Virus Research 188 (2014) 1526

Contents lists available at ScienceDirect

Virus Research
journal homepage: www.elsevier.com/locate/virusres

Role of ERK1/2 signaling in dengue virus-induced liver injury

Gopinathan Pillai Sreekanth a , Aporn Chuncharunee b , Aunchalee Sirimontaporn b ,
Jutatip Panaampon b , Chatchawan Srisawat a , Atthapan Morchang c , Shilu Malakar c ,
Peti Thuwajit c , Suwattanee Kooptiwut d , Aroonroong Suttitheptumrong e ,
Pucharee Songprakhon e , Sansanee Noisakran f , Pa-thai Yenchitsomanus e ,
Thawornchai Limjindaporn b,e,
a

Graduate Program in Biochemistry, Department of Biochemistry, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand
Department of Anatomy, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand
c
Graduate Program in Immunology, Department of Immunology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand
d
Department of Physiology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand
e
Division of Molecular Medicine, Department of Research and Development, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand
f
Medical Biotechnology Unit, National Center for Genetic Engineering and Biotechnology, National Science and Technology Development Agency, Thailand
b

a r t i c l e

i n f o

Article history:
Received 19 December 2013
Received in revised form 24 March 2014
Accepted 24 March 2014
Available online 1 April 2014
Keywords:
Dengue virus
ERK1/2
Liver injury
Apoptosis
FR180204

a b s t r a c t
The liver is considered to be an important organ of dengue virus (DENV) replication and pathogenesis.
However, molecular mechanisms of hepatic injury are still poorly understood. Modulation of Mitogen
Activated Protein Kinases (MAPKs) was previously shown to affect DENV-induced apoptosis of hepatocytes in vitro. However, the in vivo role of ERK1/2, a member of the MAPK family, and the question
whether its activation can facilitate cell survival or cell death, has not been thoroughly investigated.
Therefore, the role of ERK1/2 in a mouse model of DENV infection was examined. Our results show that
DENV induces phosphorylation of ERK1/2 and increases apoptosis. Inhibition of phosphorylated ERK1/2
by the selective ERK1/2 inhibitor, FR180204, limits hepatocyte apoptosis and reduces DENV-induced
liver injury. Clinical parameters, including leucopenia, thrombocytopenia, transaminases and histology,
show improvements after FR180204 treatment. The expression of cell death genes was further identied
using real-time PCR array and Western blot analysis. Caspase-3 was signicantly decreased in FR180204
treated DENV-infected mice compared to the levels of untreated DENV-infected mice suggesting the role
of ERK1/2 signaling in immune-mediated liver injury during DENV infection.
2014 Elsevier B.V. All rights reserved.

1. Introduction
Dengue virus (DENV) infection is one of the most important
mosquito-borne viral diseases, which is endemic in tropical and
sub-tropical regions. Clinical manifestations of DENV infection
include dengue fever (DF), dengue hemorrhagic fever (DHF), and
dengue shock syndrome (DSS). Patients with DHF generally present
with hemorrhagic tendencies, plasma leakage, thrombocytopenia,
and hemoconcentration. DSS may occur in cases of subsequent
infection with a different serotype of DENV (Halstead, 2007).
Hepatic dysfunction is a crucial feature seen in DENV infection (Halstead, 2007). Transaminase levels are increased in
DENV-infected patients (Halstead, 1988; Kuo et al., 1992; Souza
Corresponding author at: Department of Anatomy, Faculty of Medicine Siriraj
Hospital, Mahidol University, Bangkok, Thailand. Tel.: +66 2419 7035;
fax: +66 2419 7035.
E-mail addresses: thawornchai.lim@mahidol.ac.th, limjindaporn@yahoo.com
(T. Limjindaporn).
http://dx.doi.org/10.1016/j.virusres.2014.03.025
0168-1702/ 2014 Elsevier B.V. All rights reserved.

et al., 2004) and in a murine model of DENV infection (Barth et al.,

2006; Chen et al., 2004; Franca et al., 2010; Paes et al., 2005, 2009).
Apoptosis of hepatic cells, which may be related to the pathogenesis of DSS, has been observed both in vitro and in vivo (Couvelard
et al., 1999; El-Bacha et al., 2007; Huerre et al., 2001; Limonta
et al., 2007; Lin et al., 2008; Marianneau et al., 1998; Morchang
et al., 2011; Nagila et al., 2011, 2013; Netsawang et al., 2010;
Thongtan et al., 2004). DENV infection promotes apoptosis in the
hepatoma cell line, HepG2, partly through the induction of TRAIL, a
member of the death receptor pathway (Matsuda et al., 2005). TNF and Fas signaling also contribute to DENV-mediated apoptosis
(Limjindaporn et al., 2007; Nagila et al., 2013). The mitochondria
of DENV-infected HepG2 cells exhibit functional and morphological defects, suggesting activation of the mitochondrial cell death
pathway (El-Bacha et al., 2007). Similarly, DENV infection of Huh7 cells, another hepatoma cell line, alters mitochondrial function
and expression of p53 (Nasirudeen and Liu, 2009; Nasirudeen
et al., 2008). Therefore, both virus and cytokines contribute to

16

G.P. Sreekanth et al. / Virus Research 188 (2014) 1526

DENV-induced liver injury (Chen et al., 2007; Costa et al., 2012;

Guabiraba et al., 2010, 2013; Renneson et al., 2011; Sung et al.,
2012).
Mitogen activated protein kinases (MAPKs) are a family of serine/threonine kinases with three major types, including p38 MAPK,
c-Jun N-terminal kinase (JNK), and extracellular signal-regulated
kinases (ERK1/2) (Raman et al., 2007). Following DENV infection,
phosphorylated p38 MAPK is induced (Ceballos-Olvera et al., 2009;
Huerta-Zepeda et al., 2008; Lee et al., 2008; Nagila et al., 2013). Inhibition of p38 MAPK reduces DENV-mediated apoptosis of HepG2
cell line (Nagila et al., 2013). DENV also induces phosphorylation of
JNK and inhibition of JNK activity reduces DENV infection (CeballosOlvera et al., 2010). However, the role of ERK1/2 during DENV
infection remains unclear. Activation of ERK1/2 occurs during DENV
infection of liver cells, human endothelial cells and macrophages
(Ceballos-Olvera et al., 2010; Huerta-Zepeda et al., 2008; Lee et al.,
2008), but is blocked in the DENV-infected human alveolar epithelial carcinoma cell line (Chang et al., 2012). To evaluate the role
of ERK1/2 in the pathogenesis of DENV infection, we examined the
inuence of ERK1/2 activation on DENV-mediated apoptosis in vivo.

2. Materials and methods

2.1. Animals
Eight week-old male Balb/c mice were obtained from the
National Laboratory Animal Centre, Mahidol University, Thailand.
All animals were maintained at 23 2 C with a 12 h light/dark
cycle, autoclaved food and water ad libitum. The protocol was
approved by Siriraj Biosafety Risk Management Taskforce, Mahidol
University (SI-2013-11) and Siriraj Animal Care and Use Committee, Mahidol University (SI-ACUP 004/2556).
2.2. DENV infection and FR180204 treatment
DENV serotype 2 strain 16881 was propagated in mosquito cell
line C6/36. Viral titers were determined by focus forming unit (FFU)
assay (Jirakanjanakit et al., 1997). FR180204 (Tocris Bioscience) was
used to inhibit ERK1/2 activation, as FR180204 is previously shown
to inhibit ERK1/2 with more than 100-fold greater selectivity than
other kinases (Ohori et al., 2005). Two independent experiments
were performed; therefore, totally 48 mice were included in this
study. In each experiment, mice were infected intravenously in the
lateral tail vein with L-15 medium for the mock control (Group I,
n = 6). Eighteen mice were infected with DENV. Six were infected
intravenously in the lateral tail vein with DENV in L-15 medium
at a dose of 4 105 FFU (Group II, n = 6). Six were infected intravenously in the lateral tail vein with both DENV in L-15 medium
at a dose of 4 105 FFU and 2% DMSO (v/v) alone (Group III, n = 6).
Six were infected intravenously in lateral tail vein with both DENV
in L-15 medium at a dose of 4 105 FFU and FR180204 dissolved
in 2% DMSO at a dose of 50 mg/kg (Group IV, n = 6). Treatments
of 2% DMSO or FR180204, dissolved in 2% DMSO were carried out
an hour before and at an hour and 24 h post DENV infection. The
volume of all injections was 0.4 ml. At day 7 post infection, mice
were euthanized by intra-peritoneal injection of sodium pentobarbital. Blood samples were processed immediately and liver tissues
were collected for subsequent analysis. Liver tissues were stored
in RNA later (Invitrogen) for subsequent RNA preparation and
protein extraction.
2.3. Quantication of DENV NS1 viral RNA by qRT-PCR assay
Total RNA was extracted from mock (n = 3), DENV-infected liver
(n = 3), DENV-infected liver with 2% DMSO (n = 3) or DENV-infected

liver with FR180204 treatment (n = 3) using the Invitrap Spin Universal RNA Mini Kit (Stratec Molecular) and quantied using a
Nanodrop machine. Equivalent amounts of RNA from each sample
were converted to cDNA with SuperScript III First-Strand Synthesis System (Invitrogen) with a reverse primer, NS1-R 5 GCC
ATC AAT GAG AAA GGT CTG G 3 . Amplication was performed
using the SYBR Green I reaction mix (Roche) in the presence of
NS1 specic primers including NS1-F 5 CCG GCC AGA TCT GGA
GAC ATC AAA GGA ATC 3 and the NS1-R in a Roche Light Cycler
480. In vitro transcription-derived DENV NS1 RNA with known copy
number served as a standard control for qRT-PCR. The Ct of viral
RNA was measured and compared to the standard control. Results
were obtained from three independent experiments and analyzed
using the GraphPad Prism 5 program.
2.4. Detection of host RNA by real-time PCR array
The Mouse Apoptosis RT2 ProlerTM PCR Array (Qiagen) interrogates 84 genes related to apoptotic pathways. RNA was extracted
from mock, DENV-infected liver, DENV-infected liver with 2%
DMSO or DENV-infected liver with FR180204 treatment using the
Invitrap Spin Universal RNA Mini Kit (Stratec Molecular). Total RNA
was quantied using a Nanodrop machine; equivalent amounts
of RNA from each sample were converted to cDNA using the
SuperScript III First-Strand Synthesis System (Invitrogen), mixed
with RT2 qPCR mastermix containing SYBR Green (Qiagen), and
equivalent volumes were aliquoted to each well of the real-time
PCR arrays. The real-time PCR cycling program was run on a Roche
Light Cycler 480 machine. The threshold cycle (Ct) of each gene was
determined and the data were analyzed using the web program at
http://www.pcrdataanalysis.sabiosciences.com/pcr/arrayanalysis.
php.
Expression changes detected by the real-time PCR arrays
were validated by quantitative real-time PCR using different set
of primers. Total RNA was extracted from mock (n = 3), DENVinfected liver (n = 3), DENV-infected liver with 2% DMSO (n = 3)
or DENV-infected liver with FR180204 treatment (n = 3) with the
Invitrap Spin Universal RNA Mini Kit (Stratec Molecular) and
quantied using a Nanodrop machine. Equivalent amounts of RNA
from each sample were converted to cDNA using SuperScript III
First-Strand Synthesis System (Invitrogen), and PCR amplication
was carried out using TNF--specic primers including TNF-F 5
CCCCCAGTCTGTATCCTTCT 3 and TNF-R 5 TTTGAGTCCTTGATGGTGGT 3 , and GAPDH-specic primers including GAPDH-F5
TGAATACGGCTACAGCAACA 3 and GAPDH-R 5 AGGCCCCTCCTGTTATTATG 3 , respectively. Amplication was performed using
the SYBR Green I reaction mix (Roche) in a Roche Light Cycler
480. The Ct of mRNA of TNF- and GAPDH were measured and
the differences between their Ct were calculated. The relative
expression values (2Ct ) were then determined. Results were
obtained from three independent experiments and analyzed using
the GraphPad Prism 5 program.
2.5. Western blot analysis
Total protein was extracted from mock (n = 3), DENV-infected
liver (n = 3), DENV-infected liver with 2% DMSO (n = 3), DENVinfected liver with FR180204 treatment (n = 3) in RIPA buffer
containing protease inhibitor (Roche) and subjected to Western
blot analysis (Towbin et al., 1979). Phosphatase inhibitor (Roche)
was also added to maximize detection of phosphorylated proteins.
Protein concentrations of the lysates were determined using the
Bradford protein assay (Bio-Rad) and adjusted to equivalent concentrations prior to mixing with loading dye and heating at 95 C
for 5 min. Samples were separated by SDS-PAGE and blotted onto
nitrocellulose membrane. The membrane was blocked in 5% BSA

G.P. Sreekanth et al. / Virus Research 188 (2014) 1526

17

Fig. 1. Quantication of viral NS1 and viral titers from liver tissues of DENV- infected Balb/c mice. Mice were infected with L-15 medium (Mock) or DENV at a dose of 4 105
FFU in a volume at 0.4 ml of L-15 medium. Seven days after DENV infection, liver tissues were collected and stored in RNA later. Total viral RNA was isolated for viral NS1
quantication and viral supernatant from the liver homogenate for the FFU assay. (A) Standard curve plotted by qRT-PCR, from the threshold cycle numbers (Ct) of ten
fold serially diluted cDNA generated from DENV NS1 RNA standard with known copies (the dots in the gure corresponds to each ten fold dilutions) (B) Representative
amplication plot for the NS1 copies of Mock-infected (blue) and DENV-infected viral RNA (red) (C) Viral NS1 copies in 1 g total RNA of mock-infected and DENV infected
liver tissue (D) Viral titers expressed from liver tissue homogenate in FFU per milligram (FFU/mg) of mock-infected and DENV-infected mice. All the results were obtained
from three animals (n = 3) from each group. For (C) and (D), statistical analysis was done by an unpaired t-test using GraphPad Prism 5 program and the data were represented
as mean SEM. The asterisks show the level of signicance (p < 0.05 considered to be statistically signicant). (For interpretation of the references to color in this gure
legend, the reader is referred to the web version of the article.)

in TBST for phosphoprotein detection, 5% skim milk in PBST for

viral protein, and 5% skim milk in TBST for other proteins. Membranes were washed and hybridized with mouse anti-total ERK1/2
(Santa Cruz Biotechnology), mouse anti-phosphorylated ERK1/2
(Santa Cruz Biotechnology), mouse anti-TNF- (Abcam), mouse
anti-DENV E (Gentry et al., 1982; Henchal et al., 1985), mouse
anti--actin (Santa Cruz Biotechnology) or rabbit anti-cleaved
caspase-3 (Cell signaling). The membranes were again washed and
incubated with HRP-conjugated secondary antibodies, including
HRP-conjugated rabbit anti-mouse IgG for ERK1/2, phosphorylated
ERK1/2, TNF-, DENV E and actin (Dako), or HRP-conjugated swine
anti-rabbit IgG for cleaved caspase-3 (Dako). Immune complexes

were detected by enhanced chemiluminescence (Pierce). Band

intensities were quantied for at least 3 mice from each group using
the ImageJ program and normalized to respective housekeeping
genes.
2.6. Hematology and transaminases
Whole blood was obtained from mock (n = 12), DENV-infected
liver (n = 12), DENV-infected liver with 2% DMSO (n = 12) or DENVinfected liver with FR180204 treatment (n = 12) and maintained
in EDTA vaccutainer and suddenly processed for hematology. The
complete blood count was quantied using a CELL-DYNTM 3700

18

G.P. Sreekanth et al. / Virus Research 188 (2014) 1526

Fig. 2. Detection of DENV E antigen from the liver tissues of DENV- infected Balb/c
mice. (A) Western Blot analysis, using antibody to DENV E and normalized to GAPDH
(B) Densitometry analysis of DENV E protein normalized to GAPDH by Western blot
analysis Results were obtained from three animals (n = 3) from each group. Statistical
analysis was done by an unpaired t-test using GraphPad Prism 5 program and the
data were represented as mean SEM. The asterisk shows the level of signicance
(p < 0.05 considered to be statistically signicant).

hematological analyzer (Abbott, USA). Blood samples were allowed

to clot for preparing the serum. Serum alanine (ALT) and aspartate (AST) aminotransferases were quantied using an automatic
analyzer (Model 902, Hitachi Company, Japan).
2.7. Histology
Liver tissues were obtained from mock (n = 3), DENV-infected
liver (n = 3), DENV-infected liver with 2% DMSO (n = 3) or DENVinfected liver with FR180204 treatment (n = 3), harvested and xed
in 10% formalin in PBS. Fixed tissues were parafn embedded, sectioned and stained with hematoxylin and eosin (H&E).
2.8. Determination of virus titers in DENV-infected mice
At day 7 post DENV infection, mice were euthanized and 20 mg
of liver tissues from mock (n = 3), DENV-infected liver (n = 3),
DENV-infected liver with 2% DMSO (n = 3) or DENV-infected liver

Fig. 3. DENV induced liver injury in Balb/c mice. Mice were infected with L-15
medium or DENV at a dose of 4 105 FFU in a volume at 0.4 ml of L-15 medium.
Seven days after DENV infection, blood samples were processed for serum preparation and subsequent analysis of liver enzymes, ALT (A) and AST (B). The results
were obtained from twelve mice in each group and the exact values of enzymes
are expressed in scatter plot. The line represents the average value from the total
twelve mice from each group Statistical analysis was done by an unpaired t-test
using GraphPad Prism 5 program and the data were represented as mean SEM.
The asterisks show the level of signicance (p < 0.05 considered to be statistically
signicant).

Fig. 4. Histological analysis for DENV-induced liver injury in Balb/c mice. Mice were infected with L-15 medium or DENV at a dose of 4 105 FFU in a volume at 0.4 ml
of L-15 medium. Seven days after DENV infection, liver tissues were collected in 10% Formalin in PBS for histological examination (H&E staining). (A) Mock-infected liver
tissue which shows the normal pathology (B) DENV-infected liver tissue, which shows the classical liver injury induced by DENV, including ballooning of the hepatocyte,
cytoplasmic vacuolization, and cellular necrosis. The data shown are representatives for more than three independent experiments.

G.P. Sreekanth et al. / Virus Research 188 (2014) 1526

19

Table 1
Fold changes in the gene expression proling of DENV-infected mice compared to
control mice.
Gene name

Gene description

Fold changes

Tnf
Tnfrsf11b

Tumor necrosis factor

Tumor necrosis factor receptor superfamily,
member 11b
CD40 ligand
BCL2/adenovirus E1B interacting protein 3-like
Tumor necrosis factor (ligand) superfamily,
member 10
PYD and CARD domain containing
CD70 antigen
BCL2/adenovirus E1B interacting protein 3
B-cell leukemia/lymphoma 2 related protein
A1a
Fas (TNF receptor superfamily member 6)
Tnf receptor-associated factor 1
Nucleotide-binding oligomerization domain
containing 1
Defender against cell death 1
Caspase 12
B-cell leukemia/lymphoma 10
Bcl2-associated X protein
Bcl2-like 1
CD40 antigen
BH3 interacting domain death agonist
Growth arrest and DNA-damage-inducible 45
alpha
Diablo homolog (Drosophila)
Apoptotic peptidase activating factor 1
BCL2-associated agonist of cell death
BCL2-antagonist/killer 1
BCL2/adenovirus E1B interacting protein 2
Caspase 14
Caspase 4

4.9933
3.7581

Cd40lg
Bnip3l
Tnfsf10
Pycard
Cd70
Bnip3
Bcl2a1a
Fas
Traf1
Nod1
Dad1
Casp12
Bcl10
Bax
Bcl2l1
Cd40
Bid
Gadd45a
Diablo
Apaf1
Bad
Bak1
Bnip2
Casp14
Casp4

Fig. 5. DENV altered hematological parameters in Balb/c mice. Mice were infected
with L-15 medium or DENV at a dose of 4 105 FFU in a volume at 0.4 ml of L-15
medium. Seven days after DENV infection, blood samples were processed immediately for hematological analysis including white blood cells (A), platelets (B) and
hematocrit (C). The results obtained from two independent experiments with n = 6
for individual group. The results were expressed as mean SEM from twelve animals
from each group. The asterisks indicate statistically signicant differences between
groups (p < 0.05).

with FR180204 treatment (n = 3), were homogenized in RPMI and

centrifuged for 10 min at 14,000 rpm to obtain supernatant. The
presence of infectious viral particles was then determined in the
supernatants by the FFU assay (Jirakanjanakit et al., 1997) and represented as FFU/mg of tissue. Results were obtained from three
independent experiments and analyzed using the GraphPad Prism
5 program.
3. Results and discussion
3.1. DENV infection induces liver injury in Balb/c mice
Balb/c mice are susceptible to DENV and provide a convenient
animal model of DENV infection (Barth et al., 2006; Paes et al.,
2005, 2009). In the present study, intravenous infection of DENV

3.2266
3.1821
3.1167
3.0525
2.7895
2.6945
2.3950
2.2501
2.0994
1.9185
1.9053
1.8790
1.8404
1.8277
1.8150
1.8150
1.7532
1.7532
1.7291
1.7171
1.7171
1.6472
1.5801
1.5369
1.5263

in Balb/c mice resulted in detected levels of viral RNA, viral proteins and infectious viral particles. To calculate the copy number of
viral RNA, a standard control was rstly generated using DENV NS1
RNA derived from in vitro transcription with known copy number
as a template (Fig. 1A). Secondly, qRT-PCR assay was performed
using RNA extracted from mock or DENV-infected liver, respectively. Totally, 1.5 108 copies of DENV NS1 RNA were detected
in 1 g of total RNA from liver of DENV-infected mice, but none
was detected in control (Fig. 1B and C). In addition, viral titers
in liver extracts were determined to demonstrate the presence of
replicative viral particles after DENV infection. Mice were euthanized at day 7 after DENV infection and liver tissues from mock or
DENV-infected mice were homogenized and centrifuged to obtain
supernatant. The presence of infectious viral particles in supernatants was then measured by the FFU assay. Totally, 1.4 105 FFU
of infectious viral particles were detected in 1 mg of liver of DENVinfected mice, but none was detected in mock control (Fig. 1D).
Western blot analysis was subsequently performed to measure
the amount of viral proteins using an antibody specic to DENV
envelope protein (DENV E). DENV E was detected in livers of DENVinfected mice, but none was detected in control (Fig. 2A and B). The
result from this study and from others suggest that intravenous
injection system is the good route of administration of DENV in
Balb/c mice, as DENV antigens were detected, which is in contrast to
the subcutaneous injection system, in which DENV antigens could
not be easily detected (Franca et al., 2010).
Balb/c mice have been used to study liver injury during DENV
infection (Barth et al., 2006; Paes et al., 2005, 2009). Liver damage
was more severe in the intravenous injection as compared to the
intraperitoneal injection (Barth et al., 2006; Paes et al., 2005, 2009).
Elevation of liver enzymes showed a peak of both AST and ALT at the
7th day post DENV infection (Paes et al., 2005, 2009). In the present
study, DENV was injected intravenously and could induce liver

20

G.P. Sreekanth et al. / Virus Research 188 (2014) 1526

Fig. 6. TNF- expression was increased in DENV-infected Balb/c mice. Mice were
infected with L-15 medium or DENV at a dose of 4 105 FFU in a volume at 0.4 ml
of L-15 medium. Seven days after DENV infection, liver tissues were collected, and
RNA and protein was isolated. (A) The relative mRNA expression of TNF- by RTPCR; (B) Western bloting analysis of TNF- using antibodies to TNF-, normalized
to GAPDH; (C) Densitometric analysis of TNF- at protein level and normalized to
GAPDH by Western blot analysis. Results were obtained from three animals (n = 3)
from each group. Statistical analysis was done by an unpaired t-test using GraphPad
Prism 5 program and the data were represented as mean SEM. The asterisks show
the level of signicance (p < 0.05 considered to be statistically signicant).

injury in Balb/c mice at the 7th day post DENV infection (Fig. 3B and
C). Both AST and ALT levels in DENV-infected mice increased significantly compared to those of mock control. Moreover, AST level was
higher than ALT level, which is similar to those in DENV-infected
patients (Nguyen et al., 1997; Paes et al., 2005). Histological examination of liver tissues from DENV-infected mice in the present
study also conrmed the signs of liver injury including ballooning
of the hepatocyte, cytoplasmic vacuolization, and cellular necrosis
(Fig. 4A and B). Progressive necrosis in parenchyma (Franca et al.,
2010; Paes et al., 2005) and increased inltrating monocytes surrounding liver portal area, which could induce liver injury, were
previously reported in DENV-infected mice (de-Oliveira-Pinto et al.,
2012; Sung et al., 2012).
DENV altered hematological parameters of Balb/c mice in this
study. The number of white blood cells and platelets in DENVinfected mice were reduced by about 60% and 25%, respectively,
compared to that of mock-infected mice (Fig. 5A and B). In contrast,
hematocrit in DENV-infected mice was increased about 25% compared to that of mock-infected mice (Fig. 5C). Our result validates
the model that could mimic the leucopenia, thrombocytopenia,
and hemoconcentration found in other dengue models in C57BL/6
(Guabiraba et al., 2010) and in DENV-infected patients (Binh et al.,
2009).

Fig. 7. DENV induced the ERK 1/2 phosphorylation and FR180204 treatment
inhibited ERK 1/2 phosphorylation. Protein was extracted from the liver tissue of
mock-infected, DENV-infected, DMSO treated DENV-infected and FR180204 treated
DENV-infected mice. A cock-tail containing phosphatase inhibitors was also added
to maintain the phospho proteins and allowed them to be visualized by Western
blot analysis. (A) Western blot analysis using antibodies to phosphorylated-ERK1/2
(P-ERK 1/2) and total ERK1/2 (t-ERK 1/2) normalized to GAPDH (C) Densitometry
analysis of P-ERK 1, P-ERK 2 and t-ERK at protein level normalized to GAPDH by
Western blot analysis. Results were obtained from three animals (n = 3) from each
group. Statistical analysis was done by One-way ANOVA using GraphPad Prism 5
program and the data were represented as mean SEM. The asterisks show the
level of signicance (p < 0.05 considered to be statistically signicant).

3.2. Apoptotic gene expression prole in liver of DENV-infected

Balb/c mice
To gain insight into the molecular basis of liver damage in this
murine DENV model, we examined changes in the expression of
apoptotic genes. Total RNA was prepared from liver tissues of mockinfected and DENV-infected mice and used to interrogate a Mouse
Apoptosis RT2 ProlerTM PCR Array (Qiagen). Table 1 lists those
genes exhibiting increased expression (1.5 fold) in DENV-infected
mice compared to the mock control. TNF-, TRAIL and Fas mRNA
expression increased 5-fold, 3- fold, and 2-fold, respectively; these
results are similar to those obtained from in vitro analysis of apoptosis in DENV-infected hepatic cell lines (Limjindaporn et al., 2007;
Matsuda et al., 2005; Nagila et al., 2013). The pro-apoptotic prole of infected cells was also evident by the increased expression
of Bid, Bax and Bak, as well as members of the caspase proteolytic cascade, Apaf-1, caspases-4 and caspases-14. Interestingly,
CD40L and CD40 mRNA expression also increased signicantly in
DENV-infected mice. A previous study also shows that CD40L stimulated DENV infection of immature dendritic cells, suggesting a
mechanism for T cell-mediated immunopathology during DENV
infection (Sun et al., 2006). Though the majority of up-regulated
genes were pro-apoptotic, DAD1, defender against cell death 1, was
also induced. This is in contrast to the role of DAD1 in yellow head
virus (YHV) infection. The transcriptional level of DAD1 declined
dramatically after YHV challenge (Molthathong et al., 2008). The
role of DAD1 in DENV-induced apoptosis merits further investigation. As expected, the anti-apoptosis members of Bcl-2 family,
including Bcl-2-L10, and Bcl-2 itself, were down-regulated about
2-fold, and 1.5-fold, respectively.

G.P. Sreekanth et al. / Virus Research 188 (2014) 1526

21

Fig. 8. Quantication of viral NS1 and viral titers from liver tissues of DENV- infected FR180204 treated Balb/c mice. DENV-infected mice were either treated with 2% DMSO
(v/v) alone (n = 6) or treated with FR180204, dissolved in 2% DMSO at a dose of 50 mg/kg (n = 6). Treatments were given an hour before infection at a dose of 4 105 FFU and
at one and 24 h post infection. At day 7 post infection, liver tissues were collected and stored in RNA later. Total viral RNA was isolated for viral NS1 quantication, and
viral supernatant from the liver homogenate for the FFU assay. (A) Representative amplication plot for the NS1 copies of 2% DMSO (v/v) treated DENV-infected (pink) and
FR180204 treated DENV-infected mice (green). (C) Viral NS1 copies in 1 g total RNA of 2% DMSO (v/v) treated DENV-infected and FR180204 treated DENV-infected mice.
(D) Viral titers expressed from liver tissue homogenate in FFU per milligram (FFU/mg) of 2% DMSO (v/v) treated DENV-infected and FR180204 treated DENV-infected mice.
All the results were obtained from three animals (n = 3) from each group. For (B) and (C), statistical analysis was done by an un-paired t-test using GraphPad Prism 5 program
and the data were represented as mean SEM. (For interpretation of the references to color in this gure legend, the reader is referred to the web version of the article.)

Expression changes detected using the PCR arrays were subsequently conrmed by quantitative real-time PCR using different
set of primers. Total RNA was extracted from mock or DENVinfected liver and equivalent amounts of RNA from each sample
were converted to cDNA. Amplication was performed by TNF-
and GAPDH-specic primers using the SYBR Green I reaction mix;
the Ct of mRNA of the TNF- and GAPDH control were measured
and the differences between their Ct were calculated. The relative
expression values (2Ct ) were then determined. TNF--mRNA
expression increased dramatically, 30-fold post DENV infection
(Fig. 6A). Western blot analysis was performed and the result shows
that TNF- protein expression was also up-regulated in DENVinfected mice (Fig. 6B and C). Both DENV and TNF- were previously
shown to be critical for endothelium damage in a mouse model of
DENV infection (Chen et al., 2007). Moreover, anti-TNF antibody

reduced mortality in experimental DENV infection (Atrasheuskaya

et al., 2003).
3.3. Inhibition of phosphorylated ERK1/2 by FR180204 treatment
decreases liver injury and improves clinical parameters in
DENV-infected Balb/c mice
ERK1/2 signaling has been implicated in the apoptosis and liver
injury that occurs in rabbits infected with the rabbit hemorrhagic
disease virus (Garcia-Lastra et al., 2009). Following DENV infection,
phosphorylated p38 MAPK is induced in vitro (Ceballos-Olvera et al.,
2010; Huerta-Zepeda et al., 2008; Lee et al., 2008; Nagila et al.,
2013). Inhibition of phosphorylated p38 MAPK also reduces TNF production and apoptosis in DENV-infected HepG2 cells (Nagila
et al., 2013). Furthermore, DENV induces phosphorylation of JNK

22

G.P. Sreekanth et al. / Virus Research 188 (2014) 1526

Fig. 9. FR180204 treatment did not affect DENV production. DENV- infected mice
were either treated with 2% DMSO (v/v) alone (n = 6) and treated with FR180204
dissolved in 2% DMSO at a dose of 50 mg/kg (n = 6). Treatments were given an hour
before infection at a dose of 4 105 FFU and at one and 24 h post infection. At day
7 post infection, liver tissues were collected and stored in RNA later. (A) Western
Blot analysis using antibody to DENV E normalized to GAPDH (B) Densitometric
analysis of DENV E protein normalized to GAPDH by Western bloting. Results were
obtained from three animals (n = 3) from each group. Statistical analysis was done by
an unpaired t-test using GraphPad Prism 5 program and the data were represented
as mean SEM.

and ERK1/2 in Chang liver cells (Lee et al., 2008). However, the
in vivo role of ERK1/2 has not been investigated.
To provide insight into this issue, we rst asked whether
DENV induces phosphorylation of ERK1/2 in a mouse model of
DENV-induced liver injury. Total proteins from liver tissues of
DENV-infected mice were subjected to Western blot analysis using
antibodies against phosphorylated ERK1/2, total ERK1/2, or -actin,
respectively. The results show that DENV infection induced phosphorylation of ERK1/2 in vivo (Fig. 7A and B). To assess the role
of phosphorylated ERK1/2, the effect of FR180204, an inhibitor
of ERK1/2 phosphorylation, was tested by Western blot analysis. Treatment with FR180204 reduced in vivo phosphorylation of
ERK1/2 (Fig. 7A and B).
We next asked whether inhibition of phosphorylated ERK1/2 by
FR180204 treatment decreased DENV infection, apoptosis, and liver
damage. The detected levels of viral RNA, and the infectious viral
particles between DENV-infected Balb/c mice and inhibitor-treated
DENV-infected mice were similar (Fig. 8AC). Western blot analysis was also performed to measure the amount of viral proteins and
the results show that DENV E was detected in both DENV-infected
Balb/c mice and inhibitor-treated DENV-infected mice (Fig. 9A and
B). Therefore, inhibition of phosphorylated ERK1/2 by FR180204
treatment did not decrease DENV production. In contrast, inhibition of phosphorylated ERK1/2 by FR180204 treatment decreased
apoptosis. The result in Fig. 10A and B shows the decreased cleavage
form of caspase-3 in inhibitor-treated DENV-infected mice compared to that of DENV-infected mice. Furthermore, both AST and
ALT levels in inhibitor-treated DENV-infected mice decreased signicantly compared to those of DENV-infected mice (Fig. 11A and
B). The signs of liver injury including ballooning of the hepatocyte,
cytoplasmic vacuolization, and cellular necrosis were decreased in
FR180204 treated DENV-infected mice compared to that of DENVinfected mice (Fig. 12A and B) indicating the decreased liver injury
after FR180204 treatment. This effect was clearly not due to a reduction in DENV replication; therefore, ERK1/2 is likely involved in

Fig. 10. Inhibition of apoptosis by FR180204 treatment. DENV-infected mice were

either treated with 2% DMSO (v/v) alone (n = 6) and treated with FR180204 dissolved in 2% DMSO at a dose of 50 mg/kg (n = 6). Treatments were given an hour
before infection at a dose of 4 105 FFU and at one and 24 h post infection. At day
7 post infection, liver tissues were collected and protein was extracted. (A) Western blot analysis using antibody to cleaved caspase-3 (B) Densitometry analysis
of cleaved caspase-3 normalized to GAPDH by Western blot analysis. Results were
obtained from three animals (n = 3) from each group. Statistical analysis was done by
an unpaired t-test using GraphPad Prism 5 program and the data were represented
as mean SEM. The asterisk shows the level of signicance (p < 0.05 considered to
be statistically signicant).

immune cell-induced liver injury during DENV infection. Similarly,

FR180204 was shown to decrease organ injury in a mouse model
in collagen-induced arthritis (Ohori et al., 2007).
We also tested whether inhibition of phosphorylated ERK1/2
by FR180204 treatment altered the hematological parameters
of DENV-infected Balb/c mice. The result shows that inhibition of phosphorylated ERK1/2 by FR180204 treatment improved
these parameters. Firstly, the number of white blood cells and
platelets in FR180204 treated DENV-infected mice were increased
by about 50% and 25% respectively, compared to DENV-infected
mice (Fig. 13A and B). This may be due to the ability of
FR180204 to recover a systemic immunity. However, hematocrits
in FR180204 treated DENV-infected mice were not signicantly
changed between two groups (Fig. 13C). Therefore, FR180204
is not able to recover the plasma leakage in DENV-infected
mice.
3.4. Inhibition of ERK1/2 phosphorylation alters the expression of
a number of relevant apoptotic genes
Total RNA from liver tissues of control or FR180204 treated
DENV-infected mice was used to probe the Mouse Apoptosis RT2
ProlerTM PCR Array (Qiagen). Table 2 lists those genes downregulated after FR180204 treatment. In the present study, TNF-,
TRAIL, and Fas mRNA expression decreased in FR180204 treated
DENV-infected mice suggesting the involvement of ERK1/2 in the
death receptor pathway of DENV-mediated apoptosis. We further
validated the results from real-time PCR array and show that TNF-
mRNA and protein expression was decreased in liver of FR180204
treated DENV-infected mice compared to those of DENV-infected
mice suggesting the involvement of ERK1/2 in TNF- death receptor
pathway (Fig. 14A and B). Infection of human monocytes with DENV

G.P. Sreekanth et al. / Virus Research 188 (2014) 1526

23

Table 2
Ratio decreased in gene expression proling of FR180204 treated DENV-infected
mice compared to DENV-infected mice.
Gene name

Gene description

Ratio decreased

Apaf1
Cd40
Tnfsf10

Apoptotic peptidase activating factor 1

CD40 antigen
Tumor necrosis factor (ligand)
superfamily, member 10
BH3 interacting domain death agonist
Bcl2-associated X protein
Growth arrest and
DNA-damage-inducible 45 alpha
Bcl2-like 1
BCL2/adenovirus E1B interacting
protein 3
PYD and CARD domain containing
Fas (TNF receptor superfamily member
6)
Caspase 4
BCL2-associated agonist of cell death
Tnf receptor-associated factor 1
BCL2-antagonist/killer 1
CD40 ligand
BCL2/adenovirus E1B interacting
protein 2
Diablo homolog (Drosophila)
Nucleotide-binding oligomerization
domain containing 1
CD70 antigen
Defender against cell death 1
B-cell leukemia/lymphoma 10
Caspase 12
Tumor necrosis factor receptor
superfamily, member 11b
B-cell leukemia/lymphoma 2 related
protein A1a
Caspase 14
Tumor necrosis factor
BCL2/adenovirus E1B interacting
protein 3-like

0.824441
0.779302
0.761844

Bid
Bax
Gadd45a
Bcl2l1
Bnip3
Pycard
Fas
Casp4
Bad
Traf1
Bak
Cd40lg
Bnip2
Diablo
Nod1
Cd70
Dad1
Bcl10
Casp12
Tnfrsf11b
Bcl2a1a
Casp14
Tnf
Bnip3l
Fig. 11. FR180204 treatment reduced the liver injury associated with ERK 1/2 phosphorylation. DENV-infected mice were either treated with 2% DMSO (v/v) alone and
treated with FR180204 dissolved in 2% DMSO at a dose of 50 mg/kg. Treatments
were given an hour before infection at a dose of 4 105 FFU and at one and 24 h
post infection. Seven days after DENV infection, blood samples were processed for
serum preparation and subsequent analysis of liver enzymes, ALT (A) and AST (B).
The results were obtained from twelve mice in each group and the exact values of
enzymes are expressed in scatter plot. The line represents the average value from
the total twelve mice from each group. Statistical analysis was done by unpaired ttest using GraphPad Prism 5 program and the data were represented as mean SEM.
The asterisks show the level of signicance (p < 0.05 considered to be statistically
signicant).

0.755140
0.739370
0.724504
0.656121
0.648897
0.641526
0.633968
0.613096
0.599455
0.520360
0.506847
0.485936
0.478805
0.467799
0.456612
0.456596
0.441371
0.413602
0.405413
0.362708
0.358298
0.283076
0.220821
0.198927

is previously shown to increase apoptosis and expression of TNF-

(Espina et al., 2003). In addition, DENV induces endothelial cell production of reactive nitrogen and oxygen species and apoptotic cell
death, which is greatly enhanced by TNF-alpha (Yen et al., 2008).
Inhibition of p38 MAPK in HepG2 cells also reduces TNF- production and apoptosis during DENV infection (Nagila et al., 2013).
DENV infection induces apoptosis in HepG2 cells partly through
the induction of TRAIL (Matsuda et al., 2005). Hepatitis C virus
also uses TRAIL to sensitize hepatocytes to apoptosis (Lan et al.,
2008). However, TRAIL was previously shown to limit West Nile

Fig. 12. FR180204 reduced pathology in DENV-induced liver injury. DENV infected mice were either treated with 2% DMSO (v/v) alone (n = 6) and treated with FR180204
dissolved in 2% DMSO at a dose of 50 mg/kg (n = 6). Treatments were given an hour before infection at a dose of 4 105 FFU and at one and 24 h post infection. Seven days after
DENV infection, liver tissues were collected in 10% Formalin in PBS for histological examination (H&E staining). (A) The classical liver injury induced by DENV. (B) Recovery
from liver injuries by FR180204 treatment. The data shown is representative for more than three independent experiments.

24

G.P. Sreekanth et al. / Virus Research 188 (2014) 1526

Fig. 14. TNF- expression was decreased in DENV-infected Balb/c mice with
FR180204 treatment. DENV-infected mice were either treated with 2% DMSO (v/v)
alone (n = 6) and treated with FR180204 dissolved in 2% DMSO at a dose of 50 mg/kg
(n = 6). Treatments were given an hour before infection at a dose of 4 105 FFU, and
at one and 24 h post infection. Seven days after DENV infection, liver tissues were
collected, RNA and protein was isolated. (A) The relative mRNA expression of TNF-
by RT-PCR (B) Western blot analysis of TNF- using antibody to TNF-, normalized
to GAPDH (C) Densitometric analysis of TNF- at protein level normalized to GAPDH
by Western blot analysis. Results were obtained from three animals (n = 3) from each
group. Statistical analysis was done by an unpaired t-test using GraphPad Prism 5
program and the data were represented as mean SEM. The asterisks shows the
level of signicance (p < 0.05 considered to be statistically signicant).

These changes are consistent with the decrease in cleaved caspase3 in FR180204 treated DENV-infected mice (Fig. 10) indicating a
role of ERK1/2 signaling in DENV-induced apoptosis in vivo.
Fig. 13. Hematological parameters in DENV-infected Balb/c mice with FR180204
treatment. DENV-infected mice were either treated with 2% DMSO (v/v) alone and
treated with FR180204 dissolved in 2% DMSO at a dose of 50 mg/kg. Treatments
were given an hour before infection at a dose of 4 105 FFU, and at one and 24 h post
infection. Seven days after DENV infection, blood samples were processed immediately for hematological analysis including white blood cells (A), platelets (B) and
hematocrit (C). The results obtained from two independent experiments with n = 6
for individual group. The results were expressed as mean SEM from 12 animals
from each group. The asterisks indicate statistically signicant differences between
groups (p < 0.05).

virus infection of neural tissue and DENV infection of immune cells

(Shrestha et al., 2012; Warke et al., 2008). Thus, TRAIL may act as
either an anti-viral protein to limit virus infection or mediate virusinduced cell death at different stages of infection. The FasL/Fas
pathway is involved in DENV-mediated apoptosis of the vascular
endothelial cells (Liao et al., 2010). Moreover, nuclear localization
of DENV capsid protein sensitizes HepG2 cells to Fas-mediated
apoptosis (Limjindaporn et al., 2007; Netsawang et al., 2010). The
involvement of ERK1/2 signaling in the mitochondrial pathway of
DENV-induced apoptosis is suggested by the decreased Bid, Bax,
and Bak, components of the apoptosome in DENV-infected liver
after FR180204 treatment. Apoptotic protease activating factor 1
(Apaf-1) was also signicantly decreased by FR180204 treatment.

4. Conclusions
DENV induces phosphorylated ERK1/2 in vivo and inhibition of
ERK1/2 by FR180204 treatment signicantly reduces immune cellinduced liver injury during DENV infection.
Acknowledgements
This work was supported by Siriraj Research and Development
Grant No. R015533001, Mahidol University, Thailand to TL. SG
was supported by Siriraj Graduate Thesis Scholarship. We appreciate the kind assistance from Dr. Amar Nagila for preparing the
viral stock, Professor William A. Fonzi, Professor Guy Haegeman,
for the critical reading and editing of this manuscript. TL and SN
are Thailand Research Fund (TRF) Scholars and PY is a TRF-Senior
Research Scholar.
References
Atrasheuskaya, A., Petzelbauer, P., Fredeking, T.M., Ignatyev, G., 2003. Anti-TNF antibody treatment reduces mortality in experimental dengue virus infection. FEMS
Immunol. Med. Microbiol. 35 (1), 3342.

G.P. Sreekanth et al. / Virus Research 188 (2014) 1526

Barth, O.M., Barreto, D.F., Paes, M.V., Takiya, C.M., Pinhao, A.T., Schatzmayr, H.G.,
2006. Morphological studies in a model for dengue-2 virus infection in mice.
Mem. Inst. Oswaldo Cruz 101 (8), 905915.
Binh, P.T., Matheus, S., Huong, V.T., Deparis, X., Marechal, V., 2009. Early clinical and
biological features of severe clinical manifestations of dengue in Vietnamese
adults. J. Clin. Virol. 45 (4), 276280.
Ceballos-Olvera, I., Chavez-Salinas, S., Medina, F., Ludert, J.E., del Angel, R.M., 2010.
JNK phosphorylation, induced during dengue virus infection, is important for
viral infection and requires the presence of cholesterol. Virology 396 (1), 3036.
Chang, T.H., Chen, S.R., Yu, C.Y., Lin, Y.S., Chen, Y.S., Kubota, T., Matsuoka, M., Lin, Y.L.,
2012. Dengue virus serotype 2 blocks extracellular signal-regulated kinase and
nuclear factor-kappaB activation to downregulate cytokine production. PLoS
ONE 7 (8), e41635.
Chen, H.C., Hofman, F.M., Kung, J.T., Lin, Y.D., Wu-Hsieh, B.A., 2007. Both virus and
tumor necrosis factor alpha are critical for endothelium damage in a mouse
model of dengue virus-induced hemorrhage. J. Virol. 81 (11), 55185526.
Chen, H.C., Lai, S.Y., Sung, J.M., Lee, S.H., Lin, Y.C., Wang, W.K., Chen, Y.C., Kao, C.L.,
King, C.C., Wu-Hsieh, B.A., 2004. Lymphocyte activation and hepatic cellular
inltration in immunocompetent mice infected by dengue virus. J. Med. Virol.
73 (3), 419431.
Costa, V.V., Fagundes, C.T., Valadao, D.F., Cisalpino, D., Dias, A.C., Silveira, K.D.,
Kangussu, L.M., Avila, T.V., Bonm, M.R., Bonaventura, D., Silva, T.A., Sousa,
L.P., Rachid, M.A., Vieira, L.Q., Menezes, G.B., de Paula, A.M., Atrasheuskaya, A.,
Ignatyev, G., Teixeira, M.M., Souza, D.G., 2012. A model of DENV-3 infection that
recapitulates severe disease and highlights the importance of IFN-gamma in
host resistance to infection. PLoS Negl. Trop. Dis. 6 (5), e1663.
Couvelard, A., Marianneau, P., Bedel, C., Drouet, M.T., Vachon, F., Henin, D., Deubel,
V., 1999. Report of a fatal case of dengue infection with hepatitis: demonstration of dengue antigens in hepatocytes and liver apoptosis. Hum. Pathol. 30 (9),
11061110.
de-Oliveira-Pinto, L.M., Marinho, C.F., Povoa, T.F., de Azeredo, E.L., de Souza, L.A.,
Barbosa, L.D., Motta-Castro, A.R., Alves, A.M., Avila, C.A., de Souza, L.J., da Cunha,
R.V., Damasco, P.V., Paes, M.V., Kubelka, C.F., 2012. Regulation of inammatory
chemokine receptors on blood T cells associated to the circulating versus liver
chemokines in dengue fever. PLoS ONE 7 (7), e38527.
El-Bacha, T., Midlej, V., Pereira da Silva, A.P., Silva da Costa, L., Benchimol, M., Galina,
A., Da Poian, A.T., 2007. Mitochondrial and bioenergetic dysfunction in human
hepatic cells infected with dengue 2 virus. Biochim. Biophys. Acta 1772 (10),
11581166.
Espina, L.M., Valero, N.J., Hernandez, J.M., Mosquera, J.A., 2003. Increased apoptosis
and expression of tumor necrosis factor-alpha caused by infection of cultured
human monocytes with dengue virus. Am. J. Trop. Med. Hyg. 68 (1), 4853.
Franca, R.F., Zucoloto, S., da Fonseca, B.A., 2010. A BALB/c mouse model shows that
liver involvement in dengue disease is immune-mediated. Exp. Mol. Pathol. 89
(3), 321326.
Garcia-Lastra, R., San-Miguel, B., Crespo, I., Jorquera, F., Alvarez, M., GonzalezGallego, J., Tunon, M.J., 2009. Signaling pathways involved in liver injury and
regeneration in rabbit hemorrhagic disease, an animal model of virally-induced
fulminant hepatic failure. Vet. Res. 41 (1), 2.
Gentry, M.K., Henchal, E.A., McCown, J.M., Brandt, W.E., Dalrymple, J.M., 1982. Identication of distinct antigenic determinants on dengue-2 virus using monoclonal
antibodies. Am. J. Trop. Med. Hyg. 31 (3 Pt 1), 548555.
Guabiraba, R., Besnard, A.G., Marques, R.E., Maillet, I., Fagundes, C.T., Conceicao, T.M.,
Rust, N.M., Charreau, S., Paris, I., Lecron, J.C., Renauld, J.C., Quesniaux, V., Da Poian,
A.T., Arruda, L.B., Souza, D.G., Ryffel, B., Teixeira, M.M., 2013. IL-22 modulates IL17A production and controls inammation and tissue damage in experimental
dengue infection. Eur. J. Immunol. 43 (6), 15291544.
Guabiraba, R., Marques, R.E., Besnard, A.G., Fagundes, C.T., Souza, D.G., Ryffel, B.,
Teixeira, M.M., 2010. Role of the chemokine receptors CCR1, CCR2 and CCR4 in
the pathogenesis of experimental dengue infection in mice. PLoS ONE 5 (12),
e15680.
Halstead, S.B., 1988. Pathogenesis of dengue: challenges to molecular biology. Science 239 (4839), 476481.
Halstead, S.B., 2007. Dengue. Lancet 370 (9599), 16441652.
Henchal, E.A., McCown, J.M., Burke, D.S., Seguin, M.C., Brandt, W.E., 1985. Epitopic
analysis of antigenic determinants on the surface of dengue-2 virions using
monoclonal antibodies. Am. J. Trop. Med. Hyg. 34 (1), 162169.
Huerre, M.R., Lan, N.T., Marianneau, P., Hue, N.B., Khun, H., Hung, N.T., Khen,
N.T., Drouet, M.T., Huong, V.T., Ha, D.Q., Buisson, Y., Deubel, V., 2001. Liver
histopathology and biological correlates in ve cases of fatal dengue fever in
Vietnamese children. Virchows Arch. 438 (2), 107115.
Huerta-Zepeda, A., Cabello-Gutierrez, C., Cime-Castillo, J., Monroy-Martinez, V.,
Manjarrez-Zavala, M.E., Gutierrez-Rodriguez, M., Izaguirre, R., Ruiz-Ordaz, B.H.,
2008. Crosstalk between coagulation and inammation during dengue virus
infection. Thromb. Haemost. 99 (5), 936943.
Jirakanjanakit, N., Sanohsomneing, T., Yoksan, S., Bhamarapravati, N., 1997. The
micro-focus reduction neutralization test for determining dengue and Japanese
encephalitis neutralizing antibodies in volunteers vaccinated against dengue.
Trans. R. Soc. Trop. Med. Hyg. 91 (5), 614617.
Kuo, C.H., Tai, D.I., Chang-Chien, C.S., Lan, C.K., Chiou, S.S., Liaw, Y.F., 1992. Liver
biochemical tests and dengue fever. Am. J. Trop. Med. Hyg. 47 (3), 265270.
Lan, L., Gorke, S., Rau, S.J., Zeisel, M.B., Hildt, E., Himmelsbach, K., Carvajal-Yepes,
M., Huber, R., Wakita, T., Schmitt-Graeff, A., Royer, C., Blum, H.E., Fischer, R.,
Baumert, T.F., 2008. Hepatitis C virus infection sensitizes human hepatocytes to
TRAIL-induced apoptosis in a caspase 9-dependent manner. J. Immunol. 181 (7),
49264935.

25

Lee, Y.R., Lei, H.Y., Chen, S.H., Wang, J.R., Lin, Y.S., Yeh, T.M., Liu, C.C., Liu, H.S., 2008.
Signaling pathways involved in dengue-2 virus infection induced RANTES overexpression. Am. J. Infect. Dis. 4 (1), 3240.
Liao, H., Xu, J., Huang, J., 2010. FasL/Fas pathway is involved in dengue virus
induced apoptosis of the vascular endothelial cells. J. Med. Virol. 82 (8),
13921399.
Limjindaporn, T., Netsawang, J., Noisakran, S., Thiemmeca, S., Wongwiwat, W., Sudsaward, S., Avirutnan, P., Puttikhunt, C., Kasinrerk, W., Sriburi, R., Sittisombut,
N., Yenchitsomanus, P.T., Malasit, P., 2007. Sensitization to Fas-mediated apoptosis by dengue virus capsid protein. Biochem. Biophys. Res. Commun. 362 (2),
334339.
Limonta, D., Capo, V., Torres, G., Perez, A.B., Guzman, M.G., 2007. Apoptosis in tissues
from fatal dengue shock syndrome. J. Clin. Virol. 40 (1), 5054.
Lin, C.F., Wan, S.W., Chen, M.C., Lin, S.C., Cheng, C.C., Chiu, S.C., Hsiao, Y.L., Lei, H.Y.,
Liu, H.S., Yeh, T.M., Lin, Y.S., 2008. Liver injury caused by antibodies against
dengue virus nonstructural protein 1 in a murine model. Lab. Invest. 88 (10),
10791089.
Marianneau, P., Steffan, A.M., Royer, C., Drouet, M.T., Kirn, A., Deubel, V., 1998. Differing infection patterns of dengue and yellow fever viruses in a human hepatoma
cell line. J. Infect. Dis. 178 (5), 12701278.
Matsuda, T., Almasan, A., Tomita, M., Tamaki, K., Saito, M., Tadano, M., Yagita, H., Ohta,
T., Mori, N., 2005. Dengue virus-induced apoptosis in hepatic cells is partly mediated by Apo2 ligand/tumour necrosis factor-related apoptosis-inducing ligand.
J. Gen. Virol. 86 (Pt 4), 10551065.
Molthathong, S., Buaklin, A., Senapin, S., Klinbunga, S., Rojtinnakorn, J., Flegel, T.W.,
2008. Up-regulation of ribophorin I after yellow head virus (YHV) challenge
in black tiger shrimp Penaeus monodon. Fish Shellsh Immunol. 25 (12),
4046.
Morchang, A., Yasamut, U., Netsawang, J., Noisakran, S., Wongwiwat, W.,
Songprakhon, P., Srisawat, C., Puttikhunt, C., Kasinrerk, W., Malasit, P., Yenchitsomanus, P.T., Limjindaporn, T., 2011. Cell death gene expression prole:
role of RIPK2 in dengue virus-mediated apoptosis. Virus Res. 156 (12),
2534.
Nagila, A., Netsawang, J., Srisawat, C., Noisakran, S., Morchang, A., Yasamut, U., Puttikhunt, C., Kasinrerk, W., Malasit, P., Yenchitsomanus, P.T., Limjindaporn, T.,
2011. Role of CD137 signaling in dengue virus-mediated apoptosis. Biochem.
Biophys. Res. Commun. 410 (3), 428433.
Nagila, A., Netsawang, J., Suttitheptumrong, A., Morchang, A., Khunchai, S., Srisawat,
C., Puttikhunt, C., Noisakran, S., Yenchitsomanus, P.T., Limjindaporn, T., 2013.
Inhibition of p38MAPK and CD137 signaling reduce dengue virus-induced TNFalpha secretion and apoptosis. Virol. J. 10 (1), 105.
Nasirudeen, A.M., Liu, D.X., 2009. Gene expression proling by microarray analysis
reveals an important role for caspase-1 in dengue virus-induced p53-mediated
apoptosis. J. Med. Virol. 81 (6), 10691081.
Nasirudeen, A.M., Wang, L., Liu, D.X., 2008. Induction of p53-dependent and
mitochondria-mediated cell death pathway by dengue virus infection of human
and animal cells. Microbes Infect. 10 (1011), 11241132.
Netsawang, J., Noisakran, S., Puttikhunt, C., Kasinrerk, W., Wongwiwat, W., Malasit,
P., Yenchitsomanus, P.T., Limjindaporn, T., 2010. Nuclear localization of dengue
virus capsid protein is required for DAXX interaction and apoptosis. Virus Res.
147 (2), 275283.
Nguyen, T.L., Nguyen, T.H., Tieu, N.T., 1997. The impact of dengue haemorrhagic fever
on liver function. Res. Virol. 148 (4), 273277.
Ohori, M., Kinoshita, T., Okubo, M., Sato, K., Yamazaki, A., Arakawa, H., Nishimura,
S., Inamura, N., Nakajima, H., Neya, M., Miyake, H., Fujii, T., 2005. Identication
of a selective ERK inhibitor and structural determination of the inhibitor-ERK2
complex. Biochem. Biophys. Res. Commun. 336 (1), 357363.
Ohori, M., Takeuchi, M., Maruki, R., Nakajima, H., Miyake, H., 2007. FR180204, a novel
and selective inhibitor of extracellular signal-regulated kinase, ameliorates
collagen-induced arthritis in mice. Naunyn. Schmiedebergs Arch. Pharmacol.
374 (4), 311316.
Paes, M.V., Lenzi, H.L., Nogueira, A.C., Nuovo, G.J., Pinhao, A.T., Mota, E.M., Basiliode-Oliveira, C.A., Schatzmayr, H., Barth, O.M., Alves, A.M., 2009. Hepatic damage
associated with dengue-2 virus replication in liver cells of BALB/c mice. Lab.
Invest. 89 (10), 11401151.
Paes, M.V., Pinhao, A.T., Barreto, D.F., Costa, S.M., Oliveira, M.P., Nogueira, A.C., Takiya,
C.M., Farias-Filho, J.C., Schatzmayr, H.G., Alves, A.M., Barth, O.M., 2005. Liver
injury and viremia in mice infected with dengue-2 virus. Virology 338 (2),
236246.
Raman, M., Chen, W., Cobb, M.H., 2007. Differential regulation and properties of
MAPKs. Oncogene 26 (22), 31003112.
Renneson, J., Guabiraba, R., Maillet, I., Marques, R.E., Ivanov, S., Fontaine, J., Paget, C.,
Quesniaux, V., Faveeuw, C., Ryffel, B., Teixeira, M.M., Trottein, F., 2011. A detrimental role for invariant natural killer T cells in the pathogenesis of experimental
dengue virus infection. Am. J. Pathol. 179 (4), 18721883.
Shrestha, B., Pinto, A.K., Green, S., Bosch, I., Diamond, M.S., 2012. CD8+ T cells use
TRAIL to restrict West Nile virus pathogenesis by controlling infection in neurons. J. Virol. 86 (17), 89378948.
Souza, L.J., Alves, J.G., Nogueira, R.M., Gicovate Neto, C., Bastos, D.A., Siqueira, E.W.,
Souto Filho, J.T., Cezario Tde, A., Soares, C.E., Carneiro Rda, C., 2004. Aminotransferase changes and acute hepatitis in patients with dengue fever: analysis of
1585 cases. Braz. J. Infect. Dis. 8 (2), 156163.
Sun, P., Celluzzi, C.M., Marovich, M., Subramanian, H., Eller, M., Widjaja, S., Palmer, D.,
Porter, K., Sun, W., Burgess, T., 2006. CD40 ligand enhances dengue viral infection
of dendritic cells: a possible mechanism for T cell-mediated immunopathology.
J. Immunol. 177 (9), 64976503.

26

G.P. Sreekanth et al. / Virus Research 188 (2014) 1526

Sung, J.M., Lee, C.K., Wu-Hsieh, B.A., 2012. Intrahepatic inltrating NK and CD8T cells
cause liver cell death in different phases of dengue virus infection. PLoS ONE 7
(9), e46292.
Thongtan, T., Panyim, S., Smith, D.R., 2004. Apoptosis in dengue virus infected liver
cell lines HepG2 and Hep3B. J. Med. Virol. 72 (3), 436444.
Towbin, H., Staehelin, T., Gordon, J., 1979. Electrophoretic transfer of proteins from
polyacrylamide gels to nitrocellulose sheets: procedure and some applications.
Proc. Natl. Acad. Sci. U.S.A. 76 (9), 43504354.

Warke, R.V., Martin, K.J., Giaya, K., Shaw, S.K., Rothman, A.L., Bosch, I., 2008.
TRAIL is a novel antiviral protein against dengue virus. J. Virol. 82 (1),
555564.
Yen, Y.T., Chen, H.C., Lin, Y.D., Shieh, C.C., Wu-Hsieh, B.A., 2008. Enhancement by
tumor necrosis factor alpha of dengue virus-induced endothelial cell production
of reactive nitrogen and oxygen species is key to hemorrhage development. J.
Virol. 82 (24), 1231212324.