Вы находитесь на странице: 1из 9

Acta Tropica 134 (2014) 43–51

Acta Tropica 134 (2014) 43–51 Contents lists available at ScienceDirect Acta Tropica j o u r

Contents lists available at ScienceDirect

Acta Tropica

j o u r nal home p age: www.elsevier.com/locate/actatropica

Acta Tropica 134 (2014) 43–51 Contents lists available at ScienceDirect Acta Tropica j o u r

Deep intraspecific divergences in the medically relevant fat-tailed scorpions (Androctonus, Scorpiones)

Acta Tropica 134 (2014) 43–51 Contents lists available at ScienceDirect Acta Tropica j o u r

P. Coelho a , P. Sousa a,b , D.J. Harris a,b , A. van der Meijden a,

a CIBIO, InBio, Centro de Investigac¸ ão em Biodiversidade e Recursos Genéticos, Universidade do Porto, Campus Agrário de Vairão, Vairão 4485-661, Portugal b Departamento de Biologia, Faculdade de Ciências, Rua do Campo Alegre, Porto FC4 4169-007, Portugal

a r

t i

c l e

i n f o

Article history:

Received 9 October 2013 Received in revised form 28 January 2014 Accepted 1 February 2014 Available online 11 February 2014

Keywords:

Scorpionism

Androctonus

Scorpions

Phylogeny

Biogeography

Cryptic diversity

a b s t r a c t

The genus Androctonus, commonly known as fat-tailed scorpions, contains 22 species distributed from Togo and Mauritania in the west, North Africa, through the Middle East and to as far east as India. With 13 species, a substantial amount of this genus’ diversity occurs in North Africa, which is a major hotspot of scorpion sting incidents. Androctonus are among the most medically relevant animals in North Africa. Since venom composition within species is known to vary regionally, the improvement of therapeutic

management depends on a correct assessment of the existing regional specific and sub-specific variation. In this study, we assessed the phylogeographical patterns in six species of Androctonus scorpions from North Africa using mitochondrial DNA markers. We sequenced COX1, 12S, 16S and ND1 genes from 110 individuals. Despite lacking basal resolution in the tree, we found taxonomical and geographically coherent clades. We discovered deep intraspecific variation in the widespread Androctonus amoreuxi and Androctonus australis, which consisted of several well-supported clades. Genetic distances between some of these clades are as high as those found between species. North African A. australis have a deep split in Tunisia around the Chott el-Djerid salt-lake. A novel split between A. amoreuxi scorpions was found in Morocco. We also found deep divergences in Androctonus mauritanicus, corresponding to areas attributed to invalidated subspecies. In addition we uncovered a clade of specimens from coastal south Morocco, which could not be ascribed to any know species using morphological characters. Based on these findings we recommend a reassessment of venom potency and anti-venom efficacy between these deep intraspecific divergent clades.

© 2014 Elsevier B.V. All rights reserved.

1. Introduction

Worldwide, 1.2 million people are stung by scorpions every year. Scorpionism, defined as the severe to lethal incident as a conse- quence of a scorpion sting (Lourenc¸ o and Cuellar, 1995) may be responsible for 3250 global annual mortalities which are mostly concentrated in a few high-risk areas (Chippaux and Goyffon, 2008). North Africa in particular is considered a high-risk area for scorpionism (Chippaux and Goyffon, 2008), with the genera Leiu- rus Ehrenberg, 1828 and Androctonus Ehrenberg, 1828 being the foremost cause of serious envenomation in this area (Goyffon and Guette, 2005; Graham, 2011; Habermehl, 1994). Five Androctonus species are considered as dangerous to man, particularly Androc- tonus mauritanicus (Pocock, 1902) and thewidespread Androctonus

Corresponding author. Tel.: +351 916712100. E-mail address: mail@arievandermeijden.nl (A. van der Meijden).

http://dx.doi.org/10.1016/j.actatropica.2014.02.002

0001-706X/© 2014 Elsevier B.V. All rights reserved.

australis (Linnaeus, 1758), which are the most dangerous Androc- tonus in the Maghreb region (Morocco, Algeria, Tunisia) (Goyffon and Guette, 2005). A. australis is known for envenomating humans and possessing a high toxicity (LD 50 = 0.32 mg/kg in mice; Watt and Simard, 1984). For this reason, A. australis was one of the first species of scorpions to have its venom purified for neurotoxin char- acterization (Miranda et al., 1966). As in snakes (Daltry et al., 1996; Prasad et al., 1999), scorpion venom is known to have consider- able intraspecific regional variation in composition (Devaux et al., 2004; El Ayeb and Rochat, 1985; Newton et al., 2007; Smertenko et al., 2001), and thus a different response to antivenom treatment (Omran and McVean, 2000). Furthermore, other species such as Androctonus amoreuxi (Audouin, 1826) may also cause more cases of scorpionism than currently thought (Goyffon et al., 2012). It is therefore important to study the phylogeographical patterns of Androctonus over a great part of their distribution as it may have direct applications in therapeutic management. Androctonus is present in deserts and semi-arid regions from Togo to Morocco in the Atlantic coast of Africa (Lourenc¸ o and

44

P. Coelho et al. / Acta Tropica 134 (2014) 43–51

Qi, 2007; Lourenc¸ o, 2008) to the Maghreb countries and Egypt where they are also present in relatively elevated areas like the Atlas Mountains and the Sinai Peninsula mountain range (Vachon, 1952), the Middle East (Levy and Amitai, 1980), reaching across Afghanistan (Vachon, 1958) to India (Tikader and Bastawade, 1983). Little is known about the biogeography of Androctonus, although the radiation of buthids has been associated with the aridification of the Palearctic Region (Fet et al., 2003, 1998). In this work, we assess five species of the Maghrebian countries except for Libya, plus Egypt and the Sinai Peninsula. A. mauritani- cus occurs in Morocco. This country shares a further three species with Algeria, Tunisia and/or Egypt (Androctonus liouvillei, A. aus- tralis and A. amoreuxi), while Androctonus bicolor occurs in Algeria and Tunisia. A. amoreuxi is known to occur mostly in sandy deserts while A. australis and A. mauritanicus can be found in anthropogenic environments (Stockmann and Ythier, 2010). The country in our area of study with the most species of Androctonus, Morocco, is also the most orographically diverse. The mountain chains that subdi- vide Morocco, North to south the Rif Mountains, Middle Atlas, High Atlas and Anti-Atlas Mountains, are known to be important in the diversification of the scorpion genus Buthus (Husemann et al., 2012; Sousa et al., 2012; Pedroso et al., 2013). Similarly, the Tell Atlas Mountains and Aurès Mountains of Algeria and Tunisia are associ- ated with Buthus (Pedroso et al., 2013). Although Androctonus are generally not as orophilic as Buthus, these mountain chains may form a barrier for dispersal of the lowland species. However, at least one Maghreb Androctonus species is known to be associated with the Hoggar mountains in Southern Algeria; Androctonus hoggarensis (Pallary, 1929) The scorpion genus Androctonus was first described by Ehren- berg in 1828. Vachon (1952) stabilized the genus’ taxonomy, transforming it into a morphological and geographical coherent group with seven species known in North Africa. Lourenc¸ o (2005) produced an important taxonomical revision of the genus: the sub- species of A. australis and A. mauritanicus were no longer considered valid, Androctonus crassicauda gonneti Vachon, 1948 was raised to the status of species, Androctonus aeneas C. L. Koch, 1839 was placed in the synonymy of A. bicolor Ehrenberg, 1828 and A. liouvillei (Pal- lary, 1924) was raised to the species level. Recently, molecular tools have been used to assess the phy- logeny of Androctonus in Tunisia. Ben Ali et al. (2000), using nuclear DNA ITS regions (ITS-rDNA), found paraphyletic clades in three

well-accepted taxa (A. bicolor, A. australis and A. amoreuxi). Ben Othmen et al. (2004), using allozymic differentiation, found little support for the monophyly of A. australis and A. amoreuxi individ- ually. However three well-supported monophyletic lineages using 16S-rDNA, each corresponding to a species were recovered in a sub- sequent study, thus demonstrating the usefulness of this gene as a barcoding marker (Ben Othmen et al., 2009). Furthermore, they found a phylogeographic pattern of A. australis in Tunisia, where each of its two lineages are distributed to the north or south of the Chott el-Djerid salt lake, situated in central Tunisia. However their molecular dating makes it unlikely that the salt lake forma- tion has generated a vicariant evolution of Tunisian A. australis. In recent years, molecular studies using the mitochondrial COX1 gene already uncovered considerable cryptic diversity in other scorpion genera in the Maghreb region (Gantenbein and Largiadèr, 2003; Sousa et al., 2012, 2011, 2010). However, a molecular phylogenetic study of the medically relevant scorpions of the genus Androctonus across the Maghreb region has thus far not been performed. In this study, we assess the patterns of diversity estimated from COX1, 16S and 12S sequence data across the Maghreb region and Egypt. A separate reduced dataset was also made from ND1 sequences. We here provide the first molecular phylogeny for Androctonus scorpions in Morocco, Algeria and Egypt.

  • 2. Materials and methods

    • 2.1. Taxon sampling

We collected samples in the field in three countries: Morocco, Tunisia and Egypt (Fig. 1). Algerian samples were donated by Dr. Said Larbes. Additional specimens were purchased through the pet-trade for which no locality data were available other than the country of origin. Sampling sites are illustrated in Fig. 1 and fur- ther details are provided in Table 1. Scorpions were captured with long forceps and preserved in 96% ethanol. To minimize the impact on scorpion populations, non-lethal sampling methods were used when possible, and consisted of removing the distal part of one of the second leg pairs. The scorpion was subsequently placed in the sand, facilitating the clotting process and thus minimiz- ing haemolymph loss. Scorpions can recover partially amputated appendages after a few molts and it is common for scorpions to be active and functional even when missing appendages (pers. obs.).

44 P. Coelho et al. / Acta Tropica 134 (2014) 43–51 Qi, 2007; Lourenc¸ o, 2008

Fig. 1.

Map representing the sampling locations across North Africa of Androctonus scorpions. Inset shows Egyptian samples. Pet trade acquired samples were without locality

P. Coelho et al. / Acta Tropica 134 (2014) 43–51

Table 1

45

Geographical referencing of the sampled specimens, their voucher identifiers and respective countries of origin. Coordinates are in the WGS84 datum, in decimal degrees.

M.D. indicates missing data.

Taxon

Country

Clade

Latitude

Longitude

Sc code

Accession numbers a

 

12S

16S

COI

ND1

amoreuxi

  • A. 30.176

Morocco

AM1

6.875

304

KJ538271

KJ538272

M.D.

M.D.

  • A. 30.907

AM1

amoreuxi

Algeria

3.997

450

KJ538273

KJ538274

KJ538275

KJ538276

amoreuxi

  • A. 31.143

Morocco

AM1

4.387

808

KJ538277

KJ538278

KJ538279

M.D.

  • A. 28.250

Morocco

amoreuxi

AM1

9.333

1472

KJ538280

KJ538281

KJ538282

KJ538283

  • A. 28.446

Morocco

amoreuxi

AM1

9.373

1479

KJ538284

KJ538285

KJ538286

KJ538287

  • A. 28.773

Morocco

amoreuxi

AM1

9.459

1485

KJ538288

KJ538289

KJ538290

KJ538291

  • A. 28.606

Morocco

amoreuxi

AM1

9.430

1487

KJ538292

KJ538293

KJ538294

M.D.

  • A. 29.046

Morocco

amoreuxi

AM1

8.777

1489

KJ538295

KJ538296

KJ538297

KJ538298

amoreuxi

  • A. 29.148

Morocco

AM1

8.605

1491

KJ538299

KJ538300

KJ538301

KJ538302

amoreuxi

  • A. 29.060

Morocco

AM1

8.852

1493

KJ538303

KJ538304

KJ538305

KJ538306

  • A. 29.727

Morocco

amoreuxi

AM1

7.975

1503

KJ538307

KJ538308

KJ538309

KJ538310

  • A. 29.630

Morocco

amoreuxi

AM1

8.010

1507

KJ538311

KJ538312

KJ538313

KJ538314

  • A. 29.680

Morocco

amoreuxi

AM1

7.982

1508

KJ538315

KJ538316

KJ538317

KJ538318

  • A. 32.440

amoreuxi

Algeria

AM2

3.740

423

KJ538421

KJ538422

KJ538423

KJ538424

  • A. 32.440

amoreuxi

Algeria

AM2

3.740

424

KJ538425

KJ538426

KJ538427

M.D.

  • A. 32.476

Morocco

amoreuxi

AM2

1.721

791

KJ538428

M.D.

KJ538429

KJ538430

  • A. 32.505

Morocco

amoreuxi

AM2

1.502

794

KJ538431

KJ538432

KJ538433

M.D.

  • A. 31.143

Morocco

amoreuxi

AM2

4.022

807

KJ538434

KJ538435

KJ538436

M.D.

  • A. 33.943

AM2

amoreuxi

Tunisia

8.034

913

KJ538437

KJ538438

KJ538439

KJ538440

  • A. 33.943

amoreuxi

Tunisia

AM2

8.034

920

KJ538441

KJ538442

KJ538443

KJ538444

amoreuxi

  • A. 32.476

Morocco

AM2

1.721

1056

KJ538445

KJ538446

KJ538447

M.D.

  • A. 33.892

Morocco

amoreuxi

AM2

2.019

1403

KJ538448

KJ538449

KJ538450

M.D.

  • A. M.D.

Egypt

amoreuxi

AM3

M.D.

627

KJ538476

KJ538477

KJ538478

M.D.

  • A. M.D.

Egypt

amoreuxi

AM3

M.D.

671

KJ538479

M.D.

KJ538480

M.D.

  • A. M.D.

Egypt

amoreuxi

AM3

M.D.

770

KJ538481

KJ538482

KJ538483

M.D.

amoreuxi

  • A. M.D.

Egypt

AM3

M.D.

1165

KJ538484

KJ538485

KJ538486

M.D.

  • A. M.D.

Egypt

amoreuxi

AM3

M.D.

1375

KJ538487

KJ538488

KJ538489

M.D.

amoreuxi

  • A. M.D.

Egypt

AM3

M.D.

1413

KJ538490

KJ538491

KJ538492

M.D.

  • A. 32.440

australis

Algeria

AU1

3.740

416

KJ538337

KJ538338

KJ538339

M.D.

  • A. 32.440

australis

Algeria

AU1

3.740

417

KJ538340

KJ538341

KJ538342

M.D.

  • A. 32.440

australis

Algeria

AU1

3.740

418

M.D.

KJ538343

KJ538344

M.D.

  • A. 32.440

australis

Algeria

AU1

3.740

419

KJ538345

KJ538346

KJ538347

M.D.

  • A. 32.440

AU1

australis

Algeria

3.740

420

KJ538348

KJ538349

KJ538350

KJ538351

  • A. 32.440

australis

Algeria

AU1

3.740

421

M.D.

KJ538352

KJ538353

M.D.

  • A. 32.440

australis

Algeria

AU1

3.740

422

KJ538354

KJ538355

KJ538356

M.D.

  • A. 35.115

australis

Algeria

AU2

5.182

378

KJ538385

M.D.

KJ538386

M.D.

  • A. 35.170

australis

Algeria

AU2

2.217

382

KJ538387

KJ538388

KJ538389

M.D.

  • A. 35.368

AU2

australis

Algeria

2.055

385

KJ538390

M.D.

KJ538391

KJ538392

  • A. 35.368

australis

Algeria

AU2

2.055

386

KJ538393

KJ538394

M.D.

M.D.

  • A. 34.334

AU2

australis

Tunisia

8.579

903

KJ538395

KJ538396

KJ538397

M.D.

  • A. 34.334

australis

Tunisia

AU2

8.579

904

KJ538398

KJ538399

KJ538400

KJ538401

  • A. 34.334

australis

Tunisia

AU2

8.579

905

M.D.

KJ538402

KJ538403

M.D.

  • A. 33.943

australis

Tunisia

AU2

8.034

914

KF824968

KF825083

KF825024

M.D.

  • A. 33.943

australis

Tunisia

AU2

8.034

915

KJ538406

KJ538407

KJ538408

M.D.

  • A. 33.943

AU2

australis

Tunisia

8.034

916

KJ538409

KJ538410

KJ538411

M.D.

  • A. 33.943

australis

Tunisia

AU2

8.034

917

KJ538412

KJ538413

KJ538414

M.D.

  • A. 33.943

australis

Tunisia

AU2

8.034

918

KJ538415

KJ538416

KJ538417

M.D.

  • A. 33.943

australis

Tunisia

AU2

8.034

919

KJ538418

KJ538419

KJ538420

M.D.

  • A. 33.527

australis

Tunisia

AU3

8.790

922

KJ538150

KJ538151

KJ538152

M.D.

  • A. 33.527

AU3

australis

Tunisia

8.790

923

KJ538153

KJ538154

KJ538155

M.D.

  • A. 33.527

australis

Tunisia

AU3

8.790

924

KJ538156

M.D.

KJ538157

M.D.

  • A. 33.536

australis

Tunisia

AU3

9.522

928

KJ538158

KJ538159

M.D.

M.D.

  • A. 33.533

australis

Tunisia

AU3

9.991

932

KJ538160

KJ538161

KJ538162

M.D.

  • A. 33.533

australis

Tunisia

AU3

9.991

933

KJ538163

KJ538164

KJ538165

M.D.

  • A. 33.533

AU3

australis

Tunisia

9.991

934

KJ538166

KJ538167

KJ538168

M.D.

  • A. 32.785

australis

Tunisia

AU3

10.373

938

KJ538169

KJ538170

KJ538171

M.D.

  • A. 32.785

australis

Tunisia

AU3

10.373

939

KJ538172

KJ538173

KJ538174

M.D.

  • A. 32.785

australis

Tunisia

AU3

10.373

940

KJ538175

KJ538176

KJ538177

M.D.

  • A. 33.650

australis

Tunisia

AU3

10.317

948

KJ538178

KJ538179

KJ538180

KJ538181

  • A. 33.650

australis

Tunisia

AU3

10.317

950

KJ538182

KJ538183

KJ538184

M.D.

  • A. 33.650

australis

Tunisia

AU3

10.317

951

KJ538185

KJ538186

KJ538187

M.D.

  • A. M.D.

Egypt

australis

AU4

M.D.

626

KJ538451

M.D.

KJ538452

KJ538453

  • A. 31.279

Egypt

australis

AU4

27.055

954

M.D.

KJ538454

KJ538455

KJ538456

  • A. 31.279

Egypt

australis

AU4

27.055

957

KJ538457

M.D.

KJ538458

M.D.

  • A. 28.809

Egypt

australis

AU4

34.228

981

KJ538459

M.D.

KJ538460

M.D.

  • A. 28.822

Egypt

australis

AU4

34.182

992

KF548101

KJ538461

KJ538462

KJ538463

  • A. 28.822

Egypt

australis

AU4

34.182

993

KJ538464

KJ538465

KJ538466

KJ538467

  • A. M.D.

Egypt

australis

AU4

M.D.

1374

KJ538468

KJ538469

KJ538470

KJ538471

  • A. M.D.

Egypt

australis

AU4

M.D.

1414

KJ538472

KJ538473

KJ538474

KJ538475

  • A. 35.208

B

bicolor

Algeria

1.541

377

KF548106

KJ538319

KJ538320

M.D.

  • A. 35.208

B

bicolor

Algeria

1.541

383

KJ538321

KJ538322

M.D.

M.D.

  • A. 33.846

B

bicolor

Tunisia

10.128

947

KJ538323

KJ538324

KJ538325

KJ538326

46

Table 1 (Continued )

P. Coelho et al. / Acta Tropica 134 (2014) 43–51

Taxon

Country

Clade

Latitude

Longitude

Sc code

Accession numbers a

 

12S

16S

COI

ND1

  • A. 33.650

B

bicolor

Tunisia

10.317

949

KJ538327

KJ538328

KJ538329

KJ538330

bicolor

  • A. M.D.

Egypt

B

M.D.

1093

KJ538331

KJ538332

KJ538333

KJ538334

bicolor

  • A. M.D.

Egypt

B

M.D.

1371

KJ538335

KJ538336

M.D.

M.D.

cf. gonneti

  • A. 28.479

Morocco

G

11.212

1453

KJ538372

KJ538373

KJ538374

M.D.

cf. Gonneti

  • A. 28.479

Morocco

G

11.212

1454

KJ538375

KJ538376

KJ538377

KJ538378

cf. Gonneti

  • A. 28.479

Morocco

G

11.212

1455

KJ538379

KJ538380

KJ538381

KJ538382

cf. Gonneti

  • A. 28.479

Morocco

G

11.212

1456

KJ538383

KJ538384

M.D.

M.D.

liouvillei

  • A. 30.668

Morocco

L

6.380

210

KJ538188

KJ538189

M.D.

M.D.

liouvillei

  • A. 34.286

Morocco

L

3.169

780

KJ538190

M.D.

KJ538191

KJ538192

liouvillei

  • A. 34.286

Morocco

L

3.169

781

KJ538193

KJ538194

KJ538195

M.D.

liouvillei

  • A. 33.892

Morocco

L

2.019

786

KJ538196

KJ538197

KJ538198

M.D.

liouvillei

  • A. 33.213

Morocco

L

2.019

787

KJ538199

KJ538200

KJ538201

M.D.

liouvillei

  • A. 32.087

Morocco

L

1.241

793

KJ538202

KJ538203

KJ538204

KJ538205

liouvillei

  • A. 32.571

Morocco

L

2.015

796

KJ538206

KJ538207

KJ538208

M.D.

liouvillei

  • A. 32.571

Morocco

L

2.015

797

KJ538209

KJ538210

KJ538211

KJ538212

liouvillei

  • A. 33.289

Morocco

L

3.780

816

KJ538213

KJ538214

KJ538215

M.D.

liouvillei

  • A. 33.508

Morocco

L

3.528

817

KJ538216

KJ538217

M.D.

M.D.

liouvillei

  • A. 33.892

Morocco

L

2.019

830

KJ538218

KJ538219

KJ538220

M.D.

liouvillei

  • A. 32.087

Morocco

L

1.241

839

KJ538221

KJ538222

KJ538223

M.D.

liouvillei

  • A. 33.213

Morocco

L

2.019

1055

KJ538224

KJ538225

KJ538226

M.D.

liouvillei

  • A. 33.892

Morocco

L

2.019

1207

KJ538227

KJ538228

KJ538229

M.D.

liouvillei

  • A. 33.892

Morocco

L

2.019

1394

KJ538230

KJ538231

KJ538232

M.D.

mauritanicus

  • A. 32.225

Morocco

M1

8.166

15

KJ538253

KJ538254

KJ538255

KJ538256

mauritanicus

  • A. 32.526

Morocco

M1

7.863

287

KJ538257

KF825084

KJ538258

KJ538259

mauritanicus

  • A. 32.661

Morocco

M1

7.793

290

KJ538260

KJ538261

KJ538262

M.D.

mauritanicus

  • A. 32.661

Morocco

M1

7.793

291

KJ538263

KJ538264

KJ538265

KJ538266

mauritanicus

  • A. 32.661

Morocco

M1

7.793

292

KJ538267

KJ538268

M.D.

M.D.

mauritanicus

  • A. M.D.

Morocco

M1

M.D.

625

KJ538269

M.D.

KJ538270

M.D.

mauritanicus

  • A. 30.183

Morocco

M2

9.580

1467

KJ538233

KJ538234

KJ538235

KJ538236

mauritanicus

  • A. 30.183

Morocco

M2

9.580

1468

KJ538237

KJ538238

KJ538239

KJ538240

mauritanicus

  • A. 30.183

Morocco

M2

9.580

1469

KJ538241

KJ538242

KJ538243

M.D.

mauritanicus

  • A. 30.159

Morocco

M2

8.481

1549

KJ538244

KJ538245

M.D.

KJ538246

mauritanicus

  • A. 30.059

Morocco

M2

9.084

1558

KJ538247

KJ538248

KJ538249

KJ538250

mauritanicus

  • A. 30.098

Morocco

M2

8.938

1589

KJ538251

KJ538252

M.D.

M.D.

  • A. 29.068

M3

mauritanicus

Algeria

10.248

438

KJ538357

KJ538358

KJ538359

M.D.

mauritanicus

  • A. 29.087

Morocco

M3

9.898

1443

KJ538360

KJ538361

KJ538362

KJ538363

mauritanicus

  • A. 29.087

Morocco

M3

9.898

1444

KJ538364

KJ538365

KJ538366

KJ538367

mauritanicus

  • A. 29.087

Morocco

M3

9.898

1445

KJ538368

KJ538369

KJ538370

KJ538371

Voucher specimens were collected at almost all sites. All specimens are deposited in the collection of CIBIO, Centro de Investigac¸ ão em Biodiversidade e Recursos Genéticos, Universidade do Porto, Vairão, Vila do Conde, Portugal. Some key species that could not be sampled in the field, e.g. Egyptian A. bicolor, were obtained through reputable animal traders. Morphological identification was done in the lab using keys by Vachon (1952) and Lourenc¸ o (2005). A single specimen of Opisthacanthus asper (Peters, 1861) (Scorpiones: Liochelidae) was used as outgroup (details provided in Table 1).

  • 2.2. DNA extraction and PCR conditions

Fresh or preserved leg muscle tissue (or metasoma muscle for smaller specimens) was used for DNA extraction. Dissection occurred, preferentially, from the third leg in order to minimize the loss of important taxonomical characters. Total DNA was extracted using proteinase K digestion (10 mg/ml concentration) followed by a standard salt extraction protocol (Bruford et al., 1992). Four mitochondrial fragments were amplified: 16S ribosomal RNA (16S rRNA), 12S ribosomal RNA (12S rRNA), cytochrome C oxidase subunit 1 (COX1) and NADH dehydrogenase 1 (ND1) (see Table 2). Polymerase chain reactions were performed in a final vol- ume of 25 L and using 1.0 L each of 10 pmol primer, 12.5 L REDTaq ReadyMix PCR Reaction Mix with MgCl 2 (Sigma–Aldrich, St. Louis, USA), 1.0 L of the purified DNA and 9.5 L of water. Diffi- cult PCR reactions were amplified with a touchdown PCR approach. Purified PCR templates were unidirectionally sequenced using

dye-labeled dideoxy terminator cycle sequencing on an ABI 3730XL at Macrogen Inc. The sequencing primers were the same as those used in the PCRs.

  • 2.3. Data analysis

Chromatographs were checked manually for sequencing errors using FinchTV 1.4.0 (Geospiza, Inc.; Seattle, USA). Sequences were edited using MEGA 5 (Tamura et al., 2011) and aligned using default settings of MUSCLE (Edgar, 2004) for non-coding sequences and ClustalW (Larkin et al., 2007) for COX1 and ND1. Phylogeny reconstruction was performed using Maximum Like- lihood (ML) and Bayesian Inference (BI) methods. A homogeneity partition test executed in Paup* 4.0 rejected homogeneity of the different genes. We therefore carried out both a partitioned and a combined analysis. The best fitting models of sequence evo- lution were determined by the AIC criterion in JModeltest 2.1.2 (Darriba et al., 2012) both for the separate genes and the com- bined dataset. ML tree searches were performed using PhyML, version 3.0 (Guindon et al., 2010). Bootstrap branch support values were calculated with 1000 replicates. The BI analysis was con- ducted with MrBayes 3.2.2, with 5,000,000 generations, sampling trees every 10th generation (and calculating a consensus tree after omitting the first 12,500 trees). Mean genetic distances between and within clades were calculated with MEGA5 based on COX1 sequences. Variance was estimated with 4000 bootstrap replicates, with uncorrected p-distances (Table 3). GenBank accession num- bers are given in Table 1.

P. Coelho et al. / Acta Tropica 134 (2014) 43–51

47

Table 2 List of primers and PCR conditions used for molecular analyses. PCR conditions start with temperature ( C) of each step followed by the time in seconds in brackets.

Gene

Primer name

Sequence (5 3 ) CGATTTGAACTCAGATCA

GTGCAAAGGTAGCATAAT

Source

PCR conditions

16S rRNA

18-mer (forward)

20-mer (reverse)

Simon et al. (1994) Gantenbein et al. (2000)

94(180), [94(30), 50(45), 72(60)] × 35, 72(300), 12()

12S rRNA

12S-F AvdM

12S-R AvdM

AGAG-TGACGGGCAATATGTG

CAGCGGCTGCGGTTATAC

Van der Meijden et al. (2012)

94(180), [94(30), 52(45), 72(60)] × 35, 72(300), 12()

COI

ND1

LCO1490 (forward) HCO219 (reverse) COI avdm F COI avdm R

ND1-LR-N-12945 (forward) ND1-N1-J-12261 (reverse)

GGTCAACAAATCATCATAAAGATATTGG

TAAACTTCAGGGTGACCAAAAAATCA

WTYCTACIAATCAYAARGATATTGG

TAMACYTCIGGGTGWCCAAAAAAYCA

CGACCTCGATGTTGAATTAA

TCGTAAGAAATTATTTGAGC

Folmer et al. (1994)

Van der Meijden et al. (2012)

Hedin (1997)

94(180), [94(30), 48(45), 72(60)] × 35, 72(300), 12() 94(180), [94(30), 49(45), 72(60)] × 35, 72(300), 12()

94(180), [94(30), 47(45), 72(60)] × 35, 72(300), 12()

In addition we downloaded all 16S rDNA sequences in Ben Othmen et al. (2009) from GenBank and we combined these with our 16S dataset. Phylogeny reconstruction of this extended dataset was performed with ML (tree not shown).

3. Results

  • 3.1. Sequence data

We sequenced 110 Androctonus specimens and one outgroup (O. asper) (Table 1). The combined dataset consists of an alignment of 1457 basepairs (bp) (606 bp of COX1, 374 bp of 16S rRNA and 477 bp of 12S rRNA). The dataset included 777 variable sites (53.3% of the total nucleotide positions), 680 bp were constant (46.7%) and 511 positions were parsimony informative (35.1%). Due to difficulties in amplifying ND1 only 41 sequences were available, and thus this gene was not included in the combined analysis.

  • 3.2. Overall phylogeny

Four of the six species were recovered as monophyletic (Fig. 2). We identified 13 clades that correspond to biogeographical and/or taxonomical units. Most of the deeper branches present low values of bootstrap support (ML) and posterior probability (BI). Con- sequently, the relationships between species could not always be resolved. ML and BI trees using a dataset that included ND1 sequences (not shown) did not differ in the topology of well- supported clades. Trees derived from the individual genes did not contradict the groupings recovered from the concatenated dataset.

  • 3.3. Species-level clades

A. amoreuxi, is divided into three clades: clades AM1 and AM2 contain specimens from Morocco, clade AM2 also contains specimens from Tunisia and Algeria and clade AM3 consists of indi- viduals from Egypt. Clades AM1 and AM2 are placed as sister groups with a high support (BI = 1.00; ML = 87) and the AM3 clade has no well-supported affinities but may be sister taxon to A. australis. The western part of the range, from Morocco to Tunisia, is divided into two clades; a northeastern (AM2) and a southwestern clade (AM1); the Southern Moroccan amoreuxi (AM1) clade extends South, from the regions of Assa and Zag in the South, to the southern area of the Anti-Atlas Mountains and North toward Taouz, in the Erfoud area, close to the Morocco–Algerian border (Fig. 1). The A. amoreuxi clade AM2 groups specimens from three countries: in Morocco it is distributed in the Erfoud area and also to the areas surrounding Bouarfa and Ain-Beni-Mathar (High Plateau in Northeast Morocco); In Algeria it is represented in one location, Ghardaia (between the Great Ergs); in Tunisia it is represented in one location, close to Tozeur (between Chott el-Gharsa and Chott el-Djerid salt lakes). The third clade, AM3 groups specimens that were acquired via the pet-trade from Egypt, none of which are georeferenced. Pairwise genetic distances between these clades are in a range between 7.5% and 9.2% (Table 3). Downloaded 16S sequences of A. amoreuxi are split between clades AM1 and AM2 with a sequence from Ben Othmen et al. (2009) (andr05) placed in the AM2 clade whereas the sequence of Fet et al. (2003) is placed within our AM1 clade (tree not shown). Clade L (the liouvillei clade) unites all Moroccan A. liouvillei scorpions. A total of 15 specimens were collected, ranging from the High-Atlas Mountains, to the Northeastern range of the

Table 3 Genetic distances between and within groups. Numbers below the diagonal are mean p-distances calculated between clades whereas the corresponding variances, based on 4000 bootstrap replicates, are shown above the diagonal. Mean p-distances within clades are shown to the right.

 

Distance between clades

 

Within clades

AM1

0.010

0.011 0.011

0.011 0.011

0.011

0.011

0.010

0.011

0.010

0.010

0.011

0.011

0.012

0.016

0.002

A1

AM2

0.075

0.011 0.012

0.011 0.012

0.012

0.010

0.011

0.011

0.010

0.011

0.011

0.011

0.011

0.013

0.003

A2

AM3

0.092

0.089

0.012

0.011 0.011

0.011

0.012

0.012

0.011

0.011

0.011

0.012

0.011

0.013

0.003

0.001

A3

AU1

0.090

0.102

0.090

0.007 0.009

0.011

0.012

0.011

0.012

0.012

0.011

0.012

0.012

0.012

0.004

0.002

AU1

AU2

0.087

0.102

0.093 0.039

 

0.010

0.010

0.012

0.011

0.012

0.011

0.011

0.011

0.011

0.012

0.012

0.003

AU2

AU3

0.090

0.098

0.097 0.061

0.069

0.009

0.012

0.011

0.011

0.012

0.010

0.011

0.011

0.012

0.009

0.002

AU3

AU4

0.094

0.093

0.089 0.080

0.080 0.056

0.013

0.011

0.012

0.012

0.011

0.012

0.012

0.012

0.004

0.001

AU4

B1

0.088

0.086

0.096 0.093

0.090 0.097

0.108

0.008

0.011

0.011

0.012

0.011

0.012

0.012

n/c

n/c

B1

B2

0.077

0.082

0.100 0.093

0.087 0.087

0.096

0.042

0.010

0.011

0.011

0.011

0.011

0.013

0.010

0.004

B2

B3

0.094

0.100

0.099 0.106

0.099 0.098

0.107

0.079

0.074

0.011

0.010

0.011

0.011

0.012

n/c

n/c

B3

L

0.087

0.081

0.096 0.099

0.099 0.108

0.108

0.087

0.085

0.083

0.011

0.011

0.011

0.011

0.008

0.002

L

M1

0.084

0.098

0.095 0.087

0.087 0.081

0.096

0.085

0.080

0.090

0.096

0.011

0.011

0.012

0.012

0.003

M1

M2

0.110

0.103

0.115 0.109

0.108 0.099

0.116

0.096

0.099

0.094

0.099

0.105

0.010

0.011

0.023

0.004

M2

M3

0.103

0.104

0.097 0.107

0.102 0.100

0.107

0.109

0.104

0.095

0.098

0.093

0.090

0.011

0.014

0.003

M3

G

0.101

0.087

0.111 0.100

0.104 0.096

0.102

0.109

0.109

0.106

0.085

0.111

0.104

0.088

0.004

0.002

G

AM1

AM2

AM3

AU1

AU2

AU3

AU4

B1

B2

B3

L

M1

M2

M3

G

p-Distance

St. err.

48

P. Coelho et al. / Acta Tropica 134 (2014) 43–51

48 P. Coelho et al. / Acta Tropica 134 (2014) 43–51 Fig. 2. Bayesian estimate of

Fig. 2. Bayesian estimate of phylogenetic relationships of Androctonus (outgroup not shown). Posterior probabilities values and bootstrap support values are shown above and below nodes respectively. These samples are marked with the same colors and shapes in all figures.

P. Coelho et al. / Acta Tropica 134 (2014) 43–51

49

Middle-Atlas and to the High Plateau along the Algerian borderland. Average genetic distance within the clade is of 0.8%. It appears to be sister taxon to A. bicolor (ML 85% bootstrap support, BI posterior probability 0.96). A. mauritanicus, is presented in three clades; M2 and M3 are sister clades (BI = 0.60; ML = 80) whereas M1 was unrelated to these. Specimens from the M1 clade are located in the northern range of the Marrakech-Tensif-El Haouz administrative region. The speci- mens from the M2 clade occur in a horizontal stretch from the peaks of the Anti-Atlas along the Souss valley with the westernmost sample being 6 km from the seacoast. The M3 clade is comprised of specimens from two sampling locations, both from the southwest

slope of the Anti-Atlas Mountains (see Fig. 1). Genetic distances between clades range from 9.0% to 10.5% while the highest genetic distance within these clades, in clade M2, is 2.3% (Table 3). A group of four dark-colored Androctonus, which morpholog- ically resemble Androctonus gonneti most closely, are designated here as A. cf. gonneti (see Section 4). These specimens (clade G) were found in one sampling point in the southern limit of the Anti-Atlas Mountains near the mouth of the Oued Draa. A. australis forms a monophyletic unit, divided into four clades. The AU3 (east Tunisian australis) and AU4 (Egyptian australis) clades are sister groups in the Bayesian tree (BI = 0.80), which is not the case in the ML analysis. Clades AU1 (Algerian australis) and AU2 (northern Algeria and west Tunisian australis) are sister groups in both trees (BI = 0.95; ML = 99). Starting from the East, the AU4 clade is exclusive to Egypt. Some of the specimens present in this clade are not geographically referenced, as they were obtained through the pet-trade. The AU3 clade (East Tunisian australis) is distributed solely in Tunisia: specimens range Southeast of the Chott el-Djerid salt lake, north to the Chot el-Fejaj salt lake and as far south as the Tataouine desert region (Fig. 1). The AU2 clade is distributed from Algeria in the east, and westward to the Chott el-Djerid and Chot el-Gharsa salt lakes in Tunisia. The AU1 clade is comprised of specimens from a single location between the Great Ergs of Alge- ria (Fig. 1). Pairwise genetic distances between these clades range from 3.9% to 8.0%. The AU1 and AU4 clades present the lowest values of within group genetic distance (0.4%). Among A. australis, the highest within group distance was found in clade AU2 (mean p-distance = 1.2%). Our samples from the Sinai Peninsula confirm former reports on this species’ occurrence in the Sinai (Levy and Amitai, 1980). The extended 16S dataset shows that Ben Othmen et al. (2009)’s “northern and southern lineage” sequences are placed throughout the AU2 and AU3 clades respectively (tree not shown). The B clade (bicolor clade) unites all A. bicolor specimens. Notably, this clade has longer branches within it than any of the other clades in this study. For this reason we divided this clade into three subclades (B1, B2 and B3) and quantified the genetic dis- tances between them. A. bicolor is present in the Tell Atlas in Algeria, central Tunisia (Fig. 1) and Egypt (no GPS point available). Genetic distances between these subclades range from 4.2% to 7.9%. These subclades were too small for mean p-distance within clades to be calculated.

4. Discussion

Genetic methods, using one or very few mitochondrial genes, have proven very successful in uncovering cryptic diversity in North African scorpions (Froufe et al., 2008; Sousa et al., 2012, 2011). Despite using three genes with a high number of informative sites, the dataset did not provide sufficient resolution above the species level. The relationships among these species therefore could not be resolved. Species-level clades, however, were well-resolved and received high support, and we resolved several novel and biogeo- graphically coherent clades within the species.

For the past 20 M.a. the paleoclimatic history of North Africa has been characterized by drastic and oscillating events. The Mediterranean basin experienced extreme changes from the clos- ing of the Mediterranean Sea’s eastern end (15–19 M.a.) to its isolation from the Atlantic Ocean leading to the Messinian salin- ity crisis (5.96–5.33 M.a.) producing significant sea-level changes. Afterwards, the violent re-flooding of the Mediterranean basin submerged large areas of North Africa and created islands in cur- rent Morocco and Algeria (Krijgsman et al., 1999; Steininger and Rogl, 1984). Furthermore, during the last 10 M.a. glacial cycles pro- duced climatic oscillations between wetter and drier conditions in North Africa. Consequently, the Saharan desert experienced con- tractions and expansions depending on the formation of heavily vegetated landscapes or hydrographic systems (Douady et al., 2003; Schuster et al., 2006). Fragmentation during these climatic oscilla- tions of more xeric habitats (Drake et al., 2011; Le Houérou, 1997), such as those favored by Androctonus species, may have also con- tributed to the isolation and subsequent diversification in these scorpions. The Atlas Mountains, formed in the mid-late Miocene, are a major biogeographical barrier, and are thought to be the cause of diversification in several taxa (e.g. Fonseca et al., 2009; Gonc¸ alves et al., 2012; Habel et al., 2012), and seem to have also played a role in Moroccan Androctonus. The distribution of the clades of A. mauritan- icus suggests that the mountain ranges could act as barriers to gene flow. A. mauritanicus is found in median and low altitudes (e.g. clade M2 and M3). The High-Atlas is situated between M1 and M2 clades and the Anti-Atlas between M2 and M3 clades. It seems from this pattern that orography might be a probable cause for differentiation in this species, as is the case in Buthus scorpions (Habel et al., 2012). Alternatively, the rivers associated with these mountains may have also formed north–south barriers to dispersion, thus allowing dif- ferentiation within A. mauritanicus. Vachon (1952) described two subspecies in Morocco: A. m. mauritanicus and A. m. bourdoni. The distribution of clade M1 largely coincides with the distribution of the former subspecies, while the distribution of clade M2 coincides with the distribution of the latter. Although Lourenc¸ o (2005) did not find evidence to support these two subspecies, the genetic dis- tances between them are at a level of those found between full species of Androctonus (Table 3). In addition, clades M2 and M3 are also separated by a similar species-level genetic distance. An exploratory morphological analysis of the specimens of clade M3 found a very granulated prosoma and tergites, which does not fit the description of A. mauritanicus. These morphological characters also distinguish them from the specimens in clade M2, showing these scorpions are distinct both genetically and morphologically. How- ever, a more detailed morphological assessment is clearly needed prior to a taxonomic revision. A. mauritanicus is, together with A. australis, among the most dangerous scorpions in the Maghreb not only due to their venom toxicity but also because these species occurrence often overlaps regions with relatively high human pop- ulation densities (Chippaux and Goyffon, 2008). Between 1996 and 2006 in Morocco, 53% of deaths that resulted from sting cases come from incidents with A. mauritanicus (Touloun et al., 2012). The genetically highly divergent subpopulations of A. mauritanicus may, similar to A. australis (Devaux et al., 2004) and other scorpion species (El Ayeb and Rochat, 1985; Newton et al., 2007; Smertenko et al., 2001), display differences in venom composition. This should be taken into consideration in both the development of antisera and the treatment of scorpion stings. A. liouvillei, although distributed in at least as large an area as A. mauritanicus, is not as deeply split into separate clades. This may be due to the less orographically complex area it inhabits. It is mainly found on the high plateau east of the Middle Atlas, and eastward into Algeria. Although the A. liouvillei clade is sister to the A. bicolor clade, genetic distances between them are near the

50

P. Coelho et al. / Acta Tropica 134 (2014) 43–51

species-level, corroborating Lourenc¸ o’s (2005) morphology-based assessment that A. liouvillei is a distinct species from A. bicolor. A. australis is one of the most widespread scorpions in North Africa and one of the leading causes of scorpionism in North Africa (Chippaux and Goyffon, 2008). There is a deep split between clades AU1 and AU2 on one side, and clades AU3 and AU4 on the other. The clades in Tunisia (clades AU2 and AU3) are therefore more closely related to clades distributed in countries as far east as Egypt (AU4) and as far west as Algeria (AU1) than to each other. Substantial poly- morphism for three toxins in the venom of A. australis was reported in Tunisia (Devaux et al., 2004). Differences were found between the venoms of specimens from localities corresponding to clades AU2 or AU3. This shows that it is highly likely that phylogenetically divergent groups may have different venom compositions in A. aus- tralis. The genetic distance also reflects a higher distance between them than between the pairs AU1–AU2 and AU3–AU4. This sug- gests either a strong biogeographic barrier between these clades, or that their current proximity is an area of potential secondary con- tact. There is a large salt lake, Chott el-Djerid, between the regions where clades AU2 and AU3 are in closest proximity. Salt lakes as big as Chott el-Djerid might act as physical barriers for scorpion dis- persion (Ben Othmen et al., 2009) and other taxa (Kornilios et al., 2010). Although Ben Othmen et al. (2009) dealt only with Tunisian Androctonus, had fewer samples, and used only 16S rRNA data, they also found a deep divergence between the north-western and south-eastern Tunisian A. australis. Their “northern” and “south- ern lineages” are genetically and geographically congruent with our AU2 and AU3 clades respectively. They explored the possibil- ity of the lake’s formation causing the vicariant event. However the relatively recent dates for the lake’s formation (90–150 ka) do not coincide with their divergence time estimation (3.43–9.90 Ma), and they suggest that the recently formed salt lake acts only as a barrier to secondary contact, rather than having caused vicariance between these two populations. Their divergence time estimate was not based on calibration points, but rather on a constant muta- tion rate, and should therefore be regarded with caution. Pedroso et al. (2013) have found a similar high divergence between popula- tions of Buthus scorpions to the North-West and South-East of Chott el-Djerid. Due to a lack of dependable internal calibration points for molecular dating, we have refrained from calculating divergence time estimates in our study, and placing the divergences between clades and species in a paleogeographic or paleoclimatic context therefore remains tentative. Surprising was the find of two distinct clades of A. amoreuxi in Morocco. The distribution of clades AM1 and AM2 meet in the Erfoud area. Although there are no obvious geographical formations separating them, the genetic distance between clades is 7.5%, which is similar to the distance recovered between the A. australis clades. As currently recognized the species appears to be paraphyletic, with clade AM3 sister to A. australis although with very weak support lev- els. Although some A. amoreuxi specimens were separated by the largest geographic distance of any species in this study, we could not find morphological differences between them in taxonomically relevant characters (Lourenc¸ o, 2005; Vachon, 1952). The fact that the genetic distance between clades AM2 and AM3 is relatively high (8.9%) corroborates the division of A. amoreuxi into two subspecies:

  • A. a. amoreuxi in the Maghreb and A. a. levyi Fet, 1997 in the Sinai

Peninsula. However, to what taxonomic level these groups should be ascribed requires further morphological study of the intervening populations.

Near Tan Tan Plage, a coastal town near the mouth of the Draa River, we found four specimens morphologically different from

  • A. mauritanicus and Androctonus sergenti Vachon, 1948 (also, dark

colored species). Morphologically, they seem to be closer related with A. gonneti. The 4 adult male specimens we captured have the same pectinal teeth count (33) as reported by Vachon (1952) for A.

gonnetti. A. liouvillei and A. sergenti are reported to have a smaller pectinal teeth count (Lourenc¸ o, 2005; Vachon, 1952). As no other species are known for that region, we designated the G clade speci- mens as A. cf gonneti, a species known from this region. Our estimate of relationships based on mtDNA clearly indicates that these are distinct from A. liouvillei (Fig. 2). Further sampling will be neces- sary to study the relationships between this population and other species from Morocco, but it appears to be A. gonneti, a variant of this species, or an undescribed new species. Summarizing, we were able to identify cryptic variation in A. australis, A. mauritanicus and A. amoreuxi. Some cases were sim- pler, in which we could corroborate the validity of a distinct group, such as A. liouvillei. Further work should aim at sequenc- ing nuclear genes in order to resolve deeper relationships within the genus. It would also be very interesting to obtain samples of other species like Androctonus aleksandrplotkini, Androctonus hog- garensis, Androctonus maroccanus Lourenc¸ o et al., 2009, A. sergenti and A. gonneti. Those, together with a more extensive sampling of Algeria, Libya and Mauritania could provide a prime perspective on the patterns and processes shaping Androctonus evolution and current distribution in North Africa.

5. Conclusions

We here show that A. australis, A. mauritanicus and A. amoreuxi have deeply divergent subclades. Such variation can be reflected in the venom these animals produce, as seen in other scorpion species (Borges et al., 2010; Newton et al., 2007; Omran and McVean, 2000; Smertenko et al., 2001). We therefore suggest that the venom of A. australis, A. mauritanicus and A. amoreuxi should be studied with these deep divergences in mind. Antivenom developed for scor- pions in one region should be tested for efficacy against venoms from regions (