Вы находитесь на странице: 1из 7

Prolonging Storage Time of Baby Ginger by Using

a Sand-Based Storage Medium and Essential


Oil Treatment
Ji Liu, Guoliang Sui, Yongzhou He, Dongjie Liu, Jing Yan, Shuxiang Liu, and Wen Qin

Wilt and rot occur readily during storage of baby ginger because of its tender skin and high moisture content
(MC). A storage medium, which consisted of sand, 20% water, and 3.75% super absorbent polymers delayed weight
loss and loss of firmness at 12 C and 90% relative humidity. Microorganisms were isolated and purified from decayed
rhizomes; among these, 3 fungi were identified as pathogens. The results of 18S rDNA sequence analysis showed that these
fungi belonged to Penicillium, Fusarium, and Mortierella genera. The use of essential oil for controlling these pathogens
was then investigated in vitro. Essential oils extracted from Cinnamomum zeylanicum (cinnamon) and Thymus vulgaris
(thyme) completely inhibited the growth of all of the above pathogens at a concentration of 2000 ppm. Cinnamon oil
showed higher antifungal activity in the drug sensitivity test with minimal fungicidal concentration (<500 ppm against all
pathogens). In the in vivo test, cinnamon fumigation at a concentration of 500 ppm reduced infection rates of Penicillium,
Fusarium, and Mortierella by 50.3%, 54.3%, and 60.7%, respectively. We recommended cinnamon oil fumigation combined
with medium storage at 12 C as an integrated approach to baby ginger storage.

Abstract:

This research identified optimal storage conditions for baby ginger, a cold sensitive vegetable with
tender skin and high MC. These optimized conditions will be useful for storage, transport, and preservation of fresh
vegetables and fruits that are sensitive to cold exposure and have high MC and tender skin.

Practical Application:

Introduction

traditional methods such as soil burying, cellaring, heaping, and


mudding may not be practical for baby ginger. Sand, as a storage
medium, has good air permeability and water absorbability, but its
water retention capacity is poor. Super absorbent polymer (SAP),
which is widely used in sanitary articles, agriculture, or sheathing of electrical cables, has a swelling capacity of up to 500 g/g in
aqueous liquids. SAP used in the tests was composed of polyacrylic
acid sodium salt resin. It has excellent water absorbency and water retention capacity (Bakass and others 2001). SAP is safe and
environmentally benign because its final decomposition products
are carbon dioxide, water, ammoniacal nitrogen, and potassium
ions. However, SAP can cause wilting from full contact with baby
ginger. Therefore, a mixture of SAP, sand, and a certain amount
of water may be a suitable storage medium for baby ginger. To our
knowledge, this kind of medium has not been used in storage.
Rhizomes of ginger, which grows underground, may be infected by soil pathogens (Stirling 2002). Chemical fungicides such
as NaClO2 may lead to residues and browning because of gingers
thin cuticle and high polyphenol content. Because of consumer
concerns around the use of synthetic preservatives, natural compounds are being increasingly researched for their use as preservatives. Among these natural compounds, essential oils are found to
be inhibitory against a wide range of food-spoiling microorganisms (Burt 2004).
Although several studies have identified the pathogens of ginger
(Stirling 2004; Overy and Frisvad 2005), very few studies have
reported storage methods and disease control for baby ginger.
MS 20130602 Submitted 5/6/2013, Accepted 1/7/2014. Authors are with College
Therefore, the objectives of our study were to examine the efficacy
of Food Science, Sichuan Agricultural Univ., Yaan, Sichuan, China. Direct inquiries
of storage media and fumigation with essential oils for baby ginger
to author Qin (E-mail: qinwen1967@aliyun.com).
storage.

Ginger, a tropical plant species, is categorized as baby ginger


or mature ginger according to its development level. Baby ginger can be utilized in the same way as mature ginger, and has the
added benefits of lack of tough skin and fibrous center. Because of
its distinctive taste and health benefits, baby ginger is increasingly
favored by worldwide consumers as not only a spice, but also as a
vegetable (Carman 2011).
As a seasonal crop, the storage period for baby ginger is much
shorter than that of the mature rhizomes. Mature ginger, stored
properly, can be kept for months. Baby ginger will wilt within 48 h
at 25 C. Although low temperatures can inhibit the transpiration,
respiration, and growth of pathogens, cold storage is not preferred
for baby ginger because of its cold sensitivity. Policegoudra and
Aradhya found that 12 C was the optimum storage temperature
for mature mango ginger (Curcuma amada Roxb.) (2007); below
12 C, chilling injury occurred. Depending on the properties of
baby ginger, high relative humidity (RH) is required, but condensation occurs when the temperature fluctuates in an environment
of high RH (up to 90%) (Medina and others 2012). Therefore,
baby ginger needs to be stored in a water-free environment with
high RH to prevent wilting or rotting.
The medium storage method for preservation of root vegetables
has been used for centuries in Asian counties. Due to difficulties in controlling environmental conditions and soil properties,

R

C 2014 Institute of Food Technologists

doi: 10.1111/1750-3841.12384
Further reproduction without permission is prohibited

Vol. 79, Nr. 4, 2014 r Journal of Food Science M593

M: Food Microbiology
& Safety

Keywords: disease control, rot, super absorbent polymers, transmission electron microscopy, wilt

Storage of baby ginger . . .

Materials and Methods


Materials
Baby ginger obtained from Beichuan (Mianyang City, Sichuan
Province, China) was transported at 12 to 15 C to the laboratory
for medium storage, pathogen tests, and in vivo antifungal experiment, and treatments were carried out on the same day. Rhizomes
of uniform length, maturity, and color, with minimum mechanical damage and without fungal decay were selected and washed
in water at 4 C prior to storage. All essential oils were obtained
from Jian Shengda Fragrances Co., Ltd (Jian City, Jiangxi Province,
China). Polyethylene (PE) bags (20 cm 30 cm) were perforated
with 0.5-mm dia holes at a density of 100 holes/m2 . River sand
was washed in water, dried at 100 C, and screened through a
325 m mesh. SAP with a capacity of 200 g/g was obtained
from Shandong Polymer Bio-chemicals Co., Ltd (Dongying City,
Shandong Province, China).

Microorganism isolation
Rhizomes were stored without surface sterilization in the abovementioned media with varying concentrations of SAP for 30 d.
Microorganisms were isolated from the leading edge of rotten
rhizomes by crushing the tissue in sterile distilled water and plate
streaking in Sabourands agar and nutrient agar media. Individual
colonies were purified using the same respective media.

M: Food Microbiology
& Safety

Pathogen test
The pathogen test followed the method of Vero and others
(2002). The concentration of the spore suspension was 2 106
spores/mL. The storage media and rhizomes inoculated with
the same microorganism were placed into perforated PE bags.
Three replicates were used for each microorganism and each
replicate had 16 rhizomes distributed among 4 bags. Infection
rates were recorded after 10-d incubation at 12 C. The microorganisms were isolated again using the above-mentioned method,
and the morphology and pigmentation traits of purified colonies
were compared with those of the microorganism inoculated on
Medium storage
The experimental storage media were composed of SAP, water, rhizomes.
and sand in different proportions by weight. SAP to sand ratios of
2.5%, 3.75%, and 5% and water to sand ratios of 10%, 20%, and 18S rDNA sequence analysis
30% were used. Weighed rhizomes were placed into perforated PE
18S rDNA sequence analysis was performed to determine the
bags filled with the storage media. Rhizomes were divided into genus of each pathogen. The essential oils were chosen depend9 groups, with 3 replicates for each treatment and 36 rhizomes ing on the results of this analysis. Mycelia were collected after
in each replicate distributed among 9 bags (4 rhizomes per bag). 5-d incubation. DNA was extracted and identified following the
The initial data were measured on the same day. Moisture content method of Bargues and Mas-Coma (1997). The 18S rDNA se(MC) of the storage media, weight loss, and firmness of rhizomes quences were amplified by polymerase chain reaction (PCR) using
were measured every 7 d for 12 rhizomes.
the following primers:

Figure 1Growth of Mortierella sp. (2 d after


inoculation). The plates with cinnamon oil
(500 ppm) were inoculated with 50 L (2
106 spores/mL) of Mortierella sp. After 4 d
incubation, each plate was washed with 1 mL
of sterile water, and the liquid was transferred
to fresh culture media without essential oil
(MFC groupbottom 2 rows). Then, as a
control, part of the plates with fresh culture
media and the liquid were inoculated with 50
L (2 106 spores/mL) of Mortierella sp. (top
2 rows). Ten replicates were used for each of
the 2 conditions.

M594 Journal of Food Science r Vol. 79, Nr. 4, 2014

Storage of baby ginger . . .

Primers were obtained from Sangon Biotech Co. Ltd (Shanghai,


China). PCR was performed as previously described (Zhao and
others 2009). Fragments of 18S rDNA were sequenced using an
ABI PRISM 3730 DNA Sequencer produced by Applied Biosystems (Norwalk, Conn., U.S.A.) according to the manufacturers
instructions. The sequences obtained were submitted to GenBank
for homology search with the Basic Local Alignment Search Tool
(BLAST).

In vitro antifungal activity test


Essential oils from Illicium verum (star anise), Thymus vulgaris
(thyme), Syzygium aromaticum (clove), Cymbopogon citratus (lemongrass), Cinnamomum zeylanicum (cinnamon), Litsea cubeba (litsea),
Melaleuca alternifolia (tea tree), Herba Menthae (geraniol), Pelargonium graveolens (peppermint), and Ocimum basilicum (basil) are
thought to have inhibitory effects on 1 or more pathogens and
were chosen for the inhibition tests (Bakkali and others 2008).
The antifungal activity of each essential oil was tested against the
pathogens following the poisoned food technique (Singh and others 2005) at concentrations of 2000 ppm. All tests were performed
in triplicates. The efficacy of each treatment was evaluated by
measuring the average perpendicular diameter of 2 colonies, using
digital calipers (Absolute Digimatic-Mitutoyo Corp., Japan). The
rate of radial growth inhibition for fungi by each oil, in comparison with the control (without essential oils), was calculated on
the 5th d, using the following formula (Albuquerque and others
2006):

carried out in duplicates using the poisoned food technique, with


concentrations of 2000 to 16 ppm by half dilution method. The
control and treated plates were spot inoculated with 50 L (2
106 spores/mL) of each fungus. All culture dishes were incubated at 30 C for 4 d. The MIC value was determined as the
lowest concentration of the essential oil at which fungal growth
was absent.
Each culture dish containing a concentration greater than the
MIC was washed with 1 mL of sterile water, and the liquid was
transferred to fresh culture media without essential oil. As a control, some of the plates containing fresh culture media and the
liquid were inoculated again with 50 L (2 106 spores/mL) of
each fungus.
The treatment and control groups were observed and recorded
after 4 d in culture at 30 C. The essential oil concentration
corresponding to <5 pathogen colonies was considered as the
minimal fungicidal concentration (MFC). Normal growth was
observed in the control groups (Figure 1).

Ultrastructural observation
The 2-day-old fungus cultures were fumigated with essential oil
at concentrations 2 times greater than their own MIC. Cells were
prepared for transmission electron microscopy (TEM) as described
by Park and others (2007). Ultra-thin sections (approximately 50nm thick) were cut with a diamond knife using an ultra-microtome
(MT-X; RMC Inc., New York, N.Y., U.S.A.). The sections were
observed with TEM (H-600; Hitachi Ltd., Japan) operated at an
accelerating voltage of 80 kV.

In vivo antifungal activity test


The rhizomes were fumigated prior to storage because gas diffuInhibition rate = [(d c d t ) /d c ] 100
sion in the storage media was not as efficient as in air. Considering
the impact of temperature on fumigation and the necessity of a
where dc represents colony diameter for the control sets and dt
closed environment during treatment, the fumigation time should
represents colony diameter for the treatment sets.
be short to avoid wilting of rhizomes. A preliminary test was performed to choose an appropriate processing time from 4, 8, 12,
Drug sensitivity test
or 24 h at 25 C.
To determine the minimum inhibitory concentration (MIC) of
Healthy rhizomes used for evaluation of in vivo antifungal efthe essential oils that showed absolute antifungal effect, tests were
fect were washed in water, air dried, and cut into fingers. For
each essential oil concentration, 300 rhizome fingers were divided
for 6 replicates. In treatment sets, cinnamon oil (determined by
MFC test) was introduced separately into sealable plastic containers (21-L capacity) by applying them evenly onto culture dishes.
The actual oil usage depended on its MFC value and half of the
containers volume. Total volume of rhizomes was roughly equivalent to that. The open culture dish was placed at the bottom of
plastic containers and wire netting was used to separate the dishes
from the rhizomes. After fumigation, all rhizomes were placed
into PE bags filled with storage media and stored at 12 C. The
contamination rates were recorded after 30 d.
Statistical analysis
One-way analysis of variance (ANOVA) using SPSS (Version
17.0, SPSS Inc., Chicago, Ill., U.S.A.) was performed and means
were separated by Duncans multiple range test. MC of storage
media, firmness and weight loss rate of rhizomes, inhibition rates
of toxic media, and infection rates from in vivo tests were analyzed.

Figure 2The trends of moisture content change at 10 C and 90% RH over


21 d. Nine treatments consisting of different ratios of water and SAP were
set. Error bars represent the standard error. IMC, initial moisture content; Results and Discussion
3 levels (10%, 20%, and 30%) were established; MC-7D, moisture content
Initial MC (IMC) and MC after 21 d (MC-21) were not sigof each media on day 7; MC-14D, moisture content of each media on day nificantly different in media consisting of 20% IMC + 3.75%
14; MC-21D, moisture content of each media on day 21.

SAP or 30% IMC + 5 % SAP (Figure 2). This indicates that the
Vol. 79, Nr. 4, 2014 r Journal of Food Science M595

M: Food Microbiology
& Safety

NS1 (5 GTAGTCATATGCTTGTCTC 3)
NS6 (5 GCATCACAGACCTGTTATTGCCTC 3)

Storage of baby ginger . . .


Table 1Moisture content of media and firmness and weight loss of rhizomes after 21 d.
Medium
Initial moisture
content (IMC) (%)
10
20
30

Super absorbent
polymer content (%)

Moisture content
(%)

Firmness
(Kgf/cm2 )

Weight loss
(%)

2.5
3.75
5
2.5
3.75
5
2.5
3.75
5

13.5 f
15.2 ef
16.5 de
17.8 d
21.0 c
24.4 b
21.0 c
24.5 b
30.2 a

5.6 def
4.6 fg
4.2 g
7.0 bc
8.3 a
7.4 ab
6.3 bcd
5.9 cde
5.0 efg

13.1 a
11.3 ab
10.7 b
7.9 c
5.3 d
5.5 cd
5.2 d
5.5 d
4.9 d

Moisture content of media on day 21.


Different letters (a to f) indicate significant differences according to ANOVA test (P 0.05). n = 6 (moisture content); n = 10 (firmness and weight loss). In each column, values
followed by the same letter do not differ significantly according to Duncans multiple range test.

Table 2Identification of the microbial species by sequencing of the PCR-purified 18S rDNA gene of the pathogens.
IMC of medium
(days of storage)
30% IMC (14 d)
20% IMC (21 d)
30% IMC (14 d)
20% IMC (14 d)
All IMC (7 d)

Sequence ID

Closest match

Identity (%)

Closest match
(accession no.)

KC833482.1

Penicillium sp.

99

JX134614.1

KC833483.1

Mortierella sp.

98

EU428773.1

KC833484.1

Fusarium sp.

99

AF548073.1

M: Food Microbiology
& Safety

storage media maintained appropriate moisture balance in these


treatments. MC of 10% IMC medium continued to increase over
21 d (Figure 2). The MC of the 5% SAP medium was significantly
higher than that of the 2.5% SAP medium after 21 d (Table 1).
The weight loss rates of rhizomes stored in all media in this group
were >10%, and their firmness decreased because of wilting.
Among the 30% IMC groups, the MC change in the 5% SAP
medium was <5%, whereas that in the 2.5% and 3.75% SAP
media was 22.6% and 15.3%, respectively (Table 1). Although
the rhizomes stored in these media had the lowest weight loss,
their firmness was remarkably lower than that in most of the other
groups. This indicates that rhizomes stored in these high-MC
media did not wilt, but rotted.
After 21 d, fluctuation of MC in the medium consisting of 20
% IMC + 3.75 %SAP was also <5%, whereas the changes in MC
in the 2.5% and 5% SAP media in the same group were 20.5%
and 21.8%, respectively. The weight loss of rhizomes stored in the
20% IMC and 5% SAP media was remarkably lower than that in
media with low MC (17.8%), but was not significantly different
from higher MC media (24.4%, Table 1). The MC of the 20%
IMC and 5% SAP media did not change even when accidentally
exposed to room temperature (25 C) for 1 h during storage.
Four kinds of fungi and 3 kinds of bacteria were isolated from the
contaminated rhizomes stored in media. Three fungal strains were
identified and isolated again from contaminated parts of rhizomes
in the pathogen test.
The results of 18S rDNA sequence analysis showed that the rhizomes were contaminated with Penicillium, Mortierella, and Fusarium. Fusarium was present on rhizomes stored in all media after 7
d; Mortierella, on rhizomes stored in 20% IMC after 21 d and 30%
IMC after 14 d; and Penicillium, on rhizomes stored in both 30%
IMC and 20% IMC after 14 d (Table 2).
The antifungal activities of the toxic media in vitro are shown in
Table 3. Thyme and cinnamon oil completely inhibited growth
of all 3 pathogens. Both basil and clove oil completely inhibited
the growth of Fusarium and Penicillium, but were ineffective on
M596 Journal of Food Science r Vol. 79, Nr. 4, 2014

Mortierella. Litsea essential oil only inhibited the growth of Fusarium. The other essential oils had no inhibitory effects at the tested
concentrations.
The MIC of thyme oil on Penicillium, Mortierella, and Fusarium
was 500, 250, and 62.5 ppm respectively; its MFC on the former 2 was >1000 ppm. Penicillium and Mortierella showed higher
drug susceptibility toward cinnamon oil than thyme oil, indicating
the superior antifungal effect of cinnamon oil. Furthermore, the
MIC/MFC value on Mortierella was 16, whereas that on Penicillium
and Fusarium was 4.
The in vivo test indicated that the natural infection rate of Penicillium in control group was significantly lower than that of the
other fungi (P 0.01). The infection rate of Fusarium was significantly lower than that of other pathogens when treated with
cinnamon oil at concentration of 125 ppm and did not change
significantly when the concentration increased. Thus, the susceptibility of Fusarium to cinnamon oil was greater than that of other
pathogens, a result that was consistent with the MFC test (Table 4).
The infection rates of neither Penicillium nor Fusarium were significantly different between cinnamon oil fumigation at 250 and
500 ppm. However, infection rates of Mortierella were very remarkably different among each group. Cinnamon oil at concentration
of 500 ppm corresponded to infection rates of 50.3%, 54.3%, and
60.7% greater than those of the control in Penicillium, Fusarium,
and Mortierella, respectively (Figure 3).
Different levels of browning were observed during storage after fumigating for 8, 12, and 24 h with 500 ppm of cinnamon
oil. Additional experiments were conducted to exclude the physiological degradation caused by high temperature and RH. The
concentration of cinnamon oil was increased to 1000 ppm and
the processing time was reduced to 4 h. Under these conditions,
browning occurred again at the wound sites (the joints of leaf
sheath and stem).
To investigate the relationship between the effect of the essential
oil on the microstructure of the pathogenic fungi, the morphological changes in mycelia were observed by TEM (Figure 4A to 4I).

Storage of baby ginger . . .


Table 3Inhibition rates of toxic media Sabourands agar (SDA) on mycelial growth of pathogenic fungi after 4 d of incubation at
30 C.
Essential oils

% Inhibition of target fungi


Penicillium sp.
kl

1 Illicium verum (star anise)

17.76
(0.37)
100.0 a
(0.00)
100.0 a
(0.00)
36.93 f
(2.15)
100.0 a
(0.00)
10.89 n
(1.21)
13.23 m
(0.44)
6.53 o
(0.15)
17.16 l
(0.44)
100.0 a
(0.00)

2 Thymus vulgaris (thyme)


3 Syzygium aromaticum (clove)
4 Cymbopogon citratus (lemongrass)
5 Cinnamomum zeylanicum (cinnamon)
6 Litsea cubeba (litsea)
7 Melaleuca alternifolia (tea tree)
8 Herba Menthae (geraniol)
9 Pelargonium graveolens (peppermint)
10 Ocimum basilicum (basil)

Fusarium sp.

Mortierella sp.

7.94 o
(0.26)
100.0 a
(0.00)
100.0 a
(0.00)
27.76 h
(1.95)
100.0 a
(0.00)
87.93 b
(0.63)
51.58 e
(0.22)
19.69 jk
(0.16)
33.39 g
(0.39)
100.0 a
(0.00)

10.25 n
(0.30)
100.0 a
(0.00)
54.80 d
(0.94)
21.57 ij
(0.28)
100.0 a
(0.00)
18.61 kl
(0.43)
36.79 f
(0.14)
23.25 i
(0.81)
33.23 g
(0.61)
59.12 c
(0.24)

Fumigation with essential oil resulted in differing morphology of


pathogenic fungi compared with that of the controls. The mycelia
of controls had smooth cell walls, intact cellular membranes, and
uniform cytoplasm (Figure 4A, 4D, and 4G). After fumigation, the
cell walls of Penicillium and Fusarium showed distinct morphological changes; they became swollen and then ruptured. Some of the
sections showed uneven and fluffy walls (Figure 4B, 4C, and 4E);
other sections were devoid of cell wall, with the plasma membrane
still intact but exposed to the medium or ruptured and releasing
cytoplasmic remnants into the medium (Figure 4C and 4F). The
microstructural changes in Mortierella were different from those of
other fungi. Few swollen cell walls were observed in Mortierella;
most of the mycelia showed disorganized inner structures
(Figure 4H) and dissolved intracellular membranes (Figure 4I).
The improvement of storage media over traditional methods is
physiologically feasible, but will increase transportation costs. It
may be applied to storage system in the region of origin or in
the market because of the low precision required for temperature
control and treatments. However, the lack of sunlight in the storage
medium could help prevent rhizomes from oxidizing and turning
green. The SAP used for storage media costs 40 cents per kg baby
ginger.
Although a closed environment, higher temperature, and higher
RH are generally used in pathogen tests, these conditions are
improper for baby ginger storage. Because of its physical properties, the rhizomes of baby ginger would rot in high RH and
closed packaging conditions or wilt at high temperatures. In

such conditions, the decay could be caused by pathogens or by


physiological reactions. Therefore, all rhizomes used in the experiments described above were stored in the respective media
at 12 C.
Fusarium was found on the surface of rhizomes in all media on
the 7th d; thus, Fusarium is the dominant fungal pathogen among
the 3 pathogens present during storage (Stirling 2004). Moreover,
diseases caused by Fusarium may not be geographically restricted.
Our results for Penicillium and Fusarium are consistent with studies on Chinese yam, and taro (Overy and Frosvad 2005; Fatima

Table 4Minimum inhibitory concentration (MIC) and minimal


fungicidal concentration (MFC) of thyme and cinnamon essential oil on pathogenic fungi.
Pathogenic fungus

Penicillium sp.
Fusarium sp.
Mortierella sp.

MIC (ppm)

MFC (ppm)

Thyme

Cinnamon

Thyme

Cinnamon

500
62.5
250

125
62.5
32

2000
250
2000

500
250
500

Figure 3Effects of cinnamon essential oil on development of natural infection in unwounded baby ginger. The concentrations of cinnamon oil are
determined by the MFC test. Fungal species were represented by Penicillium, Fusarium, and Mortierella sp. Different letters (A to F) above the error
bars indicate significant differences (P 0.01) between various species
and concentrations by ANOVA. n = 6. Values with the same letter do not
differ significantly according to Duncans multiple range test.
Vol. 79, Nr. 4, 2014 r Journal of Food Science M597

M: Food Microbiology
& Safety

The concentration of each essential oil was 2000 ppm.


Different letters indicate significant differences between both generals and essential oils according to ANOVA tests (P 0.05). n = 3.

Storage of baby ginger . . .


and others 2009). Very few studies have shown that Mortierella is
pathogenic. Most studies on Mortierella have focused on the production of fatty acids (Zeng and others 2012). However, in our
study, baby ginger was infected by Mortierella, rotting occurred,
and the natural infection rate approached 70% in the in vivo test.
This evidence demonstrated that Mortierella is pathogenic to baby
ginger.
Cinnamon oil has been shown to have good inhibitory effect on Penicillium, Mucor dimorphosporus (Zygomycetes), Rhizopus
sp.(Zygomycetes), and Fusarium moniliforme (Matan and others 2006,
2011). These reports are in agreement with our finding that cinnamon oil could cause complete inhibition of the 3 pathogens
identified. Thyme oil can totally inhibit Penicillium and Fusarium
(Kumar and others 2008; Perez-Alfonso and others 2012). Our
results for tea tree and lemongrass oil on Penicillium and Fusarium are not inconsistent with findings reported by Hammer and
others (2003) and Velluti (2004). Contradictory findings may be
because of the different pathogens and the concentrations of oils
used. Clove and basil oils were not chosen for further experiments
because we did not observe significant effects of these oils on
Mortierella.
The MIC test was performed to choose the most efficient essential oil. Ten different essential oils were used in the tests described

here of which cinnamon oil as a fungicide was most efficient


(MIC < 62.5 ppm). In fungal cultures treated with cinnamon oil
at MIC, growth could have resumed if the cultures were transferred
to growth favorable conditions.
The MFC was different from the MIC. MFC was the concentration of essential oil at which absolute and irreversible death of
pathogens occurred. The MFC test was performed to determine
the concentration of essential oil to be used in the in vivo test
or for actual storage. The cost of fumigation was 4 cents per kg
when fumigant concentration was 500 ppm (MFC 500 ppm).
There may be other essential oils that have good antifungal effect
on these pathogens.
In vivo studies on cinnamon oil confirmed its potential as an
effective antifungal agent against various pathogens. Our results
demonstrate that cinnamon oil significantly reduced decay in
unwounded baby ginger. However, it could not completely inhibit pathogens even at 500 ppm concentration. This is in accord
with early research by Farbood and others (1976) who suggested
that higher concentrations of plant essential oils are required in
foods than in laboratory media. The duration of fumigation and
concentration of oil are also important reasons for incomplete inhibition. Browning occurs when the concentration and processing
time are inappropriate. In recent years, numerous reports have

M: Food Microbiology
& Safety

Figure 4Changes in cell wall morphology


induced by fumigation treatments. Bar = 1
m. The figures (A) to (C), (D) to (F), and (G)
to (I) are transmission electron microscopy
images of treated mycelia of Penicillium sp.,
Fusarium sp., and Mortierella sp. respectively.
(A), (D), and (G) TEM of untreated mycelia of
the 3 fungal genera showing the relatively
smooth contour and uniform thickness of the
outer cell wall. (B) and (E) Swollen cell walls
with irregular thickness. (C) and (F)
Plasmolysis and leakage of cytoplasm after
cell wall ruptured. (H) The beginning of
disorganization in cytoplasm. (I) Destruction
of endomembrane.

M598 Journal of Food Science r Vol. 79, Nr. 4, 2014

Storage of baby ginger . . .

Conclusions
We identified optimal storage media for baby ginger that could
maintain the rhizomes with relatively small variations in firmness
and weight at 12 C. This method can be employed for storage of
fresh fruits and vegetables with high MC and tender skin. New,
environmentally benign, light granular materials that can replace
sand in the storage medium and be used for transportation need
to be identified.
Cinnamon oil seems to be a promising potential fumigant;
however, very long processing times and high oil concentrations will cause damage to ginger. Detailed sensory evaluation
will be required to study the effect of fumigation on sensory
characteristics of baby ginger. We prolonged the storage time to
30 d; this period of storage could be extended in future studies.
We are currently investigating the effects of variation in nutrient composition and aromatic components. A proper method
for preventing baby ginger from browning also needs to be
identified.

Acknowledgments
The research was supported by Foundation for the Author of
Doctoral Dissertation of Sichuan Agriculture Univ.

Author Contributions
Ji Liu designed the study, drafted the manuscript, and interpreted
the results. Guoliang Sui, Yongzhou He, Jing Yan, Shuxiang Liu,
and Dongjie Liu collected test data.

References
Albuquerque CC, Camara TR, Willadino RDR, Marcelino LC, Ulisses C. 2006. Antimicrobial
action of the essential oil of Lippia gracilis Schauer. Braz Arch Biol Technol 49:52735.
Armstrong JS. 2006. Mitochondrial membrane permeabilization: the sine qua non for cell death.
BioEssays 28:25360.
Bakass M, Mokhlisse A, Lallemant M. 2001. Absorption and desorption of liquid water by a
superabsorbent polymer: effect of polymer in the drying of the soil and the quality of certain
plants. J Appl Polym Sci 83:23443.
Bakkali F, Averbeck S, Averbeck D, Idaomar M. 2008. Biological effects of essential oilsa
review. Food Chem Toxicol 46:44675.
Bargues MD, Mas-Coma S. 1997. Phylogenetic analysis of lymnaeid snails based on 18S rDNA
sequences. Mol Biol Evol 14:56977.
Burt S. 2004. Essential oils: their antibacterial properties and potential applications in foodsa
review. Intl J Food Microbiol 94:22353.
Carman T. 2011. Growing baby ginger: farmers find its worth the fuss.
The Washington Post. Available from: <http://articles.washingtonpost.com/2011-1018/lifestyle/35280435_1_ginger-mature -rhizomes-crop>. Accessed 2011 October 18.
Farbood ML, MacNeil JH, Ostovar K. 1976. Effect of rosemary spice extract on growth of
microorganisms in meats. J Milk Food Technol 39:6759.
Fatima NF, Batool H, Sultana V, Ara J, Ehteshamul S. 2009. Prevalence of post-harvest rot of
vegetables and fruits in Karachi, Pakistan. Pak J Bot 41:318590.
Hammer KA, Carson CF, Riley TV. 2003. Antifungal activity of the components of Melaleuca
alternifolia (tea tree) oil. J Appl Microbiol 95:85360.
Ibrahim MA, Kainulainen P, Aflatyni A. 2001. Insecticidal, repellent, antimicrobial activity and
phytotoxicity of essential oils: with special reference to limonene and its suitability for control
of insect pests. Agric Food Sci 10:24359.
Kumar A, Shukla R, Singh P, Prasad CS, Dubey NK. 2008. Assessment of Thymus vulgaris
L. essential oil as a safe botanical preservative against postharvest fungal infestation of food
commodities. Innov Food Sci Emerg 9:57580.
Lambert RJW, Skandamis PN, Coote P, Nychas GJE. 2001. A study of the minimum inhibitory
concentration and mode of action of oregano essential oil, thymol and carvacrol. J Appl
Microbiol 91:45362.
Lee S, Tsao R, Peterson C, Coats JR. 1997. Insecticidal activity of monoterpenoids to western
Corn rootworm (Coleoptera: Chrysomelidae), Twospotted Spider Mite (Acari: Tetranychidae), and House Fly (Diptera: Muscidae). Entomol Soc Am 90:88392.
Medina MS, Tudela JA, Marn A, Allende A, Gil, MI. 2012. Short postharvest storage under low
relative humidity improves quality and shelf life of minimally processed baby spinach (Spinacia
oleracea L.). Postharvest Biol Technol 67:19.
Matan N, Rimkeeree H, Mawson AJ, Chompreeda PH, Aruthaithanasan V, Parker M. 2006.
Antimicrobial activity of cinnamon and clove oils under modified atmosphere conditions. Intl
J Food Microbiol 107:1805.
Matan N, Saengkrajanga W, Matanb N. 2011. Antifungal activities of essential oils applied by
dip-treatment on areca palm (Areca catechu) leaf sheath and persistence of their potency upon
storage. Intl Biodeter Biodegr 65:2126.
Oussalah M, Caillet S, Lacroix M. 2006. Mechanism of action of Spanish oregano, Chinese
cinnamon, and savory essential oils against cell membranes and walls of Escherichia coli O157:H7
and Listeria monocytogenes. J Food Prot 5:10461055.
Overy DP, Frisvad JC. 2005. Mycotoxin production and postharvest storage rot of ginger
(Zingiber officinale) by penicillium brevicompactum. Intl Assoc Food Protection 68:6079.
Park MJ, Gwak KS, Yang I, Choi WS, Jo HJ, Chang JW, Jeung EB, Choi IG. 2007. Antifungal
activities of the essential oils in Syzygium aromaticum (L.) Merr. Et Perry and Leptospermum
petersonii Bailey and their constituents against various dermatophytes. Microbiol Soc Korea
45:4605.
Parveen M, Hasan MK, Takahash J, Murata Y, Kitagawa E, Kodama O, Iwahashi H. 2004.
Response of Saccharomyces cerevisiae to a monoterpene: evaluation of antifungal potential by
DNA microarray analysis. J Antimicrob Chemother 54:4655.
Perez-Alfonso CO, Martnez-Romero D, Zapata PJ, Serrano M, Valero D, Castillo S. 2012.
The effects of essential oils carvacrol and thymol on growth of Penicillium digitatum and P.
italicum involved in lemon decay. Intl J Food Microbiol 158:1016.
Policegoudra RS, Aradhya SM. 2007. Biochemical changes and antioxidant activity of mango
ginger (Curcuma amada Roxb.) rhizomes during postharvest storage at different temperatures.
Postharvest Biol Technol 46:18994.
Singh G, Maurya S, De Lampasona MP, Catalan C. 2005. Chemical constituents, antimicrobial
investigations, and antioxidative potentials of Anethum graveolens L. essential oil and acetone
extract. J Food Sci 70:20815.
Stirling AM. 2002. Erwinia chrysanthemi, the cause of soft rot in ginger (Zingiber officinale) in
Australia. Australas Plant Path 31:41920.
Stirling AM. 2004. The causes of poor establishment of ginger (Zingiber officinale) in Queensland,
Australia. Australas Plant Path 33:20310.
Velluti A, Sanchis V, Ramos AJ. 2004. Effect of essential oils of cinnamon, clove, lemon grass,
oregano and palmarosa on growth of and fumonisin B1 production by Fusarium verticillioides
in maize. J Sci Food Agric 84:11416.
Vero S, Mondino P, Burgueno J, Soubes M, Wisniewski M. 2002. Characterization of biocontrol
activity of two yeast strains from Uruguay blue mould of apple. Postharvest Biol Technol
26:919.
Zeng Y, Ji XJ, Chang SM, Nie ZK, Huang H. 2012. Improving arachidonic acid accumulation in
Mortierella alpina through B-group vitamin addition. Bioprocess Biosystems Engr 35:6838.
Zhao K, Ping W, Li Q, Hao S, Zhao L, Gao T, Zhou D. 2009. Aspergillus niger var. taxi, a
new species variant of taxol-producing fungus isolated from Taxus cuspidata in China. J Appl
Microbiol 107:12027.

Vol. 79, Nr. 4, 2014 r Journal of Food Science M599

M: Food Microbiology
& Safety

described the antimicrobial activities of essential oils, but very few


have mentioned their damaging effects on fruits and vegetables.
Moreover, essential oils have been historically used as herbicides.
Some essential oils have shown cytotoxicity to maize and corn (Lee
and others 1997; Ibrahim and others 2001). In addition, the tender
skin, unavoidable mechanical damage, and high polyphenol content could be important reasons for browning. The mechanisms
of browning are thus unclear, and further research is warranted on
the antifungal effects and cytotoxicity of constituents of cinnamon
oil. In this study, we did not test whether cinnamon oil fumigation affects the sensory characteristics of ginger. Detailed sensory
evaluation will need to be performed to confirm that cinnamon
oil does not adversely affect the sensory characteristics of ginger
during storage.
TEM revealed blurring of intracellular structures with swollen
and broken cell walls; this could be because essential oils can alter
the permeability and fluidity of biological membranes (Armstrong
2006). We thought that all of the symptoms caused by the essential
oil began with membrane damage. However, molecular studies
suggest that essential oil can modulate gene expression. Terpinene,
the active constituent of cinnamon oil, has been shown to affect
the expression of genes involved in lipid metabolism, maintenance
of cell wall structure and function, detoxification, and cellular
transport (Parveen and others 2004). Damage to the cell wall
and membrane can lead to leakage of macromolecules and lysis
(Lambert and others 2001; Oussalah and others 2006), consistent
with the results obtained for Penicillium and Fusarium. However,
the cell walls and membranes of Mortierella appeared normal. Low
concentrations of cinnamon oil inhibited the growth of Mortierella,
but did not kill it. This indicates that Mortierella is sensitive to
cinnamon oil, but probably has protective mechanisms that are
different from those of Penicillium and Fusarium. Some Mortierella
spp. can produce unsaturated fatty acids; thus, species belonging to
this genus may have higher levels of unsaturated fatty acids on their
cell membranes. Further research is needed to reveal whether the
composition of membrane lipids in pathogens is related to toxin
resistance.