DNA Sequence, June 2007; 18(3): 196202

FULL LENGTH RESEARCH PAPER

Isolation and characterization of a lectin gene from seeds of chickpea

(Cicer arietinum L.)*
INSAF A. QURESHI1, PREM S. SRIVASTAVA2 & KIRPA R. KOUNDAL1
Mitochondrial DNA Downloaded from informahealthcare.com by University of S.A Lib 119257 on 11/14/12
For personal use only.

NRC on Plant Biotechnology, I.A.R.I., New Delhi 110012, India, and 2Department of Biotechnology, Jamia Hamdard, New
Delhi 110062, India
(Received 2 March 2006)

Abstract
A cDNA library was constructed in l TriplEx2 vector using poly (A) RNA from immature seeds of Cicer arietinum. The
lectin gene was isolated from seeds of chickpea through library screening and RACE-PCR. The full-length cDNA of
Chichpea seed lectin(CpGL)is 972 bp and contains a 807 bp open reading frame encoding a 268 amino acid protein.
Analysis shows that CpSL gene has strong homology with other legume lectin genes. Phylogenetic analysis showed the
existence of two main clusters and clearly indicated that CpSL belonged to mannose-specific family of lectins. RT-PCR
revealed that CAA gene expressed constitutively in various plant tissues including flower, leaf, root and stem. When chickpea
lectin mRNA level was checked in developing seeds, it was higher in 10 DAF seeds and decreased throughout seed
development.

Keywords: Cicer arietinum, expression analysis, leguminosae, lectin gene, nucleotide sequencing

Introduction
Lectins are a large and heterogenous group of proteins
that have the ability to bind reversibly to a specific
mono-or-oligosaccharide (Van Damme et al. 1998).
They are ubiquitously distributed in nature and are
most abundant in plants, where they can be found in
seeds, leaves, barks, bulbs, rhizomes, roots and tubes
depending on the plant tissues (Lis and Sharon 1986;
Gupta et al. 2004). However, majority of studies on
lectins have been carried out on legumes, particularly,
seeds where they comprise up to 15% of total protein.
Based on evolutionary and structural relatedness,
seven lectin families have been distinguished, of which
legume lectins are best characterized (Peumans and
Van Damme 1998). Although lectins have been
extensively studied with respect to carbohydrate
binding specificity and potential utility for the
isolation and characterization of glycoconjugates, the

physiological role in plants is not yet well understood.

Proposed functions for plant lectins include a storage
or transportation role for carbohydrates in seeds,
binding of nitrogen-fixing bacteria to root hairs, and
inhibition of fungal growth or insect feeding (Diaz
et al. 1989).
Genes encoding lectins have been isolated from
plant species and some have even been transferred to
crops by genetic engineering. Transgenic crops
expressing insecticidal lectins have shown enhanced
resistance to one or more insect pests from different
orders including aphids (Jouanin et al. 1998; Carlini
and Grossi-de-Sa 2002). Therefore, exploitation of
these insect resistance genes could provide a suitable
option for improving pest control. In the present
study, we describe the cloning of a lectin gene from the
seeds of Cicer arietinum. The expression levels of lectin
were also investigated in different tissues including
seed development.

Correspondence: K. R. Koundal, NRC on Plant Biotechnology, I.A.R.I., New Delhi 110012, India. Tel: 91 11 25848783. Fax: 91 11
25843984. E-mail: kirparam@rediffmail.com
*The nucleotide sequence reported in this paper have been submitted to the GenBank and is available under the accession no. AY221982.
ISSN 1042-5179 print/ISSN 1029-2365 online q 2007 Informa UK Ltd.
DOI: 10.1080/10425170601060608

Isolation and characterization of a lectin gene

Materials and methods
Plant materials

Mitochondrial DNA Downloaded from informahealthcare.com by University of S.A Lib 119257 on 11/14/12
For personal use only.

Plants of chickpea (Cicer arietinum L.) cv. P256 were

grown in experimental field of Indian Agricultural
Research Institute, New Delhi. Seeds at various stages
of development were isolated and immediately frozen
in liquid nitrogen for RNA isolation. Seeds sterilized
with 0.01% mercuric chloride were also germinated on
water soaked filter paper in dark. After 10 days,
etiolated seedlings were harvested and immediately
frozen in liquid nitrogen for isolation of genomic DNA.
Southern blot analysis
Total genomic DNA was isolated from etiolated
seedlings according to Dellaporta et al. (1983).
Purified DNA (10 mg) was restricted overnight with
Eco RI and Bam HI at 378C and electrophoresed on
0.8% agarose gel according to protocol of Southern
(1975). The restricted samples on agarose gel was
blotted onto a Hybond N membrane (Amersham)
according to manufactures instructions and hybridized with radiolabelled probe of pea lectin cDNA.
Isolation of poly (A)1RNA
Total RNA from immature seeds (10 days after
flowering) was isolated by the method of Salzman et al.
(1999) and qualitatively checked on 1% formaldehyde
agarose gel. Poly (A) RNA was separated from nonadenylated RNA using Poly (A) Quick mRNA
isolation kit (Stratagene) according to the manufactures instruction.
Construction of cDNA library
The cDNA library was synthesized by SMART cDNA
library construction kit (Clontech). The first strand of

197

cDNA was synthesized from Poly (A) RNA and

amplified by LD PCR. The amplified product was
analyzed on 1.1% agarose gel alongside 0.1 mg of 1 kb
DNA marker. The cDNA was digested with Proteinase K and then restricted with Sfi I. It was size
fractionated by CHROMA SPIN-400 column and
electrophoresed on 1.1% agarose gel alongside 0.1 mg
of 1 kb DNA marker. Fractions containing fragments
above 1 kb were pooled and precipitated overnight
with absolute ethanol and resupended in sterile
distilled water. The cDNA (500 ng) was kept overnight with arms of lTriplEx2 vector at 168C for
ligation. The ligated DNA was added in Packgene
extract and incubated at 228C for 3 hrs and then
adsorbed on E. coli XL1-Blue. It was plated
subsequently and titre of unamplified library was
determined.

Screening of cDNA library

For primary screening, 3 ml of 1023 dilution in SM
buffer (100 mM NaCl 10 mM MgSO4 20 mM
Tris-Cl pH 7.5 0.1% Gelatin) was mixed with
600 ml cells of E. coli XL-1 Blue and kept for 15 min at
378C for adsorption of phages. The transfected
culture was mixed with 10 ml of melted NZY
top agar, cooled to 458C and poured onto NZY plates
(5 g NaCl 2 g MgSO4.7H2O 5 g yeast extract
10 g NZ amine 15 g agar for 1000 ml medium, pH
7.5). Plates were incubated at 378C for 10 h until the
well separated plaques appeared. Plaques were lifted
onto Hybond N membrane (Amersham), air-dried
and prepared for hybridization by denaturation,
neutralization and a rinse in 2 SSC followed by
baking at 808C for 2 h. The blots were pre-hybridized
and then hybridized with heterologous pea lectin
cDNA probe. For secondary screening, each of the
selected clones was plated and again hybridized. For
further confirmation of these positive clones, tertiary

Figure 1. A D. A, B. Agarose gel electrophoresis and Southern hybridization of restricted chickpea genomic DNA, Lane M. Marker l/ Hind
III, 1. Chickpea genomic DNA digested with Bam HI, 2. Chickpea genomic DNA digested with Eco RI; C, D. Agarose gel electrophoresis and
Southern hybridization of restricted cDNA clones, Lane M. Marker l/ Eco RI Hind III, Lanes 1-3. Chickpea lectin clone digested with Sfi I.

198 I. A. Qureshi et al.

screening was done by spotting of individual clones on
bacterial lawn in duplicate plates and processed as
described. These lTriplEx2 clones were converted to
pTriplEx2 and digested with Sfi I. The restricted
samples were blotted onto Hybond N membrane and
hybridized with pea lectin cDNA probe.
50 Extension of the cDNA clone

Mitochondrial DNA Downloaded from informahealthcare.com by University of S.A Lib 119257 on 11/14/12
For personal use only.

First Choicee RLM-RACE kit (Ambion) was used to

obtain the 50 nucleotide sequences of CpLac clones.

Based on the sequence of CpLac clones, specific

primers
Cpl
1
(5 0 -TGCTCCTGTGGTAG
0
CTGAGA -3 ) and Cpl 2 (50 - CCCACTCAGTAACAACATCC -30 ) were designed to amplify the 50 end.
Total RNA was first treated with calf intestinal
phosphatase (CIP) and then with tobacco acid
pyrophosphate. A 45 base RNA adapter oligonucleotide was ligated to RNA using T4 RNA ligase. The
first round of PCR was performed with primer Cpl 1
and 50 RACE outer primer (50 - GCTGATGGCGATGAATGAACACTG -30 ). It was reamplified with

Figure 2. The cDNA sequence and deduced amino acid sequence of chickpea seed lectin (CpSL). The start codon is underlined and
stop codon is italicized and underlined.

Mitochondrial DNA Downloaded from informahealthcare.com by University of S.A Lib 119257 on 11/14/12
For personal use only.

Isolation and characterization of a lectin gene

199

Figure 3. Alignment of deduced amino acid sequence of CpSL (chickpea seed lectin) with other legume lectins: CAA47011 from Pisum
sativum; CAC42124 from Lens culinaris; CAF18558 from Lathyrus sativus and CAD27484 from Vicia faba. Identical amino acid residues are
indicated with yellow. The amino acid residues identical among any two of the five lectins are indicated with gray. The amino acid residues
different from other lectins are indicated with black.

primer Cpl 2 and 50 RACE inner primer (50 CGCGGATCCGAACACTGCGTTTGCTGGCTTTGATG -30 ). The PCR product (750 bp) was
purified and cloned into pGEM-T easy vector
(Promega) followed by sequencing.
Sequence analysis
Multiple sequence alignment was performed by the
ClustalW (clustalw.genome.jp) programme. The phylogenetic tree was constructed on the basis of deduced
amino acid sequences of CpSL and other legume
lectins using ClustalX and Treeview version 1.6.5.
Expression analysis of chickpea lectin
Total RNA was isolated from various plant tissues
including leaf, root, stem and inflorescence of
chickpea according to the method of Salzman et al.
(1999). PCR was employed after reverse transcription
to study the levels of expression in different tissues. To
ensure that the samples were free of DNA, the RNA

samples were treated with RNase-free DNase prior to

the reverse transcription. RT-PCR analysis was carried
out using one step RT-PCR kit (Qiagen) according to
the manufacture0 s instruction. Based on the sequence
of CpSL, 50 - Cpsl (50 - GGCAGAGCCCTCTATTCCTC -30 ) and 30 - Cpsl (50 - TGCTGCATATTCTGCTCCTG -30 ) were designed for RT-PCR. Simultaneously, for the expression of lectin during seed
development, flowers from field grown plants were
tagged at anthesis. Pods were harvested at 5 day
interval starting from 10th day after flowering (DAF)
till maturity and total RNA was isolated from seeds of
different stages of development.

Results and discussion

Southern blot analysis
Chickpea genomic DNA restricted with Eco RI and
Bam HI hybridized strongly with pea lectin cDNA
probe (Figure 1A, B), even though the probe
was heterologous, it hybridized at high stringency.

200 I. A. Qureshi et al.

CpSL
94

1 106 pfu/mg DNA was a good packaging ratio for

higher eucaryotes. When this library was plated on Xgal and IPTG plate, it gave 95% recombinant plaques.

CAA470
41
CAF185
99
CAC421

100

CAD274
100

Mitochondrial DNA Downloaded from informahealthcare.com by University of S.A Lib 119257 on 11/14/12
For personal use only.

CAA429
100
CAA763

CAD288
100
CAF185
49
P050
60
54

BAA364
CAA369

Figure 4. Phylogenetic tree analysis of CpSL (chickpea seed lectin)

with other legume lectins: CAA47011 from Pisum sativum;
CAF18558 from Lathyrus sativus; CAC42124 from Lens culinaris;
CAD27484 from Vicia faba; CAA42937 from Medicago truncatula;
CAA76366 from Medicago sativa; CAD28836 from Phaseolus
vulgaris; CAF18557 from Vigna unguiculata; P05046 from Glycine
max; BAA36415 from Robinia pseudoacacia and CAA36986 from
Erythrina corallodendron. Number shown in the node indicates the
branch was supported with bootstrap value out of 1000.

This suggests considerable sequence homology

between pea and chickpea lectin genes. Such kind of
intergeneric homologies have been reported between
the legume genera, Pisum sativum, Canavalia gladiata
(Yamauchi and Minamikawa 1990) and Vigna
unguiculata (Datta et al. 2000). The pea lectin
cDNA probe was further used for screening the
cDNA library of chickpea for the presence of lectin
clones.

cDNA library
Of 5 mg of total RNA obtained from 5 g of immature
chickpea seeds, 2 mg was purified using oligo (dT)
cellulose column that yielded 50 mg of poly (A) RNA.
The synthesized cDNA was in the range of 0.5-5 kb.
The restricted cDNA was size fractioned by
CHROMA SPIN-400 column, 500 ng of fractioned
cDNA was ligated with 500 ng of Sfi I restricted
lTriplEx2 vector. The ligated mixture was packaged
in vitro in packaging extract. The cDNA library of

cDNA lectin clone

After primary and secondary screening, ten positive
clones were identified. When these were confirmed by
tertiary screening, five positive clones hybridized
strongly. Among five clones, three produced large
inserts while the size of other two was less than 200
bp and these were excluded from further studies. The
three tertiary clones designated as pCpL1, pCpL2 and
pCpL3 showed an insert of 0.9 kb. The inserts showed
strong hybridization with pea lectin cDNA probe
(Figure 1C, D). These were sequenced and were
found to be of 805 nucleotides. Sequence analysis
though confirmed its homology with other legume
lectins, but 50 nucleotide sequences were not present.
The 50 nucleotide sequences of CpL were obtained by
50 RACE, and full-length clone of chickpea seed lectin
(pCpSL) was cloned in pGEM-T vector.
Sequence analysis of chickpea lectin
The 972 bp full-length cDNA of CpSL is very similar
in size to other legume lectin genes, such as, pea
(Gatehouse et al. 1987), soybean (Vodkin et al. 1983)
and lentil (Galasso et al. 2004). ORF analysis showed
that the longest open reading frame was between 1
807 nucleotides in the first reading frame (Figure 2).
On translation this gives a putative protein product of
268 amino acids with a molecular mass of
29,515.9 Da that fairly correlates with other legume
lectins (Young and Oomen 1992). The total number
of bases translated in the open reading frame is 807
with A T (59%) and C G (41%), which is also
in conformity with those of other leguminous species
(Sharma and Surolia 1997; Datta et al. 2000).
The database search with ClustalW showed
considerable homology ranging from 83 to 97% with
other legume lectin genes (Figure 3). The sequence
of pCpSl is 97% identical to amino acid sequence of
Psl lectin from Pisum sativum (CAA47011) and has
92% homology with lectin from Lens culinaris
(CAC42124), 91% with lec 1 from Lathyrus sativus
(CAF18558) and 83% with lec 1 from Vicia faba
(CAD27484).
To investigate the evolutionary relationship among
different legume lectins, a phylogenetic tree was
constructed on the basis of deduced amino acid
sequences of CpSL and other legume lectins. As
shown in Figure 4, legume lectins formed two distinct
clusters. The first cluster comprised lectins from
Pisum sativum, Lathyrus sativus, Lens culinaris, Vicia
faba, Medicago truncatula and Medicago sativa. The
second cluster included lectins from Phaseolus vulgaris,
Vigna unguiculata, Glycine max, Robinia pseudoacacia

Mitochondrial DNA Downloaded from informahealthcare.com by University of S.A Lib 119257 on 11/14/12
For personal use only.

Isolation and characterization of a lectin gene

201

Figure 5. A. Expression analysis of lectin in different tissues of chickpea, Lane M. Marker l/ Eco RI Hind III, Lanes 15. Total RNA
from: 1, flower; 2, leaf; 3, root; 4, stem; 5, seed; Lane 6, Negative control; B. Expression analysis of lectin in developing seeds of chickpea, Lane
M. Marker l/ Hind III, Lanes 1-6. Seeds from: 1, 10 DAF; 2, 15 DAF; 3, 20 DAF; 4, 25 DAF; 5, 30 DAF; 6, 35 DAF; Lane 7, Negative
control.

and Erythrina corallodendron. It was also worth noting

that mannose/ glucose specific lectins on one hand,
and the galactose/N-acetyl galactosamine lectins on
the other hand form two different clusters. The lectins
which were shown in cluster I was distantly related
with those from cluster II.

Being of plant origin, lectin genes will have high degree

of compatibility with the transgenic host plants and
hence expected to provide sustained protection against
sap sucking insects, which cause major losses to crops.

Acknowledgements
Expression pattern of chickpea lectin
To investigate the expression in tissues of Cicer
arietinum, total RNA was isolated from various tissues
and reverse transcribed followed by PCR. An
amplicon of 550 bp detected in flower, leaf, root
and stem (Figure 5A) indicates that perhaps CpSL is
indeed constitutively expressed. Constitutive
expression of lectin gene has been observed in all
tissues of other plants. Zhu et al. (1996) showed
similar lectin expression at the protein level by using
immunoblot in Griffonia simplifolia. Constitutive
expression of lectin in various tissues has also been
recorded in Crinum asiaticum (Chai et al. 2003),
Pinellia ternata (Yao et al. 2003) and Arisaema
heterophyllum (Zhao et al. 2003).
The expression of chickpea lectin was growth
related. The relative quantity of CpSL mRNA in the
seeds seemed clearly dependent on the developmental
stage. The amplicon intensity was higher in 10th DAF
seeds, decreasing throughout seed development; the
lowest being on 25th DAF (Figure 5B). Our findings
are consistent with the study on expression pattern of
soybean lectin (Goldberg et al. 1983). Hybridization
experiments demonstrated that lectin mRNA levels
were maximized at mid-maturation stage but not
detectable at later stages. It implicitly implies that
stage-specific activation and repression of lectin gene
occurs during development and that the transcriptional
process plays an important role in this regulation.
Earlier studies have shown that many seed lectins of
leguminous family possess insecticidal activities
(Gatehouse et al. 1999; Powell 2001). The chickpea
lectin gene can also be introduced into crops and
resistance to a wide range of insects can be tested.

This work was carried out under the financial

assistance from the National Agricultural Technology
Project (Mission Mode), ICAR, New Delhi. We thank
Drs S. Anandhan and Ramesh Bhat for their
help during this work.

References
Carlini CR, Grossi-de-Sa MF. 2002. Plant toxic proteins with
insecticidal properties. A review on their potentialities as
bioinsecticides. Toxicon 40:1515 1539.
Chai Y, Pang Y, Liao Z, Zhang L, Sun X, Lu Y, Wang S, Tang K.
2003. Molecular cloning and characterization of a mannosebinding lectin gene from Crinum asiaticum. J Plant Physiol
160:913920.
Datta S, Kansal R, Koundal KR. 2000. Construction of cowpea
(Vigna unguiculata L) cDNA library and characterization of an
isolated lectin gene. J Plant Biochem Biotech 9:6771.
Dellaporta SL, Wood J, Hicks JB. 1983. A plant DNA
minipreparation: Version II. Plant Mol Biol Rep 1:1921.
Diaz C, Melchers LS, Hooykaas PJJ, Lugtenberg BJJ, Kijne JW.
1989. Root lectins as determinant of host plant specificity in the
Rhizobium-legume symbiosis. Nature 338:579581.
Galasso I, Lioi L, Lanave C, Bollini R, Sparvoli F. 2004.
Identification and isolation of lectin nucleotide sequences and
species relationships in the genus Lens (Miller). Theor Appl
Genet 108:10981102.
Gatehouse AMR, Davison GM, Stewart JN, Gatehouse LN, Kumar
A, Geoghegan IE, Birch ANE, Gatehouse JA. 1999. Concanavalin A inhibits development of tomato moth (Lacanobia
oleracea) and peach-potato aphid (Myzus persicae) when
expressed in transgenic potato plants. Mol Breed 5:153165.
Gatehouse JA, Bown D, Evans IM, Gatehouse LN, Jobes D, Preston
LP, Croy RR. 1987. Sequence of the seed lectin gene from pea
(Pisum sativum L.). Nucleic Acids Res 15:7642.
Goldberg RB, Hoschek G, Vodkin LO. 1983. An insertion sequence
blocks the expression of a soybean lectin gene. Cell 33:465475.
Gupta N, Narula A, Srivastava PS. 2004. Purification and
characterization of lectin from seeds of Delonix regia. J Plant
Biochem Biotech 13:141144.

Mitochondrial DNA Downloaded from informahealthcare.com by University of S.A Lib 119257 on 11/14/12
For personal use only.

202 I. A. Qureshi et al.

Jouanin L, Bonade-Bottino M, Girard C, Morrot G, Giband M.
1998. Transgenic plants for insect resistance. Plant Sci
131:111.
Lis H, Sharon N. 1986. Lectins as molecules and tools. Ann Rev
Biochem 55:3567.
Peumans WJ, Van Damme EJM. 1998. Plant lectins: Versatile
proteins with important perspectives in biotechnology. Biotechnol Genet Eng Rev 15:199228.
Powell KS. 2001. Antimetabolic effects of plant lectins towards
nymphal stages of the planthoppers Tarophagous proserpina and
Nilaparvata lugens. Entomol Exp Appl 99:7985.
Salzman RA, Fujita T, Zhu-Salzman K, Hasegawa PM, Bressan RA.
1999. An improved RNA isolation method for plant tissues
containing high levels of phenolic compounds or carbohydrates.
Plant Mol Biol Rep 17:1117.
Sharma V, Surolia A. 1997. Analyses of carbohydrate recognition by
legume lectins: Size of the combining site loops and their
primary specificity. J Mol Biol 267:433 445.
Southern EM. 1975. Detection of specific sequences among DNA
fragments separated by gel electrophoresis. J Mol Biol
98:503517.
Van Damme EJM, Peumans WJ, Barre A, Rouge P. 1998. Plant
lectins: A composite of several distinct families of structurally

and evolutionary related proteins with diverse biological roles.

Crit Rev Plant Sci 17:575692.
Vodkin LO, Rhodes PR, Goldberg RB. 1983. A lectin gene insertion
has the structural features of a transposable element. Cell
34:10231031.
Yamauchi D, Minamikawa T. 1990. Structure of the gene encoding
concanavalin A from Canavalia gladiata and its expression in
Escherichia coli cells. FEBS Lett 260:127130.
Yao J, Pang Y, Qi H, Wan B, Zhao X, Kong W, Sun X, Tang K.
2003. Transgenic tobacco expressing Pinellia ternata agglutinin
confers enhanced resistance to aphids. Trans Res 12:715 722.
Young NM, Oomen RP. 1992. Analysis of sequence variation among
legume lectins- a ring of hypervariable residues forms the
perimeter of the carbohydrate-binding site. J Mol Biol
228:924934.
Zhao X, Yao J, Liao Z, Zhang H, Chen F, Wang L, Lu Y, Sun X,
Yu S, Tang K. 2003. Molecular cloning of a novel mannosebinding lectin gene from Arisaema heterophyllum. Plant Sci
165:5560.
Zhu K, Huesing JE, Shade RE, Bressan RA, Hasegawa PM,
Murdock LL. 1996. An insecticidal N-acetylglucosaminespecific lectin gene from Griffonia simplicifolia (Leguminosae).
Plant Physiol 110:195202.