Biochemical and Biophysical Research Communications 374 (2008) 714719

Contents lists available at ScienceDirect

Biochemical and Biophysical Research Communications

journal homepage: www.elsevier.com/locate/ybbrc

Minisatellite polymorphisms of the SLC6A19: Susceptibility in hypertension

So-Young Seol a, Sang-Yeop Lee a,b, Young-Dae Kim c, Eun-Ju Do a, Jeong-Ah Kwon a, Seung Il Kim d,
In-Sun Chu b,*, Sun-Hee Leem a,*
a

Department of Biological Science, Dong-A University, 840 Hadan-2-dong, Saha-gu, Busan 604-714, Republic of Korea
Medical Genomics Research Center, KRIBB, Daejeon 305-806, Republic of Korea
c
Department of Internal Medicine, College of Medicine, Dong-A University, Busan 602-714, Republic of Korea
d
Proteomics Team, Korea Basic Science Institute, Daejeon, 305-806, Republic of Korea
b

a r t i c l e

i n f o

Article history:
Received 10 July 2008
Available online 29 July 2008
Keywords:
Essential hypertension
Neurotransmitter transporter
VNTR
Minisatellite polymorphisms
SLC6A19

a b s t r a c t
The SLC6A19 is a human homolog of B0AT1 that encodes a neutral amino acid transporter. We examined
the distribution of VNTR (variable number of tandem repeats; minisatellites) and conducted polymorphic
analysis of SCL6A19 isolated from the genomic DNA of controls and multi-generational families. The
SLC6A19 was found to contain seven blocks of minisatellites, 3 of which (SLC6A19-MS1, -MS4, and
-MS7) showed polymorphism and were found to be transmitted through meiosis following Mendelian
inheritance in seven families. These minisatellite polymorphisms may be useful markers for paternity
mapping and DNA ngerprinting. Furthermore, we conducted a case-control study in which genomic
DNA from 400 controls and 205 cases with essential hypertension was compared. A statistically signicant association was identied between rare SLC6A19-MS7 alleles and the occurrence of hypertension
(odds ratio, 7.87; 95% condence interval, 0.8870.66; and p = 0.028). These ndings suggest that the rare
SLC6A19-MS7 allele may be a risk factor for hypertension.
Crown Copyright 2008 Published by Elsevier Inc. All rights reserved.

The SLC6 (solute carrier family 6) family of proteins act as specic transporters for neurotransmitters, amino acids, and osmolytes [7,11]. The entire family of SLC6 proteins can be divided
into the following four subgroups: GABA (c-aminobutyric acid),
Monoamines, AAs (amino acids) and Orphans [2,11]. SLC6 family
members are known to play important roles in a number of pathological conditions, and several SLC6 family members are potential
drug targets that are currently being pursued by the pharmaceutical industry [2,5,11,27]. The orphan group of the SLC6 family includes SLC6A15, SLC6A16, SLC6A17, SLC6A18, SLC6A19, and
SLC6A20 [6]. SLC6A forms a phylogenic cluster with SLC6A19 and
SLC6A20 [11]. In addition, SLC6A18 was present in the sequenced
part of a library in a large-scale cDNA sequencing project and automatically annotated as Xtrp2 [22]. The expression patterns of
SLC6A18 and SLC6A19 have been found to be abundant in the forebrain [11] and kidney. In addition, it has been reported that the
murine XT2 gene, which is homologous to the human SLC6A18
gene, is associated with hypertension [23]. Furthermore, human
and mouse SLC6A19 were recently shown to be capable of transporting neutral amino acids [16]. Moreover, mutations in the
SLC6A19 gene are known to cause the renal disease known as
Hartnup disorder, which is an inherited metabolic disorder that

* Corresponding authors. Fax: +82 42 879 8119, +82 51 200 7269.

E-mail addresses: chu@kribb.re.kr (I.-S. Chu), shleem@dau.ac.kr (S.-H. Leem).

involves the transport of certain amino acids (for example, tryptophan and histidine) in the small intestine and kidneys.
A comparison of synthetic regions of the mouse and human
genome revealed the presence of two orphan transporter genes
on human chromosome 5p15, which were subsequently classied
as SLC6A18 and SLC6A19 by the human genome organization [11].
A relatively strong linkage was observed between human hypertension and the 5p15 region [24,28]. This region encodes the Xtrp
(SLC6A18) and B0AT1 (SLC6A19) genes, which are homologous to
the area of mouse chromosome 13. These SLC6A18 and SLC6A19
transporters are highly expressed in the kidney [11]. Furthermore,
disruption of the XT2 gene causes hypertension [23]. Taken together, these results indicate that the orphan family transporters
may cause hypertension in humans. We recently conducted a
study in which we reported the distribution of VNTRs of SCL6A18
[29]. However, we found no signicant differences in the overall
distribution of these minisatellites, which indicates that these
polymorphisms are not responsible for essential hypertension
(EH) susceptibility in the Korean population.
The SLC6A18 and SLC6A19 are located near the telomeres in the
p-arm of chromosome 5. Human minisatellites are highly variable
TR (tandem repeats) sequences that are predominantly located in
the subtelomeric regions of the chromosome [12,25], which is where
hTERT, SCK1/SLI, MUC2, and SLC6A18 are located [13,17,18,29]. Some
minisatellites alleles are associated with human disorders and with
differential expression of nearby genes [1,3,10,19,21], and variants

0006-291X/$ - see front matter Crown Copyright 2008 Published by Elsevier Inc. All rights reserved.
doi:10.1016/j.bbrc.2008.07.094

715

S.-Y. Seol et al. / Biochemical and Biophysical Research Communications 374 (2008) 714719

Fig. 1. Minisatellites in SLC6A18. (A) Structure of the genomic region around SLC6A19. It is predicted that 19 exons (black boxes) encode SLC6A19. The approximate positions
of minisatellites identied by the Tandem Repeats Finder Program [4] are indicated by asterisks and numbers (MS1, 2, 3, 4, 5, 6, and 7). (B) The sequences represent seven
minisatellite repeat units.

of VNTR are associated with a high risk of a variety of diseases

[13,15]. Therefore, we analyzed seven novel minisatellites from
the entire SLC6A19 region to determine if there was any putative
functional signicance to the allelic variation in these minisatellites
with respect to susceptibility for essential hypertension. To
genotype the SLC6A19 polymorphisms, 400 samples of genomic
DNA obtained from the blood of normal individuals as well as from
samples obtained from seven multi-generational families were analyzed. Furthermore, we investigated the possible association of
SLC6A19 with hypertension in Koreans.

Materials and methods

Database search analysis and primer construction for the tandem
repeats region of SLC6A19. All DNA sequence regions analyzed in
this study are based on SLC6A19 genomic sequences (length in
1101,999 bp, Fig. 1) and have been assembled by the UCSC
(>hg18_dna range = chr5:12500011352000) and the NCBI
(>ref|NC_000005.8|NC_000005: 12500011352000 Homo sapiens
chromosome 5, reference assembly, complete sequence). The Tandem Repeats Finder software [4] was used to detect VNTRs and
other repeated regions. Repeat units between 10 and 100 bp in
length that scored >300 in the program algorithm were selected
for further analysis.
All primers used in this work were designed using Primer3 software (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi)
[26]. The following primers were constructed based on the sequence of assembled by the UCSC: MS1, F-GGGTGCTGCAGG
ATTTGGGTA & R-TCAGGCCCAGCATTCGTATATGT; MS2, F-CCTGGG

CCAGCCACTGACTC & R-CGAGCACAGCGCAGATTGGA; MS3, F-GCAG

AGCCCACACCCTCTCG & R-GGGGACAGCTAGGCAGGATGG; MS4, FGCTGCACTGGGCAGGTGAGA & R-TGGCTGGGATGGGCTACTCC;
MS5, F-TGTGTGCATGCATGGGGTGT & R-CGTGCACATGAACACAGG
CACA; MS6, F- GCAGCCTGTGAGGCCCTGTC & R-ATATGGGGGCGG
GGCATGT; MS7, F-CATGGCAATGGTGCCACCTG & R-TGAGGAATG
TCCCCAGGCAGA.
Preparation of genomic DNA from peripheral blood lymphocytes.
We analyzed unrelated healthy individuals to assess the degree
of minisatellite polymorphism in SLC6A19. In addition, we performed a case-control study in which DNA obtained from 400
healthy controls was compared with DNA obtained from 205 individuals with essential hypertension (Table 1). Patients were categorized as hypertensive when they had a systolic blood pressure
(SBP) of >140 mmHg or a diastolic blood pressure (DBP) of
Table 1
Age and sex distribution of analyzed samples
Characteristic

Level

Normotensive, n (%)

Age(y)

29
3039
4049
5059
6069
7079
80+

10 (2.50)
16 (4.00)
52 (13.00)
110 (27.50)
117 (29.25)
86 (21.50)
9 (2.25)

5 (2.44)
7 (3.41)
30 (14.63)
52 (25.37)
69 (33.66)
36 (17.56)
6 (2.93)

Women
Men

59.2
147 (36.75)
253 (63.25)

59.6
115 (56.10)
90 (43.90)

400

205

Mean age
Sex
Total sample

Hypertensive, n (%)

716

S.-Y. Seol et al. / Biochemical and Biophysical Research Communications 374 (2008) 714719

>90 mmHg. In addition, individuals that were currently taking

medication for hypertension were also categorized as hypertensive. Conversely, the normotensive controls had a SBP of less than
130 mmHg and a DBP of less than 85 mmHg. The range of ages and
the sex of the normotensive controls and hypertensive individuals
are shown in Table 1. Furthermore, samples were obtained from
seven multi-generational family groups; ve two-generation families and two three-generation families. All samples were obtained

from two different hospitals in two different cities (Dong-A University Hospital [#IRB-06-10-02 & IRB-07-10-7; Busan, Korea] and
Chungbuk National University Hospital [#IRB-2006-1; Cheongju,
Korea]). For PCR experiments, genomic DNA was isolated from
peripheral leukocytes that were taken from 400 lL of whole blood
using a Blood and Cell Culture DNA Mini Kit (Qiagen, CA).
Analysis of polymorphisms in the SCL6A19 minisatellites. The
primers used to analyze the genetic polymorphisms were designed

Fig. 2. The allelic frequency and electrophoretic patterns of SLC6A19 minisatellites. The allelic patterns of each minisatellite are shown in upper part (electrophoretic
patterns) of each panel (AG). The allelic frequency, size of the PCR products and repeat number are indicated in the lower part of each panel. Minisatellites were PCRamplied from the genomic DNA of control samples using diagnostic primers (Materials and methods). Three polymorphic patterns of different genotypes with 6 alleles for
MS1 (A), 2 alleles for MS4 (D) and 5 alleles for MS7 (G) were analyzed. The other four minisatellite regions (B, C, E, and F) were found to be monomorphic. Size markers (M) are
given in bp (100 bp or 1 kb size markers). Haplotype patterns are numbered according to each minisatellite. h shows the heterozygosity of each minisatellite in the controls.

717

S.-Y. Seol et al. / Biochemical and Biophysical Research Communications 374 (2008) 714719

based on the SLC6A19 genomic sequence. Human genomic DNA

isolated from whole blood was amplied using these primers under standard PCR conditions [29]. The PCR products were then analyzed by gel electrophoresis (1 V/cm) in 1 TAE buffer through a
1.02.0% agarose gel depending on their expected sizes.
Statistical analyses. In general, the degree of polymorphism
ranges from 0 to 1 and increases with the number of alleles. To
evaluate the probability of two randomly chosen alleles being different (heterozygous) at a given locus, the following formula was
used:
k

h 1 
i1

M
1.0 kb
0.9 kb

B
300 bp
200 bp

x2i

where xi2 is the allele frequency of the ith allele at each minisatellite locus [8].
Regression analyses were performed to determine the odds
ratios (ORs) of the association between the control and case
groups. ORs were estimated using the natural logarithm and its
standard error. Where relevant, we used a chi-squared test with
one degree of freedom to assess differences between groups.
Signicant differences were determined using a condence interval (CI) of 95%. All tests were two-sided, with p < 0.05 being considered statistically signicant. Statistical analyses were performed
using MS Excel with CHITEST and R statistical software (v2.5.1,
www.r-project.org) using the chi-square test function to calculate
the chi-squared values.

C
1.0 kb
0.5 kb

Fig. 3. Meiotic inheritance of SLC6A19 minisatellites in a three-generation family:

MS1 (A), MS4 (B) and MS7 (C). PCR primers specic to SLC6A19 minisatellites were
used to analyze the length of the minisatellites in the genomic DNA obtained from
family members. The pedigree demonstrates the relationship between family
groups used in this study: rst generation (lanes 1 and 2; grandfather and
grandmother, respectively); second generation (lanes 3 and 4; fathers and
mothers); and third generation (lanes 5 and 6, children from parents 3 and 4). M
corresponds to the size marker.

Results and discussion

Minisatellite polymorphisms in SLC6A19
The SLC6A19 genomic DNA is composed of 19 exons and 18 introns, and sequence analysis of the entire SLC6A19 gene (from the
UCSC and NCBI database) allowed the identication of seven tandem repeats. A search of the GenBank database using the BLASTN
program revealed that there was no signicant similarity between
the seven novel minisatellites and previously identied regions.
Therefore, all of the minisatellites examined in this study are unique to SLC6A19, and the properties they confer may be directly related to the function of SLC6A19. The length of these repeats, their
locations and consensus sequences are presented in Fig. 1.
The degree of polymorphism within the minisatellites was
examined by PCR using diagnostic primers against human genomic
DNA samples isolated from control individuals. We analyzed 200
controls to determine if they were polymorphic or not; however,
after it was determined that minisatellite was a polymorphic locus,
we increased the number of samples. The six alleles in the
promoter region of SLC6A19-MS1 identied from the 400 control
samples ranged from 817 to 1041 bp in length and contained
4862 copies of the repeat unit (Fig. 2A) that showed the highest
heterozygosity (h = 0.663) in the SLC6A19 region. In addition,
SLC6A19-MS2, which was also found in the promoter region,
exhibited a monomorphic pattern in the 200 control samples
(Fig. 2B).
Two minisatellite regions (SLC6A19-MS3 and -MS4) were
identied in intron 2 (Fig. 2C and D). No polymorphisms were observed in SLC6A19-MS3 (Fig. 2C); however, SLC6A19-MS4 was found
to be polymorphic, with 2 to 2.5 repeats (Fig. 2D). Additionally, two
minisatellites in intron 3 and intron 4, SLC6A19-MS5 and SLC6A19MS6 (Fig. 2E and F), were found to be monomorphic in 200 individuals. Finally, the number of repeats in SLC6A19-MS7, which was
located in intron 9, varied from 6 to 14, with 8 repeats being present
in the most common allele (95.4% frequency) (Fig. 2G).
In summary, seven novel minisatellites were identied in
SLC6A19, three of which were polymorphic and four of which were

monomorphic. The high density of the minisatellites in this gene

may be related to its location near the telomere, which is similar
to what occurs in the hTERT and SLC6A18 genes [14,18,29].
Mendelian inheritance of polymorphic minisatellites in SLC6A19
To perform a segregation analysis of polymorphic minisatellites,
we selected family groups of two and three generations (4 and 3
families, respectively). Blood was then collected from the parents
and 1 to 3 children in each family. Alleles from the SLC6A19MS1, -MS4, and -MS7 were identied and their transmission traced
from parent to child in seven of the families evaluated. The results
revealed that VNTRs in SLC6A19 are subject to Mendelian inheritance (i.e., children carried 1 VNTR allele from each parent; Fig.
3), and new minisatellite alleles were not observed during this
analysis.
The minisatellites in the SLC6A19 gene were meiotically stable
in the seven families evaluated in this study, which indicates that
these polymorphisms could be useful as markers of meiotic segregation. Taken together, these results suggest that the SLC6A19
minisatellite markers identied here could be used for paternity
mapping and DNA ngerprinting by simple PCR and gel electrophoreses without the need for special equipment.
The relationship between hypertension and the susceptibility of the
SLC6A19-minisatellites alleles
According to studies conducted by Rice et al. [24] and Wu et al.
[28], there is relatively strong linkage between human hypertension and 5p15. The orphan SLC6A19 is highly expressed in the kidney [11] and rare alleles (allelic variants) of minisatellites are
associated with a high risk of various types of diseases [1,13,15].
Therefore, in this study, we investigated the allelic variation of
these minisatellites to determine if they were related to the
susceptibility for hypertension. To accomplish this, we compared
the distribution and frequency of the polymorphic SLC6A19

718

S.-Y. Seol et al. / Biochemical and Biophysical Research Communications 374 (2008) 714719

minisatellite (SLC6A19-MS1, -MS4, and -MS7) alleles of patients

with hypertension and age and sex matched controls. The present
study was designed to examine the relationship of minisatellite
variants of the SLC6A19 gene with hypertension in a Korean
population.
A case-control study was conducted to compare DNA obtained
from 400 controls of all ages with DNA obtained from 205 patients
with hypertension (Table 1). Table 2 summarizes the frequency of
minisatellite alleles for the SLC6A19-MS1, -MS4, and -MS7 genes
among the control and hypertension groups. When the control
group and the hypertensive groups were compared, there were
no signicant differences observed in the frequency of minisatellite
alleles for the SLC6A19-MS1, -MS4, and -MS7 genes. For further
analysis, each minisatellite allele was grouped into two sets (common and rare alleles) based on their frequency in the control population. The expected frequency for rare alleles was 61%. There
was no difference in the frequencies of alleles from the SLC6A19MS1 and -MS4 loci observed between the controls and EH cases
(Table 2). Table 2 summarizes the frequency of rare and common
alleles for the SLC6A19-MS7 gene among cases and controls. The
SLC6A19-MS7 gene has three common alleles for 6, 8, and 14 repeats and two rare alleles that are 7 and 9 repeat copies in length
(Table 2 and Fig. 2G). In patients with hypertension, the frequency
of the rare SLC6A19-MS7 alleles was 0.98%, whereas it was 0.12% in
the controls (Table 3). Analysis of these data revealed a statistically
signicant association between rare alleles and the odds of hypertension (SLC6A19-MS7 for hypertension: OR, 7.87; 95% CI, 0.88
70.66; p = 0.029).
Table 4 summarizes the frequency of rare SLC6A19-MS7 alleles
according to age at diagnosis. A comparison of the controls and
cases showed the following differences in the association ratio between EH and rare alleles in younger- and older-patients: younger,
p = 0.0447 vs. older p = 0.237. The frequency of rare alleles was
higher in younger cases (<60 years) than in older cases (P60
years). These results suggest that rare alleles may be genetically
associated with EH.
Table 2
Frequency of SLC6A19-MS1, -MS4, and -MS7 alleles in controls and cases repeat
Size (bp)

Normotensive

Table 4
Frequency of rare alleles at SLC6A19-MS7 and risk of hypertension by age
Age at diagnosis

Younger (<60)
Older (P60)
*

Normotensive

Hypertensive

OR (95% CI), P

Cases

Rare
alleles

Cases

Rare
alleles

Reference (Controls
of the same age)

188
212

1 (0.5%)

94
111

2 (2.1%)
2 (1.8%)

P = 0.0447*
3.87 (0.3543.18),
P = 0.237

Statistically signicant (p < 0.05).

In an attempt to determine if rare alleles in the SLC6A19 gene

were associated with other diseases, we analyzed its occurrence
in patients with bladder cancer because SLC6A19 is also highly
expressed in the uterus [11]. When we evaluated 235 patients with
bladder cancer, we found that there were no signicant difference
in the distribution of the rare SLC6A19-MS7 alleles between cancer
patients and controls, which indicates that these polymorphisms
are not responsible for bladder cancer in Koreans (data not shown).
The functional role played by SLC6A19-MS7 is not clear; however, they may be involved in regulation of the expression of
SLC6A19. When the minisatellte sequences were analyzed using
the Transfac software (MATCHTM public version 1.0; http://www.
gene-regulation.com/pub/databases.html), we found the putative
binding site for the transcription factor Pax5 [9] in the repeat region
of MS7. Pax5 is known to interact with CD19, CD79a, and MME (PubGene. http://www.pubgene.org). The MME gene is also involved in
the renin-angiotensin system [20], which regulates vasodilatation
(KEGG, http://www.genome.ad.jp) and has been suggested as an
important component of hypertension [25]. Therefore, interaction
with Pax5 may be related to hypertension. However, this study
was conducted using the complete SLC6A19 gene, which includes
all of the putative regulatory elements, including introns.
The results revealed that an increased incidence of the rare
SLC6A19-MS7 allele is associated with hypertension. This is the
rst study to characterize minisatellites for the complete SLC6A19
gene in detail and our observations suggest that the loci of
SLC6A19 minisatellites may function as indicators of risk for
hypertension.

Hypertensive

Acknowledgments

N = 800

Frequency

N = 410

Frequency

MS1-repeat
48
817
49
833
58
977
60
1009
61
1025
62
1041

2
221
1
258
317
1

0.003
0.276
0.001
0.323
0.396
0.001

2
128
2
108
170

0.005
0.312
0.005
0.263
0.415

We thank Dr. Jae Woo Kim (Dong-A University Hospital) for his
help collecting the bloods samples. We also thank Dr. Vladimir Larionov (NCI) for his helpful comments regarding the preparation of
this manuscript. This work was supported by a Grant (FG06-11-06)
from the 21C Frontier Functional Human Genome Project, Ministry
of Science & Technology, Korea.

MS4-repeat
2
209
2.5
231

342
458

0.428
0.572

166
244

0.405
0.595

References

MS7-repeat
6
317
7
360
8
403
9
446
14
661

21

763
1
15

0.026

0.954
0.001
0.019

8
4
390

0.020
0.010
0.951

0.020

Table 3
Frequency of SLC6A19-MS7 alleles and risk of hypertension
MS7

Normotensive
Hypertensive
OR (95% CI)
P
*

Analyzed
alleles

Common alleles

800
410

21
763
15
8
390
8
1.0 (Reference)

Statistically signicant (p<0.05).

14

Rare alleles
Total (%)

799 (99.88)
406 (99.02)

1
1 (0.12)
4

4 (0.98)
7.87 (0.8870.66)
0.029*

Total (%)

[1] K. Alakurtti, K. Virtaneva, T. Joensuu, J.J. Palvimo, A.E. Lehesjoki,

Characterization of the cystatin B gene promoter harboring the dodecamer
repeat expanded in progressive myoclonus epilepsy, EPM1, Gene 242 (2000)
6573.
[2] S.G. Amara, M.J. Kuhar, Neurotransmitter transporters: recent progress, Annu.
Rev. Neurosci. 16 (1993) 7393.
[3] S. Bailly, N. Israel, M. Fay, M.A. Gougerot-Pocidano, G.W. Duff, An intronic
polymorphic repeat sequence modulates interleukin-alpha gene, Expr. Mol.
Immunol. 12 (1996) 9991006.
[4] G. Benson, Tandem repeats nder, a program to analyze DNA sequences,
Nucleic Acids Res. 27 (1999) 573580.
[5] R.D. Blakely, L.J. De Felice, H.C. Hartzell, Molecular physiology of
norepinephrine and serotonin transporters, J. Exp. Biol. 196 (1994) 263281.
[6] S. Brer, The SLC6 orphans are forming a family of amino acid transporters,
Neurochem. Int. 48 (2006) 559567.
[7] A. Carlsson, Perspectives on the discovery of central monoaminergic,
neurotransmission, Annu. Rev. Neurosci. 10 (1987) 1940.
[8] A. Chakravarti, A. Lynn, Meiotic mapping in human, in: B. Birren, E.D. Green,
S. Klapholz, R.M. Myers, Roskams (Eds.), Genome Analysis A Laboratory
Manual, 4, Cold Spring Harbor Laboratory Press CSH, New York, 2004.

S.-Y. Seol et al. / Biochemical and Biophysical Research Communications 374 (2008) 714719
[9] D. Cozma, D. Yu, S. Hodawadekar, A. Azvolinsky, S. Grande, J.W. Tobias,
M.H. Metzgar, J. Paterson, J. Erikson, T. Maraoti, J.G. Monroe, M.L.
Atchison, A. Thomas-Tikhonenko, B cell activator PAX5 promotes
lymphomagenesis through stimulation of B cell receptor signaling, J. Clin.
Invest. 117 (2007) 26022610.
[10] C.E. Fiskerstrand, E.A. Lovejoy, J.P. Quinn, An intronic polymorphic domain
often associated with susceptibility to affective disorders has allele dependent
differential enhancer activity in embryonic stem cells, FEBS Lett. 458 (1999)
171174.
[11] P.J. Hglund, D. Adzic, S.J. Scicluna, J. Lindblom, R. Fredriksson, The repertoire
of solute carriers of family 6: identication of new human and rodent genes,
Biochem. Biophys. Res. Commun. 336 (2005) 175189.
[12] A.J. Jeffreys, V. Wilson, S.L. Thein, Hypervariable minisatellite regions in
human DNA, Nature 314 (1985) 6773.
[13] Y.H. Jeong, M.C. Kim, E.K. Ahn, S.Y. Seol, E.J. Do, H.J. Choi, I.S. Chu, W.J.
Kim, W.J. Kim, Y. Sunwoo, S.H. Leem, Rare exonic minisatellite alleles in
MUC2 inuence susceptibility to gastric carcinoma, PLoS One 11 (2007)
e1163.
[14] J.H. Kim, S.H. Leem, Y. Sunwoo, N. Kouprina, Separation of long-range human
TERT gene haplotypes by transformation-associated recombination cloning in
yeast, Oncogene 22 (2003) 24522456.
[15] T.G. Krontiris, B. Devlin, D.D. Karp, N.J. Robert, N. Risch, An association between
the risk of cancer, mutations in the HRAS1 minisatellite locus, N. Engl. J. Med.
329 (1993) 517523.
[16] R. Kleta, E. Romeo, Z. Ristic, T. Ohura, C. Stuart, M. Arcos-Burgos, M.H. Dave,
C.A. Wagner, S.R.M. Camargo, S. Inoue, N. Matsuura, A. Helip-Wooley,
D. Bockenhauer, R. Warth, I. Bernardini, G. Visser, T. Eggermann, P. Lee,
A. Chairoungdua, P. Jutabha, E. Babu, S. Nilwarangkoon, N. Anzai, Y. Kanai,
F. Verrey, W.A. Gahl, A. Koizumi, Mutations in SLC6A19, encoding B0AT1, cause
Hartnup disorder, Nat. Genet. 36 (2004) 9991002.
[17] S.H. Leem, N. Kouprina, J. Grimwood, J.H. Kim, M. Mullokandov, Y.H. Yoon, J.Y.
Chae, J. Morgan, S. Lucas, P. Richardson, C. Detter, T. Glavina, E. Rubin, J.C.
Barrett, V. Larionov, Closing the gaps on human chromosome 19 revealed
genes with a high density of repetitive tandemly arrayed elements, Genome
Res. 14 (2004) 239246.
[18] S.H. Leem, J.A. Londono-Vallejo, J.H. Kim, H. Bui, E. Tubacher, G. Solomon,
J.-E. Park, I. Horikawa, N. Kouprina, J.C. Barrett, V. Larionov, The human

[19]

[20]
[21]

[22]

[23]

[24]

[25]

[26]

[27]

[28]

[29]

719

telomerase gene: complete genomic sequence and analysis of tandem repeat

polymorphisms in intronic regions, Oncogene 21 (2002) 769777.
A. MacKenzie, J. Quinn, A serotonin transporter gene intron 2 polymorphic
region, correlation with affective disorders, has allele-dependent differential
enhancer-like properties in the mouse embryo, Proc. Natl. Acad. Sci. USA 96
(1999) 1525115255.
C. Marchesi, P. Paradis, E.L. Schiffrin, Role of the renin-angiotensin system in
vascular inammation, Trends Pharmacol. Sci. 29 (2008) 367374.
Y. Nakamura, K. Koyama, M. Matsushima, VNTR (variable number of tandem
repeat) sequences as transcriptional, translational, or functional regulators, J.
Hum. Genet. 43 (1998) 149152.
T. Ota, Y. Suzuki, T. Nishikawa, T. Otsuki, T. Sugiyama, R. Irie, A. Wakamatsu,
K. Hayashi, H. Sato, T. Nagai, Complete sequencing, characterization of 21,243
full-length human cDNAs, Nat. Genet. 36 (2004) 4045.
H. Quan, K. Athirakul, W.C. Wetsel, G.E. Torres, R. Stevens, Y.T. Chen, T.M.
Coffman, M.G. Caron, Hypertension, impaired glycine handling in mice lacking
the orphan transporter XT2, Mol. Cell. Biol. 24 (2004) 41664173.
T. Rice, T. Rankinen, M.A. Province, Y.C. Chagnon, L. Prusse, I.B. Borecki, C.
Bouchard, D.C. Rao, Genome-wide linkage analysis of systolic and diastolic
blood pressure: the Qubec Family Study, Circulation 102 (2000) 19561963.
N.J. Royle, R.E. Clarkson, Z. Wong, A.J. Jeffreys, Clustering of hypervariable
minisatellites in the proterminal regions of human autosomes, Genomics 3
(1988) 352360.
S. Rozen, H.J. Skaletsky, Primer3 on the WWW for general users and for
biologist programmers, in: S. Krawetz, S. Misener (Eds.), Bioinformatics
Methods and Protocols: Methods in Molecular Biology, Humana Press,
Totowa, NJ, 2000, pp. 365386.
G.E. Torres, R.R. Gainetdinov, M.G. Caron, Plasma membrane monoamine
transporters: structure, regulation and function, Nat. Rev. Neurosci. 4 (2003)
1325.
Z. Wu, J. Nakura, M. Abe, J.J. Jin, M. Yamamoto, Y. Chen, Y. Tabara,
Y. Yamamoto, M. Igase, X. Bo, K. Kohara, T. Miki, Genome-wide linkage
disequilibrium mapping of hypertension in Japan, Hypertens. Res. 26 (2003)
533540.
Y.H. Yoon, S.Y. Seol, J. Heo, C.N. Chung, I.H. Park, S.H. Leem, Analysis of VNTRs
in the solute carrier family 6, member 18 (SLC6A18) gene and essential
hypertension, DNA Cell Biol. 52, doi:10.1089/dna.2008.0755.