Mutations of the Core Promoter and Response to Interferon

Treatment in Chronic Replicative Hepatitis B

ANDREAS ERHARDT,1 ULF REINEKE,1 DIRK BLONDIN,1 WOLFRAM HUBERT GERLICH,2 ORTWIN ADAMS,3
TOBIAS HEINTGES,1 CLAUS NIEDERAU,1 AND DIETER HAUSSINGER1

In chronic replicative hepatitis B the significance of

mutations in the basic core promoter (BCP), core upstream
regulatory sequences (CURS) and negative regulatory element (NRE) for response to interferon (IFN) is unknown. A
sequence analysis of the NRE, CURS, BCP, and precore
region was performed from sera of 96 patients with chronic
replicative hepatitis B (64 hepatitis B e antigen [HBeAg]positive patients and 32 HBeAg-negative patients) treated
with alfa-IFN (IFN-a). The overall sustained response (SR)
rate to IFN was 30% with no significant difference between
HBeAg-positive and HBeAg-negative patients. IFN responsiveness correlated to hepatitis B virus (HBV)-DNA levels,
hepatitis B surface antigen (HBsAg) levels, the number of
mutations in the complete BCP, especially nucleotide (nt)
region 1753 to 1766 and mutations at nt 1762 and 1764. In
HBeAg-positive hepatitis, SR to IFN was associated with a
high number of mutations in the BCP (P F .04) and nucleotide
region 1753 to 1766 (P F .015) as well as mutations at
nucleotide 1764 (P F .007). In HBeAg-negative hepatitis,
SR to IFN correlated with a low number of mutations in the
BCP (P F .04) and nucleotide region 1753 to 1766 (P F .02)
and a wild-type sequence at nt 1764 (P F .003). Prediction of
IFN response was possible on the basis of nt 1764 in 77% of
HBeAg-positive patients and 78% of HBeAg-negative patients. IFN response did not correlate with the occurrence
of the 1896 mutation, mutations in the CURS or NRE, disease
duration, ethnic origin of the patient, alanine transaminase
(ALT) levels and HBV genotype. Our data suggest that HBV
genome mutations located within the BCP are determinants
of a response to IFN therapy. (HEPATOLOGY 2000;31:716-725.)

Abbreviations: HBV, hepatitis B virus; IFN, interferon; HBeAg, hepatitis B e antigen;

ALT, alanine transaminase; HDV, hepatitis delta virus; HIV, human immunodeficiency
virus; BCP, basic core promoter; nt, nucleotide; CURS, core upstream regulatory
sequences; NRE, negative regulatory element; mRNA, messenger RNA; HBsAg, hepatitis
B surface antigen; HCV, hepatitis C virus; PEI-U, Paul-Ehrlich-Institute units; PCR,
polymerase chain reaction.
From the 1Department of Internal Medicine, Division of Gastroenterology, Hepatology, and Infectious Diseases, Heinrich-Heine-University of Dusseldorf, Dusseldorf,
Germany; 2Institut fur Medizinische Virologie, Justus-Liebig-Universitat Giessen,
Giessen, Germany; and 3Institut fur Medizinische Mikrobiologie und Virologie,
Heinrich-Heine-University of Dusseldorf, Dusseldorf, Germany.
Received April 13, 1999; accepted November 24, 1999.
Supported by the Deutsche Forschungsgemeinschaft (Gottfried W. Leibniz Prize to D.H.).
Address reprint requests to: Andreas Erhardt, M.D., Klinik fur Gastroenterologie,
Hepatologie und Infektiologie, Heinrich-Heine-Universitat Dusseldorf, Moorenstr. 5,
D-40225 Dusseldorf, Germany. E-mail: erhardt@uni-duesseldorf.de; fax: (49) 2119346842.
Copyright r 2000 by the American Association for the Study of Liver Diseases.
0270-9139/00/3103-0023$3.00/0

Chronic hepatitis B virus (HBV) is one of the leading

infectious diseases worldwide associated with high morbidity
and mortality.1 Successful interferon (IFN) treatment improves the long-term clinical outcome.2 Only 30% to 40% of
hepatitis B e antigen (HBeAg)-positive and 10% to 50% of
HBeAg-negative patients are reported to respond to IFN
monotherapy. The aim of this study was to investigate
molecular viral parameters for prediction of IFN response.
Most studies so far have shown that for HBeAg-positive
patients low transaminase levels (alanine transaminase [ALT]
,200 U/L), high viral replication (HBV DNA .300 pg/mL),
long duration of disease, and low inflammatory score in liver
histology2-4 are associated with low response rates to IFN
therapy. Furthermore, hepatitis delta virus (HDV) coinfection, human immunodeficiency virus (HIV) coinfection, and
chronic dialysis negatively influence IFN response in chronic
hepatitis B. The significance of the HBeAg status for the
long-term outcome after IFN therapy is still under debate. It
has been reported that HBeAg-negative status is associated
with a high relapse rate and a poor sustained response of 10%
to IFN therapy.5-9 However, these data contrast with sustained
response rates of 25% to 50% in HBeAg-negative patients.10-14
Genetic viral factors have been poorly investigated for their
effect on the outcome of IFN therapy. As yet, attention has
focused on the precore region, the G1896A mutation in the
precore region, and the core gene of HBV. The occurrence of
the G1896A mutation, converting a tryptophane (TGG) into
a translational stop codon (TAG), has been reported to be
associated with a bad prognosis15-17 and a poor response to
IFN therapy6 in replicative hepatitis B negative for HBeAg.
However, the results are controversial.10-12,18,19 Mutations in
the polymerase gene play an important role for resistance to
nucleoside analogues, but do not seem to have an effect on
the outcome of IFN therapy. Whether variations of the core
gene affect the response to IFN is under discussion.20-22 As yet
the relevance of mutations of the HBV X gene and the core
promoter region for responsiveness to IFN has not been
evaluated.
The basic core promoter (BCP; at nucleotide [nt] region
1742-1849), the core upstream regulatory sequences (CURS;
at nt region 1643-1742), and the negative regulatory element
(NRE; at nt region 1611-1634) are located mainly in the HBV
X gene and play an important role in replication and hepatitis
B core antigen/HBeAg formation. Formation of the 3.5-kb
pregenome messenger RNA (mRNA), which serves for translation of the core and polymerase proteins, and the precore/
core mRNA for translation of HBeAg is controlled by the BCP
and CURS. The NRE abolishes the function of the CURS and
BCP (Fig. 1). Within these regions various mutations have

716

HEPATOLOGY Vol. 31, No. 3, 2000

ERHARDT ET AL.

717

FIG. 1. Map of the X and precore/

core gene. The nucleotide sequence
with the HNF (hepatocyte nuclear
factor), COUP (chicken ovary upstream promoter) transcription factor binding sites is indicated at the
bottom. Abbreviations: DR, direct
repeat; Enh, enhancer; e, encapsidation signal. Numbering according to
EcoRI restriction site as 0.

been described affecting the precore start codon,23 the encapsidation signal,24 and the core promoter region.25-28 The most
common of these nucleotide exchanges is a G1764A mutation, which is often associated with an A1762T mutation.27
The G1764A mutation is located within the BCP, upstream of
the pregenome and precore/core mRNA initiation sites and
may thus be involved in transcriptional regulation.
To determine predictive parameters for responsiveness to
IFN treatment, an assessment of clinical parameters and a
sequence analysis of the complete NRE, CURS, BCP, and
precore region was performed in 96 patients with chronic
replicative hepatitis B.
PATIENTS AND METHODS
Patients. Ninety-six patients treated with IFN between March
1988 and December 1998 at our center were enrolled. All patients
had completed a post-treatment follow-up of at least 6 months and
had available pretreatment serum samples. Thirty-two of the 96
patients had an HBeAg-negative replicative hepatitis B.
A patient was considered to have chronic replicative hepatitis B if
hepatitis B surface antigen (HBsAg) and HBV DNA were tested
positive at least twice over a 6-month interval. Determination of
HBeAg status was done by analysis of 2 different serum samples
collected 6 months apart. All patients but 2 had elevated serum ALT
for at least 6 months. None of the patients had markers of HDV,
hepatitis C virus (HCV), or HIV infection. Patients were treated with
3 3 5 or 3 3 6 million units IFN-a per week. Therapy was given for
4 to 6 months. Three HBeAg-negative patients (11%) were initially
treated with 2 million units IFN-a 3 times weekly preceded by a
short-term cortisone administration. Sustained response to IFN-a
was defined as persistent loss of HBV DNA in a hybridization assay
and normalization of ALT (,22 IU/mL for men and ,19 IU/mL for
women at 25C) after treatment cessation. In HBeAg-positive
patients seroconversion from HBeAg to HBe-antibody was further
required. Patients without sustained response were defined as
nonresponders.
Serological Tests. Markers of HBV (HBsAg, anti-HBs, HBeAg,
anti-HBe) and HDV (anti-HDV) were tested by commercial immunoassays (Abbott Laboratories, North Chicago, IL). For detection of

anti-HCV a commercial enzyme immunoassay (HCV 2nd generation

ELISA; Ortho Diagnostics, Raritan, NJ) was used. Anti-HIV was
detected by a commercial enzyme immunoassay (Abbott Laboratories). Serum HBV DNA was determined by a commercial standard
hybridization technique (Digene; Murex Diagnostika, Burgwedel,
Germany).29
Quantitative Assay of HBsAg and HBeAg. Quantitative assay of
HBsAg was done by Laurell electrophoresis as described30 with the
following modifications. Glass slides (3 3 2 inches) were coated
with 6 mL of 0.6% low-mr agarose containing 10,000 mIU/mL
polyvalent anti-HBs in Laurells buffer. Ten-microliter HBsAg samples
were run for 12 hours at 5 mA per slide. The length of the
precipation arc was converted to g HBsAg/mL using a calibration
curve and a reference serum. Samples containing greater than 30
g/mL were tested in dilution. The detection limit was 0.2 g/mL,
and the variation coefficient was 15%. One WHO unit of HBsAg
corresponds approximately to 0.5 ng HBsAg. Ng units from other
investigators, which have been differently calibrated using partially
inactive HBsAg, are usually higher. An accurate description of the
assay can be obtained from W. H. Gerlich (Institut fur Medizinische
Virologie, Justus-Liebig-Universitat Giessen, Giessen, Germany).
Quantitative assay of HBeAg was done of HBeAg-positive patients in
suitable serum dilutions using the Axsym 2.0 quantitative HBeAg
enzyme immunoassay (Abbott Diagnostics, Wiesbaden, Germany).
Results were expressed in Paul-Ehrlich-Institute Units (PEI-U).
HBV-DNA Extraction and Amplification for Sequencing. All investigated serum samples were drawn before IFN treatment. HBV DNA
was extracted from 10 L of serum using an alkaline extraction
procedure as described previously31 and amplified by polymerase
chain reaction (PCR). PCR was performed on 4-L DNA extract in a
100-L reaction containing (final concentration) 50 mmol/L KCl, 10
mmol/L Tris-HCl, 1.5 mmol/L MgCl2, 200 mmol/L of each of the 4
deoxynucleotide triphosphates (substitution of thymidine by uridine), 1 unit N-uracil-glycosylase (Boehringer Mannheim, Mannheim, Germany), 5 units Taq polymerase (Perkin Elmer Cetus,
Norwalk, CT) and 200 nmol/L of each of the external primers. For
amplification of the precore region 35 cycles were completed with
denaturation for 1 minute at 95C, annealing at 60C for 1 minute,
elongation for 2 minutes at 72C, and a final elongation step of 10
minutes. Primers used were sense 103 (TGTAAAACGACGGCCAGT-

718 ERHARDT ET AL.

HEPATOLOGY March 2000

GCCCAAGGTCTTACATAAGAGGAC; nt region 1639-1663; numeration with EcoRI restriction site as nt 0) with an M13 sequence at
the 58 terminus and antisense 104 (AAAGTTTCCCACCTTATGAGTCCA; nt region 2483-2460). If necessary a seminested PCR
was performed under modified conditions using 5 L of the first
round PCR, primer sense 103 and antisense 105 (CCGAGATTGAGATCTTCTGCGACGCGGCGATTGAGACC; nt region 24372400) and 20 cycles. Uracil-N-glycosylase was omitted in the
seminested protocol. For PCR amplification of the NRE, CURS, and
BCP the above protocol was slightly modified. Sense primer was 106
(TGTAAAACGACGGCCAGTAGCGCATGCGTGGAACC; nt region
1229-1245) and antisense primer was 107 (nt region 1783-1765;
CAGGAAACAGCTATGAGCAGCCTCCTAGTACAAAGA) both including an M13 sequence. Annealing temperature was 51C. For a
seminested protocol primer antisense 107 and sense 108 (CTCTGCCGATCCATACTG; nt region 1256-1273) were used. PCR was
performed twice to ensure reproducibility.
Sequencing. Amplified DNA was purified by filtration through
100,000 MWG centrifugal filter units (Millipore, Eschborn, Germany). Sequencing was performed using M13 forward primer
(GTAAAACGACGGCCAGT) and M13 reverse primer (CAGGAAACAGCTATGAC) by direct cycle sequencing with dye-labeled dideoxynucleotides according to the manufacturers instructions (Perkin
Elmer Cetus). After precipitation of the labeled reaction products
sequence analysis was performed on a 6% polyacrylamide urea gel
using an automated laser sequence analyzer (Applied Biosystem
373, Weiterstadt, Germany). A positive control was (pGEM-3Zf1)
included in each run.
Sequence Analysis. The obtained HBV X gene sequences were
compared with HBV databank entries of known HBV genotype32
with the following accession numbers: D00329, D00330, D00331,
D00630, D12980, D23677, D23678, D23679, D23684, L08805,
L27106, M12906, M32138, M38454, M38605, M54923, V00866,
V00867, V01460, X01587, X02496, X02763, X04615, X52939,
X59795, X69798, X75656, X75657, X75658, X75663, X75664, and
X75665. For alignments of DNA sequences and genotype analysis
the Lasergene Megalign software (DNAStar Inc., Madison, WI) was
used.
Statistical Analysis. Fishers exact test (two sided), Students t test,
Mann-Whitney test, and logistic regression were used to analyze the
data. Statistical analyses were done by using the SPSS program
(SPSS, Inc., Munich, Germany).
RESULTS

Clinical parameters and HBV-DNA sequence were investigated in 96 IFN-treated patients. Patients baseline clinical
characteristics are shown in Table 1. The distribution of
mutations is summarized in Table 2.
Sequence Analysis of NRE (1611-1634) and CURS (1643-1742).

The NRE was well conserved among all virus strains up to nt

position 1630 with only 4 nt exchanges. Mutational hot spots
were found at nt position 1631, 1634, 1635, and 1638.
Further mutations clustered at nt positions 1678, 1676, 1674,
and 1719 (Table 2).
Sequence Analysis of the Precore Region (1814-1901). The
G1896A mutation was found in 53% (17 of 32) of HBeAgnegative patients but in only 1.6% (1 of 64) of HBeAgpositive patients (P , .0005) and was associated with a
G1899A in 44% of cases (8 of 18).
Of the 15 patients not bearing the G1896A mutation, 2
carried a point mutation at the precore initiation codon
converting a methionine into a leucine or threonine and thus
preventing precore transcription. Two further patients (patients no. 19 and 18) had insertions of 1 or 2 additional
adenines at nt 1840 and nt leading to frameshifts. Patient no.
23 carried a deletion of 8 nucleotides in the precore open

TABLE 1. Clinical Parameters

Characteristics

All
Patients

HBeAgPositive
Patients

HBeAgNegative
Patients

Origin (low/high
56/40
39/25
17/15
prevalence)
Sex (m/f)
79/17
50/14
29/3
Age (yr)
Mean 6 SD:
38.5 6 1.4
36 6 1.7
43 6 2.2
Range:
18-68
18-68
20-67
DNA (Log pg/mL)
Mean 6 SD:
2.96 6 0.1 3.35 6 0.09 2.2 6 0.19
Range:
0-5.07
0-5.07
1-3.8
HBsAg (Log g/mL)
Mean 6 SD:
1.3 6 0.07 1.6 6 0.06 0.61 6 0.1
Range:
0-2.6
0.57-2.54
21-1.5
HBeAg (Log PEI
U/mL)
Mean 6 SD:

2.9 6 0.11

Range:

0.2-4.01

Disease duration
(mo)*
Mean 6 SD:
68 6 8.1
45 6 5.5
123 6 21
Range:
6-396
6-180
12-396
ALT (U/L)
Mean 6 SD:
115 6 11
104 6 13
137 6 18
Range:
8-713
8-713
29-451
Genotype A (%)
50
53
44
Genotype B (%)
4
6
0
Genotype C (%)
8
13
0
Genotype D (%)
38
28
56
Cirrhosis* (%)
19
11
35

Significance
HBeAgpos./neg.

NS
NS
P , .028
P , .0005
P , .0005

P , .0005

NS
NS
NS
P , .05
P , .013
P , .018

Abbreviation: NS, not significant.

*Data on disease duration were available in 88 and on cirrhosis in 92
patients.

reading frame. On the amino acid level 2 patients also

displayed transition of an essential cysteine to phenylalanine
(codon 23) near the signal peptidase cleavage site. Overall, 25
of 32 HBeAg-negative patients (78%) had mutations at the
nucleotide or amino acid level within the precore region,
which could explain HBeAg negativity.
Sequence Analysis of the BCP Region (1742-1849). The basic
core promoter comprises 3 AT-rich regions, a part of a
Kunitz-like serine protease inhibitor region (nt 1764-1797),
the direct repeat 1 (nt 1824-1834), the initiation sites of the
precore/core mRNA (nt 1790 6 1 and 1783/1784) and
pregenome mRNA (nt 1818) (Fig. 1). A sequence alignment
is depicted in Figs. 2 and 3.
A G1764A mutation was found in 30% (29 of 96) of
patients. Three further patients showed a G1764T exchange,
2 patients had a deletion of 8 or 9 nucleotides around nt
1764, and 1 patient had an insertion of 2 nucleotides. Thus, a
total of 36% of patients (35 of 96) had nucleotide exchanges
at position 1764. HBeAg-negative patients showed a higher
frequency of the 1764 mutation (59%) than HBeAg-positive
patients (25%; P , .002). A mutant nt 1764 was associated in
83% (29 of 35) of patients with an A1762T/G mutation (Table
2) and in 44% (8 of 18) with a 1896 stop mutation. Patients
with cirrhosis carried mutations at nt 1764 (64%; 11 of 17)
more often than patients without cirrhosis (28%; 21 of 75;
P , .009). This correlation was also observed in the subgroup
of HBeAg-positive patients (P , .009) but not in HBeAgnegative patients.

HEPATOLOGY Vol. 31, No. 3, 2000

ERHARDT ET AL.

TABLE 2. Summary of Nucleotide Exchanges

Mutation

G1899A

Frequency
HBeAgNegative

Frequency
HBeAgPositive

34% (11/32)

0% (0/64)

Significance

Relevance and
Distribution

P , .001

-Association with
1896
G1896A 53% (17/32)
1.6% (1/64) P , .0005 -HBeAg negativity,
precore stop
T1858C
22% (7/32)
53% (34/62) P , .004
-Stem loop formation
G1764A/T 53% (17/32) 23% (15/64) P , .001
-IFN response?
59% (19/32)* 25% (16/64)* P , .002** -HBeAg negativity?
-HNF4 binding
-COUP TF binding
A1762T/G 50% (16/32) 20% (13/64) P , .004
-IFN response?
53% (17/32)* 20% (13/64)* P , .002** -HBeAg negativity?
-HNF4 binding
-COUP TF binding
G1757A 38% (12/32) 66% (42/64) P , .016
-HNF4 binding
T1753A/C 44% (14/32)
9% (6/64)
P , .0005 -HNF4 binding
T1719G 41% (13/32) 69% (44/64) P , .015
-HNF3 binding
-Genotype A association
A1703C 38% (12/32) 53% (34/64)
NS
-Genotype A association
C1678T
44% (14/32) 17% (11/64) P , .006
-Genotype D association
T1676A
38% (12/32) 72% (46/64) P , .003
-Genotype A association
T1674C
38% (12/32) 55% (34/64)
NS
-Genotype A association
T1638C
38% (12/32) 59% (38/64)
NS
-Genotype A association
A1635G/T 41% (13/32) 36% (23/64)
NS
-Genotype D association
A1634G 41% (13/32) 72% (46/64) P , .005
-Genotype A association
T1631C
50% (16/32) 34% (22/62)
NS
-Genotype D association
NOTE. Mutations are shown if number .10.
Abbreviations: COUP TF, chicken ovary upstream promoter transcription
factor; HNF, hepatocyte nuclear factor; NS, not significant.
*Includes deletions and insertions.

An A1762T/G mutation was observed in 30% (29 of 96) of

patients (Table 1). One additional patient had a deletion.
Significantly higher frequencies of the A1762T/G mutation
were observed in HBeAg-negative patients than in HBeAgpositive patients (53% vs. 20%; P , .002).
The 3 AT-rich regions, which are thought to bind to RNA
polymerase for initiating transcription, were affected differently by mutations. Within the nt region 1789 to 1795 only 4
mutations were noted, whereas the regions 1757 to 1762 and
1752 to 1755 displayed more than 20 mutations. The Kunitz
domainlike sequence carried a variety of mutations, most
often a G1764A. A mean of 1.7 nt exchanges per patient were
found within the Kunitz domain of HBeAg-negative patients
compared with 1.2 nt exchanges in HBeAg-positive patients
(P . .3). The direct repeat 1 was completely conserved in all
but 2 viral strains (patients no. 9 and 69). Four HBeAgnegative patients (no. 14, 16, 17, and 23) but no HBeAgpositive patient carried an A to G mutation at the precore
mRNA transcription initiation site (nt 1789).
Response to IFN. The overall sustained response rate to IFN
therapy was 30% (29 of 96) of patients. Sustained response
rates between HBeAg-positive (23%; 15 of 64) and HBeAg-

719

negative patients (44%; 14 of 32) did not differ significantly.

The mean follow-up of patients with a primary response was
29 6 4 months (median 22 months; range 6-70 months). In
the total population of HBeAg-positive and HBeAg-negative
patients HBV DNA and HBsAg correlated with response to
IFN. Sustained responders had lower DNA levels (10E2.35 6
0.2 pg/mL) than nonresponders (10E3.2 6 0.1 pg/mL; P ,
.0005) and lower levels of HBsAg (10E0.96 6 0.12 vs.
10E1.4 6 0.09; P , .0005). There was a tendency for higher
ALT levels in responder patients compared with nonresponders (139 U/L vs. 105 U/L; P . .15) (Table 3). When
HBeAg-positive and HBeAg-negative patients were examined
separately, further predictive parameters could be distinguished.
In HBeAg-positive patients, the sum of mutations in the
BCP correlated with the response to IFN. Responder patients
carried more mutations (3.6 6 0.8) than nonresponder
patients (2.0 6 0.4; P , .04) in the BCP. Responders had
more nucleotide exchanges in nt region 1753 to 1766
compared with nonresponders (1.4 6 0.4 vs. 0.6 6 0.1; P ,
.015). A correlation with IFN response was also found for
nucleotide 1762 and 1764 (P , .008 and P , .007). Patients
with mutations at these nt positions had a better response to
IFN than patients with a wild-type sequence. Patients with
wild-type nt 1762 and 1764 had markedly higher HBV-DNA
levels than patients with mutations in these positions
(10E3.5 6 0.1 pg/mL vs. 10E3.0 6 0.17 pg/mL; P , .04).
In HBeAg-negative patients compared with HBeAg-positive
patients, an inverse correlation between mutations in the
BCP, nt region 1753 to 1766, nt 1762 and 1762, and
responsiveness to IFN therapy was found. HBeAg-negative
nonresponders carried an average of 4.5 6 1.0 mutations
within the BCP compared with 2.0 6 0.3 mutations in
responder patients (P , .04). Most of the mutations of the
BCP clustered in nt region 1753 to 1766. The number of
mutations within this region correlated with IFN response. In
patients with nonresponse the average number of mutations
was 3.0 6 0.4 compared with 1.0 6 0.4 in patients with
sustained response (P , .02). Within nt region 1753 to 1766
the nucleotide position 1764 was most significantly correlated with responsiveness to IFN therapy (P , .003). Lower
DNA levels (10E1.7 6 0.35 pg/mL vs. 10E2.5 6 0.16 pg/mL;
P , .017) were noticed in HBeAg-negative patients carrying
wild-type nt 1764.
Using a logistic regression analysis HBV DNA, HBsAg, the
number of mutations in the BCP, and the number of mutations in nt region 1753 to 1766 could be used for prediction
of response to IFN (Fig. 4). As shown in Fig. 4, predictive
values of 60% to 70% for a sustained response to IFN were
found for HBV-DNA levels of less than 10 pg/mL and HBsAg
levels of less than 1 g/mL in all patients irrespective of
HBeAg status. More than 10 nt mutations of the BCP in
HBeAg-positive hepatitis and 1 or no mutation of the BCP in
HBeAg-negative hepatitis allowed a correct positive prediction of sustained IFN response in 60% to 70%. A 70% to 80%
correct prediction of nonresponse was possible on the basis of
less than 5 mutations in the BCP in HBeAg-positive hepatitis
and more than 5 mutations in HBeAg-negative hepatitis.
Response to IFN was predictable in 78% of patients (25 of 32)
on the basis of nucleotide position 1764 in HBeAg-negative
hepatitis. Seventy-seven percent of the patients with wildtype nt 1764 were responders (10 of 13). In contrast only
21% (4 of 19) of the patients who displayed a mutation at

720 ERHARDT ET AL.

HEPATOLOGY March 2000

FIG. 2. DNA sequence of a part

of the HBV basic core promoter
region (nt 1741-1800) of HBeAgnegative patients. Alignment of the
DNA (1)-strands of 32 HBeAgnegative patients (no. 1 to 32) in 58
to 38 direction. Nucleotide deletions
are marked by a slash (/), nucleotide
insertions are underlined. Consensus sequence was established from
HBV databank sequences.

nucleotide 1764 were sustained responders to IFN. In HBeAgpositive hepatitis a correct prediction of IFN response was
possible on the basis of nt 1762 and 1764 in 77% of cases each
(49 of 64).
All other previously mentioned mutations (Table 2) within
the precore region, the BCP, the CURS, or the NRE allowed no
prediction of IFN response. No correlation to IFN response
was seen for the G1896A mutation. Neither patients origin,
sex, age, nor HBV genotype influenced IFN outcome. There
was a tendency for higher ALT levels in responders, although
statistical significance was not reached (Table 3).
Quantification of HBsAg and HBeAg. HBeAg-positive patients
had higher HBsAg levels than HBeAg-negative patients

(10E1.6 6 0.06 vs. 10E0.6 6 0.12; P , .0005). Overall,

patients with a 1764 or a 1762 mutation carried significantly
less HBsAg than patients without mutation (10E0.9 6 0.12
vs. 10E1.5 6 0.08; p , 0.0005 and 10E0.85 6 1.4 vs.
10E1.4 6 0.08; P , .0005). However when HBeAg-negative
and HBeAg-positive patients were considered separately (Table
4) this correlation was only seen in HBeAg-positive patients
(10E1.3 6 0.11 vs. 10E1.7 6 0.07; P , .02 and 10E1.3 6
0.14 vs. 1.65 6 0.06; P , .03).
HBeAg-positive patients with mutations at nt 1762 or 1764
carried less HBeAg than patients with a wild-type nucleotide
(10E2.4 6 0.32 vs. 10E3.05 6 0.11; P , .012 for nt 1762 and
10E2.7 6 0.24 vs. 10E3.1 6 0.11; P , .004 for nt 1764).
=

FIG. 3. DNA sequence of a part of the HBV basic core promoter region (nt 1741-1800) of HBeAg-positive patients. Alignment of the DNA (1)-strands of
64 HBeAg-positive patients (no. 33 to 96) in 58 to 38 direction. Nucleotide deletions are marked by a slash (/), nucleotide insertions are underlined. Consensus
sequence was established from HBV databank sequences.

HEPATOLOGY Vol. 31, No. 3, 2000

ERHARDT ET AL.

721

722 ERHARDT ET AL.

HEPATOLOGY March 2000

FIG. 4. Calculated predictive values (PV) for sustained response to IFN on the basis of logistic regression analysis. (A) PV depending on HBV DNA for all
investigated patients (n 5 96). (B) PV depending on HBsAg for all investigated patients (n 5 96). (C) PV depending on mutations in the BCP in
HBeAg-negative patients (n 5 64). (D) PV depending on mutations in the BCP in HBeAg-positive patients (n 5 32). (E) PV depending on mutations in nt
region 1753 to 1766 in HBeAg-negative patients (n 5 64). (F) PV depending on mutations in nt region1753 to 1766 in HBeAg-positive patients (n 5 32).

HEPATOLOGY Vol. 31, No. 3, 2000

ERHARDT ET AL.

TABLE 3. Clinical and Molecular Parameters for Prediction

of IFN Response

G1764Mut
HBeAg-positive
HBeAg-negative
T1762Mut
HBeAg-positive
HBeAg-negative
Mutations in the BCP
HBeAg-positive
HBeAg-negative
Mutations in 1753-1766
HBeAg-positive
HBeAg-negative
G1896A
HBV DNA (Log pg/mL)
All
HBeAg-positive
HBeAg-negative
HBsAg quantitative
(Log g/mL)
All
HBeAg-positive
HBeAg-negative
HBeAg quantitative
(Log PEI U/mL)
HBeAg-positive
ALT (U/L)
Genotype A (n 5 46)
Genotype D (n 5 32)

Sustained
Response

Nonresponse

Significance

53% (8/15)
29% (4/14)

16% (8/49)
83% (15/18)

P , .007
P , .003

47% (7/15)
29% (4/14)

12% (6/49)
72% (13/18)

P , .008
P , .03

3.6 6 0.8
2.0 6 0.3

2.0 6 0.3
4.5 6 1.0

P , .04
P , .04

1.4 6 0.4
1.0 6 0.4
24% (7/29)

0.6 6 0.1
3.0 6 0.4
16% (11/67)

P , .015
P , .02
NS

2.35 6 0.2
2.8 6 0.13
1.9 6 0.34

3.2 6 0.1
3.5 6 0.1
2.4 6 0.2

P , .0005
P , .0005
NS

0.96 6 0.12
1.2 6 0.11
0.58 6 1.5

1.4 6 0.09
1.7 6 0.07
0.65 6 1.9

P , .006
P , .003
NS

2.6 6 0.27
139 6 18
66% (19/29)
25% (9/29)

3.0 6 0.11
105 6 13
43% (29/67)
40% (27/67)

NS; P , .08
NS
NS
NS

Abbreviation: NS, not significant.

DISCUSSION

The relevance of mutations in the BCP, CURS, and NRE for

response to IFN in chronic replicative hepatitis B was studied
in 96 IFN-treated patients.

FIG. 5. Different effects of mutations in the basic core promoter and

their function in HBeAg-negative
and HBeAg-positive hepatitis.

723

Treatment with IFN resulted in an overall sustained

response rate of 30%, which is consistent with most studies.2
Sustained response rates did not differ significantly between
HBeAg-positive patients (23%) and HBeAg-negative patients
(44%). Most studies so far have shown poor long-term
response rates of even less than 10% in HBeAg-negative
hepatitis,5-9 but some studies reported response rates up to
50%.10-12 The highly divergent response rates to IFN therapy
for HBeAg-negative hepatitis are difficult to explain. In
HBeAg-positive hepatitis low HBV-DNA titers predict a favorable response to IFN.2 Lower HBV-DNA titers have been
reported for HBeAg-negative patients compared with HBeAgpositive patients and were also seen in our HBeAg-negative
patients (Table 1). This may explain the good response rate
for HBeAg-negative patients compared with HBeAg-positive
patients.
A correlation with IFN responsiveness was found for HBV
DNA levels, HBsAg levels, mutations at nt 1762 and nt 1764,
the number of mutations within the nucleotide region 1753
to 1766, and mutations within the complete BCP. Low
HBV-DNA and HBsAg levels were positive predictors for a
sustained response to IFN independent of HBeAg status.
Mutations at nt 1762 and 1764, the number of mutations
within the nucleotide region 1753 to 1766, and the BCP
exhibited opposite effects on IFN responsiveness in HBeAgpositive and HBeAg-negative patients. In HBeAg-negative
patients a sustained response was associated with a wild-type
nt 1762 and 1764 and a low number of mutations in the nt
region 1753 to 1766 and the BCP whereas in HBeAg-positive
patients a sustained response to IFN was associated with a
mutated nt 1762 and 1764 and a high number of mutations in
the BCP and nt region 1753 to 1766.
These divergent effects of promoter mutations may be
explained by different functions of the basic core promoter
(Fig. 5) on transcription of precore mRNA and pregenome
RNA.33 Translation of precore mRNA yields HBeAg, which is
known to induce immunotolerance,34 whereas pregenome

724 ERHARDT ET AL.

HEPATOLOGY March 2000

TABLE 4. Clinical and Molecular Parameters Depending

on Nucleotide 1764
1764 Mut

HBV DNA (Log pg/mL)

All
HBeAg-positive
HBeAg-negative
HBsAg quantitative (Log g/mL)
All
HBeAg-positive
HBeAg-negative
HBeAg quantitative (Log PEI U/mL)
HBeAg-positive
ALT [U/L]:
All
HBeAg-positive
HBeAg-negative
Cirrhosis [%]:
All
HBeAg-positive
HBeAg-negative

1764 WT

Significance

2.8 6 0.12 3.07 6 0.15

NS
3.03 6 0.17 3.5 6 0.1 P , .04
2.5 6 0.16 1.7 6 0.35 P , .017
0.9 6 0.12 1.5 6 0.08 P , .0005
1.3 6 0.11 1.7 6 0.07 P , .02
0.56 6 0.16 0.68 6 0.18
NS
2.4 6 0.27

3.1 6 0.11 P , .004

118 6 14
95 6 14
136 6 23

113 6 15
108 6 17
137 6 31

NS
NS
NS

34
31
38

10
4
31

P , .009
P , .009
NS

Abbreviations: Mut, mutant; WT, wild-type; NS, not significant.

RNA is translated into core and polymerase proteins and

reverse transcribed into minus-strand DNA. It has been
shown in vivo and in vitro that the 1762 and 1764 mutations
cause a reduction of circulating HBeAg by suppressing
precore RNA transcription.27,35-39 A marked reduction of
HBeAg was seen in our HBeAg-positive patients carrying
mutations at nt 1762 and 1764 (Table 4). On the other hand
the 1762 and 1764 mutations have been shown in transfection studies to increase viral replication by enhancing pregenome transcription39,40 or virus encapsidation.35,41 Furthermore, in vitro studies have shown that an intact precore gene
impairs progeny virus production.42,43
In HBeAg-positive hepatitis the dominant effect of mutations in the BCP might be a reduction of circulating HBeAg as
seen in our patients (Table 4) resulting in a reduced immunologic tolerance, an improved clearance of the virus, and thus a
better response to IFN. This model is supported by our and
former data23,44 showing that the 1762 and 1764 mutations
are more common in HBeAg-negative hepatitis than in
HBeAg-positive hepatitis indicating its emergence during
seroconversion, which is commonly associated with virus
clearance. Furthermore HBeAg-positive patients with mutations at nt 1762 and 1764 displayed lower HBV-DNA levels
than patients with wild-type at nt 1762 and 1764. Moreover
HBeAg-positive patients with mutations at nt 1762 and 1764
exhibit high ALT levels28 and high histological liver inflammatory scores,23 both markers of a reduced immunotolerance
and known predictors of a sustained IFN response. Consistent with this observation are our data showing a significantly
higher prevalence of the mutated nt 1764 in HBeAg-positive
patients with cirrhosis (Table 4) which was not observed in
HBeAg-negative patients. However, although there was a
clear correlation of mutations at nt 1762 and 1764 with
HBeAg levels and sustained response in HBeAg-positive
patients, no clear correlation was seen for HBeAg levels and
sustained response. This is not surprising because in HBeAgpositive patients with mutations at nt 1762 or 1764 or other
mutations in the BCP an intermediate pattern of variable
HBeAg levels and HBV DNA may result.
In HBeAg-negative hepatitis the mechanism of immunotol-

erance may play only a minor or no role in virus clearance

because of the absence of HBeAg. The dominant effect of
mutations in the promoter region might be that of increasing
HBV replication or encapsidation, thus impairing IFNinduced virus clearance. In fact higher HBV-DNA titers and
HBsAg levels were found in HBeAg-negative patients with
mutations at nt 1762 and 1764 (Table 4). Our observation is
in agreement with reports that patients with deletions in the
BCP tend to have a better response to IFN therapy than
patients with wild-type sequence.25 In contrast to HBeAgpositive hepatitis, mutations at nt 1762 and 1764 may thus
negatively influence IFN response in HBeAg-negative hepatitis B.
The nucleotide region 1753 to 1766 harbors a series of
transcription factor binding sites. Among these are an HNF4
binding site 2, COUP, and SP1 binding site. As a member of
liver-enriched transcription factors, HNF4 has been shown to
up-regulate transcription from the BCP.45 The COUP transcription factor is a member of the steroid/thyroid receptor family
and is involved in cell metabolism, proliferation, and differentiation.46-48 It is unknown how the action of these transcription factors is modulated during IFN therapy.
Most of the mutations within the BCP lie in the X gene,
which exerts multiple functions in the pathogenesis of HBV
infection.49 The A1762T and G1764A/T mutations convert a
lysine to methionine and valine to isoleucine or leucine,
respectively, within a Kunitz domainlike sequence spanning
the AA sequence 130KVFVKGGCRHKLV14250 of the HBV X
gene. This region is considered important for its transactivating function51 as well as for its interaction with proteasomes
as part of a serine protease inhibitor. AA exchanges within the
Kunitz domain-like region may thus alter transactivation
capacity and protease activity. One consequence may be an
increased ubiquitin dependent degradation of transcription
factors and viral proteins.
Taken together mutations of the BCP, especially of the
nucleotide region 1753 to 1766 as well as nucleotides 1762
and 1764 offer a variety of explanations for a modulation of
IFN action. Our data suggest that genetic alterations of the HBV
genome within the BCP, mainly at nt position 1753 to 1766, are
important factors that determine response to IFN therapy.
Acknowledgment: The authors thank U. Wend for technical assistance with the HBsAg and HBeAg quantification.
REFERENCES
1. Kane M. Global programme for control of hepatitis B infection. Vaccine
1995;13(Suppl 1):S47-S49.
2. Niederau C, Heintges T, Lange S, Goldmann G, Niederau CM, Mohr L,
Haussinger D. Long-term follow-up of HBeAg-positive patients treated
with interferon alfa for chronic hepatitis B. N Engl J Med 1996;334:14221427.
3. Perrillo RP, Schiff ER, Davis GL, Bodenheimer-HC J, Lindsay K, Payne J,
Dienstag JL, et al. A randomized, controlled trial of interferon alfa-2b
alone and after prednisone withdrawal for the treatment of chronic
hepatitis B. The Hepatitis Interventional Therapy Group. N Engl J Med
1990;323:295-301.
4. Thomas HC, Karayiannis P, Brook G. Treatment of hepatitis B virus
infection with interferon. Factors predicting response to interferon. J
Hepatol 1991;13(Suppl 1):4-7.
5. Brunetto MR, Oliveri F, Rocca G, Criscuolo D, Chiaberge E, Capalbo M,
David E, et al. Natural course and response to interferon of chronic
hepatitis B accompanied by antibody to hepatitis B e antigen. HEPATOLOGY 1989;10:198-202.
6. Brunetto MR, Oliveri F, Colombatto P, Capalbo M, Barbera C, Bonino F.
Treatment of chronic anti-HBe-positive hepatitis B with interferon-alpha.
J Hepatol 1995;22:42-44.

HEPATOLOGY Vol. 31, No. 3, 2000

7. Hadziyannis S, Bramou T, Makris A, Moussoulis G, Zignego L, Papaioannou C. Interferon alfa-2b treatment of HBeAg negative/serum HBV DNA
positive chronic active hepatitis type B. J Hepatol 1990;11(Suppl 1):7-36.
8. Pastore G, Santantonio T, Milella M, Monno L, Mariano N, Moschetta R,
Pollice L. Anti-HBe-positive chronic hepatitis B with HBV-DNA in the
serum response to a 6-month course of lymphoblastoid interferon. J
Hepatol 1992;14:221-225.
9. Brunetto MR, Giarin M, Saracco G, Oliveri F, Calvo P, Capra G, Randone
A, et al. Hepatitis B virus unable to secrete e antigen and response to
interferon in chronic hepatitis B. Gastroenterology 1993;105:845-850.
10. Aikawa T, Kanai K, Kako M, Kawasaki T, Hino K, Iwabuchi S, Tsubouchi
H, et al. Interferon-alpha 2a for chronic hepatitis B with e antigen or
antibody: comparable antiviral effects on wild-type virus and precore
mutant. J Viral Hepat 1995;2:243-250.
11. Fattovich G, Farci P, Rugge M, Brollo L, Mandas A, Pontisso P, Giustina
G, et al. A randomized controlled trial of lymphoblastoid interferonalpha in patients with chronic hepatitis B lacking HBeAg. HEPATOLOGY
1992;15:584-589.
12. Zhang X, Zoulim F, Habersetzer F, Xiong S, Trepo C. Analysis of hepatitis
B virus genotypes and pre-core region variability during interferon
treatment of HBe antigen negative chronic hepatitis B. J Med Virol
1996;48:8-16.
13. Lampertico P, Del Ninno E, Manzin A, Donato MF, Rumi MG, Lunghi G,
Morabito A, et al. A randomized, controlled trial of a 24-month course of
interferon alfa 2b in patients with chronic hepatitis B who had hepatitis B
virus DNA without hepatitis B e antigen in serum. HEPATOLOGY 1997;26:
1621-1625.
14. Lopez-Alcorocho JM, Bartolome J, Cotonat T, Carreno V. Efficacy of
prolonged interferon-alpha treatment in chronic hepatitis B patients
with HBeAb: comparison between 6 and 12 months of therapy. J Viral
Hepat 1997;4(Suppl 1):27-32.
15. Angus PW, Locarnini SA, McCaughan GW, Jones RM, McMillan JS, Bowden
DS. Hepatitis B virus precore mutant infection is associated with severe
recurrent disease after liver transplantation. HEPATOLOGY 1995;21:14-18.
16. Lai ME, Solinas A, Mazzoleni AP, Deplano A, Farci P, Lisci V, Porru A, et
al. The role of pre-core hepatitis B virus mutants on the long-term
outcome of chronic hepatitis B virus hepatitis. A longitudinal study. J
Hepatol 1994;20:773-781.
17. Omata M, Ehata T, Yokosuka O, Hosoda K, Ohto M. Mutations in the
precore region of hepatitis B virus DNA in patients with fulminant and
severe hepatitis [see comments]. N Engl J Med 1991;324:1699-1704.
18. Feray C, Gigou M, Samuel D, Bernuau J, Bismuth H, Brechot C. Low
prevalence of precore mutations in hepatitis B virus DNA in fulminant
hepatitis type B in France. J Hepatol 1993;18:119-122.
19. Liang TJ, Hasegawa K, Munoz SJ, Shapiro CN, Yoffe B, McMahon BJ,
Feng C, et al. Hepatitis B virus precore mutation and fulminant hepatitis
in the United States. A polymerase chain reaction-based assay for the
detection of specific mutation. J Clin Invest 1994;93:550-555.
20. Fattovich G, McIntyre G, Thursz M, Colman K, Giuliano G, Alberti A,
Thomas HC, et al. Hepatitis B virus precore/core variation and interferon
therapy. HEPATOLOGY 1995;22:1355-1362.
21. Schepis F, Verucchi G, Pollicino T, Attard L, Brancatelli S, Longo G,
Raimondo G. Outcome of liver disease and response to interferon
treatment are not influenced by hepatitis B virus core gene variability in
children with chronic type B hepatitis. J Hepatol 1997;26:765-770.
22. Alexopoulou A, Owsianka AM, Kafiri G, Dourakis SP, Carman WF,
Hadziyannis SJ. Core variability does not affect response to interferon
alpha in HBeAg negative chronic hepatitis B. J Hepatol 1998;29:345-351.
23. Lindh M, Horal P, Dhillon AP, Furuta Y, Norkrans G. Hepatitis B virus
carriers without precore mutations in hepatitis B e antigen-negative
stage show more severe liver damage. HEPATOLOGY 1996;24:494-501.
24. Tong SP, Li JS, Vitvitski L, Trepo C. Replication capacities of natural and
artificial precore stop codon mutants of hepatitis B virus: relevance of
pregenome encapsidation signal. Virology 1992;191:237-245.
25. Laskus T, Rakela J, Tong MJ, Nowicki MJ, Mosley JW, Persing DH.
Naturally occurring hepatitis B virus mutants with deletions in the core
promoter region. J Hepatol 1994;20:837-841.
26. Laskus T, Rakela J, Nowicki MJ, Persing DH. Hepatitis B virus core
promoter sequence analysis in fulminant and chronic hepatitis B.
Gastroenterology 1995;109:1618-1623.
27. Okamoto H, Tsuda F, Akahane Y, Sugai Y, Yoshiba M, Moriyama K,
Tanaka T, et al. Hepatitis B virus with mutations in the core promoter for
an e antigen-negative phenotype in carriers with antibody to e antigen. J
Virol 1994;68:8102-8110.
28. Takahashi K, Aoyama K, Ohno N, Iwata K, Akahane Y, Baba K,
Yoshizawa H, et al. The precore/core promoter mutant (T1762A1764) of

ERHARDT ET AL.

29.

30.
31.

32.
33.
34.
35.

36.

37.
38.

39.
40.

41.
42.
43.
44.
45.
46.

47.
48.
49.
50.
51.

725

hepatitis B virus: clinical significance and an easy method for detection. J

Gen Virol 1995;76:3159-3164.
Pawlotsky JM, Bastie A, Lonjon I, Remire J, Darthuy F, Soussy CJ,
Dhumeaux D. What technique should be used for routine detection and
quantification of HBV DNA in clinical samples? J Virol Methods
1997;65:245-253.
Gerlich W, Thomssen R. Standardized detection of hepatitis B surface
antigen: determination of its serum concentration in weight units per
volume. Dev Biol Stand 1975;30:78-87.
Erhardt A, Schaefer S, Athanassiou N, Kann M, Gerlich WH. Quantitative assay of PCR-amplified hepatitis B virus DNA using a peroxidaselabelled DNA probe and enhanced chemiluminescence. J Clin Microbiol
1996;34:1885-1891.
Kidd LK, Oberg M, Kidd AH. The hepatitis B virus X gene: analysis of
functional domain variation and gene phylogeny using multiple sequences. J Gen Virol 1995;76:2119-2130.
Yuh CH, Chang YL, Ting LP. Transcriptional regulation of precore and
pregenomic RNAs of hepatitis B virus. J Virol 1992;66:4073-4084.
Milich DR, Schodel F, Hughes JL, Jones JE, Peterson DL. The hepatitis B
virus core and e antigens elicit different Th cell subsets: antigen structure
can affect Th cell phenotype. J Virol 1997;71:2192-2201.
Buckwold VE, Xu Z, Yen TS, Ou JH. Effects of a frequent doublenucleotide basal core promoter mutation and its putative singlenucleotide precursor mutations on hepatitis B virus gene expression and
replication. J Gen Virol 1997;78:2055-2065.
Gunther S, Piwon N, Will H. Wild-type levels of pregenomic RNA and
replication but reduced pre-C RNA and e-antigen synthesis of hepatitis B
virus with C(1653) = T, A(1762) = T and G(1764) = A mutations in
the core promoter. J Gen Virol 1998;79:375-380.
Kurosaki M, Enomoto N, Asahina Y, Sakuma I, Ikeda T, Tozuka S, Izumi
N, et al. Mutations in the core promoter region of hepatitis B virus in
patients with chronic hepatitis B. J Med Virol 1996;49:115-123.
Baptista M, Kramvis A, Kew MC. High prevalence of 1762(T) 1764(A)
mutations in the basic core promoter of hepatitis B virus isolated from
black Africans with hepatocellular carcinoma compared with asymptomatic carriers. HEPATOLOGY 1999;29:946-953.
Moriyama K. Reduced antigen production by hepatitis B virus harbouring nucleotide deletions in the overlapping X gene and precore-core
promoter. J Gen Virol 1997;78:1479-1486.
Moriyama K, Okamoto H, Tsuda F, Mayumi M. Reduced precore
transcription and enhanced core-pregenome transcription of hepatitis B
virus DNA after replacement of the precore-core promoter with sequences associated with e antigen-seronegative persistent infections.
Virology 1996;226:269-280.
Buckwold VE, Xu Z, Chen M, Yen TS, Ou JH. Effects of a naturally
occurring mutation in the hepatitis B virus basal core promoter on precore
gene expression and viral replication. J Virol 1996;70:5845-5851.
Guidotti LG, Matzke B, Pasquinelli C, Schoenberger JM, Rogler CE,
Chisari FV. The hepatitis B virus (HBV) precore protein inhibits HBV
replication in transgenic mice. J Virol 1996;70:7056-7061.
Lamberts C, Nassal M, Velhagen I, Zentgraf H, Schroder CH. Precoremediated inhibition of hepatitis B virus progeny DNA synthesis. J Virol
1993;67:3756-3762.
Kidd LK, Oberg M, Kidd AH. Hepatitis B virus X gene 1751 to 1764
mutations: implications for HBeAg status and disease. J Gen Virol
1997;78:1469-1478.
Raney AK, Johnson JL, Palmer CN, McLachlan A. Members of the
nuclear receptor superfamily regulate transcription from the hepatitis B
virus nucleocapsid promoter. J Virol 1997;71:1058-1071.
Hall RK, Sladek FM, Granner DK. The orphan receptors COUP-TF and
HNF-4 serve as accessory factors required for induction of phosphoenolpyruvate carboxykinase gene transcription by glucocorticoids. Proc Natl
Acad Sci U S A 1995;92:412-416.
Kerber B, Fellert S, Hoch M. Seven-up, the Drosophila homolog of the
COUP-TF orphan receptors, controls cell proliferation in the insect
kidney. Genes Dev 1998;12:1781-1786.
Ritchie HH, Wang LH, Tsai S, OMalley BW, Tsai MJ. COUP-TF gene: a
structure unique for the steroid/thyroid receptor superfamily. Nucleic
Acids Res 1990;18:6857-6862.
Uchida T, Saitoh T, Shinzawa H. Mutations of the X region of hepatitis B
virus and their clinical implications. Pathol Int 1997;47:183-193.
Takada S, Kido H, Fukutomi A, Mori T, Koike K. Interaction of hepatitis
B virus X protein with a serine protease, tryptase TL2 as an inhibitor.
Oncogene 1994;9:341-348.
Arii M, Takada S, Koike K. Identification of three essential regions of
hepatitis B virus X protein for trans-activation function. Oncogene
1992;7:397-403.