Вы находитесь на странице: 1из 64

20152016

Master1Mouvement,Sport,Sant

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
2

Motscls:
Myotubes,ligneC2C12,lectrostimulation
invitro
(EPS),cancers,myokines

Keywords:
Myotubes,C2C12cellline,Electricalpulsestimulation(EPS),cancers,
myokines

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
3

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
4

SOMMAIRE

Listedesabrviations

Tabledesfiguresetdestableaux

Introduction

10

Revuedelittrature

12

1.

Activitphysiqueetprogressiondescancers

12

1.1.

Inactivitphysiqueetcancers

12

1.2.

APetprventionsdescancers

12

1.3.

EffetsdelAPsurlesmcanismeslislaprogressiontumorale

14

1.3.1. Insulineetinsulinorsistance

15

1.3.2. Massegrasseetadipokines

17

1.3.3. Processusinflammatoire

17

1.3.4. Apoptoseetmarqueursdelapoptose

19

1.3.5. Stressoxydant

19

1.4.

ProductiondemyokinesdurantlAPeteffetssurlescancers

21

2.

ModlesanimauxpourltudedeseffetsdelAPinvivo

24

3.

MimerlAPinvitro

25

3.1.

DescriptiondusystmeEPS

26

3.2.

Lignescellulairesetmthodesdecultureutilises

27

3.3.

Diffrenciationdesmyotubes

29

3.4.

LesdiffrentsmodlesetparamtresEPS

30

3.5.

LimitesrencontresdanslesmodlesEPS

35

Synthseetobjectifs

38

Protocolepropos

39

1.

Culturecellulaire

39

2.

Vrificationdeladiffrenciationdesmyoblastesenmyotubes

40

3.

StimulationEPS

41

4.

AnalyseducontenudesmyotubesetduMCaprsstimulationEPS

41

4.1.

DtectionetdosagedelIL6parmthodeELISA

41

4.2.

Mesuredelactivitenzymatiquedelacitratesynthase

42

5.

DosagedesprotinesetWesternBlots

43

7.

RTqPCR

44

9.

Analysesstatistiques

45

Rsultatsattendus

47

Conclusionetperspectives

48

Rfrencesbibliographiques

49

Annexes

53

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
5

Listedesabrviations
2DG
5LO
Ac
aGnRH
AICAR
AMP
AMPc
AMPK
AOM
AP
ARNm
ATP
ATPsyn
Av
Bax
Bcl2
bFGF
BSA
2+
Ca
CHI3L1
CNTF
COX
CPT1B
CRP
CS
CT1
CYCS
DE
DMEM
EAPA
ELISA
EMS
EMT
EPS
ERK
FBS
FCS
FT
GAPDH

2DeoxyDglucose,doxyglucose
5lipoxygenase
Anticorps
Agonistedelagonadolibrine
5Aminoimidazole4carboxamideribonuclotide,galementappele
Acadsine
Adnosinemonophosphate
Adnosinemonophosphatecyclique
ProtinekinaseactiveparlAMP
Azoxymthane
Activitphysique
Acideribonucliquemessager
Adnosinetriphosphate
ATPsynthase
Avidine
Bcl2associatedXprotein,
protineXassocieBcl2
Bcelllymphoma2,
protine2delymphomelymphocyteB
Basicfibroblastgrowthfactor,
facteurdecroissancedesfibroblastesbasique
Bovineserumalbumin,Albuminebovinesrique
Calcium
Chitinase3likeprotein1,
protinechitinase3like1
Ciliaryneurotrophicfactor
,facteurneurotrophiqueciliaire
Cyclooxygnase
Carnitinepalmitoyltransferase1Bmusculaire
Creactiveprotein,
protineCractive
Citratesynthase
Cardiotrophine1
Cytochromecsomatique
Dpensenergtique
DulbeccosModifiedEaglesMinimalEssentialMedium,
milieudeculture
minimumessentieldeDulbecco
Enseignantouducateurenactivitphysiqueadapte
Enzymelinkedimmunosorbentassay,
dosaged'immunoabsorptionpar
enzymelie
Electromyostimulation,stimulationmusculairelectrique
Epithelialtomesenchymaltransition,
transitionpithliomsenchymateuse
ElectricalPulseStimulation,
stimulationdecellulesparimpulsionlectrique
Extracellularsignalregulatedkinase,
kinaseextracellulairerguleparun
signal
Srumfoetalbovininactivparlachaleur
FetalCalfSerum
,Srumdeveaufoetal(SVF)
Fasttwich
,fibresmusculairesdetyperapidesetglycolytiques
Glycraldhyde3phosphatedshydrognase

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
6

GLUT1/4
GYS
H2O2
HK2
HPRT1
HRP
HS
IGF1
IGFBP
IL6
IL11
IMC
JAK
LIF
LNK
MC
MCAD
MEC
MEF2
MEK
MET
MyHC
MLP
MRF
MSS
Myf
Myf4
Myf6
MYH
MyoD
NOX
OMS
OSM
P/S
PBS
PCr
PDGF

Transporteurdeglucosedetype1ou4
Glycognesynthase
Peroxyded'hydrogne
Hexokinase2
Hypoxanthineguaninephosphoribosyltransferase1
Horseradishperoxidase,
peroxydasederaifort
Srumdecheval
Insulinlikegrowthfactor1
,facteurdecroissance1ressemblantl'insuline,
encoreappelsomatomdineC
Insulinlikegrowthfactorbindingprotein,
protinesdesquestrationdes
rcepteursdelIGF
Interleukine6
Interleukine11
Indicedemassecorporelle
Januskinase
Leukemiainhibitoryfactor,
facteurinhibiteurdeleucmie
Lymphocyte
naturalkiller
Milieuconditionn
MediumchainacylCoenzymeAdehydrogenase,
acylCoenzymeA
dshydrognasedesacidesgraschanemoyenne
Matriceextracellulaire
Myocyteenhancerfactor2,
facteur2musculaireactivateurdela
transcription
Mitogenactivatedproteinkinasekinase,
aussiMAPKK,kinasedeprotine
kinaseactivepardesmitognes(MAPK)
MetabolicEquivalentofTask,
quivalentmtaboliquepourunetche
donne
Myosinheavychain,
chanelourdedemyosine
Musclelimprotein,
protinedesmusclesdesmembresinfrieurs
Myogenicregulatoryfactors,
facteursdergulationmyogniques
Musclestrisquelettique
Myogenicfactor
,facteurmyognique
Myogenicfactor4,
facteurmyognique4,myognine
Myogenicfactor6,
facteurmyognique6,herculine,Mrf4
Myosin,heavychain,
familledegnesquiencodentlesdiffrentesisoformes
dechanelourdedemyosine
Myogenicdifferentiationfactor,
facteurdediffrenciationmyognique
NADPHoxydasedusarcolemme
OrganisationmondialedelaSant,worldhealthorganization(WHO)
OncostatineM
Pnicillineetstreptomycine
Phosphatebufferedsaline,tamponphosphatesalin
Phosphocratine,cratinephosphate
Plateletderivedgrowthfactor
,facteurdecroissancedrivdesplaquettes

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
7

Pyruvatedehydrogenasekinaseisoform4,
isoforme4delapyruvate
deshydrognasekinase
PGC1
Peroxisomeproliferatoractivatedreceptorcoactivator1
(PPARGC1A),
coactivateur1durcepteuractivparlesprolifrateursdeperoxysomes
(PPAR)
PPAR
Rcepteurgammaactivparlesprolifrateursdeperoxysomes
prARNm Acideribonucliquemessagersimplebrinimmatureprcurseur
RE
Rticulumendoplasmique
ROS
Reactiveoxygenspecies,
espcesractivesdrivesdeloxygne
RPLPo
RibosomalproteinlateralstalksubunitP0,
gneduneprotineconstitutive
delagrandesousunit60Sduribosome
RTqPCR Reversetranscriptionquantitativepolymerasechainreaction,
Ractionen
chaneparpolymrasequantitativecouplelatranscriptioninverse
SDH
Succinatedeshydrognase
SDSPAGE Sodiumdodecylsulfatepolyacrylamidegelelectrophoresis,
lectrophorse
surgeldepolyacrylamideenprsencededodcylsulfatedesodium
SO
Stressoxydant
SPARC
Secretedproteinwhichisacidicandrichincystein,
protinescrte,
acidiqueetricheencystine,ostonectine
ST
Slowtwich
,fibresmusculairesdetypelentesetoxydatives
STAT
Signaltransducerandactivatoroftranscription
TBS
Phosphatebufferedsaline
,tamponphosphatesalin
TGF
Transforminggrowthfactorbeta,
Facteurdecroissancetransformantbeta
TNF
Tumornecrosisfactor,
facteurdencrosetumorale
UCP3
Mitochondrialuncouplingprotein3,
protinedcouplantemitochondriale3
VEGF
Vascularendothelialgrowthfactor,
facteurdecroissancedel'endothlium
vasculaire
WB
Westernblot
XO
Xanthineoxydase
PDK4

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
8

Tabledesfiguresetdestableaux
Figures:

Figure1

Figure2

Figure3

Figure4

Figure5

Tableaux:

Tableau1

VoiesdesignalisationdelinsulineetdelIGF1

VoiedesignalisationdelIL6

Stimulateurlectriquedecellulesenculture

Designdeladmarcheexprimentale

ProtocoledecultureetdediffrenciationdesmyocytesC2C12

Tableau2

Tableau3

Tableau4

Tableau5

Annexes:

TableauI

TableauII

TableauIII

Tableaux
IV

VIII

TableauIX

Profilsdexpressiongniquescorrespondantauxdiffrentestapesde
lamyogense

LestypesdexercicesimitsparBurchetal.aveclesystmeEPS

LesprogrammesEPSpropossparNikolietal.etleurseffetssurles
myotubes

AnticorpsprimairesutilisspourlesWB

AmorcesutilisespourlesRTqPCR

Lesdiffrentesmyokinesactuellementconnues

Comparaisondestempsetdesmilieuxdecroissanceentreles
diffrentsprotocolesvoqusdanslarevuedelittrature

Comparaisondestempsetdesmilieuxdediffrenciationentreles
diffrentsprotocolesvoqusdanslarevuedelittrature

ComparaisondesparamtresEPSutilissentrelesdiffrents
protocolesvoqusdanslarevuedelittrature

LesdiffrentstypesdefibresdesMSS

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
9

Introduction
En 2012, selon lOMS, les cancers reprsentaient la seconde cause de mortalit
dans le monde, parmi les maladies non transmissibles (8 millions demorts,22%desdcs
par maladies non transmissibles). Les projections des pidmiologistes indiquent que les
cancers devraient rester lune des principales causes de mortalit au moins jusquen 2030
(
Ott et al. 2011
White et al. 2014
).
Face la recrudescence des cancers, de nouvelles
stratgies de lutte et de prvention sont recherches et dveloppes. Certaines tudes
voquent des effets bnfiques de lactivit physique (AP) permettent de lutter contre
certains types de cancers
(B
achmann et al. 2015
)
. LAP, telle que dfinie par lOMS,
englobe les loisirs, les dplacements, les activits professionnelles, les tches mnagres,
le jeu, les sportsoulexerciceplanifi.Elleestainsidfiniecommetoutmouvementcorporel
produit par les muscles stris squelettiques (MSS) qui engendre une dpense nergtique
(DE). LAP, en plus damliorer la survie et la qualit de viedespatientsen luttantcontrela
cachexie cancreuse,pourraitprvenirjusqu25%descancers,notammentduclon,dela
prostate et du sein. Elle prsente de plus lavantage dtre accessible presque toute la
population
(
Desnoyers et al. 2016
)
. Dans le milieu mdical, lAP a ainsi de plus en plus
tendance tre prescrite comme adjuvant au traitement de nombreuses pathologies. Dans
cecadre,onparlealorsdAPadapte(APA).

lAPA est dfinie par De Potter comme tout mouvement, activit physique et sport,
essentiellement bas sur les aptitudes et les motivations des personnes ayant des besoins
spcifiques qui les empchent de pratiquer dans des conditions ordinaires
(
De Potter
2004
)
. LAPA dsigne donc toute AP propose une population particulire et qui est
ajustable chaque individu selon sa pathologie, les conditions de son hospitalisation, son
ge et son tat gnral. Depuis seulement quelques anne en France, lAPA fait partie
intgrante des soins de support. Les soins de support regroupent toutes les formes
dinterventions de soin et de soutien qui sortent du champ des pratiques mdicales et
hospitalires. Ces pratiques visent amliorer la qualit et lesprance de vie despatients.
Daprs les 2 premiers plans cancer (20032007 et 20092013), elles doivent tre menes
conjointement aux soins mdicaux classiques. Elles viennent complter et enrichir loffre et
la qualit des soins. LAPASant repose ainsi sur la prise en charge de publics besoins
spcifiques au moyen de programmes dactivits physiques ou sportivesadaptes.Pourse
mettre en place, ces programmes dexercices doivent passerpardesphasesdediagnostic,
de conception, de mise en uvre, dvaluation, de suivi, puis de dveloppement. Toute
dmarche en APASant s'intgre dans un projet de prvention. Cette prvention est dite
primaire si elle vise rduire ou liminer les pathologies avant leur apparition,
secondaire si elle vise lutter contre une ou plusieurs pathologies durant la prise en
charge mdicale et tertiaire si elle est mise en place aprs rmission, par exemple pour
limiter le risque de rcidive
(
Desnoyers et al. 2016
)
. En France, malgr une littrature de
plus en plus fournie sur le sujet et une trentaine dannes denseignement universitaire,les
prescriptions dAP par les mdecins restent rares, mal adaptes et peuefficaces
(
Bernard,
Romain, et Vergnault 2015
)
. Afin damliorer cette situation, Bernard et al. prconisent
dune part une intgration plus importante des enseignants en APA au sein des quipes
hospitalires et dautre part une collaboration entre mdecins et enseignantchercheurs en
APAafindamliorerlacomprhensiondesmcanismesimpliqus.Letroisimeplancancer

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
10

(20142019) souligne galement limportance de la sensibilisation des professionnels de


sant etdespatientsauxdangersdelasdentaritetlintrtderenforceroudemaintenir
une AP aprs un diagnostic de cancer.
LAPA est une approche quil faut prconiser chez
les patients atteints dun cancer, et ce quel que soit le stade de la maladie. LAP de droit
communpoursapartdevraittrefavoriseavantetaprslafindetraitements.

Dans le modlehumain,lestudesquisepenchentsurleseffetsdelAPvisvisde
pathologies sont toutes ralises
in vivo.
Ces protocoles, malgr le fait quils prsentent
lavantage dtre assez proches de la clinique, ne permettent pas dtudier les processus
ainsi que les molcules intrinsques et extrinsques des MSS. Par exemple, les prises de
sang ne permettent pas de dterminer par quels types de cellules les facteurs relargus
dans la circulation sanguine ont t scrts etseulesdesbiopsiesmusculairespermettent
dobtenir ce genres de donnes, mais ces dernires sont beaucoup trop invasives. Ils
noffrent pas non plus la possibilit dtudier sparment les types cellulaires et leurs
scrtomes respectifs. Les modles dtude
in vitro prsentent quant eux lavantage de
permettre lanalyse du scrtome musculaire tout en isolant un type cellulaireouunorgane
afin den tudier prcisment lesrles. Lerecourscesmodles
invitropermetnotamment
didentifier les mcanismesmolculairesactivsenrponselAPquisontresponsablesde
ses bienfaits.Danscesmodles,lesmyotubesen culture sontcapablesdavoirune rponse
contractile en rponse des stimuli lectriques. Il a effectivement t dmontr que des
programmes de stimulation lectrique Electrical pulse stimulation (EPS) permettent de
mimer les effets de lAP sur des myotubes humains en culture
(
Nikoli
et al. 2012
)
et
murins
(
Gogh et al. 2015
).

La culture cellulaire offre donc la possibilit dtudier plus


finement les mcanismes mis en oeuvre et les molcules intrinsques et extrinsques
produites par les myotubes lors dune stimulation lectrique mimant lexercice
(
Burchetal.
2010
)
. En plus de faciliter la mise en place de protocoles de biologie cellulaire et
molculaire, lapproche
in vitro possde galement dautres avantages par rapport au
in
vivo
,elleestplusrapidemettreenplace,plusreproductibleetmoinsonreuse.

AprslamiseenplacedunprotocoleEPSavecdesparamtresclairementdfiniset
bass sur une revue critique des diffrents paramtres retrouvs dans la littrature, il sera
effectivement envisageable de traiter diffrentes lignes de cellules cancreuses avec le
milieu de culture des myocytes lectrostimuls. Cela permettra dtudier leffet du
myokinome sur des lignes de cellules cancreuses cultivesinvitroetaussideffectuerun
screening surunlargepaneldelignesafindavoirunevuedensembledeseffetspotentiels
de cetypedetraitement.Aterme,lobjectiffinalestdamenerdesconnaissancespermettant
d'amliorer la qualit et la pertinence des prescriptions dAPA pour des patients atteints de
cancers.

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
11

Revuedelittrature

1.

Activitphysiqueetprogressiondescancers

1.1. Inactivitphysiqueetcancers
Linactivit physique est untermeutilispouridentifierlespersonnesquinatteignent
pas les niveaux dAP quotidienne recommands
(
GratasDelamarche et al. 2014
)
. LOMS
considre quune personne est inactive physiquement lorsque quelle consacre moins de
5x30 min une AP dintensit modre, i.e. comprise entre 3 et 6METpar heure(METh),
par semaine, ou moins de 3x20 minutes dAP vigoureuse, i.e. partir de 6 METh, par
semaine. Linactivit physique est responsable de laugmentation du risque dun large
spectre de pathologies dont les symptmes apparents sont trs varis, elle est dailleurs
actuellement considre commele4mefacteurderisquedemortalitdansleMonde, cest
pourquoi il est important de dvelopper des critres permettant de dfinir clairement ce
quest linactivit physique afin de pouvoir ensuite envisager et tablir des stratgies
dintervention. Il convient galement de distinguer inactivit physique et comportement
sdentaire, le temps de sdentarit tant le temps pass assis. Il est aujourdhui bien
dmontr que toutes les maladies lies linactivit physique ont en commun les mmes
facteurs dclencheurs, comme linsulinorsistance, linflammation et le stressoxydant(SO)
(
Pedersen 2009
)
. Quiplusest,ces processusnesontpasindpendantslesunsdesautres,
ils sinfluencent mutuellement, ce qui rend extrmement complexe la comprhension des
mcanismes initiant ces drglements physiologiques. Afin dexplorercesmcanismes,des
efforts ont tfaitpourdvelopperdiffrentsmodlesdinactivitphysiquechezlHommeet
chez les rongeurs. Le modle dinactivit physique le plus souvent utilischezlHommeest
lexprience de bed rest, quiconsisteenunalitementsurunedureprolonge,etchezles
rongeurs il sagit du testdesuspensionparla queuequipermetdedlesterleurarriretrain
(
GratasDelamarcheetal.2014
)
.

Linactivit physique, via lmergence ou lamplification de linsulinorsistancesurle


long terme, augmenterait le risque de cancer du sein
(
Friedenreich 2011
)
, colorectal
(
Friedenreich et al. 2006
)
, du foie, du pancras
(
GratasDelamarche et al. 2014
) et de
lendomtre
(
Pedersen 2009
)
. Les rles que joue linactivit physique dans le
dveloppement des cancers ont t peu tudis et probablement sousestims
(
Courneya
et Friedenreich 2011
)
. Toutefois, daprs Friedenreich, les cancers sont aujourdhui
accepts comme des maladies lies au mode vie et la communaut mdicale accorde de
plus en plus de crdit la recherche sur le lien inactivit physique et cancers. Cette
recherchesestaccompagneparledveloppementdediffrentesstratgiesdeprvention.

1.2. APetprventionsdescancers
En prvention primaire, lOMS recommande clairement la population gnrale
deffectuer un minimum de 150 minutes dAP dendurance par semaine si lintensit est
modre ou 75minutessilintensitestsoutenue,fractionnounon parpriodesminimales

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
12

de 10 minutes. lAP dintensit modre devrait mme tre augmente 300 minutes par
semaine et lactivit soutenue 150 minutes par semaine afin de maximiser les bnfices
sur la sant
(
Khan et al. 2012
)
. Lobjectif est de lutter contre les facteurs de risques. Des
habitudes de vie saines, combinant une bonne alimentation et une AP rgulire sont par
exemple associes un risque de cancer plus faible chez des femmes postmnopauses
(
Desnoyers et al. 2016
)
. Dans ltude voque par Desnoyers et al., le risque est diminu
de 17% pour tous cancers confondus, de 22% pour le cancer du sein et de 52% pour le
cancer du clon. Pour le cancer du sein, premire cause de cancer chez la femme dansle
monde,laprventionprimaireestessentielle
(
Ott et al.2011
)
.Ilsagitducancerdanslequel
lAP apporte laplusgrandediminution durisqueenprdiagnostic,entre15et20%,avecun
maximum defficacit observ chez les femmes avec un IMC suprieur 25 et en
postmnopause. Pour le cancer du clon, distal ou proximal, deuxime cancer chez la
femme et le troisime chez lhomme en terme dincidence, la rduction du risque li la
pratique dune AP est estim 24%
(
Desnoyers et al. 2016
)
. Dans le cadre dune
prvention primaire, lAP constituerait aussi une stratgie intressante contre le cancer de
lestomac, cinquime cancerleplusfrquentlchellemondialeetletroisime entermede
mortalit
(
Ott et al. 2011
)
, le cancer de loesophage, de la vessie, des poumons ainsi que
les cancers pelviens
(
Desnoyersetal.2016
)
. Deplus,lobsitestunfacteurderisquedes
cancers les plus frquents. LAP permettrait galement de diminuer le risque de cancer en
diminuant la surcharge adipeuse. Cet effet a surtout t document chez les populations
haut risque
(
Bachmann et al. 2015
)
. Il ressort des diffrentes tudes que lintensit du
programme dAP, sa frquence et sa dure sont dterminants sur la rduction des risques
decancer.

En prvention secondaire, lAP est aussi mise en exergue comme tant un moyen
susceptible de lutter contre les effets secondaires indsirables associs aux traitements du
cancer via ses impacts potentiels sur le poids corporel et sur des marqueurs biologiques
inflammatoires, immunitaires et hormonaux. Lobjectif est de favoriser lautonomie des
patients. LAP postdiagnostic est associe un risque de mortalitinfrieurdanslecancer
colorectal et le cancer de la prostate. Mais aucune association na par contre pu tre
dmontre dans les cancers pelviens et hmatologiques. En ce qui concerne le cancer du
poumon, aucun effet bnfique na t observ, sauf concernant la rhabilitation
priopratoire et chez des patients un stadeavanc
(
Desnoyersetal.2016
)
.Deplus,la
prescription dAP en prvention secondaire des cancers nest pas forcment compatible
aveclensembledestraitements.

En ce qui concerne la prvention tertiaire,lenombredesurvivantslongtermedun


cancer, cest dire les personnes qui sont toujours en vie plusde5anssuiteaudiagnostic
continue de crotre. Ces dernires sintressent de plus en plus toutes les modifications
dans leurs habitudes quotidiennes qui peuvent permettre de prolonger leur esprance de
vie, dont lAP
(
Desnoyers et al. 2016
)
. Les tudes sur le cancer du sein sont celles qui
montrent lassociation inverse entre pratique dAP et risque de rcidive la plus significative
(
Carayol 2013
)
. Presque toutes les tudes actuellement publies concluent quune AP
dbuteavantouaprslediagnosticengendreunediminutiondurisquedemortalit.

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
13

Lassociation entre lAP et ses effets bnfiques sur les cancers est de plus enplus
tablie, nanmoins, linfluence du type, de lintensit et de la frquence de lAP nont pas
encore t clairement tudislheureactuelle.Quelques tudes permettentdapporterdes
lments de rponse pour certains cancers. En prvention primaire, pour les cancers
gastrooesophagiens, la rduction du risque est plus importante quand lAP est dintensit
modre intense et quelle seffectue une frquence de 5 fois parsemaine
(
Desnoyers
et al. 2016
)
. En prvention tertiaire, les survivants de cancer qui ralisent un entranement
en rsistance, mettant en oeuvre la capacit de rpter et soutenir longtemps un effort
d'intensit moyenne, au moins une fois par semaine prsentent une rduction de mortalit
toute causes confondues de 33%
(D
esnoyers et al. 2016
)
. Lentranement en rsistance
recouvre un ensemble dexercices qui permettent un renforcement musculaire par
augmentation de la masse, de la puissance, de lendurance et de la force des MSS. De
plus, les bnfices sur la survie pour une mme frquence et intensit dAP varient
beaucoup en fonction du site tumoral. La grande htrognit dAP retrouve dans la
littrature faitquilnyatoujourspasdeconsensusclairsurletypedAPrecommanderaux
patients. Les futures tudes mriteraientqueletypedAPsurlequelellessepenchentetles
moyens dvaluation quelles utilisent soient homogniss et standardiss. Lesconsensus
sont dautantplusdifficilestrouverqueleslimitationsintrinsquesauxpatientsdoiventtre
prises en compte. Le type dAP propos en APA doit tre individualis, sadapter aux
capacits physiques, aux prfrences du patient ainsi quaux particularits de sa maladie.
Nanmoins, il ressort actuellement que les effets positifs semblent surtout lis lAP
dintensit modre soutenue
(D
esnoyers et al. 2016
)
. Effectivement, les prises en
charge actuellement proposes alternent le plus souvent reconditionnement physique et
entranement leffort. En gnral, enprventionsecondairedecancer,lducateurenAPA
(EAPA) prconise une activit arobie modre soutenue, qui varie entre 10 et 60
minutes,raisonde25foisparsemaine.

De nombreuses tudes cliniques observationnelles ont dcrit des effets bnfiques


et prventifs de lAP contre les cancers. La liste des mcanismes molculaires et
physiologiques qui permettent dexpliquer comment une AP rgulire est capable de
prvenir les rechutes ou la mortalit lies au cancer est grandissante. Cependant ces
derniers sont encore mconnus et mritent dtre davantage dcrypts que cequiatfait
lheure actuelle. Malheureusement, lapproche des dtudes cites plus haut ne permet
pas de les tudier. Pour surmonter ces difficults, des tudes ont mesurlesbiomarqueurs
associs au risque de cancer afin de dterminer les relations de causalit entre lAP et les
cancers. Cela permet ainsi dune part de mieux comprendre les voies de signalisation
impliques, dautre part de cerner les doses optimales dAP, type, dure, frquence, et
intensitrequisespourmodifiercesmcanismes
(
Winzeretal.2011
)
.

1.3. EffetsdelAPsurlesmcanismeslislaprogressiontumorale
LAPagiraitvialamodulationdediffrentsmcanismesafinde ralentiroudiminuerla
prolifration tumorale. Ces mcanismes sont la scrtion dinsuline et linsulinorsistance,
la production et la biodisponibilit des hormones strodes sexuelles, les variations de
masse grasse et de concentration des adipokines, la fonction immunitaire, linflammation
chronique, ainsi que les processus apoptotiques.
(
Winzer et al. 2011
Desnoyers et al.

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
14

2016
)
. Il apparat que le SO est galement impliqu. Lensemble de ces processus
sinfluencent les unsavecles autres,cequirendextrmementcomplexeleuranalyseetleur
comprhension. Parmi ces pistes, celles qui sont actuellement les plus explores touchent
aux rles des cellules adipeuses, des hormones, des facteurs de croissance, de limmunit
etdesmarqueursinflammatoires
(C
arayol2013
)
.

1.3.1. Insulineetinsulinorsistance
Une partie de ces effets passent par une stabilisation et une diminution de la
surcharge adipeuse. En effet, les mcanismes physiopathologiquesfavorisantlacroissance
tumorale en lien avec lobsit sont aujourdhui bien documents, il sagit de
linsulinorsistance, de linflammation et du drglement de la production des hormones
strodiennes sexuelles
(
Bachmann et al. 2015
)
. Chez la femme en surpoids, inactive et
postmnopause, lAP auneffetfaiblemodrsurlarductiondelinsulinmie jeun,de
linsulinorsistance et de la concentration de leptine. Une diminution des taux dinsuline
sanguine jeun est susceptible dtre cliniquement important. En effet, des concentrations
leves dinsuline ont t associs une multiplicationpar2voire3durisquedecancerdu
sein.
Cette hormone est un puissant agent mitogne pour les cellules tumorales du cancer
du sein.Desconcentrationslevessontgalementassociesunrisqueaccrudercidive
long terme et de dcs, indpendamment de lIMC. Une diminution de 2025% de la
concentration en insuline augmenterait effectivement le taux de survie 5 ans aprs le
diagnostic du cancer du sein de 56%
(
Winzer et al. 2011
)
. Il a t propos que lAP
pourrait protger contre la rcidive du cancer du sein en rduisant les concentrations
dinsuline par lintermdiaire dune augmentation de la quantit et du fonctionnement des
transporteurs transmembranaires de glucose comme GLUT4, ce qui amliore la clairance
des acides gras libres et augmente lactivit enzymatique mitochondriale
(
Winzer et al.
2011
)
. Un taux lev dinsuline est galement associ au cancer du clon. Bien que peu
dtudes aient t menes, certaines donnes mettent en vidence un rle de lAP dans la
modulation dautres biomarqueurs qui sont drguls dans ces deux cancers. Parmi ces
marqueursonpeutciterlaleptine,lesoestrognesainsiquedesmarqueursdelapoptoseet
de ladiposit. Il semblerait par exemple que chez les survivants de cancer du sein lAP
augmente certains facteurs comme des protines impliques dans la voie de signalisation
de la somatomdine C (IGF1), dans le fonctionnement du systme immunitaire, dans
linflammation et sans doute aussi dans la voie mtabolique de linsuline
(
Winzer et al.
2011
)
. LAP permettraitainsidediminuerlaconcentrationdIGF1etdeleptine. LIGF1est,
comme linsuline, un mitogne puissant dans le cancer du sein, de fortes concentrations
sont associes un risque accru de rechute. Des tudes
invitro ontmontrquIGF1 ades
actions antiapoptotiques et proangiogniques. Daprs des tudes pidmiologiques,
lassociation entre IGF1 et taux de rcidive est davantage marque chez des patientes
prmnopauses. Nanmoins il a aussi t montr que lAP rduit significativement la
concentration dIGF1 et dIGF2 chez des femmes postmnopauses ayant survcu un
cancer du sein
(
Winzer et al. 2011
).
Defortesconcentrationsdeprotinesdesquestration
des rcepteurs de lIGF (IGFBP) sont considrs comme bnfiques car elles rduisent la
biodisponibilitdelIGF1.Decefait,ellessontthoriquementcensesdiminuerlerisquede
cancer. Toutefois, les tudes concernant leffet de lAP sur ces protines ne sont pas
concordantes. De plus, des tudes cliniques suggrent que des concentrations leves

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
15

dIGFBP3 peuvent augmenter le risque de rcidive long terme du cancer du sein positif
pour le rcepteur loestrogne (ER+) chez des femmes en postmnopause. Ces effets
nfastesdelIGFBP3devraienttredavantagetudis
(
Winzeretal.2011
)
.

Figure1:VoiesdesignalisationdelinsulineetdelIGF1
IR
:
Rcepteurde linsuline
IRS1/2
:Substrat 1/2 du rcepteur linsuline
PIP2/3
:Phosphatidylinositolbis/triphosphate
PI3K
: Protine kinase des phosphoinositides, i.e. driv phosphoryl du phosphatidylinositol
PTEN
: Homologue de la
phosphatase et delatensine
PDK1
: Phosphoinositidedependentprotinekinase1
Akt
:Akt1,protinekinaseB(PKB)
GLUT1/4
: Transporteurde glucose de type1ou4
p27
:Protine1inhibitricedeskinases(Kip1) cyclinedpendantes2et4
(cdk2/4)
BAD
:Protineproapoptotique quiappartientlammefamillequeBCL2
BCL2
:
Bcelllymphoma2,protine
antiapoptotique
IKK
: Protine kinase de linhibiteur (IB) du facteur nuclaire kappa B (NFB)
FoxO
: Facteur de
transcription
Forkhead Box O
GSK3
: Protine kinase 3 bta de la glycogne synthase (GS)
eIF2B et eIF4B/E
:
Facteurs dinitiation de la traduction eucaryotique (eIF)
TSC1TSC2
: Complexe protique hamartinetubrine
AMPK
:
Protine kinase active par lAMP
RHEB
: Homologue de RAS enrichi dans le cerveau
mTOR
:Cible delarapamycine
chez les mammifres
p70S6K
: Kinase de la protine ribosomale S6 dune masse de 70kD
S6
: Protine ribosomale
4EBP1
: Facteur dinitiation 4E de la traduction eucaryotique
IGF1R
: Rcepteur de lIGF1
IGFBP
: Protine de
squestration des rcepteurs delIGF
Shc
:Protine adaptatricecontenantundomainehomologueSrc
GRB2
:Protine
adaptatrice 2 liant un rcepteur de facteur de croissance
SOS
: Protine
Son of Sevenless
RAS
:
Rat sarcoma viral
oncogene
, protine activepar des mitognes
RAF
: Serine/ThreonineKinase quia unrle mitogneou protooncogne
dans le cas dune expression augmente
MEK1/2et
MKK4/7
:Deuxisoformesde lafamilledesMAPKK,kinasesdeMAPK

MAPKKK
:kinasedeMAPKK
MAPK
:Protinekinaseactivepardesmitognes
ERK1/2
: Kinasesrgulesparunsignal
extracellulaire
Myc
:cMyc,
myelocytomatosisoncogene
, protooncogne
Max
:FacteurX associmyc
Mad
: Protine
qui se dimrise avec Max
Fos
:
FBJ osteosarcoma, oncogne qui peutsedimriser avec Jun pour former le complexe
AP1
Jun
:Protooncogne
JNKs
:KinasesdeJun
P
:GroupephosphorylPO32

Thr
:Thronine.

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
16

1.3.2. Massegrasseetadipokines
Le tissu adipeux est capable dexercer des effets sur certains des autres processus
voqus. Ces derniers sont notamment mdis par la scrtion de cytokines, appeles
adipokines. LAP permet dune part de diminuer la conversion des andrognes en
oestrognes sous laction de laromatase via la perte de masse adipeuse
(
Winzer et al.
2011
)
. Dautre part, dans le cas des cancers du sein traits avec des inhibiteurs de
laromatase, lAP pourrait galement avoir un effet bnfique sur le maintien de la densit
osseuse
(
Bachmann et al. 2015
)
. Toutefois ces modifications napparaissent pas de faon
cohrente dans lensemble des tudes.Eneffet,lasignificativitcliniquedeladiminutionde
leptine avec lAP est difficile interprter du fait quune revue a montr que lassociation
entre leptine et cancer duseinnatconfirmquedanspeudtudes
(
Winzeretal.2011
)
.
Il semblerait que les effets de lAP dans la voie mtabolique de linsuline seraient plus
prononcs chez les femmes obses ou sdentaires, cestdire celles prsentant les plus
hauts niveaux dinsuline srique
(
Carayol 2013
)
. Ladiposit est aussi un facteur de risque
du cancer colorectal, du sein en postmnopause, de lendomtre, de ladnocarcinome de
loesophage, du pancras et du rein. Un indice de masse corporelle (IMC) plus lev est
aussi associ un taux de survie plus faible des cancers du sein, du clonrectum, de
loesophage, du pancras, du rein, de lestomac, de la prostate, des cancers pelviens, du
lymphomenonhodgkinienetdumylomemultiple
(
Winzeretal.2011
)
.

1.3.3. Processusinflammatoire
Linflammation systmique est associe la progression de nombreux cancers,
notamment le cancer du sein.
En ce qui concerne les effets de lAP dans linflammation,
Carayol rapporte notamment une tude montrant une amlioration dans lactivit des
lymphocytes
natural killers (LNK) etdanslaprolifrationspontanedesautreslymphocytes.
Cela conduit mettre lhypothse dun effet bnfique dune intervention en AP sur des
marqueurs de limmunit
(
Carayol 2013
)
. Les LNK jouent surtout un rle dans la dfense
contre les infections procaryotiques, mais sont aussi impliques dans llimination des
cellules tumorales. Toutefois cette augmentation des cellules immunitaires comptentes
nest que transitoire. Il sensuit une diminution importante de leur concentration sanguine
dans les heuresquisuiventlarrtdelexercice.Parailleurs,IlatproposquelAPpuisse
rduire le risquedercidivedecancerenaugmentantlafonctionimmunitaire,cequiconduit
une meilleure dtection et destruction des cellules anormales, comme les cellules
tumorales par exemple. En effet, la cytotoxicit des LNK et la prolifrationdeslymphocytes
augmente nettement en rponse lAP chezles survivantesduncancerdusein
(
Winzeret
al. 2011
)
. lAP semble galement pouvoir diminuer linflammation grce la synthse et la
scrtion de la cytokine proinflammatoire interleukine6 (IL6) par le MSS en contraction.
LIL6 active son tour unecascadedemdiateursantiinflammatoires
(
Winzeretal.2011
)
(
Figure 2
)
. LIL6 synthtise par le MSSestlatoutepremiremyokineidentifie etaussila
plus tudie du fait que sa concentration peut tre multiplie par 100 danslesangpendant
lAP. Cette dcouvertearelanclintrtdelacommunautscientifiqueconcernantlesrles
jous par cette cytokine dans le mtabolismeetaenmmetempscrunparadoxe.Dune
part, lIL6 est produite et libre de faon trs remarquable dans la priode qui suit lAP,
lorsque laction de linsuline est accrue, mais, dautre part, la scrtion dIL6 a galement

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
17

t associe au tissu adipeux dans le cas de lobsitetdelinsulinorsistance


(
Pedersen
2009
)
.

Figure2:VoiedesignalisationdelIL6

LAP semble galementrduirelesconcentrationsdeprotineCractive(CRP),une


protine de laphaseinflammatoireaigunonspcifiqueetdufacteurde ncrosetumorale
(TNF). Chez des patients en rmission dun cancer de la prostate, une tude qui value
limpact dun programme dAP de 12 semaines qui mlange AP arobie et renforcement
musculaire a mis en vidence une diminution de la CRP cliniquement et statistiquement
significative. Cependant chez des tudes valuant limpact dune intervention en AP sur la
diminution des marqueurs de linflammation, la CRP etlIL6nontpasprsentde rsultats
concluants.
(
Carayol 2013
).
Lassociation entre lAP et le niveau de CRP nest pas encore
bien dfini dans lereste delalittrature.CestudesmontrentgalementquelAPnaggrave
pas les niveaux circulants de testostrone et dantignes (Ag) spcifiques de la prostate
(
Carayol 2013
)
. Des niveaux levs de CRP ont t associs un risque dercidiveetde
mortalit par cancer du sein multiplis par deux, indpendamment de lIMC et du stade
tumoral. LAP a un effet modr sur la rduction de la concentration de CRP chez les
survivantes de cancer du sein. Bien que les rsultats de cette tude ne soient pas trs
significatifs, la rduction de 27% de la concentration de CRP observe pourrait bien tre
importante cliniquement
(
Winzer et al. 2011
)
. Dans le cas du cancer du sein, lAP permet
galement de diminuer les concentrations dhormones sexuelles responsables du
dveloppement tumoral. Par contre, lAP ne semble pas avoir deffet dfavorable sur les
hormonessexuellesdanslecasducancerdelaprostatetraitpardprivationandrognique
adjuvanteavecdesagonistesdelagonadolibrine(aGnRH)
(
Bachmannetal.2015
)
.

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
18

1.3.4. Apoptoseetmarqueursdelapoptose
Des diffrences notables ont t observes entre les hommes et les femmes en ce
qui concerne lesbiomarqueursdu cancerduclon.LAPsembleeffectivementavoiruneffet
diffrent sur les marqueurs de lapoptose, Bax et Bcl2. Ces marqueurs sont augments
chez lhomme au niveau des sites o les polypes se forment, mais cette augmentation est
moins marque chez la femme. Une explication possible rsiderait dans le fait que les
oestrognes auraient un effet protecteur contre le cancer du clon. Cette explication serait
nanmoins pondre par le fait que, comme dcrit plus haut, lAP rduit le taux
doestrogne.Toutefois,dautresdonnes pidmiologiquessuggrentaucontrairequelAP
est tout aussi protectrice contre le cancer duclonchezlhommeetchezlafemme
(
Winzer
et al. 2011
)
. Davantage dtudes sont donc ncessaires sur ce sujet, dautant plus que cet
effet proapoptotique pourrait aussi dpendre de laction de myokines induites par lAP,
commelaprotineSPARC
(
Aoietal.2013
)

1.3.5. Stressoxydant
La pratique dune AP est associe une augmentation transitoire du SO dans
lorganisme et notamment dans les MSS. Le SOarge excessive en diffrentes espces
ractives drives de l'oxygne molculaire (ROS). Il exerce de trs nombreux effets. Il a
par exemple t reli au vieillissement et la pathogense de maladies dues linduction
dedommagescellulaires.Parexemple,lexcsdestress oxydatifseretrouvedanslaplupart
des maladiesmtaboliquesimpliquantundrglementmitochondrial.Cesphnomnessont
connus et actuellement regroups sous le terme de thorie du vieillissement par le biais
radicaux libres
(
Ost et al. 2016
).
Le SO se retrouve aussi impliqu dans laprogressionde
certains cancers, comme le cancer de la prostate par exemple
(
Guritat 2015
)
. Ce
processus est certes naturel et joue un rle cl dans la rgulation de la force etlemaintien
de lhomostasie musculaire, mais son accumulation intracytoplasmique est nocivepourles
cellules. Paradoxalement, uneAPchroniquedintensitmodrepermetdemieuxprserver
lhomostasie face laugmentation des ROS. Cette adaptation est permise grce une
hausse des concentrations denzymes antioxydantes, comme la superoxyde dismutase
dpendante du manganse (MnSOD), la glutathion peroxydase (GPx) et la catalase
(
Guritat2015
)
.

Ost et al. se sont concentrs sur les facteurs scrts par les MSS qui sont
principalement induits par le stress cellulaire dans des conditions physiopathologiques et
non danslecadreduneAP
(
Ostetal.2016
)
.Les deuxprincipauxfacteursquiseretrouvent
scrts par les MSS lorsque les niveauxdeROSsonttroplevssontGDF15etFGF21.
Les complexes I et III de la chane respiratoire sont des sites de production dions
superoxydes en rponse une activit mitochondriale augmente durant la contraction
musculaire. Deplus,ilexistedautressourcesdionssuperoxydestelsque la5lipoxygenase
(5LO), la cyclooxygnase (COX), les NADPH oxydases du sarcolemme (NOXs) et la
xanthine oxydase (XO)
(
Ost et al. 2016
)
. Silveira et al. on valu le rle desROSdansles
augmentations dexpression des ARNm de PGC1, de lhexokinase 2 (HK2) et de la
protine dcouplante mitochondriale 3 (UCP3) induites par les contractions musculaires en
soumettant des cellulesdeMSSderatdesprogrammes EPSaigusuniquesou rptsen
prsence ou en absence dantioxydants. Ils ont observ que la contraction des cellules

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
19

musculaires conduit une augmentation de la formation de peroxyde d'hydrogne (H2O2).


Ils constatent galement que laprsencedantioxydantssupprimelaugmentationtransitoire
dexpression des ARNm de PGC1 et UCP3 en rponse des contractionaigus.Ilenva
de mme avec des sessions de contractions aigus et rptes, mais dans ce dernier cas
les antioxydants suppriment galementlaugmentationtransitoiredelexpressiondesARNm
de HK2
(
Silveira et al. 2006
)
. Cela suggre que les ROS jouent un rle permettant aux
contractions dengendrer une expressionaccruedeHKII,UCP3 etPGC1dansles cellules
duMSS

En plus dtre impliqu dans le processus de la myogense, leSOagalementdes


effets sur le dveloppement et la progression descancers.Effectivement,laccumulationde
ROS entrane lhydroxylation de lADN et abouti des mutations telles que des
changements de bases azotes ainsi qu des modifications de conformation de la double
hlice. Ces mutations peuvent toucher et endommager des gnes suppresseurs de tumeur
tandis quelles entranent une augmentation de lexpression des gnes prolifratifs, les
protooncognes. le SO est impliqu dans les trois grandes tapes du dveloppement du
cancer, linitiation, la promotion et la progression. Par exemple, dans ltape dinitiation, les
ROS altrent dune part le matriel gntique des cellulesmaisagissentgalementcomme
des messagers secondaires capables de modifier la rgulation redox du glutathion rduit
(GSH), ce qui engendre une activation de la thiordoxine (TRX) qui active son tour le
facteur de transcription nuclaire kappa B (NFB)
(
Guritat 2015
)
. Ce facteur est alors
transloqu dans le noyau et peut activer des gnes cibles qui sont impliqus dans la
progression du cancer. Par ailleurs, lexcs de peroxyde dhydrogne (H
O
) et un
2
2
dsquilibre de la balance pro/antioxydants activent un signal de transduction via la
rgulation des MAPKs. Les MAPKs entranent des signaux depuis la membrane vers le
noyau en rponse des stimuli. Il se trouve que ces protines rgulent de nombreux
processus dont la mitose, la prolifration et lapoptose. La famille des MAPKs est une
grande famille de protines qui regroupe ERK, JNK
(
Figure 1
) et p38. Ces dernires
modulent lexpression de gnes en activant un grande varit de facteurs de transcription
comme le complexe AP1 entre Fos et Jun, NFB ainsiquelaprotinep53. Lactivationde
ces derniers facteurs entrane la prolifration cellulaire. Une forte concentration de H
O
2
2
conduit galement une stabilisation et uneaccumulationdufacteur1induitpar l'hypoxie
(HIF1)quientraneson touruneaugmentationdelasynthsedufacteur decroissancede
l'endothlium vasculaire (VEGF)
(
Guritat 2015
)
. Cela a pour effet de favoriser
langiogense et peut faciliter le processus mtastatique. Durant lAP, lIL6 voque
prcdemment est produite par les muscles et stimule la formation dautres cytokines
antiinflammatoires, telles que lIL1ra ainsi que lIL10
(
Figure 2
)
. Ces derniresinhibentla
production de la cytokine proinflammatoire TNF
(
Guritat 2015
)
. Ce mcanisme peut
permettredexpliquercommentlAPdiminuelaprolifrationtumoraleinduiteparlesROS.

Lensemble des articles qui ont mesur ces biomarqueurs se sont penchs sur des
prises en charge avec des dures et des frquences trs varies. Ces grandes variations
influencent la magnitude des effets observs sur les diffrents marqueurs et limitent
linterprtation
(
Winzer et al. 2011
)
. Ces dtudes sont aussi perturbes par le temps de
sdentarit, qui est une variable qui nest pas surveille. Lallongement du temps de
sdentarit a t associ uneaugmentationdurisquedecancercolorectal,delaprostate,

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
20

de lendomtre et des ovaires, mais aussi linsulinorsistance, des niveaux levs de


CRP et laugmentation de la mortalit toute cause confondue. Qui plus est ces
associations sont indpendantes du temps consacrlAPdintensitintensevigoureuse.
Prescrire un nouveau programme dAP une population inactive permettrait de rduire le
temps de sdentarit chez certaines personnes seulement. En effet, les autres personnes
compenseraient le temps pass pratiquer une AP en augmentant leur temps de
sdentarit, cequiapoureffetdannulerlesbnficesduprogrammedAPpropos
(
Winzer
etal.2011
)
.

Enfin, ces mcanismes lis lAP sont rendus dautant plus complexes quils
sinfluencent mutuellement via diffrents facteurs. Cette grande complexit est de plus en
plus renforce au fur et mesure que des molcules sont dcouvertes dans le scrtome
musculaire.Cesderniressontappelesmyokines.

1.4. ProductiondemyokinesdurantlAPeteffetssurlescancers
Les MSS ont dabord t caractriss par leur activit mcanique. Cette activit
mcanique est requise pour le maintien de la posture, le mouvement et la respiration qui
dpendent de la contraction des fibres musculaires. Cependant, le MSS nest pas
uniquement un composant du systme locomoteur, mais galement un organe endocrine
capable de scrter des cytokines ainsi que dautres petits peptides
(
Pedersen 2013
Schnyder et Handschin 2015
).
Les MSS possdent ainsi un scrtome compos de
plusieurs centaines de peptides
(
Henningsen et al. 2010
) qui leur permettent de
communiquer et dexercer des effets sur dautres organes tels que le tissu adipeux, le foie,
lepancras,lesos,lecerveauainsiquesurlesMSSeuxmmes.

Le terme cytokine dsigne toutes protines solubles depetitestailles,entre5et20


KDa, gnralement composes de 160 acides amins environ, synthtisesparunecellule
ou un tissu et qui sont capables davoir un effet sur dautres cellules ou tissus. Cet effet
consiste en une modification dactivit ou de fonction de la cible. Il est dit autocrine si la
cible est la cellule scrtrice ellemme, paracrine ou juxtacrine si les cibles sont des
cellules voisines et endocrine si les cibles sont des cellules ou tissus distants qui
ncessitent un passage des cytokines dans la circulation systmique. Les cytokines sont
essentielles la communication entre les cellules et les tissus. Pedersen et collaborateurs
ont propos de regrouper sous le terme de myokines les cytokines et les autres petits
peptides qui sont produits, exprims et relargus par les cellules musculaires
(
Pedersen et
Febbraio 2012
)
. Le terme myokinome permet ainsi de dsigner le scrtome des
myotutes. Un scrtome tant lensemble des facteurs scrts par une cellule sur une
priode donne. Lemyokinomedunmusclenestpaslemmeaureposouleffort.Ilnest
pas non plus le mme selon lintensit des contractions des MSS. Deplus,selonletypede
muscle tudi et salocalisation,lacompositiondu scrtomevariegalement
(
Pedersenet
al. 2007
)
. En 2010, Henningsen et al. ont utilis une mthode de protomique quantitative
pour tudier lensemble du scrtome de cellules de MSS murin C2C12. En particulier
durant le processus de diffrenciation. 635 protines scrtes ont t identifies, dont 35
facteurs de croissance, 36 mtallopeptidases et 40 cytokines
(
Henningsen et al. 2010
)
.
Pour la plupart ce sont des protines dj connues et tudies dans dautres conditions.

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
21

Toutefois pour certaines le rle qu'elles jouent pour le muscle reste encore investiguer
(
Tableau I
)
. Ce mmoire na pas pour but de dtailler la totalitdesmyokinesactuellement
connues, on prfrera plutt se pencher sur celles qui paraissent les plus prometteuses
visvis de la lutte contre les cancers. Les effets des diffrents myokinomes sur diverses
pathologies sont de plus en plus tudis. Ces tudes permettent notamment de mieux
comprendre et mesurer les mcanismes molculaires impliqus lors de la prise en charge
de diffrents cancers par de lAPA, que ce soit en prvention primaire, secondaire ou
tertiaire.

Selon Ost et al., plusieurs protines ont rcemment t identifiescommetantdes


myokines. Il sagit de lapeline (APLN), ladcorine,laprotinechitinase3like1(CHI3L1)et
la glycoprotine matricielle SPARC
(
Ost et al. 2016
)
, parmis ces myokines, seules CHI3L1
etSPARCsontintressantevisvisdescancers.

Une tude chez lhomme a rvl que le taux de CHI3L1 plasmatique et le niveau
dexpression dARNm de CHI3L1 dans les myotubes sont augments aprs un exercicede
force aigu et un exercice arobie dendurance. Les taux sanguins de CHI3L1 sont
difficilement exploitables puisque CHI3L1 est exprime dans denombreuxtypescellulaires,
y compris des macrophages. Les concentrations sanguines mesures
in vivo ne rfltent
donc pas forcment sa scrtion par les MSS. Par contre les niveaux dARNm ont t
tudis
in vitro
sur des myoblastes en culture lectrostimuls de manire imiter les effets
de ces exercices
(
Ost et al.2016
)
.Le produitdugneCHI3L1,laglycoprotinedecartilage
de 39 kDa humaine (HCgp39, aussi connue sous le nom de YKL40), est membre de la
famille 18 des glycosides hydrolases et un marqueur de la diffrenciation tardive des
macrophages. Dautres donnes rcentes suggrent galement un effet local de CHI3L1
lors dun exercice dintensit aigu. Elle inhiberait les voies de signalisation
proinflammatoires et stimulerait la prolifration des myoblastes
(
Ost et al. 2016
)
. CHI3L1
pourrait ainsi jouer un rle important dans la rgnration musculaire, qui estunprocessus
important pour ladaptationdumusclelexercice,maisdavantagedtudessontncessaire
sur ce sujet. Elle a galement t suggre comme jouant un rle dans la transition
pithliomsenchymateuse (EMT) et faciliterait ainsi le processus mtastatique, i.e. la
dissminationdescellulestumoralesdanslesangpriphrique.

En 2013, chez la souris et chez lhomme,laprotineSPARCatidentifiecomme


une nouvelle myokine dont lexpression est augmente dans le MSS et qui est scrte
dans le sangenrponseuneAPdintensitaigu
(
Aoietal.2013
)
.Cetteprotinetireson
nom de lacronyme de termes anglais quienfranaissignifientProtineScrte,Acidique
et Riche en Cystine, elle est aussi appele ostonectine. Il sagit dune glycoprotine
matricielle, ce qui signifie quelle est scrte dans lespace extracellulaire,maisnapasde
fonction structurelle. Les protines matricielles sont induites suite une lsion tissulaire et
jouent un rleimportantdans ledveloppement,leremodelageetlarparationtissulaire.Le
premier rle connudeSPARCestderelierlecollagneauminraldanslamatriceosseuse,
mais de nouvelles fonctions lui ont t attribues depuis. SPARC a t associe lafois
une inhibition de la cancrogense en augmentant lapoptose dans un modle murin de
cancer du clon et de latrophie musculaire dans le muscle plantaire de rat. Dans ce
derniermodle,SPARCsestaussirvletreinhibeparuneAPdersistance
(
Ostetal.

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
22

2016
)
. Toutefois, la scrtion de SPARC par les myotubes et ses effets inhibiteurs sur le
dveloppement du cancer du clon ont aussi t associs de lAPchroniqueetmodre,
mais dans un seul modle actuellement, chez un cancer du clon murin induit par un
compos chimique carcinognique, lazoxymthane (AOM)
(
Aoi et al. 2013
)
. Dans ce
modle, linhibition du processus tumoral est apparu ds les premiers stades de formation
des polypes. De plus, lAP rgulire, via SPARC, a galement augment lapoptose des
cellules de la muqueuse du clon ainsi que les marqueursdelapoptose,lesformesclives
de la caspase 3 et de la caspase 8. Laugmentation du clivage de la caspase 8 plutt que
celui de la caspase 9 indique quil sagit plutt dune apoptose intrinsque et non dune
apoptose extrinsque
(
Aoi et al. 2013
)
. Toutefois, cet effet de SPARC na lheure actuel
t observ que dans les cancers du clon. En ce qui concerne les cancers du sein, une
rcente publication semble mme indiquer un effet inverse, SPARC favoriserait le
dveloppement ainsi que la croissance des tumeurs et des mtastases
(
Lindner et al.
2015
)
. CetteactionpasseraitparuneinteractiondeSPARCavecdesfacteursdecroissance
impliqus dans le remodelage de la MEC et langiogense, comme le VEGF, le facteur de
croissance des fibroblastes basique (bFGF), le facteur decroissancedrivdesplaquettes
(PDGF), le facteur de croissance transformant bta (TGF), ainsi que divers composants
de la MEC, comme des intgrines et des mtalloprotases. Daprs les auteurs, SPARC
pourrait mme devenir un nouveau biomarqueur prdictif dans plusieurs types de cancers
o il est surexprim, notamment le cancer du sein. Les rles de SPARC en tant que
myokine induite parlAPrestentflousetrequirentdavantagedtudes.Pourpouvoirtudier
cette dernire,ilapparatnanmoinsfalloirplutttravailleravecdesprogrammesdAPaigu
de haute intensit. Ainsi, pour optimiser la prsence de SPARC dans unscrtome
invitro
,
un protocole de stimulation EPS qui mime lAP aigu de haute intensit serait sans doute
plusappropriquunprotocoleEPSmimantlAPchroniquedintensitmodre.

Il existe aussi des preuves que plusieurs myokines peuvent mdier certains des
effets inhibiteurs de lAP sur la prolifration des cellules cancreuses du sein. Le rle jou
par ces myokines permettrait ainsi dexpliquer les observations dtudes pidmiologiques
rcentes. Ces dernires suggrent en effet que le risque de cancer du sein est accru chez
des femmes ayant un mode de vie sdentaire alors que celles qui pratiquent une AP
rgulire semblent davantage protges contre le dveloppement du cancer du sein
(
Pedersen et Febbraio 2012
)
. Lun des candidats possible parmi ces myokines est
loncostatine M (OSM). OSM est une protine qui appartient la superfamille de l'IL6,une
famille grandissante decytokinesquicomprendgalement,ensusdelIL6,l'interleukine11
(IL11), le facteur inhibiteur de leucmie (LIF), lefacteurneurotrophiqueciliaire(CNTF)etla
cardiotrophine 1 (CT1).
Plusieurs membres de cette superfamille contribueraient la
myogense
in vitro
, la rgnration musculaire ainsi qu la prolifration
in vivo.
Ces
dernires agissent des stades distincts danscesprocessus,viadesvoiesdesignalisation
et des effecteurs diffrents
(M
uozCnoves et al. 2013
)
. Cependant, OSM semble
galement avoir des effets sur les MSS qui pourraient bien limiter son intrt et son
utilisation potentielle contre le cancer du sein. Effectivement, des preuves que lOSM et la
CT1 jouent un rle ngatif dans la myogense
in vitro et
in vivo ont rcemment t
apportes
(
MuozCnoves et al. 2013
)
. OSM et CT1 semblent inhiber la diffrenciation
des myoblastes en myotubes. Pour OSM, cet effet passerait par lactivation de la voie de
signalisation JAK1/STAT1/STAT3.
In vitro
, STAT1 peut intragir avec le gne du facteur2

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
23

musculaire activateur de la transcription (MEF2) et rprimer son activit transcriptionnelle.


Enfin, une expression prolonge dOSM dans des MSS endommags abouti une
mauvaise rgnration musculaire
(M
uozCnovesetal.2013
)
.EncequiconcerneCT1,
son action semble mdie de manire prfrentielle par lactivation de la voie de
signalisation MEK/ERK, qui pourrait son tour interfrer avec lactivation de facteurs de
rgulation myogniques importants
(
MuozCnovesetal. 2013
)
.Ceseffetsrestentencore
tudier. En somme, ces donnesrcentessuggrent quelaCT1etlOSMpourraienttre
impliques dans le maintien de ltat indiffrenci des cellules prognitrices musculaires.
CT1 et OSM empcheraient ainsi la diffrenciation des cellules satellites et agiraient
conjointementavecIL6etLIFquifavorisentdeleurctlaprolifration.

SPARC et OSM inhibent ainsi respectivement la formation de tumeur dans le clon


et la croissance des cellules cancreuses mammaires. Ces myokines inhibent la
prolifration tumorale et induisent lapoptose des cellules cancreuses. Bien que ces effets
soient dune importance thrapeutique vidente, les rles physiologiques des ces deux
protines demeurent flous
(
Schnyder et Handschin 2015
)
.Alavenir,destudesdevraient
chercher claircircommentSPARCetOSMrgulentlaprolifrationcellulaireetlapoptose
aprs avoir t produites et scrtes par le MSS en contraction. Il conviendrait aussi de
savoirsicesderniresontdeseffetcompltementdiffrentssurdescellulessaines.

A terme, le protocole de stimulation EPS qui va tre mis en place devrait permettre
de faire synthtiser et scrter ces diffrentes myokines par des myotubes en culture.
Toutefois il apparat que la formation de certaines, comme SPARC, serait favorise par un
programme EPS aigu de haute intensit, linverse dautres myokines, comme OSM, qui
semblent davantage favorises par un programme EPS chronique dintensit modre.
Cette diversit de rponses des diffrentes myokines aux stimulations rend complexe le
choix des paramtres EPS. Ces derniers dpendent donc la fois du type dAP que lon
souhaite mimer mais galement des facteurs que lon souhaite russir exprimer afin
dtudierparlasuiteleurseffetssurdiffrentscancers.

2.

ModlesanimauxpourltudedeseffetsdelAP
invivo

Afin de pouvoirtudierdavantagelesprocessuscellulairesetmolculairesimpliqus
dans la rponse du corps humain lAP et la plasticit des MSS, les seules mthodes
disposition sont des techniques invasives, comme les biopsies musculaires. Cest la raison
pour laquelle des modles animaux capables de mimer lAP de lHomme ont t
dvelopps. Les plus utiliss sont les rongeurs, et tout particulirement le rat. Plusieurs
techniques permettent de faire pratiquer un exercice et galement dvaluer lAP chez ces
modles. Deux typesdoutilspermettentdestimerlAPdelanimalencage,lesactimtreset
les tlmtres. Les tlmtres sont nettement plus invasifs que les actimtres puisquils
ncessitent limplantation dun capteur sur le spcimen tudi. Les actimtres peuvent tre
de diffrents types, ils peuvent utiliser une grille compose de faisceaux et de capteurs
infrarouges, reposer sur un monitorage par analyse dimage vido ou bien encore mesurer
indirectement la force musculaire dploye, par exemple en dtectant les vibrations
transmisesparlacage.Cettederniremthodeconvientbienpourdtecterlesmouvements
et les comportements lgers et subtils tels que les tremblements, mais ellenestcependant

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
24

pas adapte la dtection dune AP spontane importante. Les mthodes qui conviennent
le mieux danscederniercasdefiguresontlamesuredactivitsur roueinstrumenteousur
tapis roulant motoris. De plus, dautres options ont galement t explores, comme la
nage force enbassinetllectrostimulationdebassefrquenceduMSS(10Hz).Toutefois,
la nage force est un exercice qui nest pas modulable en intensit et llectrostimulation
nengendre que de la contraction concentrique chez les fibres musculaires lentes et
oxydatives de type1,contrairementlacoursesurtapisroulantquientranediffrentstypes
de contractions, isomtrique, excentrique et concentrique. Ainsi ces deux dernires
approchesapparaissentmoinsappropries
(
FerryetRieu1994
)
.

Le modle dutapisroulantmotorisutilispourmimerlacourse dendurancechezle


rongeur est le principal modle animal dAP. Son effet chronique reproduit les mmes
adaptations que celles observes chez ltre humain entran la course dendurance
(
Ferry et Rieu 1994
)
. Afin que les effetsobservssoientreproductibles,lavitesse,ladure
de course, la frquence des entranements, la dure totale du programme et la pente du
tapis sont rgls rigoureusement selon lge et les capacits physiques des rongeurs ainsi
que des objectifs exprimentaux fixs. Ces derniers peuvent viser mimer leffort
dendurance modr, en maintenant le rat en dessous de sa vitesse maximale arobie
(VMA), intense, voiremmedemenerlerongeurjusqulpuisementphysique.Enfin,cette
technique dentranement a le dfaut dtre perturbante, ce qui rend ncessaire de laisser
une semaine dacclimatation, compose de courtes sessions de course sur tapis, avant le
dbutduprogramme.

Lutilisation du modle animal implique toujours certaines limites. Il convient par


exemple de garder lesprit que ces animaux sont en cage, donc sdentaires. La question
de la pertinence de leur utilisation dans des modles dtude des effets de lAP peut se
poser. Qui plus est, les animaux doivent tre seuls en cage pour permettre les mesures.
Cette solitude lesexpose unstresschroniquequipeut mmemenerdeladpressionou
une anxitaccrue.Ilconvientdesedemandersicetteconditionnestressninfluencepas
ou altre les effets de lAP. Dans ces modlesanimaux,leseffetsobservssurlestumeurs
tudis ne peuvent pas tre imputs au scrtome des MSS avec certitude, du fait de la
prsence de facteurs scrts par les autres organes, dhormones et dautres facteurs
humoraux. Cest pourquoi les modles
in vitro prsentent un intrt important, pour se
couperdurestedelorganisme.

3.

MimerlAP
invitro

Il existe plusieurs approches permettantdemimerlAPetdtudierseseffets


invitro
.
Il est possible de traiter les myocytes avec diffrents composs chimiques pour induire les
mmes modifications mtaboliques et biochimiques que lAP. Un exemple de stimulation
chimique bien connu est celui du 5aminoimidazole4carboxamide ribonuclotide (AICAR).
les effets de lAP chronique peuvent effectivement tre mims par un traitement chronique
en AICAR, un analogue de ladnosine monophosphate (AMP). Un traitement en AICAR
augmente lactivit musculaire, la CS, la succinate deshydrognase(SDH)etlecytochrome
c somatique (CYCS). Cet agent se substitue lAMP pour activer la protine kinase
normalement active par lAMP(AMPK)
(
Coisne2007
)
.CetteactivationdelAMPKentrane

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
25

une augmentation intracellulaire de ZMP, un analogue non mtabolisable de lAMP. Ilat


rcemment dmontr que lAMPK active favorise la biogense mitochondriale musculaire
par activation du facteur de transcription PGC1, ce qui permet doptimiserloxydationdes
substrats
(
Foretz et al. 2006
)
. La stimulation peut galement tre mcanique (
Qin et Hu
2014
)
, on parle alors deffets lis la mcanotransduction.Enfin, latroisimeapproche,qui
est celle tudie dans ce mmoire, consiste imiter la stimulation lectrique des myocytes
qui a lieu lors de lAP et qui permet dinduire leur contraction. Cette mthode
dlectrostimulation
in vitro
se nomme mthode EPS, pour Electrical Pulse Stimulation.
Actuellement, les modles exprimentaux mimant lAP sont toujours inadquats, ce qui
empche de combler les lacunessurlesrelationsentrelesdiffrentesvoiesdesignalisation
molculairesdurantlAP
(
Lamberndetal.2012
)
.

3.1. DescriptiondusystmeEPS

Figure3:Stimulateurlectriquedecellulesenculture,adaptdeMarotta,Brags,et
GmezFoix2004

La mthode EPS permet denvoyer des impulsions lectriques sur des cellules en
culture. Elle peut notamment tre utilise sur des myotubesafindestimulerleurcontraction
et ainsi imiter lactivation des fibres musculaires par les motoneurones
(
Orfanos et al.
2016
)
.
Le CPace EP, le stimulateur de cellules en culture de IonOptix, est un systme de
stimulation lectrique automatis qui permet de programmer une boucle alternanttempsde
stimulation et temps de rcupration
(
Figure 3
)
. Cette boucle peuttre compose dun
maximum de 8 squences. Un plateau de 6 boites de culture individuelles de 35 mm de

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
26

diamtre (CDish, IonOptix) est utilis (voir figure cidessous). Avant chaque utilisation, le
fond des botes est dabord recouvert de laminine ou de collagne
(
Burch et al. 2010

Gaster, BeckNielsen, et Schrder 2001


)
, ce qui permetauxcellulesdadhrerenmimant
lenvironnement des cellules
in vivo,
la MEC. Le courant est amen par deux lectrodes
plonges danslemilieu.Cellescisontengnralencarbone,onparlealorsdlectrodesen
graphite
(
Burch etal. 2010

Lamberndetal.2012
Goghetal.2015
)
.Toutefoiscertaines
quipes prfrent plutt utiliser des lectrodes en platine
(
Silveiraetal.2006

Xionget al.
2015
)
. Le choix dun type dlectrode plutt quun autre nest pour le moment justifi par
aucune tude. Le type donde utilis aaussisonimportance.Alinversedelastimulationen
continu par courant galvanique, la stimulation par ondes biphasiques rectangulaires
minimise les ractions nonfaradiques dltres et irrversibles qui se droulent au niveau
de linterface myocyteslectrodes ou tissulectrodes. De plus, les stimulis biphasiques
rectangulaires symtriques ne laissent thoriquement aucune charge rsiduelle, ce qui les
rend dautant plus intressants pour ltude du comportement des myocytes.
(
Xiong et al.
2015
)
.

3.2. Lignescellulairesetmthodesdecultureutilises
Pour que ces protocoles EPS fonctionnent, il faut que les myotubes utiliss aient
auparavant t cultivs dans les meilleures conditions possibles et que leur tat de
diffrenciation permette une rponse contractile. Les modles dtude les plus frquents
sont les myocytes de souris C2C12 et SOL8
(
Burch et al. 2010
Gogh et al. 2015
van
der Schaft et al. 2013
) ainsi que les myocytes de rats Wistar
(
Silveira et al. 2006
)
. Les
myocytes murins C2C12 et SOL8 sont issus respectivement demusclesglycolytiquesetde
muscles oxydatifs
(
Burch et al.2010
)
.Pourlemoment,peu dtudesutilisentdesmyocytes
humains
(
Nikoli et al. 2012
Lambernd et al. 2012
)
. La nature des milieux de culture et
de diffrenciation utiliss influence les processus de prolifration et de diffrenciation des
myocytesenmyoblastespuisenmyotubes,cestpourquoiilestimportantdelesdiscuter.

Dans les protocoles tudis, les cellules sont ensemences dans un milieu de
culture classique DMEM (Dulbeccos Modified Eagles Minimal Essential Medium) 4,5 g/l
de glucose (Lonza, Basel, Switzerland)
(
Goghetal. 2015
)etplacesdans uneatmosphre
humidifie, 37C et 5% CO
(
Nikoli et al. 2012
)
. Un premier milieu est utilis pour la
2
croissance des myocytes et un second pourladiffrenciation.Lacomplmentationdeces2
milieuxestdiffrente.

Chez C2C12, le milieu de croissance est du DMEM 4,5 g/l de glucose


complment avec du srum foetal bovin inactiv par la chaleur (FBS 10% 100g/ml
Gibco/Life Technologies, Carlsbad, CA, USA) et de la pnicilline et de la streptomycine
(P/S), toutes les deux la mmeconcentration(10%100g/ml)
(
Goghetal.2015
)afin de
rduire le risque de contamination microbienne. DansleprotocolemisenplaceparGoghet
al., les cellules sont cultives dans ce milieu jusqu atteindre 8090% deconfluence.Cette
tape dure en gnral entre 2 et 3 jours. Chez les myocytes de rat Wistar
(
Silveira et al.
2006
)
, du srum de veau foetal (FCS, 20%, 200g/ml) est ajout. Dans le protocole de
Silveira et al.,cettetapedure2jours.Chezles myocyteshumains
(
Nikolietal.2012
)
,les
cellules sont cultives80%deconfluence,dansunmilieuDMEMGlutaMAX,avecduFCS

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
27

(2%), de lUltroser G (2%), de la pnicilline (50 U/ml), de la streptomycine (50 mg/ml), de


lamphotricine B (1,25 mg/ml), sans insuline ajoute. Dans le protocole de Nikoli et al.,
cettetapedurede714jours
(
TableauII
)
.

Le milieu de croissance est ensuite remplac par un milieu de diffrenciation. Chez


C2C12
(
Gogh et al. 2015
)
, ce milieu est du DMEM 4,5 g/ldeglucosecomplmentavec
de la P/S (10% 100g/ml) et du srum de cheval (HS 2% 20g/ml Gibco/Life
Technologies). La diffrenciation doit durer entre 4 et 6 jours et le milieu de diffrenciation
doit tre chang toutes les 24 h
(
Tableau III
)
. Cette tape de diffrenciation permet quune
majorit de myoblastes C2C12 fusionnent entre eux pour former des myotubes avec un
syncytium plurinucl
(
Gogh et al. 2015
)
. Burch et al. dbutent leurs protocoles EPS
environ 1 h aprs que le milieu de diffrenciation ait t retir pour tre remplac par un
milieu DMEM contenant de lalbumine de srum bovin (BSA 0,1% 1 g/ml) et
supplment avec de la pnicilline (1% 10 g/ml ), et de la streptomycine (1% 10g/ml)
(
Burch et al. 2010
)
. Toutefois, comme le soulignent Gogh et al., le fait de commencer trop
tt llectrostimulation ne permet pas dexclure compltement les effets des diffrents
facteurs, pour la plupart des facteurs de croissance et des immunoglobulines (Ig), qui sont
prsents dans le srum utilis pour la diffrenciation
(
Gogh et al. 2015
Lambernd et al.
2012
)
. Ainsi, il serait prfrable de laisserlesmyotubesreposerdansunmilieuDMEM sans
aucun srum, aucune complmentation en FBS ni HS, durant une nuit, puis, de renouveler
le milieu sanssrumjusteavantledbutduprotocoleEPSlelendemain.Cettetapedarrt
de la diffrenciation permet de minimiser les effets dventuels facteurs scrts par les
myotubesdurantlanuit.

Les points sur lesquels les protocoles des diffrentes publications tudies sont le
moins en accord sont les supplmentations en srums des milieux de croissance et de
diffrenciation. Il est plus intressant dutiliser du FBS que du FCS dans le milieu de
croissance puisquil contient plus de facteurs de croissance et moins dimmunoglobulines
(Ig), ce qui le rend plus efficace et moins toxique pour les cellules. Toutefois le FCS est
souvent moins onreux que le FBS
.
Pour sassurer que les myocytes ne partent pas en
diffrenciation durant la phase de croissance, il est aussi possible dajouter du FGF2
(Fibroblast growth factor 2) en plus du FBS. Les C2C12passentpar2phasessuccessives,
une phase de prolifration et une phase de diffrenciation. Durant la phase de croissance
avec le FBS, les myocytes sont dans un tat hautement prolifratif. Cet tat est li au fait
que le FBS contient une quantit importante de facteurs de croissance. Pour passer de la
phase de prolifration la phase de diffrenciation, il faut freiner la croissance des
myocytes. Pour cela, le milieu DMEMsupplmentenFBS10%estretir etremplacpar
un milieu DMEM supplment en HS 2%. Ce second srum est moins concentr en
facteurs de croissance que le FBS. Par contre, le HS est plus concentr en insuline que le
FBS, ce qui permet galement de faciliter le processus de diffrenciation. Dans certains
protocoles, de linsuline est mme ajoute en plus du HS 2%
(
Nikoli
et al. 2012
)
. Une
autre possibilit serait non pas de remplacer le FBS par du HS, mais de passer dune
concentrationde100g/mluneconcentrationde12g/mldeFBS.

En ce qui concerne le milieu de stimulation, certaines des tudes antrieures sur


lEPS utilissurdesmyotubesindiquentquunmilieudestimulationsanssrum pourraittre

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
28

plus appropri quun milieu de stimulation avec du srum pour russir induire les mmes
adaptations que celles produites par lAP
(
Burch et al. 2010
)
. Il est possible que des
niveaux levs deROSdanslemilieudestimulationsanssrumcontribuentlinductionde
lexpression des gnes impliqus dans le processus adaptatif. Fait intressant, un effet
similaire surla performancelexerciceavecunecomplmentationenvitaminesetenfortes
doses dantioxydants a galement t montr chez lhomme
(
Burch et al. 2010
)
. Dans les
expriences ralises par Burch et al., aucune diffrence significative entre les conditions
avec srum et les conditions sans srum nont t observes. Cela pourrait tre expliqu
par des diffrences de conditions dans la culture cellulaire et la mthode EPS.Nanmoins,
les rsultats quils ont obtenu indiquent que des myotubes C2C12 stimuls par EPS
pourraient aussi tre utiliss pour tudier
in vitro leseffetsdesROSetdesantioxydantssur
les MSS durant et aprs lAP
(
Burch et al. 2010
)
. En outre, il parait galement intressant
dutiliser un srum composite de nature connue dans le milieu de stimulation. Ce dernier
pourrait tre supplment avec des facteurs additionnels afin dtudier leurs effets sur
ladaptationmusculairelAP.

Les cellules adhrentes la surface du flacon sont le plus souvent dtaches avec
lenzyme trypsine, qui permet de clivercertainesprotinesdadhsion.Cependant,bienque
lutilisation delatrypsinesoitnettementmoinstraumatisante pourlescellulesquelutilisation
dun grattoir, il existe une 3me mthode encore moins stressante. En effet, il est aussi
envisageable dutiliser un chlateur du calcium, comme lacide thylne diamine
ttraactique (EDTA) mlang un tampon phosphate salin (TBS), qui permet dinhiber
ladhsion des lectines au substrat. Le dfaut de cette dernire mthode est quelle ne
permetpasdempcherladhsiondescellulesentreelles.

Aprs ltape de diffrenciation des myotubes et avant le dbut du protocole EPS,


deux paramtres importants sont vrifier avant le dbut du protocole EPS, ltat de
diffrenciation des myocytes en myotubes ainsi que leur rponse contractile des
impulsionslectriques.

3.3. Diffrenciationdesmyotubes
Il existe un certain nombre de mthodes permettant de vrifier que ladiffrenciation
des cellules satellites en myoblastes, puis en myotubes est complte.
Llectrostimulation
couple un examen au microscope peuttre applique la fin du processus de
diffrenciation pour vrifier ltat fonctionnel et la contractilit des myotubes
(
Silveira et al.
2006
)
. Cela permet de savoir si les sarcomres sont compltement dvelopps. Il convient
de bien attendre la fin de la diffrenciation car llectrostimulation durant la diffrenciationa
pour effet de changer lexpression des isoformes de
chanes lourdes de myosine (MyHC).
La diffrenciation et la maturation des myocytes peut aussi tre analyse par RTqPCR en
allant valuer lexpression des ARNm des diffrents gnes impliqus dans ces processus.
Un marquage des protines impliques dans la maturation musculaire peut galement tre
ralis.
Cette diffrenciation et cette maturation des myocytes sont associes
laugmentation de lexpression des gnes du facteur dediffrenciationmyognique(MyoD),
a
ppartenant la famille des facteurs de rgulation myogniques (MRF)
, de la myognine
(Myf4), de lherculine (Myf6), de la protine des muscles des membres infrieurs (MLP),

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
29

ainsi que des gnes des isoformes de chane lourde de myosine (MYH) 1,2,4 et 8, ce qui
entrane laugmentation de la quantit des isoformes de MyHC. Le gne MYH 2 code
notamment pourlisoformeMyHCIIa.Ceprofildexpressiongntiqueindiqueunecomplte
diffrenciation, ou encore que le tissu musculaire est bien form
(
Langelaan et al. 2011
)
(
Tableau 1
)
. Enfin, dans le protocole de van der Schaft et al.,
le dveloppement des
striations croises peuttre tudi par marquage de
lactinine, soit sur des sections du
tissusynthtis,soitsurletissuentier
(
vanderSchaftetal.2013
)
.

Tableau1:Profilsdexpressiongniquescorrespondantauxdiffrentestapesdela
myogense

3.4. LesdiffrentsmodlesetparamtresEPS
Le protocole EPS classique, quiestactuellementlargementleplusutilis,consiste
lectrostimuler des myotubes qui adhrent simplement la surface des boites de culture.
Une des limites majeure de cemodleestquilnereproduitenaucuncaslarchitectureen3
dimensions du muscle,lesmyotubessontseulement disposssurunplan,etpasforcment
autoaligns. Toutefois, un autre protocole existe aujourdhui,quipermet derussirmimer
in vitro larchitecture tridimensionnelle des fibres musculaires. Ce dernier sinspire des
avances rcentes dans le domaine de lingnierie tissulaire et utilise la technologie du
Matrigel (Corning)
(
van der Schaft et al. 2013
)
. LEPS est en effet aussi utilise dans ce
domaine, conjointement avec des systmes biomimtiques qui permettent de mimer la
MEC, comme les surfaces bioactives et les structures tridimensionnelles
(
Xiong et al.
2015
)
.

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
30

Lensemble des paramtres EPS de diffrents protocoles ont t rassembls et


compars
(
Tableaux
IV
,
V
,
VI
,
VII
et
VIII
)
. Il en est ressortiquilestpossibledesimuler des
dures et des intensits dexercice physique diffrentes avec diffrents programmes EPS.
Burch et collaborateurs proposent dimiter 3 types dexercice: Aigu, intermittent ou continu
(
Burch et al. 2010
)
. Pour chaque type, tous les paramtres de stimulation sont les mmes
(
Voltage: 14VFrquence:50HzDuredimpulsion: 1ms).SeuleladuredessessionsEPS
change
(
Tableau2
)
.

Aigu

Intermittentouchronique

Continu

DureEPS

Unefois90
min

plusieursfois90min
intervallergulierdurant4jours

24h

Tableau2:LestypesdexercicesimitsparBurchetal.aveclesystmeEPS

La stimulation EPS de basse frquence en continu durant 24 h se retrouve aussi


dans les travaux de Gogh et collaborateurs
(
Gogh et al. 2015
) avec des paramtres de
stimulation diffrents (
Voltage: 11,5V Frquence: 1HzDuredimpulsion:2ms).Toutefoisil
apparat galement possibledalleraumoinsjusqu48hdestimulationsansquedeseffets
dltresnapparaissentpourlesmyotubes
(
Nikolietal.2012
)
.

Chez des myotubes de rat, la stimulation EPS aigu durant 90 min en continu se
retrouve galement dans les travaux de Silveira et al.
(
Silveira et al. 2006
) avec dautres
paramtres de stimulation
(
Voltage: 10V Frquence: 50Hz Dure dimpulsi
on: 1ms). Pour
mimer lAP aigu, il est aussi possible de monter une frquence dlectrostimulation de
100 Hz, Nikolietal.lontparexemplefaitpourmimerlAPaigusurdesmyocyteshumains
(
Nikoli et al. 2012
)
. Cependant,
in vivo
, cette frquence, bien que considre comme
optimale pour lentranement de force, a comme dfaut de gnrer rapidement une fatigue
musculaire
(
Dreibati et al. 2011
).
A moins dintroduire des temps de pause dans les
stimulations, Il apparat prfrable dutiliser une frquence de 50 Hz pluttque100Hzpour
mimerlAPaigu.

Silveira et al. rcuprent les myotubes au minimum 3 h aprs leur programme EPS
aigu de 90 min
(
Silveiraetal.2006
),
cedlaisemble ncessaireaprsunprogrammecourt
afin de sassurer davoir une rponse transcriptionnelle suffisante. Il ne semble par contre
pas simposer aprsunprogrammeEPSintermittentouchronique,commeceuxdeBurchet
al.
(
Burch et al.2010
)
.Pourtant,Burchetal.fontquandmmelechoixdattendre3haprs
ces programmes, en sinspirant directementdestravauxdeSilveiraetal.,maissansjustifier
cechoix.

Nikoli et al. ont mis en place et ralis deux programmes diffrents de stimulation
EPS. Afin de simuler une AP aigu unique, ils ont ralis un programme aigu et de haute
frquence, qui utilise des trains dimpulsionsbipolairesdunedure200ms100Hzet30V,
rpt toutes les5secondespendant560minutes.Lemmevoltagea tconservpour
simuler une AP modre chronique rgulire. Dans ce second programme, chroniqueetde

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
31

basse frquence, des impulsions bipolaires uniques dune dure de 2 ms 1Hz ont t
appliques en continu pendant 24 ou 48 h. La particularit de ce dernier, que lon ne
retrouve pas dans lesautresprotocoles,estquelesmyotubessontlectrostimulsdurantla
phase de diffrenciation et donc en prsence du milieu de diffrenciation. Ce choix
sexplique par le fait que Nikoli et al. ne sintressent pas au scrtome mais diffrents
biomarqueurs protiques et enzymatiques intrinsques comme le contenu en ATP, de
phosphocratine (PCr), de lisoforme 4 de la pyruvate deshydrognase kinase (PDK4), du
CYCS et de la carnitine palmitoyltransferase 1B musculaire (CPT1B). Ainsi, ils ne
rcuprent pas le milieu conditionn (MC) mais seulement les myotubes et les facteurs
intrinsquesquilscontiennent
(T
ableauVII
)(
Nikolietal.2012
)
.

TypedeprogrammeEPS

Chroniqueetbassefrquence

Aiguethautefrquence

Duretotaledelasessionde
stimulations

24ou48h

Entre5et60min

Duredimpulsion

2ms

Voltage

30V

Frquence

1Hz

100Hz

Effetssurlemtabolisme

Augmentationdumtabolisme
oxydatif

Augmentationdumtabolisme
glycolytique

Changementscellulairesobservs

Biogensemitochondriale

remodelagemtabolique

Variationsdediffrentsmarqueurs

oxydationduglucoseetdesacides
gras

Lactate

Absorptionde2DG

[ATP]

[PCr]

PDK4

IL6

CYCS

CPT1b

Tableau3:LesprogrammesEPSpropossparNikolietal.etleurseffetssurles

myotubes

Les travaux de Burch et al. se sont notamment concentrs sur lexpression et les
fonctions de PGC1 chez des myotubes murins C2C12 stimuls par EPS. Cette protine
est au coeur des adaptations du muscle lAP. Elle rgule au niveau transcriptionnel les
diffrents programmes biologiques impliqus dans cette adaptation. Les effets de cette
protine ont t tudis partir dun modleconstruitlaidedevecteursvirauxpermettant
une expression de PGC1ectopique, cestdiredansunergionextrieureaunoyau.Ila
ainsi t possible de savoir commentPGC1induitetcoactivecertainsdesespartenaires
de liaison et ainsi augmente la production de diffrents facteurs de transcription
(
Burch et
al. 2010
)
.
In vitro
, Burch et al. on dmontr que llvation dexpression de PGC1
dclenche par lEPS est aussi suffisante pour augmenter les niveaux de ces facteurs de
transcription. Elle permet galement daugmenter la transcription de gnes mitochondriaux
impliqusdanslaphosphorylationoxydative.

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
32

Chez des myotubes murins C2C12 stimuls par EPS, Burch et al. ont galement
recherch et quantifi dautresprotinesqui,commePGC1,permettentuneaugmentation
de lexpression des gnes impliqus dans ladaptation du muscle lAP. Ilsontainsitrouv
des niveaux levs de CYCS et dacylCoA dshydrognase des acides gras chane
moyenne (MCAD). La stimulation EPS de myotubes peut tre optimise afin de reproduire
au plus prs les changements observsdanslexpressiondesgneschezunMSSentran
in vivo
. Des conditions exprimentales prcises peuvent tre tablies en utilisant PGC1
comme un marqueur de ladaptation des fibres musculaires lAP chronique dendurance
(
Burch et al. 2010
)
. Chez des myotubes humains en culture, aprs 24 ou 48 h de
stimulation EPS chronique, basse frquence, Nikoli et al. ont galement observ des
changements dans les niveaux dexpression de plusieurs gnes. Leniveaudexpressionde
lARNm de la PDK4 est augment significativement. Cela implique une augmentation du
lactate partir de laction de la lactate dshydrognase (LDH) surlepyruvatequi nestplus
transform en actylcoA cause de linhibition de la pyruvate dshydrognase par la
PDK4. De plus, Nikoli et al. ont montr que chez des myotubes humains avec un
programme EPS chronique de basse frquence, lexpressiondesARNmdelIL6,duCYCS
et de CPT1B ont galement tendance augmenter
(
Nikoli et al. 2012
)
. En revanche,
lexpression des gnes des transporteurs de glucose GLUT1 et GLUT4 ne semblepastre
affecte.Il apparatainsiquelEPSchroniquedebasse frquenceaugmentelemtabolisme
oxydatif des myotubes en culture sans augmenter le mtabolisme glycolytique. Cette
variation mtabolique se retrouve galement
in vivo quand les MSS sadaptent une AP
dendurance chronique. Il est ainsi possible den conclure que, daprs lexpression de ces
diffrents marqueurs, les paramtres EPS utiliss par Burch et al. chez des myotubes
murins C2C12 et par Nikoli et al. chez des myotubes humains permettent de mimer lAP
chronique dendurance. Lambernd et al. de leur ct ont utilis lAMPK et lIL6 comme
marqueurs de ce mme type dAP afin destimer lameilleurefrquencedestimulationentre
0,1, 1 et 10 Hz permettant de mimer lexercice chronique dendurance pour un mme
voltage(11,5V)et duredimpulsion(2ms)
(
Lambernd etal.2012
)
.Cesdeuxfacteurssont
dailleurs lis, puisque lexpression dAMPK est rapidement augmente en prsence dIL6
(
Raschke et Eckel 2013
)
. Daprs lexpression de ces marqueurs, la frquence la plus
favorablesembletreplusprochede1Hzquedesautresvaleurstestes
(
TableauVIII
)
.

Par ailleurs, il est observ une augmentation du niveau dexpression relatif des
gnes codant pour les protines impliques dans limportation des acides gras et la
oxydation, ainsi que ceux impliqus danslabsorptionduglucoseetdanslaconversiondu
pyruvate en actylcoenzymeA(actylCoA).Celasuggrequelafonctionmitochondrialeet
la disponibilit du substrat sont augmentes chez les myotubes C2C12 en culture stimuls
par EPS. Cet effet est galement observ dans le MSS entran. Une expression
augmente de la glycogne synthase (GYS) dans des cellules aprs un programme EPS
reflte aussi les effets de lAP
in vivo
. Une synthse de glycogne augmente contribue
reconstituer et augmenter son stockage dans le muscle entran
(
Burch et al. 2010
)
. Par
consquent, le profil dexpression des gnes chez les myotubes C2C12 stimuls par EPS
suggre un vaste remodelage mtabolique, comme ce qui est observ
in vivo chez le
muscle entran. Effectivement,
in vivo
, la contribution relative de loxydation des acides
gras la demande nergtique globale est augmente chez les sujets sains qui excutent
une AP dintensit modre. De plus, il semble que lAP rduit la dpendancevisvisdes

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
33

hydrates de carbone comme source dnergie et augmente en contrepartie la oxydation


des acides gras
(
Nikoli et al. 2012
)
. Tandis que lexpression des gnesimpliqusdansle
mtabolismedterminelutilisationdes substrats,dautresparamtresdelafibre musculaire,
comme la vitesse de contraction et la gnration du pic de force, sont contrls par des
protinesmyofibrillairestellesquelesisoformesdelaMyHC.

Les travaux de Nikoli et al. ont montr quen stimulant intensment et


ponctuellement des myotubes en cultureavecunprogrammeEPSaigudehautefrquence,
labsorption de doxyglucose (2DG) ainsi que la production de lactate sont augmentes,
tandis que les contenus entre ATP et PCr sont diminus
(
Nikoli et al. 2012
) (
Tableaux
3
et
VII
)
.Enstimulantmodrmentetencontinu desmyotubesencultureavecunprogramme
EPS chronique basse frquence durant 24 ou 48h, leurs capacits oxydativessontaccrues
via une augmentation du mtabolisme oxydatif du glucose et de la vitesse doxydation
complte des acides gras, comme lacideolique.Enrevanche,toujourschez Nikoli etal.,
labsorption dacide oliquesembleresterinchangeaprs48hdestimulationEPS
(
Nikoli
et al. 2012
)
,alorsquilatdmontrailleursquelAPpermetdaugmenterlabsorptiondes
acides gras chez lHomme. Lesmcanismesmolculairesimpliqusdanscettelvationde
consommation ne sont manifestement toujours pas bien dfinis puisque des incohrences
persistent. Ces dernires sont dues labsence de standardisation dans les dure et les
intensitsdesprotocolesEPSmisenplaceparlesdiffrentesquipesderecherche.

En outre, aprs 48 h, ces changements fonctionnels dans les processus


mtaboliques saccompagnent par un doublement du contenu des myotubes en
mitochondries mesur sur des cellules vivantes par microscopie avec un colorant
fluorescent. Cet accroissement du volumeetdunombredemitochondriesestaussiobserv
in vivodanslesMSSavecunentranementdendurancechronique.Cedernierrsulteraitdu
cumul des augmentations transitoires en ARNm transcrits codant pour des protines
mitochondriales, suite des sancesdAPchroniquerptes.Toutefois,laugmentationdu
volume occup par les mitochondries semble ne pas tre accompagn duneaugmentation
de lactivit enzymatique aussi rapide. Effectivement, lactivit de la citrate synthase (CS) a
tendance tre amplifie, sans pour autant tre significative
(
Nikoli et al. 2012
)
. Les
travaux de Nikoli et al. montrent que, bien que lARNm de laCSaugmentetrsttdansle
programme EPS chronique, basse frquence, lactivit de cette enzyme naugmente que
bien plus tard. Il apparat quen gnral, les salves transitoires et rptes dARNm sont
produites ds les premiers moments du programme EPS, avant laugmentation de lactivit
des protines mitochondriales. Toutefois, lampleur des rponses des diffrentes protines
mitochondriales et facteurs transcriptionnels varie considrablement selon le moment du
programme EPS. Ainsi, labsence daugmentation significative de lactivit de la CS aprs
seulement 48 h de stimulation pourrait tre en accord, ou du moins reflter la complexit
temporelle des diffrents vnements molculaires qui senchanent durant la biogense
mitochondriale
(
Nikoli et al. 2012
)
. Un temps de stimulation suprieur 48 h serait ainsi
ncessairepourmenertermeceprocessus.

Le motifdexpressiondesgnesobtenuaprsunprogrammeEPSsurdesmyotubes
sest montr qualitativement trs proche de celui du muscle entran
in vivo avec une
intensit modre, mais pas decelui dumuscleentranavecuneintensitaigu
(
Burchet

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
34

al. 2010
)
. De toute vidence, une session unique de stimulation EPS sur les myotubes en
culture ne permet pas de rendre compte de la complexit et de ladaptation du MSS au
cours du temps avec lAP
in vivo
. Il est galement important de noter que ladaptation du
muscle lentranement chronique confre bien plus de bienfaits pour la santquecelledu
musclelexerciceaigu.

Gogh et al. sont alls vrifier si les effets delEPSsurlesmyotubesC2C12,comme


la scrtion de myokines telles que lIL6 etlactivationdelAMPK parphosphorylation,sont
bien causs par les contractions et nondes changements danslemilieudeculture
(
Gogh
et al. 2015
)
. Il ressort de leur tude que ces effets sont bien dus principalement lactivit
contractile. Ainsi, la stimulation EPS resterait une mthode pertinente pour mimer lAP.
Cependant, Gogh et al. ont galement observ un effet du milieu stimul par EPS sans
myotubes sur une ligne dhpatocytes. Cette observation amne des interrogations
concernant un biais potentiel. Aucun article ne sest encore pench sur un effet du milieu
contenant les myotubes sur des tumeurs ou des lignes de cellules tumorales. Ces
observations indiquent quil convient de rester prudent et de construire les protocoles de
faon toujours prendre en compte les modifications indpendantes des myotubes, par
exemple en utilisant un MC sans myotubes comme contrle exprimental si lon tudie les
effets dun MC contenant un scrtome de myotubes lectrostimuls sur des lignes de
cellulestumorales.

3.5. LimitesrencontresdanslesmodlesEPS
Il yaunintrtimportantexplorerlesdiffrentesmthodesdlectrostimulationet
largir nos connaissances sur les phnomnes cellulaires qui en rsultent. Cependant,
comme lont rcemment soulign Xiong et al.,lesprogrs danscedomainesontlents,etce
pour diffrentes raisons. Dune part, les techniques et les paramtres destimulationutiliss
jusqualors nont pas t standardiss. Dautre part, les approches actuelles reposent sur
lutilisationdlectrostimulateursfaibledbitavecunefaiblevariabilitdefrquence
(
Xiong
etal.2015
)
.Alavenir,cetypededispositifdevraitconnatreencorecertainesamliorations.
Certaines perspectives en particulier paraissent particulirement intressantes. Comme le
fait de pouvoir envisager combiner EPS et stretch mcanique, EPS et hypoxietemporaire
(
Burch et al. 2010
) ou encore EPS et construction tridimensionnelle mimant la MEC. Ces
diffrentesavancesdevraientcontribueramliorerlimitationdelenvironnementcellulaire
in vitro
, afin que les conditions de culturedesmyotubesserapprochentle pluspossibledes
conditions
invivo
.

LesprotocolesEPSaigusdehautefrquenceactuellementdveloppsprsententle
dsavantage dtre rapidement dltres pour les myotubes. De ce fait, il est prfrable
dajouter des temps de rcupration dans les sessions de ces programmes. Ce dlai de
2+
rcupration a pour objectif de permettre la restauration des stocks de calcium (Ca
) dans
les rticulums sarcoplasmiques et de prserver ladhrence des myotubes aumilieuoula
surface de culture. Orfanos et al. ont fix de dlai 5 secondes
(
Orfanos et al. 2016
)
(
TableauVI
)
.

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
35

In vivo
, Les niveaux dexpression des gnes desMyHCsontutilisspour classerles
fibres musculaires en diffrents types
(T
ableau IX
)
. Bien que la proportion relative de ces
types de fibres soit en majeure partie rgule par les motoneurones, dautres facteurs
rgulateurs existent, comme des prdispositions gntiques et des phnomnes
dimpregnation gnomique parentale due la mthylation diffrentielle de lADN
(
Burch et
al. 2010
)
.Cependant,leslignesdecellulesmusculairescultives
invitroneprsententpas
des profils dexpression des isoformes de MyHC permettant de les classer dans ces
diffrents types. Cette absence de typologie
in vitro serait due labsencedinnervationpar
les neurones moteurs. LEPS permettrait de se substituer partiellement ces derniers. En
effet, une augmentation de lexpression de certaines isoformes de MyHC chez des
myotubes C2C12 stimulsparEPSatobserve
(
Burchetal.2010
)
.Demme,chezdes
myotubes humains, Nikoli et al. ont valu les effets de la stimulation EPS chronique,
basse frquence sur lexpression des marqueurs des fibres musculaires de type lentes et
oxydatives (ST), lisoforme de la MyHC (MyHC/lent), et des fibres musculaires de type
rapides et glycolytiques (FT),lesisoformesIIdelaMyHC(MyHCII).Dans cesconditionsde
stimulation, Lexpression de la MyHC est augmente etcelledesMyHCIIestdiminue.Il
en rsulte donc que leratiodesniveauxdARNmdeMyHCsurMyHCIItendaugmenter
dans ce type de programme. Au bout de 24 ou 48 h dlectrostimulation, lexpression de
MyHC a t augmente de 45%
(N
ikolietal.2012
)
.Ilconviendraitdavoirgalementce
types de donnes chez des myotubes murins C2C12, et aussi pour des programmes EPS
aigusdehautefrquence.

Ces donnes suggrent quavec un protocole EPS adapt, par exemple avec des
stimulations lentes, rapides, continues ou sporadiques,certainstypesdefibrespeuventtre
favorissdanscescellulesenculture.Toutefois,lEPSseulnesemblepastrepassuffisant
pour orienter totalement les myotubes vers telle ou telle typologie. Nanmoins, lEPS peut
aussi tre envisage en combinaisonavecdautresapprochestellesquelajoutdextraitsde
muscles lents ourapides,oubienencorelapplicationdunlgerstressthermiqueencontinu
(
Burch et al. 2010
)
.Demme,placer lesmyotubeslectrostimulerencocultureavecdes
motoneurones pourrait tout aussi bien jouer sur la typologie et renforcer par la mme
occasion la comparabilit du modle avec le muscle
in vivo. La stimulation EPSdecellules
musculaires pourrait ainsi tre utilise pour tudier les proprits spcifiques des diffrents
types de fibres musculaires. Ces apports et ces modificationssurlemodleEPSpourraient
permettre daugmenter lactivation des diffrentes voies de signalisation qui convergent sur
PGC1 dans le muscle entran. Cette augmentation dactivation pourrait tre teste en
quantifiant lactivation decesvoiesdesignalisation,commelaphosphorylationdelAMPKet
desesciblescellulaires.

En plus de labsence dinnervation et dactivation par les motoneurones, dautres


stimuli impliqus dans ladaptation lentranement, comme le milieu hormonal, sont
galement absents. Dautre part, les niveaux des protines enzymatiques et des facteurs
fonctionnels qui sont utiliss comme marqueurs, comme par exemple ceux impliqus dans
la phosphorylation oxydative, i.e. lATP synthase (ATPsyn), le complexe I de la chane
respiratoire (NADHCoenzyme Q oxydorductase) et le complexe IV (Cytochrome c
oxydase), peuvent diffrer entre les myotubes en culture et le MSS
in vivo
(
Burch et al.
2010
)
.

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
36

Pour conclure, la stimulation EPS de myotubes en culture ne permet pasdereflter


totalement la complexit de ladaptation du MSS lAP
in vivo et au cours du temps.Cette
complexit rend rudimentaire la comprhension actuelle des processus molculaires
impliqus dans la plasticit des fibres musculaires, de leur capacit procder un
remodelage de leur cytosquelette ainsi que du contenu en isoformes de protines
spcifiques en rponse des changements de type ou de taux dactivit. Labsence
dactivation neuronale et dhormones constituent galement des biais importants qui
empchent de transposer au
in vivo les observationsfaites
invitro
.Lesniveauxoulestats
dactivation des protines tudies par mthode immunoenzymatique ELISA ou
WesternBlot(WB)diffrentainsibiensouvententrele
invivo
etle
invitro.

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
37

Synthseetobjectifs
Synthse:
La littrature scientifique nous indique que lAP, quelle soit chronique et dintensit
modre ou ponctuelle et de haute intensit, peut tre mime
in vitro grce au systme
EPS. Cette approche rend possible la ralisation dtudes plus pousses sur le scrtome
des MSS lexercice ainsi que sur les diffrents mcanismes molculaires mis en jeu.
Toutefois, une absence de standardisation dans les techniques et les paramtres de
stimulation et des conditions trop diffrentes entre le
in vivo et le
in vitro empchent de
transposer les observations dun modle un autre. Diffrentes solutions onttformules
et pourront sans doute sappliquer lavenir, comme le fait de coupler lEPS de la
contrainte mcanique et un Matrigel. Ce manque de standardisation se retrouve
galement dans le choix des milieux de croissance et de diffrenciation, ainsi que des
srums et des temps de diffrenciation. Avant de dbuter leprotocoleEPS,Ilapparatainsi
essentiel de vrifier que les modalits de culture et de diffrenciation choisies permettent
bienunecompltediffrenciationdesmyocytesenmyotubes.

Selon le type de programme EPS appliqu, les myotubes C2C12 peuvent tre
utilisspourobtenirunscrtomecomposdediffrentesmyokines.Cescrtome,une fois
isol, pourrait tre utilis commetraitementsurdeslignesdecellulestumoralesenculture,
comme le carcinome du clon murin C26 ou encore des modles de cancers du sein
murins. Cela permettra ainsi dtudier ses effets sur diffrents cancers ainsi que les
mcanismes molculaires impliqus. De plus, au regard des bienfaits des diffrents types
dAP contre les cancers, ladaptation du muscle lAP chronique dintensit modre
soutenue confre bien plus de bnfices que celle du muscle lAP aigu dintensit
soutenue. Il ressort ainsi de la revue delittraturequelescrtomedontltudeprsentele
plus grand intrt visvis des cancers est celui qui se retrouve lorsque de lAP chronique
dintensit modre est mime. De plus, les prcdentes tudes indiquent galement quil
est plus facile de russir retrouver par stimulation EPS
in vitro les biomarqueurs
caractristiquesdumuscleentrandemanirechroniqueenintensitmodre queceluidu
muscle entran de faon aigu avec une intensit soutenue. Ces constats rendent
nettement plus intressant le fait de dvelopper en priorit un programme EPS capable de
mimer lAP chronique dintensit modre etseseffetssurdesmyotubesmurinsC2C12.La
protine PGC1, le ratio de MyHC1 sur MyHC2a, lactivation de lAMPK ainsi que la
synthse et la scrtion dIL6 pourraient alors tre utiliss comme des biomarqueurs
permettant de dterminerquelactivitdecontractionproduitecorrespondbienautypedAP
quelonsouhaiteimiter.

Objectifs:
Lobjectif principal de ce mmoire est de mettre en placeunmodleEPSinvitrosur
des myotubes qui soit lepluspossiblecapabledemimerlAPchroniquedintensitmodre
et ses effets
in vivo
. A terme, cela dans le but de rcuprer le scrtome des myotubes et
tudier ses effets. Il est possible de complter cet objectif en remplissant deux
sousobjectifs. Dune part, en tablissant une mthode permettant de vrifier que les
myotubes que lontsouhaitelectrostimulersontcompltementdiffrenciset sontcapables
davoir unerponsecontractile.Dautrepart,envrifiantquelesmodificationsinduitesparle
programmeEPSchoisirefltentbienleseffetsdelAPquelonsouhaiteimiter.

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
38

Protocolepropos
Cette partie rend compte du matriel, des mthodes ainsi que des modalits des
manipulationsenvisages.Pourlemomentils'agitdoncdansunpremiertempsdetenterde
reproduire les effet dune AP chronique dintensit modre dans un modle de stimulation
EPS de myotubes en culture. La prsenceounondeceseffetsesttudiepardtectionde
diffrents biomarqueurs intrinsques ouextrinsquesprcdemmentvoqusdanslarevue
delittrature.

Figure4:Designdeladmarcheexprimentale

1.

Culturecellulaire

Les myocytes murins C2C12 sont obtenus auprs de ATCC (


CRL1772
) et sont
cultivsdans500mldemilieudecultureDMEM(4,5g/ldeglucose345ml
SigmaAldrich
)
additionn de 20% de FBS (200 g/ml 100 ml Gibco)
(
van der Schaft et al. 2013
)
,
de
P/S (10% 100 g/ml 50 ml
ATCC
)
(G
oghetal.2015
)etdeLglutamine(1%10g/ml
5 ml
SigmaAldrich
) lintrieur duneflasque de25cm (Corning)etmaintenus37Cen
atmosphre humide contenant 5%deCO
.Lescellulessontcultives ainsijusquatteindre
2
90%deconfluenceetlemilieuestchangtoutesles24h
(
Burchetal.2010
)
.

Les cellules sontensuitercoltesparajoutdunesolutiondetrypsineEDTA(


Gibco
)
et centrifuges 1 000 rpm
(v
an der Schaft et al. 2013
)
. Elles sont repiques dans une
2
plaque de culture 6 puits de 35 mm de diamtre et 8 cm
desurface(CDish,IonOptix).Un
milieu de diffrenciation vient remplacer le milieu de croissance. Ce milieu est galement
compos de DMEM et complment avec du HS (2% 20g/ml Gibco/Life Technologies)

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
39

(
Burch et al. 2010
) de la P/S (10%), et de la Lglutamine (1%). La diffrenciation dure 6
jours et le milieu de diffrenciation est chang toutes les 24 h. Aprs la phase de
diffrenciation, les myotubes sont laisss reposerdansunmilieuDMEMsansaucunsrum
pendant une nuit, puis le lendemain le milieu sans srumestrenouveljusteavantledbut
duprotocoleEPS
(
Goghetal.2015
)
.

Figure5:ProtocoledecultureetdediffrenciationdesmyocytesC2C12

2.

Vrificationdeladiffrenciationdesmyoblastesen

myotubes
Dans un premier temps, il convient de sassurer la fin de ltape dediffrenciation
que le mode de culture et de diffrenciation mis en place permet bien une complte
diffrenciation des myoblastes en myotubes. Pour ce faire, un chantillon delysatcellulaire
total est rcupr et la quantit des protines impliques dans le processus de maturation
musculaire (MyoD, Myf4, Myf6, MLP, MYH 1, 2, 4 et 8) est value par WB. Les valeurs
trouves sont compares aux valeurs dun groupe contrle de myocytes en culture non
diffrencis.

Si les rsultats de ces WB sont bien ceux attendus, il serapossibledallerconfirmer


ounoncestendancesenutilisantuneautrepartiedulysatcellulairetotaldesmyotubes
pour
raliser des RTqPCR afin dtudier
les niveaux dexpression des ARNm des gnes deces
protines. En revanche, si les rsultats obtenus ne sont pas ceux escompts, il conviendra
de revoir les modalits de culture et de diffrenciation avant de dbuter les expriences de
stimulationEPS.

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
40

Cette diffrenciationcomplteestgalementcensesecaractriserparunerponse
contractile des stimuli lectriques. Ainsi, cette rponse contractile peut aussi
ventuellement tre vrifie par examen au microscopedurantunelectrostimulation,selon
leprotocoledeSilveiraetal.
(
Silveiraetal.2006
)
.

3.

StimulationEPS

Les myotubes sont sparsen2groupesrpartisen2plaquesdeculture6 puits,un


groupe avec stimulation EPS sur une plaque quipe dlectrodes encarboneetungroupe
contrle sur une plaque sans lectrodes. Le programme EPS choisi permetdimiteruneAP
de type modre et chronique sur les myotubes C2C12, daprs les lments analyss et
compars dans la revue de littrature, il conviendrait de sorienter vers une
lectrostimulation en continu durant 48 h ou 72 h afin de laisserletempsauxchangements
enzymatiques mitochondriaux de se mettre en place
(
Nikoli et al. 2012
)
. Lintensit de
voltage qui semble la plus adapte pour ce type de stimulation apparat tre compris entre
11,5 V
(
Lambernd et al. 2012
) et 14V
(
Gogh et al. 2015
)
, une frquence de 1 Hz
(
Lamberndetal.2012
) etuneduredimpulsionde2ms
(
Lamberndetal.2012
)
.LeMCet
les myotubes sont rcuprs juste aprs llectrostimulation. Les cellules sontdtacheset
lyseslaidedungrattoiretdunesolutiontrypsineEDTA(Gibco).

4.

AnalyseducontenudesmyotubesetduMCaprs

stimulationEPS
Suite la stimulation EPS, le MC et les myotubes sont rcuprs sparment. Les
cellules sont dtaches de la plaque et lyss par friction laide dun grattoir dans un
tampon de lyse (PBS 0,2 X Triton X100 1%). Le MC est centrifug, puis plac en
conglation 80C. Les chantillons de lysat cellulaire total obtenus sont utiliss pour
raliser des WB et des RTqPCR. Cex expriences permettent dtudier les concentrations
relatives et lexpression des gnes des diffrents marqueurs intrinsques que lon sait
augments en rponse une AP chronique de dintensit modre Dautres chantillons
sont aussi utiliss pour mesurer lactivit de lenzyme CS. Le MC estquantluiutilispour
raliserdestestsELISA.

Les WB visent dterminerlaconcentrationrelativedePGC1


(
Burchetal.2010
)
,
de la protine mitochondriale CS
(
Nikoli et al. 2012
)
, le ratio des protines MyHC1 /
MyHC2a
(
Nikoli et al. 2012
) ainsi que lactivation de lAMPK par phosphorylation sur sa
Thronine 172
(
Lamberndetal. 2012
).
Lamthodeimmunoenzymatique ELISApermetde
dterminer la concentration dIL6 dans le MC
(
Lambernd et al. 2012
)
. Enfin, laRTqPCR
permetdtudierlesniveauxdARNmdesgnesdecesdiffrentesprotines.

4.1. DtectionetdosagedelIL6parmthodeELISA
La mthode la plus approprie pour dtecter et doser une protineprsentedansle
MC nest pas la mthode WB mais la mthode ELISA. La scrtion dIL6 dans le MC par
les myotubes est ainsi tudie par mthode ELISA sandwich
(
Lambernd et al. 2012
)
.
Comme dans le protocole de Gogh etal.,unkitELISAdirigcontrelIL6murine(KMC0062

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
41

Gibco) est utilis. Les manipulationsetlesmesuressonteffectuesensuivantleprotocole


donnparlefournisseur.

Un anticorps (Ac)decapturedelIL6estdilu(
ab7737Abcam
)dansuntamponde
revtement une concentration de 0,58 g/ml.100ldedecettesolutionestajoute dans
chaque puit dune plaque 96puits.Laplaqueestscelleetlaisseincuberdurantunenuit
4C, puis ramene temprature ambiante et la solution contenant les Ac de capture
toujours non fixs est retire. Aprs 3 lavages laide dune solution PBS/Tween, 200 l
dune solution deblocagesontajoutsdanschaquepuits.Laplaqueestdenouveauscelle
et laisse incuber temprature ambiante pendant environ 1 h puis relave 3fois.Aprs
dilution la concentration dsire dans une solution de blocage, la solution standard et les
chantillons sont alors ajouts par volume de 100 l dans les puits, en duplicat ou en
triplicat. La solution standard est dilue en srie afin de gnrer une courbe de dilution
standard qui sert de gamme talon. La plaque est scelle et incube temprature
ambiante pendant 24 heures sous agitation. La plaque est nettoye 35 fois avec une
solution PBS/Tween, puis un Ac de dtection (
ab84270 Abcam
) marqu la biotine est
dilu dans le tampon de blocage, uneconcentrationcompriseentre0,25et1g/mlet100
l sont ajouts dans chaque puits. La plaque est de nouveau scelle et incube
temprature ambiante pendant 1 heure, lave 35 fois avec une solution de PBSTween,
puis de la HRP complexe lavidine (AvHRP
Biolegend
) dilue dans du tampon de
blocage est ajoute raison de 100 l par puit. La plaque est scelle et incube
temprature ambiante pendant 1 heure, nettoye 35 fois avec une solution PBS/Tween,
puis 100 l du ractif TMB (6 ml de ractif A et 6 ml deractifB mlangsjusteavant)est
ajout dans chaque puits et laiss incuber temprature ambiante durant 430min,afinde
laisser le temps la solution de se colorer sous leffetdesractifs.Enfin,100ldesolution
Stop sont ajouts dans chaque puits(2NH
SO
PO
).Ladensitoptique(DO)
2
4ou 1 MdeH
3
4
est lue pour chaque puits avec un lecteur de microplaque configur pour une lecture 450
nm.

4.2. Mesuredelactivitenzymatiquedelacitratesynthase
Les expriences de WB et de RTqPCR napportent que des information
quantitatives sur la CS. Elle ne rendent en aucun cas compte de son activit enzymatique.
Or, comme rapport dans la revue de littrature, laugmentation des protines
mitochondriales nest pas accompagne dune augmentation aussi rapide de leur activit.
Ce dcalage entre niveau dexpression et activit est particulirement marqu dans le cas
de la CS
(
Nikoli
etal.2012
)
.Cestpourquoiilconviendraitgalementdetesterlactivitde
cette enzyme en plus des expriences prcdemment dcrites. Ce test permettra ainsi de
complter les donnes sur leffet du programme EPS sur la concentration et le
fonctionnementdesmitochondries.

Lactivit de la CS est value par mesure sur spectrophotomtre en utilisant un


ractif, le ractif dEllman (DTNB) qui colore la solution au contact de la CoASH, lun des
produits de la raction catalyse par la CS. Le coefficient dextinction molaire utilis pour
dtecter le complexe CoASHDTNB 412 nm est de 13,600 l.mol1.cm1. La solution
utilise est compose dun tampon pH trithanolamineHCl (100 nM), deDTNB(100M),de

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
42

dtergent TritonX (0.25% vol/vol), des substrats de la CS, i.e. loxaloactate (0.5 mM) et
lactylCoA (0.31 mM) avec un pH ajust 8,0. 10ldelysatcellulairetotalet990ldela
solution de raction sont ajouts et homogniss dans une cuve de spectrophotomtre.
Les valeursdabsorbancesontmesurestoutesles15spendant3minafindedterminerle
pic dactivit de la CS. La vitesse initiale (V0) de la CS peut galement tre dtermine
des concentrations de substrats choisies diffrentes et en mesurant labsorbance (DO)
toutes les 5 sec. Touteslesanalysessontmenesune temprature ambiantede21C.La
CS cardiaque porcine (C3260 200UN, SigmaAldrich, UK) est utilise comme talonpour
lacalibrationduspectrophotomtre.

5.

DosagedesprotinesetWesternBlots

La concentration des protines dans les chantillons de lysat cellulaire est dabord
dtermine laide de la mthode de Bradford. Cette mthode est base sur la raction
colorimtriqueentrelebleudeCoomassieetlesprotines(BioRad).Laformecationiquedu
ractif est rouge/brun alors que la forme anionique tend vers le bleu et possde un pic
dabsorption maximale autour de 595 nm. Une gamme talon est cre laide dune
solution BSA. Aprs avoir dpos 200 l dchantillon en triplicats puis laiss incuber la
plaque 96 puits durant 10 min, labsorbance est mesure 595 nm sur un lecteur
microplaque.

Anticorpsprimaire

Hte Dilution

Rfrence

antiPGC1

Lapin 1/1000

sc13067

SantaCruz

AntiCS

Lapin 1/1000

#14309CellSignaling

AntiMyHC

Lapin 1/500

ab173366Abcam

AntiMyHCIIa

Lapin 1/10000 ab124937Abcam

antiPhosphoAMPK(
Thr172
) Lapin 1/1000

#2531CellSignaling

AntiMyoD

Lapin 1:1000

sc304SantaCruz

AntiMyf4

Lapin 1/1000

ab82843Abcam

AntiMyf6

Lapin 1/1000

ab82842Abcam

AntiMLP

Lapin 1/1000

PA529155Gibco

AntiMyHCIIb

Lapin 1/2000

MP4541ECMBioSciences

AntiMyHCpn

Lapin 1/1000

LSC336250LifeSpanBioSciences

Tableau4:AnticorpsprimairesutilisspourlesWB

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
43

A partir de l, un volume dchantillon de lysat cellulaire correspondant 150 gde


protines totales est dpos et spar sur un gel dnaturant de polyacrylamide 12,5%
(SDSPAGE) aprs avoir t mlang untampondedpt.Unefoislamigrationtermine
et le transfert sur membrane de nitrocellulose ralis, cette dernire est bloque laide
dune solution de TBSTL compose de TrisHCl (50 mM pH 8), de NaCl (150 mM), de
Tween 20 (0,1% SigmaAldrich) et de lait crm (8% Rgilait) durant1htemprature
ambiante. Aprs cette tape de saturation, les protines dintrt sont hybrides avec des
Ac primaires, 4C sous agitation. Les Ac primaires sontdilusdansduTBSTL
(
Tableau
4
)
. Un marquage de la protine de mnage ubiquitaire glycraldhyde3phosphate
dshydrognase (GAPDH), dont la concentration est reconnue comme inchange quelles
que soient les circonstances, permet de servir de contrle interne et de normaliser les WB
entreeux(
antiGAPDHLapin1/2,500ab9485Abcam
).

Aprs trois rinages successifs de 5 min de lamembranedansduTTBS1Xpourla


dbarrasser de la solution contenant les Ac primaires, elle est de nouveau incube durant
45 min en prsence dun Ac secondaire coupl la HRP (mouse antirabbit IgGHRP
sc2357 Santa Cruz) dilu dans du TBSTL. La membrane estensuitedenouveau rince
3 fois et les bandes immunoractives contenant les protines dintrt sont rvles par
imagerie infrarouge avec le systme Odyssey LICOR (Biosciences).
Les valeurs trouves
sontcomparesauxvaleursdungroupecontrledemyotubesnonlectrostimuls

Ces analyses viennent complter la dtection dIL6 dans le MC par ELISA. En


considrant que les rsultats obtenus pour les expriences de WB et dELISA soient bien
ceux attendus, il sera alorspossibledeconfirmerqueleprogrammeEPSutilispermetbien
dimiter lAP chronique dintensit modre. Dans un tel cas de figure, pour aller plus loin
dans lanalyse, et confirmer ou non les tendances observes par ces mthodes, une autre
partie du lysat cellulaire total des myotubes peut tre utilise pour tudierpar RTqPCR
les
niveauxdexpressiondesARNmdesgnesdecesmmesbiomarqueurs.

7.

RTqPCR

Les ARN totaux des myotubes sont extraitsenutilisantduractifTRIzol(Invitrogen


400 l). En premier lieu, la quantit et la qualit de ces ARN totaux sont mesurs avec un
spectromtre NanoDrop ND1000 et son integrit est vrifie par lectrophorse sur gel
dagarosednaturantclassique.

A partir de l, des RTqPCR sont ralises afin dtudier lexpression relative des
ARNm des diffrents gnes que lon sait augments en rponse une AP chronique de
basse intensit. La transcription inverse est ralise sur 1 g des ARNtotauxenutilisantla
transcriptase inverse (RT) SuperScript II (Gibco) ainsi que des amorces oligo(dT) (Gibco)
en prsence de nuclotides (nt). Les PCR effectues parlasuiteutilisent chacune0,5lde
lADNc obtenu par rtrotranscription des ARNm. Ce volume est ajout une solution
contenant galement du tampon PCR 10X (5 L), du mix dNTP (2 l dATP, dTTP,dCTP,
dGTP), les amorces sens (2 l) et antisens (2 l) et lenzyme Taq polymrase de lADN
(GoTaq) mlange son cofacteur enzymatique MgCl2 (0, 25 l). Cette solution est

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
44

complte 50 l avec de l'eau milliQ dans un tube eppendorf de 500 l, vortexe puis
placedansunthermocycleur.

Le nombre de cycles, leur dure et leur temprature varient selon les amorces
utilises. Les squences de ces amorces pour la partie amplification par PCR sont
prsentes dans le tableau cidessous
(
Tableau 5
)
. Les niveaux dexpression sont
normaliss partir de lexpression de 2 gnes de mnage, HPRT1 et RPLPo. Les produits
de PCR sont dtects aprs lectrophorse sur gel dagarose par coloration de lADN au
bromure d'thidium. Les valeurs trouves sont compares aux valeursdungroupe contrle
demyotubesnonlectrostimuls.

Gne

Amorces

IL6

Sens:
5CATCCAGTTGCCTTCTTGGG3
Antisens:
3CCAGTTTGGTAGCATCCATC5

PGC1

Sens:
5AAACTTGCTAGCGGTCCTCA3
Antisens:
3TGGCTGGTGCCAGTAAGAG5

CS

Sens:
5GGAAGGCTAAGAACCCTTGG3
Antisens:
3TCATCTCCGTCATGCCATAGT5

MyoD

Sens:
5ATCCGCTACATCGAAGGTCT3
Antisens:
3CGCTGTAATCCATCATGCCA5

Myf4

Sens:
5CAGTGAATGCAACTCCCACA3
Antisens:
3CGAGCAAATGATCTCCTGGG5

MRF4

Sens:
5CTACATTGAGCGTCTACAGGACC3

Antisens:
3CTGAAGACTGCTGGAGGCTG5

MLP

Sens:
5

TTGGCCCAGAGTCTTCACCATG3
Antisens:
3AGCAGGCAGCTTCACTCCTTC5

MYH1

Sens:
5ATTTCTCTCTCTGCCAGGCA3

Antisens:
3TCAAACTAGCCCCGCAGTG5

MYH2

Sens:
5CTGTACAAAGATCTGCTGT3

Antisens:
3CAAGTCAGCGAGTGACCA5

MYH4

Sens:
5TCTGTCACTCGGTGCTTCC3

Antisens:
3AGGGTTTTTGGAGGCTGTTT5

MYH7

Sens:
5GTGACAACAGCCCTTTCTAAAT3

Antisens:
3CTCCAGCTCCCACTCCTACC5

MYH8

Sens:
5ACACATCTTGCAGAGGAAGG3
Antisens:
3TAAACCCAGAGAGGCAAGTG5

HPRT1

Sens:
5CCTAAGATGAGCGCAAGTTGAA3
Antisens:
3CCACAGGACTAGAACACCTGCTAA5

RPLPo

Sens:
5ACCTCCTTCTTCCAGGCTTT3
Antisens:
3ACCTCTTTCTTCCAAGCTTT5
Tableau5:AmorcesutilisespourlesRTqPCR

9.

Analysesstatistiques

Les bandes dintrt des Western Blot sont quantifies relativement par rapport au
blot de la GAPDH laide du logiciel BIO1D. Ces rsultats sont exprims en moyenne
lerreurstandardlamoyenne(ESM)den=3expriences.Lesdiffrencesentrelesgroupes
de donnes sont analyses laide dun test U non paramtriquedeMannWhitneylaide
du logiciel GraphPad Prism. Une valeur de p infrieure 0,05 est admise pour que les

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
45

diffrences entre les donnes soient considres comme significatives. Les donnes
obtenues par RTqPCR et ELISA sont quant elles analyses en utilisant le testt de
Student (Logiciel GraphPad Prism 5.0 pour Windows, GraphPad Software Inc., San Diego,
CA).

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
46

Rsultatsattendus
Lexpression des ARNm des marqueurs MyoD,
MRF,
Myf4,Myf6,MLP, MYH1,2,4
et 8 devrait tre augmente aprs la diffrenciation des myotubes. Ce qui permettra de
confirmer que les modes de culture et de diffrenciation des myocytes C2C12 qui ont t
choisis sont appropris.
Ensuite, aprs 48 h de stimulation EPS en continu 1 Hz, la
quantit deprotinesPGC1devraittreaugmentesignificativement,commesuggrpar
Burchet al.
(
Burchetal. 2010
)
.Cetteaugmentationdevraitgalementseretrouver chezles
protines IL6
(
Lambernd et al. 2012
)
, CS et MyHC. La quantit desprotinesMyHCIIa
peut galement se montrer augmente, mais le ratio MyHC / MyHCIIa devrait largement
rester en faveur de MyHC
(N
ikoli et al. 2012
)
. La quantit de protine AMPK
phosphoryle sur la thronine 172 sera aussi augmente
(
Lambernd et al. 2012
)
.
Lexpression des ARNm est galement augmente pour les gnes de ces mmes
biomarqueurs, ce qui montre bien que laugmentation des protines est bien lie une
augmentation de lactivitde latranscriptiondeleursgnesetnonuneaugmentationdela
dure de vie des protines tudies. Qui serait due par exemple une diminution de la
dgradation par lesystmeubiquitineprotasome.Demme
,commesuggrparNikoli et
al., lactivit de la protine mitochondriale CS apparat tre plus forte, mais cette
augmentation est moins marque que celle de sa concentration intrinsque
(
Nikoli et al.
2012
)
.

Toutefois ces donnes ne permettent aucunement de savoir si laugmentation de la


quantit denzymes et de lactivit mitochondriale est accompagne dune augmentation du
nombre ou du volume des mitochondries. Il existe une autre approche, base sur de
limagerie par microscopie confocale couple lutilisation dun marqueur fluorescent
spcifique des mitochondries actives (MitoTracker rouge FM)
(
Nikoli et al. 2012
)
, qui
permettrait dvaluer la quantit de mitochondries et leur activit. Il pourrait ainsi aussi tre
pertinent de ralisercetypedobservationsurlesmyotubesvivantsaprslectrostimulation,
maiscelanestpasenvisagpourlemoment.

Laugmentation du ratio MyHC / MyHCIIa reflterait une adaptation de typologie


des fibres musculaires qui tend vers une augmentation de la proportion des fibres ST par
rapport aux fibres FT. Cette adaptation se retrouve galement chez les MSS sous leffet
dune AP chronique dendurance. De plus, la hausse dAMPK active et de PGC1
suggrerait une augmentation de la biogense mitochondriale dans les myotubes. Ce
constat serait alors renforc par laugmentation de la quantit de lenzyme mitochondriale
CS, dont lactivit serait galement augmente. Ces variations dexpression tant les
mmes que cellesobservesdansladaptationdesMSSlAPrptedintensitmodre,
ces donnes devraient permettre de confirmer que le protocole EPS permet de mimer les
effets de ce type dAP. En revanche, si les rsultats obtenus ne sont pas ceux attendus, il
conviendra de revenir sur le choix des paramtres de stimulation EPS avant de pouvoir
poursuivreplusloinetdenvisagerdeconstruireunprojetautourdeceprotocoleEPS.

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
47

Conclusionetperspectives
Les effets du scrtome sur diffrentes lignes de cellules cancreuses pourraient
faire lobjet dtude ultrieures. En particulier en se penchant sur les rles de lIL6, de
SPARC et dOSM. Par exemple il serait possible dtudier les effets dun scrtome
contenant SPARC sur des lignes de cellules tumorales de carcinome du clon, comme
C26. En observant en particulier des paramtres tels que la prolifration ou le processus
mtastatique. Toutefois, ces modles de cellules tumorales en culture ne permettent ni
ltude de la MEC ni de langiogense. Ainsi les effets de SPARC surleremaniementdela
MEC
(
Lindner et al. 2015
) ne peuvent pas tre abords. Cette limite empche galement
de pouvoir se pencher sur les effets dautres myokines sur les cancers quisontmdispar
des modifications du microenvironnement tumoral, comme cest par exemple le cas pour la
protine CHI3L1
(
Ost et al. 2016
).
Visvis du cancer du sein, on peut sinterroger sur les
effets combins des myokines SPARC et OSM. Par exemple, sur un modle murin de
cancer du sein, en allant comparerleseffetsdunscrtomeavecunratio[SPARC]/[OSM]
faible par rapport aux effets dun scrtome avec un ratio [SPARC] / [OSM] lev. Il esten
thorie possible dobtenir ces variations de ratio avec diffrents paramtres de stimulation
EPS. Plus on tend vers une stimulation aigu de haute frquence, plusSPARCdevraittre
prsent et plus on tend vers une stimulation chronique de basse frquence, plus OSM
devrait tre produit et scrt. Ces effets pourraient tre tudis surdeslignesdecellules
de cancer du sein chez la souris, comme 4T1ouE0771.Ilconviendraitgalementdtudier
les interactions et effets potentiels de SPARC et de OSM lun sur lautre. Comme voqu
prcdemment dans la revue de littrature, il apparat aussi important de tenir compte des
potentiels effets lis au MC sur les lignes de cellules tumorales quiseronttudies
(
Gogh
et al. 2015
)
. Par exemple en utilisant un MC sans myotubes stimul par EPS comme
contrlengatifdansdefuturesexprimentations.

Il conviendrait galement terme de parvenir transposer ce protocole de


stimulation EPS sur des myotubes humains, comme lont fait Nikoli et al.
(
Nikoli et al.
2012
) afin de pouvoir tudier directement les effets du scrtome sur diffrents cancer
directement chez lHomme. Bien que la comparaison entre llectrostimulation
in vitro
et
llectromyostimulation (EMS) soit difficile, ltude de la composition du scrtome pour
diffrentes AP mimes est galement susceptible dapporter un nouvel clairage sur les
possibilits dapplications de lEMS. De plus, au del de ltude de leffet de diffrents
facteurs lis lexercice physique sur les cancers, ces derniers pourraient galement
permettre de tester de nouvelles approches pour traiter latrophie et les dystrophies
musculaires
(
Burch et al. 2010
).
En dfinitive, ces myotubes lectrostimuls pourraient
constituer un outil essentiel afin de mieux lucider les mcanismes molculaires impliqus
dansladaptationdumusclelAPoulinactivit.

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
48

Rfrencesbibliographiques

Aoi
, Wataru, Yuji Naito, Tomohisa Takagi, Yuko Tanimura, Yoshikazu Takanami, Yukari Kawai, Kunihiro
Sakuma, et al.2013. A Novel Myokine, Secreted ProteinAcidicandRichinCysteine(SPARC),
Suppresses Colon Tumorigenesis via Regular Exercise .
Gut 62 (6): 882
89.
doi:10.1136/gutjnl2011300776.

Bachmann
, Patrick, CdricBaudinet, AudeMarieFoucaut, AnneSophie Kempf,Renaud Meyrand, Sophie
Berthouze,Batrice Fervers, et MarinaTouillaud.2015.Activitphysiquependantetaprslecancer:
comment prescrire et dans quels objectifs ?
Nutrition Clinique et Mtabolisme 29 (2): 121
25.
doi:10.1016/j.nupar.2015.02.002.

Bernard
, Paquito, Ahmed Jrme Romain, et Mathieu Vergnault.2015. Lactivit physique adapte,une
ncessit pour mettre en uvre les recommandations .
Nutrition Clinique et Mtabolisme 29 (2):
88
90.doi:10.1016/j.nupar.2015.02.006.

Brandt
, Claus, et Bente K. Pedersen. 2010. The Role of ExerciseInduced Myokines in Muscle
Homeostasis andtheDefense against Chronic Diseases .
Journalof BiomedicineandBiotechnology
2010.doi:10.1155/2010/520258.

Burch
, Nathalie, AnneSophie Arnold,Flurin Item,SergeSummermatter,Gesa BrochmannSantanaSantos,
Martine Christe, Urs Boutellier, Marco Toigo,etChristophHandschin.ElectricPulseStimulation
of Cultured Murine Muscle Cells Reproduces Gene Expression Changes of Trained Mouse
Muscle.
PLoSONE
5,no

6(4juin2010).doi:10.1371/journal.pone.0010970.

Carayol
, Marion. 2013. Le rlede lactivit physique danslaprvention tertiairedu cancer .
Journalde
PharmacieClinique
32(1):23
30.doi:10.1684/jpc.2013.0239.

Coisne
, Tom. 2007. Contribution ltude des effets de lactivit physique sur le fonctionnement
mitochondrial et la productionde radicaux libresEtudesurmitochondriesmusculairesethpatiques.
Phdthesis,
Universit
JosephFourier

Grenoble
I.
https://tel.archivesouvertes.fr/tel00626716/document.

Courneya
, Kerry S., et Christine M.Friedenreich. 2011. PhysicalActivityand Cancer: AnIntroduction.
Recent ResultsinCancerResearch.FortschritteDerKrebsforschung.ProgrsDansLesRecherches
SurLeCancer
186:1
10.doi:10.1007/9783642042317_1.

De Potter
. 2004. Cit dans Dfinition, formation,lgislationet rle duprofessionnelen activitphysique
adapte , Alvole 2010, Rhabilitation des patients atteints de pathologies respiratoires aigus,
D'aprs la communication de C. Fabre, Article rdig par Chavignay E., (2010). Revue Maladie
RespiratoireActual2:628630,ditparElsevierMassonSAS.

Desnoyers
,A.,E.Riesco, T.Flp,etM.Pavic.2016.Activitphysiqueetcancer:miseaupointetrevue
de la littrature .
La Revue de Mdecine Interne
. Consult le fvrier 23.
doi:10.1016/j.revmed.2015.12.021.

Dreibati
, B.,C.Lavet, A.Pinti,et G.Poumarat.2011.Characterizationof anelectricstimulationprotocol for
muscular exercise .
Annals of Physical and Rehabilitation Medicine 54 (1): 25
35.
doi:10.1016/j.rehab.2010.11.004.

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
49

Emrani
,Ramin,AmlieRbillard,Luz Lefeuvre,Arlette GratasDelamarche, KelvinJ.A. Davies, etJosiane
Cillard. 2015. TheCalcineurinAntagonist RCAN14IsInducedbyExhaustiveExerciseinRat Skeletal
Muscle
.
Free

Radical
Biology
&
Medicine
87
(octobre):
290
99.
doi:10.1016/j.freeradbiomed.2015.06.023.

Ferry
, A, et M Rieu. 1994. Adaptation des systmes physiologiques lactivit physique .
mdecine/sciences
10(8
9):868.doi:10.4267/10608/2721.

Foretz
, Marc, Nellie Taleux, BrunoGuigas,SandrineHorman,Christophe Beauloye, Fabrizio Andreelli,Luc
Bertrand, et BenotViollet.2006. Rgulationdu mtabolismenergtiquepar lAMPK: Unenouvelle
voie thrapeutique pour le traitement des maladies mtaboliques et cardiaques .
M/S: mdecine
sciences
22(4):381
88.

Friedenreich
, Christine, Teresa Norat, Karen Steindorf, MarieChristine BoutronRuault, Tobias Pischon,
Mathieu Mazuir, Franoise ClavelChapelon, et al. 2006. Physical Activity and Risk of Colon and
Rectal Cancers: The European Prospective Investigation into Cancer and Nutrition .
Cancer
Epidemiology, Biomarkers & Prevention: A Publication of the American Association for Cancer
Research, Cosponsored by the American Society of Preventive Oncology 15 (12): 2398
2407.
doi:10.1158/10559965.EPI060595.

Friedenreich
, Christine M. 2011. Physical Activity and Breast Cancer: Review of the Epidemiologic
Evidence and Biologic Mechanisms .
Recent Results in Cancer Research. Fortschritte Der
Krebsforschung. Progrs Dans Les Recherches Sur Le Cancer 188: 125
39.
doi:10.1007/9783642108587_11.

Gaster
, M., H. BeckNielsen, etH.D.Schrder. 2001. Proliferation Conditions forHumanSatelliteCells.
The Fractional Content of Satellite Cells .
APMIS: Acta Pathologica, Microbiologica, et
ImmunologicaScandinavica
109(11):726
34.

Gogh
, Inkie J. A. Eversvan, Sheril Alex, Rinke Stienstra, Arjan B. Brenkman, Sander Kersten, et Eric
Kalkhoven. Electric PulseStimulationofMyotubesasanInVitroExerciseModel:CellMediated
and NonCellMediated Effects .
Scientific Reports 5 (19 juin 2015): 10944.
doi:10.1038/srep10944.

GratasDelamarche
,A.,F. Derbr,S.Vincent,etJ.Cillard. 2014. Physical Inactivity,Insulin Resistance,
and the OxidativeInflammatory Loop .
Free Radical Research 48 (1): 93
108.
doi:10.3109/10715762.2013.847528.

Guritat
,Jordan. 2015. Exercicephysiqueet progression ducancerde la prostate:effetscombinsavec
la prise dantioxydants naturels ou la radiothrapie externe: identification de voies de signalisation
redoxdpendantes.Rennes2.http://www.theses.fr/2015REN20012.

Hartwig
, Sonja, SiljaRaschke, BirgitKnebel,Mika Scheler,Martin Irmler,WaltraudPasslack, StefanMuller,
etal. 2014. Secretome Profiling of PrimaryHumanSkeletalMuscleCells.
BiochimicaEtBiophysica
Acta
1844(5):1011
17.doi:10.1016/j.bbapap.2013.08.004.

Henningsen
, Jeanette, Kristoffer T. G. Rigbolt, Blagoy Blagoev, Bente Klarlund Pedersen, et Irina
Kratchmarova. 2010. Dynamics of the Skeletal MuscleSecretome duringMyoblastDifferentiation.
Molecular&CellularProteomics:MCP
9(11):2482
96.doi:10.1074/mcp.M110.002113.

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
50

Khan
,KarimM.,Angela M.Thompson,StevenN.Blair,JamesF.Sallis,KennethE.Powell,FionaC.Bull,et
Adrian E. Bauman. 2012. Sport and Exercise as Contributors to the Health of Nations .
Lancet
(London,England)
380(9836):59
64.doi:10.1016/S01406736(12)608654.

Lambernd
, S.,A. Taube,A.Schober, B. Platzbecker,S.W.Grgens,R.Schlich,K.Jeruschke,J.Weiss,K.
Eckardt, et J. Eckel. Contractile Activity of Human Skeletal Muscle Cells Prevents Insulin
Resistance by Inhibiting proInflammatory Signalling Pathways .
Diabetologia 55, no
4 (avril
2012):1128
39.doi:10.1007/s001250122454z.

Langelaan
, MarloesL. P., KristelJ.M.Boonen, KangYuenRosariaChak,DaisyW.J.vanderSchaft,Mark
J. Post, et Frank P. T. Baaijens. 2011. Advanced Maturation by Electrical Stimulation:
Differences in Response between C2C12 and Primary Muscle Progenitor Cells .
Journal of
TissueEngineeringandRegenerativeMedicine
5(7):529
39.doi:10.1002/term.345.

Lindner
, J. L., S. Loibl, C. Denkert, B. Ataseven, P.A. Fasching, B.M. Pfitzner,B. Gerber, et al.2015.
Expression of Secreted Protein Acidic and Rich in Cysteine (SPARC) in Breast Cancer and
Response to Neoadjuvant Chemotherapy .
Annals of Oncology: Official Journal of the
EuropeanSocietyforMedicalOncology/ESMO
26(1):95
100.doi:10.1093/annonc/mdu487.

Marotta
, Mario, RamnBrags, et AnnaM. GmezFoix.2004. Designand Performanceofan Electrical
StimulatorforLongTermContractionofCulturedMuscleCells.
BioTechniques
36(1):68
73.

MuozCnoves
, Pura, Camilla Scheele, Bente K. Pedersen, et Antonio L. Serrano.2013. Interleukin6
Myokine SignalinginSkeletalMuscle:ADoubleEdgedSword?
TheFEBSJournal280(17):4131
48.
doi:10.1111/febs.12338.

Nikoli
, Nataa, SirilSkaret Bakke,EiliTranheimKase, IdaRudberg,IngeborgFlo Halle,ArildC.Rustan, G.
Hege Thoresen, et VigdisAas. ElectricalPulse Stimulationof CulturedHuman SkeletalMuscle
Cells as an In Vitro Model of Exercise .
PLoS ONE 7, no
3 (22 mars 2012): e33203.
doi:10.1371/journal.pone.0033203.

Orfanos
, Zacharias, Markus P. O. Gdderz, Ekaterina Soroka, Tobias Gdderz, AnastasiaRumyantseva,
Peter F.M. van derVen, Thomas J.Hawke,etDieter O. Frst.2016.Breaking Sarcomeres by
inVitroExercise.
ScientificReports
6:19614.doi:10.1038/srep19614.

Ost
,Mario,VerenaColeman, JulianeKasch, et Susanne Klaus.2016. RegulationofMyokineExpression:
Role of Exercise and Cellular Stress .
Free Radical Biology & Medicine
, fvrier.
doi:10.1016/j.freeradbiomed.2016.02.018.

Ott
, J. J., A. Ullrich, M. Mascarenhas, et G. A. Stevens. 2011. Global Cancer Incidence and Mortality
Causedby Behaviorand Infection.
Journal of PublicHealth (Oxford, England)33(2):223
33.
doi:10.1093/pubmed/fdq076.

Pedersen
, Bente Klarlund, Thorbjrn C. A. Akerstrm, AndersR.Nielsen,etChristianP. Fischer. 2007.
Roleof Myokines in Exercise and Metabolism .
Journal of AppliedPhysiology(Bethesda,Md.: 1985)
103(3):1093
98.doi:10.1152/japplphysiol.00080.2007.

Pedersen
,Bente K.2009. The Diseasome ofPhysical InactivityandtheRoleofMyokinesinMuscleFat
CrossTalk.
TheJournalofPhysiology
587(Pt23):5559
68.doi:10.1113/jphysiol.2009.179515.

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
51

Pedersen
, Bente K., et Mark A. Febbraio. 2012. Muscles, Exercise and Obesity: Skeletal Muscle as a
SecretoryOrgan.
NatureReviews.Endocrinology
8(8):457
65.doi:10.1038/nrendo.2012.49.

Pedersen
, Bente K. 2013. Muscle as a Secretory Organ .
ComprehensivePhysiology 3 (3):1337
62.
doi:10.1002/cphy.c120033.

Qin
,YiXian, et Minyi Hu.2014. MechanotransductioninMusculoskeletal TissueRegeneration: Effects of
Fluid Flow, Loading, andCellularMolecular Pathways.
BioMedResearchInternational2014:863421.
doi:10.1155/2014/863421.

Raschke
, Silja, et Jrgen Eckel. 2013. AdipoMyokines: Two Sides of the Same CoinMediators of
Inflammation and Mediators of Exercise .
Mediators of Inflammation 2013: 320724.
doi:10.1155/2013/320724.

Schnyder
, Svenia, et Christoph Handschin. 2015. Skeletal Muscle as an Endocrine Organ: PGC1,
MyokinesandExercise.
Bone
80(novembre):115
25.doi:10.1016/j.bone.2015.02.008.

Silveira
, Leonardo R., Henriette Pilegaard, Keiko Kusuhara, Rui Curi, et YlvaHellsten. TheContraction
Induced Increase in Gene Expression of Peroxisome ProliferatorActivated Receptor
(PPAR)Gamma Coactivator 1alpha (PGC1alpha), Mitochondrial Uncoupling Protein 3 (UCP3)
andHexokinaseII(HKII)inPrimaryRatSkeletal Muscle CellsIsDependentonReactiveOxygen
Species .
Biochimica Et Biophysica Acta 1763, no
9 (septembre 2006): 969
76.
doi:10.1016/j.bbamcr.2006.06.010.

So
,Byunghun,HeeJaeKim,Jinsoo Kim, et Wook Song. 2014. Exerciseinduced myokinesin health and
metabolic diseases .
Integrative Medicine Research
, Gathering, Connecting, and Integrating, 3 (4):
172
79.doi:10.1016/j.imr.2014.09.007.

van der Schaft


, Daisy W. J., ArianeC.C.vanSpreeuwel,KristelJ.M. Boonen,Marloes L.P. Langelaan,
CarlijnV. C. Bouten,etFrank P. T.Baaijens. EngineeringSkeletalMuscleTissuesfromMurine
Myoblast Progenitor Cells and Application of Electrical Stimulation .
Journal of Visualized
Experiments:JoVE
,no

73(2013):e4267.doi:10.3791/4267.

White
, Mary C., Dawn M. Holman, Jennifer E. Boehm, Lucy A. Peipins, Melissa Grossman, et S. Jane
Henley. 2014. AgeandCancer Risk: A PotentiallyModifiableRelationship.
AmericanJournal
ofPreventiveMedicine
46(3Suppl1):S7
15.doi:10.1016/j.amepre.2013.10.029.

Winzer
, Brooke M., DavidC.Whiteman,MarinaM. Reeves,etJenniferD.Paratz. 2011. PhysicalActivity
and Cancer Prevention: A Systematic Review of ClinicalTrials.
Cancer Causes&Control: CCC 22
(6):811
26.doi:10.1007/s1055201197614.

Xiong
, Gordon Minru, Anh Tuan Do, Jun Kit Wang, Chee Leong Yeoh, Kiat Seng Yeo, et Cleo Choong.
2015. Development of a miniaturized stimulation device for electrical stimulation of cells .
JournalofBiologicalEngineering
9:14.doi:10.1186/s1303601500121.

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
52

Annexes

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
53

Myokine

Gne

Espce

Rfrence

LesInterleukines
IL4

IL4

BrandtetPedersen2010

IL6

IL6

BrandtetPedersen2010

IL7

IL7

BrandtetPedersen2010

IL8

IL8

BrandtetPedersen2010

IL15

IL15

Homme

Ostetal.2016

Rat

Ostetal.2016

Mice

Ostetal.2016

Rat

Ostetal.2016

Souris

Ostetal.2016

Souris
C2C12

Ostetal.2016

Homme

Ostetal.2016

Homme

Ostetal.2016

Souris
MDX

Ostetal.2016

Souris

Ostetal.2016

Homme

Ostetal.2016

BrainDerivedNeurotrophicFactor(Neurotrophin)

LeukemiaInhibitoryFactor

BDNF

LIF

Irisin

FNDC5

LesFibroblastsGrowthFactors/Facteursdecroissancedefibroblastes
FibroblastGrowthFactor2(Basic)

FGF2

BrandtetPedersen2010

FibroblastGrowthFactor21

FGF21

Human

Ostetal.2016

Mice

Ostetal.2016

Human

Soetal.2014

Mouse

Ostetal.2016

SecretedProtein,AcidicandRichinCystein(Osteonectin)

SPARC

Insulinlikegrowthfactor1(SomatomedinC)

IGF1

LesGrowth/DifferenciationFactors
GDF8
(Myostatine)

MSTN

Ostetal.2016

GDF15

GDF15

Ostetal.2016

Myonectine

CTRP15

Ostetal.2016

FollistatinLikeProtein1(FSL1)

FSTL1

BrandtetPedersen2010

Meteorin,GlialCellDifferentiationRegulatorLike(Subfatin)

METRNL

BrandtetPedersen2010

Chemokine(CXCMotif)Ligand1

CXCL1

BrandtetPedersen2010

TransformingGrowthFactor,Beta1(TGF)

TGFB

BrandtetPedersen2010

CiliaryNeurotrophicFactor

CNTF

SchnyderetHandschin2015

OncostatinM

OSM

SchnyderetHandschin2015

Chemokine(CCMotif)Ligand2(MCP1)

CCL2

RaschkeetEckel2013

AngiopoietinLike4

ANGPTL4

RaschkeetEckel2013

VascularEndothelialGrowthFactor

VEGF

Ostetal.2016

RegulatorofCalcineurin1(RCAN1)

RCAN1

Emranietal.2015

Apeline

APLN

Ostetal.2016

Chitinase3Like1(CartilageGlycoprotein39)

CHI3L1

Ostetal.2016

Ostocrine
(Muscline/Musculine)

OSTN

Ostetal.2016

Vitronectine

VTN

Hartwigetal.2014

EphrintypeAreceptor4

EPHA4

Hartwigetal.2014

Granulocytecolonystimulatingfactor3

CSF3

Hartwigetal.2014

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
54

Retinoicacidreceptorresponderprotein1

RARRES1

Hartwigetal.2014

Betamannosidase

MANBA

Hartwigetal.2014

Collagentriplehelixrepeatcontainingprotein1

CTHRC1

Hartwigetal.2014

Cartilageoligomericmatrixprotein

COMP

Hartwigetal.2014

Plasminogenactivatorurokinase

PLAU

Hartwigetal.2014

PAI1(SerpinE1)

SERPINE1

RaschkeetEckel2013

PEDF(SerpinF1)

SERPINF1

RaschkeetEckel2013

Dipeptidylpeptidase4

DPP4

RaschkeetEckel2013

Secretedfrizzledrelatedprotein4

SFRP4

Hartwigetal.2014

Integrinbetalikeprotein1

ITGBL1

Hartwigetal.2014

Latenttransforminggrowthfactorbetabindingprotein2

LTBP2

Hartwigetal.2014

SushirepeatcontainingproteinXlinked

SRPX

Hartwigetal.2014

Protoglycanesquifonctionnentcommedesmyokines
Dcorine

DCN

Ostetal.2016

SchnyderetHandschin2015

Produitdumtabolisme
Acideaminoisobutyrique(BAIBA)

Pasune
protine

TableauI:Lesdiffrentesmyokinesactuellementconnues

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
55

Lignedemyocytes

Publication

Souris C2C12

Burchet
al.2010

(CRL1772)

MilieudeCroissance
(GM=GrowthMedium)

Dure(jour)

DMEMsupplment avecdelaP/S(1%10g/ml)et duFBS


(FBS10%100g/ml)

Jusqucequeles
cellulesatteignent
90%deconfluence

Goghetal. DMEM contenant 4.5 g/l de glucose (Lonza, Basel,


Switzerland) supplmentavec dusrumfoetalbovininactiv
2015

Jusqucequeles
cellulesatteignent
8090%de
confluence

par la chaleur (FBS 10% 100g/ml Gibco/Life


Technologies, Carlsbad, CA, USA), de la pnicilline (10%
100g/ml Lonza) et de la streptomycine (10% 100g/ml
Lonza)

SOL8
(CRL2174)

Rat

Wistar
Cellules
primairesde
MSSdes
membres
postrieurs
(Mle150g)

Humaine

vander
Schaftet
al.2013

DMEM avanc (335 ml), supplment avec du srum foetal


bovin (FBS 20% 100ml), dusrumde cheval(HS 10 %
50 ml), de lapnicilline(1% 5ml),delastreptomycine(1%
5 ml), de la Lglutamine (1% 5 ml) et delextraitdembryon
depoulet(CEE1%5ml).
Lescellulessontrepiques(1:3)tousles3jours.

12

Orfanoset
al.2016

Dans un milieu DMEM riche en glucose, avec du GlutaMax


(Thermo Fischer Scientific Gibco, Darmstadt, Germany) et
contenant du FCS (15% 150g/ml), des acidesaminsnon
essentiels (2mM), du pyruvate de sodium (1mM), de la
pnicilline(100U/ml)etdelastreptomycine(100g/ml).
Lemilieuestchangtousles2jours.

Burchet
al.2010

DMEMsupplment avecde la pnicilline(1%10g/ml),de


la streptomycine (1% 10 g/ml) et du srum foetal bovin
(FBS20%200g/ml).

Jusqucequeles
cellulesatteignent
90%deconfluence

Silveiraet
al.2006

DMEMsupplmentavecduFCS(20%200g/ml)

Nikoliet
al.2012

DMEMGlutamaxTM
supplment avec du srum de veau
foetal(FCS 2% 20g/ml), delUltroserG(2% 20g/ml),de
la pnicilline (50 U/ml), de la streptomycine (50mg/ml)et de
lamphotricineB(1,25mg/ml).
Pasdinsulineajoute
Culture80%deconfluence

Lambernd
etal.2012

MilieumodifideEagle(MEM)oumilieuHamsF12

714

Jusqucequeles
cellulesaientpresque
atteintlaconfluence

TableauII:Comparaisondestempsetdesmilieuxdecroissanceentrelesdiffrents

protocolesvoqusdanslarevuedelittrature

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
56

Lignedemyocytes
Souris

C2C12
(CRL1772)

Publication

Milieudediffrenciation
(DMDifferenciationmedium)

Dure(jour)

Burchetal.
2010

DMEM supplment avec de la P/S (1% 10g/ml) et du HS (2%


20g/ml).
Milieuchangtoutesles24h.

46

Goghetal.
2015

DMEM contenant 4.5 g/l de glucose (Lonza, Basel, Switzerland)


supplment deHS(2%20g/mlGibco/LifeTechnologies)etdeP/S
(10%100g/ml).
Milieuchangtoutesles24h.

vander
Schaftetal.
2013

Milieu de diffrenciation = Milieu de croissance utilisdansle tableau


prcdent,sansCEE.
DMEMavanc(335ml),supplmentavecdusrumfoetal bovin(FBS
20%100ml), dusrumdecheval(HS 10%50ml),dela pnicilline
(1% 5ml),de la streptomycine (1% 5 ml),de laLglutamine(1%5
ml)
Milieurenouveltousles23jours.

Orfanosetal. Dans un milieu DMEM riche en glucose, avec du GlutaMax (Thermo


FischerScientificGibco, Darmstadt,Germany), duHS(2% 20g/ml),
2016

des acides amins nonessentiels (2mM), du pyruvate de sodium


(1mM),delapnicilline(100U/ml)etdelastreptomycine(100g/ml).
Lemilieuestchangtousles2jours.

(CRL2174)

Burchetal.
2010

DMEM supplment avec de la P/S (1% 10g/ml), et du HS (2%


20g/ml).
Milieuchangtoutesles24h.

Wistar

Silveiraetal.

DMEMsupplmentavecduHS(10%100g/ml).

Rq:LetermeMilieudefusion(MF)dsignelemilieudediffrenciation

Nikoli
etal.
2012

DMEMGlutamaxTM
complment avec du FCS (2% 20g/ml), dela
pnicilline (50 U/ml), de la streptomycine (50 mg/ml) et de
lamphotricineB(1,25mg/ml).
25pMdinsulinesontajouts
Lemilieuestchangtousles23jours.

89

Lamberndet
al.2012

MEMcontenantduHS(2%20g/ml).

SOL8

Rat

Cellules
2006
primairesde
MSSdes
membres
postrieurs
(Mle
150g)

Humaine

46

TableauIII:Comparaisondestempsetdesmilieuxdediffrenciationentreles

diffrentsprotocolesvoqusdanslarevuedelittrature

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
57

Programmesdestimulationappliqussurdes
lignesanimales
demyocytes(partie1)
Publication

Burchetal.2010

Goghetal.2015

Myocytesutiliss

Myocytes murins C2C12 (CRL1772) et


SOL8(CRL2174)

C2C12(murin)

Etatdediffrenciationdes
myocytes

Utilissaprs 46joursdansunmilieude
diffrenciation (DMEM, 1% de P/S
(10g/ml), 2% de HS). Milieu chang
toutesles24h

Utiliss aprs 5 jours dans un milieu de


diffrenciation ( DMEM, 4,5 g/l de glucose, 2% de
HS (Gibco/Life Technologies), 10% de P/S
(100g/ml).Milieuchangtoutesles24h.

Appareildestimulation

CPace EP culture pacer (IonOptix,Dublin,


Ireland)

(CPace100IonOptix,Milton,MA,USA)

Typedeplaquedeculture

6wellplates(Corning,NewYork,USA)

Nombredecellules
ensemencesparpuits

Typedexerciceimit

Aigu

Intermittent

Duretotaledelasession
destimulations(EPS)(min
ouh)

1x90
min

plusieursfois90min 24h
intervalle
rgulier
durant4jours

Changementdumilieude
culture

1havantchaquesessiondestimulations

Tempsdercupration(ms)
(Duredepauseentre2
stimulations)

1000

Duredelastimulation
(trains)(ms)

1000

Typedestimulation

Train(suite)dimpulsions

Impulsion(pulse)

Bipolaire

Duredimpulsion(ms)

Voltage(V)

14

11,5

Frquence(Hz)

50

Intervalleentre2impulsions
(pulsesms)

20

1000
(1Hz=1vnementpars)

Continu

Continu
24h

TableauIV:ComparaisondesparamtresEPSutilissentrelesdiffrentsprotocoles

voqusdanslarevuedelittrature(1)

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
58

Programmesdestimulationappliqussurdes
lignesanimales
demyocytes(partie2)
Publication

vanderSchaftetal.2013

Myocytesutiliss

C2C12(murin)

Cellules primairesde MSS des membres postrieursde rats


mlesWistar(150g)Sacrificepardislocationcervicale
Culture dans un premier milieu de croissance (DMEM20%
de FCS) durant 48 h. Puis dans unmilieude diffrenciation
appel milieu de fusion (MF) (DMEM 10% de HS)durant
24h.

Etatdediffrenciationdes
myocytes

Myocytes diffrencis
tous
aligns en myotubes, dans le
Matrigel,
perpendiculairement
auxlectrodes

Les myocytes commencent se diffrencier et former des


myotubesplurinucls72haprslamiseenculture.
(vrification de lactivit contractile par examen au
microscope)

Appareildestimulation

CPace EP culture pacer


(IonOptix,Dublin,Ireland)

Stimulateurdeculturequipdlectrodesenplatine

Typedeplaquedeculture

6wellplates(CDish,IonOptix)

30mmdishes

Nombredecellules
ensemences

entre7,5x105
et12,5x105
cellules
par
construction
en
Collagen/Matrigel

Typedexerciceimit

Aigu

Duretotaledelasessionde
stimulations(EPS)(minouh)

90min

Changementdumilieude
culture

Tous les 24 h durant les


stimulations

Tempsdercupration(ms)
(Duredepauseentre2
stimulations)

500mspauses

Duredelastimulation(ms)
(trains)

continue

500

Typedestimulation

Impulsion(pulse)

Duredimpulsion(ms)

Voltage(V)

4(4V/CM)

10

Frquence(Hz)

50

Intervalleentre2impulsions
(pulsesms)

500

20

Silveiraetal.2006

TableauV:ComparaisondesparamtresEPSutilissentrelesdiffrentprotocoles

voqusdanslarevuedelittrature(2)

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
59

Programmesdestimulationappliqussurdes
lignesanimales
demyocytes(partie3)
Publication

Orfanosetal.2016

Myocytesutiliss

C2C12(murin)

Etatdediffrenciationdesmyocytes

Myocytes diffrencis dans un milieu DMEM riche en glucose, avec du GlutaMax


(Thermo FischerScientificGibco, Darmstadt,Germany), duHS(2% 20g/ml), des
acides amins nonessentiels (2mM), dupyruvatede sodium (1mM),delapnicilline
(100U/ml)etdelastreptomycine(100g/ml).
Tempsdediffrenciationnonprcis.

Appareildestimulation

CPaceunit(IonOptix,Milton,MA,USA)

Typedeplaquedeculture

Lamelles de 15mm laves lthanol, autoclavespuisplaces dansune plaque 6


puits(CytoOne/Starlab,Hamburg,Germany)

Nombredecellulesensemences

Typedexerciceimit

Duretotaledelasessiondestimulations
(EPS)(minouh)
Changementdumilieudeculture

Tempsdercupration(ms)
(Duredepauseentre2stimulations)

Duredelastimulation(ms)
(trains)

Typedestimulation

Impulsion(pulse)

Unseulpulseparseconde

Duredimpulsion(ms)

20

Voltage(V)

10

Frquence(Hz)

Protocoletwitch:
1

Protocoledamage:
15et5

Intervalleentre2impulsions(pulsesms)

5secondes

Alternance entredesimpulsionsencontinu
pendant 5 secondes 15 Hz, 5 secondes
de pause, des impulsions pendant 5
secondes 5 Hz, puis de nouveau 5
secondesdepause.

TableauVI:ComparaisondesparamtresEPSutilissentrelesdiffrentprotocoles

voqusdanslarevuedelittrature(3)

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
60

Programmesdestimulationappliqussurdes
ligneshumaines
demyocytes(partie1)
Publication

Nikolietal.2012

Myocytesutiliss

Myocytes humains et issus dune banque de cellules satellites constitue partir


dchantillons de biopsies de muscles obliques internes de l'abdomen prlevs sur des
volontaires en bonne sant. 12 femmes, 2 hommes entre 34et70 ans,moy=50,9 +/9
ans Un IMC entre19,6et29,7 kg/m, moy= 23,9+/0,9kg/m.Laglycmiejeundeces
volontaires est comprise entre 4,9 et 6,9 mM, moy= 5,2 +/ 0,2 mM. Les taux de lipides
plasmatiquesetlespressionssanguinesdesvolontairessontdanslanormale.

Etatdediffrenciationdes
myocytes

1 2 semaines, 80% deconfluence, dans unmilieude croissance (DMEMGlutamaxTM


,
2% de FCS, 2% dUltroser G, 50 U/ml de pnicilline, 50 mg/ml de streptomycine, 1,25
mg/ml damphotricine B, sansinsulineajoute). Puis,le milieu decroissanceestremplac
parun milieu dediffrenciation (DMEMGlutamaxTM
,2% de FCS,50U/mldepnicilline,50
mg/ml de streptomycine, 1,25 mg/ml damphotricine B, 25 pM dinsuline) pendant 8 9
jours.Lemilieuestchangtousles23jours.

Appareildestimulation

Un lectrostimulateur fabriqu dans unlaboratoire dlectronique delInstitutde Chimiede


lUniversitdOslo

Typedeboitedeculture(CDish)

Boitedeculture6puitsrecouvertsdungelmatricemimantlaMEC

Nombredecellulesensemences

Touslesmyotubescultivssontutiliss

Typedexerciceimit

Chronique

Aigu

Duretotaledelasessionde
stimulations(EPS)(minouh)

2448h
Durant la fin de la priode de
diffrenciation

560min

Changementdumilieudeculture

Toutesles12h

Non

Tempsdercupration(ms)
(Duredepauseentre2
stimulations)

0
(stimulationcontinue)

5000(apulseevery5thsecond)

Duredelastimulation(trains)
(ms)

200

Typedestimulation(pulse)

Impulsionunique

Train(suite)dimpulsions

Impulsion

Bipolaire

Duredimpulsion(ms)

Voltage(V)

30

Frquence(Hz)

100

Intervalleentre2impulsions
(pulses:ms)

1000

10

TableauVII:ComparaisondesparamtresEPSutilissentrelesdiffrentsprotocoles

voqusdanslarevuedelittrature(4)

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
61

Programmesdestimulationappliqussurdes
ligneshumaines
demyocytes(partie2)
Publication

Lamberndetal.2012

Myocytesutiliss

Cellulesdemusclesquelettiquehumain(HSkMC)provenantde5 donneursenbonnesant.
3 hommes gs respectivement de 16, 21 et 47 ans, ainsi que 2 femmes, ges
respectivementde33et37ans.

Etatdediffrenciationdesmyocytes

Myotubes compltement diffrencis aprs 5 jours dans un milieu modified Eagles


medium(MEM)complmentavecduHSsuividunenuitdansduMEMsanssrum.

Appareildestimulation

CPace100IonOptix,Milton,MA,USA.Electrodesencarbone

Typedeboitedeculture(CDish)

Botedeculture6puits(CDish)

Nombredecellulesensemences

Lescellulessontensemencesraisonde1x105

cellulesparpuits

Typedexerciceimit

Duretotaledelasessionde
stimulations(EPS)(minouh)

De224h

Changementdumilieudeculture

Justeavantledbutdelastimulation

Tempsdercupration(ms)
(Duredepauseentre2
stimulations)

Duredelastimulation(ms)
(trains)

Typedestimulation

Impulsion(pulse)

Bipolaire

Duredimpulsion(ms)

Voltage(V)

11,5

Frquence(Hz)

Intervalleentre2impulsions(pulses
ms)

TableauVIII:ComparaisondesparamtresEPSutilissentrelesdiffrentprotocoles

voqusdanslarevuedelittrature(5)

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
62

Fibres
contractionLente

Fibrescontractionrapide

Oxydatives

Glycolytiques

Type1

Type2a

Type2x

Type2b

Slowtwich

Fasttwicha

Fasttwichx

Fasttwichb

ST

FTa

FTx

FTb

Coloration

Rouges

Roses

Blanches

Tempsdecontraction

Lentesoxydatives

Rapides
Intermdiaires

Rapides

Trsrapides

Rsistancelafatigue

Eleve

Assezleve

Modre

Faible

Typedemtabolisme
leplusefficace

Mtabolisme
arobie

Mtabolisme
anarobie

Longterme

Longterme

Courtterme

Courtterme

Tempsmaximumde
recrutement

Plusieursheures

Moinsde30
minutes

Moinsde5
minutes

Moinsde1minute

Densitmitochondriale

Trsforte

Forte

Modre

Faible

Capacitsoxydatives

leves

leves

Modres

Faibles

Vascularisation

Dense

Intermdiaire

Faible

Faible

Substratsnergtiques
lesplusstocks

Triglycrides

PCr
Glycogne

ATP
PCr
Glycogneen
faiblequantit

ATP
PCr

Propritsparticulires

Consommation
dacidelactique

Production
dacidelactique
etdePCr

Consommationde
PCr

Consommationde
PCr

IsoformedeMyHC
caractristique

MyHC/lent

MyHCIIa

MyHCIIx/d

MyHCIIb

Gneassoci

MYH7

MYH2

MYH1

MYH4

TableauIX:LesdiffrentstypesdefibresdesMSS

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
63

GrimaudJoaquim

Miseenplaced'unsystmedestimulationlectriquedecellulesmusculairesafin

demimerl'activitphysique
invitro
2016
64

Оценить