Вы находитесь на странице: 1из 28

Tema 8.

Evolucin de secuencias de DNA


1. Tasa de mutacin espontnea
2. Estimacin de las tasas de sustitucin de nucletidos.

Evolucion Molecular
http://bioinfo2.ugr.es/EvolMol/

Universidad de Granada

Jos L. Oliver
http://www.ugr.es/~oliver/

4 transiciones ()
8 transversiones ()

Proporcin esperada Transiciones/Transversiones = 1/2

DESDE

ATCTAGATCTAGTGCATAGCATGCA
|*|||*||*|||||*|||*|||*||

HASTA

ACCTAAATTTAGTGAATATCATCCA

Desde/Hasta

--

AT

AC

AG

TA

--

TC

TG

CA

CT

--

CG

GA

GT

GC

--

Evolucion Molecular
http://bioinfo2.ugr.es/EvolMol/

Universidad de Granada

Jos L. Oliver
http://www.ugr.es/~oliver/

Evolucion Molecular
http://bioinfo2.ugr.es/EvolMol/

G A (en 1)

T G (en 1)

Se excluye

Se excluye

Se excluye

Universidad de Granada

Jos L. Oliver
http://www.ugr.es/~oliver/

Las transiciones suponen el 59.3%, frente al 33% (4/12) esperado


C y G son los nucletidos ms mutables (la mutacion C G es
la ms frecuente, salvo en las islas CpG)
La mayora de las mutaciones son hacia A o T
Mutacin de base en el genoma: aumento de A+T
Pero los genes son ricos en G+C !!
Evolucion Molecular
http://bioinfo2.ugr.es/EvolMol/

Universidad de Granada

Jos L. Oliver
http://www.ugr.es/~oliver/

Transition/Transversion ratio = 15.7 !!

Genes funcionales:
Gen 1
Consenso

Gen 2
Gen 3

Evolucion Molecular
http://bioinfo2.ugr.es/EvolMol/

Universidad de Granada

Jos L. Oliver
http://www.ugr.es/~oliver/

ATCTAGATCTAGTGCATAGCATGCA
|*|||*||*|||||*|||*|||*||
ACCTAAATTTAGTGAATATCATCCA

p = nd / n

Evolucion Molecular
http://bioinfo2.ugr.es/EvolMol/

nd nmero de posiciones
con nucletidos diferentes

probabilidad = 1/3

Universidad de Granada

No vale Poisson

Jos L. Oliver
http://www.ugr.es/~oliver/

Mtodo de Jukes y Cantor

=1
=1
=1
=1

K = -3/4 ln(1 - 4/3 p)

siendo p = nd / n

Si la distancia entre ambas secuencias es baja, K es una buena estima


de la divergencia.
Pero para distancias mayores, K sigue subestimando la divergencia
Evolucion Molecular
http://bioinfo2.ugr.es/EvolMol/

Universidad de Granada

Jos L. Oliver
http://www.ugr.es/~oliver/

Mtodo de Kimura con 2 parmetros (K2P)

=1
=1
=1
=1

R+P+Q=1

K = - ln [(1 2P Q) 1 2Q]

Evolucion Molecular
http://bioinfo2.ugr.es/EvolMol/

Universidad de Granada

Jos L. Oliver
http://www.ugr.es/~oliver/

Evolucion Molecular
http://bioinfo2.ugr.es/EvolMol/

Universidad de Granada

Jos L. Oliver
http://www.ugr.es/~oliver/

Mtodo de Tamura
El contenido en G+C () de las secuencias puede ser 0.5

Mtodo de Tamura y Nei


Toma en cuenta tanto el sesgo en G+C como en la proporcin
de transiciones / transversiones

Evolucion Molecular
http://bioinfo2.ugr.es/EvolMol/

Universidad de Granada

Jos L. Oliver
http://www.ugr.es/~oliver/

Modelo general de sustitucin de nucletidos (12 parmetros)

PERO no da estimas mejores que los de 6 parmetros

Evolucion Molecular
http://bioinfo2.ugr.es/EvolMol/

Universidad de Granada

Jos L. Oliver
http://www.ugr.es/~oliver/

Comparacin de los diferentes mtodos


En principio, se podra pensar que los mtodos con ms
parmetros sern mejores, ya que son ms realistas
Pero en la prctica no es as debido a que hay que estimar ms
parmetros menos estadstica ms errores de muestreo (las
secuencias son finitas...)
Otro problema es que la frmula de los mtodos con ms
parmetros a menudo es inaplicable (logaritmos con argumento
negativo, etc.)

Ejemplo: estimas de K entre la -globina de conejo y ratn


Posicin del
codn

JC

0.64

0.64

0.68

II

0.42

0.42

0.52

III

III

0.88

0.92

Inaplicable

Evolucion Molecular
http://bioinfo2.ugr.es/EvolMol/

K2P

GIN (6 parmetros)

Divergencia
II

Universidad de Granada

Jos L. Oliver
http://www.ugr.es/~oliver/

Divergencia
II
I
III

II: Valores bajos

Correccin poco importante (8.5 9.3)

III:

altos

Evolucion Molecular
http://bioinfo2.ugr.es/EvolMol/

muy

Universidad de Granada

(36.8 87.9)
Jos L. Oliver
http://www.ugr.es/~oliver/

Secuencia
ancestral

Simulacin

mutaciones

...n veces

Alineamientos

Evolucion Molecular
http://bioinfo2.ugr.es/EvolMol/

Universidad de Granada

Jos L. Oliver
http://www.ugr.es/~oliver/

Simulacin

Evolucion Molecular
http://bioinfo2.ugr.es/EvolMol/

Universidad de Granada

Jos L. Oliver
http://www.ugr.es/~oliver/

Las distancias ms sofisticadas


(con ms parmetros) son
imprescindibles para estimar
correctamente la longitud de las
ramas en una filogenia, pero
importan menos para estimar la
topologia (orden de
ramificacin) correcta

Evolucion Molecular
http://bioinfo2.ugr.es/EvolMol/

Universidad de Granada

Jos L. Oliver
http://www.ugr.es/~oliver/

Tasa de sustitucin

K
Tasa de sustitucin de nucletidos:
r = K / 2T

Evolucion Molecular
http://bioinfo2.ugr.es/EvolMol/

Universidad de Granada

Jos L. Oliver
http://www.ugr.es/~oliver/

-globina

SS > NS
Mayor dispersin en SS

The amount of nucleotide divergence


at synonymous and nonsynonymous
sites of the -globin gene as a
function of time since divergence.

Evolucion Molecular
http://bioinfo2.ugr.es/EvolMol/

Universidad de Granada

Jos L. Oliver
http://www.ugr.es/~oliver/

Histona H4

Gen:
55 sustituciones
SS > NS

Protena:
2 sustituciones

Evolucion Molecular
http://bioinfo2.ugr.es/EvolMol/

Universidad de Granada

Jos L. Oliver
http://www.ugr.es/~oliver/

Humanos vs. roedores (ratn o rata)

Evolucion Molecular
http://bioinfo2.ugr.es/EvolMol/

Universidad de Granada

Jos L. Oliver
http://www.ugr.es/~oliver/

Humanos vs. roedores (ratn o rata)

Evolucion Molecular
http://bioinfo2.ugr.es/EvolMol/

Universidad de Granada

Jos L. Oliver
http://www.ugr.es/~oliver/

Variacin en distintas regiones de los genes

Evolucion Molecular
http://bioinfo2.ugr.es/EvolMol/

Universidad de Granada

Jos L. Oliver
http://www.ugr.es/~oliver/

Divergencia en exones vs. intrones

Evolucion Molecular
http://bioinfo2.ugr.es/EvolMol/

Universidad de Granada

Jos L. Oliver
http://www.ugr.es/~oliver/

Variacin de NS en el gen de la insulina

NS

Evolucion Molecular
http://bioinfo2.ugr.es/EvolMol/

Universidad de Granada

Jos L. Oliver
http://www.ugr.es/~oliver/

Tasa evolutiva en el genoma mitocondrial de mamferos


Tasa de sustitucin de nucletidos muy alta: SS diez
veces mayor que en el ncleo
Causas:
Alta concentracin de radicales superxido O2 Replicacin poco fiel
Saturacin rpida: linealidad hasta slo 10 MA Reloj
rpido

Filogenias entre
especies prximas:
primates, etc.

Evolucion Molecular
http://bioinfo2.ugr.es/EvolMol/

Universidad de Granada

Jos L. Oliver
http://www.ugr.es/~oliver/

Tasa evolutiva en orgnulos de plantas

Evolucion Molecular
http://bioinfo2.ugr.es/EvolMol/

Universidad de Granada

Jos L. Oliver
http://www.ugr.es/~oliver/

Tasa evolutiva en virus

Evolucion Molecular
http://bioinfo2.ugr.es/EvolMol/

Universidad de Granada

Jos L. Oliver
http://www.ugr.es/~oliver/

Tasa evolutiva en el virus de la gripe

Evolucion Molecular
http://bioinfo2.ugr.es/EvolMol/

Universidad de Granada

Jos L. Oliver
http://www.ugr.es/~oliver/