CHEE 484: Tutorial Molecular Biology

This review will be extremely helpful to understand your next tutorial article de Lipathy et al.
2003. In situ exposure to low herbicide concentrations affects microbial population composition
and catabolic gene frequency in an aerobic shallow aquifer. Appl. Environ. Microbiol. 69: 461467.
1) What is the difference between genotype and phenotype?
2) What are the components of DNA? Name all the nitrogenous bases.
3) What are the components of RNA? Name the nitrogenous bases.
4) What are the three different kinds of RNA and their function (ie their role in protein
synthesis)?
5) If the sequence on one DNA strand is AGCTCAG, what is the sequence on the strand of
complementary DNA? Of the corresponding mRNA?
6) If there are 45 cytosines in a 100-basepair DNA double helix, how many adenines are there?
7) What is the key function of PCR? How would you determine if you had successfully
amplified a PCR product?
8) What is the difference between gel electrophoresis and denaturing gradient gel
electrophoresis?
9) What is a DNA primer?
10) What is 16S rRNA? How is it used to determine the phylogeny of microbial populations?
11) What do you need to know before you can design a PCR-based test to detect the presence of
anthracene-degrading bacteria in soil?
12) How will you ensure that your primers will hybridize only to the DNA which you wish to
detect?
13) For the DNA sequence shown below, write out the sequence of a 10-basepair primer that will
hybridize to it. Recall that DNA replication takes place from the 5 to 3 direction.
5 AATGCAGGCCCTATAATGGGCTATATTTAACTATAGGACCGGATGCATA3
14) Mark where the probe ( 3 GGATGCTACCATAGC 5) will hybridize to the following DNA
sequence:
ACAATTGTCGATCTGCGATCTGGGATCGATTC

CCGGGATCTAGGCCTACGATGGTATCGTTAGC

15) What are restriction endonucleases? How can they be used in phylogeny identification?
16) What is reverse transcriptase? How can it be used in phylogeny identification?
17) How would you track the survival of a genetically engineered pure culture which have been
tagged with the gfp gene and released in soil? Assume that all genes are on the chromosome.