You are on page 1of 103

FUNDAMENTOS

DEL DNA
18 Febrero 2016

Nobel 1962

Almacenamiento de informacin gentica

1869 Miescher aisl una sustancia con fsforo de ncleos de


clulas, que llam nuclena

Laboratorio Hoppe-Seyler

Principio de transformacin
Streptococcus pneumoniae

Frederick Griffith

La sustancia pasa desde


la bacteria muerta a la
viva = FACTOR DE
TRANSFORMACIN

1944

Realizaron el experimento con


las bacterias de Griffith Streptococcus pneumoniae

DNA O PROTENA?

Experimento para la confirmacin (1952)


Alfred D. Hershey y Martha Chase

https://www.youtube.com/watch?v=inysl_ydfzQ

Composicin del DNA


Erwin Chargaff
Composicin del DNA

La composicin del DNA generalmente vara de una


especie a otra.
El DNA aislado de diferentes tejidos de la misma
especie tiene la misma composicin de bases.
La composicin de bases de DNA no cambia en un
organismo con la edad, estado nutricional o cambio
de ambiente.
En todo el DNA, el nmero de adenosinas, es igual a
el nmero de timinas (A = T) y el nmero de
guanosinas es igual al nmero de citosinas (C = G)
A+G = T+C

Humanos A=30.9
T=29.1
G=19.9
C=19.8

DNA
Polmero de deoxironucletidos
Se encuentra en cromosomas, mitocondria y
cloroplastos

BASE
AZCAR
FOSFATO

Los nucleosidos y bases analgas pueden tener usos como


Anticancergenos

Leucemia linfoblstica aguda (LLA)

Su eficacia radica en que se


une de forma irreversible a
la enzima timidilato sintasa,
esencial para la sntesis de
nucletidos de timina.

Agentes Antirretrovirales

Aprobado en 1987 como un medicamento indicado para personas


infectadas con el VIH por su efecto retardador de la extensin de la
infeccin por VIH,

Azidotimina

La secuencia del DNA siempre se sintetiza del 5` a 3

La estructura secundaria del DNA es una DOBLE HLICE

2 cadenas antiparalelas que


giran sobre el mismo eje

Los grupos fosfato de las


cadenas envuelven la periferia
Bases
ocupan
el
ncleo
f o r m a n d o
b a s e s
complementarias A-T, G-C
Se mantiene unida por puentes
de hidrgeno

2 puentes de hidrgeno entre A-T


3 Puentes de hidrgeno entre C-G

Apilamiento

Las bases nitrogenadas en el DNA son


planares y tienen tendencia a apilarse
Fuerzas de apilamiento
Interacciones hidrofbicas y fuerzas de
van der Waals

Formas estructurales del DNA

Estructura terciaria

El DNA de doble hlice se enrolla alrededor de las histonas


El DNA se une a para formar fibras llamadas nucleosomas (10 nm)
Nucleosomas contienen 146 nucletidos

Nucleosoma
Son unidades globulares repetidas de cromatina que consiste en un complejo histona y DNA

Compactacin del DNA en el cromosoma

EN RESUMEN

El DNA esta formado pro 4 bases A, G, T, C, que se encuentran en formacin


lineal por arreglos de enlaces fosfodister.

El DNA est organizado en 2 cadenas antiparalelas por el emparejamiento de


las bases A-T y G-C en cadenas complementarias. Estas cadenas forman una
doble hlice alrededor de un eje central.

Las 3x10 9 pares de bases del DNA humano estn organizadas en 23


cromosomas

REPLICACIN
Proceso de duplicacin de la cadena de DNA
(Sntesis de una nueva cadena idntica)

Participantes
Doble hlice del DNA

DNA Polimerasa I y III

Helicasa

Topoisomerasa
SSB

Primasas y ligasas

Caractersticas generales
1. Complementariedad entre las bases del DNA

Recordemos.

2. Proceso semiconservativo
Cada una de las dos cadenas sirven de molde para la sntesis de nuevas cadenas

3. Direccin de replicacin 5- 3

4. Primer (cebadores)
Pequeas unidades de RNA (20 nucletidos)
5. Primasa
Enzima que introduce el primer
7. Origen de Replicacin
6. DNA polimerasa
Participan en la polimerizacin del DNA

8. Replicacin Bidireccional

FRAGMENTOS DE OKASAKI

DNA pol I

DNA pol II

DNA pol III

Estructura

Monmero
109 kD

Monmero
90 kD

Multimro
900 kD

Funcin

Elongacin,
correccin y
reparacin

Elongacin,
correccin y
reparacin

Elongacin,
correccin y
reparacin

Ausencia

Afecta la
reparacin del
DNA

Incompatible con la
Ninguna conocida
vida

Reaccin en cadena de la DNA polimerasa

PCR

Tcnica desarrollada en 1985 por Kary B. Mullis


Premio Nobel Qumica 1993

Tcnica de Biologa Molecular que tiene por objetivo la amplificacin directa de un gen
o fragmento de DNA
Amplifica millones de fragmentos pequeos de DNA hasta 10 Kb en perodos cortos

Amplificacin
PCR
Deteccin

FUNDAMENTOS

Mimetiza el proceso de replicacin

Complementaridad

Capacidad del DNA para desnaturalizarse y renaturalizarse

PARTICIPANTES

1. Molde (Template) DNA

2. Primers

3. DNA Polimerasa
Microorganismos arqueas, son: Thermus aquaticus (polimerasa Taq), Pyrococcus furiosus (Pfu), Thermococcus litoralis (Vent) y Thermus thermophilus (Tth).
Generalmente se emplean mezclas del polimerasas muy procesivas (Taq) con otras capaces de hacer correccin de errores (Pfu, Vent).

4. Mg++
5. Deoxynucletidos dNTPs
6. Buffer

MOLDE O TEMPLADO

Es la molcula que contiene la regin de DNA que quiere amplificar


Se requiere poca cantidad

No se requiere puro

Tiene que se libre de altas concentraciones de EDTA

PRIMERS (CEBADORES, INICIADORES)

Son oligonucletidos sintticos que flanquean la regin blanco, unindose por


complementaridad de bases a cada uno de los extremos a amplificar

Deben ser especficos para la secuencia a amplificar

Deben tener idealmente entre 40-50% CG

Deben evitar estructuras secundarias

Generalmente su longitud debe variar entre 18 y 30 pb

Los primers se ligan a su secuencia complementaria en el DNA target


* Un primer compuesto por solo 3 letras, ATT, por ejemplo, tiene una alta probabilidad
de encontrar complemento mas de una vez
*A medida que el cebador crece en nucletidos, la probabilidad de que una secuencia de 35
letras se encuentre repetida se vuelve ms remota.
Por ejemplo

Caractersticas de un buen Primer

Temperatura de fusin (Tm) en el intervalo de 50C a 65C

Temperatura a la cual el 50% de las cadenas se


encuentran separadas

Que no formen horquillas > a 3pb


Bajo contenido de GC para evitar exceso de afinidad no complementaria

Slo puede existir una zona complementaria en el DNA donde el primer se una, lo cual
significa que el primer debe ser irrepetible

La composicin de las bases afecta la especificidad de la hibridacin as como su temperatura


La composciin aleatoria de bases es lo mejor.
Evitar primers con secuencias de conformacin GCGCGC o ATATAA
Un contenido de G+C alrededor de 40-50% nos proporcionar una buena temperatura de
alineamiento

Temperatura de hibridacin
Se calcula usando la temperatura de fusin (Tm) de los primers

Thibridacin = Tm_primer - 4 C
Si los primers son complementarios entre si, y se hibridan entre ellos en lugar del DNA
muestra, la eficiencia de la PCR se ver afectada drasticamente

La temperatura de hibridacin debe ser mutuamente compatible. La mxima diferencia


permisible en la temperatura de los 2 primeros es de 3C.

RESUMEN
ESPECIFICIDAD: Asegurar que a secuencia complementaria sea nica
LONGITUD: 17-28 Bases
COMPOSICIN DE BASES: El contenido promedio (C+G) en el intervalo de 40-50% y evitar
regiones ricas en (A+T) y (G+C)
TM : intervalo de 55-70C
Minimizar la posibilidad de formacin de estructuras secundarias, horquillas y dmeros

La muestra del DNA, Taq o Pfu, el tampn, los ncleotidos


trifosfato y los cebadores son vertido en tubos de paredes
delgados y estos puestos en un termociclador de PCR

CGTTGCGTGCTCGCCTTACCCTCTCAACTCAATTTCTTCAACCCAATTTCTTCG
M A
F
P
I
P
A R Q
L
F
I
CATTTAACCAAGAATG GCG TTC CCA ATT CCT GCT CGT CAG CTA TTC ATC
D
G
E W R
E
P
I
K
K
N
R
U
P
V
GAC GGA GAG TGG AGA GAA CCC ATT AAA AAA AAT CGC ATA CCC GTC
I
N
P
S
T E
E
I
I
G
D
I
P
A A
ATC AAT CCG TCC ACT GAA GAA ATC ATC GGT GAT ATT CCG GCA GCC
T A E
D
V
E V
A V V
A
A R
R A
ACG GCT GAA GAT GTG GAG GTT GCG GTG GTG GCA GCT CGA AGA GCC
F R
R
N
N W S A
T
S
G A H
R
A
TTT AGG AGG AAC AAT TGG TCA GCA ACA TCT GGG GCT CAT CGT GCC
T Y L R
A
I A
A K
I
T
E
K
K D
ACA TAC TTG CGT GCT ATT GCT GCT AAG ATA ACA GAA AAA AAA GAT
H
F V K
L
E T
I
D S
G
K
P F D
CAT TTC GTT AAA CTG GAA ACC ATT GAT TCT GGG AAA CCT TTT GAT
E
A V L
D
I
D
D V
A
S C
F
E Y
F
GAA GCA GTG CTG GAC ATT GAT GAC GTT GCT TCA TGT TTT GAA TAT TTT
A G
Q
A
E A
L D G
K
Q
K
A P V
GCC GGA CAA GCA GAA GCT CTT GAT GGT AAA CAA AAG GCT CCA GTC
T L P M
E
R
F
K
S
H V
L R
Q
P
ACC CTG CCT ATG GAA AGG TTC AAA AGT CAT GTT CTC AGG CAG CCC
L G V V
G
L
I
S
P
W N Y
P
L L M
CTT GGT GTT GTT GGA TTA ATA TCC CCA TGG AAT TAC CCA CTT CTA ATG
A T W K
I
A P
A
L A A G
C
T A
GCT ACA TGG AAA ATT GCT CCA GCA CTT GCT GCT GGG TGT ACA GCT
V
L K
P
S
E
L
A S V
T
C
L E F
GTA CTT AAG CCA TCC GAG TTG GCA TCT GTG ACT TGT CTA GAA TTC
G E
V C
N
E V
G
L P P
G V
L N
GGT GAA GTT TGC AAC GAA GTG GGA CTT CCT CCA GGC GTG TTG AAT
I
L T
G
L G
P
D
A G A
P
L V
S
ATC TTG ACA GGA TTA GGT CCA GAT GCT GGT GCA CCA TTA GTA TCA
H
P
D V D
K
I
A F
T G
S
S
A T
CAC CCC GAT GTT GAC AAG ATT GCC TTT ACT GGG AGT AGT GCC ACT
G S
K
V M A
S A A
Q
L V
K P V
GGA AGC AAG GTT ATG GCT TCT GCT GCC CAA TTG GTT AAG CCT GTT
T L E
L
G
G
K
S
P I
V V F
E
D
ACA TTA GAA CTT GGG GGT AAA AGT CCT ATT GTA GTG TTT GAA GAT
V D
I
D
K V V
E
W T I F
G
C
F W
CTA GAA GTT GGA GCT GTT TGG GTT AAT TGC TCA CAA CCA TGC TTT GTT
Q
A P W G
G
I
K
R
S
G
F
G
R
E
CAA GCT CCT TGG GGA GGC ATC AAG CGT AGT GGT TTT GGA CGT GAA
L G
E
W G
I
Q
N Y L
N
I
K
Q V
CTT GGA GAA TGG GGT ATC CAG AAT TAC TTG AAT ATC AAG CAG GTG
T Q
D
I
S
D
E P
W G
W Y K
S
P
ACT CAA GAT ATT TCT GAT GAA CCA TGG GGA TGG TAC AAG TCT CCT
TGA

DNA POLIMERASA

Taq polimerasa
Comete un error por cada 10000 nucletidos
Temperatura 72C
No posee actividad correctora
Necesita Mg2+ como cofactor
Mg2+ en altas concentraciones
afecta la especificidad,
amplificaciones inespecficas,
forma complejos con los dNTPs

CMO SE HACE?
Diseo del Primer

Extraccin del DNA

PCR

DETECCIN

ETAPAS

Alineamiento

Desnaturalizacin

ELONGACIN FINAL

Extensin

Cmo podramos monitorear la PCR?

Electroforesis en geles de agarosa

Microscopia
de polmero de
agarosa

Uso de colorantes

1. BROMURO DE ETIDIO

2. SYBER SAFE

1. BROMURO DE ETIDIO
Es un agente intercalante

Bromuro de Etidio

Syber Safe

CGTTGCGTGCTCGCCTTACCCTCTCAACTCAATTTCTTCAACCCAATTTCTTCG
M A
F
P
I
P
A R Q
L
F
I
CATTTAACCAAGAATG GCG TTC CCA ATT CCT GCT CGT CAG CTA TTC ATC
D
G
E W R
E
P
I
K
K
N
R
U
P
V
GAC GGA GAG TGG AGA GAA CCC ATT AAA AAA AAT CGC ATA CCC GTC
I
N
P
S
T E
E
I
I
G
D
I
P
A A
ATC AAT CCG TCC ACT GAA GAA ATC ATC GGT GAT ATT CCG GCA GCC
T A E
D
V
E V
A V V
A
A R
R A
ACG GCT GAA GAT GTG GAG GTT GCG GTG GTG GCA GCT CGA AGA GCC
F R
R
N
N W S A
T
S
G A H
R
A
TTT AGG AGG AAC AAT TGG TCA GCA ACA TCT GGG GCT CAT CGT GCC
T Y L R
A
I A
A K
I
T
E
K
K D
ACA TAC TTG CGT GCT ATT GCT GCT AAG ATA ACA GAA AAA AAA GAT
H
F V K
L
E T
I
D S
G
K
P F D
CAT TTC GTT AAA CTG GAA ACC ATT GAT TCT GGG AAA CCT TTT GAT
E
A V L
D
I
D
D V
A
S C
F
E Y
F
GAA GCA GTG CTG GAC ATT GAT GAC GTT GCT TCA TGT TTT GAA TAT TTT
A G
Q
A
E A
L D G
K
Q
K
A P V
GCC GGA CAA GCA GAA GCT CTT GAT GGT AAA CAA AAG GCT CCA GTC
T L P M
E
R
F
K
S
H V
L R
Q
P
ACC CTG CCT ATG GAA AGG TTC AAA AGT CAT GTT CTC AGG CAG CCC
L G V V
G
L
I
S
P
W N Y
P
L L M
CTT GGT GTT GTT GGA TTA ATA TCC CCA TGG AAT TAC CCA CTT CTA ATG
A T W K
I
A P
A
L A A G
C
T A
GCT ACA TGG AAA ATT GCT CCA GCA CTT GCT GCT GGG TGT ACA GCT
V
L K
P
S
E
L
A S V
T
C
L E F
GTA CTT AAG CCA TCC GAG TTG GCA TCT GTG ACT TGT CTA GAA TTC
G E
V C
N
E V
G
L P P
G V
L N
GGT GAA GTT TGC AAC GAA GTG GGA CTT CCT CCA GGC GTG TTG AAT
I
L T
G
L G
P
D
A G A
P
L V
S
ATC TTG ACA GGA TTA GGT CCA GAT GCT GGT GCA CCA TTA GTA TCA
H
P
D V D
K
I
A F
T G
S
S
A T
CAC CCC GAT GTT GAC AAG ATT GCC TTT ACT GGG AGT AGT GCC ACT
G S
K
V M A
S A A
Q
L V
K P V
GGA AGC AAG GTT ATG GCT TCT GCT GCC CAA TTG GTT AAG CCT GTT
T L E
L
G
G
K
S
P I
V V F
E
D
ACA TTA GAA CTT GGG GGT AAA AGT CCT ATT GTA GTG TTT GAA GAT
V D
I
D
K V V
E
W T I F
G
C
F W
CTA GAA GTT GGA GCT GTT TGG GTT AAT TGC TCA CAA CCA TGC TTT GTT
Q
A P W G
G
I
K
R
S
G
F
G
R
E
CAA GCT CCT TGG GGA GGC ATC AAG CGT AGT GGT TTT GGA CGT GAA
L G
E
W G
I
Q
N Y L
N
I
K
Q V
CTT GGA GAA TGG GGT ATC CAG AAT TAC TTG AAT ATC AAG CAG GTG
T Q
D
I
S
D
E P
W G
W Y K
S
P
ACT CAA GAT ATT TCT GAT GAA CCA TGG GGA TGG TAC AAG TCT CCT
TGA

5`CATTTAACCAAGAATG GCG TTC CCA ATT CCT GCT CGT CAG CTA TTC ATCGAC GGA GAG TGG AGA GAA CCC ATT AAA AAA AAT CGC ATA 3
3GTAAATTGGTTCTTACCGCAAGGGTTAA GGA CGA GCA GTC GAT AAGTAGCTG CCT CTC ACC TCA CTT GGG TAA TTT TTT TTA GCG TAT 5`

PRIMER FORWARD
ATG GCG TTC CCA ATT CCT GCT CGT CAG CTA TTC ATCGA

5`TGG GGT ATC CAG AAT TAC TTG AAT ATC AAG CAG GTG ACT CAA GAT ATT TCT GAT GAA CCA TGG GGA TGG TAC AAG TCT CCT 3
3ACC CCA TAG GTC TTA ATG AAC TTA TAG TTC GTC CTC TGA GTT CTA TAA AGA CTA CTT GGT ACC CCT ACC ATG TTC AGA GGA 5
PRIMER REVERSE
5 AGG AGA CTT GGA CCA TCC CCA TGG CCA TTC ATC 3

VECTORES DE CLONACIN
Los vectores de clonacin son molculas transportadoras que transfieren y replican fragmentos de ADN que
llevan insertados mediante tcnicas de ADN recombinante. Para que sirva de vector, una molcula debe ser
capaz de replicarse junto con el fragmento de ADN que transporta. Tambin tiene que tener secuencias de
reconocimiento que permitan la insercin del fragmento de ADN a clonar.

PLSMIDOS
Son ampliamente usados, proceden de molculas de DNA de doble cadena extracromosmicas
y se replican autonmamente dentro de la clula
pUC18
Es un plsmido muy usado, es derivado del pBR322, 10,000 pb
Bacteriofago
20, 000 pb
Csmidos
Plsmido-lambda 50,000 bp
YAC
Son cromosomas de levadura 100 kb a 1000kb

Plsmido
1. ORIGEN DE REPLICACIN
Capaz de hacer copias exactas de si mismo independiente del cromosoma del hospedero
2. MARCADORES DE SELECCIN
Permite aislar a las clulas que poseen el gen deseado, generalmente resistencia a un
antibitico
3. SITIO DE CLONACIN MULTIPLE (SCM)
Sitios de enzimas de restriccin en regiones no esenciales. Permite abrir al plsmido e
insertar DNA.

Restriccin

Las endonucleasas se denominan enzimas de restriccin, debido a


que es la forma de defensa de las bacterias contra la invasin por
virus, es decir, restringen la invasin por el DNA viral.

Enzimas de restriccin
Las enzimas de restriccin, tambin conocidas como endonucleasas, son enzimas que cortan
los enlaces fosfodiester del material gentico a partir de una secuencia que reconocen.

Permiten cortar DNA de hebra doble, donde reconocen secuencias palindrmicas (secuencias
que se leen igual en ambas direcciones)

Nomenclatura
Ejemplo
E
Escherichia
co
coli
R
RY13
I La primera enzima identificada

Corresponde a:
Gnero de la bacteria
Especie de la bacteria
Cepa de la bacteria
Orden de identificacin de la enzima

Extremos romos

Extremos cohesivos

TRANSFORMACIN
CAMBIO HEREDABLE EN UNA CLULA U ORGANISMO PRODUCIDO POR LA INTRODUCCIN DE UN DNA EXGENO

Puede ser
NATURAL (se han encontrado aproximadamente 40 especies
que pueden realizar este proceso)
ARTIFICIAL (INDUCIDA)

El caballito de batalla es la bacteria Escherichia coli


Es una tcnica fundamental en biologa molecular: clonacin y generar
organismos transgnicos

cmo se induce el estado competente de


una bacteria?

1. Tratamiento qumico
2. Electroporacin

Preparar clulas competentes de E. coli

A= 0.6 0.8 a 600 nm

3 mL medio
Luria
Incubar toda la
noche a 37C

Preparar clulas competentes de E. coli


5 mL CaCl2

3 mL NaCl

5000 r.p.m.
5 min
4C

Resuspender

Resuspender

CLULAS
COMPETENTES

Incubar 20 min

2500 r.p.m
min

LA TRANSFORMACIN SE REALIZAR POR CHOQUE


TRMICO

42C
70 s

1 hr

Incubar a 37C
con agitacin
por 45 min
1 mL medio SOC

Inmediatamente en
hielo

Al final de la transformacin

Clulas
no
transformantes

Clulas
transformantes