PART-1 Comprehensive Exam- December 2012

Section-1 (Part A) 9AM 1PM

Instructions: Attempt 8 questions in this section. You have to pass 6 (six). Please spend
no more than 30 minutes on each question.
Begin the answer to each question on a fresh page
Q1
A gene that you work on encodes a transcription factor that expresses in developing
muscles of early embryos. Null mutants of this gene are embryonic lethal. While studying
its expression pattern you find it is also expressed in regions of the brain of adult animals.
Describe, in some detail, at least two molecular genetic experimental plans that will help
in understanding its function in adult brain. You can choose any animal of your liking.
Ans: a) Tissue and stage specific RNAi knockdown followed by phenotypic
characterization and molecular changes in brain function e.g. altered transcription
profiles b) Weak mutants that survive as adults. This would require checking RNA and
protein levels of the TF in the brain first.
Q2
Mammalian erythrocytes (red blood cells) are created via a series of differentiation steps
from hematopoietic stem cells. In one of these steps, the cell extrudes its nucleus to give
the final enucleated (i.e. lacking a nucleus) RBC. Speculate on the molecular players and
pathways that might be involved in enucleation. (Hint: which well known cellular process
does this enucleation process most closely resemble?) Describe in detail (molecules and
morphology) the series of events that must occur during enucleation.
ANS: Enucleation is related to cytokinesis, since you basically make two large blobs
from a single large blob. This should give clues about the rest of the answer: we require
the contractile cytoskeleton (actin, myosin) as well as the machinery of vesicle traffic.
The following steps must occur: 1. Asymmetry: move nucleus to one side (push with
actin). 2. Move relevant proteins to extrusion site (vesicle traffic). 3. Form a ring in the
cortical cytoskeleton through which the nucleus is extruded (actin and regulators). 4.
Generate pressure that starts extrusion (contractile cytoskeleton). 5. Move membrane to
the ring to accommodate growing bulge (vesicle traffic). 6. Seal the gap (vesicle traffic).
Q3
How would you make use of DNA and RNA deep sequencing techniques to measure the
following on a genomic scale? (a) Chromosome topology. (b) Impact of topology on gene
expression. Your answer should include a step-wise description of the cellular or
organismal context, any treatments or perturbations, sample extraction and preparation,
and any analyses required in order to convert the sequencing reads you get into
informative quantitative readouts.
Measuring DNA topology: There are many answers to this. Most students have based this
on histone occupancy. In this case, one could measure this using either chromatin
immunoprecipitation (crosslinking - fragmentation - IP) using an anti-histone or a
1

histone-mark antibody (depending on what the student has chosen to study).

Other possibilities include crosslinking DNA fragments that are spatially close together,
followed by restriction enzyme-mediated digestion and filling+ligation using biotinylated
oligos. This is followed by a pulldown again of biotinylated fragments and sequencing
from both ends.
One could similarly use methods that cross-link DNA in a manner that correlates with
topological features (e.g. ppsoralen).
Data analysis:
Irrespective of the experiment, the deep sequencing experiment will provide a
quantitative readout across the genome. This can be obtained by mapping reads to
genome and counting number of reads that map to each base on the genome. By analying
the distributions so obtained one could come up with ways to identify reagions which are
statistically enriched for histone / histone-marks or cross-linkers. In this way one could
also get pairs of genomic regions which are close together spatially.
To analyse effect on gene expression, use appropriate perturbation method, extract RNA
and perform deep sequencing. Analyse data by mapping to genome, follwed by
normalisation and computation of differential expression. At a more advanced level, one
could design experiments that could account for the many pleiotropic effects that
inhibitors of DNA topology-modifying proteins might have.
Q4.
A.
B.
C.

What are secondary structural propensities of amino acids?

How are these derived?
Explain three contexts in bioinformatics where such propensity values can be
helpful.

Q5
Specialized DNA Polymerases belonging to the Y-family function to rescue stalled
replication by mediating synthesis across damaged nucleotides. Suggest a general
mechanism utilized by such DNA Polymerases to bypass damaged nucleotides to rescue
replication. Also, what are possible negative outcomes of the action of these enzymes?
ANS: Y-family DNA Polymerases possess specialized plastic active sites that allow them
to accommodate damaged nucleotides and add nucleotides opposite these damaged
nucleotides onto the growing primer strand. A majority of these Polymerases also use
unusual modes of base pairing to select and stabilize the incoming nucleotide opposite
the damaged nucleotide. The major negative outcome of this strategy is that translesion
synthesis can be error-prone and lead to the appearance of mutations.

Q6
I have been given a small-molecule drug that the manufacturers claim will boost
performance in learning and memory tasks. The drug is administered by intravenous
injection, and is claimed to work in mice and man. I want to test the manufacturers claim
by measuring the performance of mice in a Morris water maze. In this navigation task,
mice are placed in a cylindrical pool of water, and are required to find a platform hidden
just below the water surface. By making use of visual cues around the pool, mice are able
to find the platform relatively quickly after the first few attempts. I measure the time
taken to successfully complete the task. I run one trial with the vehicle injected (C), and
another with the drug injected (D). I first carry out all my C measurements. The platform
position and visual cues are then shuffled, and I carry out all my D measurements. After
my initial experiments on = 9 individuals I have the following data (seconds), giving
the initial time taken (C0, D0), as well as the time taken after the mouse has learned over
several attempts (C1, D1).

147

151

78

141

94

79

41

254

179

158

194

109

77

98

46

68

43

Mouse

C0

112

147

80

53

89

277

204

248

C1

54

89

51

23

34

104

123

D0

54

390

204

81

118

307

D1

16

142

66

23

37

111

C1/C0

0.48 0.61 0.64 0.43 0.39 0.38 0.60 0.57 0.64 0.52

0.11

D1/D0

0.29 0.36 0.32 0.28 0.31 0.36 0.31 0.55 0.29 0.34

0.08

D0/C0

0.48 2.65 2.55 1.53 1.33 1.11 1.24 0.72 1.07 1.41

0.74

D1/C1

0.29 1.59 1.29 1.00 1.08 1.07 0.63 0.69 0.49 0.90

0.41

The t-test statistic for two equal-sized samples of equal variance is:
=

!! !!!
!!! !!!!

()

where gives sample means, gives sample standard deviations, and is the sample
size. Let us assume that a t-statistic value of 2.0 or greater is judged to be significant (this
would be the 95% interval on a two-sided t-test with many degrees of freedom).
A. What is the function () that incorporates the effect of sample size?
ANS: f(N)=N
B. All the measurements done here have large standard deviations. List 3 potential
causes of this variation.
ANS:
1. The mice could have different intrinsic abilities to navigate mazes.
2. The maze itself could set some level of difficulty, though the degree of difficulty is
3

mouse-specific since different mice might use different strategies.

3. Each run contains some random component, such as the initial position and
orientation of the mouse.
C.
Assuming that the drug acts on learning and memory pathways alone, but does
not otherwise affect spatial abilities, which pairs of numbers might I expect to be not
significantly different? Is this borne out by the data?
ANS: The initial performance of the mice should be unaffected by the drug. So D0 and
C0 should be similar, and D0/C0 should be approximately 1. For the D0 to C0
comparison, we find t=0.96. For the D0/C0 to 1 comparison we find t=1.43. As expected,
neither of these is significant. Remember that the platform and cues are shuffled,
producing a large variation around the mean of 1.
D.
The manufacturers claim that the drug should reduce the final time to solve the
maze by up to 30%. The values of D1 and C1 seem consistent with this claim, showing a
drop of 15%, but the result is not very convincing. If the manufacturers are correct, and
assuming that the measured trends persist, how many animals would you need to test in
order to establish this claim in a statistically significant manner using only a D1 to C1
comparison?
ANS: The value of the denominator of t-test statistic for the D1 to C1 comparison is 60.
This is a measure of the amount of variation you expect by chance. Starting with a value
C1=79, a 15% drop gives C1-D1=12, while a 30% drop gives C1-D1=24. For the former,
significance requires N12/60>2 or N>100. Even assuming the manufacturers claim,
significance requires N24/60>2, or N>25. Similar arguments can be made for using
the ratio D1/C1
E. Suppose no further experiments are possible. Looking at the table above, are there any
other comparisons you could make that would establish that the drug is a success? Why
does the nave comparison of D1 to C1 not show any result, whereas other comparisons
might?
ANS: Comparing D1/D0 to C1/C0, we obtain a value t=3.97, which is highly significant.
Assuming equal values of C0 and D0, we would expect D1/C1=0.34/0.52=0.65, an effect
about the size the manufacturer claims. The reason this comparison works is that the D1
to C1 comparison is confounded by large variations in the intrinsic abilities of mice,
which leads to the large standard deviations. This variation is eliminated if we first take
the ratio D1/C1, thereby normalizing out the ability of individual mice. This is one
version of a paired-test experimental design.
Q7
From the gel below, draw the secondary structure of the RNA sequence.
CACACGAUGACUGAACUACCGCAUGAAAGUGCGGAUCACAGUCGUCAAAA
AAAA.
Lane 1: cleavage under denaturing conditions with RNAse A.
Lane2: Cleavage under denaturing conditions using RNAse T1.
Lanes 3-5: Limited cleavage under folded conditions Lane 3: with RNAse A
Lane 4: RNAse VI
Lane 5: RNAse T1.

Q8
The Lower, Middle and North Andaman Islands form a 3-island chain in the Bay of
Bengal. I am studying the movement patterns of a small bird species, which can fly
between neighboring islands. The year is split between a migrating season and a breeding
season. In a given year, I find that 1/2 the birds on any given island remain where they
are, while the other 1/2 tend to migrate. From the North and South islands all migrating
birds to go the Middle Island. From the Middle Island, the migrating birds split evenly
between North and South Islands. During the subsequent breeding season, I find that
births and deaths are evenly balanced, so the population of offspring each year is the
same as the population of adults they replace.
A. Write down the matrix relating the number of birds from year-to-year on each
island:
!"#$!
!"##$%
!"#$!

!!!

!"#$!
= !"##$% .
!"#$! !

1/2 1/4
0
ANS: = 1/2 1/2 1/2
0
1/4 1/2
B. Find the eigen values of this matrix.
ANS: We have 0 = det = ( 1/2)( 1) so the eigenvalues are
= 0, 1/2, 1.
C. Find the eigenvector corresponding to the largest eigenvalue.
1
ANS: For ! = 1, we have ! = 2 .
1

D. Suppose I start with a population of 4000 birds on each of the three islands. What
values will the populations approach after a period of several years?
ANS: After several years the distribution will resemble the eigenvector with the largest
eigenvalue. The largest eigenvalue is 1 because the total population is conserved. We
therefore will have:
!"#$!
!"##$%
!"#$!

!!

3000
= 6000
3000

Q9
A complete answer to this question should contain the following elements:
1.
Draw an appropriately shaped EPSP fast rise time and slow decay, positivegoing as the connections are excitatory
2.
Show monosynaptic EPSPs reliably following the 40Hz train but the disynaptic
EPSPs do not follow the spike train in X (or A).
3.
Partial credit for describing greater latency for disynaptic compared to
monosynaptic.
4.
When Calcium is replaced with Magnesium gradually, single APs in X cause
smaller and smaller EPSPs in Y if there is a monosynaptic connection. If there is a
disynaptic connection, there will be failure of EPSPs in Y whenever the X to Z EPSP
amplitude falls below threshold.
5.
Partial credit for mentioning that calcium is important for vesicle release.
6.
Additional test for testing monosynapticity: Synaptic latency variability (more
than its absolute value) is one test; Broaden the action potential in X pharmacologically
and see if EPSP amplitude in Y increases. If it does, then the connection is monosynaptic.
If it doesnt, more synapses are involved. Also, in the presence of TTX, uncaging calcium
inside neuron X should cause EPSPs in Y if Y is monosynaptically connected to X.

Q10
Following antigen stimulation, mature B-cells undergo a transition to form antibody
producing plasma cells. This developmental transition involves a huge increase in the
secretory capacity of the cells to produce and secrete antibody molecules. Describe
signalling strategies that might be used by B-cells to detect and adapt to the increased
secretory load.
The answer should have the following elements:
1.
The transition from B-cells to plasma cells should is associated with the functional
change namely the ability to produce and secrete large quantities of antibody.
2. This requires that the cell adjust its biology to be able to undertake enhanced levels
of protein synthesis.
3.
To do this the major cell biological changes required are an increase in the cells
ability to increase the volume of its ER and also upregulate its secretory transport to deal
with increased secretory load.
4. They should then articulate a signaling mechanism where by following activation of
peripheral B-cell information is communicated to the cellular machinery to build rough
ER and readjust secretory transport.
5.
In reality this involves the unfolded protein response and its multiple elements;
however if they don't know the specific molecular details of this it is OK. To pass the
logic of the signaling pathway required must come through in the answer as articulated
above.
Q11
Morphogens act over many cell-diameters to specify cell-fate in a concentration
dependent mechanism. In the Drosophila wing disc Hh is expressed in the posterior
compartment in En expressing cells. Yet, Dpp expression is activated, in a narrow row of
cells, by Hh signaling, only at the anterior-posterior (A-P) border on the anterior side of
the border. Write down a mechanism by which this narrow expression of Dpp is achieved
by Hh and how you would use the tools of genetics available in flies to test the
mechanism proposed.
A. Hh is not active in En expressing cells because the activity of Ci, its target is regulated
to prevent activation of the pathway. A high concentration of Hh (close to the source at
the A-P border) turns on Dpp at the border. This model can be tested by ectopic
expression of Hh, En and Hh, and En.
Q12
(a) The isoelectric point of a substance (pI) is that pH at which the substance carries no
net charge. An amino acid like ALA has two ionizable groups (the amino group and the

acid group). Derive the value of pI in terms of the equilibrium constants of the two
ionization reactions: K_1 and K_2.
(b) If a protein has a lot more ASP and GLU residues (their side chains contain -COOH)
than ARG, LYS or HIS residues (their side chains contain -NH_2 or -NH- groups) do you
expect its pI to be above or below a pH of 7? Explain your answer.
(c) A structured protein has a certain number of residues with ionizable side chains. The
ionization equilibrium constants (K_1, K_2 ... K_n) for these side chains have been
measured for the individual amino acids in solution. Do you expect the pI calculation for
the protein to be as simple as in (a)? Explain your answer.
ANS
(a) Derive the relationship between K_1, K_2 and pI and not just state it.
(b) below pH = 7.0. more acidic groups means the pI will get closer and closer
to the pKa of the acidic groups.
(c) no, structure will change individual pKas and you can't now just add
up the solution pKas.