International Biodeterioration & Biodegradation 103 (2015) 179e185

Contents lists available at ScienceDirect

International Biodeterioration & Biodegradation

journal homepage: www.elsevier.com/locate/ibiod

Bioremediation of inorganic mercury through volatilization

and biosorption by transgenic Bacillus cereus BW-03(pPW-05)
Hirak R. Dash, Surajit Das*
Laboratory of Environmental Microbiology and Ecology (LEnME), Department of Life Science, National Institute of Technology, Rourkela, 769 008, Odisha,
India

a r t i c l e i n f o

a b s t r a c t

Article history:
Received 20 November 2014
Received in revised form
22 April 2015
Accepted 23 April 2015
Available online 16 May 2015

A transgenic bacterium Bacillus cereus BW-03(pPW-05) was constructed by transforming a plasmid

harbouring mer operon of a marine bacterium Bacillus thuringiensis PW-05 into another mercury resistant marine bacterium B. cereus BW-03 with mercury biosorption capability. The transformant was able
to remove >99% of mercury supplement in-vitro by simultaneous volatilization (>53%) and biosorption
(~40%). Encapsulation of the transformant increased its mercury removal potential to almost 100%.
Additionally, B. cereus BW-03(pPW-05) could resist wide variations of salinity (5e30 ppt), pH (Brierley
et al., 1989; Chung et al., 1989; Chen and Wilson, 1997; Chakraborty and Das, 2014) and mercury (5
e50 ppm) and survived in mercury contaminated simulated environment up to 7 days. eSH and eCOOH
groups were possibly involved for mercury biosorption under laboratory conditions. The potential for
application of this transgenic bacterium for in-situ bioremediation was demonstrated in a microcosm
experiment, where it removed 96.4% inorganic mercury synergistically with the normal microbiota.
2015 Elsevier Ltd. All rights reserved.

Keywords:
Transformation
mer operon
Inorganic mercury
Biosorption
Volatilization

Introduction
Mercury is one of the most toxic metals among the pollutants
and there are many reports of using marine bacteria for bioremediation of mercury (De et al., 2006). The reported microorganisms
have been found to remove mercury either via mer operon mediated mercury resistance pathways (Dash and Das, 2012) or extracellular absorption of mercury (Francois et al., 2012). The mer
operon mediated mercury resistance results in the conversion of
cationic mercury (Hg2) to volatile, relatively less toxic Hg0. The
mer operon has been found to be present either in plasmid or
genomic DNA or located within transposons (Barkay et al., 2003).
Though the research on mercury and mercury resistant bacteria
has been conducted for many decades, the quest for the most
suitable mechanisms of mercury bioremediation is still going on
(Dash and Das, 2012). Much progress has been achieved for
bioremediation of mercury by marine bacteria (De et al., 2006;
bler, 2013). However, complete
Zhang et al., 2012; Wagner-Do
removal of mercury from the contaminated environments is still a
challenge in microbial treatment systems.

* Corresponding author. Tel.: 91 661 2462684; fax: 91 661 2462022.

E-mail addresses: surajit@nitrkl.ac.in, surajit@myself.com (S. Das).
http://dx.doi.org/10.1016/j.ibiod.2015.04.022
0964-8305/ 2015 Elsevier Ltd. All rights reserved.

There are many reports of using marine bacteria as well as many

transgenic bacteria for the treatment of mercury contaminated
wastes (Chen and Wilson, 1997; Ruiz et al., 2011; Dash et al., 2014).
However, most of the studies using transgenic bacteria harbour one
of the two most elucidated mechanisms of mercury bioremediation
i.e. either mer operon mediated volatilization or mercury biosorption. Ruiz et al. (2011) developed a transgenic bacterium for
mercury bioremediation by expressing metallothionein (mt-1) and
polyphosphate kinase (ppk) genes in Escherichia coli JM109 for
mercury biosorption. In a similar fashion, Chen and Wilson (1997)
used the gene fusion vector system to construct pSUTP by inserting
merT and merP in GST fusion protein of pea MT and subsequent
transformation in E. coli JM109. This construct was also found to be
helpful for biosorption of mercury from the contaminated wastes.
In this regard, construction of a transgenic bacterium harbouring
both the mechanisms of mercury resistance (volatilization and
absorption) in a wild marine strain with higher mercury removal
ability promises a better strategy for mercury bioremediation insitu.
Nevertheless, incorporation of both the above mentioned
mechanisms (volatilization and absorption) in an engineered bacterium will not only accumulate a high concentration of mercury,
but also can remove mercury from the contaminated environments. Hence, the prime objective of the present work was to

180

H.R. Dash, S. Das / International Biodeterioration & Biodegradation 103 (2015) 179e185

optimize removal of inorganic mercury by combining biosorption

with volatilization via the mer operon based pathway in a transgenic bacterium.
Methods
Strains selection, their characterization and growth medium used
Two Bacillus species Bacillus thuringiensis PW-05 (GenBank
accession no. JX273776) and Bacillus cereus BW-03 (GenBank
accession no. KF241550) were previously isolated from the marine
environment of the Bay of Bengal, in India and used during this
study. B. thuringiensis PW-05 was found to be a highly mercury
resistant marine bacterium resisting up to 50 ppm of HgCl2 and
possess plasmid mediated volatilization of inorganic mercury at a
level of >90% when 25 ppm of initial mercury concentration was
used (Dash et al., 2014). In contrast, B. cereus BW-03 possesses the
non-mer operon based biosorption and mercury resistance at a
concentration of 50 ppm. Modication of eSH group in this isolate
conrmed its functional role in biosorption of mercury and the
isolate had the capability of removing up to 71% of inorganic
mercury under laboratory conditions (De et al., 2014). Due to the
marine origin, the routine growth medium used was sea water
nutrient (SWN) agar (peptone e 5 g, yeast extract e 3.0 g, agar e
15 g, aged sea water e 500 ml, deionized water e 500 ml, pH e
7.5 0.1) supplemented with 10 ppm of mercury as HgCl2.
Transformation of Hg resistant plasmid and screening of functional
transformants
The mer operon is present in the plasmid of B. thuringiensis PW05 (Dash et al., 2014). Thus, competent cells of B. cereus BW-03 were
prepared using TSS buffer (PEG8000 e 5 g, 1M MgCl2 e 1.5 ml,
DMSO e 2.5 ml, Luria Bertani broth e 50 ml, lter sterilize by
0.22 mm lter). Briey, an overnight grown culture of bacterium
was diluted to OD630 0.2e0.5, centrifuged at 3000 rpm, 10 min, 4  C.
The cell pellets were suspended in chilled TSS buffer (10% of the
culture volume) and 100 ml aliquots were transferred to chilled
centrifuge tubes and stored immediately at 80  C (Chung et al.,
1989). Plasmids were isolated from B. thuringiensis PW-05 using
standard procedure (Sambrook and Russell, 2001) and the presence
of mer operon was conrmed by PCR amplication of merA gene in
the isolated plasmid, which was stored at 20  C till further use. For
transformation, 100 ng/ml of isolated plasmid was mixed with
100 ml of competent cell solution and incubated on ice for 10 min
followed by heat shock to the cells for 2 min at 42  C. The cells were
re-suspended in 900 ml of Luria Bertani (LB) broth supplemented
with 30 mg/ml of ampicillin and incubated at 37  C with shaking for
2 h. The cells were then transferred to LB agar plates supplemented
with 30 mg/ml of ampicillin and 49.94 mg/ml of mercury as HgCl2
and incubated for 24 h at 37  C. The colonies of transformant
B. cereus BW-03(pPW-05) were grown on the plates and the
transformation was conrmed by amplication of merA gene,
mercury volatilization and biosorption assay (Nakamura and
Nakahara, 1988; Dash et al., 2014; De et al., 2014). Transformation
efciency of this technique was found to be 2  108 CFU/mg DNA.
Mercury resistant bioassay, characterization of B. cereus BW03(pPW-05) and survival
B. cereus BW-03(pPW-05) was grown in SWN broth at various
concentrations of mercury as HgCl2 (i.e. 5, 10, 15, 30 and 50 ppm)
and the growth pattern was quantied by detecting OD630 followed
by viable cell count. The effect of pH (5.0, 6.0, 7.0 and 8.0) and
salinity (5, 10, 15 and 30 ppt) on growth of the transformant was

also investigated. Survival of the transformant was monitored by

measuring the growth in terms of OD630 and viable cell count for 10
days both in presence and absence of mercury stress. Mercury
biosorption by the transformant was also studied by H2S assay (De
et al., 2014). FTIR analysis was carried out to trace the modication
of functional groups due to mercury biosorption by B. cereus BW03(pPW-05). B. cereus BW-03(pPW-05) was grown both in presence
(50 ppm) and absence of mercury supplementation, cell pellets
were harvested by centrifugation at 8000 rpm for 10 min followed
by mixing with 2% KBr. The mixture was compressed into translucent sample disks and xed in the FTIR spectrometer (PerkineElmer RX I) for analysis (Deng and Wang, 2012).
Mercury removal, biosorption and volatilization potential of
B. cereus BW-03(pPW-05)
B. cereus BW-03(pPW-05) was inoculated in SWN broth containing 50 ppm of mercury as HgCl2 and grown at 30  C for 48 h.
Both cell pellet and supernatant were collected by centrifugation
and the cell pellet was re-suspended in lysis buffer [100 mM
NaH2PO4, 10 mM Tris-Cl, 8M Urea (pH 8.0)] for 1 h and centrifuged
at 13,000 rpm for 10 min to collect cell associated mercury. The
concentration of mercury in both supernatant and cell mass were
determined by cold vapour atomic absorption spectrophotometry
(PerkineElmer AAnalyst 200) with a standard solution of HgCl2
(Merck, India).
Microcosm study of mercury removal by B. cereus BW-03(pPW-05)
Microcosms were prepared in sterile conical asks containing
20 g of sediment samples collected from Paradeep region of Bay of
Bengal, Odisha, India (2017.5080 N & 086 42.9660 E). The initial
concentration of mercury in the sediment samples was measured
using cold vapour atomic absorption spectrophotometer (AAS). The
sediment samples were treated with required amount of HgCl2
solution to obtain a nal concentration of 25 ppm. 1 ml of 0.5
McFarland culture of B. cereus BW-03(pPW-05) was inoculated into
the microcosm and incubated at 30  C. Mercury content as well as
other physicoechemical parameters such as pH, salinity and temperature was determined at regular intervals as described elsewhere (Dash et al., 2014). The experiment was performed in four
sets (with triplicates) i.e. microcosm with B. cereus BW-03(pPW-05)
in unsterilized sediment sample (E1), with sterilized sediment
sample (E2), without inoculum in unsterilized sediment sample
(E3) and sterilized sediment samples (E4) as negative control.
Statistical analysis
The statistical signicance of the variation in mercury removal
efciency among the experimental treatments was determined by
2-way ANOVA, P < 0.05.
Expression level of merA gene under varied salinity conditions
Quantitative Real-time Polymerase chain reaction (qRT-PCR)
was carried out following Zhang et al. (2012) to study the expression pattern of transformed merA gene under various experimental
conditions of salinity i.e. 5, 10, 15 and 30 ppt. RNA was extracted
from cells using RNA purication kit (Fermentas, USA). cDNA was
prepared from the extracted RNA with the random hexamer primer
and the RevertAid First Strand cDNA synthesis kit (Thermo Scientic, USA). The synthesized cDNA was used as the template to carry
out RT-PCR in an eppendrof real time detection system by using
SYBR Green JumpStart Taq ReadyMix (SigmaeAldrich). The
primers used for this study were merAF (50 GAGATCTAAAG

H.R. Dash, S. Das / International Biodeterioration & Biodegradation 103 (2015) 179e185

CACGCTAAGGC30 ) and merAR (50 GGAATCTTGACTGTGATCGGG30 )

(Dash et al., 2014). 16S rRNA was used as an internal control for this
experiment. Dissociation analysis was performed at the end of each
PCR run to conrm that only PCR product was amplied and
detected. The comparative threshold cycle method (2DDCT) was
used to analyze the relative mRNA expression by using Mastercycler ep realplex (Eppendorf, Germany).
Removal of mercury by B. cereus BW-03(pPW-05) after
encapsulation
In order to enhance the mercury removal potential of B. cereus
BW-03(pPW-05), it was encapsulated in sodium alginate beads
following Lotpour et al. (2012). Briey, the overnight grown culture of B. cereus BW-03(pPW-05) in SWN broth supplemented with
10 ppm HgCl2 was mixed with 20 ml of sterilized 1% w/v sodium
alginate solution, mixed thoroughly for 30 min to obtain a homogenous suspension and the suspension was extruded drop wise
into the sterile hardening solution i.e. 4% w/v CaCl2. The beads were
washed with sterile milliQ water and inoculated into various concentrations of mercury supplementations (10, 20, 30 and 50 ppm)
in SWN broth. After incubation of 24, 48 and 72 h, the supernatant
was harvested after separating the beads and the mercury was
analysed using cold vapour atomic absorption spectrophotometer
(AAS) (PerkineElmer, USA).
Pathogenicity assessment of the transformant B. cereus BW03(pPW-05)
In order to assess the pathogenicity of the transformant B. cereus
BW-03(pPW-05), phenotypic analyses were carried out such as
motility, biolm formation and cytotoxicity assay (Kamar et al.,
2013). Each experimental set up consisted of three sets i.e. transformant B. cereus BW-03(pPW-05), a pathogenic strain of E. coli
isolated from hospital samples and the negative control. Briey, for
motility assay, the overnight grown cultures were stabbed in
straight lines in soft nutrient agar tubes. The growth was monitored
after incubation at 37  C for 24 h and the average distance of the
growth from the stabbing line was measured in each case. The
biolm formation assay was performed with the micro-titre plate
technique. The biolm forming ability of the isolates was quantied
by measuring OD at 595 nm after staining with 0.1% crystal violet
and subsequent decolourization with ethanol. For cytotoxicity
assay, the isolates were grown for 48 h in LB broth and three dilutions (10 ml, 50 ml and 100 ml) of the supernatant after centrifugation were tested. The keratinocyte cell line (HaCaT) was seed
cultured in DMEM medium (Life Technologies, USA) supplemented
with 4.5 g/l glucose, 2 mM L-glutamine and 10% fetal bovine serum
and treated with the culture supernatants for 48 h. Subsequently,
MTT assay was performed in a micro-titre plate reader to determine
the cytotoxicity level of the isolates (Garca et al., 2010).
Results and discussion
Transformation of mercury resistant plasmid and screening of
functional transformants
The parent strains of marine bacteria B. thuringiensis PW-05 and
B. cereus BW-03 have shown mercury resistance by mer operon
mediated volatilization and biosorption of mercury, respectively.
Transformant B. cereus BW-03(pPW-05) was screened on SWN agar
plates supplemented with 50 ppm HgCl2 and ampicillin. Colony
PCR conrmed the successful transformation by amplication of
merA gene followed by volatilization of mercury. Many marine
bacteria including Alcaligenes faecalis, Bacillus pumilus,

181

Pseudomonas aeruginosa (De et al., 2008), B. thuringiensis (Dash

et al., 2014), Azotobacter sp., Bacillus sp. (Francois et al., 2012) and
Pseudomonas putida (Zhang et al., 2012) have been reported with
enormous bioremediation potential of mercury. This may be due to
the fact that these marine bacteria are naturally living under constant stress (Dash et al., 2013). Hence, the marine bacterium
B. cereus BW-03 is also expected to retain its natural adaptability in
the transformant B. cereus BW-03(pPW-05).
Mercury resistant bioassay, characterization of B. cereus BW03(pPW-05) and survival
The MIC of B. cereus BW-03(pPW-05) for mercury was 50 ppm
and the transformant was able to grow both in presence and
absence of mercury up to 50 ppm. The growth of the transformant
with mercury is due to the mer operon mediated mercury resistance. Further, the transformant was found to survive up to 7 days
in presence of mercury stress conrming its stability. In addition to
that, the transformant was able to survive in a wide range of pH and
salinity conditions (Fig. 1). This further suggests the utility of the
transformant in poly-extreme environmental conditions. B. cereus
BW-03(pPW-05) was found to grow in presence of up to 50 ppm of
HgCl2, 458 ppm CdCl2, 1614 ppm ZnSO4, 2500 ppm Pb(NO3)2 and
465 ppm Na2HAsO4  7H2O. The strain was found to be resistant to
the antibiotics Amoxycillin (30 mg), Cephradine (30 mg), Ampicillin
(10 mg), Methicillin (5 mg), Vancomycin (30 mg) and sensitive to
Chloramphenicol (30 mg) and Kanamycin (30 mg) by disc diffusion
assay (Bauer et al., 1966) as per the interpretation chart provided by
the manufacturer (Hi-Media, India).
Marine bacteria possess certain unique characters to overcome
the extreme physicoechemical parameters of pH, temperature and
salinity by secreting secondary metabolites, shifting their physical
locations, presence of unknown protein in their cell membrane or
by symbiosis with other organisms (Dash et al., 2013). Thus, the
transformant B. cereus BW-03(pPW-05) possessed most of the
characteristics of parent B. cereus BW-03 and survived at wide
variations of salinity (5e30 ppt), pH (Brierley et al., 1989; Chung
et al., 1989; Chen and Wilson, 1997; Chakraborty and Das, 2014)
and mercury (5e50 ppm) for 7 days.
Mercury removal, biosorption and volatilization potential of
B. cereus BW-03(pPW-05)
As the transgenic strain exhibits mercury volatilization as well
as mercury biosorption, H2S assay was performed and the development of black colour conrmed the biosorption of mercury. No
such colour development was noticed when the transformant was
grown with other toxic metals such as cadmium (458.3 ppm), lead
(2500 ppm), zinc (1614 ppm) and arsenic (464.8 ppm). A comparison of IR spectra of B. cereus BW-03(pPW-05) with and without
supplementation of Hg2 demonstrated sharp shifts in wave
numbers of some functional groups in the range of 400e4000 cm1
(Table 1). The peaks at 3283.16 cm1, 1650.14 cm1, 1385.63 cm1,
1095.78 cm1 and 668.53 cm1 in the absence of Hg2 were
attributed to bonded hydroxyl group (eOH), amide (C]O), Nitrile
(CeN), phosphate group (P]O stretch) and alkyl halide respectively. In presence of Hg2, these peaks shifted to further lower
wave numbers suggesting a possible involvement of these functional groups in mercury metabolism by this transformant. Similar
observation was also found in the parent strains B. thuringiensis
PW-05 and B. cereus BW-03.
The transformant B. cereus BW-03(pPW-05) showed a large
improvement in its mercury removal efciency in comparison to
one of the parent strains B. cereus BW-03 (the biosorbing strain),
whereas a marginal increase was observed in comparison to the

182

H.R. Dash, S. Das / International Biodeterioration & Biodegradation 103 (2015) 179e185

Fig. 1. Growth and survival pattern of the transgenic strain B. cereus BW-03(pPW-05) on SWN broth (peptone e 5 g, yeast extract e 3.0 g, aged sea water e 500 ml, deionized water
e 500 ml) (a) at different mercury concentrations (5, 10, 15, 30 and 50 ppm); (b) at different pH conditions (pH 5, 6, 7 and 8); (c) Under salinity stress conditions (5, 10, 15 and
30 ppt); (d) Comparison of survival in presence and absence of mercury (10 ppm).

Table 1
Modication of functional groups in presence of Hg2 supplementation in transgenic B. cereus BW-03(pPW-05).
Groups

Bonded eOH
SeH stretch
Amide C]O stretch
Nitrile CeN stretch
Phosphate P]O stretch
Alkyl halide

B. cereus BW-03(pPW-05)
W/o Hg2

With Hg2

3432.41
2449.50
1721.56
1275.84
1057.85
976.10

3413.92
2367.75
1676.79
1258.32
1039.35
976.10

were the target of genetic modication. Most of the previous studies

discussed on the enhanced uptake and bioaccumulation of mercury
either by incorporation of Synthetic phytochelatins (ECs) (Bae et al.,
2001) or expression of metallothionein (MT) and polyphosphate
kinase (ppk) (Ruiz et al., 2011). Expression of MT and ppk in transgenic E. coli increased its mercury removal efciency to 83% (Ruiz
et al., 2011) which is less than the combinatorial mercury removal
efciency of the transgenic strain B. cereus BW-03(pPW-05).
Expression level of merA and microcosm study of mercury removal
by B. cereus BW-03(pPW-05)

mercury volatilizing strain B. thuringiensis PW-05 (Fig. 2). This performance is superior to that reported previously for organisms
engineered for mercury remediation, where either biosorption
(Chen and Wilson, 1997; Bae et al., 2001; Ruiz et al., 2011) or volatilization activities (Kiyono and Pan-Hou, 2006; Haque et al., 2010)

Various salinity conditions did not affect the transcription level

of 16S rRNA gene in B. cereus BW-03(pPW-05) (internal control).
However, the expression of merA gene was signicantly inuenced
by salinity stress and the mRNA level was higher in low salinity
condition (Fig. 3).

Fig. 2. In-vitro mercury removal potential of the test organisms B. thuringiensis PW-05,
B. cereus BW-03, transgenic B. cereus BW-03(pPW-05) and encapsulated B. cereus BW03(pPW-05) with various concentrations of mercury as HgCl2. The absorption capacity
of the alginate beads was 0.8%.

Fig. 3. Effect of salinity on the expression of merA. The mRNA level of merA was
normalized to that of 16S rRNA.

H.R. Dash, S. Das / International Biodeterioration & Biodegradation 103 (2015) 179e185

The up-regulation of the expression level of merA gene at low

salinity (5 ppt) in comparison to high salinity condition (30 ppt)
indicates the potential use of the transformant in the low saline
environment also. A similar result was also reported in case of the
parent strain B. thuringiensis PW-05 (Dash et al., 2014) conrming
the similar nature of mer operon present in the transformant
B. cereus BW-03(pPW-05). In contrary, decreased salinity has been
reported to decrease the expression level of other catabolic genes
such as czcABC (Chakraborty and Das, 2014) conrming the strain
specic genetic nature of metal catabolic genes in bacteria.
Mercury removal kinetics of the transgenic bacterium B. cereus
BW-03(pPW-05) was studied in microcosms established with the
sediment samples (Fig. 4). The normal microbiota of the microcosm
could remove 6.4% of mercury whereas; simultaneous action of
normal microbiota and B. cereus BW-03(pPW-05) removed 96.4%
inorganic mercury after 72 h. The physicoechemical parameters of
the microcosm varied less during the experiments.
The microcosm study reveals that, the transformant could
remove mercury efciently with the synergistic action of the
normal microbiota of the marine sediments. This conrms the
applicability of the transformant B. cereus BW-03(pPW-05) in marine environments with mercury contamination. However, with
due course of time, inorganic mercury contamination changes its
form to either ReSeHg or ReCH2eHg in the environment (Dash
and Das, 2012). This reaction of methylation of mercury is slow in
comparison to mercury volatilization or biosorption (Kerin et al.,
2006; Fleming et al., 2006; Zhang et al., 2012). Previous reports
also suggested that the signicant methylation of mercury occurs
only after 3 days to 1 week of contamination (Zhang et al., 2012).
However, the current study reveals the removal of 96.4% of mercury
from the contaminated sediment after 72 h. This suggests that the
faster rate of mercury volatilization and biosorption outclasses the
natural mercury methylation. Thus, the use of this transformant
B. cereus BW-03(pPW-05) can efciently remove freshly contaminated inorganic mercury from the marine sediment.

Fig. 4. Microcosm study of mercury removal efciency of B. cereus BW-03(pPW-05)

with 25 ppm of initial supplement of mercury at 8.31 0.35 pH, 28.24 3.87 ppt of
salinity and 26.83 1.86  C of temperature. E1: B. cereus BW-03(pPW-05) along with
the normal microbiota, E2: the activity of B. cereus BW-03(pPW-05) alone, E3: normal
microbiota alone and E4: negative control (sterile unioculated sediment). The study
has been carried out in triplicates and the data has been represented as mean SD.
Statistical analysis revealed that there is no statistical signicance (P > 0.05) among the
nal physicoechemical parameters after microbial metabolism during mercury
removal whereas, a signicant difference (P < 0.05) was observed among the mercury
removal efciency of the various combinations of microcosms studied.

183

Removal of mercury by encapsulated organism

Encapsulated B. cereus BW-03(pPW-05) was able to remove
mercury ~100% after 24 h with 10 and 20 ppm of mercury supplementation. However, for 30 and 50 ppm of mercury supplementation, complete removal of mercury occurred only after
48e72 h (Fig. 2).
As B. cereus BW-03(pPW-05) possesses both the mechanisms of
mercury resistance, it can remove 99.3% of mercury which is higher
than the parent isolates possessing any individual mechanism i.e.
95.6% (B. thuringiensis PW-05, volatilization) and 71% (B. cereus BW03, biosorption). It has been reported that, immobilization of bacterial cells in some type of networking matrix enhances the sorption of metals by microorganisms (Brierley et al., 1989). Although
encapsulation of B. cereus BW-03(pPW-05) removed ~100% inorganic mercury, this procedure did not improve its mercury removal
efciency signicantly compared to that of planktonic cells. Besides, the immobilized cells can also offer several potential advantages over free cells for bioremediation of various types of
wastes (Bang and Pazirandeh, 1999).
Pathogenicity assessment of the transformant B. cereus BW03(pPW-05)
The transformant B. cereus BW-03(pPW-05) (OD595 0.0772)
produced less biolm compared to the pathogenic strain of E. coli
(OD595 0.177286). Similarly, the transformant was found to travel
<0.1 cm from the stab line, whereas the pathogenic strain of E. coli
migrated up to 0.7 cm from the stab line in the soft agar tubes.
Survival of keratinocyte cell line with culture supernatant of
B. cereus BW-03(pPW-05) was found to be at a higher level than that
of the culture supernatant of pathogenic strain of E. coli irrespective
of the amount of supernatant tested (Fig. 5).
Though B. cereus is considered to be a potential human food
borne pathogen, not all strains of this species are pathogenic
(Kamar et al., 2013). Thus, phenotypic analysis was employed to
evaluate the pathogenicity level of the transformant B. cereus BW03(pPW-05) in this study. There also exists extensive list of use of
Bacillus strains for probiotic use in human (Cutting, 2011), shrimp
(NavinChandran et al., 2014) and rotifers (Murillo and Villamil,
2011). The transformant B. cereus BW-03(pPW-05) used in this
study showed less pathogenicity which was conrmed by biolm
formation, motility test and cytotoxicity assay. Some earlier studies
also indicated that the environmental isolates possess limited
cytotoxicity (Auger et al., 2009; Lopez-Campos et al., 2012). This
further suggests the utility of the transformant for bioremediation
application in natural environmental conditions.
However, the application of genetically engineered microorganisms (GEMs) for bioremediation is limited due to many regulations regarding their use and safety. Thus, the risks associated
with the safe release of the GEMs should be monitored prior to the
release in the eld conditions. In this regard, the selection of
indigenous microbiota (as used in this study) for genetic modication and proper assessment of its pathogenicity may be conducted to achieve a regulatory, safe and cost-effective system for
enhanced bioremediation.
Conclusion
The genetically engineered bacterium B. cereus BW-03(pPW-05)
was capable of simultaneously volatilizing and biosorbing inorganic mercury. With the synergistic action of the normal microbiota, the transformant was able to remove 96.4% inorganic
mercury after 72 h in a soil microcosm. Encapsulation further
increased the mercury removal efciency of the transformant to

184

H.R. Dash, S. Das / International Biodeterioration & Biodegradation 103 (2015) 179e185

Fig. 5. Pathogenicity test of the transformant B. cereus BW-03(pPW-05) revealed by phenotypic analysis, (a) Motility test on soft agar tubes, (b) Biolm formation assay and (c)
Cytotoxicity assay. 1: Transformant B. cereus BW-03(pPW-05), 2: pathogenic E. coli strain, 3: negative control.

~100% under laboratory conditions. Additionally, survival of the

transformant under varied conditions of pH, salinity and mercury
concentration conrmed its usability for treatment of sites freshly
contaminated with mercury.
Acknowledgements
Authors would like to acknowledge the authorities of NIT,
Rourkela for providing facilities. H.R.D. gratefully acknowledges the
receipt of doctoral research fellowship from the NIT, Rourkela (An
Institute of National Importance under Ministry of Human
Resource Development, Government of India). We sincerely
acknowledge the anonymous reviewers and the Editor Prof. Rene
Peter Schneider for their critical comments in improving the
manuscript. Dr. S. K. Bhutia, Department of Life Science, NIT Rourkela is acknowledged for MTT Assay.
References
Auger, S., Ramarao, N., Faille, C., Fouet, A., Aymerich, S., Gohar, M., 2009. Biolm
formation and cell surface properties among pathogenic and nonpathogenic
strains of the Bacillus cereus group. Appl. Environ. Microbiol. 75, 6616e6618.
Bae, W., Mehra, R.K., Mulchandani, A., Chen, W., 2001. Genetic engineering of
Escherichia coli for enhanced uptake and bioaccumulation of mercury. Appl.
Environ. Microbiol. 67, 5335e5338.
Bang, S.S., Pazirandeh, M., 1999. Physical properties and heavy metal uptake of
encapsulated Escherichia coli expressing a metal binding gene (NCP).
J. Microencapsul. 16, 489e499.

Barkay, T., Miller, S.M., Summers, A.O., 2003. Bacterial mercury resistance from
atoms to ecosystems. FEMS Microbiol. Rev. 27, 355e384.
Bauer, A., Kirby, W., Sherris, J., Turck, M., 1966. Antibiotic susceptibility testing by a
standardized single disk method. Am. J. Clin. Path. 45, 493e496.
Brierley, C.L., Brierley, J.A., Davidson, M.S., 1989. Applied microbial processes for
metals recovery and removal from wastewater. In: Beveridge, T.J., Doyle, R.J.
(Eds.), Metal Ions and Bacteria. John Wiley and Sons, New York, pp. 359e382.
Chakraborty, J., Das, S., 2014. Characterization and cadmium resistant gene
expression of biolm forming marine bacterium Pseudomonas aeruginosa JP-11.
Environ. Sci. Pollut. Res. 21, 14188e14201.
Chen, S., Wilson, D.B., 1997. Genetic engineering of bacteria and their potential for
Hg2 bioremediation. Biodegradation 8, 97e103.
Chung, C.T., Niemela, S.L., Miller, R.H., 1989. One-step preparation of competent
Escherichia coli: transformation and storage of bacterial cells in the same solution. Proc. Natl. Acad. Sci. U. S. A. 86, 2172e2175.
Cutting, S.M., 2011. Bacillus probiotics. Food Microbiol. 28, 214e220.
Dash, H.R., Das, S., 2012. Bioremediation of mercury and importance of bacterial mer
genes. Int. Biodeterior. Biodegrad. 75, 207e213.
Dash, H.R., Mangwani, N., Chakrabarty, J., Kumari, S., Das, S., 2013. Marine bacteria:
potential candidates for enhanced bioremediation. Appl. Microbiol. Biotechnol.
97, 561e571.
Dash, H.R., Mangwani, N., Das, S., 2014. Characterization and potential application in
mercury bioremediation of highly mercury-resistant marine bacterium Bacillus
thuringiensis PW-05. Environ. Sci. Pollut. Res. 21, 2642e2653.
De, J., Sarkar, A., Ramaiah, N., 2006. Bioremediation of toxic substances by mercury
resistant marine bacteria. Ecotoxicology 15, 385e389.
De, J., Ramaiah, N., Vardanyan, L., 2008. Detoxication of toxic heavy metals by
marine bacteria highly resistant to mercury. Mar. Biotechnol. 10, 471e477.
De, J., Dash, H.R., Das, S., 2014. Mercury pollution and bioremediation e a case study
on biosorption by a mercury resistant marine bacterium. In: Das, S. (Ed.), Microbial Biodegradation and Bioremediation. Elsevier, USA, pp. 137e166. http://
dx.doi.org/10.1016/B978-0-12-800021-2.00001-7.
Deng, X., Wang, P., 2012. Isolation of marine bacteria highly resistant to mercury
and their bioaccumulation process. Bioresour. Technol. 121, 342e347.

H.R. Dash, S. Das / International Biodeterioration & Biodegradation 103 (2015) 179e185
Fleming, E.J., Mack, E.E., Green, P.G., Nelson, D.C., 2006. Mercury methylation from
unexpected Sources: molybdate-inhibited freshwater sediments and an ironreducing bacterium. Appl. Environ. Microbiol. 72, 457e464.
Francois, F., Lombard, C., Guigner, J.M., Soreau, P., Brian-Jaisson, F., Martino, G.,
Vandervennet, M., Garcia, D., Molinier, A.L., Pignol, D., Peduzzi, J., Zirah, S.,
Rebuffat, S., 2012. Isolation and characterization of environmental bacteria
capable of extracellular biosorption of mercury. Appl. Environ. Microbiol. 78,
1097e1106.
Garca, J.L., Asadinezhad, A., Pachernk, J., Lehock, M., Junkar, I., Humpol
cek, P.,
S
aha, P., Val
asek, P., 2010. Cell proliferation of HaCaT keratinocytes on
collagen lms modied by argon plasma treatment. Molecules 15,
2845e2856.
Haque, S., Zeyaullah, M., Nabi, G., Srivastava, P.S., Ali, A., 2010. Transgenic tobacco
plant expressing environmental E. coli merA gene for enhanced volatilization of
ionic mercury. J. Microbiol. Biotechnol. 20, 917e924.
hanno, I., Re
jasse, A., Kallassy, M., Lereclus, D., Sanchis, V.,
Kamar, R., Gohar, M., Je
Ramarao, N., 2013. Pathogenic potential of Bacillus cereus strains as revealed by
phenotypic analysis. J. Clin. Microbiol. 51, 320e323.
Kerin, E.J., Gilmour, C.C., Roden, E., Suzuki, M.T., Coates, J.D., Mason, R.P., 2006.
Mercury methylation by dissimilatory iron-reducing bacteria. Appl. Environ.
Microbiol. 72, 7919e7921.
Kiyono, M., Pan-Hou, H., 2006. Genetic engineering of bacteria for environmental
remediation of mercury. J. Health Sci. 52, 199e204.
 pez-Alonso, V., 2012.
Lopez-Campos, G., Martnez-Su
arez, J.V., Aguado-Urda, M., Lo
 pezDetection, identication and analysis of foodborne pathogens. In: Lo
rez, J.V., Aguado-Urda, M., Lo
 pez-Alonso, V. (Eds.),
Campos, G., Martnez-Sua
Microarray Detection and Characterization of Bacterial Foodborne Pathogens,
Springer, USA Briefs in Food, Health, and Nutrition, pp. 13e32. http://dx.doi.org/

185

10.1007/978-1-4614-3250-0_2. Guillermo Lopez-Campos, Joaquin V.

 nica Aguado-Urda, Victoria Lopez Alonso.
Martinez-Suarez, Mo
Lotpour, F., Mirzaeei, S., Maghsoodi, M., 2012. Evaluation of the effect of CaCl2 and
alginate concentrations and hardening time on the characteristics of Lactobacillus acidophilus loaded alginate beads using response surface analysis. Adv.
Pharm. Bull. 2, 71e78.
Murillo, I., Villamil, L., 2011. Bacillus cereus and Bacillus subtilis used as probiotics in
rotifer (Brachionus plicatilis) cultures. J. Aquat. Res. Dev. http://dx.doi.org/
10.4172/2155-9546.S1-007.
Nakamura, K., Nakahara, H., 1988. Simplied X-ray lm method for detection of
bacterial volatilization of mercury chloride by Escherichia coli. Appl. Environ.
Microbiol. 54, 2871e2873.
NavinChandran, M., Iyapparaj, P., Moovendhan, S., Ramasubburayan, R., Prakash, S.,
Immanuel, G., Palavesam, A., 2014. Inuence of probiotic bacterium Bacillus
cereus isolated from the gut of wild shrimp Penaeus monodon in turn as a potent
growth promoter and immune enhancer in P. monodon. Fish Shellsh Immunol.
36, 38e45.
Ruiz, O.N., Alvarez, D., Gonzalez-Ruiz, G., Torres, C., 2011. Characterization of mercury bioremediation by transgenic bacteria expressing metallothionein and
polyphosphate kinase. BMC Biotechnol. 11, 82. http://dx.doi.org/10.1186/14726750-11-82.
Sambrook, J.F., Russell, D.W., 2001. Molecular Cloning: a Laboratory Manual, third
ed., Vols. 1e3. Cold Spring Harbor Academic Press, USA, p. 2100.
bler, I., 2013. Current research for bioremediation of mercury. In:
Wagner-Do
bler, I. (Ed.), Bioremediation of Mercury: Current Research and InWagner-Do
dustrial Applications. Caister Academic Press, Norfolk, England, pp. 1e16.
Zhang, W., Chen, L., Liu, D., 2012. Characterization of a marine-isolated mercuryresistant Pseudomonas putida strain SP1 and its potential application in marine
mercury reduction. Appl. Microbiol. Biotechnol. 93, 1305e1314.