ORIGINAL ARTICLE

MYCOLOGY

Linking Pneumocystis jiroveci sulfamethoxazole resistance to the

alleles of the DHPS gene using functional complementation in
Saccharomyces cerevisiae
R. Moukhlis1, J. Boyer2, P. Lacube1, J. Bolognini1, P. Roux1 and C. Hennequin1
1) Laboratoire de Parasitologie-Mycologie, Faculte de Medecine Pierre et Marie Curie (site Saint Antoine) and 2) Unite de Genetique Moleculaire des
Levures, Universite Pierre et Marie Curie, Paris, France

Abstract
Curative and prophylactic therapy for Pneumocystis jiroveci pneumonia relies mainly on cotrimoxazole, an association of trimethoprim
and sulfamethoxazole (SMX). SMX inhibits the folic acid pathway through competition with para-aminobenzoic acid (pABA), one of the
two substrates of the dihydropteroate synthase (DHPS), a key enzyme in de novo folic acid synthesis. The most frequent non-synonymous single nucleotide polymorphisms (SNPs) in P. jiroveci DHPS are seen at positions 165 and 171, the combination leading to four
possible different genetic alleles. A number of reports correlate prophylaxis failure and mutation in the P. jiroveci DHPS but, because of
the impossibility of reliably cultivating P. jiroveci, the link between DHPS mutation(s) and SMX susceptibility is not definitively proven. To
circumvent this limitation, the yeast Saccharomyces cerevisiae was used as a model. The introduction of the P. jiroveci DHPS gene, with or
without point mutations, directly amplified from a clinical specimen and cloned in a centromeric plasmid into a DHPS-deleted yeast
strain, allowed a fully effective complementation. However, in the presence of SMX at concentrations >250 mg/L, yeasts complemented
with the double mutated allele showed a lower susceptibility compared with strains complemented with either a single mutated allele
or wild-type alleles. These results confirm the need for prospective study of pneumocystosis, including systematic determination of the
DHPS genotype, to clarify further the impact of mutations on clinical outcome. Additionally, the S. cerevisiae model proves to be useful
for the study of still uninvestigated biological properties of P. jiroveci.
Keywords: Cotrimoxazole, Pneumocystis jiroveci, resistance
Original Submission: 27 October 2008; Revised Submission: 5 January 2009; Accepted: 7 January 2009
Editor: E. Roilides
Article published online: 10 August 2009
Clin Microbiol Infect 2010; 16: 501507
10.1111/j.1469-0691.2009.02833.x
Corresponding author and reprint requests: C. Hennequin,
Laboratoire de Parasitologie-Mycologie, Faculte de Medecine Pierre
et Marie Curie (site Saint Antoine), 27 rue de Chaligny, 75012 Paris,
France
E-mail: christophe.hennequin@laposte.net

Introduction
Pneumocystis pneumonia (PCP) caused by Pneumocystis jiroveci
remains an important opportunistic infection affecting immunocompromised patients such as organ transplant patients,
cancer patients and, especially, human immunodeficiency
virus (HIV)-infected patients [13]. Although the incidence of
PCP has declined in HIV patients due to the introduction of
highly active antiretroviral therapy [4], PCP still reveals HIV
infection in >40% of cases in France [5], and remains an
important cause of mortality [6].

The drug of choice for both treatment and prophylaxis of

PCP is cotrimoxazole, a combination of sulfamethoxazole
(SMX) and trimethoprim [7]. Sulfa drugs such as SMX act on
the folic acid synthesis (FAS) pathway and deplete cells of
folates, which are essential for growth. SMX activity occurs
by competing with para-aminobenzoic acid (pABA) in a reaction catalysed by dihydropteroate synthase (DHPS) that leads
to the formation of a precursor of folinic acid [8]. As is the
case in Saccharomyces cerevisiae, the P. jiroveci FAS protein
is a multidomain protein responsible for DHPS activity, in
conjunction with other enzyme activities also involved in the
de novo FAS pathway [9]. Most common non-synonymous
mutations single nucleotide polymorphisms (SNPs) in the
P. jiroveci DHPS gene are located at nucleotide positions 165
(AG) and 171 (CT), causing amino acid substitutions at
codon 55 (Thr to Ala) and 57 (Pro to Ser) in a highly
conserved region of one of the putative active sites of the
enzyme [10,11]. Likewise, similar point mutations in equiva-

2009 The Authors

Journal Compilation 2009 European Society of Clinical Microbiology and Infectious Diseases

502

Clinical Microbiology and Infection, Volume 16 Number 5, May 2010

lent positions have been shown to cause sulfa resistance in

pathogens such as Plasmodium falciparum [12], Toxoplasma
gondii [13], Streptococcus pneumonia [14] and Escherichia coli
[15]. Several studies have demonstrated a significant association between sulfa and sulfone prophylaxis and the emergence of DHPS gene mutations in P. jiroveci [1618].
Because there is still no reliable culture system for P. jiroveci,
resistance studies based upon in vitro drug susceptibility testing
cannot be performed. In this study, S. cerevisiae was used as a
model to better understand the relationship between DHPS
gene mutations and sulfa drug susceptibility. Although phylogenetically distant, both species are members of the phylum Ascomycota and contain similar DHPS genes. While similar
studies have been done using site mutagenesis targeting the
S. cerevisiae DHPS gene [19,20], we show here that the P. jiroveci DHPS can complement the S. cerevisiae deletion mutant,
and then tested DHPS alleles, with or without point mutation(s), collected directly from clinical samples. Using this
strategy, we demonstrate that a decrease in susceptibility to
SMX is associated with the double mutated genotype.

Materials and Methods

Reagents were purchased from Sigma (Lyon, France) excepted
when specified.
Strains and growth

Molecular cloning and plasmid amplification were done in the

E. coli strain DH5a (Gibco, Cergy Pontoise, France). The
growth medium used was Luria-Bertani (LB) broth (1% tryptone, 0.5% yeast extract, 0.5% NaCl). Cells were made competent by calcium chloride treatment, and transformants
were selected in LB supplemented with 100 mg/L of ampicillin (LB-Amp). Saccharomyces cerevisiae yeast strains used in
this study derived from YH1 (mata leu2-3, 112trp1 tup1 ura
3-52) [21]. Yeasts were grown in YEPD medium (1% yeast
extract (Difco), 2% peptone (Difco), 2% glucose). The S. cerevisiae DHPS-deficient strain EHY1 (mata leu2-3, 112trp1 tup1
ura 3-52 DHPS::LEU2) was grown in YEPD supplemented
with 100 mg/L of folinic acid [22].
Cloning P. jiroveci DHPS gene into the yeast expression
vector pCM189

Bronchoalveolar lavage fluid samples were obtained from

patients with a diagnosis of PCP confirmed by Giemsa staining
and indirect immunofluorescence (MonoFluo kit P. carinii; BioRad, Marnes-la-Coquette, France). DNA was extracted with a
QiaGen Mini kit (Qiagen, Courtaboeuf, France) and P. jiroveci
DHPS genotype was determined using a PCR-RFLP method

CMI

previously described [23]. The four DHPS genotypes: WW

(wild type in positions 165 and 171), WM (wild type in 165
and mutated in 171), MW (mutated in position 165 and wild
type in 171) and MM (mutated in positions 165 and 171) were
obtained for this study. For cloning, the P. jiroveci DHPS gene
was amplified by a nested PCR protocol using the primers
Pj-DHPS-F1and Pj-DHPS-R1 for the first PCR and hybrid
primers Pj-DHPS-F2 and Pj-DHPS-R2 containing the BglII
restriction enzyme site for the second PCR (Table 1). The
sequence of P. carinii f. sp. hominis hydroxymethyl-dihydropterin pyrophosphokinase/dihydropteroate synthase gene
(GenBank accession AF139132) was used to design the primers. Primers were selected to amplify the complete ORF of
the DHPS domain (48 nt upstream the start codon to 61 nt
downstream the stop codon). Cycles of amplification were as
follows: 94C for 5 min, then five cycles at 94C for 30 s,
55C for 1 min and 72C for 1 min followed by 25 cycles at
94C for 30 s, 50C for 1 min and 72C for 1 min. For the
second round of PCR, the protocol was ten cycles at 92C for
30 s, 52C for 1 min and 72C for 1 min followed by 25 cycles
at 92C for 30 s, 42C for 1 min and 72C for 1 min. The
resulting product (834 bp) was digested with BglII, purified
using a QiaGen Mini kit, and cloned into the yeast centromeric
vector pCM189 [24] previously digested with BamHI.
This plasmid is characterized by the presence of the Ura3
gene and a tet promoter, repressed by doxycycline, behind the
multiple-cloning site. Cloning was done for each of the four
P. jiroveci DHPS genotypes to produce WW-, WM-, MW-,
MM-pCM189-PjDHPS. As a control, the DHPS gene of S. cerevisiae was amplified using primers Sc-DHPS-F and Sc-DHPS-R
(Table 1), and then similarly cloned to produce pCM189ScDHPS. Vectors were then introduced into E. coli by electroporation transformation [25]. The insertion of DHPS into the
plasmid was verified by PCR on colonies selected on LB-Amp
plates using the Seq4 and Seq8 primers (Table 1). Positive
transformants were then grown in LB-Amp broth overnight at
37C. Plasmids were then extracted using a JetSTAR kit

TABLE 1. PCR primers used in this study

Name

Sequences 5 3

Origin

Ahum
Bhum
Pj-DHPS-F1
Pj-DHPS-R1
Pj-DHPS-F2
Pj-DHPS-R2
Sc-DHPS-F
Sc-DHPS-R
Seq-4
Seq-8

GCGCCTACACATATTATGGCCATTTTAAATC
CATAAACATCATGAACCC
GGATTACCTATAGTTTCTTATC
GCAAAATTACAATCAACCAAAG
GAAGATCTTCCCTGGTATTAAACCAGTTTTGC
GAAGATCTTCCAATTCAATAAACTCCTTTCC
CGCGGATCCCGTAGTGGTGTGGAGCCT
CGCGGATCCCACTTGTTTCCTCCCTTGG
CAGGTTGTCTAACTCCTTCCTTTTCG
GAGCTCGGTACCCTATGGCA

[23]
[23]
This
This
This
This
This
This
[24]
[24]

BglII restriction sites used for cloning are underlined.

2009 The Authors

Journal Compilation 2009 European Society of Clinical Microbiology and Infectious Diseases, CMI, 16, 501507

study
study
study
study
study
study

CMI

Moukhlis et al.

(Qbiogen, Illkirch, France). The product (1834 bp) was gelpurified using a Qiagen Gel extraction kit (Qiagen) and introduced into the S. cerevisiae EHY1 strain by lithium acetate protocol transformation [26]. EHY1 transformants were selected
in minimal medium plates (0.65% yeast nitrogen base (YNB)
medium without amino acids, 2% glucose) supplemented with
20 mg/L tryptophan and 100 mg/L thymidine monophosphate.
In order to eliminate the presence of other mutations in the
amplified sequence, alleles used for transformation were
sequenced at this step by direct sequencing of amplicons
obtained by PCR colony using primers Pj-DHPS-F2 and PjDHPS-R2. The role of the plasmid in the change of phenotype
was checked by plating transformants on media with and without doxycycline (100 mg/L).

Sulfamethoxazole resistance in Pneumocystis jiroveci

CFU/mL A

503

105
104
103
102
SMX (g/mL)

50

250

Folinic acid (g/mL)

pABA (g/mL)

CFU/mL A

0
C

0
C

105
104
103
102

Sulfa drug resistance assays

As a first experiment, the susceptibility of S. cerevisiae to

SMX was checked by plating tenfold serial suspensions of
YH1 strain (102105 CFU/mL) onto YNB, added with
increasing SMX (ICN Biomedicals Inc., Warrenale, PA, USA)
concentrations prepared in 70% ethanol from 50 to
1000 mg/L. Complemented yeasts were further tested similarly. The reversion of the phenotype was checked by the
addition of 100 mg/L folinic acid to the medium. The plates
were evaluated after 2 days incubation at 30C.
To evaluate further the in vitro susceptibility of constructed strains to SMX, a liquid medium assay was also
used. Briefly, 2 108 cells, pre-cultured overnight in YNB
medium supplemented with 20 to SMX tryptophan and 100
to SMX thymidine monophosphate, were cultured in this
medium, added with increasing concentrations of SMX, from
0 to 3 mg/mL, in a 96-U-shaped-well microplate. Absorbance
at 595 mm was measured after 48 h of incubation at 30C.
Each experiment was done in triplicate.

Results
Effect of SMX on S. cerevisiae yeast

To establish the validity of our yeast model system, the

effect of SMX on the growth of S. cerevisiae strain YH1,
which has a functional DHPS, was confirmed. As shown in
Fig. 1, YH1 (inoculum 103 cells/mL) was sensitive to SMX,
with an inhibition of growth especially noticeable when the
concentration of SMX reached 250 mg/L and complete inhibition at concentrations of SMX >1000 mg/L. In the presence
of folinic acid, the growth was restored to a level similar to
that observed in the absence of SMX, suggesting an uptake
of folinic acid by the yeasts. The same results were obtained
when pABA at 2 mg/L was added instead of folinic acid. No

SMX (g/mL)

1000

250

250

Folinic acid (g/mL)

100

pABA (g/mL)

FIG. 1. Susceptibility of Saccharomyces cerevisiae strains to sulfamethoxazole (SMX) and reversion of the activity by exogenous folinic
acid. Log serial dilutions of yeast cell suspensions. Yeast strains (A)
YH1 [functional dihydropteroate synthase (DHPS)]; (B) EHY1
(DHPS-deficient) transformed with pCM189-wild type Pneumocystis
jiroveci DHPS; (C) EHY1 transformed with pCM189-S. cerevisiae
DHPS. Plates were photographed after 2 days incubation at 30C.

growth was observed for S. cerevisiae strain EHY1 in the

absence of exogenous folinic acid.
Cloning of P. jiroveci DHPS in EHY1 and complementation
tests

To test the complementation of the DHPS-deleted EHY1

strain by P. jiroveci DHPS, the yeasts were transformed with
either WW-pCM189-PjDHPS or pCM189-ScDHPS as a control, and plated in parallel onto YNB, with or without exogenous folinic acid (Fig. 1). Both constructed plasmids allowed
the EHY1 strain to grow normally without the need of exogenous folinic acid. Addition of doxycycline induced an inhibition of growth, supporting the fact that normal growth is
restored by the plasmid-borne gene controlled by the tet-off
promoter (Fig. 2). The addition of folinic acid abolished the
growth inhibition afforded by doxycycline and restored a
wild-type phenotype (data not shown).
Double mutation in P. jiroveci DHPS gene influences SMX
susceptibility of S. cerevisiae complemented yeast

Whatever the P. jiroveci DHPS genotype, transformants were

found to be able to grow on minimal medium without addition

2009 The Authors

Journal Compilation 2009 European Society of Clinical Microbiology and Infectious Diseases, CMI, 16, 501507

504

Clinical Microbiology and Infection, Volume 16 Number 5, May 2010

CFU/mL A
105

104
103
102
SMX (g/mL)

Folinic acid (g/mL)

Doxycycline (g/mL)

0
0

0
100

CFU/mL A B
105

C D

104
103
102
SMX (g/mL)

Folinic acid (g/mL)

Doxycycline (g/mL)

250

250

0
0

100
0

FIG. 2. In vitro susceptibility of transformed Saccharomyces cerevisiae

strains against sulfamethoxazole (SMX) according to the dihydro-

CMI

induce any change in susceptibility to SMX, compared with

wild-type DHPS of P. jiroveci or the parent strain YH1 with a
functional DHPS. In contrast, EHY1 expressing the double
mutant P. jiroveci DHPS appeared less susceptible to SMX than
other constructed strains with either a wild-type or single
mutation profile, and grew in the presence of SMX at 250 mg/
L. In a microdilution assay with SMX concentrations of 1.5 mg/
mL, growth of yeast strains complemented with either wildtype or single mutated P. jiroveci-DHPS was reduced by 72
75%, whereas double mutation was associated with a growth
reduction of only 10% (Fig. 3). Indeed, SMX concentration as
high as 3 mg/mL had only a marginal effect (11.6% reduction)
on the growth of this strain. In contrast, at concentrations of
SMX between 0.5 and 1 mg/mL, EHY1 complemented with
P. jiroveci DHPS harbouring either one or no mutation was
more sensitive than the YH1 parent strain.

Discussion

pteroate synthase (DHPS) genotype. (AD): EHY1 (DHPS-deficient)

transformed by the pcM189 vector harbouring (A) double mutated
(positions 165 and 171) Pneumocystis jiroveci DHPS; (B) position 165
mutated P. jiroveci DHPS; (C) position 171 mutated P. jiroveci; (D)
wild-type P. jiroveci DHPS; (E) YH1 (functional DHPS). Plates were
photographed after 2 days incubation at 30C.

of folinic acid or pABA and therefore express a functional

DHPS. In order to examine the effect of P. jiroveci DHPS mutations of SMX resistance, the in vitro susceptibility of EHY1
transformed with pCM189 harbouring one of the four
genotypes of P. jiroveci DHPS was compared. As shown in
Fig. 2, a single mutation at either position 165 or 171 did not
1.40

YH1
EHY1 + WW-PjDHPS
EHY1 + WM-PjDHPS
EHY1 + MW-PjDHPS
EHY1 + MM-PjDHPS

1.20
OD at 595 nm

Sulfamethoxazole, which targets the DHPS enzyme, remains

a major component of PCP treatment and prophylaxis.
A correlation between mutation(s) in the P. jiroveci DHPS
gene and resistance to SMX has been suggested by several
surveys [1618]. However, the inability to culture P. jiroveci
in a standardized culture system prevents routine susceptibility testing and detection of drug resistance. To address
this question, an alternative strategy using S. cerevisiae was
thus designed. Indeed, S. cerevisiae is an easy and inexpensive tool, commonly used for in vitro complementation studies, notably for testing inhibitors of heterologous enzymes
[27,28]. Recently, functional complementation of deleted

1.00
0.80
0.60
0.40
0.20
0.00

250

1000
1500
500
750
SMX concentration (g/mL)

2000

3000

FIG. 3. In vitro sulfamethoxazole (SMX) susceptibility assay in YEPD liquid medium. Yeast strains YH1 [functional dihydropteroate synthase
(DHPS)] and EHY1 (DHPS-deficient) transformed with the different genotypes of Pneumocystis jiroveci DHPS WW-PjDHPS: wild-type P. jiroveci
DHPS; WM-PjDHPS: position 171 mutated P. jiroveci DHPS; MW-PjDHPS: position 165 mutated P. jiroveci DHPS; MM-PjDHPS: double mutated
(positions 165 and 171) P. jiroveci DHPS. Growth was measured by optical density at 595 mm 48 h after incubation at 30C. The error bars
indicate standard deviations of triplicate experiments.
2009 The Authors
Journal Compilation 2009 European Society of Clinical Microbiology and Infectious Diseases, CMI, 16, 501507

CMI

Moukhlis et al.

yeasts by Pneumocystis homologue genes has been obtained

for dihydrofolate synthase and brl1 (coding for a nuclear
envelope protein) genes [29,30]. Together with our data,
this supports the development of an S. cerevisiae model to
explore other biological characteristics of P. jiroveci until a
reliable in vitro culture becomes available [31]. In accordance with previous studies showing the efficacy of other
sulfonamide derivatives against yeasts [28], we confirmed
the in vitro susceptibility of S. cerevisiae to SMX. We then
fully complemented a DHPS-deficient yeast strain with the
wild-type P. jiroveci DHPS gene, consistent with the high
level of conservation of this enzyme (73% similarity
between S. cerevisiae and P. jiroveci). Complementation was
successful for all four P. jiroveci DHPS alleles. However, the
response to SMX was different, according to which P. jiroveci
DHPS allele was expressed. Pneumocystis jiroveci DHPS with
the double mutation was associated with lower susceptibility to SMX, an observation supported by assays
performed either on solid medium or in liquid medium. It
is noteworthy that multiple point mutations in the Plasmodium falciparum DHPS gene are required for the induction
of resistance to sulfa drugs [32,33]. This may be due to
critical changes in the structure of the protein leading to an
altered interaction with the substrate, here, the sulfa drug.
Our findings strengthen the results of previous studies
that used either E. coli or S. cerevisiae as models and sitedirected mutagenized DHPS to address the question of
resistance to sulfa drugs [19,34]. Similarly, in E. coli, using a
heterologous DHPS construction consisting of DNA
fragments coding for the first 33 amino acids of the yeast
DHPS fused to the different alleles of P. jiroveci DHPS, double
mutation resulted in MICs threefold higher than wild-type
DHPS [35].
In contrast, complementation by chromosomal integration
of a fragment of the S. cerevisiae FOL1 gene, previously
mutagenized, into a DHPS-knockout yeast strain resulted in
a requirement of pABA for growth, evidence of reduced
susceptibility to sulfa drugs, but in this case associated with
hypersensitivity to SMX [20].
Our study differed from these studies by the use of P. jiroveci DHPS genes obtained directly from clinical specimens.
Contrary to previous studies, this was not associated with
an auxotrophy for pABA, allowing easier interpretation of
the susceptibility tests that clearly demonstrate a decrease of
SMX susceptibility in the case of double mutation in the
P. jiroveci DHPS. This was not an artefact result due to a
growth defect of the more susceptible strains, since all
constructed strains exhibited a growth rate generally similar
to that of the DHPS-functional parent strain (data not
shown).

Sulfamethoxazole resistance in Pneumocystis jiroveci

505

The clinical impact of these mutations is still controversial.

In Europe, the prevalence of the double mutated genotype
remains low (<3%), whereas prevalence as high as 40% has
been reported in the USA [3638]. Some studies did not find
any link between DHPS mutations and treatment setting or
clinical outcome [5,39], whereas a threefold increase in mortality rate has been demonstrated for patients infected with
Pneumocystis harbouring a DHPS mutation, compared with
those infected with wild type-DHPS Pneumocystis [16].
Pharmacokinetic properties (notably related to drug
dosage) and pharmacodynamic properties of therapeutic
molecules may influence the clinical results. Furthermore,
the correlation between in vitro susceptibility tests and clinical outcome is often considered to be poorly predictive of
opportunistic fungal infections, the prognosis being related
mainly to host immune status. However, several surveys
have highlighted a correlation between the presence of
DHPS mutations and prophylaxis with sulfa drugs [4042].
Moreover, a double mutated allele is the predominant P. jiroveci DHPS genotype found in patients experiencing sulfa-drug
prophylaxis failure [11,39,43], suggesting the existence of a
selective pressure on P. jiroveci organisms.
Our results confirm the importance of DHPS genotyping of
P. jiroveci to establish more clearly a possible link between
double mutation in the P. jiroveci DHPS gene and clinical
outcome according to therapy. A positive correlation would
prompt the use of higher doses of SMX or the use of alternative therapies.

Acknowledgements
We are grateful to C. Fairhead for English language revision.

Transparency Declaration
This work was supported by Eurocarinii Project (QLK2-CT2000-01369). The authors declare to have no relationship
(commercial or otherwise) that may constitute a dual or
conflicting interest.

References
1. Radisic M, Lattes R, Chapman J et al. Risk factors for Pneumocystis
carinii pneumonia in kidney transplant recipients: a casecontrol
study. Transpl Infect Dis 2003; 5: 8493.
2. Cardenal R, Medrano FJ, Varela JM et al. Pneumocystis carinii pneumonia in heart transplant recipients. Eur J Cardiothorac Surg 2001; 20:
799802.

2009 The Authors

Journal Compilation 2009 European Society of Clinical Microbiology and Infectious Diseases, CMI, 16, 501507

506

Clinical Microbiology and Infection, Volume 16 Number 5, May 2010

3. Miller RF, Allen E, Copas A, Singer M, Edwards SG. Improved survival

for HIV infected patients with severe Pneumocystis jirovecii pneumonia
is independent of highly active antiretroviral therapy. Thorax 2006;
61: 716721.
4. Wolff AJ, ODonnell AE. Pulmonary manifestations of HIV infection
in the era of highly active antiretroviral therapy. Chest 2001; 120:
18881893.
5. Latouche S, Lacube P, Maury E et al. Pneumocystis jirovecii dihydropteroate synthase genotypes in French patients with pneumocystosis:
a 19982001 prospective study. Med Mycol 2003; 41: 533537.
6. Kaplan JE, Sepkowitz K, Masur H, Sirisanthana T, Russo M, Chapman L.
Opportunistic infections in persons with HIV or other immunocompromising conditions. Emerg Infect Dis 2001; 7: 541.
7. Walzer PD, Foy J, Steele P et al. Activities of antifolate, antiviral,
and other drugs in an immunosuppressed rat model of Pneumocystis carinii pneumonia. Antimicrob Agents Chemother 1992; 36: 1935
1942.
8. Skold O. Sulfonamide resistance: mechanisms and trends. Drug Resist
Updat 2000; 3: 155160.
9. Volpe F, Ballantine SP, Delves CJ. The multifunctional folic acid
synthesis fas gene of Pneumocystis carinii encodes dihydroneopterin
aldolase, hydroxymethyldihydropterin pyrophosphokinase and dihydropteroate synthase. Eur J Biochem 1993; 216: 449458.
10. Lane BR, Ast JC, Hossler PA et al. Dihydropteroate synthase polymorphisms in Pneumocystis carinii. J Infect Dis 1997; 175: 482485.
11. Kazanjian P, Locke AB, Hossler PA et al. Pneumocystis carinii mutations
associated with sulfa and sulfone prophylaxis failures in AIDS patients.
AIDS 1998; 12: 873878.
12. Brooks DR, Wang P, Read M, Watkins WM, Sims PF, Hyde JE.
Sequence variation of the hydroxymethyldihydropterin pyrophosphokinase: dihydropteroate synthase gene in lines of the human malaria
parasite, Plasmodium falciparum, with differing resistance to sulfadoxine. Eur J Biochem 1994; 224: 397405.
13. Allegra CJ, Boarman D, Kovacs JA et al. Interaction of sulfonamide
and sulfone compounds with Toxoplasma gondii dihydropteroate synthase. J Clin Invest 1990; 85: 371379.
14. Lopez P, Espinosa M, Greenberg B, Lacks SA. Sulfonamide resistance
in Streptococcus pneumoniae: DNA sequence of the gene encoding
dihydropteroate synthase and characterization of the enzyme.
J Bacteriol 1987; 169: 43204326.
15. Dallas WS, Gowen JE, Ray PH, Cox MJ, Dev IK. Cloning, sequencing,
and enhanced expression of the dihydropteroate synthase gene of
Escherichia coli mc4100. J Bacteriol 1992; 174: 59615970.
16. Helweg-Larsen J, Benfield TL, Eugen-Olsen J, Lundgren JD, Lundgren
B. Effects of mutations in Pneumocystis carinii dihydropteroate
synthase gene on outcome of AIDS-associated P. carinii pneumonia.
Lancet 1999; 354: 13471351.
17. Ma L, Kovacs JA, Cargnel A, Valerio A, Fantoni G, Atzori C. Mutations in the dihydropteroate synthase gene of human-derived Pneumocystis carinii isolates from Italy are infrequent but correlate with prior
sulfa prophylaxis. J Infect Dis 2002; 185: 15301532.
18. Visconti E, Ortona E, Margutti P et al. Identification of dihydropteroate (DHPS) gene mutant in Pneumocystis carinii in respiratory samples
of HIV+ patients from 1992 to 1997. J Eukaryot Microbiol 1999; 46:
S132.
19. Iliades P, Meshnick SR, Macreadie IG. Dihydropteroate synthase
mutations in Pneumocystis jiroveci can affect sulfamethoxazole resistance in a Saccharomyces cerevisiae model. Antimicrob Agents Chemother
2004; 48: 26172623.
20. Meneau I, Sanglard D, Bille J, Hauser PM. Pneumocystis jiroveci dihydropteroate synthase polymorphisms confer resistance to sulfadoxine
and sulfanilamide in Saccharomyces cerevisiae. Antimicrob Agents Chemother 2004; 48: 26102616.

CMI

21. Huang T, Barclay BJ, Kalman TI, von Borstel RC, Hastings PJ. The
phenotype of a dihydrofolate reductase mutant of Saccharomyces cerevisiae. Gene 1992; 121: 167171.
22. Bayly AM, Berglez JM, Patel O et al. Folic acid utilisation related to
sulfa drug resistance in Saccharomyces cerevisiae. FEMS Microbiol Lett
2001; 204: 387390.
23. Santos LD, Lacube P, Latouche S et al. Contribution of dihydropteroate synthase gene typing for Pneumocystis carinii f. sp. hominis epidemiology. J Eukaryot Microbiol 1999; 46: S133S134.
24. Gari E, Piedrafita L, Aldea M, Herrero E. A set of vectors with a
tetracycline-regulatable promoter system for modulated gene expression in Saccharomyces cerevisiae. Yeast 1997; 13: 837848.
25. Chung CT, Miller RH. A rapid and convenient method for the preparation and storage of competent bacterial cells. Nucleic Acids Res
1988; 16: 3580.
26. Gietz RD, Schiestl RH, Willems AR, Woods RA. Studies on the
transformation of intact yeast cells by the liac/ss-DNA/peg procedure. Yeast 1995; 11: 355360.
27. Brophy VH, Vasquez J, Nelson RG, Forney JR, Rosowsky A, Sibley
CH. Identification of Cryptosporidium parvum dihydrofolate reductase
inhibitors by complementation in Saccharomyces cerevisiae. Antimicrob
Agents Chemother 2000; 44: 10191028.
28. Castelli LA, Nguyen NP, Macreadie IG. Sulfa drug screening in yeast:
fifteen sulfa drugs compete with p-aminobenzoate in Saccharomyces
cerevisiae. FEMS Microbiol Lett 2001; 199: 181184.
29. Hauser PM, Macreadie IG. Isolation of the Pneumocystis carinii dihydrofolate synthase gene and functional complementation in Saccharomyces cerevisiae. FEMS Microbiol Lett 2006; 256: 244250.
30. Lo Presti L, Cockell M, Cerutti L, Simanis V, Hauser PM. Functional
characterization of Pneumocystis carinii brl1 by transspecies complementation analysis. Eukaryot Cell 2007; 6: 24482452.
31. Hauser PM, Lo Presti L, Cockell M, Cerutti L, Simanis V. Analysis of
Pneumocystis carinii gene function by complementation in yeast
mutants. J Eukaryot Microbiol 2006; 53 (Suppl 1): S149S150.
32. Olliaro P. Mode of action and mechanisms of resistance for antimalarial drugs. Pharmacol Ther 2001; 89: 207219.
33. Triglia T, Wang P, Sims PF, Hyde JE, Cowman AF. Allelic exchange at
the endogenous genomic locus in Plasmodium falciparum proves the
role of dihydropteroate synthase in sulfadoxine-resistant malaria.
EMBO J 1998; 17: 38073815.
34. Iliades P, Walker DJ, Castelli L, Satchell J, Meshnick SR, Macreadie
IG. Cloning of the Pneumocystis jirovecii trifunctional fas gene and complementation of its DHPS activity in Escherichia coli. Fungal Genet Biol
2004; 41: 10531062.
35. Iliades P, Meshnick SR, Macreadie IG. Mutations in the Pneumocystis
jirovecii DHPS gene confer cross-resistance to sulfa drugs. Antimicrob
Agents Chemother 2005; 49: 741748.
36. Esteves F, Montes-Cano MA, de la Horra C et al. Pneumocystis jirovecii
multilocus genotyping profiles in patients from Portugal and Spain.
Clin Microbiol Infect 2008; 14: 356362.
37. Kazanjian PH, Fisk D, Armstrong W et al. Increase in prevalence of
Pneumocystis carinii mutations in patients with AIDS and P. carinii
pneumonia, in the United States and China. J Infect Dis 2004; 189:
16841687.
38. Magne D, Lacube P, Angoulvant A et al. Pneumocystosis: survey and
DHPS genotype analysis in 14 Parisian hospitals in 2003 and 2004.
J Eukaryot Microbiol 2006; 53 (Suppl 1): S106S107.
39. Navin TR, Beard CB, Huang L et al. Effect of mutations in Pneumocystis carinii dihydropteroate synthase gene on outcome of P. carinii
pneumonia in patients with HIV-1: a prospective study. Lancet 2001;
358: 545549.
40. Ma L, Borio L, Masur H, Kovacs JA. Pneumocystis carinii dihydropteroate synthase but not dihydrofolate reductase gene mutations corre-

2009 The Authors

Journal Compilation 2009 European Society of Clinical Microbiology and Infectious Diseases, CMI, 16, 501507

CMI

Moukhlis et al.

late with prior trimethoprim-sulfamethoxazole or dapsone use.

J Infect Dis 1999; 180: 19691978.
41. Kazanjian P, Armstrong W, Hossler PA et al. Pneumocystis carinii
mutations are associated with duration of sulfa or sulfone prophylaxis
exposure in AIDS patients. J Infect Dis 2000; 182: 551557.
42. Huang L, Beard CB, Creasman J et al. Sulfa or sulfone prophylaxis
and geographic region predict mutations in the Pneumocystis carinii
dihydropteroate synthase gene. J Infect Dis 2000; 182: 11921198.

Sulfamethoxazole resistance in Pneumocystis jiroveci

507

43. Takahashi T, Hosoya N, Endo T et al. Relationship between mutations in dihydropteroate synthase of Pneumocystis carinii f. sp. hominis
isolates in Japan and resistance to sulfonamide therapy. J Clin Microbiol
2000; 38: 31613164.

2009 The Authors

Journal Compilation 2009 European Society of Clinical Microbiology and Infectious Diseases, CMI, 16, 501507