Australian Biologics Response To Senate Inquiry Into Lyme Disease

Growing evidence of an emerging tick-borne disease that causes a Lyme like illness for many Australian patients
Submission 545
1 of 36
To the Senate :
Thank you for your invitation to provide a submission in relation to your Inquiry into the growing
evidence of an emerging tick-borne disease that causes a Lyme-like illness for many Australian
patients.
I write as the Director of Australian Biologics Testing Services, a private Pathology Laboratory
specialising in the detection of bacteria causing chronic illnesses. I wish to address Points A and C
and to a lesser extent Point D, as listed in the terms of reference for this Hearing.
Background :
Australian Biologics has operated as a laboratory since 1985. In 2002 our Molecular Biology section
was established. This involves the use of the Polymerase Chain Reaction (PCR) assay to identify the
presence of Borrelia DNA in human samples (blood, urine, tissue etc).
In August 2012 we introduced the Borrelia EliSpot LTT assay and in August 2013 we began offering
the Mikrogen IgM/IgG recomLine assay which measures IgG and IgM antibodies to antigens of
Borrelia. The EliSpot assays measures the amount of Interferon-gamma (a Cytokine) produced when
a patients Lymphocytes are exposed to antigens of Borrelia.
In response to Point A :
The prevalence and geographic distribution of Lyme-like illness in Australia :
Appendix 1 Geospatial Data (Pg. 11)
In response to Point C :
Laboratory Testing procedures for the detection of the Borrelia species in Australian Patients :
Limitations of Testing: There are multiple papers relating to the difficulties of accurate detection of
Borrelia. Testing by varying technologies is more likely to enable a definitive result of true positive
or true negative.
Serological testing has been shown not to be efficient for patients with a chronic infection of Borrelia
(see http://www.borreliose-gesellschaft.de/Texte/guidelines.pdf) as the infection causes
depression/exhaustion of the immune system which may cause false negatives. Unlike most other
bacterial infections, many patients do not sero-convert from IgM to IgG.
Earlier ELISA testing was known to have poor sensitivity whereas the newer ImmunoBlot assays
using recombinant antigens have a much higher level of sensitivity. The EliSpot Lymphocyte
Transformation Test is useful to show if an infection is active, although PCR testing remains the gold
standard for the detection of a bacterial infection.
Submission 545
2 of 36
PCR is one of the most sensitive methods utilised to detect microbial pathogens in clinical
specimens. This is particularly necessary when specific pathogens, difficult to culture in vitro or are
known to be of low level in blood, tissue and other samples, are to be detected. The diagnostic
value of PCR is known to be significant.
To validate a PCR assay a laboratory enters into Quality Assurance Programme testing with an
accredited provider and/or obtains sequencing of the PCR product to confirm the validity of the
assay.
We have participated in QAPs for Borrelia with Quality Control Molecular Diagnostics (QCMD) based
at Glasgow University since 2014 .
Appendix 2.
Quality Assurance Programmes from QCMD for PCR testing for Borrelia. (Pg. 14)
(Please note in the 2015 QAP our ability to detect B.miyamotoi)

Appendix 3.
Quality Assurance Programme from RCPA for Serology testing of Borrelia. (Pg. 22)
Appendix 4.
Sequences of Australian tick and Australian patients (Pg. 25)
Appendix 5.
Comparison of three technologies testing for Borrelia. (Pg. 26)
Appendix 6.
Total number of patients tested by PCR. (Pg. 27)
We utilise the following centres to sequence our PCR products - AGRF (the Australian Genomic
Research Facility) and the Ramaciotti Centre (a sequencing facility based at the University of New
South Wales).
Serology and Immunology for the detection of Borrelia :

Both the Mikrogen recomLine for Borrelia and the AID EliSpot Lymphocyte Transformation Test for
Borrelia assays are kit tests imported from Germany.
Mikrogen : The recomLine assay is an ImmunoBlot assay utilising recombinant antigens. Highly
specific, genetically engineered, immunodominant Borrelia proteins are used.
Only the recomLine Borrelia detects antibodies against all four of the so far known as
immunopathogenic genospecies (B. burgdorferi sensu stricto, B. garinii, B. afzelii, B. spielmanii and B.
bavariensis) on one single test strip. This test gives IgG and IgM response to Borrelia antigens. This
is a much more sensitive assay than the standard first stage ELISA testing currently recommended.
http://www.mikrogen.de/english/deutschland/products/product-overview/testsystem/borrelia-igg1.html
AIDs EliSpot assay is known to be one of the most sensitive cellular immunoassays available,
allowing the detection of cytokine producing T-cells down to the single cell level. With the EliSpot
Submission 545
3 of 36
test, it becomes possible to detect one specific cell out of 100,000 irrelevant cells, making this
method much more sensitive than traditional ELISA applications.
This method is an Interferon- assay for the specific detection of T-cells secreted due to a Borrelia
infection.
EliSpot (or ElisaSpot, short for Enzyme-linked Immunosorbent Spot Assay) was originally developed
as a method to detect antibody-secreting B-cells. Later the method was adapted to determine T-cell
reactions to a specific antigen, usually represented as the number of activated cells per million. Most
researchers use Interferon gamma (IFN-g) production as a read-out for activation of single cells.
Australian Biologics is a well-respected laboratory amongst doctors working with Borrelia infections
both in Australia and overseas. We regularly receive patient samples from clinics in Canada and
have tested samples from Asia, New Zealand and the United Kingdom. It appears that only in
Australia are we regularly subjected to slanderous attacks on our testing of Borrelia. Patients have
reported to us behaviour from senior Doctors and Specialists that involve quite outrageous
falsehoods about the quality of our testing.
For example, one specialist Practitioner told a patient who mentioned our testing, that he and some
colleagues had sent us water and that we returned a positive Borrelia result. We have been accused
of falsifying results in order to give the patient the result they want, patients have been told that
our laboratory is contaminated. The defamatory remarks are generally from Medical Specialists
none of whom have ever been to this laboratory or have had any dealings/discussions with us.
Submission 545
4 of 36
Accreditation by NATA :
There are new regulatory requirements to be introduced for in-house IVDs. Under the new
regulatory framework for in vitro diagnostic medical devices (IVDs) that commenced on 1 July 2010,
laboratories manufacturing in-house IVDs will be required to meet the regulatory requirements to
legally supply their IVDs.
The Therapeutics Goods Agency is expected to introduce these new requirements for laboratory
inhouse testing in mid 2017.
Our PCR and recomLine assays are inhouse tests.
Inhouse tests are tests either developed from first principles; or developed or modified from a
published source; or used for a purpose, other than the intended purpose assigned by the
manufacturer.
To comply with the new legislation, we applied for NATA accreditation early in 2014. As there had
been no reason for our laboratory to go through accreditation (we do not seek Medicare payments
for our tests) we sought to have our Borrelia PCR assays accredited which includes accreditation of
the Laboratory.
This has not been an easy process and has not been aided by the disbelief of key figures at NATA
that we are detecting Borrelia. As mentioned earlier we have lodged with NATA copies of
sequences from patients tested and found positive for Borrelia by PCR. Our Quality Assurance
programmes with QCMD have been presented. Both sequencing and QAPs validate our PCR
procedures. As part of our validation we submitted a Probit Regression Study Appendix 7.
Probit Regression Study. (Pg. 28)
which entailed testing 850 samples and has shown our Borrelia PCR to be highly sensitive and with
good repeatability and reproducibility. We have shown correlation between our testing and other
overseas laboratories in our published research papers.
As NATA works jointly with the RCPA, the stance of the RCPA that no Borrelia exists in Australia
makes our accreditation problematic.
The International Standard for Laboratory Testing is ISO15189. Laboratories in all countries
undertaking accreditation must meet this standard. Due to the problems we have experienced with
NATA, we investigated the possibility of undertaking accreditation through an overseas accreditation
group.
Even though this is an international standard, in Australia no other accreditation groups will be
accepted. The TGA will not recognise any accreditation group apart from NATA.
There is enormous emphasis placed on NATA accredited laboratories compared to non NATA
accredited laboratories. It is necessary for an understanding of just what these differences mean in
reality.
Submission 545
5 of 36
Any laboratory wishing to claim Medicare rebates for their testing must have NATA accreditation.
This means the Government can be assured that the public money is going to laboratories that
comply with international standards, ISO 15189 and NPAAC requirements. Laboratories that do not
seek payment through Medicare have no legal requirement to go through NATA accreditation.
There are a number of small speciality laboratories operating in Australia who do not have
accreditation and have no need or intent to go through this process. Not having accreditation does
not mean that a laboratory is not giving accurate testing.
It is important to realise as well that University research laboratories do not have NATA
accreditation. We use two facilities for our sequencing of PCR products. One is the AGRF (Australian
Genomic Research Facility) which gained NATA accreditation a few years ago, the other is the
Ramaciotti Centre for Genomics at the New South Wales University which does not have NATA
accreditation. There is no suggestion made that results from the Ramaciotti cannot be trusted as
they do not have NATA accreditation.
The RCPA and Infectious Disease Society have relied on the research paper from Professor Peter
Irwin et al Bacterial Profiling Reveals Novel Ca. Neoehrlichia, Ehrlichia, and Anaplasma Species in
Australian Human-Biting Ticks. This paper was published December 28, 2015.
However earlier the same year, Professor Irwin published a paper Inhibition of the endosymbiont
Candidatus Midichloria mitochondrii during 16S rRNA gene profiling reveals potential pathogens in
Ixodes ticks from Australia published June 2015 in which he states the following :
Borrelia 16S sequences were obtained from ten questing I. ricinus ticks and a single I. holocyclus tick
removed from a wild Echidna (Tachyglossidae sp.). Borrelia sequences derived from the I. holocyclus
tick had 100 % sequence similarity, and clustered with high bootstrap confidence (91.1 %) into a
group of pathogenic relapsing fever Borrelia species including B. duttonii, B. recurrentis, B. parkeri
and B. crocidurae
Professor Irwins laboratory at Murdock University is not a NATA accredited laboratory.
The Dept. of Medical Entomology at Westmead Hospital does not have NATA accreditation.
Our Quality Assurance Programmes cannot be faked. The results prove that we have the ability to
detect Borrelia.
We participate in quality assurance programmes for both Molecular Biology and Serology, as we
strive to maintain high-quality standards in all areas of our work.
We are continuing our accreditation process despite the difficulties placed in our path.
D.
Evidence of investments in contemporary research into Australian pathogens specifically
acquired through the bite of a tick and including other potential vectors.
We have tested a large number of ticks and other potential carriers of the Borrelia bacteria. These
include bush lice and head lice. Borrelia DNA has been detected in all of these. Head lice (Pediculus
humanus capitis) was initially collected from a speciality hairdresser in a Sydney suburb not known
Submission 545
6 of 36
specifically as an endemic tick area. This collection of insects did not give a positive signal, however
at a later date, we were supplied with some Head Lice from a child who had tested positive for
Borrelia DNA. These Lice were found to be positive. We do not have the means to show
transmission however through such insects.
Samples from a horse drench were supplied to us for testing. The area of origin is known to us as
having positives in ticks from varying animals feral pigs, feral goats and horses. A strong positive
Borrelia DNA signal was found in eggs contained in the drench. We have not had these formally
identified but the horse had been infected with Botflys and the eggs may be from these Botflys.
Further research is needed to see how many animals may harbour the Borrelia bacteria.
Australian Biologics is part of a research group that includes Dr. Raphael Stricker of San Fransisco,
(Medical Director, Union Square Medical Associates, San Francisco, CA) Dr. Marianne Middelveen
(Microbiologist, Canada) and Professor Eva Sapi (Professor Biology New Haven University,
Connecticut). Studies generally utilise PCR for Borrelia from both Australian Biologics and New
Haven University.
Australian Biologics receives no remuneration from our research studies.
Appendix 8.
Australian Biologics Research publications relating to Borrelia.
Evidence for Ixodes holocyclus as a vector for human Lyme borreliosis infection in Australia
http://www.ncbi.nlm.nih.gov/pubmed/25434042
Association of spirochetal infection with Morgellons disease.
http://www.ncbi.nlm.nih.gov/pubmed/24715950
Granulomatous hepatitis associated with chronic Borrelia burgdorferi infection: a case report
http://digitalcommons.newhaven.edu/biology-facpubs/33/
Submission 545
7 of 36
In response to Submission 67s statement relating to our use of the Mikrogen recomLine
assay :
The paragraph below appeared in the submission from the anonymous Medical Specialist.
At no time have we been approached with any questions regarding our use of this test.
A laboratory scientist colleague recently worked in a laboratory in central Sydney that
specialises in diagnosing tick-borne infections. She reported that this laboratory was not
able to obtain NATA (National Association of Testing Authorities) accreditation due to their
poor scientific practices. She noted that if a patients antibody test was negative, the
scientist in charge would regularly tell them to incubate it for another day until it went
positive. This does not mean that the patient had a positive test rather it means the test
was performed incorrectly and the result is inaccurate. Antibody tests must be incubated for
exactly the duration specified by the test manufacturer, or results are not accurate. These
are the results that Australian patients are paying large amounts of money for, and are
holding onto as evidence they have diseases which they do not have.
Firstly I must say that we do not believe that any of our previous staff members would lie in
such a manner and the above charges are untrue. It would appear that the author of
Submission 67 has no real laboratory experience with ImmunoBlot testing as lengthening
the incubation time will not magically produce a positive result.
Secondly, it is not unusual for a laboratory to modify a kit test method. This makes the test
an in-house test which requires validation. We have performed the validation studies
required for this assay.
When we first began utilising Borrelia serology testing, we used a different assay to our
current Mikrogen kit. We changed to Mikrogen as we were not happy with the lack of
correlation between our serology testing and our PCR assays or between our serology and
results from overseas laboratories.
In mid 2014, I read a poster presentation titled Prolonged incubation and improved readout of the recomLine Borrelia burgdorferi IgM and IgG immunoblots (Mikrogen)
The following poster was presented at the 23rd meeting of the European Society of Clinical
Microbiology and Infectious Diseases by Doctors Goossens and Van Loo from the University
Hospital in Maastricht, the Netherlands.
Submission 545
8 of 36
Serology: miscellaneous
Monday, April 29, 2013, 12:30 - 13:30
Prolonged incubation and improved read-out of the recomLine Borrelia

burgdorferi IgM and IgG immunoblots (Mikrogen)
V.J. Goossens, I.H.M. Van Loo* (Maastricht, NL)
Objective: Recently the renewed recomLine Borrelia burgdorferi IgM and IgG immunoblots
(Mikrogen) were introduced in our lab. In a preliminary validation study and performing the
assay according to the insert instructions - including a one hour first incubation step several
samples were negative in the Borrelia immunoblots despite positive results in up to three
Borrelia EIA screening assays.
Methods: We performed a preliminary study on a selection of serum samples in which we
compared one hour incubation with prolonged overnight incubation. The selected serum
samples were positive in up to three Borrelia burgdorferi EIA screening assays (IgM, IgG and
C6 elisa).
Results: Remarkably, after prolonged overnight incubation of the immunoblots, most of the
selected samples became undoubtedly positive with intense band coloration. Additional IgM
and IgG bands were detected mainly for OspC and VlsE. From a clinical point of view, these
positive blot results were in accordance with positive EIA screening assays and with the
clinical picture of patients presenting with erythema migrans.
A single patient with a positive IgM, positive C6 EIA and negative IgG EIA deserved further
attention. With standard one-hour incubation of the blot, this patient was negative in both the
IgM and IgG blot. Otherwise, with prolonged overnight incubation OspC bands appeared
inducing a possible result in the IgM blot. However, this patient was also positive for
autoimmune antinuclear antibodies in high titers. Therefore, false positive results have to be
considered.
In all other samples, read-out of the blots was much easier due to more intense coloured
bands.
Conclusion: Overall, in this preliminary study, the robustness of the recomline Borrelia
immunoblots (Mikrogen) and discrimination between positive and negative results may be
highly improved by prolonged overnight incubation. Further analysis will focus both on
sensitivity and specificity of different antigens.
http://registration.akm.ch/einsicht.php?XNABSTRACT_ID=163869&XNSPRACHE_ID=2&XNKONGRESS_ID=180&
XNMASKEN_ID=900
Submission 545
9 of 36
I spoke with Mikrogen about this and they suggested that increased incubation was not
required. We continued following the kit method for several months during which our
correlations with serology testing did not improve. I then managed to contact Dr. Van Loo
and spoke with her about this method. The conversation satisfied me that the method was
worth trialling so for the next few months we worked on validation of prolonged incubation.
Validation consisted of running all patient samples in tandem, one with 1 hour incubation
and a second with overnight incubation. We were able to confirm that overnight incubation
improved correlation with other more sensitive testing such as PCR and that the increased
incubation did not give false positives.
In relation to the comment made by Doctors Goossens and Van Loo Therefore, false
positive results have to be considered. Following is the statement that appears on our
result sheet for the recomLine assay.
Please note : An increase in ANA + EBV titres may induce false positives.
Practitioners are encouraged to test both ANA and EBV in patients with positive Blot results,
particularly with a positive IgM result.
Mikrogens production process is certified according to DIN EN ISO 13485. The Borrelia
recomLine IgM/IgG kit is CE-marked and matches the European Union IVD directive
98/79/EC.
Reading Submission 67, one would assume that all of our recomLine assays are sent out as
positive results. This is untrue. We find many more negative results than positive using the
recomLine kit. Statistics of patient results are found at;
Appendix 9. (Pg. 36)
A Quality Assurance Programme for Serological Testing of Borrelia species. This is a QAP
supplied by the Australian Royal College of Pathologists. This was passed successfully using
our prolonged incubation technique and with no false positives.
Submission 545
10 of 36
In response to Submission 362 relating to the accuracy of our testing
This anonymous Infectious Disease Specialist states the following :
I contacted the staff at Australian Biologics to ascertain how accurate their testing was. They sent
me data to say that testing on random samples of blood from patients presenting to a Rheumatology
Clinic and also random blood samples from well Australians showed positive results in approximately
70% and 35%, respectively. Thus the false positive rate appears to be extremely high with such
interferon gamma release assays. PCR testing by some of these groups uses short primers and a very
high number of cycles, both of which are known to be sources of false positives in all PCR tests.
Patients having these tests have often had a wide variety of investigations for their illness and are
understandably frustrated that their doctors cannot make a diagnosis easily. However, I am certainly
suspicious when they are charged over $1000 for a test with a very high false positive rate
The initial statement on interferon gamma release assays refers to the EliSpot LTT assay. This
statement is completely false. We have never carried out any testing on patients presenting to a
Rheumatology Clinic or performed random blood sampling on well Australians utilising EliSpot assays
or any other form of testing. If this doctor had called and asked for data on our accuracy of testing
we would have supplied our Quality Assurance Programmes from QCMD. The EliSpot assay is a kit
method and has been validated by the manufacturer AID Autoimmun Diagnostika GmbH in
Germany.
In relation to his comment on PCR, this statement is inaccurate.
To begin with, my staff are not allowed to divulge the origin and nature of reagents utilised in the
laboratory. With regard to our PCR technology, Australian Biologics uses probe mediated detection
technology which is by far the most specific PCR method for the detection of microorganisms. As a
result, false positivity can only occur by DNA contamination, however, we use the necessary controls
to know when false positives occur and runs are repeated to confirm positives when necessary.
That we have or would charge over $1000 for a test is also a falsehood. Our most expensive test is
the Borrelia EliSpot Lymphyocyte Transformation Test at $300, our PCR testing is $250 per sample.
Again it is very clear that this doctor has not had any contact at all with our laboratory and it is not at
all surprising that he has declined to provide his name.
Carl Sagan the late eminent astrophysicist stated Absence of Evidence is not Evidence of
Absence
We have provided evidence of presence that is being intentionally ignored.
Jennie Burke MSc (Hons)

Director,
Australian Biologics
Submission 545
11 of 36
A
Submission 545
12 of 36
APPENDIX 1B
SURVEYED
PATIENTS
Tested positive for
Borrelia; either never
left Australia or
developed symptoms
prior to travel.
Submission 545
13 of 36
APPENDIX 1C
ALL PATIENTS
Tested positive for
Borrelia in Australia.
Submission 545
APPENDIX 2
14 of 36
20 12 Bo rrelia burgdo rferi
Individual Report
D at ase t code : 1
D at e Su bm it t e d : 19 D EC 12
Ms Jenni e Bur k e
Aus tr a l i a n Bi o l o g i cs Tes ti ng S er vi ces P /L
S yd ney - 2 0 0 0
Aus tr a l i a .
Laborat ory Code : AU0 4 4
2 6 MAR 2 0 13
Dea r Ms Jenni e Bur k e,
QCMD 2012 Borreli a burgdorf eri DNA EQA Programme - Indi vi dual Report
Tha nk yo u fo r p a r ti ci p a ti ng i n thi s Q CMD EQ A P r o g r a mme. Li s ted b el o w a r e the p a nel co d es a nd s a mp l e co ntents o f the
EQ A p a nel yo u r ecei ved .
Expe ct e d re su lt s of t h e program m e in orde r of sam ple con t e n t an d con ce n t rat ion .

Sam ple
Mat rix *
Sam ple Con t e n t
Copie s/m l
Bb D NA12 -0 3
Buffe r
B. b ur g do r fe r i D NA
10 0 ,0 0 0 c o p i e s/ml
Bb D NA12 -0 4
Buffe r
10 ,0 0 0 c o p i e s/ml
Bb D NA12 -0 2
Buffe r
B. afze l i i D NA
10 0 ,0 0 0 c o p i e s/ml
Bb D NA12 -0 5
Buffe r
B. afze l i i D NA
10 ,0 0 0 c o p i e s/ml
Bb D NA12 -0 1
Buffe r
Bo r r r e l i a sp p . D NA Ne g ati ve
Bb D NA12 -0 8
Cul tur e Me di um
B. b ur g do r fe r i
Bb D NA12 -10
Cul tur e Me di um
10 ,0 0 0 c e l l s/ml
Bb D NA12 -0 6
Cul tur e Me di um
B. afze l i i
10 0 ,0 0 0 c e l l s/ml
10 ,0 0 0 c e l l s/ml
Bb D NA12 -0 7
Cul tur e Me di um
B. afze l i i
Bb D NA12 -0 9
Cul tur e Me di um
Bo r r e l i a sp p . Ne g ati ve
10 0 ,0 0 0 c e l l s/ml
* Buffer: TE Buffer. Culture medium: Borrelia MKP medium.

The values are not technology s pecific and s hould not be us ed by participants for method comparis on or as a target for individual laboratory as s es s ment.
Deta i l s o f yo ur i nd i vi d ua l p er fo r ma nce a r e p r o vi d ed i n thi s r ep o r t. A fi na l r ep o r t co nta i ni ng ful l p er fo r ma nce d eta i l s fo r

thi s EQ A p r o g r a mme wi l l b e p r o vi d ed s ep a r a tel y.
If yo u ha ve a ny q uer i es co ncer ni ng thi s s tud y p l ea s e co nta ct the Q CMD Neutr a l O ffi ce (neutr a l o ffi ce@ q cmd .o r g ).
Y o ur s S i ncer el y,
D r An t on Van Loon
QCMD Exe cu t ive Co-ordin at or
QCMD 2012: The data and report documents provided are intended for the s ole us e of the participant. It is bas ed on material in our pos s es s ion or s upplied to us , which we believe to be reliable. Whils t every
effort has been made to ens ure its accuracy, we cannot offer any warranty that factual errors have not occurred. We therefore take no res pons ibility for any damage or los s that may be s uffered by reas on
of any s uch inaccuracies .
www.qcmd.org
Submission 545
APPENDIX152 of 36
20 12 Borrelia burgdorferi
Analysis o f yo ur labo rat o ry's Qualit at ive EQA dat a
An alysis of you r laborat ory's pe rf orm an ce on t h e core prof icie n cy sam ple s:
The co r e p r o fi ci ency s a mp l es i n thi s EQ A p r o g r a mme wer e:

Bb DNA12 -0 1, Bb DNA12 -0 3, Bb DNA12 -0 4, Bb DNA12 -0 6 , Bb DNA12 -0 8 , Bb DNA12 -0 9 , Bb DNA12 -10
Y o u r ep o r ted 7/7 (10 0 .0 % ) o f the co r e s a mp l es co r r ectl y.
O f the to ta l d a ta s ets r ep o r ted b y a l l p a r ti ci p a nts i n thi s EQ A p r o g r a mme, 8 1.1% r ep o r ted co r r ect r es ul ts fo r a l l
co r e p r o fi ci ency s a mp l es .
An alysis of you r laborat ory's pe rf orm an ce on all prof icie n cy sam ple s:
You r laborat ory's qu alit at ive re su lt s an d pe rf orm an ce score s
Qu alit at ive
Sam ple
Sam ple Con t e n t
Sam ple
St at u s
Sam ple
T ype
You r
qu alit at ive
re su lt
You r
qu alit at ive
score
Bb D NA12 -0 3
Fr e q ue ntl y de te c te d
Co r e
p o si ti ve
Bb D NA12 -0 4
D e te c te d
Co r e
p o si ti ve
Bb D NA12 -0 2
B. afze l i i D NA
D e te c te d
Educ ati o nal
ne g ati ve
Bb D NA12 -0 5
B. afze l i i D NA
I nfr e q ue ntl y de te c te d
Educ ati o nal
p o si ti ve
Bb D NA12 -0 1
Bo r r r e l i a sp p . D NA Ne g ati ve
Ne g ati ve
Co r e
ne g ati ve
Bb D NA12 -0 8
Co r e
p o si ti ve
Bb D NA12 -10
Co r e
p o si ti ve
Bb D NA12 -0 6
B. afze l i i
Co r e
p o si ti ve
Bb D NA12 -0 7
B. afze l i i
D e te c te d
Educ ati o nal
p o si ti ve
Bb D NA12 -0 9
Bo r r e l i a sp p . Ne g ati ve
Ne g ati ve
Co r e
ne g ati ve
Su m Qu alit at ive Pan e l Score
Su m Qu alit at ive Pan e l Score s f or all part icipan t s
The numb er o f Q ua l i ta ti ve d a ta s ets a na l ys ed :
53
The s um o f the Q ua l i ta ti ve P a nel S co r e fo r yo ur d a ta s et i s : 2

Thi s s co r e (o r b etter ) wa s a chi eved b y :
73.6 % o f a l l d a ta s ets
II
www.qcmd.o rg
Submission 545
APPENDIX 2
16 of 36
20 13 Bo rrelia burgdo rferi
Individual Report
D at ase t code : 1
D at e Su bm it t e d : 2 4 OCT 13
Ms Jenni e Bur k e
S yd ney - 2 0 0 0
Aus tr a l i a .
2 3 DEC 2 0 13
QCMD 2013 Borreli a burgdorf eri DNA EQA Programme - Indi vi dual Report
Expe ct e d re su lt s of t h e program m e in orde r of sam ple con t e n t an d con ce n t rat ion .

Sam ple
Mat rix *
Sam ple Con t e n t
ce lls/m l
Bb D NA13 -0 3
Cul tur e me di um
B. g ar i ni i
1.0 x10 E5
Bb D NA13 -0 5
Cul tur e me di um
B. g ar i ni i
1.0 x10 E4
Bb D NA13 -0 7
Cul tur e me di um
B. g ar i ni i
1.0 x10 E3
Bb D NA13 -0 8
Cul tur e me di um
B. b ur g do r fe r i s.s.
1.0 x10 E5
Bb D NA13 -10
Cul tur e me di um
1.0 x10 E4
Bb D NA13 -0 2
Cul tur e me di um
1.0 x10 E3
Bb D NA13 -0 4
Cul tur e me di um
B. afze l i i
1.0 x10 E5
Bb D NA13 -0 6
Cul tur e me di um
B. afze l i i
1.0 x10 E4
Bb D NA13 -0 1
Cul tur e me di um
T r e p o ne ma p hag e de ni s
1.0 x10 E5
Bb D NA13 -0 9
Cul tur e me di um
Cul tur e ne g ati ve
* Culture medium: Borrelia MKP medium.

The values are not technology s pecific and s hould not be us ed by participants for method comparis on or as a target for individual laboratory as s es s ment.

1 of 2
www.qcmd.org
Submission 545
APPENDIX172 of 36
20 13 Borrelia burgdorferi

Bb DNA13-0 1, Bb DNA13-0 3, Bb DNA13-0 4, Bb DNA13-0 5, Bb DNA13-0 6 , Bb DNA13-0 8 , Bb DNA13-0 9 , Bb DNA13-10 .
Y o u r ep o r ted 8 /8 (10 0 .0 % ) o f the co r e s a mp l es co r r ectl y.
O f the to ta l d a ta s ets r ep o r ted b y a l l p a r ti ci p a nts i n thi s EQ A p r o g r a mme, 76 .7% r ep o r ted co r r ect r es ul ts fo r a l l
Qu alit at ive
Sam ple
Sam ple Con t e n t
Sam ple
St at u s
Sam ple
T ype
You r
qu alit at ive
re su lt
You r
qu alit at ive
score
Bb D NA13 -0 3
B. g ar i ni i
Co r e
p o si ti ve
Bb D NA13 -0 5
B. g ar i ni i
Co r e
p o si ti ve
Bb D NA13 -0 7
B. g ar i ni i
Educ ati o nal
p o si ti ve
Bb D NA13 -0 8
Co r e
p o si ti ve
Bb D NA13 -10
Co r e
p o si ti ve
Bb D NA13 -0 2
D e te c te d
Educ ati o nal
p o si ti ve
Bb D NA13 -0 4
B. afze l i i
Co r e
p o si ti ve
Bb D NA13 -0 6
B. afze l i i
Co r e
p o si ti ve
Bb D NA13 -0 1
Ne g ati ve
Co r e
ne g ati ve
Bb D NA13 -0 9
Cul tur e ne g ati ve
Ne g ati ve
Co r e
ne g ati ve
The numb er o f Q ua l i ta ti ve d a ta s ets a na l ys ed :
60
The s um o f the Q ua l i ta ti ve P a nel S co r e fo r yo ur d a ta s et i s : 0

Thi s ma xi mum s co r e wa s a chi eved b y :
6 5.0 % o f a l l d a ta s ets
2 of 2
www.qcmd.o rg
Submission 545
APPENDIX
18 2
of 36
20 14 Bo rrelia burgdo rferi s pp.
Individual Report
D at ase t code : 1
D at e Su bm it t e d : 0 5 NOV 14
Ms Jenni e Bur k e
S yd ney - 2 0 0 0
Aus tr a l i a .
19 DEC 2 0 14
QCMD 2014 Borreli a burgdorf eri s pp. DNA EQA Programme - Indi vi dual Report
Expe ct e d re su lt s of t h e program m e in orde r of sam ple con t e n t

Sam ple
Mat rix *
Sam ple Con t e n t
Qu alit at ive
Ct valu e
Bb D NA14-0 1
BHI Br o th
Bo r r e l i a g ar i ni i
2 /2 Po s (10 0 % )
2 3 .5 2
Bb D NA14-0 7
BHI Br o th
2 /2 Po s (10 0 % )
2 7.5 5
Bb D NA14-0 8
BHI Br o th
2 /2 Po s (10 0 % )
3 1.9 2
Bb D NA14-0 9
BHI Br o th
Bo r r e l i a b ur g do r fe r i s.s.
2 /2 Po s (10 0 % )
2 9 .2 6
Bb D NA14-0 3
BHI Br o th
2 /2 Po s (10 0 % )
3 2 .9 3
Bb D NA14-0 4
BHI Br o th
2 /2 Po s (10 0 % )
3 5 .5 8
Bb D NA14-10
BHI Br o th
Bo r r e l i a afze l i i
2 /2 Po s (10 0 % )
2 5 .9 0
Bb D NA14-0 5
BHI Br o th
2 /2 Po s (10 0 % )
2 9 .2 6
Bb D NA14-0 2
BHI Br o th
2 /2 Ne g (10 0 % )
Bb D NA14-0 6
BHI Br o th
Bo r r e l i a ne g ati ve
2 /2 Ne g (10 0 % )
* Brain Heart Infus ion (BHI) Broth.

The values provided are s pecific to the QCMD reference target and methodology us ed for the qualification of panel members . As quantification values are dependent on the analytical
procedure, the nucleic acid extraction and molecular as s ay us ed, they will vary from laboratory to laboratory, particularly when there are currently no accepted International S tandards
available. QCMD provides thes e values for reference purpos es only and it is important that laboratories es tablis h their own values bas ed on their laboratorys molecular procedures .
Qualitative: Qualitative res ults returned as Borrelia Pos itive or Negative by external tes ting laboratories including number of repeats and percentage correct.
Ct value: Cycle thres hold values provided by external tes ting laboratory.

1 of 2
www.qcmd.org
Submission 545
19 of 36
APPENDIX 2
20 14 Borrelia burgdorferi s pp.

Bb DNA14-0 1, Bb DNA14-0 2 , Bb DNA14-0 3, Bb DNA14-0 5, Bb DNA14-0 6 , Bb DNA14-0 7, Bb DNA14-0 9 , Bb DNA14-10 .
Y o u r ep o r ted 8 /8 (10 0 .0 % ) o f the co r e s a mp l es co r r ectl y.
O f the to ta l d a ta s ets r ep o r ted b y a l l p a r ti ci p a nts i n thi s EQ A p r o g r a mme, 9 8 .3% r ep o r ted co r r ect r es ul ts fo r a l l
Qu alit at ive
Sam ple
Sam ple Con t e n t
Sam ple
St at u s
Sam ple
T ype
You r
qu alit at ive
re su lt
You r
qu alit at ive
score
Bb D NA14-0 1
Co r e
p o si ti ve
Bb D NA14-0 7
Co r e
p o si ti ve
Bb D NA14-0 8
D e te c te d
Educ ati o nal
p o si ti ve
Bb D NA14-0 9
Co r e
p o si ti ve
Bb D NA14-0 3
Co r e
p o si ti ve
Bb D NA14-0 4
D e te c te d
Educ ati o nal
p o si ti ve
Bb D NA14-10
Co r e
p o si ti ve
Bb D NA14-0 5
Co r e
p o si ti ve
Bb D NA14-0 2
Ne g ati ve
Co r e
ne g ati ve
Bb D NA14-0 6
Bo r r e l i a ne g ati ve
Ne g ati ve
Co r e
ne g ati ve
Not e s on Qu alit at ive Pan e l Scorin g f or t h is EQA program m e

S cores were awarded for all panel members bas ed on qualitative s ample s tatus .
S cores provided on panel members BbDNA14-04 and -08 are for educational purpos es only.
T h e n u m be r of
Qu alit at ive dat ase t s
an alyse d
59
T h e su m of t h e
Qu alit at ive Pan e l Score
f or you r dat ase t is
T h is m axim u m score was

ach ie ve d by
2 of 2
8 9 .8 % o f a l l
d a ta s ets
www.qcmd.o rg
APPENDIX 2
Submission 545
Individual
Report
C at alo g ue C o d e :
QAB114147
QCMD 2015 Borrelia burgdorf eri spp.

DNA EQA Programme
C halle ng e /D ist rib ut io n:
BbDNA15
Analysis T yp e :
Qualitative
D at ase t :
51533
20 of 36
R e p o rt UID :
3894/51533/267
Part icip ant :

AU044- 01
Intended Results / Panel Composition

Samp le C o d e
Samp le C o nt e nt
Samp le Mat rix
D e t e ct io n Fre q ue ncy [1]
Samp le St at us
BbDNA15- 01
Borrelia miyamotoi
BHI Broth
Negative
EDUCATIONAL
BbDNA15- 02
Borrelia afz elii
BHI Broth
Frequently Detected
CORE
BbDNA15- 03
Borrelia afz elii
BHI Broth
Frequently Detected
CORE
BbDNA15- 04
Borrelia afz elii
BHI Broth
Frequently Detected
CORE
BbDNA15- 05
Borrelia burgdorferi s.s.
BHI Broth
Frequently Detected
CORE
BbDNA15- 06
Borrelia burgdorferi s.s.
BHI Broth
Frequently Detected
CORE
BbDNA15- 07
Borrelia bavariensis
BHI Broth
Frequently Detected
CORE
BbDNA15- 08
BHI Broth
Frequently Detected
CORE
BbDNA15- 09
BHI Broth
Frequently Detected
CORE
BbDNA15- 10
Borrellia Negative
BHI Broth
Negative
CORE
[2]
[1] De t e ct ion Fre que ncy: To aid q ualitative analys is e ac h p ane l me mb e r is as s ig ne d a fre q ue nc y o f d e te c tio n. This is b as e d o n
the p e e r g ro up c o ns e ns us o f all q ualitative re s ults re turne d fro m p artic ip ants within the EQ A c halle ng e / d is trib utio n.
[2] Sample St at us: EQ A s amp le s are d e fine d as CO RE o r EDUCATIO NAL. Co re p ro fic ie nc y s amp le s are re vie we d b y the Q CMD
Sc ie ntific Exp e rt(s ). This is o n the b as is o f s c ie ntific info rmatio n, c linic al re le vanc e , c urre nt lite rature and , whe re ap p ro p riate ,
p ro fe s s io nal c linic al g uid e line s . Partic ip ating lab o rato rie s are e xp e c te d to re p o rt c o re p ro fic ie nc y s amp le s c o rre c tly within the
EQ A c halle ng e / d is trib utio n.
For further details please refer to the current participant manual.
Your Summary Results

Unit s
EQ A Asse ssme nt G ro up
N/A
[1]
C o re Pane l D e t e ct io n ( Q ualit at ive ) Sco re
Real- time In- House PCR

[2]
C o re Pane l Est imat io n ( Q uant it at ive ) Sco re
Q C M D , Te c h n o l o g y Te rrac e , To d d C amp u s , We s t o f
Sc o tl an d Sc i e n c e Park , G l as g o w, G 20 0 XA Te l : +44 (0 ) 141
9 45 6 474, Fax: +44 (0 ) 141 9 45 579 5 We b : www.q c md .o rg
0
[3]
N/A
Pag e 1 o f 9
Is s u e D ate : 0 6 N o v 20 15
R e p o rt au th o ri s e d b y th e Q C M D Exe c u ti ve (1)
A U KAS ac c re d i te d p ro fi c i e n c y te s ti n g p ro vi d e r N o .438 5
Submission 545
APPENDIX 2
Individual
Report
QCMD 2015 Borrelia burgdorf eri spp.

DNA EQA Programme
C at alo g ue C o d e :
QAB114147
C halle ng e /D ist rib ut io n:

BbDNA15
Samp le
Code
EQ A Asse ssme nt
G ro up C o nse nsus
BbDNA15- 01
SD
Analysis T yp e :
Qualitative
D at ase t :
51533
21 of 36
R e p o rt UID :
3894/51533/267
[5]
Yo ur
Q uant it at ive
R e sult [6 ]
Yo ur
Q ualit at ive
R e sult [7]
Positive
BbDNA15- 02
Positive
BbDNA15- 03
Positive
BbDNA15- 04
Positive
BbDNA15- 05
Positive
BbDNA15- 06
Positive
BbDNA15- 07
Positive
BbDNA15- 08
Positive
BbDNA15- 09
Positive
BbDNA15- 10
Negative
[4]
D e t e ct io n
Sco re [8]
Part icip ant :

AU044- 01
Est imat io n
Sco re [9 ]
[1] EQ A Asse ssme nt Group: To aid d ata analys is , p artic ip ant re s ults are g ro up e d ac c o rd ing to the mo le c ular
amp lific atio n/d e te c tio n me tho d s p e c ifie d within the ir mo le c ular wo rkflo w fo r this c halle ng e / d is trib utio n. Fo r furthe r d e tails re fe r to
the Additional Information: Individual Panel Member Analysis s e c tio n o f this re p o rt.
[2] Core Pane l De t e ct ion (Q ualit at ive ) Score : An o ve rall c o re p ane l d e te c tio n s c o re p ro vid e d p e r c halle ng e / d is trib utio n.
[3] Core Pane l Est imat ion (Q uant it at ive ) Score : An o ve rall c o re p ane l e s timatio n s c o re p ro vid e d p e r c halle ng e / d is trib utio n.
[4] EQ A Asse ssme nt Group Conse nsus: The me an value fo r all re s ults within yo ur EQ A as s e s s me nt g ro up .
[5] SD: The s tand ard d e viatio n fo r re s ults fro m yo ur EQ A as s e s s me nt g ro up .
[6 ] Your Q uant it at ive Re sult : The q uantitative re s ult yo u re turne d fo r e ac h s amp le within this EQ A c halle ng e . LO D/NR (limit o f
d e te c tio n o r no t re p o rte d ).
[7] Your Q ualit at ive Re sult : The q ualitative re s ult yo u re p o rte d fo r e ac h s amp le within this EQ A c halle ng e / d is trib utio n.
[8 ] De t e ct ion Score : Yo ur d e te c tio n (q ualitative ) s c o re s are b as e d o n the as s ig ne d d e te c tio n fre q ue nc y o f e ac h p ane l me mb e rs ,
whe re 0 (z e ro ) is hig hly s atis fac to ry and 3 (thre e ) is hig hly uns atis fac to ry. Sc o re s are p ro vid e d fo r ind ivid ual p ane l me mb e rs .
[9 ] Est imat ion Score : Yo ur e s timatio n (q uantitative ) s c o re s are c alc ulate d b as e d o n yo ur variatio n fro m the c o ns e ns us fo r yo ur EQ A
as s e s s me nt g ro up . With 0 (z e ro ) s c o re d if the q uantitative value yo u re p o rte d is within o ne s tand ard d e viatio n (SD) fro m yo ur EQ A
as s e s s me nt g ro up c o ns e ns us , 1 (o ne ) if yo ur q uantitative value is b e twe e n o ne and two SDs , 2 (two ) if yo ur q uantitative value is
within two and thre e SDs and 3 (thre e ) if yo ur q uantitative value is mo re than thre e SDs fro m the me an o f yo ur EQ A as s e s s me nt
g ro up .
For further details please refer to the current participant manual.
Panel Score Breakdown
Q C M D , Te c h n o l o g y Te rrac e , To d d C amp u s , We s t o f
Sc o tl an d Sc i e n c e Park , G l as g o w, G 20 0 XA Te l : +44 (0 ) 141
9 45 6 474, Fax: +44 (0 ) 141 9 45 579 5 We b : www.q c md .o rg
Pag e 2 o f 9
Is s u e D ate : 0 6 N o v 20 15
R e p o rt au th o ri s e d b y th e Q C M D Exe c u ti ve (1)
A U KAS ac c re d i te d p ro fi c i e n c y te s ti n g p ro vi d e r N o .438 5
Submission 545
APPENDIX 3
RCPA Quality
Phone
Assurance Programs
Fax
ABN
+61 2 9045 6000
+61 2 9356
22
of 2003
36
32 003 520 072
Suite 201, 8 Herbert Street

St Leonards NSW 2065
www.rcpaqap.com.au
Parasite and Spirochaete Program
Survey Report
Participant Number 1074
Copyright
This material is copyright and may n
any purpose whatsoever (inclu
Limited. Permission must be sought in writing from the Program but will not be unreasonably refused.
Confidentiality
RCPA Quality Assurance Programs Pty L
party, unless required by legis
papers to journals.
2015 RCPA Quality Assurance Programs Pty Ltd. All rights reserved
File
S4:2015
Report Issued
Friday, 30 October 2015
Page
Page 1 of 11
Accredited for compliance with ISO/IEC 17043

Accreditation Number: 14863
Submission 545
APPENDIX 3
23 of 36
Survey Report
2015 RCPAQAP Serology. All rights reserved
RCPA Quality Assurance Programs Pty Ltd keeps all participant details confidential. Such details
will not be disclosed to a third party, unless required by legislation, without the prior written
consent of the participant.
Parasite & Spirochaete Module Report for Survey S4:2015 Due Date: 23 Oct 2015
Participant Number: 1074
Report comprises: Lyme Disease
Report Issued: 30 Oct 2015
Participants: 14
Test
Lyme Disease IgG
Spec
4E
Consensus
pos
Result
100%
Lyme Disease IgM

Lyme Disease Total Antibody
4E
neg
4E
No Consensus
Lyme Disease IgG Confirmatory Test
4E
Lyme Disease IgM Confirmatory Test
4E
Graphs
Your Result
NA
Your Score
-
Kit in date
-
Total Score
-
Possible
-
100%
NA
NA
No Consensus
pos
No Consensus
neg
Your Interpretative Comments
Total Score:
Test
Lyme Disease IgG
Spec
4F
Lyme Disease IgM

Lyme Disease Total Antibody
Consensus
No Consensus
Result
-
4F
pos
4F
No Consensus
Lyme Disease IgG Confirmatory Test
4F
Lyme Disease IgM Confirmatory Test
4F
Your Interpretative Comments
Graphs
100%
Your Result
NA
Your Score
-
Kit in date
-
Total Score
-
Possible
-
100%
NA
NA
No Consensus
pos
No Consensus
pos
Total Score:
Page 2 of 11
RCPAQAP Serology
Suite 201, Level 2
8 Herbert Street
ST LEONARDS NSW 2065
Phone: +61 2 9045 6070
Fax: 1300 78 29 21 (Aus)
+ 61 2 9356 2003 (Intl)
ABN: 32 003 520 072
100%
Submission 545
APPENDIX
24 of 36
Survey Report
2015 RCPAQAP Serology. All rights reserved
Cumulative Year to Date Scores for Participant 1074
Survey
Your Score
Possible Score
Your Percent
All Participants
S4:2015
100%
94%
Overall Year to Date:
100%

Page 4 of 11
RCPAQAP Serology
Suite 201, Level 2
8 Herbert Street
ST LEONARDS NSW 2065
Phone: +61 2 9045 6070
Fax: 1300 78 29 21 (Aus)
+ 61 2 9356 2003 (Intl)
ABN: 32 003 520 072
Submission 545
25 of 36
Appendix 4. Sequences
Lab
number
sample
Date
CM0906
Tick
29/10/14
CO1852(a)
CP0271
CO0676
CO1995
Tissue
(Site of Bite)
Blood
Serum
CSF
30/10/15
24/11/15
24/11/15
24/11/15
Organism
Borrelia garinii
Identity
98%
seq. alignment length

116
Borrelia burgdorferi
99%
100%
99%
99%
128
107
134
141
Sequences
>CM906
TATATTCCAGCCGGTaAGCATCTTTTGGTTAGAGATGGAGATGTTGTTAAAGCAGGCGATATGCTTTGTGATGGCAGA
ATTAATCCTCATGATGTGCTTGAAATTTTAGGTGGGA
NCBI Blast: https://drive.google.com/file/d/0By5_nsCaD9lob2xRdXN5Z2djLWM/view?usp=sharing
> CO1852(a)
CCGTTGGCAATCTACCATCACAAGCATATCTCCTGCTTTTACAACATCTCCAGTCTCTAACCAAAAGATGTTTTCCAGCT
GGAATATAATGCTTATGTTCAACCCCATACTCATCTAAAATATTAATAAGCCTTTTACCTTTTTGAATTGA
NCBI Blast: https://drive.google.com/file/d/0By5_nsCaD9loQ2lhdkhXM3pVTHc/view?usp=sharing
>CP271
GACTAGTGAACTGCATTCAAGCCTATCTCCTTTTTTGATTGAAACACATCTCCATCTCTAACCAAAAGATGTTTTCCAGCT
GGAATATAATGCTTATGTTCAACCCCATACTCATCTAAAATATTAATAAGCCTTTTACCTTTTTGAATTGAA
NCBI Blast: https://drive.google.com/file/d/0By5_nsCaD9loeWR6YkhGb05wRjQ/view?usp=sharing
>CO676
GCTAGTACTCTACATCACAAGCATATCTCCTGCTTTTACAACATCTCCATCTCTAACCAAAAGATGTTTTCCAGCTGGAA
TATAATGCTTATGTTCAACCCCATACTCATCTAAAATATTAATAAGCCTTTTACCTTTTTGAATTGAATT
NCBI Blast: https://drive.google.com/file/d/0By5_nsCaD9loUmRsYUhTWFh5XzA/view?usp=sharing
>CO1995
AATAGTCTCTACATCACAAGCATATCTCCTGCTTTTACAACATCTCCATCTCTAACCAAAAGATGTTTTCCAGCTGGAAT
ATAATGCTTATGTTCAACCCCATACTCATCTAAAATATTAATAAGCCTTTTACCTTTTTGAATTGAA
NCBI Blast: https://drive.google.com/file/d/0By5_nsCaD9loSnNZU2Joc1laLXM/view?usp=sharing
Submission 545
26 of 36
A
l
P
&
&
&
Borrelia
Elispot
Immunoblot
Submission 545
27 of 36
Submission 545
Rev.:
Laboratory Manual
Australian Biologics Testing Services Pty Ltd
0
28 of 36
Page #:
Appendix 47 Method Validation Report
1 of 2
APPENDIX 7
Method Validation Report

Microorganism:
Borrelia spp.
Aims:
The aim of this validation study is to assess or calculate:
1.
2.
3.1
3.2
4.
5.
6.
7.
the DNA extraction method;

the false positive rate;
the probability of detection depending on bacteria concentration;
the effect of different sample types (i.e.: blood concentrate, serum, urine, tissue or CSF) on detection;
the combined probability of detection of repeated tests;
the limit of detection of our real-time PCR assay;
the repeatability of results performed by the same operator;
the reproducibility of results performed by different operators;
Materials and Method:

1:DNA extraction
The genomic DNA of B.burgdorferi (AmpliRun DNA Control, 15,750 copies/ l, provided by Vircell) was serially diluted
to concentrations spanning from 10,000 to 2 copies/l. We spiked 2 l of each dilution into 500 l of negative samples (i.e.:
4l in 1ml). Therefore the initial DNA concentrations in our samples had a range from 40,000 to 8 copies/ml.
Since we wanted to assess the effect of sample types on detection, we used a range of donors samples which were
previously tested as negative. The samples types were: Blood Concentrate; Serum; Urine; Tissue and CSF. The preparation
of each sample type is described in our laboratory manual in Part II Sample preparation for DNA extraction.
The extraction of total DNA was performed using the Qiagen QIAamp DNA Mini Kit as described in the laboratory manual
in Part III DNA Extraction. All samples were eluted in 80 l.
For the PCR amplification, 2 l of DNA were used in each reaction, in a final volume of 20 l. The reaction setup was
performed according to the laboratory manual. Each sample was tested 5 times by each of two technicians, for a total of 10
reactions.
A total number of 504 reactions were performed to produce this study.
(See: Appendix 1 for raw data and DNA extraction validation)
2: False positives
To assess the false positive rate, a total of 84 reactions were performed on samples from two healthy donors.
A fluorescence threshold of 0.03 R was established such that the background did not interfere with our readings, especially
at high cycle numbers (>40). As Positive control were used 10 copies of B.burgdorferi; as negative control we used distilled
DNAase, RNAase-free water.
3: Probit regression analysis

We measured the rate of detection (i.e.: number of detections out of 10 reactions) for each dilution of B.burgdorferi
positive control, from 40,000 to 8 copies /ml. The R software was used to calculate Probit regression curves which predict
the rate of detection depending on DNA concentration.
C:\Documents and Settings\Me\Desktop\Senate\Appendix 5. Validation Report_10_Apr_ LM.docx

Created by:
Approved by:
Authorised by: Jennie Burke
Controlled Copy # LM_AB1/1

Issue date: 08/04/2014
Effective date: 08/04/2014
Unless signed by author, authoriser and/or approver, printed copy is controlled document only on date last printed 08/04/2014
Submission 545
Rev.:
Laboratory Manual
0
29 of 36
APPENDIX 7
Page #:
2 of 2
4 : Effect of replicate testing

We calculated the effect of replicate testing on the sensitivity of our assay.
We used the probability of detection estimated by the probit model and applied the binomial distribution to calculate the
probabilities of true positive; false negative and equivocal calling.
5 : Limit of detection
The probit regression analysis estimates the probability of detection depending on the DNA concentration, which provides a
measure of the sensitivity of our RT-PCR assay. Moreover we established the lowest concentration that could be
independently confirmed by direct sequencing.
6: Repeatability
Our data were analysed to assess the variability of results obtained by the same operator using the same instrument across
different tests (i.e.: repeatability). As a unit of measure we used the following: % Repeatability = 100 - % Standard
Deviation.
7: Reproducibility
The reproducibility of results was assessed comparing the means of measurements obtained by two operators and
performing a Students t-test for paired samples. A Bonferroni adjustment was performed in order to establish the correct
significance level for multiple testing.
Results:
1. DNA extraction validation
In order to evaluate the efficiency of our DNA extraction method we compared a standard curve obtained diluting the
B.burgdorferi control DNA in TE buffer (Fig 1a) with a standard curve obtained after spiking control DNA into different
sample types (Blood Concentrate; Serum; Urine; CSF and Tissue) and performing DNA extraction (Fig 1b). A detailed
explanation of the spiking protocol is provided in Appendix 1.1 (serial dilution 1).
Standard curve - unextracted

45
Ct value
40
y = -3.35x + 36.7
35
B.burg
30
25
20
-1
log(copies)
(a)

Created by:
Approved by:

Submission 545
Rev.:
Laboratory Manual
0
30 of 36
APPENDIX 7
Page #:
3 of 2
Standard curve - extracted

45
Blood Concentrate
Ct value
40
y = -3.3x + 36.7
Urine
35
Serum
Tissue
30
CSF
average
25
-1
Linear (average )
log(copies)
(b)
Figure 1: (a) standard curve before extraction; (b) after spiking in different samples and performing DNA extraction.
From the equations of the standard curves we calculate PCR efficiencies of nearly 100% both before and after extraction.
Similarly, the intercepts (i.e.: the Ct value for one copy of target DNA) were 36.7 cycles both before and after extraction,
which confirms that our DNA extraction method is reliable and quantitative (Appendix 1.3.)
2. False positive rate
In order to assess the false positive rate of the Borrelia RT-PCR assay we performed 84 reactions using negative samples
from 2 healthy donors and we observed no positives using a threshold of 0.03 R. Using a Bayesian approach (Gelman et
al. 2004; Carlin and Louis 1996, Appendix 2) we estimated the posterior mean false positive rate as (0+1)/(84+2) = 1.1%,
with one sided 95% credible interval of [0, 3.5%]. This places an upper limit of 3.5% for the false positive rate for a single
reaction. However, it is important remind the reader that it is our standard practice to process water samples along patients
samples in order to control for contamination during the DNA extraction or the PCR setup steps. Moreover, by performing
the PCR reactions up to 6 times, we reduce the probability of false positive calling. See section 4 for false positive
probability calculations.
Probit regression analysis

3.1 General probit model: probability of detection depending on concentration
The strength of real-time PCR results (Ct-values or cycle-threshold values) is that they are inversely proportional to the
template concentration for a wide range of concentrations. This gives the quantitative ability to this method. However, when
concentration falls below such ranges, the detection rate exhibits a probabilistic behaviour.
We wanted to assess the probability of detection of B.burgdorferi at concentration below the linear range. Therefore we
performed serial dilutions of standard controls and we spiked them into negative samples to achieve final concentrations
from 64 to 8 copies/ml and we performed further tests as described before. A probit regression model was constructed
combining all data, allowing us to estimate the overall probability of detection depending on DNA concentration. For this
analysis we will use copies/ml of sample as unit of concentration, as this is more relevant in the clinical practice. Figure 2
shows the Probit regression curve, which predicts the probability of detection depending on DNA concentration. See
Appendix 3.0 for input data and Appendix 3.1 for the parameters of the probit regression model.
Created by:
Approved by:

Submission 545
Rev.:
Laboratory Manual
0
31 of 36

APPENDIX 7
Page #:
4 of 2
Figure 2: Probit regression model combining all data
3.2 Effect of sample type

We included the sample types (i.e.: blood concentrate; serum; urine; CSF and tissue) as explanatory variables to assess if
they had an impact on the probability of detection. Figure 3 shows the probit curves for each sample type. The Probit
regression analysis for individual sample types shows that there is no significant effect of sample types on the probability of
detection (Anova p=0.46; see Appendix 3.2).

Created by:
Approved by:

Submission 545
Rev.:
Laboratory Manual
APPENDIX 7
0
32 of 36
Page #:
5 of 2
Figure 3: probit curves for individual sample types. Colour coding as per legend. Triangles: observed data points; dashed lines: probit
regression predictions.
Given the fact that the probability of detection is not affected by the sample type, we can provide a general table of
detection probabilities depending on DNA concentration (Table 3.4).
bacteria
Conc (copies/ml)
log.conc
P(Detection)
B.burgdorferi
40000
10.60
1.000
B.burgdorferi
8000
8.99
1.000
B.burgdorferi
1600
7.38
1.000
B.burgdorferi
320
5.77
1.000
B.burgdorferi
64
4.16
0.996
B.burgdorferi
32
3.47
0.956
B.burgdorferi
16
2.77
0.775
B.burgdorferi
12.8
2.55
0.673
2.08
0.422
B.burgdorferi
Table 3.4: detection probabilities
4 : Effect of replicate testing

We calculated the effect of replicate testing on the sensitivity of our assay. Each patients sample is routinely analysed in a
triplicate PCR reaction; the results are interpreted as follows:
0/3 = negative;
1/3 = inconclusive;
2/3, 3/3 = positive.
If the results are inconclusive, a new triplicate assay is performed, yielding a total of 6 reactions per sample. The new results
are interpreted as follows:

Created by:
Approved by:

Submission 545
Rev.:
Laboratory Manual
0
33 of 36
APPENDIX 7
Page #:
6 of 2
1/6 = negative;
2/6 = equivocal;
3/6, 4/6 = positive.
Given the probabilities of detection predicted by our probit model (Table 3.4) and applying the above-mentioned rules we
calculate that at 16 copies/ml we achieve a probability of detection of 97.3%, with a false negative rate of 1.3%.
Despite the 0% found in the 84 tests for a false positive, the Bayesian analysis in section 2 allowed false positive rate
estimates to be made as 3.5% (at the 95% probability level).
Using the same criterion for a true positive as given above, the false positive rate is 1.3%.
(For probability calculations, see Appendices 4.1, 4.2 and 4.3).
5 : Limit of detection
In order to ensure a probability of detection greater than 77%, as predicted in the probit regression model, we set our limit
of detection as 16 copies/ml (See Table 3.4). However, we successfully detected amplification signals from as low as 8
copies/ml: this detection was confirmed by end-point amplification and sequencing (Appendix 5).
6: Repeatability
Our data were analysed to assess the consistency of results obtained by the same operator across different tests (i.e.:
repeatability). As a unit of measure we used the following: % Repeatability = 100 - % Standard Deviation.
(5 repeats per measurement). Appendix 6 shows the data from repeatability studies.
Since we want to exclude the variability of the assay due to low template concentrations, we focussed on the data obtained
from samples with a concentration greater than 64 copies/ml. As shown in Figure 5, the repeatability of results by each
operator across all sample types and concentrations was above 95%.
% repeatability
Repeatability
100%
99%
98%
97%
96%
95%
94%
93%
92%
91%
90%
Blood conc. (Maira)

Blood conc. (Yean)
Urine (Maira)
Urine (Yean)
Serum (Maira)
Serum (Yean)
40,000
8,000
1600
320
Concentration (copies/ml)
64
Tissue (Maira)
Tissue (Yean)

Created by:
Approved by:

Submission 545
Rev.:
Laboratory Manual
0
34 of 36
APPENDIX 7
Page #:
7 of 2
Fig 5: repeatability of tests: percentage repeatability of results across different DNA concentrations and different sample types. (a) B.Burgdorferi data;
7: Reproducibility
The reproducibility of results performed by two operators (ie: reproducibility), was assessed comparing the means of each
data point and performing a Students t-test for paired samples: applying a Bonferroni adjustment for multiple testing, we
observed no statistical difference in 36 pairwise comparisons (T-test p values in Appendix 7). All the P-values are above
the adjusted significance level, which means that there is no statistically significant difference between the measurements of
different operators.
Comparison Maira - Yean

concentration (copies /ml)
Blood conc.
Serum
Urine
Tissue
CSF
40,000
8,000
1600
320
64
0.94
0.42
0.73
0.95
0.80
0.49
0.04
0.35
0.91
0.87
0.31
0.67
0.40
0.38
0.39
0.44
0.28
0.11
0.77
0.94
0.93
0.08
0.21
0.09
0.57
Comparison Maira - Lorenzo

concentration (copies /ml)
Blood conc.
Serum
Urine
64
32
16
0.72
0.23
0.02
0.05
0.46
0.30
0.56
0.22
0.82
Bonferroni adjustment of significance level: 0.05/number of comparisons (36) = 0.0014
Conclusion and Discussion:

With the present study we confirmed that our DNA extraction method is reliable and quantitative, since serial dilutions of
standard control DNA were detected with very similar parameters before and after extraction. We assessed the false
positive rate by testing multiple samples of known healthy donors: no positives were detected out of 84 reactions: with a
Bayesian approach we calculated that the upper limit of the false positive rate is 3.5% (95% confidence) for a single
reaction. This has also been shown in our participation of a Quality Assurance Programme from QCMD where our false
positive rate again was 0%. Moreover, by performing the PCR reactions up to 6 times, we reduce the probability of false
positive calling.
The use of probit regression analysis allows us to predict a probability of detection depending on the initial DNA
concentration in the samples and allows us to state that there is no significant difference of detection depending on sample
types. Moreover, replicate testing increases the probability of detection and reduces the probability of false positive calling.
Our assay has high sensitivity: we predict a 77% probability of detection in samples with as low as 16 copies per ml.
The repeatability of the data produced by each of three different operators has been shown to be above 95% and the
reproducibility of data between operators has been determined to be statistically significant according to Students t-test for
paired samples. These observed repeatability and reproducibility are therefore fit for purpose.
We have been very aware that samples from Australian patients for this assay do not contain high levels of the infective
organisms DNA, therefore utilising probit regression to measure the sensitivity of this assay has been a most useful
exercise. We have shown that replicate testing greatly enhances our detection ability.
Created by:
Approved by:

Submission 545
Rev.:
Laboratory Manual
0
35 of 36

APPENDIX 7
Page #:
8 of 2
References
Gelman, A., Carlin, J.B., Stern, H.S. and Rubin, D.B., Bayesian Data Analysis, 2004, 2nd Ed., Boca Raton, FL , Chapman
& Hall/CRC
Carlin, B.P. & Louis, T.A. (1996), Bayes and Empirical Bayes Methods for Data Analysis, Chapman & Hall, London
Additional Notes and Recommendations:
Approved by
Date

Created by:
Approved by:

Submission 545
36 of 36
A

Australian Biologics Response To Senate Inquiry Into Lyme Disease

Загружено:

Сведения о документе

Оригинальное название

Авторское право

Доступные форматы

Поделиться этим документом

Поделиться или встроить документ

Параметры публикации

Этот документ был вам полезен?

Это неприемлемый материал?

Авторское право:

Доступные форматы

Australian Biologics Response To Senate Inquiry Into Lyme Disease

Загружено:

Авторское право:

Доступные форматы

Growing evidence of an emerging tick-borne disease that causes a Lyme like illness for many Australian patients

(Please note in the 2015 QAP our ability to detect B.miyamotoi)

Sequences of Australian tick and Australian patients (Pg. 25)

Comparison of three technologies testing for Borrelia. (Pg. 26)

Total number of patients tested by PCR. (Pg. 27)

Serology and Immunology for the detection of Borrelia :

Probit Regression Study. (Pg. 28)

Australian Biologics Research publications relating to Borrelia.

Prolonged incubation and improved read-out of the recomLine Borrelia

Jennie Burke MSc (Hons)

20 12 Bo rrelia burgdo rferi

Laborat ory Code : AU0 4 4

Dea r Ms Jenni e Bur k e,

Expe ct e d re su lt s of t h e program m e in orde r of sam ple con t e n t an d con ce n t rat ion .

Sam ple Con t e n t

* Buffer: TE Buffer. Culture medium: Borrelia MKP medium.

Deta i l s o f yo ur i nd i vi d ua l p er fo r ma nce a r e p r o vi d ed i n thi s r ep o r t. A fi na l r ep o r t co nta i ni ng ful l p er fo r ma nce d eta i l s fo r

Analysis o f yo ur labo rat o ry's Qualit at ive EQA dat a

The co r e p r o fi ci ency s a mp l es i n thi s EQ A p r o g r a mme wer e:

Sam ple Con t e n t

Educ ati o nal

Educ ati o nal

Educ ati o nal

Su m Qu alit at ive Pan e l Score

Su m Qu alit at ive Pan e l Score s f or all part icipan t s

The numb er o f Q ua l i ta ti ve d a ta s ets a na l ys ed :

The s um o f the Q ua l i ta ti ve P a nel S co r e fo r yo ur d a ta s et i s : 2

20 13 Bo rrelia burgdo rferi

Laborat ory Code : AU0 4 4

Dea r Ms Jenni e Bur k e,

Expe ct e d re su lt s of t h e program m e in orde r of sam ple con t e n t an d con ce n t rat ion .

Sam ple Con t e n t

Cul tur e ne g ati ve

* Culture medium: Borrelia MKP medium.

Deta i l s o f yo ur i nd i vi d ua l p er fo r ma nce a r e p r o vi d ed i n thi s r ep o r t. A fi na l r ep o r t co nta i ni ng ful l p er fo r ma nce d eta i l s fo r

Analysis o f yo ur labo rat o ry's Qualit at ive EQA dat a

The co r e p r o fi ci ency s a mp l es i n thi s EQ A p r o g r a mme wer e:

Sam ple Con t e n t

Educ ati o nal

Educ ati o nal

Cul tur e ne g ati ve

Su m Qu alit at ive Pan e l Score

Su m Qu alit at ive Pan e l Score s f or all part icipan t s

The numb er o f Q ua l i ta ti ve d a ta s ets a na l ys ed :

The s um o f the Q ua l i ta ti ve P a nel S co r e fo r yo ur d a ta s et i s : 0

20 14 Bo rrelia burgdo rferi s pp.

Laborat ory Code : AU0 4 4

Dea r Ms Jenni e Bur k e,

Expe ct e d re su lt s of t h e program m e in orde r of sam ple con t e n t

Sam ple Con t e n t

* Brain Heart Infus ion (BHI) Broth.

Deta i l s o f yo ur i nd i vi d ua l p er fo r ma nce a r e p r o vi d ed i n thi s r ep o r t. A fi na l r ep o r t co nta i ni ng ful l p er fo r ma nce d eta i l s fo r

20 14 Borrelia burgdorferi s pp.

Analysis o f yo ur labo rat o ry's Qualit at ive EQA dat a

The co r e p r o fi ci ency s a mp l es i n thi s EQ A p r o g r a mme wer e:

Sam ple Con t e n t

Educ ati o nal

Educ ati o nal

Su m Qu alit at ive Pan e l Score

Not e s on Qu alit at ive Pan e l Scorin g f or t h is EQA program m e

Su m Qu alit at ive Pan e l Score s f or all part icipan t s

T h is m axim u m score was

QCMD 2015 Borrelia burgdorf eri spp.