads of the ATMs using disinfectants
on a regular basis may help in reducing the spread of microbes.

35

6. CONCLUSION

This study confirmed the presence of microbial contamination on touch screen and keypads
of ATMs. Pathogenic organisms like Escherichia coli, Klebsiella sp., Pseudomonas sp.,
Acinetobacter sp. and Proteus sp. were isolated from the ATM surfaces. Many of these
organismsshowed phenotypic resistance to some commonly used antibiotics. The result of
this study shows that ATM devices are potential areas for pathogen accumulation and
microbial contamination of ATM surfaces like touch screen and keypads may be a common
mechanism of transfer of potentially pathogenic and disease resistant bacteria among the
users. A proper cleaning regimen using appropriate sanitizers should be developed to reduce
the presence of microbial contamination on ATM surfaces and care must be taken that the
regimen is strictly adhered, so as to reduce the spread of infection among ATM users.

36

REFERENCES

1 Agbagwa,

ObakpororoEjiro

significance of

and

Nwechem

Daughter.(2010).Public

health

microorganisms associated with public restrooms in University of

Port Harcourt.Scientia Africana, Vol. 9 (No.1), March, 2010 pp 126-132.

2 Anesa Jerkovi-Mujki, Renata Beta and Sabina Memievi.(2013).Bacterial
contamination of public telephones in the downtown area of Sarajevo .African journal
of microbial research. 7(17): 1664-1667.

3 Anjana Chandrasekhar, Aparna K P, PriyankaAjithkumar, M P Aarathy,

SabahaFathima, Badari, AnandPremRajan . International Journal of Chemtech
Applications Vol. 2; Issue 1; Page 71-76
4 Annu Rev Biochem. 2009 ;78:119 146.doi:1 0.1146/ annurev.biochem. 78.082907.1
45923

5 AnyimChukwudi,

IlangDonatus

C,

Okonkwo

Eucharia

C..

Bacteriological

Examination of Computer Keyboards and Mouse Devices and their Susceptibility

Patterns to Disinfectants. American Journal of Bioscience and Bioengineering. Vol. 1,
No. 3, 2013, pp. 36-43.doi: 10.11648/j.bio.20130103.11.

6 Ashok Kumari and Meena Srivastava.(2012).Computer components in college and its

surroundings encompass the pathogenic bacteria.Vol 7(1): 43-47.
7 Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, and Struhl K
8 (1994) Current Protocols in Molecular Biology, pp 2.0.1-2.14.8, John Wiley and
Sons,New York.
9 Bergey's Manual of Determinative Bacteriology / Edition 9 John G. Holt, Peter H.
Sneath (Editor), Noel R. Krieg (Editor), John G. Holt (Editor), John G. Holt (Editor)

10 Bhat SS, Hegde SK, Salian S. Potential of Mobile Phones to Serve as a Reservoir in
Spread of Nosocomial Pathogens.Online J Health Allied Scs. 2011;10(2):14.

37

11 Breathnach AS, de Ruiter A, Holdsworth GM, et al.: An outbreak of multi-drugresistant tuberculosis in a London teaching hospital. J Hosp Infect 1998, 39(2):111117.
12 Buers S, Fishbain JT, Uyehara CFT, Parker JM, Berg MW (2000). Computer
keyboards and faucet handles as reservoirs of nosocomial pathogens in the intensive
care unit. Am. J. Infect. Control, 28: 465-470.

13 Cheesebrough, M.(2006): District Laboratory practice in tropical countries (Part II). C

ambridge University, P19110.

14 Dahbi G, Mora A, Lpez C, Alonso MP, Mamani R, Marzoa J, Coira A, GarciaGarrote F, Pita JM, Velasco D, Herrera A, Viso S, Blanco JE, Blanco M and Blanco J.
2013. Emergence of new variants of ST131 clonal group among extraintestinal
pathogenic Escherichia coli producing extended-spectrum -lactamases. Int J
Antimicrobial Agents,42(4):347-351.

15 Davies J: Bacteria on the rampage. Nature 1996, 383:219-220.

16 Dhar N, McKinney JD. Microbial phenotypic heterogeneity and antibiotic tolerance.
Curr. Opin. Microbiol 2007;10:3038. [PubMed: 17215163].
17 Dobson, A., and J. Foufopoulos. 2001. Emerging infectious pathogens of wildlife.
Philos. Transac. R. Soc. Lond. Ser. B ,Biol. Sci. 356:10011012.
18 Ekrakene, T. and C.L. Igeleke .Micro-organisms Associated with Public Mobile
Phones along Benin-sapele Express Way, Benin City, Edo State of Nigeria.Journal of
Applied Sciences Research, 3(12): 2009-2012, 2007.
19 Famurewa, O. and David, O. M.Cell Phone: A Medium of Transmission of Bacterial
Pathogens.(2009). vo1 (2): 69-72.

20 Francis, J. 1971. Susceptibility to tuberculosis and the route of infection. Aust. Vet. J.
47:414414.

38

21 French, G.L., J.A. Otterb, K.P. Shannona, N.M.T. Adamsb and D. Watlingb et al.,
2004. Tackling contamination of the hospital environment by Methicillin-Resistant
Staphylococcus aureus(MRSA): A comparison between conventional terminal
cleaning and hydrogen peroxide vapour decontamination. J. Hosp. Infect., 57: 31-37.
DOI: 10.1016/j.jhin.2004.03.006.

22 Frick, W. F., J. F. Pollock, A. C. Hicks, K. E. Langwig, D. S.,Reynolds, G. G. Turner,

C. M. Butchkoski, T. H. Kunz. 2010.An emerging disease causes regional population
collapse of a common North American bat species. Science 329:679682.

23 Fulford, G. R., M. G. Roberts, and J. A. P. Heesterbeek. 2002. The metapopulation

dynamics of an infectious disease: tuberculosis in possums. Theor. Popul. Biol.
61:1529.
24 Greed, C. (2006). The role of the public restroom: Pathogen Transmitter. Building
Serv. Eng. Res. Technol. 27(2): 1-13.

25 Gurang B, Bhati P, Rani U,Chawla K,Mukhopodhyay C, Barry I (2008). Do mobiles

carry pathogens. Microcon. Oct. 3.
26 Hardy, K.J., B.A. Oppenheim, S. Gossain, F. Gao and P.M. Hawkey, 2006. A study
of the relationship between environmental contamination with Methicillin-Resistant
Staphylococcus Aureus (MRSA) and patients acquisition of MRSA. Infect Control
Hosp. Epidemiol., 27: 127-132. PMID: 16465628.
27 Hassan, S.H. Sensitivity of Salmonella and Shigella to

antibiotics and

chemotherapeutic agents in Sudan.J. Trop Med Hyg, 88: 243-248. 1995.

28 Hendley, J. O., Wenzel, R. P. and Gwaltney, J.M. J. (1997). Trasnsmission of
rhinovirus colds by self-inoculation. New. Eng. J. Med.288: 1361-1664.

29 Hirsch S (2005). Germs are working overtime at the office (hppt/www.latimes.com).

39

30 Huber JS, Pelon W (2005). Low cost screening for microbial contamination in
aerosols generated in a dental office. Gen. Dent., 53: 270-271.

31 Humphrey, T.J., K.W. Martin and A. Whitehead, 1994.Contamination of hands and

work surfaces with Salmonella enteritidis PT4 during the preparation of egg dishes.
Epidemiol. Infect., 113: 403-409. DOI: 10.1017/S0950268800068412.
32 Horrevorts, A. M., J. Borst, R. J. T. Puyk, R. D. Ridder, G. Dzoljic- Danilovic, J. E.
Degener, K. F. Kerrebijn, and M. F. Michel. 1990. Ecology of Pseudomonas
aeruginosa in patients with cystic fibrosis. J. Med. Microbiol. 31:119124.

33 Issmat I Kassem,Von Sigler and Malak A Esseili. Public computer surfaces are
reservoirs for methicillin resistant staphylococci.The ISME Journal(2007) 1,265268.
34 Jernigan JA, Titus MG, Groschel DHM, Getchell-White SI, Farr BMEffectiveness of
contact isolation during a hospital outbreak of methicillin- resistant Staphylococcus
aureus. Am J Epidemiol 1996;143:496-504.
35 Kapdi M, Hoskote S, Joshi SR (2008). Health hazards of mobile phones: an Indian
perspective. JAPI. 56:893-897.
36 K. Chairman, Elizabath Mathew. K, Padmalatha. C and Ranjit Singh.

37 A .J.A,(2011).Beware of pathogens on public utility devices.J. Microbiol. Biotech.

Res., 2011, 1 (3): 85-90
38 34. Kunin CM, Tupasi T, Craig WA. Use of antibiotics: a brief exposition of the
problem and some tentative solutions. Ann Intern Med 1973;79:555-560.
39 Leavis HL, Bonten MJ, Willems RJ: Identification of high-risk enterococcal clonal
complexes: global dispersion and antibiotic resistance. Curr Opin Microbiol 2006,
9:454-460.
40 Lewis K. Persister cells and the riddle of biofilm survival. Biochemistry
2005;70:26774. [PubMed: 15807669]

40

41 L.P., Dancer, S.J., Robertson, C. (2007). Microbiological Evaluation of Hospital

Cleaning Methods. International Journal Environ Health Res. 17(4): 285 295
42 Mabel Joshaline C.1, Subathra M.2, Shyamala M.1, Padma S.2,
Rekha.(2014).Automated Teller Machine (ATM)- A pathogen city A Surveillance
Report from Locations in and around Madurai city, Tamil Nadu, India.

43 Mafalda Viana, Rebecca Mancy, Roman Biek, Sarah Cleaveland, Paul C. Cross,
James O., Lloyd Smith, Daniel T.Haydon(2014).Assembling evidence for identifying
reservoirs of infection.

44 Management of Multidrug-Resistant Organisms In Healthcare Settings, 2006 Jane D.

Siegel, MD; Emily Rhinehart, RN MPH CIC; Marguerite Jackson, PhD; Linda
Chiarello, RN MS; the Healthcare Infection Control Practices Advisory Committee

45 Maria Avila, Najwane Said, David M. Ojcius.The book reopened on infectious

diseases,Microbes and Infection 10 (2008) 942-947.
46 Mehmet SaitTekerekolu, Yusuf Yakupogullari, BarisOtlu, YucelDuman and
NilayGucluer .(2012).Bacteria found on banks automated teller machines
(ATMs),African journl microbial research. Vol. 7(16),pp. 1619-1621, 16 April, 2013.

47 M.L. Cohen, Changing patterns of infectious disease, Nature 406 (2000)762-767.

48 M.ShakeelAnjumn , P.Parthasarathi Reddy, Irram Abbas, M.Monica,Yadav Rao.
Microbial Contamination of laptop/keyboards in dental settings.(2011).International
Journal for health and dentistry.
49 Neely, A.N. and D.F. Sittig, 2002. Basic microbiologic and infection control
information to reduce the potential transmission of pathogens to patients via computer
hardware. J. Am. Med. Inform. Assoc., 9:500-508. PMID: 12223502
50 Nester EW, Evans CR, Nancy P, Denise GA, Martha TT (2004). The Genus:
Staphylococcus In: Nester EW ed. Microbiology a Human Perspective. 2nd McGrew
Hill, New York, pp. 693-695.

41

51 Okoro Nworie, Mbaba Mercy,Anyim Chukwudi, Inya Oko, S. Okoli Chukwudum,

Victor Maduka Agah and Uchechukwu Onyeukwu Ekuma .Antibiogram of Bacteria
isolated from Automated Teller Machines within Abakaliki Metropolis.American
Journal of Infectious Diseases, 2012, 8 (4), 168-174.
52 Oluduro, A.O., A.O. Ubani and I.E. Ofoezie, 2011. Bacterial assessment of electronic
hardware user interfaces in Ile-Ife, Nigeria. J. Basic Applied Pharmaceut. Sci., 32:
323-334.
53 Oluduro, A. O ; Ubani, E. K.; Ofoezie, I. E. Journal of Basic and Applied
Pharmaceutical Sciences . 2011;32(3):323-334.
54 Onochie Charles Chimezie, AnyimChukwudi, Alo Moses Nnaemeka,
55 OnwaNdubuisi Collins, Okonkwo EuchariaChinyere and AfiukwaFelicitasNgozi.
Bacterial examination of computer keyboards and mouse devices and their
susceptibility patterns to disinfectants. American Journal of Microbiology 4 (1): 9-19,
2013.
56 Pamela J. Yeh , Dawn M. Simon , Jess A. Millar , H. Forrest Alexander , Darleen
Franklin Public Health Res Perspect 2011 2(3), 202-209.
57 Pitout

JDD,

Laupland

KB.

Extended-spectrum

-lactamase

producing

Enterobacteriaceae; an emerging public health concern. Lancet Infect Dis 2008; 8:

15966.
58 Rahman, m., Rahman, B., Rahman, T., Khan, F.R and Hosen, M.J. Pattern of
antimicrobial resistance and plasmid profiles of Escherichia coli isolates obtained
from calf, cattle and diarrheic children in Mymensingh-Bangledish. J. Am. Sci.., 3:
74-84. 2007.

59 Rasiah, D. ATM Risk Management and Controls. Eur. d. Econ. Finance Admin. Sci.,
1: 161-171. 2010.
60 Reinhardt A, Kohler T, Wood P, Rohner P, Dumas JL, Ricou B, van Delden C:
Development and persistence of antimicrobial resistance in Pseudomonas aeruginosa:

42

a longitudinal observation in mechanically ventilated patients. Antimicrob Agents

Chemother 2007, 51:1341-1350.

61 Rusin, P., S. Maxwell and C. Gerba, 2002. Comparative surface-to-hand and

fingertip-to-mouth transfer efficiency of gram-positive bacteria, gram-negative
bacteria and phage. J. Applied Microbiol., 3: 585-592. PMID: 12234341.
62 Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989). Gel electrophoresis of DNA. In:
Sambrook, J., Fritsch, E.F. and Maniatis, T. (Eds.) Molecular Cloning: a Laboratory
Manual. New York: Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY,
USA, chapter 6.
63 Samy S. Ashgar, Hamdy M. El-Said.Pathogenic Bacteria Associated with Different
Public.Open Journal of Medical Microbiology, 2012, 2, 133-137 .
64 S. C. Enemuor, T. A. Apeh and O. O. Oguntibeju.Microorganisms associated with
computer keyboards and mice in a university environment. (2012). African Journal
of Microbiology Research. 6(20): 4424-4426.
65 Seuli Saha Roy, Siddhartha Sarathi Misra and Malik Mehboob Willayat .Isolation
and identification of bacteria of public health importance from mobile phones of fish
and animal handlers of Kashmir. African journal of microbiology research (2013).
66 Shah, N. S., A. Wright, G. H. Bai, L. Barrera, F. Boulahbal, N. Martin-Casabona, F.
Drobniewski, C. Gilpin, M. Havelkova, R. Lepe, R. Lumb, B. Metchock, F. Portaels,
M. F. Rodrigues, S. Rusch-Gerdes, A. V. Deun, V. Vincent, K. Laserson, C. Wells,
and J. P. Cegielski. 2007. Worldwide emergence of extensively drug-resistant
tuberculosis. Emerg. Infect. Dis. 13:380387.

67 Sotgiu, G., G. Ferrara, A. Matteelli, M. D. Richardson, R. Centis, S. Ruesch- Gerdes,

O. Toungoussova, J.-P. Zellweger, A. Spanevello, D. Cirillo, C. Lange, and G. B.
Migliori. 2009. Epidemiology and clinical management of XDR-TB: a systematic
review by TBNET. Eur. Respir. J. 33:871881.
68 Stanley ChukwudozieOnuoha,KayodeFatokun. Bacterial Contamination and Public
Health risk Associated with the Use of Banks Automated Teller Machines(Atms) in
EbonyiState,Nigeria.American Journal Of Public Health Research ,2014,Vol
2,No.2,46-50 .
69 Stephen Abban 1, 2, KwakuTano-Debrah.Automatic teller machines (ATMs) as
potential sources of food-borne pathogens a case from Ghana. Nature and Science,
2011;9(9)

43

70 S.Y. Eltablawy and H.N. Elhifnawi. Microbial Contamination of Some Computer

Keyboards and Mice in National Center for Radiation Research and
Technology(NCRRT).World Applied Sciences Journal 6(2):162,2009.
71 The Challenge of Antibiotic Resistance by Stuart B. Levy
72 D Tagoe, F Kumi Ansah. Computer Keyboard and Mice: Potential Sources of
Disease Transmission and Infections. The Internet Journal of Public Health. 2010
Volume 1 Number 2.
73 Tagoe D N, Gyande V K, Ansah E O. Bacterial Contamination of Mobile Phones:
When Your Mobile Phone Could Transmit More Than Just a Call . WebmedCentral
MICROBIOLOGY 2011;2(10):WMC002294.
74 Toroglu, S. and S. Dincer, 2008. Elimination and conjugal transfer of their resistance
in isolated gram negative bacteria from Aksu River(Kahramanmaras-Turkey). Adv.
Environ. Biol., 2:124-131.

75 Tsiodras S, Gold H, et al.: Linezolid resistance in a clinical isolate of Staphylococcus

aureus. Lancet 2001, 358:207-208.
76 Usha Arora, Pushpa Devi, Aarti Chadha, Sita Malhotra.Cellphones A Modern
Stayhouse For bacterial pathogens. Vol. 11 No. 3.2009.
77 Velayati, A. A., M. R. Masjedi, P. Farnia, P. Tabarsi, J. Ghanavi, A. H. ZiaZarifi, and
S. E. Hoffner. 2009. Emergence of new forms of totally drug-resistant tuberculosis
bacilli: super extensively drug-resistant tuberculosis or totally drug-resistant strains in
Iran. Chest 136:420425.

78 Wang J, Soisson SM, Young K, Shoop W, Kodali S, Galgoci A, Painter R,

Parthasarathy G, Tang YS, Cummings R et al.: Platensimycin is a selective FabF
inhibitor with potent antibiotic properties. Nature 2006, 441:358-361.
79 Woodford, N., Fagan, E. J. & Ellington, M. J. (2006). Multiplex PCR for rapid
detection of genes encoding CTX-M extended-spectrum -lactamases. J Antimicrob
Chemother 57, 154155.

80 Wayne, Pa. Daniel, T., Haydon, Cleaveland, S.,Taylor, L. H. and Karen, L.M (2002).
Identifying reservoirs of infection: A conceptual and practical challenge. Emmer.
Infect. Dis.

44