Article

pubs.acs.org/JAFC

Selenium Alleviates Aatoxin B1Induced Immune Toxicity through

Improving Glutathione Peroxidase 1 and Selenoprotein S Expression
in Primary Porcine Splenocytes
Shu Hao, Junfa Hu, Suquan Song, Da Huang, Haibing Xu, Gang Qian, Fang Gan, and Kehe Huang*
Institute of Nutritional and Metabolic Disorders in Domestic Animals and Fowls and College of Veterinary Medicine, Nanjing
Agricultural University, Nanjing 210095, Jiangsu Province, China
ABSTRACT: Selenium (Se) is generally known as an essential micronutrient and antioxidant for humans and animals. Aatoxin
B1 (AFB1) is a frequent contaminant of food and feed, causing immune toxicity and hepatotoxicity. Little has been done about
the mechanisms of how Se protects against AFB1-induced immune toxicity. The aim of this present study is to investigate the
protective eects of Se against AFB1 and the underlying mechanisms. The primary splenocytes isolated from healthy pigs were
stimulated by anti-pig-CD3 monoclonal antibodies and treated by various concentrations of dierent Se forms and AFB1. The
results showed that Se supplementation alleviated the immune toxicity of AFB1 in a dose-dependent manner, as demonstrated by
increasing T-cell proliferation and interleukin-2 production. Addition of buthionine sulfoximine abrogated the protective eects
of SeMet against AFB1. SeMet enhanced mRNA and protein expression of glutathione peroxidase 1 (GPx1), selenoprotein S
(SelS), and thioredoxin reductase 1 without and with AFB1 treatments. Furthermore, knockdown of GPx1 and SelS by GPx1specic siRNA and SelS-specic siRNA diminished the protective eects of SeMet against AFB1-induced immune toxicity. It is
concluded that SeMet diminishes AFB1-induced immune toxicity through increasing antioxidant ability and improving GPx1 and
SelS expression in splenocytes. This study suggests that organic selenium may become a promising supplementation to protect
humans and animals against the decline in immunity caused by AFB1.
KEYWORDS: selenomethionine, aatoxin B1, immune toxicity, oxidative stress, selenoprotein

INTRODUCTION
Aatoxin B1 (AFB1), produced by the fungi Aspergillus avus
and Aspergillus parasiticus, is commonly found in foods and
feedstus and is considered accountable for the increased
incidence of health impairment and economic losses.1,2 For
example, Lai surveyed the occurrence of aatoxins (AFs) in rice
collected from six provinces in China at 63.5%, and the average
concentrations was 0.65 g/kg.3 Wu described that over 100
nations have AFB1 contamination, which incurs economic
losses including export maize and other AFB1-contaminated
commodities.4 Numerous epidemiological studies have linked
consumption of aatoxin-contaminated food and feedstus to
immune toxicity,5 carcinogenicity,6 genotoxicity,7 hepatotoxicity,8 and reproductive disorders.9 Among these, a consensus is
growing that chronic toxin poisoning has become an interesting
topic in public life because chronic toxin poisoning, which is
associated with a reduction of immune function and an increase
of susceptibility to infectious diseases, is widespread and covert.
Therefore, chronic toxin poisoning brings more serious
economic losses in livestock husbandry.10 That is why AFB1induced immune toxicity will be worth studying in the present
work.
Selenium (Se), although initially considered a toxin, is now
viewed as an essential trace element linked to many health
benets in humans and other mammals.11 In recent years, there
has been growing interest in selenium in relation to
chemopreventive eects,12 oxidant defense,13 and protective
eects against cancer and other chronic diseases.14 The
biological eects of Se are exerted through covalent bonding
within the amino acid selenocysteine (Sec),15 the 21st amino
2016 American Chemical Society

acid used for selenoprotein synthesis. Numerous selenoprotein

families participate in antioxidant defense and redox state
regulation, such as cytosolic glutathione peroxidase (GPx),
selenoprotein S (SelS), and thioredoxin reductases (TR).16,17
Several previous pieces of evidence have shown that
selenoprotein is a key factor in the modulation of the immune
system, suggesting that dietary Se levels modulate free thiol
levels and specic signaling events during CD4+ T cell
activation, thus inuencing their proliferation and dierentiation.18 However, further work is needed to provide insight
into the role of selenium and specic selenoproteins in relation
to diverse diseases.
From the results of previous studies, the doses of AFB1 and
SeMet were determined.19,20 As we know, pigs are extremely
sensitive to AFB121 and considered to be a tractable model for
human immunity. The spleen is the center of cellular immunity
and humoral immunity in body, accounting for 25% of total
body lymphatic tissue, containing many lymphocytes and
macrophages. That is why this species and tissue for the assays
were chosen for the present work.
The objectives of this study were to investigate the eect of
organic selenium on the AFB1-induced immune toxicity in
primary porcine splenocytes and to explore the mechanisms by
which selenoprotein aects AFB1-induced immune toxicity.
Received:
Revised:
Accepted:
Published:
1385

November 26, 2015

January 23, 2016
January 23, 2016
January 24, 2016
DOI: 10.1021/acs.jafc.5b05621
J. Agric. Food Chem. 2016, 64, 13851393

Article

Journal of Agricultural and Food Chemistry

MATERIALS AND METHODS

Table 1. Primers Used for Real-Time Quantitative PCR

Animal and Cell Culture. The experimental animals were

approved by the Nanjing Agricultural University Animal Care
Committee. A total of 80 normal Meishan pigs with half males and
half females, aged 30 days and weighing 8 2 kg, were collected from
the breeding center of Jiangsu Polytechnic College of Agriculture and
Forestry and killed. The following procedures were performed as
previously described.19 Isolated spleen lymphocytes were cultivated
with enriched RPMI-1640 medium (Invitrogen, Paisley, Scotland,
UK), were added to 10% fetal bovine serum (FBS) and penicillin
streptomycin (20 mg/mL), and cultivated at 37 C in the incubator
with 5% CO2. The viability of isolated spleen lymphocyte was
evaluated by 0.4% trypan blue dye exclusion, and the standard of cell
viability was used by 95%.
Spleen Lymphocyte Proliferation Assay. Spleen lymphocytes
(1 106 cells/well) were stimulated by anti-pig-CD3 mAb (Abcam,
Cambridgeshire, UK) and cultivated in 96-well plates for 60 h. Sodium
selenite and SeMet were exposed at 0, 0.5, 1, 2, 4, 8, and 16 M
concentrations. AFB1 was treated at 0, 1, 2, 4, and 8 g/mL
concentrations. 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium
bromide (MTT) soluion (Sigma, St. Louis, MO, USA) was later
added at 5 mg/mL concentration. Finally, the optical density (OD)
value was assessed as absorbance at 490 nm by enzyme-labeled
instrument (Bio-Rad, Hercules, CA, USA). Proliferative activity should
be expressed as percent of viability. All samples were assayed in
quadruplicate.
A total of 1 106 cells/well carboxyuorescein succinimidylester
(CFSE) (Invitrogen, Paisley, Scotland, UK)-stained splenocytes was
cultivated in 24-well plates for 60 h. Subsequently, splenocytes were
centrifuged and stained with anti-CD3-PEcy5 (Abcam) and then
prepared for ow cytometry analysis. Flow cytometry was performed
using FACSCalibur (BD Biosciences, San Jose, CA, USA) ow
cytometers with acquisition enabled by CellQuest Pro software (BD
Biosciences, San Jose, CA, USA). Color compensation was achieved
using an appropriate single uorochrome-labeled sample. Data were
analyzed using FlowJo 7.6.5 (TreeStar).
Determination of IL-2 in Splenocytes. Splenocytes (1 106
cells/well) were cultivated in 96-well plates and treated with various
concentrations of SeMet (0, 0.5, 1, 2, and 4 M) in the absence
(controls) or presence of 4 g/mL AFB1 for 60 h. The cell
supernatants were then collected and assayed for IL-2 by ELISA (BD
Biosciences). All samples were assayed in triplicate.
GSH Level Analysis. Primary porcine splenocytes at a density of 2
106 cells/well in 6-well plates were treated with SeMet at 0, 0.5, 1, 2,
and 4 M with or without 4 g/mL AFB1 for 60 h. Intracellular
glutathione (GSH) in splenocyte cytosol was measured as previously
described,19,20 using commercially available kits (Jiancheng, Nanjing,
Jiangsu, China). Data were expressed as micromoles of GSH per gram
of protein. All samples were assayed in triplicate.
Determination of Selenoprotein mRNA Levels by Real-Time
PCR. PCR primers (-actin, GPx1, GPx4, SelS, and TR1) (Table 1)
were designed using Beacon Designer (Palo Alto, CA, USA) and
synthesized by Invitrogen on the basis of known porcine sequences. A
total of 2 106 cells/wells were seeded in 6-well plates and cultured as
described above. Total RNA was isolated from splenocytes using the
RNAiso Plus kit (TaKaRa, Dalian, Liaoning, China) according to the
manufacturers protocol. The RNA pellet was dissolved in diethyl
pyrocarbonate-treated water, and the RNA quality was measured by
the absorbance ratio at 260/280 nm. First-strand cDNA was
synthesized from 1 g of total RNA using Oligo dT primers and MMLV reverse transcriptase (TaKaRa) according to the manufacturers
instructions. Reactions were followed in an ABI Prism Step One Plus
detection system (Applied Biosystems, Foster City, CA, USA). In
short, reactions were performed in a 20 L reaction mixture containing
10 L of 2 SYBR Green I PCR Master Mix (TaKaRa), 2 L of
cDNA, 1 L of each primer (10 M), and 6.8 L of PCR-grade water.
The PCR procedure consisted of a 95 C step for 30 s followed by 40
cycles consisting of 95 C for 5 s and 60 C for 30 s. A dissociation
curve was run for each plate to conrm the production of a single

gene

accession no.

Actb

DQ845171.1

GPx1

NM_214201

GPx4

NM_214407.1

TR1

NM_214154

SelS

DQ845171.1

primer sequence (53)

forward:
CTGCGGCATCCACGAAACT
reverse:
AGGGCCGTGATCTCCTTCTG
forward:
TGGGGAGATCCTGAATTG
reverse:
GATAAACTTGGGGTCGGT
forward:
GATTCTGGCCTTCCCTTGC
reverse:
TCCCCTTGGGCTGGACTTT
forward:
CCCTGGTGACAAAGAGTA
reverse:
GTCCTGGTCAAATCCTCT
forward:
GGAAGCGTCAGGAAGAAG
reverse:
TTAGCCTCATCCACCAGAT

product
(bp)
147

172

183

184

102

product. The ratio of the level of various selenoproteins to that of the

-actin internal control was used for statistical comparison of the
dierent treatments.
Western Blot Analysis. Spleen lymphocyte suspension was
cultured in a 6-well plate at a density of 2 106 cells/well for 60 h.
After separation by 15% sodium dodecyl sulfatepolyacrylamide gel
electrophoresis (SDS-PAGE), protein molecules were transferred to a
polyvinylidene diuoride (PVDF) membrane (Bio-Rad Trans-Blot
SD) and then incubated using a specic antibody to quantitatively
detect GPx1 (1/500) (goat anti-GPx1 from Santa Cruz Biotechnology,
Dallas, TX, USA) and SelS (1/500) protein (rabbit anti-actin from
Santa Cruz Biotechnology) in TBST. After the rst antibody reaction
overnight, the PVDF membrane was washed by TBST three times and
incubated in horseradish peroxidase (HRP)-labeled anti-rabbit
secondary antibody (Cell Signaling Technology, Danvers, MA,
USA), diluted 1/5000 in 5 TBST. Blots were visualized according to
the standard enhanced chemiluminescence system (Bio-Rad, Hercules,
CA, USA).
Small Interfering RNA (siRNA) Transfection. Specic siRNA
was designed using the sequence of Sus scrofa GPx1 mRNA (GenBank
accession no. NM_214201.1) and SelS mRNA (GenBank accession
no. NM_001164113) by Invitrogen BlockiT RNAi designer. The
GPx1-specic siRNA sequence was 5-GGGACUACACCCAGAUGAATT-3. The control siRNA had the sequence 5-UUCUCCGAACGUGUCACGUTT-3. The SelS-specic siRNA sequence was 5GCUUUAGCAGCAGCUCGUUTT-3. The control siRNA had the
sequence 5-AACGAGCUGCUGCUAAAGCTT-3. Duplexes were
resuspended in DEPC-treated water to obtain 20 M solutions before
use. Primary porcine splenocytes in RPMI-1640 10% FBS without
antibiotics were seeded in 6-well plates at a density of 2 106 cells/
well and incubated at 37 C. X-tremeGene siRNA transfection reagent
(Roche, Basel, Switzerland) (2.5 L) and 0.5 g of siRNA were added
to each well and incubated for 5 h. The cells were then washed and
transferred to RPMI-1640 + 10% FBS.
Statistical Analysis. Statistical analyses were performed by a oneway analysis of variance (ANOVA) followed by Tukeys b (K) posttest to separate the means using the SPSS 18.0 computer program for
Windows (Statistical Product and Service Solutions, Inc., Chicago, IL,
USA). Results are expressed as the mean standard error (SEM). p
values of <0.05 were considered statistically signicant.

RESULTS
Immunotoxic Eects of Various Concentrations of
AFB1 or Dierent Se on Primary Porcine Splenocytes. To
assess the immunotoxic eects of AFB1 or dierent forms of
1386

DOI: 10.1021/acs.jafc.5b05621
J. Agric. Food Chem. 2016, 64, 13851393

Article

Journal of Agricultural and Food Chemistry

Figure 1. Eects of concentrations of AFB1 or dierent Se forms on T cell proliferation and IL-2 production induced by anti-CD3. Cells were
assayed for cell proliferation (A) and IL-2 production (B). Data are presented as means SEM of four independent experiments. Bars with a
symbol are statistically signicant dierence from control (() p < 0.05 and () p < 0.01). # and ## indicate signicant dierence ((#) p < 0.05 and
(##) p < 0.01) between selenite-treated cells and SeMet-treated cells in the same concentration.

Figure 2. SeMet supplementation protects splenocytes from AFB1-induced toxicity. Cells were assayed for cell proliferation (A) and IL-2 production
(B). Data are presented as means SEM of four independent experiments. Within the groups without AFB1 treatment, signicance was compared
with the control cells without SeMet treatment, (() p < 0.05 and () p < 0.01). Within the groups with AFB1 treatment, signicance was
compared with the control cells without SeMet treatment ((#) p < 0.05 and (##) p < 0.01).

cantly lowered by AFB1 from 4 to 8 g/mL in a dosedependent manner. Whereas IL-2 production presents the same
trend (Figure 1B), AFB1 at the concentration of 4 g/mL
reduced the IL-2 production of T-cells (p < 0.05). At the same
time, over the range of concentrations of selenite used, the cell
proliferation (Figure 1A) was signicantly increased at the
concentration of 2 M but selenite at concentrations of 8 and

selenium on primary porcine splenocytes, we examined the

eects of AFB1, selenite, and SeMet at various concentrations
through T-cell proliferation and IL-2 production, respectively.
In the MTT assay, splenocytes were seeded at a density of 1
106 cells/well in 96-well plates and cultured for 60 h. As shown
in Figure 1A, over the range of concentrations of AFB1 used,
the proliferation of primary porcine splenocytes was signi1387

DOI: 10.1021/acs.jafc.5b05621
J. Agric. Food Chem. 2016, 64, 13851393

Article

Journal of Agricultural and Food Chemistry

Figure 3. Eects of SeMet and/or BSO on T cell proliferation and IL-2 production induced by AFB1. Cells were assayed for cell proliferation (A)
and IL-2 production (B). Data are presented as means SEM of four independent experiments. Signicance was compared with control (() p <
0.05 and () p < 0.01). Signicance was compared with cells in AFB1 treatment ((#) p < 0.05 and (##) p < 0.01). Changed levels of GSH were
assayed as described under Materials and Methods (C). Data are presented as means SEM of three independent experiments. Signicance was
compared with control (without only treatment from AFB1 or SeMet) (() p < 0.05 and () p < 0.01). Within the groups with AFB1 treatment,
signicance was compared with the control cells without SeMet treatment, ((#) p < 0.05 and (##) p < 0.01). Signicance was compared in the same
SeMet concentration, (($) p < 0.05 and ($$) p < 0.01).

Figure 4. Eects of SeMet supplementation on selenoprotein expression. Cells were assayed for GPx1 (A), SelS (B), TR1 (C), and GPx4 (D)
mRNA levels and GPx1 and SelS protein expression (EG). Data are presented as means SEM for three independent experiments. Within the
groups without AFB1 treatment, signicance was compared with the control cells without SeMet treatment (() p < 0.05 and () p < 0.01). Within
the groups with AFB1 treatment, signicance was compared with the control cells without SeMet treatment ((#) p < 0.05 and (##) p < 0.01).
Signicance was compared in same SeMet concentration (($) p < 0.05 and ($$) p < 0.01).

16 M signicantly lowered cell proliferation. In contrast,

SeMet signicantly promoted anti-CD3-induced proliferation at

concentrations from 1 to 16 M (p < 0.05), with a maximal

increase at 2 M (Figure 1A). The IL-2 production measured
1388

DOI: 10.1021/acs.jafc.5b05621
J. Agric. Food Chem. 2016, 64, 13851393

Article

Journal of Agricultural and Food Chemistry

Figure 5. Eect of GPx1 knockdown and SelS knockdown on GPx1/SelS expression in splenocytes. Cell samples were assayed for GPx1 mRNA
levels (B) and GPx1 protein levels (A). Cell samples were assayed for SelS mRNA levels (D) and SelS protein levels (C). Data are presented as
means SEM of three independent experiments. Signicance was compared with control (() p < 0.05 and () p < 0.01).

increase in GSH levels compared with control group, and in

AFB1-treated group, Se at 2 and 4 M signicantly enhanced
the GSH levels in a dose-dependent manner (p < 0.05).
To determine whether the protective eect of SeMet in T
lymphocytes is associated with oxidative stress, we used
buthionine sulfoximine (BSO), which is a specic inhibitor of
glutamatecysteine ligase. Splenocytes at a density of 1 106
cells/well in 96-well plates were inoculated or not with 10 M
BSO and incubated with 4 g/mL AFB1 for 60 h. As shown in
Figure 3B, we found that BSO increased AFB1-induced immune
toxicity as demonstrated by decreasing cell proliferation and IL2 production compared with the AFB1 group and signicantly
weakened the protective eects of SeMet against AFB1-induced
immune toxicity (p < 0.05)..
Eects of SeMet Supplementation on Selenoprotein
Expression. To investigate the mechanism responsible for the
observed eect of SeMet on protective action, cells at a density
of 2 106/well in 6-well plates were inoculated with Se at 0.5,
1, 2, and 4 M for 12 h and then cultured with or without AFB1
at 4 g/mL for a further 48 h. As shown in Figure 4, AFB1
treatment signicantly decreased GPx1 mRNA levels by 44.6%
(Figure 4A), GPx1 protein expression by 23.1% (Figure 4G),
SelS mRNA levels by 37.5% (Figure 4B), SelS protein
expression by 2.5% (Figure 4G), and GPx4 mRNA levels by
42.5% (Figure 4D) compared to without AFB1. In contrast,
AFB1 treatment did not show a signicant change in TR1
mRNA levels (Figure 4C).
After SeMet was added, whether primary porcine splenocytes
were treated or not with AFB1, selenium supplementation
signicantly increased GPx1, SelS, and TR1 mRNA levels
(Figure 4AC). Moreover, SeMet supplementation caused
only a small increase in GPx4 mRNA levels in splenocytes
(Figure 4D).
Western blot was used to measure protein levels of GPx1 and
SelS protein in activated splenocytes. The signicant decrease
in GPx1 and SelS expression was associated with a treatment of

by ELISA showed a pattern similar to that of MTT (Figure 1B).

In subsequent experiments AFB1 at 4 g/mL was used, and
SeMet was used at concentrations between 0.5 and 4 M.
Protective Eects of SeMet against AFB1-Induced
Immune Toxicity in Primary Porcine Splenocytes. To
evaluate the protective eects of SeMet against immune
toxicity, primary porcine splenocytes at a density of 1 106
cells/well in 96-well plates or 1 106 cells/well in 24-well
plates were inoculated with Se at 0.5, 1, 2, and 4 M for 12 h
and then cultured with or without AFB1 at 4 g/mL for a
further 48 h. As shown in Figure 2, Se at 1, 2, and 4 M
signicantly promoted the proliferation of splenocytes (Figure
2A) and increased IL-2 production (Figure 2B) when cultured
with AFB1 compared with only the AFB1 group in a dosedependent manner.
To conrm whether the phenomenon observed by cell
counting assay was due to the proliferation of T lymphocytes or
total cells or any other cell type, CD3+T cell proliferation was
estimated by CFSE labeling of splenocytes and following antipig-CD3-PEcy5 staining. Total CD3+T cells proliferated more
in the 2 M SeMet-treated group than in the control group in
anti-CD3 stimulated splenocytes (58.4 versus 39.0%, Figure
2C). In the AFB1-treated group, the percentage of proliferating
cells was less compared to control group at the concentration of
4 g/mL (21.9 versus 39.0%, Figure 2C); however, this
decrease was smaller when 2 M SeMet was added (31.0 versus
21.9%, Figure 2C).
SeMet Blocks Increased Immune Toxicity in Primary
Porcine Splenocytes Induced by AFB1. To determine
whether AFB1-induced immune toxicity is associated with
oxidative stress, intracellular glutathione (GSH) in splenocyte
cytosol was measured as an indicator of its antioxidant capacity.
As shown in Figure 3C, we observed that AFB1 added induced
oxidative stress, which was judged by decreasing GSH levels
without any Se addition (p < 0.05). After that, SeMet
supplementation at 0.5, 1, 2, and 4 M induced a signicant
1389

DOI: 10.1021/acs.jafc.5b05621
J. Agric. Food Chem. 2016, 64, 13851393

Article

Journal of Agricultural and Food Chemistry

Figure 6. Protective eects of SeMet supplementation against immune toxicity induced by AFB1 in SelS-knockdown cells. Cell samples were assayed
for cell proliferation (A), IL-2 production (B), and GSH levels (C) in GPx1-knockdown cells. Cell samples were assayed for cell proliferation (D),
IL-2 production (E), and GSH levels (F) in SelS-knockdown cells. Data are presented as means SEM of three independent experiments.
Signicance was compared with control group (() p < 0.05 and () p < 0.01). Signicance was compared with AFB1 group ((#) p < 0.05 and (##)
p < 0.01). Signicance was compared with SeMet and AFB1 group (($) p < 0.05 and ($$) p < 0.01).

AFB1, and the dose-dependent increase in protein expression

was associated with an addition of SeMet in gray value (Figure
4E,F). However, more dramatic changes in SelS expression
than in GPx1 expression were seen after SeMet treatment
(Figure 4G).
Eect of GPx1 and SelS Knockdown on GPx1 and SelS
Expression in Primary Porcine Splenocytes. We used
siRNA to silence the expression of GPx1 and SelS, and the
extent of knockdown was evaluated by determination of GPx1
and SelS expression after splenocytes were transfected with
specic siRNA. As shown in Figure 5A, transfection of
splenocytes with GPx1-specic siRNA resulted in 59.4%
decreases of GPx1 mRNA (Figure 5B) and 56.1% decreases
of protein levels (Figure 5A) compared to the control siRNA
group and control group. Transfection of splenocytes with
SelS-specic siRNA resulted in a 46.3% decrease in SelS mRNA
(Figure 5D) and a 40.4% decrease in protein levels (Figure
5C).
Protective Eects of SeMet against AFB1-Induced
Cytotoxicity in GPx1-Knockdown and SelS-Knockdown
Splenocytes. To address whether GPx1 and SelS play a key
role in the protective eects of SeMet against cytotoxicity
induced by AFB1, splenocytes were transfected with specic or
control siRNA. After 5 h of transfection treatment, cells were
centrifuged and the medium was removed. Transfected cells
were then cultured with Se at 2 M and 4 g/mL AFB1 for a
further 55 h.
As shown in Figure 6, a signicant decrease in cell
proliferation and the production of IL-2 was observed after
GPx1 knockdown. Supplementation of SeMet at a concentration of 2 M increased cell proliferation (Figure 6A) and IL2 production (Figure 6B) in splenocytes treated with the
control siRNA but not in splenocytes treated with the GPx1-

specic siRNA. To investigate the mechanism responsible for

the observed changes in AFB1-induced immune toxicity in
response to SeMet supplementation, the antioxidant capacity in
GPx1-knockdown cells was evaluated. As measured by the
intracellular GSH levels, SeMet supplementation showed less
eect on GPx1-knockdown cells than control cells in decreasing
oxidative stress (Figure 6C). These data suggest that GPx1knockdown caused a signicant decrease in antioxidant
capacity. Meanwhile, similar results were obtained in SelSspecic siRNA. As shown in Figure 6, SelS-specic siRNA
increased the immune toxicity of AFB1, as demonstrated by
decreasing cell proliferation (Figure 6D) and IL-2 production
(Figure 6E). In addition, SelS-specic siRNA alleviated the
eects of Se, reversing the changes of cell proliferation, IL-2
production, and GSH levels induced by AFB1, but smaller
eects were seen on GSH levels (Figure 6F) compared to
GPx1-specic siRNA.

DISCUSSION
A previous study showed that AFB1 treatment inhibited antiCD3-induced lymphocyte proliferation and IL-2 production by
the oxidative stress mediated ERK1/2 MAPK signaling pathway
in the splenocyte.19 In contrast, Ren demonstrated that
selenium could promote T-cell response to TCR stimulation
and IL-2 production.20 Also, it is known that selenium could
relieve the oxidative stress induced by AFB1 in MDCK cells,22
and sodium selenite plays a possible protective role in AFB1induced oxidative stress and apoptosis in the spleen of broilers
by inhibiting oxidative stress and excessive apoptosis.5,23
However, further work is needed to provide insight into the
mechanism of how selenium supplementation alleviates AFB1induced immune toxicity at the cellular level, other than animal
experiments. The present work is the rst to identify the
1390

DOI: 10.1021/acs.jafc.5b05621
J. Agric. Food Chem. 2016, 64, 13851393

Article

Journal of Agricultural and Food Chemistry

Because Se supplementation is anticipated to aect any of the

25 selenoproteins,35,36 the specicity of the eect of Se
supplementation on the expression of various selenoproteins
and protection from AFB1-induced immune toxicity is not
unequivocal.37,38 To investigate the role of selenium and
specic selenoproteins in relation to the protective eects of Se
against immune toxicity by AFB1-induced, we chose four major
selenoproteins to detect their mRNA levels. In general, GPx
activities are regulated by the availability of selenium in tissues.
However, in some previous studies, AFB1 exposure led to
signicant inhibition of GPx activities in mouse kidney39 and in
MDCK cells.22 In this study we found AFB1 addition to lower
GPx1, GPx4, and SelS mRNA levels. Therefore, it is possible
that the increase of oxidative stress, which caused a depletion of
antioxidant enzymes including GPx and SelS, has been linked to
antioxidative protection in a cell-type-dependent manner.37
TR1 seems to have an AFB1-insensitive property. SeMet
supplementation signicantly increased GPx1 mRNA and SelS
mRNA, but failed to signicantly increase GPx4 mRNA levels.
A possible explanation for these phenomena is that GPx4 is
negative to selenium intake.40,41 In the Western blot experiment, GPx1 and SelS protein expression further demonstrated
the mRNA results, and SelS has the maximum increase among
these two selenoenzymes. It has been suggested that GPx1 and
SelS both are major metabolic mediators of body selenium to
protect animals against oxidative stress.
To further determine the specicity of the two selenoproteins having essential eects on AFB1-induced oxidative stress
and immune toxicity, experiments were repeated using GPx1specic siRNA and SelS-specic siRNA, which can specically
block GPx1 and SelS expression. Gan showed that GPx1specic siRNA alleviated the eects of SeMet, reversing the
changes of cell viability, LDH activity, and GSH and ROS levels
induced by ochratoxin A.42 In Figure 6, the weakening in
immune toxicity induced by 2 M SeMet was blocked by the
GPx1-specic siRNA, and this eect of the siRNA correlated
with the eects of SeMet supplementation on cell proliferation,
IL-2 production, and parameters of oxidative stress status in Tcell. Our results are consistent with the previous studies. SelS
has been classied as a new endoplasmic reticulum (ER)
membrane protein that regulates cellular redox balance and
protects the ER against the deleterious eects of oxidative
stress.43 Previous studies indicated that SelS expression plays a
key role in the regulation of cytokines and innate immunity.44
Fradejas found that suppression of SelS by small interfering
RNA severely increases the cytotoxicity of OGD on astrocyte.45
Our results suggested the treatment of SelS-specic siRNA
impaired the protective eect of selenium, which proved that
SelS may be a key selenoprotein in the protective eect on
selenium alleviating T-cell immune toxicity induced by AFB1. In
a word, we could draw the conclusion that supplementation of
organic selenium could be a potential antioxidant to protect
humans and animals suering from the abyss of chronic toxin
poisoning and increasing susceptibility to infectious diseases
caused by AFB1 through improving GPx1 and SelS expression.

protective eects of dierent kinds of selenoprotein on AFB1induced immune toxicity.

Selenium supplementation has been found to improve
immune function and protect against various toxicities.24,25
Previous studies have shown that Se has an antagonistic eect
against AFB1 toxicity, that the degree of antagonistic eect of Se
against AFB1 was related to its concentration,26 and that Se
supplied in the diet may improve the impaired cellular immune
function induced by AFB1.27 To investigate whether Se caused
the protective eect on splenocytes against AFB1-induced
immune toxicity, we chose inorganic selenium, sodium selenite,
and organic selenium SeMet, as dierent selenium resources. It
is well-known that selenium-enriched yeast and seleniumenriched probiotics, a newly developed product, are recognized
as available organic selenium in animal production. These two
products contain >90% organic selenium and >75% SeMet.28
The aim of the current study is to provide a theoretical
foundation for the wide application of selenium-riched yeast
and selenium-enriched probiotics, so we chose SeMet as the
organic selenium resource in our cell experiment.
Both Se resources have lower immune toxicity; however,
SeMet showed a wider safe range and better protective eects
than sodium selenite. Chen et al. showed that SeMet exhibited
signicantly lower toxicity compared with sodium selenite over
a range of concentrations in PK15 cells, which was consistent
with a previous study.29 Besides, Anjum demonstrated that
among the organic forms of selenium, SeMet was bioavailable
to a higher extent than selenocysteine,30 and Le31 reported that
Se derived from SeMet showed the highest digestibility and
bactericidal activities, signicantly higher than those of Se from
selenite and selenocysteine (57.47 to 45.95 and 46.56%). In
contrast, the physiological concentration of Se in humans and
pigs was 2 M.32 Above all, SeMet at concentrations between
0.5 and 4 M was selected in the present study. In this range of
concentrations, SeMet does not have any toxic eect on
primary porcine splenocytes.
In anti-CD3-induced T cells, we found that SeMet
supplementation was eective in protecting cells from 4 g/
mL AFB1-induced immune toxicity as demonstrated by
increasing cell proliferation and IL-2 production activity. To
ensure the accuracy of the results, both MTT and ow
cytometry were used as eective methods to measure the
proliferation of T cells in the present experiment. Our current
results strongly indicated SeMet could alleviate AFB1-induced
immune toxicity in primary porcine splenocytes.
To our knowledge, AFB1 treatment induced intracellular
oxidative stress in the splenocytes, and the AFB1-induced
immunotoxic eects were due to an increase of redox status.
GSH was measured as an indicator of redox status;33 previous
research indicated that GSH, a major intracellular thiol, will
arise under more reduced conditions when more selenium is
supplemented.34 We hypothesized that SeMet protected
splenocytes against AFB1-induced immune toxicity by improving the intracellular oxidative stress. Our data show that
supplementation with SeMet signicantly alleviated AFB1induced GSH depletion. Moreover, we observed that BSO
addition could enhance AFB1-induced immune toxicity and
diminished the protective eects of SeMet against AFB1induced immune toxicity as measured by decreasing cell
proliferation and IL-2 production. Both strongly indicated that
SeMet could protect splenocytes against AFB1-induced immune
toxicity by improving antioxidant capacity.

AUTHOR INFORMATION

Corresponding Author

*(K.H.) Mail: College of Veterinary Medicine, Nanjing

Agricultural University, Nanjing 210095, Jiangsu Province,
China. Phone: +86-25-84395507. Fax: +86-25-84398669. Email: huangdahd@Gmail.com.
1391

DOI: 10.1021/acs.jafc.5b05621
J. Agric. Food Chem. 2016, 64, 13851393

Article

Journal of Agricultural and Food Chemistry

Funding

kappaB DNA-binding promoted by selenite. Antioxid. Redox Signaling

2007, 9, 115121.
(18) Hoffmann, F. W.; Hashimoto, A. C.; Shafer, L. A.; Dow, S.;
Berry, M. J.; Hoffmann, P. R. Dietary selenium modulates activation
and differentiation of CD4+ T cells in mice through a mechanism
involving cellular free thiols. J. Nutr. 2010, 140, 11551161.
(19) Hao, S.; Pan, S.; Hu, J.; Qian, G.; Gan, F.; Huang, K. Aflatoxin
B1 suppressed T-cell response to anti-pig-CD3 monoclonal antibody
stimulation in primary porcine splenocytes: a role for the extracellular
regulated protein kinase (ERK1/2) MAPK signaling pathway. J. Agric.
Food Chem. 2015, 63, 60947101.
(20) Ren, F.; Chen, X.; Hesketh, J.; Gan, F.; Huang, K. Selenium
promotes T-cell response to TCR-stimulation and ConA, but not PHA
in primary porcine splenocytes. PLoS One 2012, 7, e35375.
(21) Weaver, A. C.; See, M. T.; Hansen, J. A.; Kim, Y. B.; De Souza,
A. L.; Middleton, T. F.; Kim, S. W. The use of feed additives to reduce
the effects of aflatoxin and deoxynivalenol on pig growth, organ health
and immune status during chronic exposure. Toxins 2013, 5, 1261
1281.
(22) Parveen, F.; Nizamani, Z. A.; Gan, F.; Chen, X.; Shi, X.;
Kumbhar, S.; Zeb, A.; Huang, K. Protective effect of selenomethionine
on aflatoxin B1-induced oxidative stress in MDCK cells. Biol. Trace
Elem. Res. 2014, 157, 266274.
(23) Zimmermann, C. E.; Cruz, I. B.; Cadona, F. C.; Machado, A. K.;
Assmann, C.; Schlemmer, K. B.; Zanette, R. A.; Leal, D. B.; Santurio, J.
M. Cytoprotective and genoprotective effects of beta-glucans against
aflatoxin B1-induced DNA damage in broiler chicken lymphocytes.
Toxicol. In Vitro 2015, 29, 538543.
(24) You, L.; Liu, C.; Yang, Z. J.; Li, M.; Li, S. Prediction of
selenoprotein T structure and its response to selenium deficiency in
chicken immune organs. Biol. Trace Elem. Res. 2014, 160, 222231.
(25) Pietschmann, N.; Rijntjes, E.; Hoeg, A.; Stoedter, M.; Schweizer,
U.; Seemann, P.; Schomburg, L. Selenoprotein P is the essential
selenium transporter for bones. Metallomics: Integrated Biometal Sci.
2014, 6, 10431049.
(26) Agar, G.; Alpsoy, L.; Bozari, S.; Erturk, F. A.; Yildirim, N.
Determination of protective role of selenium against aflatoxin B1induced DNA damage. Toxicol. Ind. Health 2013, 29, 396403.
(27) Chen, K.; Shu, G.; Peng, X.; Fang, J.; Cui, H.; Chen, J.; Wang,
F.; Chen, Z.; Zuo, Z.; Deng, J.; Geng, Y.; Lai, W. Protective role of
sodium selenite on histopathological lesions, decreased T-cell subsets
and increased apoptosis of thymus in broilers intoxicated with aflatoxin
B1. Food Chem. Toxicol. 2013, 59, 446454.
(28) Pan, C. L.; Zhao, Y. X.; Liao, S. F. F.; Chen, F.; Qin, S. Y.; Wu,
X. S.; Zhou, H.; Huang, K. H. Effect of selenium-enriched probiotics
on laying performance, egg quality, egg selenium content, and egg
glutathione peroxidase activity. J. Agric. Food Chem. 2011, 59, 11424
11431.
(29) Chen, X.; Ren, F.; Hesketh, J.; Shi, X.; Li, J.; Gan, F.; Huang, K.
Selenium blocks porcine circovirus type 2 replication promotion
induced by oxidative stress by improving GPx1 expression. Free
Radical Biol. Med. 2012, 53, 395405.
(30) Anjum, K.; Platel, K. Bioaccessibility of selenium, selenomethionine and selenocysteine from foods and influence of heat
processing on the same. Food Chem. 2016, 194, 12931299.
(31) Le, K. T.; Fotedar, R. Bioavailability of selenium from different
dietary sources in yellowtail kingfish (Seriola lalandi). Aquaculture
2014, 420, 5762.
(32) Pillai, R.; Uyehara-Lock, J. H.; Bellinger, F. P. Selenium and
selenoprotein function in brain disorders. IUBMB Life 2014, 66, 229
239.
(33) Chowdhury, A. A.; Chaudhuri, J.; Biswas, N.; Manna, A.;
Chatterjee, S.; Mahato, S. K.; Chaudhuri, U.; Jaisankar, P.;
Bandyopadhyay, S. Synergistic apoptosis of CML cells by buthionine
sulfoximine and hydroxychavicol correlates with activation of AIF and
GSH-ROS-JNK-ERK-iNOS pathway. PLoS One 2013, 8, e73672.
(34) Cao, F.; Wang, N.; Zhang, M.; Dai, H.; Dawood, M.; Zhang, G.;
Wu, F. Comparative study of alleviating effects of GSH, Se and Zn

This work was funded by the National Natural Science

Foundation of China (31272627, 31472253), the Research
Fund for Doctoral Program of Higher Education in China
(20110097110014 and 20120097130002), and the Priority
Academic Program Development of Jiangsu Higher Education
Institutions (Jiangsu, China).
Notes

The authors declare no competing nancial interest.

REFERENCES

(1) Flores-Flores, M. E.; Lizarraga, E.; de Cerain, A. L.; GonzalezPenas, E. Presence of mycotoxins in animal milk: a review. Food
Control 2015, 53, 163176.
(2) Grace, D.; Mahuku, G.; Hoffmann, V.; Atherstone, C.;
Upadhyaya, H. D.; Bandyopadhyay, R. International agricultural
research to reduce food risks: case studies on aflatoxins. Food Secur.
2015, 7, 569582.
(3) Lai, X. W.; Liu, R. C.; Ruan, C. Q.; Zhang, H.; Liu, C. L.
Occurrence of aflatoxins and ochratoxin A in rice samples from six
provinces in China. Food Control 2015, 50, 401404.
(4) Wu, F. Global impacts of aflatoxin in maize: trade and human
health. World Mycotoxin J. 2015, 8, 137142.
(5) Meissonnier, G. M.; Pinton, P.; Laffitte, J.; Cossalter, A. M.;
Gong, Y. Y.; Wild, C. P.; Bertin, G.; Galtier, P.; Oswald, I. P.
Immunotoxicity of aflatoxin B1: impairment of the cell-mediated
response to vaccine antigen and modulation of cytokine expression.
Toxicol. Appl. Pharmacol. 2008, 231, 142149.
(6) Lorico, A.; Nesland, J.; Emilsen, E.; Fodstad, O.; Rappa, G. Role
of the multidrug resistance protein 1 gene in the carcinogenicity of
aflatoxin B1: investigations using mrp1-null mice. Toxicology 2002,
171, 201205.
(7) Zeinvand-Lorestani, H.; Sabzevari, O.; Setayesh, N.; Amini, M.;
Nili-Ahmadabadi, A.; Faramarzi, M. A. Comparative study of in vitro
prooxidative properties and genotoxicity induced by aflatoxin B1 and
its laccase-mediated detoxification products. Chemosphere 2015, 135,
16.
(8) Lu, X.; Hu, B.; Shao, L.; Tian, Y.; Jin, T.; Jin, Y.; Ji, S.; Fan, X.
Integrated analysis of transcriptomics and metabonomics profiles in
aflatoxin B1-induced hepatotoxicity in rat. Food Chem. Toxicol. 2013,
55, 444455.
(9) Shuaib, F. M. B.; Ehiri, J.; Abdullahi, A.; Williams, J. H.; Jolly, P.
E. Reproductive health effects of aflatoxins: a review of the literature.
Reprod. Toxicol. 2010, 29, 262270.
(10) Bircan, C.; Koc, M. Aflatoxins in dried figs in Turkey: a
comparative survey on the exported and locally consumed dried figs
for assessment of exposure. J. Agric. Sci. Technol.Iran 2012, 14, 1265
1274.
(11) Hatfield, D. L.; Tsuji, P. A.; Carlson, B. A.; Gladyshev, V. N.
Selenium and selenocysteine: roles in cancer, health, and development.
Trends Biochem. Sci. 2014, 39, 112120.
(12) Li, J. L.; Gao, R.; Li, S.; Wang, J. T.; Tang, Z. X.; Xu, S. W.
Testicular toxicity induced by dietary cadmium in cocks and
ameliorative effect by selenium. BioMetals 2010, 23, 695705.
(13) Bellinger, F. P.; Raman, A. V.; Reeves, M. A.; Berry, M. J.
Regulation and function of selenoproteins in human disease. Biochem.
J. 2009, 422, 1122.
(14) Nicastro, H. L.; Dunn, B. K. Selenium and prostate cancer
prevention: insights from the selenium and vitamin E cancer
prevention trial (SELECT). Nutrients 2013, 5, 11221248.
(15) Kryukov, G. V.; Castellano, S.; Novoselov, S. V.; Lobanov, A. V.;
Zehtab, O.; Guigo, R.; Gladyshev, V. N. Characterization of
mammalian selenoproteomes. Science 2003, 300, 14391443.
(16) Papp, L. V.; Lu, J.; Holmgren, A.; Khanna, K. K. From selenium
to selenoproteins: synthesis, identity, and their role in human health.
Antioxid. Redox Signaling 2007, 9, 775806.
(17) Ueno, H.; Kajihara, H.; Nakamura, H.; Yodoi, J.; Nakamuro, K.
Contribution of thioredoxin reductase to T-cell mitogenesis and NF1392

DOI: 10.1021/acs.jafc.5b05621
J. Agric. Food Chem. 2016, 64, 13851393

Article

Journal of Agricultural and Food Chemistry

under combined contamination of cadmium and chromium in rice
(Oryza sativa). BioMetals 2013, 26, 297308.
(35) Turanov, A. A.; Shchedrina, V. A.; Everley, R. A.; Lobanov, A.
V.; Yim, S. H.; Marino, S. M.; Gygi, S. P.; Hatfield, D. L.; Gladyshev, V.
N. Selenoprotein S is involved in maintenance and transport of
multiprotein complexes. Biochem. J. 2014, 462, 555565.
(36) Takayama, H.; Misu, H.; Iwama, H.; Chikamoto, K.; Saito, Y.;
Murao, K.; Teraguchi, A.; Lan, F.; Kikuchi, A.; Saito, R.; Tajima, N.;
Shirasaki, T.; Matsugo, S.; Miyamoto, K.; Kaneko, S.; Takamura, T.
Metformin suppresses expression of the selenoprotein P gene via an
AMP-activated kinase (AMPK)/FoxO3a pathway in H4IIEC3
hepatocytes. J. Biol. Chem. 2014, 289, 335345.
(37) Speckmann, B.; Gerloff, K.; Simms, L.; Oancea, I.; Shi, W.;
McGuckin, M. A.; Radford-Smith, G.; Khanna, K. K. Selenoprotein S is
a marker but not a regulator of endoplasmic reticulum stress in
intestinal epithelial cells. Free Radical Biol. Med. 2014, 67, 265277.
(38) Penglase, S.; Hamre, K.; Rasinger, J. D.; Ellingsen, S. Selenium
status affects selenoprotein expression, reproduction, and F1
generation locomotor activity in zebrafish (Danio rerio). Br. J. Nutr.
2014, 111, 19181931.
(39) Gupta, R.; Sharma, V. Ameliorative effects of tinospora
cordifolia root extract on histopathological and biochemical changes
induced by aflatoxin-b(1) in mice kidney. Toxicol. Int. 2011, 18, 94
98.
(40) Van Blarigan, E. L.; Ma, J.; Kenfield, S. A.; Stampfer, M. J.;
Sesso, H. D.; Giovannucci, E. L.; Witte, J. S.; Erdman, J. W., Jr.; Chan,
J. M.; Penney, K. L. Plasma antioxidants, genetic variation in SOD2,
CAT, GPX1, GPX4, and prostate cancer survival. Cancer Epidemiol.,
Biomarkers Prev. 2014, 23, 10371046.
(41) Crosley, L. K.; Bashir, S.; Nicol, F.; Arthur, J. R.; Hesketh, J. E.;
Sneddon, A. A. The single-nucleotide polymorphism (GPX4c718t) in
the glutathione peroxidase 4 gene influences endothelial cell function:
interaction with selenium and fatty acids. Mol. Nutr. Food Res. 2013,
57, 21852194.
(42) Gan, F.; Xue, H.; Huang, Y.; Pan, C.; Huang, K. Selenium
alleviates porcine nephrotoxicity of ochratoxin A by improving
selenoenzyme expression in vitro. PLoS One 2015, 10, e0119808.
(43) Curran, J. E.; Jowett, J. B.; Elliott, K. S.; Gao, Y.; Gluschenko, K.;
Wang, J.; Abel Azim, D. M.; Cai, G.; Mahaney, M. C.; Comuzzie, A.
G.; Dyer, T. D.; Walder, K. R.; Zimmet, P.; MacCluer, J. W.; Collier,
G. R.; Kissebah, A. H.; Blangero, J. Genetic variation in selenoprotein
S influences inflammatory response. Nat. Genet. 2005, 37, 12341241.
(44) Hall, J. A.; Bobe, G.; Vorachek, W. R.; Hugejiletu; Gorman, M.
E.; Mosher, W. D.; Pirelli, G. J. Effects of feeding selenium-enriched
alfalfa hay on immunity and health of weaned beef calves. Biol. Trace
Elem. Res. 2013, 156, 96110.
(45) Fradejas, N.; Pastor, M. D.; Mora-Lee, S.; Tranque, P.; Calvo, S.
SEPS1 gene is activated during astrocyte ischemia and shows
prominent antiapoptotic effects. J. Mol. Neurosci. 2008, 35, 259265.

1393

DOI: 10.1021/acs.jafc.5b05621
J. Agric. Food Chem. 2016, 64, 13851393