Universit de Sherbrooke

Rgulation de lexpression du rcepteur P 2 Y 2 dans les maladies inflammatoires intestinales

par les facteurs de transcription NF-kB et C/EBPP et son implication dans le processus de
rparation de lpithlium intestinal.

Par
milie Degagn
Dpartement d anatomie et biologie cellulaire

Thse prsente la Facult de mdecine et des sciences de la sant

en vue de lobtention du grade de philosophiae doctor (Ph.D.) en biologie cellulaire

Sherbrooke, Qubec
Mai, 2012

Membres du jury d valuation

Pr Femand-Pierre Gendron, Dpartement d anatom ie et de biologie cellulaire
Pr Franois Boudreau, Dpartement d anatomie et de biologie cellulaire
Pr Abdelaziz Amrani, Dpartement de pdiatrie
Pr Jean-Franois Ct, IRCM, Dpartement de mdecine, Universit de M ontral

milie Degagn, 2012

1+1

Library and Archives

Canada

Bibliothque et
Archives Canada

Published Heritage
Branch

Direction du
Patrimoine de l'dition

395 Wellington Street

Ottawa ON K1A0N4
Canada

395, rue Wellington

Ottawa ON K1A 0N4
Canada
Your file Votre rfrence
ISBN: 978-0-494-93248-3
Our file Notre rfrence
ISBN:

978-0-494-93248-3

NOTICE:

AVIS:

The author has granted a non

exclusive license allowing Library and
Archives Canada to reproduce,
publish, archive, preserve, conserve,
communicate to the public by
telecommunication or on the Internet,
loan, distrbute and sell theses
worldwide, for commercial or non
commercial purposes, in microform,
paper, electronic and/or any other
formats.

L'auteur a accord une licence non exclusive

permettant la Bibliothque et Archives
Canada de reproduire, publier, archiver,
sauvegarder, conserver, transmettre au public
par tlcommunication ou par l'Internet, prter,
distribuer et vendre des thses partout dans le
monde, des fins commerciales ou autres, sur
support microforme, papier, lectronique et/ou
autres formats.

The author retains copyright

ownership and moral rights in this
thesis. Neither the thesis nor
substantial extracts from it may be
printed or otherwise reproduced
without the author's permission.

L'auteur conserve la proprit du droit d'auteur

et des droits moraux qui protege cette thse. Ni
la thse ni des extraits substantiels de celle-ci
ne doivent tre imprims ou autrement
reproduits sans son autorisation.

In compliance with the Canadian

Privacy Act some supporting forms
may have been removed from this
thesis.

Conform m ent la loi canadienne sur la

protection de la vie prive, quelques
formulaires secondaires ont t enlevs de
cette thse.

W hile these forms may be included

in the document page count, their
removal does not represent any loss
of content from the thesis.

Bien que ces formulaires aient inclus dans

la pagination, il n'y aura aucun contenu
manquant.

Canada

II
RSUM
Rgulation de lexpression du rcepteur P 2 Y 2 dans les maladies inflam m atoires
intestinales par les facteurs de transcription NF-kB et C/EBPp et son implication dans
le processus de rparation de lpithlium intestinal.
Par
milie Degagn
Dpartement d anatomie et biologie cellulaire
Thse prsente la Facult de mdecine et des sciences de la sant en vue de lobtention
du diplme de philosophiae doctor (Ph.D.) en biologie cellulaire, Facult de mdecine et
des sciences de la sant, Universit de Sherbrooke, Sherbrooke, Qubec, Canada, J 1H 5N4.

Les maladies inflammatoires intestinales (M il) sont caractrises par des priodes
d inflammation chronique entrecoupes de priodes de rmission. Elles mobilisent laction
de plusieurs molcules pour favoriser le retour lhomostasie. Il a t dmontr que
lexpression du rcepteur P2 Y 2 (P 2 Y 2) est augmente chez les patients atteints de M il et
dans un modle murin de colite chimique. Cette thse s intresse aux mcanismes de
rgulation transcriptionnelle du gne de P 2 Y 2 et son rle dans les MIL Premirement, la
disponibilit de la chromatine au promoteur de P 2 Y 2 a t caractrise par le statut
d actylation des histones H3 et H4 par immunoprcipitation de la chromatine (ChIP). Le
site d initiation de la transcription du gne de P 2 Y 2 a t identifi par 5 RLM -RACE. NFk B et C/EBPp sont des candidats idals pour rguler lexpression de P 2 Y 2 puisquils sont
impliqus dans la rgulation de gnes lis linflammation. En utilisant le logiciel
TRANSFAC, les sites de liaison potentielle (SLP) de N F - k B et C/EBPp ont t identifis
sur le promoteur du rcepteur P 2 Y 2. Ensuite, des essais lucifrase ont dmontr que N F - kB
et C/EBPP transactivent le promoteur de P 2 Y 2 dans les cellules pithliales intestinales
(CEI) en condition inflammatoire ou non. Lorsque ces deux facteurs de transcription sont
co-exprims dans les CEI, on observe une synergie de la transactivation du prom oteur de
P 2 Y 2 . Par des essais lucifrase avec des constructions du promoteur mutes pour les SLP
des facteurs de transcription ltude ainsi que par des gels de retardement et des essais de
ChIP, nous avons montr que C/EBPp se lie en position -229 -220pb du prom oteur et que
N F - kB se lie en position -181 -172pb. Finalement, la stimulation du rcepteur P 2 Y 2 active
la voie de signalisation PI-3K/Akt qui inactive GSK-3P favorisant la stabilisation des
microtubules permettant la cellule de migrer pour rparer une monocouche de CEI
blesses. De plus, dans les CEI, lexpression de COX-2 et PGE 2 qui sont des molcules
importantes pour la rparation tissulaire, est augmente par la stimulation de P 2 Y 2. In vivo,
la stimulation du rcepteur favorise la rmission de souris atteintes de colite chimique.
Cette thse dmontre donc que lexpression du rcepteur P 2 Y 2 dans les M il est rgule par
N F- k B et C/EBPP et que ce rcepteur joue un rle important dans les M il en favorisant la
phase de rmission.

Mots cls : facteurs de transcription, rcepteur P 2 Y 2, inflammation, restitution, migration

cellulaire, maladies inflammatoires intestinales

A m a fille Lily, mon mari Gabriel

et mes parents Rjeanne et Alain

It doesn't matter how beautiful your theory is, it doesn't matter how sm art yo u are. I f it
doesn't agree with experiment, it's wrong.
Richard P. Feynman
Dans vingt ans vous serez plus dus par les choses que vous n avez pas fa ite s que par
celles que vous avez faites. Alors sortez des sentiers battus. Mettez les voiles. Explorez.
Rvez. Dcouvrez.
M ark Twain

TABLE DES MATIRES

RSUM..........................................................................................................................................II
TABLE DES MA TIRES..............................................................................................................V
LISTE DES TABLEAUX........................................................................................................... VII
LISTE DES FIGURES............................................................................................................ VIII
LISTE DES ABBRVIA TIONS, SIGLES E T SYMBOLES.................................................. X
INTRODUCTION............................................................................................................................1
1.

L i n t e s t i n ........................................................................................................................................................................................l
S tru c tu re et fon ctio n s de l p ith liu m in testin a l ................................................................................................... /
L IMMUNIT DE LA MUQUEUSE INTESTINALE....................................................................................................................4
2.1
L 'im m unit in n e ................................................................................................................................................................ 4
2.2
L 'im m unit a d a p ta tiv e ...................................................................................................................................................... 6
L e s m a l a d ie s i n f l a m m a t o ir e s i n t e s t i n a l e s ............................................................................................................ 9
3. /
La m aladie de C r o h n .........................................................................................................................................................9
3.2
La colite u lc re u se ............................................................................................................................................................11
3.3
La rparation de la m uqueu se in te stin a le .............................................................................................................. 12
3.3.1 Premire tape de la rparation de blessures : la restitution ....................................................................................12
3.3.2 La deuxime tape de la rparation de blessures : la prolifration ........................................................................ 14
3.3.3 La dernire tape de la rparation de blessures : la maturation .............................................................................. 15
3.3.4 Molcules favorisant la rparation de blessures .......................................................................................................... 16
L e s n u c l o t id e s e x t r a c e l l u l a ir e s ..............................................................................................................................17
4 .1
So u rce de nuclotides extra cellu la ires dans l'in te s tin ..................................................................................... 1 7
4.2
C oncentration de nuclotid es dans le m ilieu extra cellu la ire d e l'in te s tin ............................................... 19
4.3
M tabolism e des n u c l o tid e s ....................................................................................................................................... 19
4.4
O rigine de la signalisation p u rin e rg iq u e ............................................................................................................... 2 1
L e s r c e p t e u r s p u r i n e r g i q u e s P 2 .................................................................................................................................21
5.1
Les rcepteurs m tabotro p iq u es P 2 Y ...................................................................................................................... 22
5.2
Le rcep teu r P 2 2 ............................................................................................................................................................ 23
5.2.1
Localisation gnique et polym orphism es g n tiq u es.............................................................................................23
5.2.2
Structure de la protine..................................................................................................................................................24
5.2.3
Signalisation a sso cie.................................................................................................................................................... 26
5.2.4 D istribution et rle dans l'o rg an ism e..............................................................................................................................28
5.2.4
Rgulation transcriptionnelle....................................................................................................................................... 30
L e FACTEUR d e t r a n s c r ip t io n R f. l A / p 6 5 ..................................................................................................................... 31
6. /
Stru ctu re p r o t iq u e .......................................................................................................................................................... 31
6.2
R gulation de l activation d e N F - k B p a r la vo ie ca n o n iq u e ......................................................................... 32
6.3
R gulation de l'a ctiva tio n d e N F - k B p a r les voies a ltern a tives .................................................................. 33

1. I

2.

3.

4.

5.

6.

6.4
R gulation de l activit d e R elA /p 6 5 p a r des m o difications p o s t tra d u ctio n n elles et l'in te ra ctio n
avec des p ro t in e s r g u la tric es .................................................................................................................................................. 33
6.5
R les et fo n c tio n s de NF- k B dans l'in te s tin .......................................................................................................... 34
7.

LE FACTEUR DE TRANSCRIPTION C /E B P B ......................................................................................................................... 35

S tru ctu re p r o t iq u e .......................................................................................................................................................... 36
1.2
R gulation de l'a c tiv it de C /E B P p .......................................................................................................................... 36
7.3
R les et fo n c tio n s de C /E B P p da n s l'p ith liu m in te stin a l .............................................................................. 37
8.
H y p o t h s e , o b j e c t if s e t m t h o d e s .............................................................................................................................. 37
7.1

CHAPITRE 1 .................................................................................................................................39

VI

P2Y2 RECEPTOR TRANSCRIPTION IS INCREASED B Y NF- kB AND STIMULA TES

COX-2 EXPRESSION AND PGE2 RELEASED BY INTESTINAL EPITHELIAL
CELLS............................................................................................................................................. 39
A u t e u r s d e l a r t i c l e .......................................................................................................................................................................39
S t a t u t d e l a r t i c l e ...........................................................................................................................................................................39
A v a n t - p r o p o s ........................................................................................................................................................................................39
9.
R s u m d e l a r t i c l e ..............................................................................................................................................................4 0
10.
A b s t r a c t ................................................................................................................................................................................... 42
11.
In t r o d u c t i o n ......................................................................................................................................................................... 42
12.
M a t e r ia l s a n d M e t h o d s ................................................................................................................................................ 44
13.
R e s u l t s ..................................................................................................................................................................
49
14.
D i s c u s s i o n ................................................................................................................................................................................58
15.
S u p p l e m e n t a l d a t a ............................................................................................................................................................ 63
16.
A c k n o w l e d g e m e n t s ...........................................................................................................................................................67
17.
R e f e r e n c e s .........................................................:................................................................................................................. 68

CHAPITRE 2 ..................................................................................................................................73
P2Y2 RECEPTOR PROMOTES INTESTINAL EPITHELIAL CELL MIGRATION
THROUGH A GO PROTEIN AND INTEGRIN a v PATHWAY ALLOWING
MICROTUBULE STABILIZATION AND MUCOSAL RE-EPITHELIZATION IN
EXPERIMENTAL COLITIS.......................................................................................................73
A u t e u r s d e l a r t i c l e .......................................................................................................................................................................73
St a t u t d e l a r t i c l e
................................................................................................................................................................ 73
A v a n t - p r o p o s ....................................................................................................................................................................................... 73
18.
RSUM DE LARTICLE...........................................................................................................................................................74
19.
A b s t r a c t ................................................................................................................................................................................... 76
20.
In t r o d u c t i o n ......................................................................................................................................................................... 77
21.
M a t e r ia l s a n d m e t h o d s ............................................................................................................................
80
22.
R e s u l t s ......................................................................................................................................................................................84
23.
D i s c u s s i o n ............................................................................................................................................................................... 97
24.
S u p p l e m e n t a l d a t a .......................................................................................................................................................... 101
25.
A c k n o w l e d g m e n t s ........................................................................................................................................................... 102
26.
R e f e r e n c e s ............................................................................................................................................................................ 103

CHAPITRE 3 ............................................................................................................................... 107

P2Y2 RECEPTOR EXPRESSION IS REGULATED BY C/EBPB DURING
INFLAMMATION IN INTESTINAL EPITHELIAL CELLS............................................107
A u t e u r s d e l a r t i c l e .....................................................................................................................................................................107
S t a t u t d e l a r t i c l e ........................................................................................................................................................................ 107
A v a n t - p r o p o s ..................................................................................................................................................................................... 107
27.
RSUM DE LARTICLE......................................................................................................................................................... 108
28.
S u m m a r y ................................................................................................................................................................................. 110
29.
In t r o d u c t i o n ....................................................................................................................................................................... 111
3 0.
R e s u l t s .................................................................................................................................................................................... 112
31.
D i s c u s s i o n ............................................................................................................................................................................. 118
32.
M a t e r ia l s a n d m e t h o d s ................................................................................................................................................120
3 3.
A c k n o w l e d g e m e n t s .........................................................................................................................................................126
34.
R e f e r e n c e s ............................................................................................................................................................................ 127
35.
S u p p l e m e n t a l d a t a .......................................................................................................................................................... 130

DISCUSSION..............................................................................................................................131
CONCLUSION............................................................................................................................142

VII

REMERCIEMENTS....................................................................................................................145
LISTES DES PUBLICA TIONS................................................................................................ 146
ANNEXES.....................................................................................................................................163
A n n e x e 1 : A r t ic l es
Annexe

2: DAI

p u b l i s en t a n t q u e d e u x i m e a u t e u r

........................................................................................ 163

et t r a n sl o q u a t io n b a c t r ie n n e d a n s la r a i e

de

so u r is

P2Y,"

a tte in te s d ' une

CO U TE CHIMIQUE............................................................................................................................................................................................... 165

A n n e x e 3 : T r a n s a c t iv a t io n du p r o m o te u r du r c e p t e u r P2Y 2 d a n s le s c e l l u l e s C a c o -2 p a r le s
FACTEURS DE TRANSCRIPTION C /E B P A ET C /E B P a ............................................................................................................. 167

LISTE DES TABLEAUX

T a b l e a u 1. C a r a c t r i s t i q u e s d e s r c e p t e u r s
T ableau

2.

P2Y.........................................
P2Y2 d a n s l 'o r g a n i s m e

D istr ibu t io n et r le s d u r c e pt e u r

LISTE DES FIGURES

F i g u r e 1. A r c h i t e c t u r e d e l ' p i t h l i u m d u c l o n e t d e l ' i n t e s t i n g r l e ................................ 3

F ig u r e 2. L e s y s t m e im m u n it a ir e in t e st in a l e n c o n d it io n p h y s io l o g iq u e et
P A THO LOG IQU E.....................................................................................................................................................................

F i g u r e 3 . R g u l a t i o n d e l a m i g r a t i o n c e l l u l a i r e p a r l e c y t o s q u e l e t t e d a c t i n e e t
LES M IC R O T U B U L E S ................................................................................................................................................................. 1 5
F i g u r e 4 . R e p r s e n t a t i o n s c h m a t i q u e d e s e c t o - n u c l o t i d a s e s ................................................. 2 0
F ig u r e 5. R e p r s e n t a t io n de la s t r u c t u r e e n d e u x d im e n s io n s d u r c e p t e u r P 2 Y 2
h u m a in

............................................................................................................................................................................................ 2 6

F ig u r e 6. S c h m a r e p r s e n t a n t l e s v o ie s d e s ig n a l is a t io n a c t iv e s p a r le
RCEPTEUR P 2 Y 2 ...................................................................................................................................................................... 2 7
F ig u r e 7. V o ie s d a c t i v a t i o n d u f a c t e u r d e t r a n s c r i p t i o n

N F-kB ............................................. 3 2

LISTE DES ABBRVIATIONS, SIGLES et SYM BOLES

5 RLM-RACE: 5 prime RNA ligase mediated rapid amplification o f cDNA ends
ADN : Acide dsoxyribonuclique
ADP: Adnosine diphosphate
AMP: Adnosine monophosphate
ARF : ADP-ribosylation factor
ARN: Acide ribonuclique
ARP2/3: Actin-related protein 2/3
ATG16L1: Autophagy related 16- like 1
ATP: Adnosine triphosphate
Bcl-XL: B-cell lymphoma-extra large
BCR: B cell recetor
BMP: Bone morphogenetic protein
BrdU: 5-bromo-2'-deoxyuridine
BRE: B recognition element
bZIP: Basic leucine zipper domain
C/EBPp : CCAAT-enhancer binding protein beta
CARD 15: Caspase recruitment domain-containing protein 15
CBP: CREB-binding protein
Cdc42: Cell division control protein 42 homolog
CEI: Cellule pithliale intestinale
ChIP: Chromatin immunoprcipitation
CK2: Casein Kinase II
CMH: Complexe majeur d histocompatibilit
COX-2: Cyclooxygnase 2
DAG: Diacylglycrol
DPE: Downstream promoter element
DSS: Dextran sodium sulfate
EGF: Epidermal growth factor
EGFR: Epidermal growth factor receptor
ENaC: Epithelial sodium channel
EP: E series prostaglandin receptor

ERK: Extracellular signal-regulated kinases

FAK: Focal adhesion kinase
GDP: Guanoside diphosphate
GPCR: G protein-coupled receptor
GSK-3P: Glycogen synthase 3 beta
GTP: guanosine triphosphate
HDAC: Histone dactylase
HEK-293T: Human embryonic kidney-293T
H esl : Hairy and enhancer o f split 1
HGF: Hepatocyte growth factor
HLA: Human leukocyte antigen
IEC: Intestinal epithelial cell
IEL: Intraepithlial lymphocyte
IFN-y: Interfron gamma
IGF: Insulin growth factor
IKK: I k B kinase
IL: Interleukine
ILK: Integrin-linked kinase
INR: Initiator element
IP3: Inositol 1,4,5-triphosphate
IP3R: Inositol 1,4,5-triphosphate receptor
KGF: Keratinocyte growth factor
LAP: Liver-enriched activator protein
Lgr5: Leucine-rich repeat-containing G-protein coupled receptor 5
LIP: Liver-enriched inhibitory protein
LPS: Lipopolysacharide
MAPK: M itogen-activated protein kinase
MCP-1 : Monocyte chemotactic protein-1
MEK: MAPK kinase
miARN: Micro acide ribonuclique
MIL Maladies inflammatoires intestinales
MLC-2; Myosin light chain II
NEMO: NF- kB essential modulator

N F- kB: N uclear factor-kappa B

NIK: NF- kB inducing kinase
NKT: Natural killer T cell
NOD: Nucleotide Oligomerization domain
PDLIM4: PDZ and LIM domain protein 4
PGE 2 : Prostaglandine E 2
PI-3K: Phosphoinositide 3-kinase
PKC: Protein kinase C
PLC: Phospholipase C
PPAR-y: Peroxysome proliferator-activated receptor gamma
PPi: Pyrophosphate
Pyk2: Protein tyrosine kinase 2
Rac: Ras-related C3 botulinum toxin substrate
RANTES: Regulated upon activation, normal T-cell expressed and secreted
RCPG: Rcepteur coupl aux protines G
ReglIIy: Regenerating islet-derived protein 3 gamma
RelA: v-rel reticuloendotheliosis viral oncogene homolog A
RGD: Arginine/Glycine/Aspartic acid
RGE: Arginine/Glycine/Glutamic acid
RhoA: Ras homolog gene family member A
ROCK: Rho-associated protein kinase
SH3: SRC homology 3 domain
shRNA: Short-hairpin ribonucleic acid
SLP: Site de liaison potentiel
Spl : Specific protein 1
STAT3: Signal transducer and activator o f transcription 3
SWI/SNF: SW Itch/Sucrose Non Fermentable
TBP: TATA-binding protein
TCR: T-cell receptor
TFIID: Transcription factor II D
TFIIFI: Transcription factor II H
TGF-a: Transforming growth factor alpha
TGF-(3: Transforming growth factor beta

T: T helper cell
TLR: Toll-like receptor
TNF-a: Tumor necrosis factor alpha
TRAF: Tumor necrosis factor-associated factor
Treg: Regulatory T cell
Trem2: Triggering receptor expressed on myeloid cells 2
UDP: Uridine diphosphate
UMP: Uridine monophosphate
UTP: Uridine triphosphate
WASP: W iskott-Aldrich syndrome protein

INTRODUCTION

1. L intestin
Selon Taxe rostro-caudal, lintestin se subdivise en deux entits intimement lies, soit
lintestin grle et le clon (Tortora et Grabowski, 2001). L intestin grle est divis en trois
sections distinctes et complmentaires soit le duodnum, le jjunum et lilon. Le clon est
subdivis en quatre parties soit le clon ascendant, transverse, descendant et sigmode.

1.1 Structure et fonctions de (pithlium intestinal

Laxe crypte-villosit est lunit fonctionnelle qui caractrise larchitecture de lpithlium
de lintestin grle (voir Figure 1).

La crypte est lendroit o sont localises les cellules

souches qui donneront naissance aux cellules diffrencies. La localisation exacte de ces
cellules dans la crypte est encore source de discussion. Des tudes antrieures ont dmontr
que les cellules souches taient localises la base de la crypte (Bjerknes et Cheng, 1981;
Potten et al., 1997). Le rcepteur Lgr5 qui est un rcepteur orphelin coupl aux protines G
est un marqueur spcifique des cellules souches adultes qui a rcemment permis de
confirmer la prsence de cellules souches la base de la crypte (Li et Clevers, 2010; May et
al., 2009; Sato et al., 2009; Scoville et al., 2008). Toutefois, en utilisant des marqueurs de
prolifration comme la thymidine tricie ou le BrdU qui sincorporent lADN des cellules
en division, d autres quipes ont plutt localis les cellules souches la position +4 partir
de la base de la crypte (Batlle, 2008; Potten et al., 2002). Selon certaines tudes, les cellules
en position +4 seraient des cellules souches quiescentes responsables de la rparation
suivant une blessure alors que les cellules souches Lgr5+ du fond de la crypte serait
responsables du renouvellement physiologique des cellules de laxe crypte-villosit (Li et
Clevers, 2010; May et al., 2009; Scoville et al., 2008).
Dans la niche des cellules souches, on retrouve des cellules msenchym ateuses qui
scrtent des facteurs essentiels pour le maintien de la fonction des cellules souches. Elles
scrteront ainsi les ligands de la voie Wnt qui favorise la survie et la prolifration des
cellules souches ainsi que des antagonistes des BM Ps qui permettent aux cellules souches
de rester indiffrencies. Ainsi dans lintestin, on retrouvera un gradient d expression de

Wnt dcroissant vers la villosit et un gradient d expression des BMPs dcroissant vers la
crypte (G regorieff et al., 2005). Lorsque les cellules souches se divisent, elles donneront
naissance aux cellules prognitrices qui en migrant le long de la crypte seront exposes
des concentrations croissantes de BMPs favorisant leurs diffrenciations (Haramis et al.,
2004). Bien que les BMPs soit essentiels pour la diffrentiation des cellules prognitrices,
c est la voie de signalisation Notch qui permettra d effectuer la diffrentiation terminale.
Les cellules prognitrices dans lesquelles la voie Notch sera active perm ettront la
transcription du facteur de transcription Hesl qui est un rpresseur de la transcription du
facteur de transcription M athl (Tamura et al., 1995; Yang et al., 2001). Ces cellules
prognitrices dpourvues de lexpression de M athl deviendront des cellules absorbantes
(Yang et al., 2001). Dans les cellules prognitrices dans lesquelles la voie de signalisation
Notch nest pas active, il y aura expression du facteur de transcription M athl perm ettant la
diffrenciation terminale des cellules en cellules de la ligne scrtrice (M ilano et al.,
2004). Les cellules seront donc pleinement diffrencies latteinte de la jonction cryptevillosit et elles auront une survie denviron trois jours puisque le renouvellement constant
de lpithlium intestinal les pousse migrer vers la pointe de la villosit o elles seront
exfolies par anokose (Hall et al., 1994).
Les cellules diffrencies composant lintestin grle sont les cellules absorbantes nommes
entrocytes et les cellules de la ligne scrtrice soit les cellules caliciformes, les cellules de
Paneth et les cellules entroendocrines.

Les entrocytes reprsentent plus de 80% des

cellules de la muqueuse (Karam, 1999).

Ils sont responsables de la digestion, de

labsorption et du transport des nutriments contenus dans le bol alimentaire. Les cellules
caliciformes reprsentent 4% 16% des cellules de la muqueuse (Karam, 1999).

Elles

scrtent des mucines et des facteurs en trfles qui ont pour rle de protger lpithlium
contre les assauts des bactries et des molcules dltres pour le maintien de lhomostasie
intestinale (Tortora et Grabowski, 2001).

Les cellules entroendocrines reprsentent

environ 1% des cellules de la muqueuse (Schonhoff et al., 2004). On compte une quinzaine
de sous-types de cellules entroendocrines qui sont responsables de la scrtion de
diffrentes hormones (Schonhoff et al., 2004). Les cellules de Paneth constituent le dernier
type cellulaire diffrenci qui compose laxe crypte-villosit.

Contrairement aux autres

types cellulaires diffrencis prsents, les cellules de Paneth entreprennent une migration

Lpithlium du clon prsente une architecture similaire celui de lintestin grle

lexception de la prsence de villosits dont il est dpourvu (voir Figure 1). Les cellules
souches se retrouvent au fond des cryptes et en se divisant donnent naissance aux cellules
prognitrices qui vont migrer vers le haut de la crypte vers lpithlium de surface. La voie
de signalisation Wnt joue ici aussi un rle de m aintient de la survie et de la prolifration des
cellules souches (Kuhnert et al., 2004). Les cellules m senchymateuses pricryptales
exprimeront plusieurs antagonistes de la voie des BMP soit la grem lin-1 et la gremlin-2
ainsi que la chordin-1 afin de garder lenvironnement de la niche des cellules souches
propices la prolifration (Kosinski et al., 2007). Afin de permettre la diffrentiation des
cellules prognitrices, la prsence d un gradient d expression dcroissant des BMP de
lpithlium de surface vers le fond de la crypte sera observe (Hardwick et al., 2004). Une
autre molcule importante pour la diffrentiation des cellules prognitrices est Indian
Hedgehog. Cette protine est exprime par les clonocytes et entrane laugmentation de
lactivation de la voie des BMPs et limite lexpression de W nt lpithlium de surface
(van den Brink et al., 2004; van Dop et al., 2009). Dans le clon, on retrouvera trois types
de cellules pithliales diffrencies soit les cellules entroendocrines, les cellules
caliciformes et finalement les clonocytes. Les colonocytes tout comme les entrocytes de
lintestin grle ont des proprits d absorption. Cependant, les colonocytes sont spcialiss
dans labsorption de leau et des lectrolytes contenus dans la lumire intestinales (Karam,
1999; Tortora et Grabowski, 2001)
L pithlium intestinal n a pas seulement que des fonctions de digestions et d absorption, il
permet aussi le maintien de lhomostasie intestinale en participant lim munit inne.

2.

Limmunit de la muqueuse intestinale

2.1 L immunit inne

La barrire pithliale reprsente la premire ligne de dfense de lintestin contre
lenvironnement extrieur.

Elle permet labsorption des nutriments, de leau et des

lectrolytes en plus de maintenir une dfense efficace contre les toxines de la lumire
intestinale, des antignes et la microflore. L pithlium maintient sa fonction de barrire

par la formation de diffrents types de jonctions cellulaires qui permettent de lier entre elles
les cellules adjacentes et de sceller lespace intercellulaire (Groschwitz et Hogan, 2009).
Les diffrents types de cellules diffrencies qui composent lpithlium intestinal ont des
rles complmentaires et distincts jo u er dans limmunit inne. Les cellules caliciformes
scrtent diffrentes mucines permettant la formation d une couche de m ucus qui protge la
barrire pithliale en limitant le contact des bactries pathognes et celles de la microflore
sans empcher la diffusion des nutriments, de leau et des lectrolytes (Garrett et al., 2010).
Les cellules de Paneth produisent et stockent dans des granules de scrtions de multiples
molcules antimicrobiennes comme les dfensines, les lysozymes et les cathlicidines
(Garrett et al., 2010; Ito et al., 2012). Les cellules entroendocrines sont positionnes
stratgiquement le long de lpithlium intestinal. Ces cellules expriment, par ailleurs, des
rcepteurs de type Toll et suivant des stimuli microbiens ou alimentaires (par exemple la
prsence de glucose) scrteront diffrentes chimiokines, hormones et dfensines (Garrett
et al., 2010; Selleri et al., 2008). Finalement les entrocytes et les clonocytes expriment
diffrents rcepteurs PAMP (pathogen-associated molecular patterns) comme certains
rcepteurs de type Toll et des rcepteurs de reconnaissance de pathogne intracellulaire
(NOD) qui suivant leurs activations produisent des dfensines, des cytokines et des
chimiokines (Garrett et al., 2010; M uller et al., 2005).
Finalement les cellules du systme

immunitaire rsidentes de

lintestin

soit les

macrophages, les cellules dendritiques et les lymphocytes intrapithliaux (IEL) participent

aussi limmunit inne. Les macrophages rsidents de lintestin sont un type de cellules
spcialises de la lamina propria participant limmunit inne.

Les macrophages

rsidents sont anergiques et ils se caractrisent par une forte activit phagocytaire, mais par
une faible capacit produire et scrter des cytokines (Smythies et al., 2005). De plus, il
n est pas encore tabli si les macrophages rsidents peuvent faire la prsentation
dantignes et ainsi participer limmunit adaptative (Smith et al., 2011).
On compte deux sous-types dIEL, soit les a(3 IEL et les y IEL (Sheridan et Lefrancois,
2010). Les IEL participent limmunit inne en produisant des facteurs antimicrobiens tel
que Regllly permettant de contrler linvasion de la microflore intestinale (Ismail et al.,
2011). De plus, lors de la prsence d une brche dans lpithlium intestinal du clon, les

IEL vont scrter le facteur de croissance KGF qui entranera la migration et la

prolifration des cellules de lpithlium favorisant ainsi lintgrit de la barrire pithliale
(Chen et al., 2002b). Dernirement, il a t dmontr que les cellules dendritiques
participaient aussi limmunit inne puisquen prsence de flagelline, elles sont
responsables de la production d IL-23 qui son tour augmente lexpression de la molcule
antimicrobienne Regllly (Kinnebrew et al., 2012).

2.2 L immunit adaptative

Limmunit adaptative fait appel la rponse humorale via la production d anticorps par
les lymphocytes B et la rponse mdiation cellulaire via lactivation des lymphocytes T.
Les diffrentes populations de lymphocytes B et T possdent un rcepteur nomm
respectivement BCR et TCR qui reconnaissent les complexes majeurs d histocompatibilit
(CM H) prsentant les antignes la surface de toutes les cellules (Parham, 2003). Les
CMH comportent deux sous-types : le CMH de classe I qui est exprim par toutes les
cellules et le CMH de classe II qui est exprim par les cellules prsentatrices d antignes
telles que les cellules dendritiques et les cellules M qui sont prsentes dans lintestin
(Parham, 2003).
Lintestin comprend des structures spcialises appeles tissus lymphodes associs aux
muqueuses dnommes plaques de Peyer dans lintestin grle qui renferment des
populations de lymphocytes B et T (Abraham et Cho, 2009; Parham, 2003).

Les

lymphocytes T auxiliaire qui se subdivisent en plusieurs sous-types se lient aux CM H de

classe II des cellules prsentatrices d antigne (Parham, 2003).

Lactivation de ces

lymphocytes est maximale suivant la liaison de leur corcepteur avec la cellule

prsentatrice d antigne (Parham, 2003). C est en prsence de diffrentes cytokines et
chimiokines que les lymphocytes T auxiliaires pourront se diffrencier en diffrents soustypes. La prsence d IFN-y et d IL-12 favorisera la diffrentiation en lymphocytes T u l qui
scrteront de lIFN-y (Abraham et Cho, 2009). La prsence d IL-4 favorisera la
diffrentiation en lymphocytes Th2 qui scrteront de lIL-4, de lIL-5 et de lIL-13 et
participeront lactivation et la prolifration des lymphocytes B qui produiront les
anticorps (Abraham et Cho, 2009). La prsence de TGF-P, d IL-1 et d IL-6 perm ettra la

diffrentiation en lymphocytes T h 17 qui produiront des cytokines telles lIL 17, lIL-21,
lIL-22 et lIL-2 et permettra de limiter les infections bactriennes et stim ulera le
recrutement des neutrophiles aux sites d inflamm ation (Abraham et Cho, 2009; W eaver et
al., 2007). Finalement, la prsence de TGF-P perm ettra la diffrentiation en lymphocytes
Treg qui scrtent des molcules anti-inflamm atoires telles lIL-10 et le TGF-P et permettra
de diminuer la rponse inflammatoire (Abraham et Cho, 2009; Sakaguchi et Sakaguchi,
2005).
La rgulation fine de la raction immunitaire de lintestin, par exemple contre les bactries
de la microflore, est essentielle pour le m aintien de lhomostasie de cet organe. Un
dsquilibre de la rponse immunitaire peut entraner le dveloppement de maladies
inflammatoires intestinales comme illustr la Figure 2.

contexte, lpithlium forme une barrire recouverte de mucus qui favorisera en

collaboration avec les cellules de la lamina propria, lhomostasie de lintestin. B)
Linflammation peut tre cause par des brches dans lpithlium, une couche de mucus
absente ou rduite, une permabilit accrue, une augmentation de ladhrence des bactries
lpithlium favorisant ainsi lactivation de la rponse immunitaire afin de favoriser un
retour rapide lhomostasie intestinale. Chez les patients atteints de maladies
inflammatoires intestinales, une susceptibilit gntique rsultera en une suractivation du
systme immunitaire envers la prsence de bactries et d antignes. Cette suractivation aura
pour effets d augmenter la scrtion de cytokines pro-inflammatoires, d augm enter la
permabilit de la barrire pithliale et de dim inuer la tolrance en favorisant la gnration
de cellules T hl7. Tir et adapt de (Abraham et Cho, 2009).

3. Les maladies inflammatoires intestinales

La maladie de Crohn et la colite ulcreuse sont des maladies du tube digestif regroupes
sous le terme gnral de maladies inflammatoires intestinales. Ces maladies rsulteraient
d une rponse inflammatoire inapproprie aux bactries de la microflore intestinale chez un
individu susceptible gntiquement (Abraham et Cho, 2009).

Entre 1998 et 2000, la

prvalence de la maladie de Crohn slevait 223,7 cas par 100 000 habitants alors que
lincidence tait estime 13,4 nouveaux cas par 100 000 habitants faisant du Canada le
pays avec la plus haute prvalence et incidence jam ais rapport (Bernstein et al., 2006). Au
Canada, durant ces mmes annes, la prvalence de la colite ulcreuse tait de 193,7 cas par
100 000 habitants alors que lincidence tait estime 11,8 nouveaux cas par 100 000
habitants (Bernstein et al., 2006).

3.1 La maladie de Crohn

La maladie de Crohn peut affecter tout le tube digestif de la bouche lanus mais affecte
principalement la jonction ilo-caecal (M acdonald et Monteleone, 2005). Les lsions
inflammatoires sont transmurales c est--dire q u elles peuvent affecter toutes les couches
tissulaires formant lintestin. Les lsions inflammatoires se prsenteront sous forme
discontinue le long du tube digestif (M acdonald et Monteleone, 2005). L inflammation
retrouve consiste principalement en la prsence de lymphocytes T et de macrophages
(Macdonald et Monteleone, 2005). Le patient prsentera des signes cliniques caractriss

10

par des douleurs abdominales, des diarrhes chroniques et par une perte de poids
importante (Yamada, 2009).
Les patients atteints de cette maladie prsentent des prdispositions gntiques complexes
pouvant conduire un drglement du systme immunitaire face la m icroflore intestinale
(M acdonald et M onteleone, 2005). Plusieurs patients vont prsenter des polymorphismes
dans un ou plusieurs gnes de susceptibilit pouvant tre regroups en diffrentes
catgories (Tsianos et al., 2011). La premire catgorie reprsente les gnes associs aux
rcepteurs de reconnaissance de patrons molculaires tels les gnes NOD2 (CARD15) et
TLR. Par exemple, dans les cellules de Paneth des mutations dans NOD2 ont t associes
avec une diminution de lexpression de peptides antimicrobiens comme la-dfensines
(W ehkamp et al., 2004). La deuxime catgorie comprend les gnes situs sur le locus
nomm IBD5 et qui seraient impliqus dans lhomostasie de la barrire pithliale. Par
exemple, une mutation dans le gne PDLIM4 pourrait promouvoir la contraction des
filaments d actine dans les cellules pithliales et du coup augmenter la permabilit
paracellulaire (Reinhard et Rioux, 2006).
La troisime catgorie regroupe les gnes lis la rponse immunitaire adaptive et
lapoptose soit CMH et HLA. Des mutations dans le gne de HLADRB1 sont associes la
maladie de Crohn et la colite ulcreuse et pourraient occasionner une rponse immunitaire
inapproprie (Annese et al., 2005). La quatrime catgorie rassemble les gnes impliqus
dans la diffrentiation lymphocytaire tels IL23R et STAT3. Il a t dmontr q u un
polymorphisme dans le gne d IL23R favorise une augmentation de la concentration de la
cytokine pro-inflammatoire IL-22 dans le srum de patients atteints de la maladie de Crohn
(Seiderer et al., 2008).
La dernire catgorie comprend le gne reli lautophagie ATG16L1. L autophagie
permet la dgradation de composants du cytoplasm e en priode o il y a un manque de
nutriments. Durant les infections, lautophagie est employe pour dgrader les pathognes
qui ont pntr lintrieur de la cellule (N aser et al., 2012). Rioux et collaborateurs ont
dmontr le rle essentiel d ATG16Ll dans lautophagie de bactries en utilisant des
cellules HEK-293T dont le gne d A TG 16Ll a t invalid. Ils ont dm ontr que dans ces

11

cellules, il n y avait plus d autophagie dirige envers les bactries pathognes (Rioux et al.,
2007).

3.2 La colite ulcreuse

La colite ulcreuse est caractrise par la prsence d inflammation qui n affectera que la
muqueuse intestinale de faon continue dbutant au rectum et pouvant atteindre tout le
clon suivant la progression de la maladie (M acdonald et M onteleone, 2005). Les patients
atteints de colite ulcreuse vont prsenter les signes cliniques suivant : diarrhes sanglantes
avec prsence de mucus ou non, douleurs abdominales, perte de poids et fivre (Danese et
Fiocchi, 2011).
Un modle propos pour expliquer la pathogense de la colite ulcreuse implique tout
d abord des glycolipides qui proviennent soit des clonocytes et/ou des bactries et qui
entranent laugmentation de lexpression du rcepteur de lIL-13 des cellules NKT (natural
killer T) (Danese et Fiocchi, 2011). Les cellules NKT reconnaissent les glycolipides et, en
absence de ceux-ci, peuvent rpondre aux cytokines scrtes par les cellules dendritiques
(Tupin et al., 2007). Les cellules NKT produisent de lIL-13 qui agissant de manire
autocrine permet lexpansion du nombre de ces cellules dans la muqueuse du clon crant
des dommages important celle-ci (Danese et Fiocchi, 2011). Lorsque la muqueuse est
endommage, il y aura entre dans lorganisme de bactries et d antignes prsents dans la
lumire du clon qui favoriseront lactivation des cellules prsentatrices d antignes telles
les cellules dendritiques qui pourront leur tour activer les lymphocytes T et les
macrophages rsultant en la production et la scrtion d un cocktail de cytokines pro
inflammatoires (Danese et Fiocchi, 2011). Les clonocytes actives par la prsence d ILip scrteront de lIL-8, un puissant chimio-attractant pour le recrutement des neutrophiles
au site dinflammation. Les clonocytes produiront aussi des chimiokines telles MCP-1 et
RANTES qui attireront et activeront respectivement les macrophages et les cellules T
auxiliaires (Danese et Fiocchi, 2011). Les cellules T auxiliaires de type 2 produiront de
lIL-13 et de lIL-5 contribuant respectivement la dgradation de la muqueuse et au
recrutement et lactivation des osinophiles (Danese et Fiocchi, 2011).

De plus, des

variantes gntiques associes la colite ulcreuse entranent une rduction de la scrtion

12

de PPAR-y par les clonocytes, des anomalies dans la production et la scrtion de mucus
et dans la prsence et lactivation de lymphocytes T auxilliaires de type rgulateur (Treg)
(Danese et Fiocchi, 2011).

3.3 La rparation de la muqueuse intestinale

Le maintien de lintgrit de la barrire pithliale intestinale est essentiel afin de prvenir
lentre dans lorganisme d antignes, de microorganismes et de virus (Laukoetter et al.,
2006; Watson et al., 2005). Suivant, une blessure qui pourrait tre cause par une rponse
immunitaire

incontrle

telle

quobserve

chez

les patients atteints de

maladies

inflammatoires intestinales, des mcanismes de rparation doivent s enclencher afin de

retrouver le plus rapidement possible lintgrit de la barrire pithliale. Le processus de
rparation pithliale peut tre divis en trois tapes distinctes qui sont interdpendantes et
qui se superposent dans le temps. Ces trois tapes sont : la restitution, la prolifration et
finalement la maturation.

3.3.1 Premire tape de la rparation de blessures : la restitution

L tape de restitution survient dans les minutes suivant la blessure. Cette tape implique la
migration des cellules adjacentes la blessure de faon refermer le plus rapidement
possible la brche. Ces cellules subiront un changement de forme et de phnotype grce
ladoption

d une

transition

pithliale-msenchyme

cause

entre

autres

par

une

rorganisation du cytosquelette d actine qui entranera la formation de lamellipodes au

front de migration.

Ces lamellipodes sont obtenus suivant le dsassemblage des

microvillosits de la bordure en brosse (Albers et al., 1995). Brivement et comme illustre

sur la Figure 3, au front cellulaire, il y aura activation de la petite protine G Rac qui
stimule la formation de amellipode par la rorganisation du cytosquelette d actine. Tout
d abord, il y aura formation d embranchement d actine produit la m embrane plasmique
par lactivation des molcules W ASP-Arp2/3 (Le Clainche et Carlier, 2008). Ces
embranchements seront maintenus par laddition constante de molcule d actine sous
laction de la profiline. Les lamellipodes seront ancrs la matrice extracellulaire par des
complexes focaux. Alors que la cellule migre vers lavant, les complexes focaux vont se
retrouver sur les cts latraux de la cellule et devenir plus dense en intgrines (W ehrle-

13

Haller et Imhof, 2003). Ces complexes focaux seront lis au cytosquelette d actine par les
fibres de stress qui sont cres suivant lactivation de RhoA.

Finalement, les complexes

focaux qui se sont densifis se localiseront larrire de la cellule o ils porteront le nom
de contacts focaux (W ehrle-Haller et Imhof, 2003). Les microtubules sattacheront ses
contacts focaux et exerceront une force de traction vers lintrieur de la cellule permettant
ainsi le dtachement des contacts focaux de la matrice extracellulaire et lavancement de la
cellule (W ehrle-Haller et Imhof, 2003).
Le rle du cytosquelette d actine dans la migration cellulaire est amplement tudi.
Rcemment, des tudes ont dmontr que les microtubules jouent aussi un rle essentiel
dans la promotion de la migration cellulaire (W atanabe et al., 2005; W ehrle-Haller et
Imhof, 2003).

Les microtubules sont en tat d instabilit dynamique, c est--dire que

lextrmit positive du microtubule est sujette la polymrisation/dpolymrisation. Ceci

permet aux microtubules d explorer lespace intracellulaire (Kirschner et M itchison, 1986).
Durant la migration cellulaire, il y aura une stabilisation des extrmits positives des
microtubules leur permettant de se polariser vers le front de migration. Plusieurs
modifications post-traductionnelles de la tubuline permettent daugm enter sa stabilit.
Parmi celle-ci la dtyrosination et lactylation de la-tubuline.

La dtyrosination est

catalyse par la carboxypeptidase qui est une dtyrosinase cytosolique, (Ham mond et al.,
2008) alors que lactylation est catalyse par le complexe d histone actyltransfrase
Elongator (Creppe et al., 2009).
La premire tude dcrire quil y avait une polarisation et une stabilisation des
microtubules vers le front de migration a t ralise par Gundersen et collaborateurs. Ils
ont dmontr que dans les vingt minutes suivant une blessure d une monocouche de
fibroblastes murins, que les microtubules sorientaient vers le front de migration et q u il y
avait une augmentation de la dtyrosination de ces microtubules. (Gundersen et Bulinski,
1988). Des tudes subsquentes ont dmontr que cette stabilisation des microtubules de la
cellule en migration tait rgul par la protine Rho et son effecteur m Dia (Cook et al.,
1998; Palazzo et al., 2001).
Le rle de lactylation de la-tubuline dans la stabilisation et la promotion de la migration
cellulaire est relativement rcent.

Une tude ralise par Creppe et collaborateurs a

14

identifi que le complexe d histone actyltransfrase Elongator taient responsables de

lactylation de fa-tubuline (Creppe et al., 2009).

De plus, ils ont dmontr que

lutilisation d un mutant non-actylable de la-tubuline empchait la migration cellulaire de

neurones corticaux de rat. Le rle de lactylation dans la promotion de la migration
cellulaire pourrait tre de favoriser le transport de cargo contenant des lm ents du
cytosquelette ou des protines requises pour la migration (Creppe et al., 2009).
Les tudes prsentes dans cette section dm ontrent que c est par laction coordonne du
cytosquelette dactine et des microtubules que seffectue la migration cellulaire ncessaire
ltape de restitution.

3.3.2 La deuxime tape de la rparation de blessures : la prolifration

L tape de prolifration survient dans les heures ou les jours suivant la blessure.

Les

cellules souches de lintestin vont gnrer un grand nombre de cellules prognitrices qui
permettra de remplacer le pool de cellules endommages suivant la blessure (Dignass et
Podolsky, 1993).

Lapparition d une brche dans lpithlium intestinal perm et un

recrutement important de macrophages afin de contrler linvasion des bactries de la flore

intestinale (Pull et al., 2005). Cependant, des tudes rcentes suggrent que ce ne serait pas
l le seul rle des macrophages lors de rparation de blessures. Il existe deux types de
macrophages : M l et M2. Les macrophages M l sont obtenus suivant la stimulation avec
des cytokines pro-inflammatoires comme lIL -ip , le LPS ou encore le TN F-a (Ricardo et
al., 2008). Les macrophages^Ml seront responsables de la scrtion de plusieurs cytokines
dont le TNF-a, lIL-6 et lIL-12 ainsi que de la production d oxyde nitrique (Ricardo et al.,
2008). Les macrophages M2 sont principalem ent obtenus suivant la stimulation par les
cytokines IL-4 et IL-13 (Lolmede et al., 2009; Ricardo et al., 2008). Les macrophages M2
sont associs la rparation tissulaire entre autres parce q u ils produisent et scrtent du
VEGF et des MMP9 associs au remodellage de la membrane basale (Lolmede et al.,
2009). Une tude ralise par Pull et collaborateurs a dmontr que des macrophages vont
se localiser proximit des cellules souches et exprim er diffrentes m olcules (facteurs de
croissance, mtalloprotases, etc.) qui vont favoriser la prolifration de ces cellules (Pull et
al., 2005). Une autre tude ralise en 2008 par Seno et collaborateurs a aussi dmontr le
rle des macrophages dans la promotion de la prolifration cellulaire.

En effet, les

16

seront responsables de la rtraction des contacts focaux larrire de la cellule perm ettant
celle-ci d avancer alors quau devant de la cellule les microtubules seront responsables de
la livraison de cargo vers les complexes focaux et les lamellipodes. Tir, adapt et modifi
de (W ehrle-Haller et Imhof, 2003).

3.3.4 Molcules favorisant la rparation de blessures

La rgulation de chacune des tapes du processus de rparation pithliale est favorise par
diffrents

signaux

extracellulaires.

Plusieurs

facteurs

de

croissance,

cytokines

et

chimiokines tels le TGF-a, le TGF-p, lEGF, lHGF, le KGF, lIGF-I, lIGF-II, lIL -lp,
lIL-2 et les peptides en trfle ont t impliqus dans les tapes de restitution et de
prolifration (Ciacci et al., 1993; Dignass et al., 1994a; Dignass et al., 1994b; Dignass et
Podolsky, 1993; 1996; Dignass et al., 1994c; Housley et al., 1994; Ohneda et al., 1997;
Park et al., 1992). Le TGF-P joue un rle central dans la restitution bien q u il inhibe la
prolifration des cellules pithliales intestinales (Dignass et Podolsky, 1993).

Plusieurs

des facteurs de croissance et cytokines m entionns ci-haut favorisent la restitution en

augmentant la production de TGF-P bioactif rsultant en lactivation de sa voie de
signalisation (Dignass et al., 1994b; Dignass et Podolsky, 1993; 1996; Dignass et al.,
1994c). Le TGF-P permet suivant sa liaison avec son rcepteur de type srine/thronine
kinase lactivation des effecteurs SMAD. Les effecteurs SMAD transloquent au noyau de
la cellule et se lient leurs promoteurs cibles permettant la transcription de gnes qui
favorisent le remodelage de la matrice extracellulaire ainsi que lexpression d intgrines
ncessaire la migration des cellules pithliales (Ciacci et al., 1993; Faler et al., 2006;
Schiller et al., 2004).
Il a t dmontr dans les cellules pithliales intestinales q u u n des gnes cibles du TGF-p
est COX-2 (Shao et al., 1999). COX-2 est une enzyme responsable de la production des
prostaglandines. Cette enzyme est exprime trs faiblement dans lintestin en conditions
normales (Singer et al., 1998).

Cependant, elle est rapidement exprime suivant des

dommages la muqueuse comme observs chez les patients atteints de maladies

inflammatoires intestinales (Singer et al., 1998).

COX-2 catalysera la production de

prostaglandines E 2 qui en condition normale rgulent plusieurs processus ncessaire au

maintien de lhomostasie intestinale (Chinen et al., 2011; Hawkey et Rampton, 1965). Les

17

prostaglandines E 2 jouent aussi un rle dans la protection et la rparation de blessures de

lpithlium intestinal.

Deux tudes utilisant le modle de souris traites au DSS afin

d induire une colite chimique ont dmontr que la prostaglandine E 2 tait le m diateur de
leffet protecteur suivant lactivation du rcepteur de type Toll 4 (Brown et al., 2007;
Fukata et al., 2006). En effet, il a t dm ontr dans un modle de souris traites au DSS
que leffet protecteur du PGE 2 tait d lactivation de son rcepteur de type 4 (EP4)
(Kabashima et al., 2002). Ainsi, des souris dans lesquelles lexpression du rcepteur EP4 a
t invalide, ont montr une susceptibilit beaucoup plus svre la colite induit par le
DSS (Kabashima et al., 2002).

Ces souris dmontraient une perte de la fonction de la

barrire pithliale, des dommages importants des cryptes et une agrgation de neutrophiles
et de lymphocytes dans le clon significativement plus importants que les souris de type
sauvage (Kabashima et a}., 2002).
Le processus de rparation pithliale est astucieusement contrl afin de prom ouvoir le
plus rapidement possible le retour lhomostasie.

Plusieurs molcules extracellulaires

joueront un rle essentiel dans ce processus en permettant lactivation de voies de

signalisation qui entraneront le remodelage du cytosquelette ou encore la production de
diffrentes molcules identifies prcdemment.

Parmis ces molcules, les nuclotides

extracellulaires comme lADP et lATP augmentent significativement la rparation d une

monocouche

de cellules pithliales

intestinales

de 42% et

57%

respectivement

comparativement au contrle (Dignass et al., 1998). Cette tude dmontrait que les
nuclotides extracellulaires jouent un rle important dans la rparation de blessure de
lpithlium intestinal. Cependant les mcanismes et les rcepteurs impliqus dans le rle
de ces nuclotides demeuraient ju sq u ce jour inconnu.

4. Les nuclotides extracellulaires

4.1 Source de nuclotides extracellulaires dans lintestin
La principale source physiologique d ATP dans la lumire intestinale provient des
bactries. L utilisation de souris C57BL/6 SPF (specific-pathogen free) qui sont obtenues
en inoculant des souris axniques avec un cocktail de huit souches retrouves normalement
dans la micro flore de la souris a permis de dmontrer que la concentration d ATP dans les

18

fces de ces souris tait de 102 pmole/g (Atarashi et al., 2008). Atarashi et collaborateurs
ont trait ces mmes souris avec deux antibiotiques soit la vancomycine et le mtronidazole
et la concentration d ATP dans les fces chutait sous la limite de dtection de la technique
utilise dmontrant que la majorit de lATP extracellulaire retrouve dans lintestin
provient des bactries. Une autre tude ralise par Iwase et collaborateur a m ontr que la
souche bactrienne Enterococcus gallinarium scrte la majorit de lATP chez ces souris
C57BL/6 SPF (Iwase et al., 2010). De plus, des tudes in vitro ralises sur ces bactries
isoles de fces humaines ont permis de constater que E. gallinarium scrte de lATP
(Iwase et al., 2010).
Les cellules de la muqueuse contribuent elles aussi la relche de nuclotides
extracellulaires. Les travaux de Patel et collaborateur, ont dmontr que la muqueuse
pithliale du clon et de lilon relchait de lATP dans le milieu extracellulaire en
condition physiologique (Patel et al., 2011). Cette relche semble tre associe lhmicanal pannexine-1 puisque lactivation de ce canal est associe la relche d ATP dans le
milieu extracellulaire de cellules pithliales pulmonaires suivant T activation de Rho
(Seminario-Vidal et al., 2011). De plus, en utilisant les cellules pithliales cilies bovines,
Li et collaborateurs ont montr que la relche d ATP dans le milieu extracellulaire par les
cellules pithliales implique une scrtion vsiculaire. L utilisation de bafilomycine, un
inhibiteur de la relche de vsicules a rduit de 25% la relche d ATP dans le milieu
extracellulaire suivant un stress hypotonique (Li et al., 2010).
En condition pathologique o on retrouve de linflammation et/ou une blessure, les
plaquettes sanguines ainsi actives sont une source de nuclotides extracellulaires
importante (M arcus et al., 2003). En effet, les granules des plaquettes sont riches en ATP
et en ADP. Leurs dgranulations perm ettent d lever la concentration de nuclotide
extracellulaire pour une varit de fonctions physiologiques et pathologiques.

Les

neutrophiles recruts au site dinflammation relchent aussi de lATP par la connexine 43,
un hmi-canal (Eltzschig et al., 2006).

En conditions pro-inflammatoires, les cellules

pithliales intestinales vont aussi participer augmenter la concentration de nuclotides

extracellulaires. Suivant la stimulation de cellules Caco-2/15 avec de TIFN-y et du TN F-a,
il y a une augmentation de la relche d UDP d environ 110 nM 125 nM dans le milieu
extracellulaire (Grbic et al., 2008). Finalement, les dommages cellulaires peuvent entraner

19

la lyse des cellules et le relchement d une grande quantit de nuclotides extracellulaires

(Hart et al., 2008).

4.2 Concentration de nuclotides dans le milieu extracellulaire de lintestin

La concentration exacte de nuclotides extracellulaires dans lintestin est inconnue autant
en condition physiologique que pathologique.

Cependant, une tude rcente utilisant un

nouveau biomarqueur de lATP a rapport in vitro que la muqueuse du clon en condition

physiologique relchait une concentration d ATP de lordre de 0,8 1,0 pM (Patel et al.,
2011).

Il est propos que lATP et lUTP soient relchs de faon sim ilaire puisque la

relche d UTP par les cellules de types non-scrtrices, comme les clonocytes, suit le
mme patron de relche que celui de lATP (Lazarowski et Boucher, 2001). De plus, en
condition physiologique, la muqueuse du clon est expose un stress mcanique lors du
passage des fces. Ce stress mcanique pourrait stim uler la relche d ATP et d UTP par un
facteur de 10 20 fois ce quon retrouve en condition basale (Lazarowski et Boucher,
2001; Lazarowski et al., 2003; Lazarowski et Harden, 1999; Lazarowski et al., 1997).
Comme mentionn prcdemment, les nuclotides extracellulaires peuvent aussi provenir
des bactries de la flore intestinale, des cellules apoptotiques et des cellules du systme
immunitaire. En effet, T activation des leucocytes et des plaquettes sanguines ainsi que les
microenvironnements acide et hypoxique retrouve lors dune inflammation vont favoriser
la relche de nuclotides extracellulaires (Di Virgilio et al., 2001; Gordon, 1986;
Luttikhuizen et al., 2004).

4.3 M tabolisme des nuclotides

Dans le milieu extracellulaire, on retrouve des ecto-nucltotidases solubles ou lies la
membrane plasmique qui ont la capacit d hydrolyser ou de synthtiser les nuclotides
(voir Figure 4). Ces enzymes permettent une rgulation de lactivation ou de la terminaison
de la signalisation cellulaire associes aux rcepteurs purinergiques qui sera aborde plus
en dtail la section 5 de cette introduction.

21

quatrime famille est compose d un seul membre nomm nucloside diphosphokinase ou

NPDK qui a la capacit de catalyser rversiblem ent le transfert d un groupem ent phosphate
entre un nucloside di et triphosphate comm e par exemple : ATP + UDP <-> ADP + UTP
(Boissan et al., 2009).
L avant-dernire famille est appele alcaline phosphatase.

Ces enzym es ancres la

membrane ont la capacit d hydrolyser un nucloside triphosphate ju sq u sa forme la plus

simple soit sous forme de nucloside et phosphate inorganique (Zimmermann, 2001). La
dernire famille d ecto-nuclotidases comprend sept membres nom ms ecto-adnylate
kinase ou ecto-AK.

Ces enzymes membranaires catalysent la conversion de deux

molcules d ADP en ATP et AMP et ce de faon rversible (Dzeja et Terzic, 2009;

Yegutkin, 2008).

4.4 Origine de la signalisation purinergique

Les premires preuves que les nuclotides retrouvs dans le m ilieu extracellulaire
pouvaient avoir un rle physiologique furent dmontres par Drury et Szent-Gyorgyi en
1929 (Drury et Szent-Gyorgyi, 1929). Il aura fallu attendre plus de 40 ans avant que le rle
important de mdiateur autocrine et paracrine des nuclotides extracellulaires soit rem is de
lavant (Sattin et Rail, 1970). Finalement en 1976, les travaux du Pr B um stock ont permis
d tablir les premires bases d un systme de classification des rcepteurs purinergiques
(Bumstock, 1976).

5.

Les rcepteurs purinergiques P2

Les rcepteurs P2 sont diviss en deux familles soit les rcepteurs ionotropiques P2X et les
rcepteurs mtabotropiques P2Y. La famille de rcepteurs P2X compte sept membres chez
lhumain soit P2X1 P2X7. Contrairement aux rcepteurs P2Y, les rcepteurs P2X ne
possdent quun seul agoniste naturel: lATP.

22

5.1 Les rcepteurs mtabotropiques P2Y

Les rcepteurs mtabotropiques P2Y sont, comme leurs nom s lindiquent, des rcepteurs
coupls aux protines G. ce jour, on compte huit rcepteurs de la famille P2Y chez
lhumain soit P2Y,, P2Y2, P2Y4, P2Y6, P2Y n , P2Y i2, P2Y I3 et P2Y ,4 (Abbracchio et al.,
2006) Les agonistes endognes des rcepteurs P2Y sont lATP, lUTP, lADP, lUDP,
lUDP-glucose et lUDP-galactose (Abbracchio et al., 2006).

Le tableau 1 indique les

agonistes endognes ainsi que les protines G auxquels chacun des rcepteurs de la famille
P2Y se couplent.

23

Agonistes

Rcepteur

endognes

Mcanismes de

Rfrences

transduction

y ii

3BwMH H Wm
ATP, UTP

P2Y2

Famille Gq/G n

(Lazarowski et al., 1995)

Famille Gi/G0
Famille G |2/G |3

j g g g lg
P2Y6
t a

hh
UDP>UTP

Famille Gq/Gn

BflS9jHHBRS9

|
P2Y,

ADP

1Bminmi
(Communi et al., 1996)

H
Famille Gj/G0

(H erbert et Savi, 2003;

Simon et al., 2002)

P2Y,

UDP-

Famille G,/G0

(Fricks et al., 2009)

glucose
UDPgalactose

Tableau 1. Caractristiques des rcepteurs P2Y.

Dans ce tableau est reprsent les rcepteurs humains de la famille P2Y ainsi que leurs
agonistes endognes et principaux mcanismes de transduction et effecteurs.

5.2 Le rcepteur P2Y2

5.2.1

Localisation gnique et polymorphismes gntiques

Le gne humain du rcepteur P2Y2 est situ sur le chromosome 11 au locus q l3 .5 et la

squence codante ne contient aucun intron. Plusieurs polymorphismes ont t identifis sur

24

le gne du rcepteur P 2 Y 2. La premire tude a rapport un changement en position 334

d une arginine pour une cystine dans la protine de P 2 Y 2 (Janssens et al., 1999). Pour
dterminer leffet de ce variant sur la fonction du rcepteur P2 Y 2, les auteurs ont utilis les
cellules humaines astrocytaires 1321N1 qui n expriment aucun rcepteur P2. Lexpression
du variant exprimant une cystine en position 334 du rcepteur P 2 Y 2 dmontre une
diminution de laccumulation d IP 3 suivant lactivation du rcepteur avec ces agonistes
suggrant que ce variant permet une activation moindre de ses voies de signalisation
associes (Janssens et al., 1999). Une autre tude a dmontr que chez les patients atteints
de fibrose kystique, il y a une augmentation significative d un polymorphisme dans le gne
du rcepteur P2Y2 (Buscher et al., 2006). En effet, le changement en position 312 d une
arginine pour une srine tait plus frquent dans la population de patients atteints de fibrose
kystique comparativement la population contrle. L expression de ce variant dans les
cellules 1321N1 a rvl que suivant la stimulation avec lA TP7 il y avait une augm entation
de la concentration de calcium intracellulaire plus importante que celle observe avec le
variant non-associ la fibrose kystique (Buscher et al., 2006). La stimulation du rcepteur
P 2 Y 2 augmente la concentration de calcium intracellulaire et lactivation des CaCCs
(calcium-activated chloride channels) qui rgulent la scrtion d ions chlore chez les
patients atteints de fibrose kystique (Buscher et al., 2006). Ainsi, lexpression de ce variant
(Ser312) chez les patients atteints de fibrose kystique pourrait modifier la scrtion de
chlore et tre pris en compte dans les thrapies utilisant les agonistes du rcepteur P2Y2
(Buscher et al., 2006).

Finalement, trois tudes publies par Wang et collaborateur ont

dmontr une incidence significative de diffrents variants du gne du rcepteur P 2 Y 2 chez

la population nipponne qui prdispose lhypertension, aux infarctus du myocarde et aux
infarctus crbraux sans toutefois investiguer leffet de ces variants sur la structure et la
fonction du rcepteur P 2 Y 2 (W ang et al., 2010; Wang et al., 2009a; W ang et al., 2009b).

5.2.2

Structure de la protine

La protine encode par lARNm du rcepteur P 2 Y 2 est compose de 377 acides amins
(voir Figure 5). Le site de liaison des agonistes est situ entre les boucles extracellulaires
des domaines transmembranaires six et sept.

Ainsi, il a t dmontr par mutagense

25

dirige que le remplacement de lhistidine en position 262 et des arginines en position 265
et 292 par des leucines qui sont des acides amins neutres rsultaient en une diminution
d environ 100 850 fois la capacit de lATP et de lUTP d induire une rponse calcique
normale (Erb et al., 1995).
Dans la premire boucle extracellulaire du rcepteur P 2 Y 2, on retrouve un m o tif arginineglycine-asparagine (RGD) qui permet la colocalisation du rcepteur P 2 Y 2 avec les
intgrines a v(V P 5 (Erb et al., 2001).

Ce m otif est essentiel pour linteraction avec les

intgrines dyf^/Ps puisque le remplacement du m otif RGD par une squence RGE abolie cet
interaction (Erb et al., 2001).
Le domaine intracellulaire en C-terminal de la protine contient un site de phosphorylation
pour les kinases de rcepteurs coupls aux protines G (GPCR kinases) qui permet la
dsensibilisation et la squestration du rcepteur suivant sa stimulation.

En effet, des

formes tronques pour diffrentes portions du domaine C-terminal ont permis de dmontrer
que la dltion des dix-huit derniers acides amins entranait une dim inution de la
dsensibilisation du rcepteur P 2 Y 2 d environ 30% suivant la stimulation avec les agonistes
(Garrad et al., 1998). La squestration du rcepteur aprs trois heures de stimulation tait
diminue d autant plus que la partie en C-terminale tait tronque (Garrad et al., 1998).
Ces rsultats dmontrent que la portion en C-terminale de la protine est importante pour
rguler la dsensibilisation et la squestration du rcepteur P 2 Y 2.
En plus de son rle important dans la dsenbilisation du rcepteur, la rgion C-terminal de
P 2 Y 2 est implique dans le recrutement et lactivation de Src (Liu et al., 2004).

Le

recrutement de Src se fait grce la prsence de deux domaines de liaison SH3 retrouvs
dans le domaine carboxi-terminal de P 2 Y 2 (Liu et al., 2004).

Src ainsi activ peut

transactiver les rcepteurs de facteur de croissance comme lEGFR (les voies de

signalisation actives par le rcepteur P 2 Y 2 seront discutes plus en dtails la section
5.2.3) (Liu et al., 2004).

28

signalisation telles que MEK/ERK (Albert et al., 1997).

De plus, laugm entation de

calcium intracellulaire permettra lactivation des calmodulines et la m odulation de

diffrents canaux ioniques comme les canaux potassiques et sodiques sensibles au calcium
retrouvs sur les cellules pithliales intestinales (Lee et al., 2003; M atos et al., 2005;
Matos et al., 2007).
Les protines G sont composs de trois sous-units soit a, P et y. On retrouve plusieurs
sous-types de sous-units a qui seront classs selon les effecteurs activs.

Suivant la

liaison de GTP sur la sous-unit a, il y aura dissociation des sous-units P et y. La sousunit a peut ensuite activer diffrents effecteurs ju sq u ce que la molcule de GTP
laquelle elle est lie soit hydrolyse.

Les sous-units Py peuvent ensem ble activer

diffrents effecteurs. Ainsi, suivant la stimulation du rcepteur P2Y2, les sous-units Py de

la protine Gq entrane le recrutement et lactivation de la protine Src qui phosphoryle et
active Pyk2 permettant de transactiver les rcepteurs de facteurs de croissance (Liu et al.,
2004).

S.2.3.2 Signalisations associes au recrutement de G 0 et G 12

Linteraction avec les intgrines c ^ / P s permet le recrutement de la protine G0 et G 12 qui
entraneront respectivement lactivation de Rac et RhoA activant des voies de signalisation
favorisant le remodelage du cytosquelette d actine et la migration cellulaire (Bagchi et al.,
2005; Erb et al., 2001). Par exemple, lactivation de RhoA entrane lactivation de ROCK
et de la MLC-2 permettant la formation de fibres de stress favorisant la chim iotaxie de
cellules astrocytaires 132IN 1 (Liao et al., 2007; Mediero et al., 2008).

5.2.4 Distribution et rle dans lorganisme

Le rcepteur P 2 Y 2 est exprim de faon ubiquitaire dans lorganisme et ses fonctions sont
troitement associes aux tissus dans lequel il est exprim.
distribution et le rle du rcepteur P 2 Y 2 dans lorganisme.

Le tableau 2 rsume la

29

Cellules

Systmes

Rles

Rfrences
......... hI!ni mu wiiBrargfs^w

Cerveau

Astrocytes

HHHH
M igration cellulaire

(Bagchi et al.,
2005)

Systme rnal

BaK& BSSBaBHBBBBSBSmKS^^SsSt^M
Scrtion d ions
Cellules pithliales
(Rajagopal et al.,

2011)

du rein

1181

im i
Systme osseux

Ostoclastes

*,,2007)
Prolifration

Sll
(K a tz et al., 2011)

cellulaire

Peau

Cellules pithliales

M igration cellulaire
Rparation de

(Braun et al.,
2006)

blessure
Tableau 2. Distribution et rles du rcepteur P2Y2 dans lorganisme
Systmes et types cellulaires dans lesquels le rcepteur P2Y2 est exprim suivi du rle
asssoci ces types cellulaires.

30

Finalement, le rcepteur P 2 Y 2 est aussi exprim dans lintestin o il joue plusieurs rles
dans lpithlium intestinal. Ainsi en condition physiologique, le rcepteur P 2 Y 2 participe
labsorption et la scrtion d lectrolytes par les cellules pithliales. Il rgule entre autre
la scrtion de potassium et de chlore ainsi que lactivation du canal ENaC qui rgule la
scrtion de sodium (Dong et al., 2009; Ghanem et al., 2005; Kerstan et al., 1998; M atos et
al., 2005; Matos et al., 2007).

Une fois active, le rcepteur P 2 Y 2 augmente la

concentration intracellulaire de Ca2+ et ceci favorise la scrtion de bicarbonate de sodium

par un transporteur dont lidentit n est pas encore connue (Dong et al., 2009).
En condition pathologique, il a t rapport une augmentation de lexpression du rcepteur
P2Y2 dans des tumeurs colorectales (Nylund et al., 2007). De plus, il y a une augmentation
de lexpression du rcepteur P2Y2 dans des tissus de patients atteints de colite ulcreuse et
de maladie de Crohn ainsi que dans un modle murin de colite chimique induit au DSS
(Grbic et al., 2008).

Finalement, une tude a dmontr que la stimulation du rcepteur

P2Y2 de cellules pithliales intestinales entranait une augmentation de la transm igration

des macrophages et des neutrophiles qui pourraient contribuer la pathologie des maladies
inflammatoires intestinales (Langlois et Gendron, 2009).

5.2.4

Rgulation transcriptionnelle

Il est connu que suivant la stimulation de diffrents types cellulaires avec des molcules
pro-inflammatoires quil y a une augmentation de lexpression du rcepteur P2Y 2 (Ballerini
et al., 2006; Garcia-Verdugo et al., 2008; Hou et al., 2000; Kong et al., 2009).

Un des

facteurs de transcription impliqu serait N F- kB puisque lutilisation d un inhibiteur de la

voie de signalisation amenant lactivation de ce facteur de transcription rsulte en
labolition de laugmentation de lexpression du rcepteur P2Y2 induit par la stimulation
lIL -lp (Kong et al., 2009).

Cependant, aucune tude ne porte sur les mcanismes

transcriptionnels rgulant lexpression du rcepteur P2Y2.

31

6. Le facteur de transcription RelA/p65

Le facteur de transcription RelA/p65 fait partie de la famille du facteur de transcription NFkB.

Cette famille comprend cinq membres nom mes RelA/p65, c-Rel, RelB, N F- k B 1

(p50/pl05) et N F- kB2 (p52/pl00). RelA, RelB et c-Rel sont actifs constitutivem ent alors
que N F- kB 1 (p50/pl05) et N F- kB2 (p52/pl00) sont synthtiss en un long prcurseur qui
doit tre cliv pour permettre la translocation au noyau et la liaison leurs gnes cibles.
Ces facteurs de transcription forment des dimres dont presque toutes les combinaisons
entre les membres de cette famille sont possibles (Neumann et Naum ann, 2007).
Nanmoins, ce ne sont pas toutes les com binaisons qui pourront induire la transcription
ainsi les dimres p52/p52, p50/p50 ainsi que p50/p52 sont transcriptionnellem ent inactifs
(O'Dea et Hoffmann, 2009). Ces dimres peuvent se lier lADN mais ne peuvent
transactiver leurs gnes cibles (O'Dea et Hoffmann, 2009).

Ainsi dans la littrature

scientifique, la majorit des tudes portent sur le dimre form de RelA/p65 et N F- kB 1 p50
qui est en fait le complexe principal impliqu dans la rponse inflammatoire (Neum ann et
Naumann, 2007).

6.1 Structure protique

RelA/p65 est une protine de 551 acides amins et possde un domaine d hom ologie Rel en
N-terminal qui permet sa liaison lADN ainsi que sa dimrisation (Perkins, 2007). De
plus, la squence de localisation nuclaire associe ce facteur est localise au sein mme
du domaine d homologie Rel. En C-terminal, on retrouve un domaine de transactivation
compos de deux sous-domaines nomms TA1 et TA2. Une tude antrieure a dmontr
que les deux sous-domaines TA1 et TA2 possdent une squence similaire et c est ainsi
quils entrent en comptition pour les mmes cofacteurs (Schmitz et al., 1995). Par contre,
le sous-domaine TA1 est phosphoryl de manire constitutive alors que le sous-dom aine
TA2 sera phosphoryle par la PKC ayant pour effet d augmenter le potentiel de
transactivation de N F- kB (Schmitz et al., 1995).

33

6.3 Rgulation de lactivation de NF- kB par les voies alternatives

La voie d activation alternative implique la liaison de molcules telles que LTB, BAFF et
le ligand de CD40 (Viatour et al., 2005). Ces m olcules font parties de la superfam ille du
TGF-p. Dans lexemple illustr la Figure 7, on observe la liaison du ligand CD40 avec
son rcepteur, il y aura recrutement des protines TRAF et F activation de NIK et d un
dimre d IK K a qui entranera la phosphorylation et lubiquitination de N F- kB2 plOO
permettant son clivage par le protasome afin de gnrer la forme p52.

Cette voie

d activation gnre principalement des dimres composs de p52/RelB qui pourront

transloquer au noyau et activer leurs gnes cibles.
Une autre voie d activation dite atypique est IKK indpendante et implique des dommages
causs par diffrents stress physiologiques tels que lhypoxie, la prsence de peroxyde ou
encore par les ultra-violets (UV) comme illustr la Figure 7 (Neumann et Naumann,
2007). Lexposition aux UVs, permet lactivation de p38 qui activera CK2 qui pourra alors
phosphoryler IicBa et le cibler pour la dgradation par le protasome librant ainsi le
dimre de N F- kB.

6.4 Rgulation de lactivit de RelA/p65 par des modifications post traductionnelles et

linteraction avec des protines rgulatrices
La rgulation de lactivit de RelA/p65 sopre par diffrents mcanismes im pliquant la
protine

inhibitrice

IicBa,

des

modifications

post-traductionnelles

actylases, des dactylases, des kinases et des ubiquitinases.

im pliquant

des

IicBa qui agit comme

protine inhibitrice de RelA/p65 dans le cytoplasme en bloquant son site de localisation

nuclaire peut aussi rguler lactivit de RelA/p65 lorsque celui a t activ et a transloqu
au noyau.

En effet, IxBa possde un site de localisation nuclaire et un site d export

nuclaire qui lui permet de transloquer au noyau et de se lier avec N F- kB (Nelson et al.,
2004).

Le complexe peut alors retourner dans le cytoplasme o suivant un stimulus

appropri, il y aura activation du complexe IKK permettant la dgradation d iKBa et la

transloquation du dimre de N F- kB au noyau crant ainsi une boucle de rtroaction
ngative (Nelson et al., 2004).

34

Plusieurs modifications post-traductionnelles soit la phosphorylation, lactylation, la

dsactylation ainsi que lubiquitination peuvent rguler lactivit de RelA/p65. Par
exemple, la phosphorylation de RelA/p65 sur la srine 536 par A kt va augm enter le
potentiel de transactivation de la protine (M adrid et al., 2001). Lactylation sur le rsidu
lysine 221, par CBP/p300, va permettre d augmenter la liaison lADN de RelA/p65 (Chen
et al., 2002a).

Consquemment la dsactylation par HDAC3 de RelA/p65 favorise la

liaison avec IicBa nuclaire et le retour du com plexe dans le cytosol (Chen et al., 2001).
Finalement, lubiquinitation de la lysine 195 de RelA/p65 est associe sa dgradation par
le protasome (Fan et al., 2009).

6.5 Rles et fonctions de NF- kB dans lintestin

Le facteur de transcription N F- kB est associ avec laugmentation de la rgulation de
plusieurs gnes pro-inflammatoires comme lIL -ip et le TN Fa (Wang et al., 1999). Les
premires tudes sintressant lexpression de ce facteur de transcription dans des tissus
de patients atteints de maladies inflammatoires intestinales ont dmontr une augmentation
de lexpression et de la localisation nuclaire de RelA/p65 associant donc lactivation de
NF- kB chez ces patients avec des effets nfastes pour lhomostasie intestinale (Ellis et al.,
1998; Rogler et al., 1998; Schreiber et al., 1998). Cependant de rcentes tudes semblent
dmontrer que dpendamment du type cellulaire dans lequel NF- kB est activ, ce facteur
de transcription pourrait aussi jouer un rle de maintien de lhomostasie intestinale en
contexte inflammatoire.
Dans les cellules pithliales, lactivation de NF-kB protge la barrire pithliale en
favorisant la restitution et en diminuant la rponse apoptotique. En effet, deux tudes ont
dmontr limportance de lactivation du TLR4 des cellules pithliales intestinales dans un
modle murin de colite chimique (Fukata et al., 2006; Fukata et al., 2005). L activation du
TLR4 suivant la liaison avec son ligand le LPS entrane lactivation de N F-kB qui lui
favorise la production de COX-2. COX-2 est reconnu pour favoriser la prolifration des
cellules souches de lintestin par la production de PGE 2. Dans un essai de blessure d une
monocouche de cellule pithliale intestinale de rat, les IEC-18, il a t montr que lajout
d un inhibiteur de lactivation de NF-kB diminue la rparation de blessure (Karrasch et al.,

35

2006). Le rle protecteur de N F- kB dans Fpithlium intestinal a t dmontr plus

particulirement dans des modles de souris invalide pour lexpression d IKKJ3
spcifiquement dans les cellules pithliales.

Ces souris ont dmontr une susceptibilit

accrue aux modles de blessures induits par les radiations (Egan et al., 2004). Le rle de
RelA/p65 a t dmontr dans un modle murin de colite chimique induit au DSS dans
lequel linvalidation de lexpression de RelA/p65 dans les cellules pithliales a entran
une diminution de lexpression de la molcule anti-apoptotique Bcl-XL (Karrasch et Jobin,
2008).
la lumire de ces tudes et de plusieurs autres, Karrasch et Jobin (Karrasch et Jobin,
2008) ont propos le modle suivant qui implique que lactivation de N F- kB dans les
cellules pithliales intestinales entranerait une rponse anti-inflamm atoire caractrise par
la restitution et la rparation de blessure ainsi q u une activit anti-apoptotique. Cependant,
lactivation des cellules mononucles de la lamina propria induit une augm entation de la
production

de

molcules

pro-inflammatoires

qui

chez

un

individu

susceptible

gntiquement aux maladies inflammatoires intestinales entranerait des dommages

tissulaires et une inflammation soutenue.

7. Le facteur de transcription C/EBPP

La famille de facteur de transcription C/EBP est implique dans la rgulation de gnes lis
plusieurs processus cellulaire dont la diffrentiation, la prolifration et linflammation
(Ramji et Foka, 2002). Un membre de cette famille nomm C/EBPp revt une importance
particulire puisquil permet la transactivation de plusieurs gnes li linflammation dont
lIL-6, lIL -ip et le TN F-a en se liant sa squence consensus RTTGCGYAAY (R : A ou
G et Y : C ou T) retrouve sur les promoteurs de ces molcules. (Akira et Kishimoto, 1997;
Ramji et Foka, 2002). Le facteur de transcription C/EBPP rgule lexpression des gnes en
formant un dimre avec les autres membres de la famille C/EBP ou avec d autres facteurs
de transcription comme N F- kB (Khanjani et al., 2011).

36

7.1 Structure protique

La rgion en C-terminal de la protine C/EBPp est compose d un dom aine bZIP qui est
caractris par une rgion basique et d un m otif leucine zipper qui sont responsables de la
liaison lADN et de la dimrisation (Kalvakolanu et Roy, 2005). C/EBPp possde deux
domaines de rgulation ngative RDI et RD2 situs au centre de la protine qui contiennent
des sites pouvant tre phosphoryls par des kinases. En N-terminal, C/EBPp possde un
domaine d activation transcriptionelle qui peut aussi subir diffrentes m odifications posttraductionnelles.
On retrouve trois isoformes de la protine C/EBPP nomms LAP, LAP* et LIP (Ramji et
Foka, 2002). Ils sont tous obtenus par lutilisation de codons alternatifs.

LIP est une

protine de 20 kDa qui agit comme un rpresseur de la transcription puisquil ne contient

pas le domaine de transactivation.

Les formes LAP* (38 kDa) et LAP (35 kDa)

contiennent les domaines d activation de la transcription. Les formes prdom inantes sont
les formes LAP et LIP (Ramji et Foka, 2002).

7.2 Rgulation de lactivit de C/EBPp

C/EBPp se retrouve sous forme inactive et la phosphorylation de certains acides amins
joueraient un rle cl dans lactivation de cet isoforme. Par exemple, la phosphorylation de
la thronine 235 par la voie de signalisation MAPK perm ettra d augmenter son potentiel de
transactivation (Nakajima et al., 1993). Une autre modification post-traductionnelle qui est
importante dans la rgulation de C/EBPp est lactylation (Cesena et al., 2007).
L actylation de la lysine 39 de C/EBPP par CBP/p300 a t dmontr pour potentialiser la
transactivation du promoteur Cebpa in vitro. Rcemment, des tudes se sont intresses au
rle de la sumoylation dans la rgulation de lactivation de C/EBPp.

Par exemple, la

mutation de la lysine 173 de C/EBPp qui est normalement un site de sumoylation levait la
rpression exerce par C/EBPP sur le promoteur de la cycline D1 (Eaton et Sealy, 2003).

37

7.3 Rles et fonctions de C/EBPp dans (pithlium intestinal

Dans le clon de la souris nonatale, lexpression de C/EBPp est retrouve dans le noyau
des cellules de la crypte et des cellules diffrencies de lpithlium (Biais et al., 1995). De
plus, son expression a aussi t rapporte dans les cellules constituant la lamina propria.
Dans le modle cellulaire des IEC-6, il y a une augmentation de lexpression protique de
C/EBPp suivant la stimulation avec le srum et les glucocorticodes (Boudreau et al.,
1996). Par la suite, il a t rapport que C/EBPP tait responsable de laugm entation de
lexpression de gnes associs la phase de rponse aige suivant un stress inflammatoire.
Ainsi, C/EBPp rgule notamment lexpression de lalpha-1 glycoprotine acide, de
lhaptoglobine, du complment C3 et du facteur B suivant la stimulation des cellules
pithliales avec divers stimuli soit les glucocorticodes et le TNF-a (Andoh et al., 1999;
Boudreau et al., 1998; Pelletier et al., 1998).

La stimulation de cellules pithliales

intestinales avec lIL-1 (3. active C/EBPP par les MAPK et permet la production d IL-6,
cytokine de la phase aigu de linflammation (Hungness et al., 2002a; Hungness et al.,
2002b).
8. Hypothse, objectifs et mthodes
L inflammation augmente lactivit des facteurs de transcription NF-kB et C/EBPp.

De

plus, il a t rapport quil y avait une augmentation de lactivation et de lexpression de

NF-kB et de lexpression du rcepteur P 2 Y 2 dans les tissus de patients atteints de maladies
inflammatoires intestinales et dans un modle murin de colite ulcreuse.
Le rle du rcepteur P 2 Y 2 dans lpithlium intestinal est reli la rgulation de la
scrtion de diffrents ions. Cependant le rle que ce rcepteur pourrait jouer en condition
pathologique reste inconnu.

Plusieurs vidences dans la littrature m ontrent que

lactivation du rcepteur P 2 Y 2 suivant une blessure favorise la rparation pithliale en

augmentant le processus de migration cellulaire. De plus, la stimulation avec lATP qui est
lun des agonistes du rcepteur P 2 Y 2 favorise la rparation d une monocouche de cellules
pithliales intestinales blesses.
Lhypothse de mon projet de recherche est que laugmentation de lexpression du
rcepteur P 2 Y 2 dans les maladies inflammatoires intestinales est rgule par les facteurs de

38

transcription N F- kB et C/EBPP et que suivant son activation par ses agonistes favorisera la
restitution pithliale intestinale.
Deux objectifs gnraux ont t fixs.
O bjectif 1 : Caractriser la rgion du prom oteur du rcepteur P2Y2 et limplication des
facteurs de transcription NF-kB et C/EBPp dans la transactivation du prom oteur du
rcepteur P 2 Y 2.
Les sous-objectifs sont de :

Prciser le site d initiation de la transcription du rcepteur P 2 Y 2 hum ain et ltat de la

chromatine qui y est associe.

Dterminer si les facteurs de transcription NF-kB et C/EBPP peuvent transactiver la

rgion promotrice du rcepteur P 2 Y 2.

Caractriser les sites de liaison potentiels des facteurs de transcription ltude.

Identifier les vnements molculaires et cellulaires des M il induisant laugmentation

de l expression du rcepteur P 2 Y2

O bjectif 2 : Dterminer la participation du rcepteur P 2 Y 2 au processus de rparation de

lpithlium intestinal in vitro et in vivo.
Les sous-objectifs sont de :

Dterminer l implication du rcepteur P 2 Y 2 dans la migration des cellules pithliales

intestinales.

Caractriser les voies de signalisation actives par le rcepteur P 2 Y 2 qui permettent la

rparation.

Identifier des molcules pro-rparation induite par lactivation du rcepteur P 2 Y 2.

Etudier in vivo limpact de lapplication d une solution de 2-thioUTP pendant la phase

de

rmission

de

souris

traites

au

DSS.

CHAPITRE 1
P 2 Y 2 receptor transcription is increased by NF-kB and stimulates COX-2 expression
and PGE 2 released by intestinal epithelial cells.
Auteurs de Particle: Emilie Degagn, Djordje M. Grbic, Andre-Anne Dupuis, Elise G.
Lavoie, Christine Langlois, Nishant Jain, Gary A. W eisman, Jean Svigny et FemandPierre Gendron.
Statut de Particle : Publi dans The Journal o f Immunology, volume 183, pages 4521 4529, 2009.
Avant-propos : J ai crit le manuscrit et j ai mis en forme les figures dans la premire
version de la publication. J ai effectu la majorit du travail exprimental lexception de
la figure 4 C et D ainsi que la figure supplmentaire 1.

40

9. Rsum de larticle
Suivant la stimulation avec des molcules pro-inflammatoires, il y a une augmentation de
lexpression de lARNm du rcepteur P 2 Y 2 (P 2 Y 2R) dans les lignes cellulaires Caco-2 et
IEC-6. De plus, on observe une augmentation de lexpression du P 2 Y 2R dans les tissus de
clon provenant de patients atteints de la maladie de Crohn et de la colite ulcreuse.
Cependant, les mcanismes transcriptionnels de la rgulation de lexpression du P 2 Y 2R
sont encore mconnus. Nous avons identifi le site d initiation de la transcription du gne
du P 2 Y 2R et dmontr que les histones H3 et H4 sont actyles respectivement sur la lysine
14 et la lysine 8 suggrant que la chromatine associe au P 2 Y 2R est accessible aux facteurs
de transcription.

Nous avons dmontr que le facteur de transcription N F-kB p65

transactive le promoteur du P 2 Y 2R et ce, autant en conditions physiologiques que pro

inflammatoires. Nous avons identifi un site de liaison pour NF-kB p65 situ de - 181 172 paires de base du promoteur du P 2 Y 2R. De plus, lactivation du P 2 Y 2R par lATP et
lUTP entrane une augmentation de lexpression de COX-2 et de la scrtion de PG E 2 par
les cellules pithliales intestinales. Ces rsultats dm ontrent que lexpression du P 2 Y 2R
est rgule durant linflammation intestinale par un m canism e dpendant de NF-kB p65 et
que le P 2 Y 2R pourrait contribuer non seulement aux maladies inflammatoires intestinales
mais aussi d autres maladies inflammatoires en rgulant la relche de prostaglandines.

41

P2Y2 Receptor Transcription is Increased by NF-kB and Stimulates COX-2 Expression and
PGE 2 Released by Intestinal Epithelial Cells.

(Running title: NF-kB regulates P 2 Y 2 receptor transcription)

Emilie Degagn*, Djordje M. Grbic*, Andre-Anne Dupuis*, Elise G. L avoiet, Christine

Langlois*, Nishant JainJ, Gary A. W eism anJ, Jean Svignyt and Fem and-Pierre
Gendron* 1

*Canadian Institutes o f Health Research Team on the Digestive Epithelium, Dpartement

d Anatomie et de Biologie Cellulaire, Facult de M decine et des Sciences de la Sant,
Universit de Sherbrooke, 3001, 12th Ave North, Sherbrooke, Qubec, Canada, J1H 5N4.
t Centre de Recherche eh Rhumatologie et Immunologie, Centre Hospitalier Universitaire
de Qubec, Universit Laval, 2705, Boulevard Laurier, Qubec, QC, G1V 4G2, Canada.
% Department o f Biochemistry, University o f M issouri, 540E Christopher S. Bond Life
Sciences Center, 1201 Rollins Road, Columbia, M O 65211, USA.

Key words: transcription factors, gene regulation, mucosa, inflammation, m olecular

biology

42

10. Abstract
Inflammatory stresses associated with inflammatory bowel diseases upregulate P 2 Y 2
mRNA receptor expression in the human colon adenocarcinom a cell line Caco-2, the noncancerous IEC-6 cells and in colonic tissues o f patient suffering from C rohns disease and
ulcerative colitis. However, the transcriptional events regulating P2Y 2 receptor (P2Y 2R)
expression are not known.

We have identified a putative transcription start site in the

P2Y2R gene and demonstrated actylation o f lysine 14 on histone H3 and lysine 8 on

histone H4 thus suggesting that the chromatin associated to the P2Y2 prom oter is accessible
to transcription factors. We also showed that the transcription factor NF-kB p65 regulates
P2Y2R transcription under both pro-inflammatory and basal conditions.

A NF-kB-

responsive element was identified at -181 to -172bp in the promoter region o f P2Y2.
Hence, activation o f P2Y2R by ATP and UTP stimulated COX-2 expression and PGE2
secretion by IEC. These findings demonstrate that P2Y 2R expression is regulated during
intestinal inflammation through an NF-kB p65-dependent mechanism and could contribute
not only to IBD but to other inflammatory diseases by regulating prostaglandin released.

11. Introduction
Intestinal inflammation is often sees as a pernicious manifestation o f lost o f homeostasis
that can cause significant damage to the host tissue. In fact, inflammation is a key element
o f mucosal defence. It is aimed at limiting entry o f foreign material and microbes in the
blood stream and to facilitate the repair o f damaged tissues (1). The intestinal epithelium
constitutes the first defensive frontline o f the mucosal immune system (2, 3). Despite the
fact that intestinal epithelial cells (IECs) are continually exposed to intraluminal bacteria
and their products, the intestinal mucosa maintains a controlled state o f inflam mation (2, 4).
IECs play an active role in cellular responses to inflammatory stimuli by secreting
cytokines as well as sending cellular messages to immune cells o f the intestinal m ucosa and
submucosa (5, 6).

For many years, cytokines and chemokines and their receptors have

been accepted as regulators o f cross-talk between the intestinal epithelium, immune cells
and the vascular endothelium.

Interestingly, extracellular nucleotides, including ATP,

ADP, UTP and UDP, also have cytokine-like properties (7-10).

43

Recently, these molecules have been described as endogenous danger-signal

molecules that display potent innate immune-enhancing activities (7, 10, 11).

Hence,

inflammation likely promotes the release o f nucleotides, such as ATP and UTP or UDP, not
only from IECs, as we recently showed (10), but also from other cell types, such as
leukocytes, platelets and smooth muscle cells as well as from intestinal bacteria (12).
Another important source o f nucleotides is damaged or dead cells that release nucleotides
present at high concentrations in the cytoplasm (7, 10, 11).

This increase in the

extracellular nucleotide concentration in the environment o f inflamed tissues has also been
associated with an increased expression o f P2Y2 and P2Y6 receptor mRNA in colonic
epithelium o f patients with C rohns disease and ulcerative colitis and in mice with
chemical-induced colitis (10). Upregulation o f P 2 Y 2 receptor (P 2 Y2R) expression was also
observed in a variety o f pathophysiological conditions associated with inflammation and/or
tissue damage (13-15).

This increased in P 2 Y 2R expression and functions has been

associated to the aggravation o f inflammatory-disease symptoms such as in vascular intimai

hyperplasia and Sjogrens syndrome (15-18).

However, P 2 Y 2R expression and activity

could also be beneficial in tissue repair or wound healing (19, 20).

Beside its role in the regulation o f Cl- and K+ secretion by IECs (21-23) and its
reported overexpression in human colon cancer (24), there is no information on the
pathophysiological function o f P 2 Y 2R in inflammatory bowel diseases (IBDs).

More

surprisingly, there is no data demonstrating how P2Y 2R gene expression is regulated. The
characterization o f the promoter region o f the P 2 Y 2R gene could help to understand the
transcriptional regulation o f P2 Y 2R expression in IBD and in other inflamm ation process.
Among the various transcription factors previously described, the p65 subunit o f nuclear
factor-kappa B (NF-kB p65) has been shown to regulate the transcription o f a broad range
o f genes related to inflammation in C rohns disease and ulcerative colitis (25). The current
study describes the cloning and sequence analysis o f the proximal prom oter region o f the
P 2 Y 2R gene in which we have detected the presence o f three consensus NF-kB binding
sites. Our results also demonstrate that NF-kB p65 stimulates P 2 Y 2R transcription in
colonic epithelial cells under pro-inflammatory conditions. Finally, we dem onstrated that
upregulation and activation o f the P 2 Y 2R lead both to an increase in COX-2 expression and
in PGE 2 released by IECs.

44

12. Materials and Methods

Reagents
Dulbeccos modified Eagles medium (DM EM ), Eagles minimum essential medium
(EMEM), F I2 medium, penicillin-streptomycin, HEPES and fetal bovine serum (FBS)
were purchased from W isent (St. Bruno, QC). FBS was inactivated by heating at 50C for
60 min. Optim-MEM and glutamine (GlutaM ax) were from Invitrogen (Burlington, ON).
Dextran sulfate sodium (DSS3; Mr 36,000-50,000) was obtained from MP Biochemicals
(Irvine, CA).

Lipopolysaccharide (LPS; E. coli 0 5 5 :B5) and IL-6 were purchased

respectively from Calbiochem (San Diego, CA) and BioShop Canada, Inc. (Burlington,
ON).

Mouse monoclonal anti-NF-xB p65 antibody was purchased from Santa Cruz

Biotechnology, Inc. (Santa Cruz, CA). Rabbit anti-acetyl-Flistone H3 (lys 14) polyclonal
antibody and rabbit anti-acetyl-Histone H4 (lys 8) polyclonal antibody were from Millipore
(M illipore, Mississauga, ON).

Mouse anti-COX-2 monoclonal antibody was purchased

from Caymen Chemical Co. (Burlington, ON). Prostaglandin E 2 (PGE 2) assay kits were
obtained from R&D system (Burlington, ON). The pGL4.10 and pcDNA3.1 vectors were
purchased, respectively, from Promega (M adison, WI) and Invitrogen (Burlington, ON).
The pcDNA3.1/NF-KB p65 construct was kindly provided by Dr. Marc Servant (Universit
de Montreal, Facult de Pharmacie, Quebec, Canada).

Cell Culture
Human coronary artery endothelial cells (HCAEC3; ATCC# CRL-2266) were cultured, as
previously described (26). The human colon carcinoma cell line Caco-2 (ATCC #HTB-37)
and the non-cancerous rat intestinal epithelial cell line IEC-6 (ATCC, CRL-1592) were
grown as previously described (10, 27). Cells were incubated in serum free medium for 24
h at 37C prior to experiments. W hen indicated, 0.5% (w/v) DSS, (10 ng/m l) IL-6 or (12.5
pg/ml) LPS were added to Caco-2 or IEC-6 cells for the specified time period to induce a
pro-inflammatory response, as previously described (10, 28, 29).

Real-time PCR quantification

45

Total RNA was isolated from Caco-2 and IEC-6 cells with the Totally RNA Kit
(Ambion, Auston, TX) according to the m anufacturers instructions. Com plem entary DNA
(cDNA) was then synthesized from 2 pg o f purified RNA by reverse transcription using the
Superscript II system (Invitrogen). Five percent o f the synthesized cDNA was used as a
template for real-time PCR using the QuantiTect SYBR green PCR Kit (Qiagen,
Mississauga, ON) and the Stratagene M x3000P QPCR System. The sequence-specific
primers for P 2 Y 2R, COX-2 and TBP3 (TATA-binding protein) are listed in Table 1
(supplemental).

Primer Extension Reaction

Single-stranded

43-m er

CTCTCGCCACTGCGCTG

anti-sense

oligonucleotide

(10

pm ol)

5-

CGCTTCTCCTCTCAGGGTGCCGTCGC-3 (Tm=75.3C)

corresponding to exon 1 in the P 2 Y 2R gene sequence was designed and chemically

synthesized, and end-labeled using polynucleotide kinase from Promega and [y-32P]EasyTides adenosine 5'-triphosphate from Perkin Elm er (Boston, MA). Labeled primers
( 1 pmol) were hybridized for 20 min with 5 pg o f polyA+ RNA isolated from HCAECs and
AMV3 reverse transcriptase was added for 30 min at 41C to yield the corresponding
cDNA. AMV reverse transcriptase was inactivated by incubating all samples at 90C for
10 min. The resulting products were analyzed on an 8% (w/v) polyacrylam ide denaturing
gel. Kanamycin-positive mRNA (1.2 kb) from the Promega kit was used with a
corresponding

primer

as

positive

control.

The

negative

control

included

diethylpyrocarbonate-treated water instead o f mRNA in the reaction.

5 RLM-RACE
The transcription start site (TSS3) o f the human P 2 Y 2R gene was determ ined using the
RNA ligase-mediated rapid amplification o f 5 cDNA ends (5' RLM -RACE) with the
FirstChoice RLM-RACE kit following the manufacturer's instructions (Ambion). Briefly,
total RNA was isolated from Caco-2 cells using the RNeasy kit (Qiagen) according to the
manufacturers instructions and 10 pg o f RNA was treated with alkaline phosphatase to
remove phosphate groups on degraded mRNA, rRNA, tRNA and DNA. RNA was then

46

treated with tobacco acid pyrophosphatase to remove the cap from full-length nascent
transcripts.

Then, a RACE prim er was ligated to phosphorylated uncapped transcripts.

Reaction products were reverse transcribed using Superscript III reverse transcriptase
(Invitrogen) and the oligonucleotide dT20. M odified cDNA was subjected to PCR analysis
using the PCR primer hY2R4 (supplemental data - Table 2) and outer prim er detecting the
5-RACE adapter (Ambion). The generated PCR products were reamplified in a second,
nested PCR using the inner prim er detecting the 5RACE adapter and one o f the hY 2R l
and hY2R3 primers (Table 2, supplemental).

All PCR amplifications were perform ed

using the Expand High Fidelity PCR system (Roche, Laval, QC).
cloned into pCRII-TOP using the TOPO cloning kit (Invitrogen).
fragments were identified by automatic

DNA

PCR products were

The cloned DNA

sequencing (ABI 3730x1; Applied

Biosystems) using the M l3 oligonucleotide provided by the TOPO cloning kit.

Human P2Y2R promoter cloning and constructs

Human genomic DNA, isolated from human intestinal epithelial cells using the DNeasy
Tissue kit (Qiagen), was kindly provided by Dr. Nathalie Rivard (Universit de
Sherbrooke, Dpartement d Anatomie et Biologie Cellulaire, Quebec, Canada). The human
P 2 Y 2R promoter, -1572 bp to +93 bp relative to the putative TSS, was PCR-amplified from
the human genomic DNA using the prP2Y2/NheI forward and prP2Y2/BglII reverse primers
(Table 3, supplemental).

The PCR fragment was cloned into the pGL4.10 expression

vector (Promega) upstream of the luciferase gene (prP2Y2-luc). Deletion mutants o f the
P 2 Y 2R promoter were generated by PCR amplification with the following oligonucleotides
(Tables 3 and 4, supplemental): prP2Y2A-350bp and prP2Y2/BglII prim ers for deletion o f 1572 bp to -351 bp; prP2Y2A-784bp and prP2Y2/BglII prim ers for deletion o f -1572 bp to 785 bp, and prP2Y2A-l 165bp and prP2Y2/BglII prim ers for deletion o f -1572 bp to -1166
bp.

The PCR fragments were cloned into the pGL4.10 expression vector (Promega)

upstream o f the luciferase gene.

Deletions within the prP2Y2A-350bp mutant were

generated by restriction enzyme digests with StuI (-273 bp) (prP2Y22A-350bp/StuI), Pmll
(-33 bp) (prP2Y2A-350bp/PmlI) and Nhel (-350 bp). Deletion o f the putative N F-kB p65
binding m otif (NBM3) in the prP2Y2A-350bp construct was done by overlap extension

47

PCR by replacing those 10 bp by a scrambled nucleotide sequence, as previously described

(27).

The upstream amplification was performed with the prP2Y2/NheI oligonucleotide

primer (Table 3, supplemental) and either the prP2Y2ANBM l, prP2Y2ANBM2 or

prP2Y2ANBM3 primer (Table 5, supplemental).

The downstream amplification was

performed with the prP2Y2A N BM lR, prP2Y2ANBM2R or prP2Y2ANBM 3R (Table 5,

supplemental) and the prP2Y2/BglII (Table 3, supplemental) primers.

Products resulting

from these two PCRs were used DNA templates for the final PCR using the prP2Y2/NheI
and prP2Y2/BglII oligonucleotides. The PCR fragments were then cloned into the pGL4.10
luciferase vector. The presence o f the mutations was verified by sequence analysis (McGill
University and Genome Quebec Innovation Center).

Transient transfections and luciferase assays

Caco-2 cells, at 80% confluence, were seeded in 24-well plates for 24 h. The next day, 1 h
before transfection, complete DM EM was replaced by 300 pi o f O pti-M EM (Invitrogen),
free o f antibiotic and antimycotic. Cells were co-transfected using LipofectAM INE 2000
(Invitrogen) with 0.1 pg o f pcDNA3.1/NF-icB p65 and 0.1 pg o f the different P 2 Y 2R
promoter constructs or 0.1 pg o f pGL4.10 (control). After 6 h o f transfection, the OptiMEM was replaced with complete DMEM. Two days after transfection, luciferase activity
was measured, as previously described (10). In some experiments, cells were stimulated
with DSS at a final concentration o f 0.5% (w/v) for 6 h prior to measuring luciferase
activity. Results are expressed as fold induction compared with control (pcDNA3.1/NF-icB
p65 + pGL4.10) values, normalized to Renilla luciferase expression.

Chromatin immunoprcipitation assays

Chromatin immunoprcipitation assays were performed using the EZ ChIP assay kit
protocol (Upstate, Lake Placid, NY, USA).

Briefly, 80% confluent Caco-2 cells were

cross-linked with 1% (v/v) formaldehyde for 10 min at 37oC. Following cross-linking,

chromatin was sheared and immunoprecipitated with 5 pg o f mouse anti-NF-xB p65
polyclonal antibody (Santa Cruz Biotechnology) or 5 pg o f rabbit anti-acetyl-Histone H3
(lys 14) polyclonal antibody or 5 pg o f rabbit anti-acetyl-Histone H4 (lys 8) polyclonal

48

antibody (M illipore). Five pg o f normal mouse or normal rabbit IgG (Upstate) was used as
a negative control. For Re-ChIP assays, a second immunoprcipitation was conducted with
5 pg o f rabbit anti-p300 polyclonal antibody, after eluting the immunoprecipitated NF-kB
p65-DNA complex from the G protein agarose beads.
before

immunoprcipitation)

was

used to

verify

Input (ten percent o f the lysate

the

amount o f DNA

in

each

immunoprcipitation. Immunoprecipitated DNA was purified and am plified by real-time

PCR using the QuantiTect SYBR green PCR Kit (Qiagen) and the Stratagene M x3000P
QPCR System with P 2 Y 2C upstream and downstream oligonucleotide prim ers amplifying
the -221bp to -105bp (Table 6, supplemental). Data are expressed as fold increase over
background (negative control) normalized to input as proposed by SuperArray Biosciences
and adapted as described (w ww.workingthebench.com).

Electromobility shift assay (EMSA)

Nuclear proteins were obtained, as previously described (27). EMSA assays were carried
out using 7.5 pg o f nuclear protein extracts, and 3.5 x 104 cpm o f 5' end-labeled [y-32P]ATP double-stranded oligonucleotides (Table 7, supplemental) in the presence o f 50 ng
poly(dl-dC) (Roche) in buffer D (5 mM HEPES, 10% (v/v) glycerol, 0.05 mM EDTA,
0.125 mM PMSF). DNA-protein complexes were separated on a non-denaturing 5% (w/v)
polyacrylamide gel run against Tris-glycine buffer, as described (30).

In supershift

experiments, 3 pg o f mouse monoclonal anti-NF-xB p65 antibody was used per sample and
added 20 min prior to the addition o f the radiolabeled probes. In competition experiments,
1OX or 100X o f the unlabeled probe NBM2 was added to the sample at the same tim e o f
labeled probe. Gels were dried and autoradiographed on an Imaging Screen-K (Kodak) for
18 h and imaged using a Bio-Rad M olecular Imager FX apparatus and data were acquired
using Quantity One software from Bio-Rad.

W estern immunoblotting
After nucleotide stimulation, Caco-2 cells were lysed and processed as previously
described (10).

Samples were subjected to 7.5% SDS-PAGE, and transferred to PVDF

membranes for protein immunoblotting, as previously described (10). Im m unoblotting for

49

human COX-2 was performed using a 1:750 dilution o f mouse monoclonal anti-COX-2.
Specific protein band on membranes were detected using a 1:10,000 dilution o f HRPconjugated anti-mouse as the secondary antibody and visualized on autoradiographic film
using the Millipore chemiluminescences system. Normalization o f the signal was realized
as previously described (10).

Quantification o f PGE 2 released by IECs.

PGE2 released was quantified using the PGE 2 assay kit from R & D systems. Caco-2 cells
were stimulated with 100 pM ATP or UTP for 24h. Cell m edia were collected, cleared o f
debris and used for PGE 2 assays as recommended by the manufacturer.

Statistical analysis
Results are expressed as the mean standard error o f the mean (SEM).

The statistical

significance was determined by performing an unpaired t or ANOVA tests as described in

figure legends.

The numbers o f replicates for each experiment are presented in figure

legends.

13. Results
P 2 Y 2R expression is increased in Caco-2 and IEC-6 intestinal epithelial cells under
inflammatory-like conditions.
Recently, we showed that P 2 Y 2R mRNA expression was increased in colonic tissues o f
patients suffering from Crohns disease and ulcerative colitis (10). Sim ilar observations
were made in colonic epithelium o f mice in which intestinal inflammation was induced by
adding DSS to the drinking water (10). Using real-time PCR, we found that addition o f
DSS for 3 to 6 h to Caco-2 intestinal epithelial cells causes more than a 2-fold increase in
level o f P2Y2R mRNA (Fig. 1A). In addition, treatment o f Caco-2 cells with LPS 12.5
pg/ml resulted in a 8-fold increase in level o f P 2 Y 2R mRNA after 24 h (Fig. IB ) which was
also confirmed in a normal intestinal epithelial cell line, IEC-6, which resulted in more than

50

7-fold increase in level o f P 2 Y2R mRNA after 12 h (Fig. ID). Moreover, treatm ent o f IEC6 cells with IL-6 (10 ng/ml) causes an increase o f more than 2.5-fold in level o f P 2 Y2
mRNA after 18 h (Fig. 1C).

05h

Ik
3h
DSS (0.5% w *)

<h

IS

2
s?
I ! 10

II

E.

> 1T

1
se

in

24k

LPS (12 5 pB'ml)

IL -6 (IO a s rn f)

LPS <12-5

FIG U R E 1. P 2 Y 2 receptor mRNA expression in intestinal epithelial cells is enhanced by

pro-inflammatory stimuli. P 2 Y 2R mRNA expression was determined by quantitative RT-

51

PCR in confluent IEC-6 and 3-days post-confluent Caco-2 cells. A, B) Increases in mRNA
expression were significant after a 3 and 6 h incubation with 0.5% (w/v) dextran sulfate
sodium (DSS) and 24 h incubation with 12.5 pg/m l LPS in Caco-2 cells. C, D) Increases in
mRNA expression were significant after 12 h incubation with 12.5 pg/m l LPS and 18 h
treatment with 10 ng/ml IL-6 in IEC-6 cells. Data are expressed as P 2 Y 2R mRNA
expression induced by stimuli relative to the untreated control (ctrl). Results were
normalized to the expression o f TBP mRNA. Values are the means SEM o f results from
three separate experiments done in duplicate. Statistical significance was determined by
unpaired t test, where *p < 0.05 and **p < 0.01, as compared to crtl.

Localization o f the transcription start site (+1) o f the human P 2 Y 2R.

We used prim er extension analysis to identify the potential transcription start site (TSS) in
the P 2 Y 2R gene using mRNA extracted from human coronary artery endothelial cells
(HCAECs). The single-stranded 43-m er oligonucleotide used was highly specific for
P 2 Y 2R mRNA exon 1. The expected cDNA product size was 134 bp when the P 2 Y 2R TSS
conformed to transcripts arrived at for P 2 Y 2R mRNA by in silico analysis (31). The
positive control was a 1.2 kb kanamycin-positive in vitro product that was expected to give
a product size o f 84 bp. The chief cDNA products obtained by prim er extension were
smaller (57 bp and 84 bp) and larger (200 bp) than predicted (supplemental data, Fig. 1A).
More than one TSS has been known to be associated with TATA-less promoters (32, 33).
However, formation o f products due to secondary structures in m RNA in the primer
extension reaction cannot be ruled out. To confirm and delineate the TSS, we used RLM RACE and nested PCR assays with Caco-2 cells (supplemental data, Fig. IB).

RLM-

RACE is a more sensitive method than prim er extension analysis since it removes
uncapped mRNA, DNA and other non-m RN A molecules by treatment o f the RNA sample
with calf intestine phosphatase (34, 35).

Electrophoretic analysis o f the nested PCR

amplification products revealed that Caco-2 cells express only variant 2 o f the human
P 2 Y 2R mRNA and a single TSS, as shown by the presence o f a single band for both clones
analyzed from the nested PCR assays with hY 2R l and hY2R3 oligonucleotide primers
(supplemental data, Fig. IB). Sequence alignment o f representative clones obtained from
the nested PCR with the 5 -UTR sequence o f human P 2 Y 2R (variant 2; NM 002564)
allowed us to localize the TSS (+1) 72 nucleotides downstream from the first nucleotide o f
the published P 2 Y 2R gene sequence, as indicated in supplemental - Fig. 1C. We also found

52

a mutation at +32 where a thymine (T) was replaced by a cytosine (C) residue, as indicated
by the arrowhead (supplemental data, Fig. 1C). Finally, the translation start point (ATG)
was located at position +262, as indicated by the bold letters (supplemental data, Fig. 1C).
We aligned the sequence o f the promoter from the two different cell types and identified by
computational analysis potential binding sites for Spl and NF-kB (supplem ental data, Fig.
2). The P 2 Y 2R promoter o f these cell types is 99.2% identical.

Chromatin is decondensed at the P 2 Y 2R prom oter region.

Modifications o f histone tails are known to facilitate or hinder accessibility o f transcription
factors to their binding sites in promoter regions o f genes by promoting condensation or
decondensation o f the chromatin (36, 37). One o f the modifications that is o f significant
importance to enhanced transcription o f genes is the actylation o f histone H3 and H4 (37).
We performed ChIP assays to immunoprecipitate histones H3 and H4 with respectively
anti-acetyl-Histone H3 (ly s l4) and anti-acetyl-Histone H4 (lys 8 ) antibodies followed by
real-time PCR amplification to identify those specific actylations o f histones H3 and H4
(supplemental data, Fig. 3). Actylation o f these two lysine residues is associated with
active gene transcription and more particularly with genes that are transactivated by NF-kB
p65 (38). Results indicated a 4.6- and 2.3-fold increase in acetylated histone H3 (on lys 14)
and acetylated histone H4 (on lys 8 ), respectively, over background from the negative
control (mouse IgG) normalized to input.

NF-kB p65 regulates the expression o f the P2Y 2R.

To determine whether NF-kB p65 regulated P 2 Y 2R expression, we first verified the
presence o f potential NF-kB p65 DNA-binding sites in the proximal P 2 Y 2 R human
promoter using computer analysis (Fig. 2A). We identified multiple putative N F-kB DNAbinding sites by the characteristic GGG(A/G)NN(T/C)(T/C)CC consensus sequence (39).
We then cloned -1572 to +93 bp o f the proximal human P 2 Y 2R promoter in the luciferasecontaining pGL4.10 vector to assess the transcriptional activity in response to NF-kB p65
expression under basal and stress-like conditions (Fig. 2B). P 2 Y 2R prom oter transcriptional
activity was increased 2 -fold under basal conditions, as compared to the absence o f

53

promoter (Fig. 2B, p < 0.01) but increased to more than 7-fold in response to DSS (Fig. 2B,
p < 0.05).

To delineate the P 2 Y 2R promoter region required for N F-kB p65-dependent

induction, we compared the P 2 Y 2R prom oter transcriptional activity to the 5 -deletion

mutants prP 2 Y 2A-l 165, prP2Y2A-784 and prP2Y2A-350.

Surprisingly, none o f the

prP 2 Y 2R deletion mutant constructs showed decreased luciferase activity in response to

NF-kB p65 expression (Fig. 2C), suggesting that the prom oter region and potential NF-kB
DNA binding sites located upstream o f nt -350 are not involved in the regulation o f the
P 2 Y 2R gene expression. In contrast, further deletion downstream o f -350 bp site abolished
P 2 Y 2R transcriptional activation, as compared to the full-length P 2 Y 2R and P2Y2A-350
promoter constructs (Fig. 2D). These data indicate that the promoter region between -273
and -33 nt is essential for NF-kB p65-dependent P 2 Y 2R transcriptional regulation.

To

prove that NF-kB is involved in the transcriptional regulation o f the P 2 Y 2R gene, we

specifically mutated 3 potential NF-kB DNA binding motifs in the P 2 Y 2R prom oter region
using the oligonucleotide primers NBM1 (-278 to -269), NBM 2 (-181 to -172) and NBM3
(-135 to -126), as shown in Fig. 2A.

M utation o f NBM2 significantly reduced the

luciferase activity o f the minimal P2Y2A-350-Luc promoter construct by more than 60%,
whereas mutation o f NBM1 and NBM3 had no effect on luciferase activity (Fig. 2E),
suggesting a role for NBM2 in the transcriptional regulation o f P 2 Y 2R expression by NFkB. We also have identified other potential binding sites for transcription factors in the
P 2 Y 2R promoter region, such as SP1 (supplemental data, Fig. 2) that rem ain to be
characterized.

54

-II* *

-1572*

-7 1 4 *

-1200*
'''Nun!

-U S *

NBM2

NBM)

-271 Is -200

- III W -172 -1)5 -12*

KO*

200 *

-100*

I*

- J*

10

, *
i*
;

p fK Y A -ll* )

I *
1

mA

DSS O SS

NF-dtyS
ptWY.-fat
pOM.IO

prfjYjA-TM
ptf2Yj-330

"I............

0.5
|.0
Lactfcnac actmty
(FU vanatMa over M l le a f* promoter)

K)

pRY-A-UBSM

"T

oi

1.0

ij

L a c tfe ra a c a c t m t y

(FoU vanaooa over M l leaf'll promoter)

/////

t///

FIGURE 2. N F-kB p65 transactivates the P 2 Y2R promoter region under basal conditions
and this transactivation is enhanced following DSS-induced stress in Caco-2 cells. A)
Schematic representation o f the P 2 Y2R promoter constructs. B) Subconfluent Caco-2 cells
were transiently cotransfected with the P 2 Y2R promoter-luciferase construct (prP2Y2-luc)
and the N F-kB p65-expressing vector or the empty pG L4.10 vector (control). Cells were
incubated with or without 0.5% (w/v) DSS for 6 h and luciferase activity was assayed after
48 h. C) Subconfluent Caco-2 cells were cotransfected with the P 2 Y2R promoter-deletion
luciferase constructs prP2Y2A-350bp, prP2Y2A-784bp or prP2Y2A-l 165bp and the NF-kB
p65-expressing or control vector. D) Subconfluent Caco-2 cells were cotransfected with
the P 2 Y2R promoter-deletion luciferase constructs prP2Y2A-350/PmlI or prP2Y2A-350/StuI
and the NF-kB p65-expressing or control vector. E) prP2Y2ANBM l, prP2Y2ANBM2,
prP2Y2ANBM3, P 2 Y2R full-length promoter constructs or prP2Y2A-350bp promoter
construct were transiently cotransfected with the N F-kB p65-expressing or control vector.

55

Luciferase activity is expressed as the fold increase relative to the activity o f the empty
vector cotransfected with the NF-kB p65-expressing vector. Data are the means SEM o f
results from at least 4 separate experiments done in triplicate. Statistical analysis was
performed by an ANOVA test, where *p < 0.05 and **p < 0.01, as com pared to respective
controls and indicated on the figures. In panel E, s s p < 0 .0 1 , as compared to empty vector
control (EV).
We verified by electrophoretic mobility and supershift assays, the ability o f labeled NBM 1,
NBM2 and NMB3 double-stranded oligonucleotides to bind NF-kB p65 in Caco-2 nuclear
extracts (Fig. 3A).

O f the three NBM sites, the NBM 2-protein complex was the major

complex supershifted by a NF-kB p65 antibody (Fig. 3A). We also did a com petition assay
using unlabeled NBM 2 probe with NBM2 labeled probe and observed alm ost complete
diminution o f the intensity o f the labeled protein-DNA complex in the presence o f 100X o f
unlabeled probe (Fig. 3B).

Thus, NF-kB p65 interacts in vitro with the NBM 2 -

181GCGGCGTC CC-172 sequence.

To assess whether NF-kB p65 bound the NBM2

DNA-binding site o f the minimal P2 Y 2R promoter in vivo, we perform ed a chromatin

immunoprcipitation assay with Caco-2 genomic DNA (Fig. 3C) and showed that NF-kB
p65 binds the -221 to -105 P 2 Y 2R promoter region encompassing the NBM 2 DNA-binding
site. Following real-time PCR, we quantified a 2-fold increase in the binding o f N F-kB p65
to this region, as compared to the negative control (mouse IgG). We also did a re-ChIP
assay (Fig. 3C) in which the second immunoprcipitation was achieved with an antibody
against p300. The p300 protein is a coactivator with an histone acetyltransferase (HAT)
activity that can bind to and acetylate NF-kB p65 or histones directly or indirectly by the
recruitment o f other HATs, thereby decondensing chromatin to enhance the transactivation
o f genes regulated by NF-kB (40, 41). Using real-time PCR amplification we determined
that approximately half o f the immunoprecipitated p65 is bound to p300 (Fig. 3C).

Activation o f P 2 Y 2R stimulates COX-2 expression and PGE 2 released by IEC.

In normal intestine, COX-1 is expressed constitutively in epithelial cells where it is
associated to intestinal mucosa homeostasis (42). On the opposite, COX-2 is expressed at
low basal level under normal condition, but its expression is rapidly upregulated by proinflammatory molecules (43).

COX-2-dependent arachidonic acid metabolites, such as

PGE 2, can modulate the inflammatory response o f the intestinal m ucosa (43-45).

56

Stimulation o f COX-2 expression and PGE 2 released through P 2 Y 2R activation have

previously been reported in other systems (46-48), but it has never been associated to the
increase o f P 2 Y 2R expression as observed during intestinal inflammation. In this context,
we showed that P 2 Y 2R activation by ATP (Fig. 4A) or UTP (Fig. 4B) significantly
increased the expression o f COX-2 mRNA after only 30 m in and sustained for up to 60
min. It also increased the expression o f COX-2 at the protein level as soon as 3 h following
stimulation o f P 2 Y 2R (Fig. 4C) in Caco-2 intestinal epithelial cells. The P 2 Y 2R-dependent
increase o f COX-2 expression correlated with PG E 2 released by Caco-2 cells in response to
ATP and UTP stimulation (Fig. 4D). PGE 2 released was stimulated by more than 2 fold in
response to ATP and UTP when compared to non-stimulated Caco-2 cells (Fig. 4D).

57

c >

2-5 - ,

' ...""I...
N F - B p A 5

pJOO

FIGURE 3. N F- k B p65 binds to the P 2 Y2R prom oter sequence. A) N uclear extracts from
Caco-2 cells were incubated with the putative [y- P]ATP-labeled N F - k B p65 DNAbinding site probes NBM1, NBM 2 or NBM 3 and anti-NF-KB p65 antibodies for
electrophoretic mobility and supershift assays. DNA-protein complexes were separated
from the free probe on a native polyacrylam ide gel. N F - k B p65 D NA-binding and
supershifted complexes are indicated by the arrow. B) Nuclear extracts from Caco-2 cells
were incubated with the putative [y-32P]ATP-labeled N F - k B p65 DNA-binding site probe
NBM2 and 10X or 100X o f unlabeled NBM2 for electrophoretic mobility and competition
assays.
DNA-protein complexes were separated from the free probe on a native
polyacrylamide gel. Results are representative o f three independent experiments. N F - k B
p65 DNA-binding complex is indicated by the arrow.
C) Chromatin was
immunoprecipitated with or without rabbit IgG antibody or anti-NF-KB p65 antibody. The
re-ChIP assay was performed with anti-p300 antibody following the first

58

immunoprcipitation with anti-p65 antibody. Samples were verified by quantitative RTPCR analysis with oligonucleotides amplifying the -221 bp to -155 bp region o f the P 2 Y2R
promoter and expressed as fold increase over normal rabbit IgG normalized to input.
Representative results from 3 independent experiments are shown.

14. Discussion
We recently reported the upregulation o f P 2 Y 2R mRNA in the colonic tissues
isolated from patients suffering from IBDs (10). Similar observations were also made in
colon isolated from mice suffering from chemically induced colitis (10).

It is well

described that immune cells, such as neutrophils and monocytes/macrophages, expressed

numerous P2 nucleotide receptors among which the P 2 Y 2R (49). As for many diseases,
IBDs are characterized by an increasing number o f infiltrating

neutrophils

and

monocytes/macrophages that could have contributed to the observed increased in P 2 Y 2R

transcript expression previously described (10).

In the present study, we demonstrated

using the adenocarcinoma-derived Caco-2 cells and the non-cancerous IEC - 6 cells that the
increased expression o f the P 2 Y 2R transcript could be attributable in part to the
upregulation o f receptor expression by IECs (Fig. 1).

This increase in P 2 Y 2R mRNA

expression and function has been associated to enhanced tissue dam ages as reported in
Sjogrens syndrome-like phenotype in mice (14, 50), chronic pancreatitis (13) and the
induction o f intimai hyperplasia in an animal model o f human atherosclerosis (15, 51).
More recently, P 2 Y 2R increased expression and function in rat prim ary cortical neurons
have been associated to the a-secretase-dependent processing o f amyloid precursor protein,
a well described molecule involved in neurodegenerative disorders (52).

In addition,

P 2 Y 2R activation, in A549 alveolar type II epithelial cells, stimulated the expression o f

COX-2 and PGE 2 production that were associated to airway inflammation (46). Despite
these numerous reports describing the upregulation o f P2 Y 2R expression and function in
inflammatory diseases and the apparent contribution o f a NF-icB-dependent mechanism
(52), there are no data describing how P 2 Y 2R gene expression is regulated.
In this report, we identified, cloned and characterized the prom oter region o f the
human P 2 Y 2R gene, from -1572 bp to +93 bp. In addition, we have associated the increase
in P 2 Y 2R expression to the stimulation o f COX-2 expression and PGE 2 released by IECs.

59

N F - kB p65 is one o f the prototypic transcription factors associated with inflammation

under a number o f pathophysiological conditions (25). N F - kB p65 activation is related to

the transcriptional regulation o f a number o f proteins involved in the inflammatory
response, such as cytokines and cell adhesion molecules. Thus, it is appropriate that this
transcription factor was found to regulate the transcription o f the P 2 Y 2R gene under both
basal and pro-inflammatory conditions. We localized a potential N F - k B p65 binding site
on the human P 2 Y 2R promoter region and showed that this region is transcriptionally active
by measuring histones H3 and H4 actylation o f lysine 14 and 8 , respectively (37, 41, 53).
Moreover, the specific actylation o f histones H3 and H4 are associated with N F - k Bregulated genes that are transcriptionally active (38). Since we are interested in N F - k B p65
transactivation

potential,

we

also

looked

at

p300,

coactivator

with

histone

acetyltransferase activity that increases transcription factor actylation and accessibility to

the DNA (53). Using re-ChIP assay, we determined that p65 and p300 are associated with
the P 2 Y 2R promoter. Accordingly, it was reported that p300 can be associated with the p65
subunit o f N F - kB and promote transcription o f genes targeted by N F - kB by acetylating
histones, recruiting other HATs, or acetylating N F - k B p65 (54) to enhance the
transcriptional activity and the DNA binding o f N F- kB p65 (40).
The determination o f the transcription start site (TSS) o f the P 2 Y 2R prom oter by
primer extension assays using polyA+ RNA isolated from HCAECs and confirmed by
5 RLM-RACE using Caco-2 cells RNA allowed us to focus on a putative promoter region
o f 1572 bp upstream o f the + 1 bp site in the P 2 Y 2R gene. In both assays, regardless o f the
different nature o f the cells, we were able to pinpoint the TSS to the same area o f the
promoter. The difference o f approximately 11 bp in nucleotide localization is due to the
nature o f the methods used, RLM -RACE being a more sensitive m ethod than primer
extension.

Many TATA-less promoters contain multiple GC-rich sequences that are

recognized by the transcription factor Spl (55).

S pl can recruit the TFIID complex to

initiate the assembly o f the transcriptional machinery.

By computational analysis

(Supplemental Data, Fig. 2), we identified three potential Spl binding sites 50 bp upstream
o f the P 2 Y 2R TSS. Further studies will be necessary to define the role o f these potential
binding sites, since multiple Spl elements can act independently or synergistically to
promote gene transcription (55).

60

J t

$.<*>

3
4
UTP(100nM)

0)

ATP(IOO|iM)

ctrt

0.3

72k0>
if BM*

t rig fl

FIGURE 4. ATP and UTP stimulate COX-2 expression and PGE 2 released by Caco-2.
Addition o f 100 pM ATP (A) or UTP (B) rapidly stimulated the mRNA expression o f
COX-2 in Caco-2 cells. C, Caco-2 cells were stimulated w ith 100 pM ATP or UTP for 0
(control; Ctrl), 3, 6 , 18 and 24 h. COX-2 protein expression was detected by W estern
analysis. D, PGE 2 released in the cell culture m edia was determined after a 24 h
stimulation o f Caco-2 cells with lOOpM o f ATP or UTP. For panels A, B and D, data are
the means SEM o f results from 3 separate experiments done in duplicate. Statistical
analysis was performed by an unpaired t test, where *p < 0.05; **p < 0.01 and *** p <
0.001, is comparison to unstimulated cells (ctrl). Panel C presented blot is typical o f three
separate sets o f experiments.
Truncation o f the 5 -region o f the P 2 Y 2R promoter has allowed us to identify the
region between -273 and -33 nt as important for transactivation o f P 2 Y 2R gene expression
by the transcription factor NF-kB p65. We then conducted computational analysis o f this

61

promoter region and indeed found three potential NF-kB binding sites (NBM 1-3).
specific

mutations

o f these

NBMs

in the

P2Y2A-350bp promoter

Site-

followed

by

cotransfection with NF-kB p65 in Caco-2 cells further supported the postulate that NBM2
is a binding site for NF-kB. Actually, mutation o f the NBM 2 site resulted in a decreased
luciferase activity o f more than 50%. This result was confirmed by EM SA experiments
which demonstrated that p65 interacts strongly in vitro with NBM2, as compared to NBM1
and NBM3.

ChIP assays revealed that p65 binds to the region (-221bp to -105bp) that

contains the NBM2 motif. Interestingly, transactivation o f the P 2 Y 2R prom oter by NF-GB
p65 occurs under both basal and pro-inflammatory conditions. Our results suggest that the
induction o f inflammation in intestinal epithelial cells allows nuclear translocation o f NFkB p65 and leads to an increased transactivation o f the P2Y2R promoter and subsequently
the upregulation o f P 2 Y 2R mRNA. These results are in agreement with recently published
data demonstrating that a 24h stimulation o f rat prim ary cortical neurons w ith IL -ip
induced P 2 Y 2R mRNA expression possibly through a NF-KB-dependent mechanism (52).
To circumvent the cancerous nature o f Caco-2 cells, we used the non-cancerous intestinal
epithelial cell line IEC - 6 and measured an increased in P 2 Y 2R mRNA expression following
IL - 6 or LPS stimulation.

These results are thus confirming that P 2 Y 2R transcript

expression is upregulated in IECs under an inflammatory insult.

We have associated the increase in P 2 Y 2R expression and function to the
stimulation o f COX-2 expression and PGE 2 released by IECs (Fig. 4). In the intestine, the
role o f COX-2-dependent generation o f arachidonic acid metabolites, such as the intestine
predominant PGE 2, is controversial. On one hand, PGE 2 have pro-inflammatory effects in
the acute phase o f IBD (44, 56). On the other hand, this molecule could be beneficial since
PGE 2 production in the intestine appears to have a protective effect on the integrity o f the
epithelial intestinal wall, presumably through the enhancement o f IECs survival and
regeneration (44, 56), while having a dampening effect on granulocytes infiltration (57).
In this study, we propose for the first time a promoter sequence for P 2 Y 2R that is
euchromatin accessible to transcription factors. We also show that N F-kB p65 regulates
P 2 Y 2R gene expression under both basal and pro-inflam m atory conditions. In addition, we
are proposing that P 2 Y 2R on IECs may serve two purposes. First, in the acute phase o f
inflammation, P 2 Y2R-dependent activation o f COX-2 and PG E 2 production could stimulate

62

the inflammatory response o f the intestinal m ucosa thus resulting in increasing tissue
damages but also at limiting entry o f foreign molecules to the systemic circulation, as well
as facilitating the repair o f damage tissues.

Second, in the resolution phase following

inflammation, these same molecules could enhance epithelium repair by stimulating IEC
proliferation and increasing the IECs barrier integrity (44, 56).

15. Supplemental data

A)

S)
_

hY2R1 hY2&

bp -

cDNA

soo300-

C)
*

____ _____ _____

053 544 IM rA CK -G C A O GG AlVsro^Ae^GG Gt^rXCAJM KU tCXrRtiffrrTCTQCfiSCroea
' H 3 I1

*Y261

................. r:..........................................t . . ..........

G33 56.4 (SfG *:C C SlX *C T < ylX ^X W UKiW COOCACC*CCTGAfi*CG*l**C

s r2 R 3
* C T c r a a c c m f a i i s < g r a a t x A C 0 6 C c c c * c c c ACM ng
i ,y 3 * i
> c T ^ K U C c c o a c s c c c o : a A C C c c i c c r c c K s f t a a u 3 u c c

n t 0 3 2 5 6 4 & ^ ^ O ^ T ^ S A C M I ^ C C r r C T O C A C A G C ^ T k t:c r a C C C * l3 A A M A T r ;
' 4Y 263 K A K 9 -M n t3 :6 M 3 M X 0 C C C C T t< :r^ A e c ^ ^ A C T W C T Q C C rjtG A M A T Y ;

MJKI Oi^OC*C7WC(yuU(WJWCCCCTTSrG*C*CCA:AC'TCCTlX'CCG*AA*Ar'5
k* 00356 rtc^T^'Tcwc^CTi^cTirtnfcrwTncciiiS
hfj*3 S*0CKa3GCCrt5M:CtXIW!X5rtOCGC*CCTQrTriTO.'WTrTOCCCCAilkG
h3l ncsAQSCToeoccrosci.'cciiGScrrosacACrfoTTrtTccKrrTcei.'cAAi
n t 053 56.4 rTcccTCcjuxccoiT^auwTcnjujseaTO'roakTrcATatcrcywiiAAcnccToo*

iliii.i rrc.ccwi5!xorrcc*ffrcc*awTCTcc*TTCMfi*cT4S3Juu:ocaYc
&rl rrcCCtTJkCCCi3TCakOCTCC*l5CCCTCr5C*TTCTCCTfJM3rJ5*CCCOTOCA
m 055564 cecocrcjuiCATccrGjurcT&oAOjuxAQi^recTCjooGxaaocxiicaijOJicci
Y63 03C3CTGlbEC3kTCrrClkCC-r0S*ajUIC3MiCG!iCTSCTataCSCG>Maau3CAakCC-t
i y 5 6 i c ^ o :Y ^ J v c c 6 r 7 0 J u ;c 7 G C * M ;

n t 053 564 KoixccTcauoTCArjkccArrMTixciiccrcocjkrcoccA

6Y56) (SCKTCG*TI*t6CCAKJk*TaC^.CTO^tSOKA7
M 5RI

................

........

Suppleminfal-fflgare 1. LaeaUzstSon f tiw transcription art te a f the

human K Y ^t geee. A) Primer extension analysis revealed one major transcription
start site using mRNA from human coronary artery endothelial cells (HCAECs) and
some weak intensity products of sizes from 100-230 bp. Apositive control (C+) from
the Promega lot aras included that produced a band at 94 bp. Hinf 1digested matters
(M) were used as standards to compare the sizes of the products. B) Localization of
the TSS was determined by RLM-RACE using mRNA isolated from human Caco-2
intestinal epithelial cells. Electrophoretic analysis of the nested PCR amplification
products was performed on a 2% (w/v) agarose gel using total Caco-2 modified
cDNAs. The second step of amplification was done with two different inner reverse
primers, hY2RI and hY2R3, respectively. C) Sequence alignment of representative
clones obtained after nested PCR with the 5*-UTR sequence of human P2Y,R
(NM_002564). Taro positive clones obtained with bY2R3 amplification and three
out of 12 from hY2Rl amplification were sequenced; all sequences were identical.
We localized the TSS (-*-1 site) position +72 in exon I of the previously described
P2YjR sequence (NM_002564). A mutation position +32, where a T is replaced
with a C, was also observed (arrowhead). The translation start site (ATG) is shown
in bold and the primers used for the nested PCR ate underlined, namely hY2Rl and
hY2R3.

64

C om am u
prfYJ Caco-2
pfS2Y2HCAC

C o n ta n t*
ptS2T2Ca-2
ph tch ca k

caccgoEoo
aaxK^i^aaaxKM aaasmsos(aaasaxmaacaaakt*osK.
GCAGGGGCEGGACAGGGtnAGGGIGGCGCGGIGCCIIjGGCIjCAAAGGIC

CCg^TTf^<TA(riCy/K/^/Clt^CKXXAA*ACmGOCGTCIt<iAAA
CCGCAGTOCGCCACOCAGGCACCGGGCTtiACCTGGCAAAACTITBGCGilCICtGAAA
OCEC<6IOO6COCSOCGC<COGCCCIC<CCTGCCAAAACTTTGCOGIOOGAAA
NF k B (N BM I)

ContanM
faSTT] Caco-2
PMT2HCAK

ACIQGGIMCCAOCICOnTCtAGCtnGAMGAGCC^^
ACCTCHiCIAAOOGClOOCnCTACCGIGAGGGAGOCEGGAGGCCTCCTICIOGCC

ConMmw

aiCogiGACAGCxnqaxccccgAcitr iccicsncoccAcccc^^

lf2Y2 Caco-2
pif7Y2HCAfiC

CGCOGnMGAGOncXXXGCCiaWKiriCCOCTTGOCCXCGCnAOGAOCGa
COGCAGTGACAOCSTOOCGCCCGACCCICCPin OCACCACCOGTAOGACACGCC

ACCTCTOGTAACCAOCTCCCTICTAGCGIOAGGGACCCGOOiGOCCTCCTTCTCGCC

NfkB(NBM2)
r^rrrrr^*srT rr,vrj^ J & r f ^ ^ r s jsjrj-j7Trj-srjr*m rTu-rr

Consens*
p tO m Caco-2
prfZY2HCAK

GACCCCGCGOCCTTGICGCIOCOCOGCXiICKGGAGCGGGIOGOSCGGTGICIACCC
GACCirGCGGCCTTGTCGCTCOCSGCGTCCCGGAGiCOGiGTGGCSCGGTCrCTAOCC

C om ns*
prF2Y2 Caco-2
pf2Y2 HCAEC

OCuCCCTTGACCCCGOlOCOGGCICAGICAAAAGilOOGCCCCCiCCCOCIXaOC-GO
CXUCG0GT1GAC(XICXTCCC<CGGTCMnCAAA<G1GCGCCCGC(ZXC10CC10C
COGCCGGTTGAGGOCGCTGCCAGGCTCAGTCAAAAGTCCGCCCCGCCCCCTOCCSGO

SOI

prf2Y2 Caco-2
prWYJHCAK

Gomma*
prMM Caco-2
prP2Y2 HCAtC

NFkB(NBM3)

CCtECCTTCGGGGTTCGGGAAiCAGCGCA(jG<l*OCTGGOT%CCCOOCTCCCAG<jCAC
CCCGGCTICGGCCnGGOGAACAGCOCAOOGAOO'CiGGTAOCCGCKiCTCCCAGCAe
aX00CTTOWWTT0GGGAACAGC<XAOMi<iiaiG'AOCCGG0CKCCAG*f
! '.bp rss3bp
G!GCCK1CTOCG0CTOCO(jCC<CiC>ACCCG<iC>C1OGCACCCCi(i(iAGCGGCCCiCGAC
GTGGGTCTCTCiC<jGCIGCGCGG6<CCG&G< 'CTGGCaCCCGGGAGCG&CGGCGAC

GIWXiTnCTWGaiGCGCiCGGGACCrGOGr'CCrACrCrGCJUKGGCGGCWC

Contant*
pif JYJ Caco-2
p if JY2 HCAiC

CjGCACCCrGAGA.C<iMi*ACCCiCMjCGCACiTG<jCCAf>ACGrG<jijGTC<iGGCG'rCTGcjA
GGCACCCCGACAOGAGAAGCClCACiCGCAG'GGCCiACiMiGrGGGGICiGCiGCGTOGGA
CGCACCCTGA&aGGACiAAGCGCWiCGC *r,rf<<W>(^3C.Crfiin5CiCGTCTC^

Cornant*
pif2V2 Caco-2
piP2Y2HCAiC

GGAACAAGGCG f U O b p
6G&WCAAGGCG
C-GCAACXCGCG

SUPPLEMENTAL-FIGURE 2. Schematic n p m n U d o i of the P2Y,R cor promoter arpalwrtoa. Alignment

of the core promoter sequences cloned from Caco-2 and HCAEC cells shows a homology of 99-2%. Spl and NFsfl
potential binding sites are indicated in red and purple, respectively. The green region represents I30bp of exon I.
Transcription start site found using primer extension assay is indicated in pink while transcription start site found
using 5RLM-RACE is indicated in orange. Mismatched base pairs are indicated by blue stars.

65

A c-H J (ly i 14)

A e -H 4 <ly t )

Ctrl -

SUPPLEMENTAL-F1GURE 3. Transcriptional activation of the P2Y,R gene by NF-kB

p6S is located in a chromosomic region of active transcription. Chromatin immunoprcipita
tion assays were performed on Caco-2 cell extracts. Chromatin was immunoprecipitated with a
mouse IgG antibody (Ctrl -) or antibody against acetylated histone H3 (lys 14) and H4 (lys 8).
Samples were verified by quantitative RT-PCR analysis with oligonucleotides amplifying die
-221 bp to -155 bp region o f the P2Y2R promoter and expressed as fold increase over negative
control normalized to input. Representative results from 3 independent experiments are shown.
Statistical analysis were performed an unpaired / test where *; p < 0.05 when compared to
samples immunoprecipitated with the normal mouse IgG antibody.

66

Table 1. Oligonucleotides used for Real-Time PCR o f P2Y.?R

Oligonucleotide

Sequence (5 > 3 )

P 2 Y 2R U pstream a

CGGT GG ACTT AGCTCT G AGG

P 2 Y 2R D ow nstream a

GCCTCC AG ATGGGTCT AT GA

P 2 Y2R Upstream b

ATGTCGCTTCAACGAGGACT

P2 Y 2R Downstream b

T GCCAGGTGAAACATGTAGG

COX-2 U pstream 3

TGAAACCCACTCCAAACAC

COX-2 Downstream 3

A ACTG AT GCGT G AAGT GCTG

TBP U pstream 3

T G AGGATAAGAGAGCCACGAA

TBP D ow nstream 3

G AGC AC AAGGCCTTCT AACCT

TBP Upstream b

T AT A AT CCC AAGCGGTTT GC

TBP D ow nstream b

CCCACCATGTTCTGGATCTT

Oligonucleotide primers targeting : 3 Homo sapiens; b Rattus norvegicus

Table 2. P2 Y 2R primers for RLM -RACE assays
Oligonucleotide

Sequence (5 > 3 )

hY 2Rl (296 bp to 315 bp)c

G AGC ATCCT GACCT GG AG AG

hY2R3 (371 bp to 390 bp)c

AT GGC ACCT GGG AT GGGG AT

hY2R4 (675 bp to 694 bp)c

CACCAACCTTTACTGCAGCA

c given position relative to GenBank NM 002564.2

Table 3. P 2 Y 2R promoter cloning

Oligonucleotide

Sequence (5 > 3 )

P 2 Y2/N heI (upstream)

GCTAGCCAGGAATGCAGTTTCCTCAGCTG

P2 Y2/B g lll (downstream)

AGATCTCGCCTTGTTCCCTCCAGA

Underlined are the annealing sequences

67

Table 4.
mutants

Oligonucleotides used for the construction o f P2Y2R prom oter deletion

Oligonucleotide

Sequence (5 - 3 )

P2Y2A-400bp (-359bp to -339bp)

A AGCT GGCTAGCGGCTG ACCTGGC A A A ACTTT

P2Y2A-800bp (-794bp to -774bp)

A AGCT GGCTAGC AGC AGG AAG A AGGC AG ACCT

P2Y2A-1200bp (-1172bp tp 1152bp)

AAGCTGGCTAGCCACTATGGGCTGTGTGTCCA

Underlined are the annealing sequences

Table 5. Oligonucleotides used for the deletions o f the putative NFiB-p65 binding
m otif
Oligonucleotide

Sequence (5

3 )

P2Y2ANBM1 (-290 to -260 )d

GT G AGGG AGG A ATTCCCT AGGCTTCTGGCC

P2Y2ANBM 2 (-192 t o -162)d

CTT GTCGCTGTT A ATT AAG A ATTCGCGGGT

P2Y2ANBM3 (-145 to -1 15)d

GGGCGGGTT G A ATT C ACGCGT AGGGTC AGT

Sense strands only are shown

Table 6. ChIP assays
Oligonucleotide

Sequence (5 3 )

P2Y2C Upstream (-221bp to -201bp)

ACCGGTACAGACACGCTGAC

P2Y2C Downstream (-123bp to - 104bp)

GGCGGA CTTTTGA CTGA CC

Table 7. List o f oligonucleotides used for EMSA*

Oligonucleotide

Sequence (5-> 3 ) e

NBM1 (-282 bp to -268 bp)

CCGGGA GG CCTCCTT

NBM2 (-184 bp t o -169 bp)

GGGCGGCGTCCCGGA

NBM 3 (-138 bp t o -124 bp)

GAGGGCGGTGCCAGG

e Sense strands only are shown. M utated nucleotides are underlined.

16. Acknowledgements
The authors thank Naomie Turgeon and Isabelle Frechette for their technical help w ith the
ChIP and EMSA studies as well as Dr. Cheikh I. Seye and Sophie Tousignant for critical
and careful reading o f the manuscript.

68

Disclosure: The authors have no conflict o f interest to disclose.

17. References
1.
Wallace, J. L., and P. R. Devchand. 2005. Emerging roles for cyclooxygenase-2 in
gastrointestinal mucosal defense. Br. J. Pharmacol. 145:275-282.
2.
McKay, D. M. 2005. Good bug, bad bug: in the case o f enteric inflammatory
disease does the epithelium decide? Mem. Inst. Oswaldo Cruz 100 Suppl 1:205-210.
3.
Muller, C. A., I. B. Autenrieth, and A. Peschel. 2005. Innate defenses o f the
intestinal epithelial barrier. Cell. Mol. Life Sci. 62:1297-1307.
4.
Dunne, C. 2001. Adaptation o f bacteria to the intestinal niche: probiotics and gut
disorder. Inflamm. Bowel Dis. 7:136-145.
5.
Dionne, S., F. M. Ruemmele, and E. G. Seidman. 1999. Im m unopathogenesis o f
inflammatory bowel disease: role o f cytokines and immune cell-enterocyte interactions.
Nestle Nutr. Workshop Ser. Clin. Perform. Programme 2:41-57; discussion 58-61.
6.
Panja, A., E. Siden, and L. Mayer. 1995. Synthesis and regulation o f
accessory/proinflammatory cytokines by intestinal epithelial cells. Clin. Exp. Immunol.
100:298-305.
7.
Bours, M. J., E. L. Swennen, F. Di Virgilio, B. N. Cronstein, and P. C. Dagnelie.
2006. Adenosine 5'-triphosphate and adenosine as endogenous signaling molecules in
immunity and inflammation. Pharmacol. Ther. 112:358-404.
8.
Brunschweiger, A., and C. E. Muller. 2006. P2 receptors activated by uracil
nucleotidesan update. Curr. Med. Chem. 13:289-312.
9.
Gendron, F. P., N. L. Newbold, P. A. Vivas-Mejia, M. Wang, J. T. Neary, G. Y.
Sun, F. A. Gonzalez, and G. A. W eisman. 2003. Signal transduction pathways for P2Y 2 and
P2X? nucleotide receptors that mediate neuroinflammatory responses in astrocytes and
microglial cells. Biomed. Res. 14:47-61.
10.
Grbic, D. M., E. Degagne, C. Langlois, A. A. Dupuis, and F. P. Gendron. 2008.
Intestinal inflammation increases the expression o f the P2Y 6 receptor on epithelial cells and
the release o f CXC chemokine ligand 8 by UDP. J. Immunol. 180:2659-2668.
11.
Oppenheim, J. J., and D. Yang. 2005. Alarmins: chemotactic activators o f immune
responses. Curr. Opin. Immunol. 17:359-365.
12.
Ivanova, E. P., Y. V. Alexeeva, D. K. Pham, J. P. Wright, and D. V. Nicolau. 2006.
ATP level variations in heterotrophic bacteria during attachment on hydrophilic and
hydrophobic surfaces. Int. Microbiol. 9:37-46.
13.
Kunzli, B. M., P. O. Berberat, T. Giese, E. Csizmadia, E. Kaczmarek, C. Baker, I.
Halaceli, M. W. Buchler, H. Friess, and S. C. Robson. 2007. Upregulation o f
CD39/NTPDases and P2 receptors in human pancreatic disease. Am. J. Physiol.
Gastrointest. Liver Physiol. 292:G223-230.
14.
Schrader, A. M., J. M. Camden, and G. A. Weisman. 2005. P2Y 2 nucleotide
receptor up-regulation in submandibular gland cells from the NOD.B10 mouse model o f
Sjogren's syndrome. Arch. Oral Biol. 50:533-540.
15.
Seye, C. I., Q. Kong, L. Erb, R. C. Garrad, B. Krugh, M. Wang, J. T. Turner, M.
Sturek, F. A. Gonzalez, and G. A. Weisman. 2002. Functional P2Y 2 nucleotide receptors

69

mediate uridine 5'-triphosphate-induced intimai hyperplasia in collared rabbit carotid

arteries. Circulation 106:2720-2726.
16.
Baker, O. J., J. M. Camden, R. S. Redman, J. E. Jones, C. I. Seye, L. Erb, and G. A.
W eisman. 2008. Proinflammatory cytokines tumor necrosis factor-alpha and interferongamma alter tight junction structure and function in the rat parotid gland Par-C10 cell line.
Am. J. Physiol. Cell. Physiol. 295:C 1191-1201.
17.
Baker, O. J., J. M. Camden, D. E. Rome, C. I. Seye, and G. A. W eisman. 2008.
P 2 Y 2 nucleotide receptor activation up-regulates vascular cell adhesion m olecule - 1
[corrected] expression and enhances lymphocyte adherence to a hum an submandibular
gland cell line. Mol. Immunol. 45:65-75.
18.
Seye, C. I., N. Yu, R. Jain, Q. Kong, T. M inor, J. Newton, L. Erb, F. A. Gonzalez,
and G. A. Weisman. 2003. The P 2 Y 2 nucleotide receptor mediates UTP-induced vascular
cell adhesion molecule-1 expression in coronary artery endothelial cells. J. Biol. Chem.
278:24960-24965.
19.
Braun, M., K. Lelieur, and M. Kietzmann. 2006. Purinergic substances promote
murine keratinocyte proliferation and enhance impaired wound healing in mice. W ound
Repair Regen. 14:152-161.
20.
Taboubi, S., J. Milanini, E. Delamarre, F. Parat, F. Garrouste, G. Pomm ier, J.
Takasaki, J. C. Hubaud, FI. Kovacic, and M. Lehmann. 2007. G alpha(q/l l)-coupled P 2 Y 2
nucleotide receptor inhibits human keratinocyte spreading and migration. Faseb J. 21:40474058.
21.
Ghanem, E., B. Robaye, T. Leal, J. Leipziger, W. Van Driessche, R. Beauwens, and
J. M. Boeynaems. 2005. The role o f epithelial P 2 Y( 2) and P2 Y( 2> receptors in the
regulation o f intestinal chloride secretion. Br. J. Pharmacol. 146:364-369.
22.
Kerstan, D., N. Gordjani, R. Nitschke, R. Greger, and J. Leipziger. 1998. Luminal
ATP induces K+ secretion via a P 2 Y 2 receptor in rat distal colonic mucosa. Pflugers Arch.
436:712-716.
23.
Matos, J. E., B. Robaye, J. M. Boeynaems, R. Beauwens, and J. Leipziger. 2005.
K+ secretion activated by luminal P 2 Y 2 and P 2 Y 4 receptors in mouse colon. J. Physiol.
564:269-279.
24.
Nylund, G., L. Hultman, S. Nordgren, and D. S. Delbro. 2007. P2Y 2- and P2Y 4
purinergic receptors are over-expressed in human colon cancer. Auton. Autacoid
Pharmacol. 27:79-84.
25.
Schreiber, S., S. Nikolaus, and J. Hampe. 1998. Activation o f nuclear factor kappa
B inflammatory bowel disease. Gut 42:477-484.
26.
Seye, C. I., N. Yu, F. A. Gonzalez, L. Erb, and G. A. Weisman. 2004. The P 2 Y 2
nucleotide receptor mediates vascular cell adhesion molecule - 1 expression through
interaction with VEGF receptor-2 (KDR/Flk-1). J. Biol. Chem. 279:35679-35686.
27.
Gendron, F. P., S. Mongrain, P. Laprise, S. M cM ahon, C. M. Dubois, M. Blais, C.
Asselin, and N. Rivard. 2006. The CDX2 transcription factor regulates furin expression
during intestinal epithelial cell differentiation. Am. J. Physiol. Gastrointest. Liver Physiol.
290:G310-G318.
28.
Araki, Y., H. Sugihara, and T. Hattori. 2006. In vitro effects o f dextran sulfate
sodium on a Caco-2 cell line and plausible mechanisms for dextran sulfate sodium-induced
colitis. Oncol. Rep. 16:1357-1362.
29.
Francoeur, C., F. Escaffit, P. H. Vachon, and J. F. Beaulieu. 2004. Proinflammatory
cytokines TNF-alpha and IFN-gamma alter laminin expression under an apoptosis-

70

independent mechanism in human intestinal epithelial cells. Am. J. Physiol. Gastrointest.

Liver Physiol. 287:G592-598.
30.
Laniel, M. A., A. Beliveau, and S. L. Guerin. 2001. Electrophoretic m obility shift
assays for the analysis o f DNA-protein interactions. Methods Mol. Biol. 148:13-30.
31.
Strausberg, R. L., E. A. Feingold, L. H. Grouse, J. G. Derge, R. D. Klausner, F. S.
Collins, L. Wagner, C. M- Shenmen, G. D. Schuler, S. F. Altschul, B. Zeeberg, K. H.
Buetow, C. F. Schaefer, N. K. Bhat, R. F. Hopkins, H. Jordan, T. M oore, S. I. Max, J.
Wang, F. Hsieh, L. Diatchenko, K. M arusina, A. A. Farmer, G. M. Rubin, L. Hong, M.
Stapleton, M. B. Soares, M. F. Bonaldo, T. L. Casavant, T. E. Scheetz, M. J. Brownstein, T.
B. Usdin, S. Toshiyuki, P. Caminci, C. Prange, S. S. Raha, N. A. Loquellano, G. J. Peters,
R. D. Abramson, S. J. Mullahy, S. A. Bosak, P. J. McEwan, K. J. M cKem an, J. A. Malek,
P. H. Gunaratne, S. Richards, K. C. Worley, S. Hale, A. M. Garcia, L. J. Gay, S. W. Hulyk,
D. K. Villalon, D. M. Muzny, E. J. Sodergren, X. Lu, R. A. Gibbs, J. Fahey, E. Helton, M.
Ketteman, A. Madan, S. Rodrigues, A. Sanchez, M. Whiting, A. C. Young, Y. Shevchenko,
G. G. Bouffard, R. W. Blakesley, J. W. Touchman, E. D. Green, M. C. Dickson, A. C.
Rodriguez, J. Grimwood, J. Schmutz, R. M. Myers, Y. S. Butterfield, M. I. Krzywinski, U.
Skalska, D. E. Smailus, A. Schnerch, J. E. Schein, S. J. Jones, and M. A. Marra. 2002.
Generation and initial analysis o f more than 15,000 full-length human and mouse cDNA
sequences. Proc. Natl. Acad. Sci. U S A 99:16899-16903.
32.
Suzuki, Y., H. Taira, T. Tsunoda, J. Mizushima-Sugano, J. Sese, H. Hata, T. Ota, T.
Isogai, T. Tanaka, S. Morishita, K. Okubo, Y. Sakaki, Y. Nakamura, A. Suyama, and S.
Sugano. 2001. Diverse transcriptional initiation revealed by fine, large-scale m apping o f
mRNA start sites. EMBO Rep. 2:388-393.
33.
Yang, C., E. Bolotin, T. Jiang, F. M. Sladek, and E. Martinez. 2007. Prevalence o f
the initiator over the TATA box in human and yeast genes and identification o f DNA
motifs enriched in human TATA-less core promoters. Gene 389:52-65.
34.
Volloch, V., B. Schweitzer, and S. Rits. 1994. Ligation-mediated am plification o f
RNA from murine erythroid cells reveals a novel class o f beta globin m RNA with an
extended 5'-untranslated region. Nucleic Acids Res. 22:2507-2511.
35.
Beilina, A., F. Tassone, P. H. Schwartz, P. Sahota, and P. J. Hagerman. 2004.
Redistribution o f transcription start sites within the FMR1 promoter region with expansion
o f the downstream CGG-repeat element. Hum. Mol. Genet. 13:543-549.
36.
Li, B., M. Carey, and J. L. W orkman. 2007. The role o f chrom atin during
transcription. Cell 128:707-719.
37.
Quina, A. S., M. Buschbeck, and L. Di Croce. 2006. Chromatin structure and
epigenetics. Biochem. Pharmacol. 72:1563-1569.
38.
Miao, F., I. G. Gonzalo, L. Lanting, and R. Natarajan. 2004. In vivo chromatin
remodeling events leading to inflammatory gene transcription under diabetic conditions. J.
Biol. Chem. 279:18091-18097.
39.
Sun, Z., and R. Andersson. 2002. NF-kappaB activation and inhibition: a review.
Shock 18:99-106.
40.
Chen, L. F., and W. C. Greene. 2003. Regulation o f distinct biological activities o f
the NF-kappaB transcription factor complex by actylation. J. Mol. Med. 81:549-557.
41.
Davie, J. R., and V. A. Spencer. 1999. Control o f histone modifications. J. Cell.
Biochem. Suppl. 32-33:141-148.

71

42.
Cohn, S. M., S. Schloemann, T. Tessner, K. Seibert, and W. F. Stenson. 1997. Crypt
stem cell survival in the mouse intestinal epithelium is regulated by prostaglandins
synthesized through cyclooxygenase-1. J. Clin. Invest. 99:1367-1379.
43.
Singer, II, D. W. Kawka, S. Schloemann, T. Tessner, T. Riehl, and W. F. Stenson.
1998. Cyclooxygenase 2 is induced in colonic epithelial cells in inflammatory bowel
disease. Gastroenterology 115:297-306.
44.
Sheibanie, A. F., J. H. Yen, T. Khayrullina, F. Emig, M. Zhang, R. Tuma, and D.
Ganea. 2007. The proinflammatory effect o f prostaglandin E 2 in experimental inflammatory
bowel disease is mediated through the IL-23>IL-17 axis. J. Immunol. 178:8138-8147.
45.
Stenson, W. F. 2007. Prostaglandins and epithelial response to injury. Curr. Opin.
Gastroenterol. 23:107-110.
46.
Marcet, B., F. Libert, J. M. Boeynaems, and D. Commupi. 2007. Extracellular
nucleotides induce COX-2 up-regulation and prostaglandin E 2 production in human A549
alveolar type II epithelial cells. Eur. J. Pharmacol. 566:167-171.
47.
Sun, R., N. G. Carlson, A. C. Hemmert, and B. K. Kishore. 2005. P 2 Y 2 receptormediated release o f prostaglandin E 2 by IMCD is altered in hydrated and dehydrated rats:
relevance to AVP-independent regulation o f IMCD function. Am. J. Physiol. Renal
Physiol. 289:F585-592.
48.
Welch, B. D., N. G. Carlson, H. Shi, L. Myatt, and B. K. Kishore. 2003. P2Y 2
receptor-stimulated release o f prostaglandin E 2 by rat inner medullary collecting duct
preparations. Am. J. Physiol. Renal Physiol. 285:F711-721.
49.
Jin, J., V. R. Dasari, F. D. Sistare, and S. P. Kunapuli. 1998. Distribution o f P2Y
receptor subtypes on haematopoietic cells. Br. J. Pharmacol. 123:789-794.
50.
Ahn, J. S., J. M. Camden, A. M. Schrader, R. S. Redman, and J. T. Turner. 2000.
Reversible regulation o f P 2 Y( 2) nucleotide receptor expression in the duct-ligated rat
submandibular gland. Am. J. Physiol. Cell. Physiol. 279:C286-294.
51.
Seye, C. I., A. P. Gadeau, D. Daret, F. Dupuch, P. Alzieu, L. Capron, and C.
Desgranges. 1997. Overexpression o f P 2 Y 2 purinoceptor in intimai lesions o f the rat aorta.
Arterioscler. Thromb. Vase. Biol. 17:3602-3610.
52.
Kong, Q., T. S. Peterson, O. Baker, E. Stanley, J. Camden, C. I. Seye, L. Erb, A.
Simonyi, W. G. Wood, G. Y. Sun, and G. A. Weisman. 2009. Interleukin-1beta enhances
nucleotide-induced and alpha-secretase-dependent amyloid precursor protein processing in
rat primary cortical neurons via up-regulation o f the P 2 Y ( 2) receptor. J. Neurochem.
109:1300-1310.
53.
Spencer, V. A., and J. R. Davie. 1999. Role o f covalent modifications o f histones in
regulating gene expression. Gene 240:1-12.
54.
Zhong, H., M. J. May, E. Jimi, and S. Ghosh. 2002. The phosphorylation status o f
nuclear NF-kappa B determines its association with CBP/p300 or HDAC-1. Mol. Cell.
9:625-636.
55.
Pugh, B. F., and R. Tjian. 1991. Transcription from a TATA-less prom oter requires
a multisubunit TFIID complex. Genes Dev. 5:1935-1945.
56.
Wallace, J. L. 2006. COX-2: a pivotal enzyme in mucosal protection and resolution
o f inflammation. Scientific W orld J. 6:577-588.
57.
Ajuebor, M. N., A. Singh, and J. L. Wallace. 2000. Cyclooxygenase-2-derived
prostaglandin D(2) is an early anti-inflammatory signal in experimental colitis. Am. J.
Physiol. Gastrointest. Liver Physiol. 279:G238-244.

72

Footnotes
1. Correspondence: Dr. Femand-Pierre Gendron, Dpartement d anatom ie et de biologie
cellulaire, Facult de mdecine et des sciences de la sant, Universit de Sherbrooke, 3001
12e Avenue Nord, Sherbrooke, QC, Canada, J1H 5N4; Tel. (819) 564-5272; Fax. (819)
564-5320; E-mail: Femand-P.Gendron@ USherbrooke.ca
2. This research was supported by the C rohns and Colitis Foundation o f Canada Grant in
Aid o f Research, the Canadian Institutes o f Health Research (CIHR, N M D -94729) and an
establishment grant from the Fonds de la recherche en Sant du Qubec (FRSQ) to F.P.G.,
and by grants from the Canadian Institutes o f Health Research (CIHR) and The Arthritis
Society (TAS to J.S. andN IH grants AGI 8357, DE07389, and D E I7591 to G.A.W . F.P.G.
is a scholar from the FRSQ and he is mem ber o f the FRSQ-funded Centre de Recherche
Clinique tienne-Le Bel. D.M.G. is a recipient o f scholarship from the Natural Sciences
and Engineering Research Council o f Canada. J.S. was a recipient o f a new investigator
award from the CIHR and E.G. Lavoie o f a scholarship from the FRSQ.
3. Abbreviations: AMV, avian myeloblastosis virus; DSS, dextran sulfate sodium; HCAEC,
human coronary artery endothelial cells; IBD, inflammatory bowel diseases; IECs,
intestinal epithelial cells; NBM, NF-DB binding motif; TBP, TATA binding protein; TSS,
transcription

starting

site

CHAPITRE 2

P2Y2 receptor promotes intestinal epithelial cell migration through a Go protein and
integrin a v pathway allowing microtubule stabilization and mucosal re-epithelization
in experimental colitis.
Auteurs de larticle: Emilie Degagn, Jade Degrandmaison, Djordje M. Grbic, Valrie
Vinette, Guillaume Arguin et Fem and-Pierre Gendron.
Statut de larticle : Sous presse dans le Journal o f Cellular Physiology, 2012.
Avant-propos : Ma contribution pour cet article a t d crire le manuscrit et de m ettre en
forme les figures pour la premire version de la publication. J ai effectu la m ajorit du
travail exprimental des 8 figures rgulires et des 2 figures supplmentaires de ce papier
lexception de la figure 5 A-G, des figures 6 A et 7A et de la figure supplm entaire 1 A.

74

18. Rsum de larticle

Dans les maladies inflammatoires intestinales (M il), lexpression du rcepteur P 2 Y 2 est
augmente dans les cellules pithliales intestinales (CEI). Dans ce contexte, la stimulation
du rcepteur P 2 Y 2 augmente la relche de PGE 2 par les CEI suggrant un rle de ce
rcepteur dans la rparation de blessure.
cellulaire non-cancreuse IEC- 6 .

Pour cette tude, nous avons utilis la ligne

La m igration des cellules IEC - 6 a t dterm ine en

chambres de Boyden ou en utilisant un modle de blessure par lame de rasoir. Nous avons
activ le rcepteur avec ses agonistes endognes soit lATP et lUTP ou en utilisant un
agoniste de synthse soit le 2-thioUTP.

Des inhibiteurs pharmacologiques, un peptide

bloquant, un anticorps neutralisant et des shRNAs ont t utiliss pour caractriser la

signalisation implique. Les complexes focaux et la dynamique des microtubules ont t
tudis par immunofluorescence en utilisant respectivement un anticorps dirig contre la
vinculine et la forme actyle de la-tubuline. In vivo, le modle murin de colite chimique
induit par le DSS a t utilis pour caractriser les effets de lagoniste 2-thio-UTP sur la
rmission.

Nous avons montr que la stimulation du rcepteur P 2 Y 2 augmentait la

migration cellulaire et la rparation de blessure par le recrutement de la protine Go suivant

une coopration avec lintgrine a v. Suivant lativation du rcepteur P 2 Y 2, nous avons
dmontr que lactivit de GSK3J3 tait inhibe en rponse lactivation d Akt. Ceci mne
la stabilisation des microtubules et une augmentation du nombre de point focaux
d adhsion. In vivo, lactivation du rcepteur P 2 Y 2 favorise la rmission, tel quillustre
par une rduction de lindex de svrit de la maladie et les scores histologiques
comparativement aux souris contrle. Ces rsultats dmontrent une nouvelle fonction pour
ce rcepteur dans les CEI. Ils illustrent aussi que les rcepteurs P2Y pourraient tre des
cibles dans le dveloppement de nouvelles thrapies pour le traitement des MIL

75

P 2 Y 2 receptor promotes intestinal epithelial cell migration through a Go protein and

integrin a v pathway allowing microtubule stabilization and mucosal re-epithelization in
experimental colitis.
milie D egagn1, Jade Degrandm aison1, Djordje M. G rbic1, Valrie V inette1, Guillaume
A rguin 1 and Femand-Pierre G endron1'2*.
1

Department o f Anatomy and Cell Biology, Canadian Institutes o f Health Research Team

on Digestive Epithelium, Faculty o f Medicine and Health Sciences, Universit de

Sherbrooke, Sherbrooke, QC, Canada, J1H 5N4.

Running head: P 2 Y 2 receptor promotes intestinal epithelium wound healing

Key Words: inflammatory bowel diseases, cell migration, P 2 Y 2 receptor, remission,

intestinal epithelial cells.

* Corresponding author: Femand-Pierre Gendron, Ph.D., Department o f Anatomy and Cell

Biology, FMSS, Universit de Sherbrooke, 3001 12e Avenue Nord, Sherbrooke, QC,
Canada,

J1H

5N4.

Tel.

819-564-5272,

Fax:

819-564-5320;

P.Gendron@ USherbrooke.ca

Total number o f figures: 8 ; Tables: 0

Contract grant sponsor: Crohn's and Colitis Foundation o f Canada

Contract grant number: none

E-mail:

Fernand-

76

19. Abstract
P 2 Y 2 receptor expression is increased in intestinal epithelial cells (IECs) during
inflammatory bowel diseases (IBDs).

In this context, P 2 Y 2 stimulates PGE 2 release by

IECs, suggesting a role in wound healing. For this study, we have used the non-cancerous
IEC -6 cell line.

IEC -6 cell migration was determined using Boyden chambers and the

single-edged razor blade model o f wounding. The receptor was activated using ATP, UTP
or 2-thioUTP. Pharmacological inhibitors, a blocking peptide, a neutralizing antibody and
interfering RNAs were used to characterize the signaling events.

Focal adhesions and

microtubule (MT) dynamics were determined by immunofluorescence using anti-vinculin

and anti-acetylated-a-tubulin antibodies, respectively. In vivo, the dextran sodium sulfate
mouse model o f colitis was used to characterize the effects o f P 2 Y 2 agonist 2-thioUTP on
remission. We showed that P 2 Y 2 increased cell migration and wound closure by recruiting
Go protein with the cooperation o f integrin a v.

Following P 2 Y 2 activation, we

demonstrated that GSK3P activity was inhibited in response to Akt activation. This leads
to MT stabilization and increased number o f focal adhesions. In vivo, P 2 Y 2 activation
stimulates remission, as illustrated by a reduction in the disease activity index values and
histological scores as compared to control mice. These findings highlight a novel function
for this receptor in IECs. They also illustrate that P2Y receptors could be targeted for the
development o f innovative therapies for the treatm ent o f IBDs.

77

20. Introduction
Crohn's disease and ulcerative colitis are chronic and relapsing inflammatory bowel
diseases (IBDs) that can affect the entire length o f the intestine (Abraham and Cho, 2009).
IBDs are the consequence o f intestinal epithelial cells (IECs) and immune cell dysfunction
resulting in impaired or abnormal mucosal immune responses (Laukoetter et al., 2008).
The regenerative capacity o f the mucosal surface epithelium is essential to the maintenance
o f the intestinal mucosal barrier integrity even after extensive damages (Sturm and Dignass,
2008). However, the inflammatory burst associated with the relapsing episodes observed in
IBDs, impaired the regenerative capacity o f the IEC monolayer. As a consequence, it is
possible

to

observed

crypt

abscess

formation,

uncontrolled

bacterial

infiltration,

exacerbated inflammatory responses and loss o f tissue architecture and functions (Sartor,
2004; Sturm and Dignass, 2008).

Consequently, to significantly increase or obtain

complete remission the regeneration o f a functional epithelium is a prerequisite (Ardizzone

et al., 2 0 1 1 ).
The regeneration o f the intestinal epithelial lining requires the coordinate and
overlapping action o f three wound-healing processes. First, IECs adjacent to the injured
surface migrate into the wound to cover the denuded area.

Those epithelial cells that

migrate into the wound depolarize, form pseudopodia-like structures, reorganize their
cytoskeleton, and repolarize after wound closure. This restitution process is independent o f
cell proliferation (Sturm and Dignass, 2008). Intestinal epithelial restitution occurs within
minutes to hours both in vivo and in vitro. Second, epithelial cell proliferation is necessary
to replace and maintain the IEC monolayer.

Third, maturation and differentiation o f

undifferentiated epithelial cells is needed to reestablish the polarized m onolayer o f

differentiated enterocytes and to maintain intestinal function. These events are regulated by
a number o f structurally distinct regulatory factors, including cytokines, growth factors,
adhesion molecules and phospholipids (Okamoto and W atanabe, 2005; Taupin and
Podolsky, 2003).
We and others have shown that extracellular adenosine 5-triphosphate (ATP) and
uridine 5-triphosphate (UTP) have cytokine-like properties by activating the P 2 Y 2 receptor
(Ben Yebdri et al., 2009; Grbic et al., 2011; la Sala et al., 2003; Langlois and Gendron,

78

2009). Nucleotides are released in the extracellular environment o f IECs under normal
physiological conditions, but are massively liberated following inflammation and injury (Di
Virgilio et al., 2001; Grbic et al., 2008; Luttikhuizen et al., 2004).

The exact level o f

endogenous P 2 Y 2 agonists in the colonic lumen or mucosa under normal or inflammatory

conditions is unknown. Nonetheless, a recent study using a novel ATP biosensor reported
that colonic mucosal release ATP at a concentration ranging from 0.8 to 1 pM , in vitro
(Patel et al., 2011) under normal conditions. Given that UTP releases from non-secretory
cells, like colonocytes, follows the same pattern o f ATP release, it was proposed that both
ATP and UTP are released with a similar time courses (Lazarowski and Boucher, 2001).
Under normal in vivo conditions, the colonic mucosa is also exposed to mechanical stress
that could be induced by the passage o f feces. This mechanical stress could stimulate the
release o f ATP and UTP by a 10- to 20-fold increase (Lazarowski and Boucher, 2001;
Lazarowski et al., 2003; Lazarowski and Harden, 1999). Endogenous extracellular ATP
and UTP could also originate from intestinal bacteria, apoptotic cells and/or from luminal
immune cells (Di Virgilio et al., 2001; Gordon, 1986; Ivanova et al., 2006; Luttikhuizen et
al., 2004). As a result o f inflammation, activated leukocytes and platelets as well as the
acidic and hypoxic microenvironments provided by inflammation will favor the release o f
extracellular ATP and UTP (Di Virgilio et al., 2001; Gordon, 1986; Luttikhuizen et al.,
2004) as well as UDP (Grbic et al., 2008). Furthermore, w e showed that P 2 Y 2 expression
was increased in the colon o f IBD patients and in a animal model o f intestinal inflammation
(Grbic et al., 2008). The reported up-regulation o f P 2 Y 2 expression was in part due to an
increased expression at the surface o f IECs (Degagne et al., 2009).

It was reported that

P 2 Y 2 agonists can also negatively regulate immunity and inflammation (Di Virgilio et al.,
2009), and could thus affect both mucosal inflammation and the healing process (Boucher
et al., 2010; Braun et al., 2006; Crooke et al., 2009; Dignass et al., 1998).

In fact, the

contribution o f adenine nucleotides to intestinal wound healing has been previously

reported (Dignass et al., 1998).

As o f yet, the identity o f the specific P2Y receptor

involved and the signaling events associated with intestinal wound healing have never been
investigated.
Signaling

through

the

Gq-coupled

P 2 Y2

involves

the

hydrolysis

of

phosphatidylinositol-4, 5-bisphosphate (PIP 2) by phospholipase C, thus generating inositol

79

1, 4, 5-trisphosphate (IP 3) and diacylglycerol (DAG).

IP 3 increases the concentration o f

intracellular calcium and triggers calcium-dependent cell responses, such as the activation
o f protein kinase C (PKC) (Erb et al., 2006). PKC stimulation o f M APK activity regulates
various cellular processes, notably migration and proliferation. In addition to MAPK, P 2 Y2
can stimulate PI3K/Akt activity through a PLC/IP 3/Ca2+ and PKC pathway (Bilbao et al.,
2010).

P 2 Y 2 is also coupled to integrins a vp3 and a vp5 via a RGD integrin-binding

domain found in its first extracellular loop (Bagchi et al., 2005; Erb et al., 2001).
Association o f P 2 Y 2 to the a v integrin subunit is necessary for the recruitm ent o f Go and
the initiation o f Go-mediated signaling events leading to cell migration (Bagchi et al.,
2005).
The participation o f the actin cytoskeleton in cell migration has been well described.
It provides a protrusion force at the cell front and a contractile force in the cell body
(Gardel et al., 2010). In contrast, the role o f microtubules (M T) is far more diverse and the
tight regulation o f MT dynamics is required for proper directed cell m igration (EtienneManneville, 2010; Wen et al., 2004). Hence, the regulation o f MT dynamics is essential to
cytoskeleton and focal adhesion organization (Blikslager et al., 2007; Gardel et al., 2010).
One key component o f MT is a-tubulin (a-T ub), which is stabilized through protein
actylation (Creppe et al., 2009). Consequently, detection o f the acetylated form o f a-T ub
is an indication o f MT stabilization (Creppe et al., 2009; Etienne-M anneville, 2010). MT
dynamics is regulated by numerous effectors including, but not limited to, G SK3p and
PI3K/Akt. The PI3K/Akt pathway is important for MT dynamics as well as being a key
element for cell migration and proliferation (Sun et al., 2009), whereas GSK3P regulates
MT dynamics by inhibiting the activation o f M T-associated proteins like CLIP, EB1 and
APC that are responsible for MT elongation and stabilization (Hur et al., 2011; Wen et al.,
2004).
In this study, we have investigated the role o f P 2 Y 2 in intestinal epithelial wound
healing processes.
monolayer o f IECs.

We showed that P 2 Y 2 activation induces migration o f a wounded

Furthermore, we demonstrated that IECs migration induced by the

P 2 Y 2 receptor requires a v integrin subunit and Go protein as well as the subsequent

activation o f the PI3K/Akt signaling pathway, which leads to the elongation and

80

stabilization o f a-tubulin via inactivation o f GSK3J3.

Furthermore, animal studies

demonstrated that activation o f purinergic receptors during the recuperation phase

following acute intestinal inflammation strongly enhanced the wound healing process.

21. M aterials and methods

Materials
Dulbeccos modified Eagles medium (DMEM), penicillin-streptomycin, HEPES
and fetal bovine serum (FBS) were purchased from W isent (St. Bruno, QC, Canada).
GlutaMax, Alexa Fluor 488 goat anti-rabbit IgG (H+L) and Fluo-4/AM were from
Invitrogen (Burlington, ON, Canada). ATP was from Roche Applied Science (Laval, QC,
Canada). UTP, suramin and PPADS were purchased from Sigm a-Aldrich (St. Louis, MO)
and 2-thioUTP was from Tocris Bioscience (Ellisville, MO).

The PI3K inhibitor

LY294002, H-Arg-Gly-Asp-Ser-OFl (RGDS) peptide and control were acquired from EMD
chemicals (Mississauga, ON, Canada). The rabbit anti-phospho-Akt (Ser473), anti-phosphoGSK-3J3 (Ser9), anti-Ac-a-tubulin (Lys40), anti-integrin a v, anti-Akt antibodies and rabbit
monoclonal anti-GSK3p antibody were purchased from Cell Signaling Technology
(Pickering, ON, Canada). Integrin a v neutralizing antibody and normal mouse IgG were
purchased from Santa Cruz Biotechnologies (Santa Cruz, CA).

The rabbit anti-P 2 Y2

receptor antibody, mouse monoclonal anti-actin (clone C4), DAPI and -ECL reagent were
purchased from Millipore (M ississauga, ON, Canada).

Horseradish peroxidase (HRP)-

conjugated goat anti-mouse IgG and HRP-conjugated goat anti-rabbit IgG were from GE
Health Care Bio-Sciences Corp (Piscataway, NJ). Dextran sulfate sodium (DSS; Mx
36,000-50,000) was obtained from MP Biomedicals (Solon, OH). Pertussis toxin (PTX)
was purchased from Enzo Life Sciences (Burlington, ON, Canada).
Cell culture
The non-cancerous rat intestinal epithelial cell line IEC -6 (ATCC #CRL-1592) was
grown as previously described (Degagne et al., 2009; Langlois and Gendron, 2009). Cells
were incubated in serum free medium at 37C, 24 h prior to experiments.

81

Generation o f shP 2 Y 2 cell lines

The 29mer shRNA constructs against rat P 2 Y 2R, empty control vector (EV) and
control shRNA scramble sequence (shNT) were purchased from Origene (Burlington, ON).
Retroviruses were produced and used for infection o f IEC - 6 cells according to Origene
recommendations (HuSEl shRNA Plasmid Panels (29-mer), Application Guide). Receptor
expression was validated by Western blot.
Cytosolic [Ca2+] Measurement
IEC - 6 cells (10 xlO 6 cells grown in 10-cm dishes) were detached by a brief
trypsin/EDTA treatment, re-suspended in complete culture medium, and washed by
centrifugation for 3 min at 100 x g before being incubated w ith 1 pM Fluo-4/AM in 4.5 ml
HBSS with Ca2+ and Mg2+ (W isent, St-Bruno, QC) for 25 min at 37C. After a wash by
centrifugation, cells were re-suspended in HBSS containing Ca

'j 1

and Mg

"yA-

and incubated

for 25 min at 37C to ensure complete hydrolysis o f the Fluo-4/AM. Cells were then
centrifuged again and re-suspended in 16 ml o f HBSS with Ca2+ and M g2+ and 2 ml o f cells
suspension was gently stirred in a quartz cuvette while [Ca2+]j was m onitored on a RF-5301
PC Shimadzu spectrofluorometer (M an-Tech, Guelph, ON) with excitation and emission
wavelengths o f 488 and 520 nm, respectively. Change in intracellular Fluo-4 fluorescence
intensity (F) was acquired using the Panorama fluorescence 1.1 software. At the end o f
each recording, maximal (Fmax) and minimal (Fmin) fluorescence were determined by
adding successively 0.1% Triton X-100 and 50 mM EDTA to cell suspensions. The
2+
9+
following equation was used to relate the fluorescence intensity to Ca levels: [Ca ] = Kd
x (7r-Fm in)/(Fm ax-/:r). Kd is the Ca2+ dissociation constant o f Fluo-4 (345 nM)
(G rynkiew iczetal., 1985).
M igration assay
IEC - 6 cells or IEC -6 cell populations for shP 2 Y 2 (IEC- 6 /shY 2), shNT (IEC - 6 /shNT)
or EV (IEC- 6 /EV) were grown to confluence and serum-deprived 24 h before assays.
Briefly, cells were trypsinized and resuspended in 600 pi o f migrating buffer (0.05%
gelatine and 25 mM HEPES in DMEM). The upper cham ber o f an 8 pm Transwell was
loaded with 175,000 cells. The lower chamber was filled with 600 pi o f migrating buffer
supplemented or not with P 2 Y 2R agonists, with or without P2 receptor antagonists suramin

82

or PPADS. Antagonists were added 30 min prior to cell stimulation with 100 pM A TP or
UTP, or 10 pM 2-thioUTP. After a 6 h incubation period, the upper and lower chambers
were washed using PBS, The remaining cells in the upper cham ber were removed with a
cotton swab. Cells present beneath the membrane were fixed with ice-cold methanol. The
filter was then removed and placed on a microscope slide. M igrating epithelial cells were
counted in 4 random fields using a Leica DM2500 microscope equipped with a Hamamatsu
ORCA-R 2 digital cam era under bright field illumination.
Wounding assay
Cells were grown to confluence in 100-mm dishes. They were incubated in serumfree medium for 24 hours, wounded with a single-edged razor blade and incubated in the
presence or absence of 100 pM ATP or UTP, or 10 pM 2-thioUTP for 24 hours. To assess
the signaling pathways involved, IEC - 6 cell m onolayers were pre-treated for 30 min with
10 pg/ml anti-integrin a v neutralizing antibody, 10 pg/ml normal m ouse IgG or 10 pM o f
LY294002 wounded and stimulated in the presence or absence o f ATP or UTP.

In the

assays in which PTX was used, PTX was added at a concentration o f 250 ng/ml for 16 h
prior to wounding and nucleotide stimulation. Photom icrographs were taken at 4 locations
per wound, and the area o f migrating cells was measured using ImageJ software.
Western blotting
After treatments, IEC - 6 cells were lysed and samples processed for protein
immunoblotting, as previously described (Grbic et al., 2008).

W estern blots were

performed using a 1/1,000 dilution o f rabbit anti-phospho-Akt (Ser 473), anti-phosphoGSK-3(3 (Ser 9), anti-acetyl-a-tubulin K40 and anti-P 2 Y 2 anti-integrin a v. Specific protein
bands on membranes were detected using a 1:10,000 dilution o f HRP-conjugated anti
rabbit as the secondary antibody and visualized on autoradiographic films using the
Millipore chemiluminescence system.

For normalization o f signals, membranes were

stripped o f antibodies (Grbic et al., 2008) and reprobed w ith a 1/1,500 dilution o f rabbit
anti-Akt, a 1/5,000 dilution o f mouse anti-GSK3p or a 1/10,000 dilution o f mouse
monoclonal anti-P-actin followed by a 1/10,000 dilution o f HRP-conjugated anti-rabbit IgG
or HRP-conjugated anti-mouse IgG as the secondary Ab, respectively.
Indirect immunofluorescence

83

IEC -6 cells grown on sterile glass coverslips were washed twice with ice-cold PBS
after treatments and fixed with 3% paraformaldehyde for 30 min at 4C. Cells were washed
with PBS, quenched with 100 mM glycine for 10 min and permeabilized with PBS
containing 0.1% Triton X-100 for 10 min at RT. Cells were washed and then blocked with
PBS containing 2% BSA for 20 min at RT. They were then immunostained for 2 h with the
rabbit anti-acetyl-a-tubulin as the primary antibody, followed by the Alexa Fluor 488 goat
anti-rabbit IgG (H+L) as the secondary antibody for 1 h. Nuclei were stained with 4', 6 diamidino-2-phenylindole (DAPI). Staining for the focal adhesion proteins vinculin and Factin using phalloidin was realized using the Actin Cytoskeleton and Focal Adhesion
Staining Kit (M illipore) as recommended by the manufacturer. Negative controls (normal
IgG antibody) were included in all experiments. Slides were washed in PBS, mounted, and
images were captured on Leica DM 2500 microscope using a Hamamatsu O RCA -R 2 digital
camera.
Mouse model o f IBD and 2-thioUTP injections
Adult CD -I mice (30-35 g) were purchased from Charles River Laboratories (St.
Constant, QC, Canada). Colitis-like disease was induced by adding 4% (w/v) DSS to the
drinking water for 7 days as previously described (Grbic et al., 2011; Grbic et al., 2008).
After a 24 h recovery period, mice received daily rectal enemas o f a 2-thioUTP solution at
a dose o f 2 pg per gram o f body weight versus saline. The dose o f 2-thioUTP used was
based on a recent paper by Grbic et al. (Grbic et al., 2011) in which UDP was given by
enemas at a dose o f 100 pg per gram o f body weight (pg/g) to stimulate, in vivo, the P2Y 6
receptor. The reported EC 50 for 2-thioUTP toward P 2 Y 2 receptor is ranging from 35 to 50
nM (El-Tayeb et al., 2006) as compared to previously reported average EC 50 values ranging
from 1.5 to 5.8 pM for ATP and UTP (Velazquez B. et al. 2000). Thus, 2-thioUTP is more
potent for the P 2 Y 2 receptor by about a 90 fold factor as compared to ATP or UTP.
Adenosine 5'-triphosphate (ATP) has been previously used in clinical trial as a cancer
treatment at doses ranging from 24 pg/g (Beijer et al., 2010) to 135 pg/g (Agteresch et al.,
2000) and even up to 228 pg/g (Haskell et al., 1998) for an average dose o f about 129 pg/g.
Given the potency and selectivity o f 2-thioUTP as compared to ATP we decided to use a
dose o f 2 pg/g, which reflect the difference in potency between P 2 Y 2 receptor natural
agonists and 2-thioUTP and also similar to the recently reported level o f nucleotide

84

secreted by colonic mucosa in vitro (Patel et al., 2011). The 2-thioUTP solution was
prepared in normal saline and sterilized by filtration (0.22 pm filter pores). The 2-thioUTP
solution or saline was injected in the distal colon up to the first curvature leading to the
transverse colon as we previously described (Grbic et al., 2011). Colitis was assessed by
clinical and histological scoring, as previously described (Cooper et al., 1993; Dielem an et
al., 1998; Grbic et al., 2011; Grbic et al., 2008). Spleen was harvested to measure bacterial
translocation. All procedures were approved by the Universit de Sherbrooke Animal Care
Committee and performed according to the Canadian Guidelines for Care and Use o f
Experimental Animals.
Bacterial translocation
Enteric bacterial translocation to spleen was assessed in C D -I mice that were
treated with 2-thioUTP after receiving 4% (w/v) DSS in their drinking water for 7 days.
The harvested tissues were removed under strictly aseptic conditions and were
homogenized in sterile PBS. Homogenates were plated on tryptic soy agar under aerobic
conditions and were allowed to grow for 24 h at 37C. CFUs were counted and expressed
as the LogioCFU/organ.
Histological analysis
Mice colon were fixed in 4% paraformaldehyde overnight at 4C, embedded in
paraffin, cut into 5-pm sections, and applied to Superfrost/Plus slides (Fisher Scientific), as
previously described (Grbic et al., 2008). Hematoxylin and eosin (H&E) staining was
performed by the QTRN/CToDE intestinal phenotyping platform from the Universit de
Sherbrooke. Images were captured on a Leica DMLB2 microscope using a Leica DC300
camera.
Statistical analysis
Results are expressed as the means standard error o f the mean (SE).

Statistical

significances were determined using ANOVA tests or as indicated in the figure legends.
The numbers o f replicates for each experiment is presented in the figure legends.
22. Results
P 2 Y 2 agonists stimulate IECs migration in vitro

85

First, we determined the optimal concentrations o f ATP, UTP or 2-thioUTP that

were required to stimulate P2 Y 2 receptor activity and cell migration.

As shown in

supplemental Fig. SI A, the most efficient concentration o f A TP or UTP stimulating P 2 Y 2

activation was 100 pM as determined by measuring the variation o f intracellular calcium
concentration in IEC -6 cells loaded with Fluo-4, whereas 10 pM 2-thioUTP was the most
efficient analogue concentration stimulating IEC - 6 cells migration following wounding
(supplemental Fig. SIB ). We showed that addition o f 100 pM ATP (Fig. 1A), UTP (Fig.
IB ) or 10 pM 2-thioUTP (Fig. 1C) to the bottom compartment o f Boyden chambers
induced IEC - 6 cell migration across the membrane delineating the upper cham ber from the
lower compartment. Migration was significantly increased by more than 20 to 30% as
compared to control. Addition o f suramin, a general P2 receptor antagonist, prior to P 2 Y 2
activation reduced IEC - 6 cell migration back to control levels (Fig. 1A-C). Addition o f
PPADS, a P2 receptor antagonist not affecting P 2 Y 2 (Grbic et al., 2008), prior to cell
stimulation had no effect on receptor-mediated IEC -6 cell migration. To circum vent the
absence o f a specific P2Y 2 antagonist, a stable IEC -6 cell population in which P2Y 2
expression was knocked down by retroviral infection was generated.

Cell lines were

generated with the empty vector (EV), a non-targeting scrambled shRNA (shNT), or a
shRNA targeting the receptor. Neither the EV nor the shNT constructs affected the
expression o f P 2 Y 2 (Fig. ID). However, the expression o f shP2Y2-08 showed a 60%
decrease in receptor expression and was used in subsequent experiments (Fig. ID). The
migration o f IEC- 6 /shP 2 Y 2 cells in response to agonists was brought back to non
stimulated control levels (Fig. IE), thus clearly suggesting a role for P 2 Y 2 in IECs
migration.

86

B 1.6
S

1.6

il
11
S

r*

1.4

14

I1

fl 10 a . a

l . l

5 S 1.2

1.0

3 ? 0.8 t

S S 1.2

3 I 0.8
I 0.4

0.4

0.0

+ ATP
- Suramin
+ PPADS

0.0

UTP
- Suramin
+ PPADS

I S-actin

+ 2-thioUTP g
- Suramin
PPADS

ni
ATP

UTP

EV shNT 05
shP2Y,

EV
H shNT
sh P 2 Y 2

2-thioUTP

FIGURE 1. P 2 Y 2 agonists increase IEC - 6 cell migration.

IEC -6 cells were seeded in the upper compartment o f Boyden's chamber and 100 pM ATP
(A), UTP (B) or 10 pM o f 2-thioUTP (C ) was added to the lower cham ber with or without
100 pM o f P2Y receptor antagonists, suramin or PPADS. The number o f migrating cells
was measured in four different optical fields and normalized to control. Results represent
means SE o f three separate experiments. Statistical significance was determ ined by one
way ANOVA in which *, p < 0.05 and **, p < 0.01 and ***, p < 0.001 as com pared to
unstimulated cells, and (j), p < 0.05 and <!><(>, p < 0.01 vs. nucleotide stimulated cells. (D)
P 2 Y 2 expression in the shP 2 Y2 cell lines generated was detected by im m unoblot analysis.
(E) EV, shNT and shP 2 Y 2 IEC -6 cells were seeded in the upper cham ber o f a Transwell
and stimulated in the lower chamber with 100 pM ATP, UTP or 10 pM 2-thioUTP, and the
number o f migrating cells was measured in four different optical fields and norm alized to
control. Results represent means SE o f three separate experiments.
Statistical
significance was determined by one-way ANOVA in which *, p < 0.05 and **, p < 0.01
and ***, p < 0.001 as compared to stimulated IEC- 6 /shNT cells.

87

W ound healing is increased following P 2 Y 2 activation

The role o f P 2 Y 2 in epithelial cell migration was analyzed using the single-edged
razor blade model o f wounding. Confluent IEC -6 cell m onolayer wounded and stimulated
for 24 h with P 2 Y 2 agonists ATP, UTP or 2-thioUTP showed a significant increase by more
than 40% in the area covered by IEC -6 cells after wounding, as opposed to unstimulated
cells (Fig. 2A and B). Reduction o f P 2 Y 2 expression by shRNA significantly decreased the
area o f migrating cells (Fig. 2C). Our results support our hypothesis that P 2 Y 2 stimulates
IECs migration and wound closing.

Ctrt

ATP

UTP 2-thioUTP
EV
shNT
shP2Y

ATP

UTP

2-thioUTP

FIGURE 2. Agonists o f P 2 Y 2 stimulate wound closure o f a wounded IEC -6 cell monolayer.

(A) Photomicrographs o f representative wounds 24 hours after wounding. IEC -6 cell
monolayer was wounded and either left unstimulated (ctrl) or stimulated with 100 pM o f
ATP, UTP, or 10 pM 2-thioUTP. The original magnification was 5x with scale bars = 435
pm. (B) Cell migration was measured 24 hours following wounding and stimulation with
or without ATP, UTP and 2-thioUTP. Results represent means SE o f three separate

88

experiments. Statistical significance was determined by one-way ANOVA in which *, P <

0.05 and **, p < 0.01 and ***, p < 0.001 as compared to unstimulated cells. (C ) EV, shNT
and shP 2 Y 2 IEC - 6 cell monolayers were w ounded and either left unstim ulated (ctrl) or
stimulated with 100 pM o f ATP or UTP, or 10 pM 2-thioUTP, and the area o f migrating
cells into the wound after 24 hours was measured. Results represent m eans SE o f three
separate experiments. Statistical significance was determined by one-w ay ANOVA in
which *, p < 0.05 and **, p < 0.01 and ***, p < 0.001 as compared to unstim ulated cells.

P 2 Y 2-induced migration is attributable to its cross-talk with a v integrin subunit

Association o f P 2 Y 2 with the a v integrin subunit is necessary for receptordependent recruitment o f Go and initiation o f Go-mediated signaling events leading to cell
migration (Bagchi et al., 2005). This migratory advantage is o f particular interest for the
IECs located at the margin o f the wounded epithelium as it could favor w ound closure. As
shown in Fig. 3A, addition o f a RGDS blocking peptide to IEC -6 cells inhibited the cell
migration effect mediated by ATP and UTP. The role and expression pattern o f a v integrin
subunit in IECs is unclear, although it was suggested that it acts as a fibronectin receptor in
human IECs (Gagne et al., 2010). In this study, we showed that IEC -6 cells express a v
integrin subunit (Fig. 3B), which could participate with P 2 Y 2 to promote IECs migration.
As predicted by the literature (Chm a et al., 2007), addition of the a n ti-a v neutralizing
antibody for 24 h significantly decreased the integrin expression by 30% (Fig. 3B).
Consequently, the addition o f the neutralizing antibody against a v integrin subunit blocks
P 2 Y 2-mediated IEC -6 cell migration and wound closure as compared to normal IgG treated
cells (Fig. 3C).

89

~ 20
]5 1.8

**

g 16
S o 1.4
1.2

il

II

1.0
0.8
P E
?

it

0.4

00
Ctrl ATP UTP

Ctrl ATP UTP

+
+
+ RGDS
anti-ITAV

"ST
Integrin a
(Vactin

> t 0.5

anti-ITAV

i A*

fi li
2 3

v co
O E 0.8
04

qxfxp

0.0
Ctrl ATP UTP
+

Ctrl ATP UTP

+ anti-a,,
- IgG

FIGURE 3. P 2 Y 2 and integrin a v cooperate to increase cell migration.

(A) IEC -6 cell monolayers were pre-treated with 100 pM o f RGDS for 30 min, wounded
and either left unstimulated (ctrl) or stimulated with 100 pM ATP or UTP, and the wound
area was measured 16 hours after wounding. Results represent fold variation o f the means
SE o f three separate experiments normalized to control. Statistical significance was
determined by one-way ANOVA in which *, p < 0.05 and **, p < 0.01 and ***, p < 0.001
as compared to unstimulated cells. (B) Integrin a v expression in IEC -6 cells was detected
by immunoblot analysis in the presence or not o f 10 pg/ml anti-integrin a v blocking
antibody (anti-ITAV) or 10 pg/ml control IgG for the indicated time. A typical western
blot is presented with densitometry quantification o f three independent experiments.
Results (mean SE) are presented as the ratio o f integrin a v over P-actin expression.
Statistical significance was determined by an unpaired t test, where *, p < 0.05 vs IgG
treated cells. (C) IEC -6 cell monolayers were pre-treated with 10 pg/m l o f anti-integrin a v
neutralizing antibody or 10 pg/ml o f control IgG for 30 min, wounded and either left
unstimulated (ctrl) or stimulated with 100 pM ATP or UTP. The w ound area was

90

measured 16 hours after wounding. Results represent fold variation o f the means SE of
three separate experiments normalized to control. Statistical significance was determined
by one-way ANOVA in which *, p < 0.05 and **, p < 0.01 and ***, p < 0.001 as compared
to unstimulated cells.

P2 Y2 promotes cell migration via stabilization o f the elongating microtubule

Regulation o f microtubule (MT) dynamics is essential to cytoskeleton and focal
adhesion organization (Blikslager et al., 2007; Gardel et al., 2010). Accordingly, we
observed that P2 Y2 activation by ATP or UTP leads to a-Tub actylation on Lys 40, as
shown by immunofluorescence microscopy (Fig. 4A-C). While the number o f F-actin stress
fibers is slightly increased (red) in response to ATP or UTP stimulation, nucleotide
treatments lead to increased focal adhesions as assessed by staining for the focal adhesion
protein vinculin (green) (Supplemental Fig 2A-C).

FIGURE 4. P2Y 2 activation stimulates the actylation o f a-tubulin in IEC -6 cells.

Sub-confluent IEC-6 cells were treated with or without 100 pM ATP or UTP for 15 min.
IEC-6 cells were stimulated for 15 min with PBS (A), 100 pM ATP (B) or 100 pM UTP

91

(C). The acetylated form o f a-tubulin (a-T ub) was detected with an anti-acetyl-a-Tub
(Lys40) antibody (green filaments). Nuclei (blue) were counterstained with 4',6-diamidino2-phenylindole (DAPI). Presented results are typical immunofluorescence micrographs o f
two to three independent experiments. The original magnification was set to 40x and scale
bars = 50 pm.

P 2 Y 2 mediates cell migration through a PI3K/Akt pathway regulating M T dynamics

MT dynamics is an important elem ent for cell migration and proliferation, and as
such it must be tightly regulated. In this context, we showed that P2 Y 2 activation with 100
pM ATP (Fig. 5A) or UTP (Fig. 5B) increased Akt phosphorylation within 5 min.
Inhibition o f the PI3K/Akt pathway using 20 pM LY294002 strongly reduced the number
o f A c-a-Tub positive MT fibers that were formed in response to 100 pM ATP (Fig. 5C) or
UTP (Fig. 5D) when compared to IEC-6 cells stimulated with ATP (Fig. 5E) or UTP (Fig.
5F) alone. The loss o f staining for A c-a-T ub correlated with the inhibition o f IEC-6 cell
migration induced by ATP and UTP in the presence o f LY294002 (Fig. 5H).

92

LV294002

FIGURE 5. P2 Y2 promotes cell migration by activating the PI3-K signaling pathway and
the stabilization of microtubules.
IEC-6 cells were stimulated with 100 pM ATP (A) or UTP (B) for 0 (control), 5 ,1 5 , 30, 60
and 120 min. Akt phosphorylation was detected by Western blot analysis. Presented blots
are typical of three separate sets o f experiments. Indirect immunofluorescence o f acetyl-atubulin in IEC-6 cells stimulated with 100 pM ATP () or UTP (D) for 15 min in the
presence o f 20 pM LY294002 or in the absence of inhibitor (panels E and F). Unstimulated
control IEC-6 cells are presented on panel G. Original magnification o f 63x with scale bars
= 30 pm. (H) IEC-6 cell monolayers were pre-treated with 20 pM o f LY294002 for 30
min, wounded and either left unstimulated (ctrl) or stimulated with 100 pM o f ATP or
UTP, and the wound area was measured 16 hours after wounding. Results represent fold
variation of the means SE of three separate experiments normalized to control. Statistical
significance was determined by one-way ANOVA in which *, p < 0.05 and **, p < 0.01
and ***, p < 0 .001 as compared to unstimulated cells, and <(), p < 0.05 and <()<j>, p < 0.01 vs.
nucleotide stimulated cells.

P2 Y2 stimulates GSK3P phosphorylation downstream of PI3K/Akt

93

The inhibition o f GSK3P activity is strongly associated with M T stabilization and

cell migration. As shown in Fig. 6, P2Y2 activation with 100 pM ATP (Fig. 6A) or UTP
(Fig. 6B) induced the inhibitory phosphorylation o f GSK3P on Ser9. These findings
suggest that the effect o f P2Y2 on MT stabilization is dependent on the inhibition o f
GSK3P activity. We showed that addition o f the PI3K inhibitor, LY294002, prior to P2Y2
stimulation with ATP or UTP (Fig. 6C) favors the balance toward an active nonphosphorylated GSK3p that will block cell migration. These results showed that GSK3P is
activated downstream o f the PI3K/Akt pathway.

phoipt-GSK3p

15
30
60
ATP (100 mM)

| GSK-3P
120 Time |mm)

phopfto-GSK3(S

15
30
60
UTP (100 |M )

| GSK-3P
120 Tin (min(

phoipxHiSK3p
GSK-30
Cttl

ATP

UTP

CW

ATP UTP
LV204002

FIGURE 6. P2Y2 activation induces GSK3P phosphorylation downstream o f the PI3K/Akt

pathway.
Rat intestinal epithelial IEC-6 cells were stimulated w ith 100 pM ATP (A) or UTP (B) and
GSK3P phosphorylation on Ser9 determined by W estern blot. Presented blots are typical o f
three separate sets o f experiments. (C) IEC-6 cells were pre-treated w ith 20 pM o f
LY294002 for 30 min before stimulation with 100 pM ATP or UTP for 5 min. GSK-3p
phosphorylation was detected by Western blot analysis. Presented blots are typical o f three
separate sets o f experiments.

The migrating effect mediated by P 2 Y 2 involves a PTX-sensitive G protein

To determine the contribution o f Go to P2Y2-mediated migration, we added 250
ng/ml PTX to IEC-6 cells for 16 hours before nucleotide stimulation. As shown in Fig. 7A,
PTX treatments reduced the phosphorylation o f A kt on Ser473 and correlated with the
inhibition o f ATP- and UTP-induced IEC-6 cell migration and wound closure effects (Fig.
7B). As for the inhibition o f the PI3K/Akt pathway using LY294002, addition o f PTX (250

94

n g /m l) reduced the n u m b e r of Ac-a-Tub positive MT fibers that were formed in response

to 100 pM ATP (Fig. 7C) or UTP (Fig. 7D) when compared to IEC-6 cells stimulated with
ATP (Fig. 7E) or UTP (Fig. 7F) alone.
pnospho-Akt

Ctrl ATP UTP Ctri ATP UTP

PTX
*

ii.
CM

ATP UTP

Ctrl

ATP UTP

PTX

FIGURE 7. ATP- and UTP-induced wound closure is dependent on a pertussis toxin

sensitive G-protein located upstream o f Akt.
(A) Stimulation of P2Y2 with 100 pM ATP or UTP for 5 min phosphorylated Akt as
determined by Western blot analysis. Addition of 250 ng/ml o f pertussis toxin (PTX) 16 h
prior to P2Y2 activation blocked Akt phosphorylation. (B ) Inhibition o f Go-protein with
PTX abolished the ATP and UTP healing effects o f a wounded IEC-6 cell monolayer.
Results represent fold variation o f the means SE o f three separate experiments

95

normalized to control. Statistical significance was determined by one-way ANOVA in

which *, p < 0.05 and **, p < 0.01 as compared to unstim ulated cells and where <j>, p < 0.05
vs. ATP or UTP stimulated cells without PTX. Indirect immunofluorescence o f acetyl-atubulin in IEC-6 cells stimulated with 100 pM ATP (C) or UTP (D) for 15 min in the
presence o f 250 ng/ml PTX or in the absence o f inhibitor (panels E and F). Unstimulated
control IEC-6 cells are presented on panel G. Original magnification o f 40x with scale bars
= 50 pm.

2-thioUTP administrations during the remission phase o f mice suffering from colitis-like
disease improve recovery
Non-inflamed mice treated for three days with PBS enemas displayed typical colon
architecture with well define crypts and undisturbed surface epithelium (Fig. 8A-A'), as
shown by H&E staining. On the contrary, m ice suffering from D SS-induced colitis had
regions where the epithelium was completely absent (Fig. 8B) and where the crypt
architecture was lost (Fig. 8B'). As for the non-inflam ed mice treated with PBS enemas,
non-inflamed mice treated with 2-thioUTP also displayed normal colon architecture (Fig. 8
C -C ). Finally, inflamed mice treated with 2-thioUTP had regained part o f their epithelium
although crypts and surface epithelium were not as well defined (Fig. 8D-D').

Hence,

massive infiltrates o f immune cells were still visible in the colon o f inflamed mice treated
with the P2Y2 agonist (Fig. 8D, white arrow).

Administration o f 2-thioUTP during

recovery significantly reduced the disease activity index (DAI) value as com pared to mice
receiving PBS enemas (Fig. 8E).

From the H&E staining, we evaluated the overall

histological damages following treatment with 4% DSS prior to daily injections o f 2thioUTP for three days using the scoring chart described by Jeffers et al. (Jeffers et al.,
2002). In Fig. 8F, we showed that 2-thioUTP treated mice had a score significantly lower
than control PBS mice. As an indication o f IECs barrier function, we determined bacterial
translocation in spleen. We observed that bacterial translocation to the spleen (Fig. 8G)
was significantly reduced in mice treated with daily injections o f 2-thioU TP during
recovery as compared with non-treated mice.

96

pS^^W oUTP

P8S

P#

2-thoUTP

pbs 2UiTP.Pa. .3 ttiWTP

DSS

FIGURE 8. 2-thioUTP enemas stimulate recovery in a mouse model o f colitis.

Colitis-like inflammation was induced with 4% (w/v) DSS in drinking water o f mice for 7
days. 24 hours after the end o f the treatment, mice received 2-thioUTP (2 pg per gram
body weight) enemas or control PBS for 3 days. (A-D') Typical H&E staining o f two
different mice colons are showed after 3 days o f recovery: (A-A') Normal control mice
receiving PBS enemas, (B-B') mice suffering from DSS-induced colitis with PBS enemas,
(C-C') normal mice treated with 2-thioUTP (2 pg per gram body weight) enemas, and (DD') mice suffering from DSS-induced colitis after the 2-thioUTP treatment. The original
magnification was set to 20x with scale bars = 200 pm. (E) Disease activity index after 3
days o f 2-thioUTP enemas to mice suffering colitis-like symptoms. (F) H&E score o f
colonic tissues of mice receiving 2-thioUTP or not after DSS treatment. (G) Bacterial
translocation to spleen. Horizontal bars represent the mean SE o f 6 to 10 animals.
Statistical significance was determined by one-way ANOVA test with multiple
comparisons post-test, where ns: non-significant, **: p<0.01 and ***: p < 0.001 when
compared to normal control mice, and <j>: p < 0.05 and
p < 0.01 vs. DSS mice with PBS
enemas.

97

23. Discussion
IECs constitute a physical barrier to bacteria and other luminal contents that could
trigger an uncontrolled immune response (Blikslager et al., 2007). Following wounding,
cells located at the wound margin rapidly migrate to seal the epithelial defect and
reconstitute the barrier (Sturm and Dignass, 2008). In a recent study, it was shown that
inhibition o f P 2 Y 2 expression in vivo using siRNA applied to a model o f com eal wounding
delayed the restitution response to receptor agonists (Crooke et al., 2009). IEC -6 cell is an
accepted and validated in vitro model to study epithelial restitution as it gives reproducible
wounds.

Hence, cell migration is independent o f DNA synthesis and there is no

proliferation at the wound edge even 24 h after wounding (M cCormack et al., 1992). Using
this cell model, it was previously reported that ATP stimulation increased the cell migration
rate when compared to control (Dignass, 2001). However, no mechanisms or any receptors
were identified as being involved in this process. The reported EC 50 values for the
recombinant P 2 Y 2 receptor range from 1.5 to 5.8 pM (Velazquez B. et al. 2000) and
although, 300 pM o f ATP or UTP elicited the maximal variation in intracellular calcium,
we chose the 100 pM concentration as the working concentration based on our previous
publication (Degagne et al., 2009; Langlois and Gendron, 2009). Our data clearly showed
that the most efficient 2-thioUTP-concentration stimulating cell migration was 10 pM.
Hence, we showed that P 2 Y 2 is involved in wound closure o f an IEC-6 monolayer. In fact,
the selective inhibition o f P 2 Y 2 expression by shRNA highlighted the important role o f this
receptor in cell migration and the wound healing processes triggered by ATP and UTP.
P 2 Y 2 cooperates with integrin a v through a RGD m otif found in the receptor's first
extracellular loop to promote cell migration (Erb et al., 2001). This cooperation results in
the recruitment o f Go (Bagchi et al., 2005), the clustering o f a v integrin and the activation
o f Mek/Erk pathway dependent on PI3K activity (Chm a et al., 2007). Integrin clustering
can be seen as focal adhesions in cells and these cellular entities act as a platform for
different signaling pathways involved in cell m igration (W elf et al., 2011). Using a RGD
blocking peptide and an anti-integrin a v neutralizing antibody, we demonstrated that P 2 Y 2induced cell migration required the coordinate action o f integrin a v and P 2 Y 2 .

The

reduction o f a v integrin subunit expression following treatm ent with the integrin blocking

98

antibody is in accordance with the literature (Chm a et al., 2007). Using U-937 cell line,
Chm a et al. demonstrated that incubation o f these cells for 24 h with a v integrin blocking
antibody leads to the internalized o f this integrin, resulting in a decrease o f integrin
expression at the cell surface by 35% (C hm a et al., 2007).
We report here a novel mechanism by which P 2 Y 2 enhances IECs m igration that
involves the stabilization o f MT through the stimulation o f a-Tub actylation.

In fact,

recent studies have showed that the stabilization o f MT requires the coordinate actions o f
microtubule-associated proteins to catalyze the actylation o f a-T ub and thus promote cell
migration (Creppe et al., 2009; Etienne-M anneville, 2010; Gundersen and Bulinski, 1988).
MT stabilization is regulated by numerous factors, but GSK3(3 seems central to this
process. Active GSK3P was reported to inhibit MT stabilization by dow n-regulating MTassociated protein CRMP2 activity and by negatively regulating Tau (Sun et al., 2009).
GSK3P activity is inhibited by phosphorylation o f serine 9 residue found in its N-terminal
domain. Consequently, inhibition o f GSK3P results in Tau and CRMP2 activation, as well
as the subsequent elongation and stabilization o f MT. We showed that P 2 Y 2 activation
leads to an Akt-dependent GSK3P phosphorylation, ensuing actylation o f a-tubulin on
Lys40 in IEC -6 cells. These findings are not only in accordance with the role o f Akt and
MT stabilization in cell migration (Creppe et al., 2009; Etienne-M anneville, 2010), but
most interestingly propose that P 2 Y 2 is involved in the control o f MT dynamics.
Furthermore, indirect immunofluorescence for Ac-a-Tub in IEC - 6 cells pretreated with
PTX showed a reduction in the actylation o f a-Tub induced by ATP and UTP (Fig. 7). On
the other hand, the presence of PTX prior to ATP and UTP stimulation did not influence
the number o f vinculin positive FA (data not shown). These results are thus suggesting that
activation o f a PTX-sensitive Go protein is responsible for the increase in the acetylated
form o f a-Tub.
The maintenance o f the intestinal epithelium integrity is a necessity to prevent the
translocation o f bacteria or entry o f luminal molecules that could trigger an excessive and
uncontrolled immune response and lost o f tissue architecture and function.

Here, we

reported that following P 2 Y 2 activation there is an increase in the acetylated form o f a-T u b
and in the number o f FA. Both a-T ub actylation and FA are essential to IECs migration.

99

FA are composed in part o f integrin a vP3 and other signaling molecules, like vinculin, FAK
and Src, that are involved in signaling cascades responsible for the attachm ent o f migrating
cells to the extracellular matrix (Hamadi et al., 2009).

Contrary to the role o f FA, the

contribution o f MT to IECs migration is not well defined. In the course o f cell migration,
there is a reorientation o f the microtubule organizing center towards the leading edge that
allows the asymmetrical polarization and elongation o f microtubule to the m igrating front
(Kaverina et al., 1998; Wehrle-Haller and Imhof, 2003). M T are then pulled at their plus
ends by plus-end tracking proteins and stabilized by protein like CLIP (Schober et al.,
2007). MT at the leading edge can thus deliver important signaling m olecules necessary to
cell migration. In fact, disruption o f a-T ub actylation results in a significant decreased in
the binding and motility o f kinesin-1 (Reed et al., 2006).

Kinesin-1 is necessary to the

transport o f cargo towards the MT plus-end. M oreover, it was showed that Necl-5 interacts
with PDGF receptor and intregrin a vP3 at the leading edge o f NIH3T3 to promote
directional cell migration (Minami et al., 2010; Minami et al., 2007). They have showed
that activation o f Necl-5 allows the growth and attraction o f microtubules at the leading
edge in an intregrin a vP3-dependant manner.

We believe that a sim ilar process occurs

following P 2 Y 2 receptor activation and its subsequent interaction with integrin a v to

promote the growth and stabilization o f MT and to increased cell migration. In another
way, activation o f P 2 Y 2 leads to an increase in the number o f acetylated a-Tub filaments
and the resulting stabilized MT could be necessary to the motor activity o f kinesin-1.
However additional experiments will be needed to validate this hypothesis.
Administration o f 2-thioUTP during the recovery phase o f mice suffering from
acute DSS colitis displayed a reduction o f the disease activity index and histological score
values as well as a reduction in bacterial translocation to the spleen when compared with
untreated mice. Although mice receiving 2-thioUTP enemas still displayed signs o f colitis
like disease after three days o f treatment, our results indicate that treated mice were in
significantly better shape than control animals.

In this context, we could argue that by

increasing the dose o f 2-thioUTP or the length o f treatment we could favor the healing
process.

Nonetheless, the observed reduction in bacterial count in spleen are good

indicators that 2-thioUTP treatments favored the reepithelization process, since bacterial

100

translocation can be the result o f increased barrier permeability, as observed in IBDs (Berg,
1999).
In this study, we provided evidence that activation o f P2Y 2 during the remission
phase following acute inflammation could facilitate wound healing. Therefore, not only
have we described a novel function for this receptor in IECs, we are also the first to show
that P2Y 2 could modulate M T dynamics. Regulation o f M T dynamics is essential for
wound closure (Etienne-M anneville, 2010), but deregulation o f this phenom enon is also
linked to cancer progression (Etienne-M anneville, 2010). In fact, as proposed by our in
vivo experiments, our findings could lead to the development o f novel therapies aimed at
stimulating intestinal wound healing, which could represent a step forward in the treatm ent
o f IBDs (Ardizzone et al., 2011; Pineton de Chambrun et al., 2010).

101

24. Supplemental data

UTP

(nucleolideal (pM)

0.1
(2-ttiioUTP)

Figura S1. Characterization of concentration

response to P2Y, agonist In IEC-6 calls. (A) IEC-6
colls loaded with Fluo-4 wore stimulated with
increasing concentration of ATP or UTP and variation
m intracellular calcium concentration (.tlCa^'J)
determined by spectrofluorometry with excitation and
emission wavelengths of 488 and 520 nm.
respectively
(B) Determination of the effective
2-thioUTP concentration stimulating IEC-6 cell
migration using Bowden chambers Results are
presented as the mean SE of three separate
experiments. Statistical significance w as determined
by one-way ANOVA in which p < 0 05 and *** p <
0 001 a s compared to unstimulated cells.

102

Figura 32. P2Y, activation Inducaa th a formation of focal

adtumiona in UEC4 c a ls. Sub-confluunt IEC-6 cafta wara
traatad wh or without 100 pMATP or UTP far 15 min Calta wara
staaied for focal adhaaton protons vincuRn (groan) or F-aciin with
phaNonn (rad), with tha Adin Cytosketaton and Focal Adhsion
Staining Kit (MMipora) (A) Unstimuialad cafte; (B)ATP stimuiatad
cala and (C) UTP-ahmulatad cafte Nudai (Wua) wara countarstainad with 4' 8-diamtooo-2-phanytln<Jote (CJAP1) Praaantad rasutta
ara typical immunohuorasconca micrographs of two to thraa
mdepandant anpanmanta Tha ongmai magnification waa sat to
40* with scaia bar* * 50 pm

25. Acknowledgments
We thank Gabriel Mitchell from the department o f Biology from the Universit de
Sherbrooke for his technical help with the bacterial translocation studies. This research was
supported by the Crohns and Colitis Foundation o f Canada Grant in Aid o f Research
(2009-2012) to F.P.G. F.P.G. is member o f the FRSQ-funded Centre de Recherche
Clinique Etienne-Le Bel. D.M.G. is a recipient o f an Alexander Graham Bell scholarship
from the Natural Sciences and Engineering Research Council o f Canada.
Disclosure: The authors have no conflict of interest to disclose.

103

26. References
Abraham C, Cho JH. 2009. Inflammatory bowel disease. N Engl J Med 361(21):20662078.
Agteresch HJ, Dagnelie PC, van der Gaast A, Stijnen T, W ilson JH. 2000. Randomized
clinical trial o f adenosine 5'-triphosphate in patients with advanced non-small-cell lung
cancer. J Natl Cancer Inst 92(4):321-328.
Ardizzone S, Cassinotti A, Duca P, M azzali C, Penati C, M anes G, M armo R, Massari A,
Molteni P, Maconi G, Porro GB. 2011. Mucosal healing predicts late outcomes after the
first course o f corticosteroids for newly diagnosed ulcerative colitis. Clin Gastroenterol
Hepatol 9(6):483-489 e483.
Bagchi S, Liao Z, Gonzalez FA, Chm a NE, Seye CI, W eisman G A, Erb L. 2005. The
P2Y2 nucleotide receptor interacts with alphav integrins to activate Go and induce cell
migration. J Biol Chem 280(47):39050-39057.
Beijer S, Hupperets PS, van den Borne BE, W ijckmans NE, Spreeuwenberg C, van den
Brandt PA, Dagnelie PC. 2010. Randomized clinical trial on the effects o f adenosine 5'triphosphate infiisions on quality o f life, functional status, and fatigue in preterminal cancer
patients. J Pain Symptom Manage 40(4):520-530.
Ben Yebdri F, Kukulski F, Tremblay A, Sevigny J. 2009. Concomitant activation o f
P2Y(2) and P2Y(6) receptors on monocytes is required for TLR1/2-induced neutrophil
migration by regulating IL -8 secretion. Eur J Immunol 39(10):2885-2894.
Berg RD. 1999. Bacterial translocation from the gastrointestinal tract. Adv Exp Med Biol
473:11-30.
Bilbao PS, Santillan G, Boland R. 2010. ATP stimulates the proliferation o f M CF-7 cells
through the PI3K/Akt signaling pathway. Arch Biochem Biophys 499(1-2):40-48.
Blikslager AT, M oeser AJ, Gookin JL, Jones SL, Odle J. 2007. Restoration o f barrier
function in injured intestinal mucosa. Physiol Rev 87(2):545-564.
Boucher I, Rich C, Lee A, Marcincin M, Trinkaus-Randall V. 2010. The P2Y2 receptor
mediates the epithelial injury response and cell migration. Am J Physiol Cell Physiol
299(2):C411-421.
Braun M, Lelieur K, Kietzmann M. 2006. Purinergic substances promote murine
keratinocyte proliferation and enhance impaired wound healing in mice. W ound Repair
Regen 14(2): 152-161.
Chm a NE, Chevres M, Santos-Berrios C, Orellano EA, Erb L, Gonzalez FA. 2007. P2Y2
receptors induced cell surface redistribution o f alpha(v) integrin is required for activation o f
ERK 1/2 in U937 cells. J Cell Physiol 2 1 1(2):410-422.
Cooper HS, Murthy SN, Shah RS, Sedergran DJ. 1993. Clinicopathologic study o f dextran
sulfate sodium experimental murine colitis. Lab Invest 69(2):238-249.
Creppe C, M alinouskaya L, Volvert ML, Gillard M, Close P, Malaise O, Laguesse S,
Cornez I, Rahmouni S, Ormenese S, Belachew S, M algrange B, Chapelle JP, Siebenlist U,
Moonen G, Chariot A, Nguyen L. 2009. Elongator controls the migration and
differentiation o f cortical neurons through actylation o f alpha-tubulin. Cell 136(3):551564.
Crooke A, Mediero A, Guzman-Aranguez A, Pintor J. 2009. Silencing o f P2Y2 receptor
delays Ap4A-comeal re-epithelialization process. Mol Vis 15:1169-1178.
Degagne E, Grbic DM, Dupuis AA, Lavoie EG, Langlois C, Jain N, W eisman GA, Sevigny
J, Gendron FP. 2009. P2Y2 receptor transcription is increased by N F-kappa B and

104

stimulates cyclooxygenase-2 expression and PGE2 released by intestinal epithelial cells. J

Immunol 183(7):4521-4529.
Di Virgilio F, Boeynaems JM, Robson SC. 2009. Extracellular nucleotides as negative
modulators o f immunity. Curr Opin Pharmacol 9(4):507-513.
Di Virgilio F, Chiozzi P, Ferrari D, Falzoni S, Sanz JM , M orelli A, Torboli M, Bolognesi
G, Baricordi OR. 2001. Nucleotide receptors: an emerging family o f regulatory molecules
in blood cells. Blood 97(3):587-600.
Dieleman LA, Palmen MJ, Akol H, Bloemena E, Pena AS, M euwissen SG, Van Rees EP.
1998. Chronic experimental colitis induced by dextran sulphate sodium (DSS) is
characterized by Thl and Th2 cytokines. Clin Exp Immunol 114(3):385-391.
Dignass AU. 2001. M echanisms and modulation o f intestinal epithelial repair. Inflamm
Bowel Dis 7(l):68-77.
Dignass AU, Becker A, Spiegler S, Goebell H. 1998. Adenine nucleotides modulate
epithelial wound healing in vitro. Eur J Clin Invest 28(7):554-561.
El-Tayeb A, Qi A, M uller CE. 2006. Synthesis and structure-activity relationships o f uracil
nucleotide derivatives and analogues as agonists at human P2Y2, P2Y4, and P2Y6
receptors. J Med Chem 49(24):7076-7087.
Erb L, Liao Z, Seye Cl, W eisman GA. 2006. P2 receptors: intracellular signaling. Pflugers
Archiv - European Journal o f Physiology 452(5):552-562.
Erb L, Liu J, Ockerhausen J, Kong Q, Garrad RC, Griffin K, Neal C, Krugh B, SantiagoPerez LI, Gonzalez FA, Gresham HD, Turner JT, W eisman GA. 2001. An RGD sequence
in the P2Y(2) receptor interacts with alpha(V)beta(3) integrins and is required for G(o)mediated signal transduction. J Cell Biol 153(3):491-501.
Etienne-Manneville S. 2010. From signaling pathways to microtubule dynamics: the key
players. Curr Opin Cell Biol 22(1): 104-111.
Gagne D, Groulx JF, Benoit YD, Basora N, Herring E, Vachon PH, Beaulieu JF. 2010.
Integrin-linked kinase regulates migration and proliferation o f human intestinal cells under
a fibronectin-dependent mechanism. J Cell Physiol 222(2):387-400.
Gardel ML, Schneider IC, Aratyn-Schaus Y, W aterman CM. 2010. M echanical integration
o f actin and adhesion dynamics in cell migration. Annu Rev Cell Dev Biol 26:315-333.
Gordon JL. 1986. Extracellular ATP: effects, sources and fate. Biochem J 233(2):309-319.
Grbic DM, Degagn E, Larrive JF, Bilodeau MS, Vinette V, Arguin G, Stankova J, Gendron
FP. 2011. P2Y(6) receptor contributes to neutrophil recruitment to inflamed intestinal
mucosa by increasing CXC chemokine ligand 8 expression in an A P -1-dependent manner
in epithelial cells. Inflamm Bowel Dis.
Grbic DM, Degagne E, Langlois C, Dupuis AA, Gendron FP. 2008. Intestinal inflammation
increases the expression o f the P2Y6 receptor on epithelial cells and the release o f CXC
chemokine ligand 8 by UDP. J Immunol 180(4):2659-2668.
Grynkiewicz G, Poenie M, Tsien RY. 1985. A new generation o f Ca2+ indicators with
greatly improved fluorescence properties. J Biol Chem 260(6):3440-3450.
Gundersen GG, Bulinski JC. 1988. Selective stabilization o f microtubules oriented toward
the direction o f cell migration. Proc Natl Acad Sci U S A 85(16):5946-5950.
Hamadi A, Deramaudt TB, Takeda K, Ronde P. 2009. Src activation and translocation from
focal adhesions to membrane ruffles contribute to formation o f new adhesion sites. Cell
Mol Life Sci 66(2):324-338.

105

Haskell CM, M endoza E, Pisters KM, Fossella FV, Figlin RA. 1998. Phase II study o f
intravenous adenosine 5'-triphosphate in patients with previously untreated stage IIIB and
stage IV non-small cell lung cancer. Invest N ew Drugs 16( 1):8 1-85.
Hur EM, Saijilafu, Lee BD, Kim SJ, Xu WL, Zhou FQ. 2011. GSK3 controls axon growth
via CLASP-mediated regulation o f growth cone microtubules. Genes Dev 25( 18): 19681981.
Ivanova EP, Alexeeva YV, Pham DK, W right JP, Nicolau DV. 2006. ATP level variations
in heterotrophic bacteria during attachment on hydrophilic and hydrophobic surfaces. Int
Microbiol 9(l):37-46.
Jeffers M, M cDonald WF, Chillakuru RA, Yang M, Nakase H, Deegler LL, Sylander ED,
Rittman B, Bendele A, Sartor RB, Lichenstein HS. 2002. A novel human fibroblast growth
factor treats experimental intestinal inflammation. Gastroenterology 123(4): 1151-1162.
Kaverina I, Rottner K, Small JV. 1998. Targeting, capture, and stabilization of
microtubules at early focal adhesions. J Cell Biol 142(1): 181-190.
la Sala A, Ferrari D, Di Virgilio F, Idzko M, Norgauer J, Girolomoni G. 2003. Alerting and
tuning the immune response by extracellular nucleotides. J Leukoc Biol 73(3):339-343.
Langlois C, Gendron FP. 2009. Promoting MPhi transepithelial migration by stimulating
the epithelial cell P2Y(2) receptor. Eur J Immunol 39(10):2895-2905.
Laukoetter MG, Nava P, Nusrat A. 2008. Role o f the intestinal barrier in inflammatory
bowel disease. W orld J Gastroenterol 14(3):401-407.
Lazarowski ER, Boucher RC. 2001. UTP as an extracellular signaling molecule. News
Physiol Sci 16:1-5.
Lazarowski ER, Boucher RC, Harden TK. 2003. M echanisms o f release o f nucleotides and
integration o f their action as P2X- and P2Y-receptor activating molecules. M ol Pharmacol
64(4):785-795.
Lazarowski ER, Harden TK. 1999. Quantitation o f extracellular UTP using a sensitive
enzymatic assay. Br J Pharmacol 127(5): 1272-1278.
Luttikhuizen DT, Harmsen MC, de Leij LF, van Luyn MJ. 2004. Expression o f P2
receptors at sites o f chronic inflammation. Cell Tissue Res 317(3):289-298.
M cCormack SA, Viar MJ, Johnson LR. 1992. M igration o f IEC - 6 cells: a model for
mucosal healing. Am J Physiol 263(3 Pt l):G426-435.
Minami A, Mizutani K, Waseda M, Kajita M, Miyata M, Ikeda W, Takai Y. 2010. Necl5/PVR enhances PDGF-induced attraction o f growing microtubules to the plasma
membrane o f the leading edge o f moving NIH3T3 cells. Genes Cells 15(11):1123-1135.
Minami Y, Ikeda W, Kajita M, Fujito T, Amano H, Tamaru Y, Kuramitsu K, Sakamoto Y,
M onden M, Takai Y. 2007. Necl-5/poliovirus receptor interacts in cis with integrin
alphaVbeta3 and regulates its clustering and focal complex formation. J Biol Chem
282(25): 18481 -18496.
Okamoto R, Watanabe M. 2005. Cellular and molecular mechanisms o f the epithelial repair
in IBD. Dig Dis Sci 50 Suppl l:S34-38.
Patel BA, Rogers M, Wieder T, O'Hare D, Boutelle MG. 2011. ATP microelectrode
biosensor for stable long-term in vitro monitoring from gastrointestinal tissue. Biosens
Bioelectron 26(6):2890-2896.
Pineton de Chambrun G, Peyrin-Biroulet L, Lemann M, Colombel JF. 2010. Clinical
implications o f mucosal healing for the management o f IBD. N at Rev Gastroenterol
Hepatol 7(1): 15-29.

106

Reed NA, Cai D, Blasius TL, Jih GT, M eyhofer E, Gaertig J, Verhey KJ. 2006.
M icrotubule actylation promotes kinesin-1 binding and transport. Curr Biol 16(21):21662172.
Sartor RB, Sandbom, W., editor. 2004. K irsners Inflammatory Bowel Disease. 6 th ed.
Philadelphia: WB Saunder Co.
Schober JM , Komarova YA, Chaga OY, Akhm anova A, Borisy GG. 2007. M icrotubuletargeting-dependent reorganization o f filopodia. J Cell Sci 120(Pt 7): 1235-1244.
Seye CI, Agca Y, Agca C, Derbigny W. 2012. P2Y2 Receptor-mediated Lymphotoxinalpha Secretion Regulates Intercellular Cell Adhesion Molecule-1 Expression in Vascular
Smooth Muscle Cells. The Journal o f biological chemistry 287(13):10535-10543.
Sturm A, Dignass AU. 2008. Epithelial restitution and wound healing in inflammatory
bowel disease. W orld J Gastroenterol 14(3):348-353.
Sun T, Rodriguez M, Kim L. 2009. Glycogen synthase kinase 3 in the world o f cell
migration. Dev Growth Differ 51(9):735-742.
Taupin D, Podolsky DK. 2003. Trefoil factors: initiators o f mucosal healing. Nat Rev Mol
Cell Biol 4(9):721-732.
W ehrle-Haller B, Im hof BA. 2003. Actin, microtubules and focal adhesion dynamics
during cell migration. Int J Biochem Cell Biol 35(l):39-50.
W elf ES, Naik U, Ogunnaike B. 2011. Probabilistic modeling and analysis o f the effects o f
extra-cellular matrix density on the sizes, shapes, and locations o f integrin clusters in
adherent cells. BMC Biophysics 4(1): 15.
Wen Y, Eng CH, Schmoranzer J, Cabrera-Poch N, Morris EJ, Chen M, W allar BJ, Alberts
AS, Gundersen GG. 2004. EB1 and APC bind to mDia to stabilize microtubules
downstream o f Rho and promote cell migration. Nat Cell Biol 6(9):820-830.

CHAPITRE 3

P2Yj receptor expression is regulated by C/EBP0 during inflammation in intestinal

epithelial cells
Auteurs de Particle milie Degagn, Naomie Turgeon, Claude Asselin et Femand-Pierre
Gendron
Statut de Particle : Soumis FEBS Journal, numro de manuscrit : F J-12-0294
Avant-propos : Ma contribution pour cet article a t d crire le m anuscrit et de mettre en
forme les figures pour la premire version de la publication. J ai effectu la majorit du
travail exprimental des 4 figures de ce papier lexception de la figure 4 G ainsi que la
figure supplmentaire 1 .

108

27. Rsum de larticle

Les maladies inflammatoires intestinales (M il) sont caractrises par des rechutes
entrecoupes de priodes de rmission durant lesquels plusieurs facteurs, incluant des
facteurs de stress comme les nuclotides, sont mobiliss pour rtablir lhomostasie de la
muqueuse intestinale. Nous avons prcdemment dmontr que lexpression du rcepteur
purinergique P 2 Y 2 tait augmente dans les tissus cloniques de patients atteints de M il
ainsi que dans un modle murin de colite. Nous avions aussi dmontr que la transcription
du gne du rcepteur P 2 Y 2 tait en partie rgule par le facteur de transcription NF-kB.
Suivant lanalyse des sites de liaison potentiels de facteurs de transcription, nous avons
identifi trois sites de liaison potentiels pour le facteur de transcription C/EBPP dans la
rgion proximal du promoteur du rcepteur P 2 Y 2. Nous avons donc vrifi le rle de ce
facteur de transcription dans la rgulation de lexpression du rcepteur P 2 Y 2 dans les
cellules pithliales intestinales. Nous avons ainsi identifi par essai lucifrase et gel de
retardement, un site de liaison de C/EBPp sur le promoteur du rcepteur P 2 Y 2 sur la rgion
situe entre les paires de base -229 -220bp en amont du site d initiation de la
transcription. La mutation de ce site diminue la transactivation du prom oteur du rcepteur
P 2 Y 2 tel que dmontr par essais lucifrase. Bien que C/EBPP puisse lui seul induire la
transcription du gne du rcepteur P 2 Y 2, nous avons montr que C/EBPP et NF-kB agissent
en synergie pour induire la transactivation du prom oteur du rcepteur P 2 Y 2. Des essais
d immunoprcipitation de la chromatine ont rvl que ces deux protines sont lies
simultanment au promoteur du rcepteur P 2 Y 2. Ainsi, nous avons identifi le facteur de
transcription C/EBPP comme un nouveau rgulateur de lexpression du rcepteur P 2 Y 2 -

109

P2Y2 receptor expression is regulated by C/EBPp during inflammation in intestinal

epithelial cells
milie D egagn1, Naomie Turgeon1, Claude A sselin 1 and Femand-Pierre G endron 1 2*.
1 Department

o f Anatomy and Cell Biology , 2 Canadian Institutes o f Health Research Team

on Digestive Epithelium, Faculty o f M edicine and Health Sciences, Universit de

Sherbrooke, Sherbrooke, QC, Canada, J1H 5N4.

* Corresponding author: Femand-Pierre Gendron, Department o f A natomy and Cell

Biology, Universit de Sherbrooke, 3201 rue Jean-M ignault, Sherbrooke (QC), Canada,
J1E 4K 8. Tel. +1-819-821-8000, ext. 75272; Fax: +1-819-820-6831;
E-mai 1: Fem and-P.Gendron@ USherbrooke.ca

Running title: C/EBPP regulates P 2 Y 2 receptor transcription.

Abbreviations:

C/EBPp,

CCAAT/enhancer-binding

protein

P;

ChIP,

chromatin

immunoprcipitation; cpm, counts per minute; DAPI, 4', 6-diamidino-2-phenylindole;

DMEM, Dulbecco's Modified Eagle M edium;_DSS, dextran sulfate sodium;_FBS, fetal
bovine serum; HRP, horseradish peroxidase; IBD, inflammatory bowel diseases; IECs,
intestinal epithelial cells; IL-24, interleukin-24; IFN-y, interferon-y; IP 3, inositol 1, 4, 5triphosphate; LPS, lipopolysaccharide; MAPK, mitogen-activated protein kinase; NF-kB,
nuclear factor kappa B; PBS, phosphate buffered saline; PI3K, phosphoinositide 3-kinase;
PKC, protein kinase C; PLC, phospholipase C; PM SF, phenylmethylsulfonyl fluoride

Key Words: C/EBP, colitis, gene regulation, intestinal mucosa, P 2 Y 2 receptor, intestinal
epithelial cells.

Subdivision: Gene expression, transcription and translation

110

28. Summary
Inflammatory bowel diseases (IBD) are characterized by relapses and rem ission periods
during which numerous factors, including stress factors such as nucleotides, are mobilized
to reestablish intestinal mucosal homeostasis.

We have previously found that P 2 Y 2

nucleotide receptor (P 2 Y 2) expression is increased in colonic tissue isolated from IBD

patients as well as in a mouse model o f colitis, and that P 2 Y2 transcription is regulated in
part by N F-kB p65.

Following transcription factor DNA-binding site analysis, we

identified three potential C/EBPp binding sites in the P 2 Y2 proximal promoter.

We thus

verified the role o f C/EBP transcription factors in the regulation o f P 2 Y2 in intestinal

epithelial cells.

We identified a region between -229 bp and -200 bp upstream o f the

transcription initiation-starting site, as a DNA-binding site for C/EBPp, by electrophoretic

mobility and supershift assays. Mutagenesis o f this site decreased C/EBPp-dependent P 2 Y2
expression, as assessed by luciferase assays. While C/EBPp was sufficient to induce P 2 Y2
transcription, C/EBPP and NF-kB p65 synergized to insure increased receptor transcription.
Chromatin immunoprcipitation assays revealed that both proteins were simultaneously
bound to the P 2 Y2 promoter. Thus, we have identified C/EBPp as a novel regulator o f P 2 Y2
expression.

Ill

29. Introduction
Crohn's disease and ulcerative colitis are chronic and relapsing inflammatory bowel
diseases (IBD) [1] caused, among others, by intestinal epithelial cell (IECs) and immune
cell dysfunction. These impaired or abnormal mucosal immune responses lead to epithelial
breaches potentially harmful [2]. Usually, the epithelial regenerative capacity m aintains the
integrity o f the intestinal mucosal barrier even after extensive damages [3].

However,

during inflammation associated with IBD, repair o f the epithelial m onolayer is impaired,
leading to crypt abscess formation, uncontrolled bacterial infiltration, exacerbated
inflammatory responses and loss o f tissue architecture and functions [3, 4],

As a

consequence, numerous factors, including cytokines, chimiokines and nucleotides, are

released from damaged IECs, from underlying fibroblasts as well as from resident and
newly recruited immune cells [5-7].

The inflammation resulting from this intestinal

epithelial barrier breach may result in exacerbated and uncontrolled immune responses,
leading to IBD [1]. In contrast, a limited and controlled immune response will regulate
foreign pathogen and noxious agent entry, and will favor wound healing and rem ission [ 1 ,
4, 8 ].

Among the numerous factors released after wounding, extracellular nucleotides,

namely ATP, UTP and diphosphate derivatives, have recently been described as dangerassociated molecular pattern molecules [7, 9, 10] and as immunodepressants [11]. These
labile molecules can either stimulate the inflammatory response or act as anti-inflamm atory
and pro-healing mediators [11-14].

This dual function associated with extracellular

nucleotides depends not only on the microenvironment, but also on the P2 receptor subtype
activated [7, 9, 11-13].
P2 receptor subtypes include P2X ATP-gated ion channels and P2Y G protein-coupled
receptors [15, 16].

Among this family o f receptors, the P 2 Y 2 receptor is activated

equipotently by extracellular ATP and UTP [17]. P 2 Y 2 activation regulates among others,
cell proliferation, inflammation and angiogenesis [17-19], Signaling through Gq-coupled
P 2 Y 2 involves phosphatidylinositol-4, 5-bisphosphate hydrolysis by phospholipase C
(PLC), thus generating inositol 1, 4, 5-trisphosphate (IP 3) and diacylglycerol [20].

IP 3

increases the concentration o f intracellular calcium and triggers calcium -dependent cell
responses, such as the activation o f protein kinase C (PKC) [20].

PKC stim ulation o f

MAPK activity regulates various cellular processes, notably migration and proliferation. In

112

addition to MAPK, P 2 Y 2 stimulates PI3K/Akt activity through a PLC/IP 3/Ca2+ and PKCdependent pathway [2 1 ]. P2 Y 2 is also coupled to integrins a vp3 and a vp5 via binding to a
RGD integrin-binding domain in the first extracellular loop [22, 23]. P 2 Y 2 and a v integrin
subunit interaction is necessary for Go recruitment and the initiation o f Go-mediated
signaling events leading to cell migration [22].

Recently, it was showed that P 2 Y 2

activation increases the rate o f IEC migration in an integrin a v-dependent m anner that
translated into an improvement in the rem ission phase o f mice suffering from chemically
induced colitis [14],
Furthermore, P 2 Y2 expression is increased in the colonic tissue o f IBD patients and in a
mouse model o f chemically induced colitis [7].

We have determined that the pro-

inflammatory transcription factor NF-kB p65 is a major regulator o f P 2 Y 2 receptor

expression in intestinal epithelial cells [12]. Indeed, N F-kB p65 binds the P 2 Y2 minimal
promoter region between position -181 to -172 bp upstream o f the transcription initiation
site [12].

Besides NF-kB, CCAAT/ enhancer-binding protein p (C/EBPP) is a key

transcription factor activated by pro-inflammatory molecules [24], In intestinal epithelial

cells, C/EBPP is involved in the differential expression o f acute phase protein genes in
response to hormones and cytokines [25-27]. More recently, C/EBPp was associated with
the expression o f IL-24, a cytokine with suppressive effect on mucosal inflammation in
IBD [28],
In this study, we have investigated the role o f the C/EBPP transcription factor in the
transactivation o f P 2 Y 2. We have identified several potential C/EBP D NA-binding sites in
the P 2 Y2 proximal promoter.

Our data show that C/EBPp is a novel regulator o f P 2 Y 2

expression in inflammatory conditions in intestinal epithelial cells.

Our results also

demonstrate that NF-kB p65 cooperates with C/EBPP to transactivate the P 2Y i promoter.

30. Results
C/EBPp regulates

2 Y 2 expression

Following our studies on the regulation o f P 2 Y 2 by NF-kB [12], we have identified putative
C/EBP DNA-binding sites by TRANSFAC analysis.

Indeed, three characteristic

113

RTTGCGYAAY consensus C/EBP DNA-binding motifs were localized in the proximal

P2Y2 human promoter (Fig. 1A).

C/EBPp overexpression significantly enhanced P2Y 2

expression more than 7-fold as compared to control, as assessed by luciferase assays using
the cloned proximal human P 2 Y2 promoter in the luciferase-containing pGL4.10 vector
[12] (Fig. IB). To determine the C/EBP DNA-binding site involved, we replaced the three
motifs by inserting scrambled CEBP1, CEBP2, and CEBP3 sequences (Fig. 1C). While
mutation o f the CEBP2 and CEBP3 sites did not affect luciferase activity, m utation o f the
CEBP1 site significantly reduced luciferase activity o f the minimal P2Y2A350-Luc
promoter construct by more than 50% (Fig. 1C). We confirmed by electrophoretic mobility
and supershift assays with HEK 293T C/EBPP overexpressing nuclear extracts, C/EBP
binding to the CEBP1 site, and the presence o f the C/EBPP isoform (Fig. ID). This result
was verified by the absence o f C/EBPp binding to a mutated CEBP1 double-stranded
oligonucleotide. These results indicate that CEBP1 ~229GTT GCA GCA C 220 is a potential
binding site required for the transcriptional regulation o f P 2 Y2 expression by C/EBPp.

114

P2Y..V50

_350bf>

-l?72 bp

-lioO bp

-sltO

-400 bp

CKBP2
CEBPl
-7* bp 1 0 - 6 9 bp
-229 bp to - 720 bp

bp O ^Obp

-200 bp

-UK) bp

t T Hp\
bp to - 48 bp
11 bp

*93 bp

~ 40-,

+
+

350
D
antbC/EBPfl
Nuclear extract

pcDNA 3 1
pGL4 10
pcONA31-C/EBPp
pGL4 10-prP2Y.

CEBP1 CEBP2 CEPB3

CBP1
-

CBP2

C/EBP3 mutCBPI
+ . . +

Fig. 1. C/EBPP transactivates the human P 2 Y2 receptor promoter. (A) Schematic

representation o f the P lY j promoter constructs. (B) HEK 293T cells were transiently
transfected with the P2Y-2 full-length promoter-luciferase construct (pG L4.10-prP2Yi) and
the C/EBPP expressing vector. Luciferase activity was assayed 48 h after transfection.
Luciferase activity is expressed as the fold-increase relative to the activity o f the empty
vectors. (C) Site-directed mutagenesis o f three potential binding sites o f C/EBPP into the
minimal promoter was performed. Then, CEBP1, CEPB2, CEPB3 constructions and
prP2Y2/\-350bp promoter construct were transiently transfected w ith the C/EBPPexpressing vector. Luciferase activity is expressed as the fold-increase relative to the
activity o f the pcDNA3.1 empty vector with CEBP1, CEPB2, CEPB3 or prP2Y2A-350bp
promoter constructs.
Data are the means SEM o f results from at least 4 separate

115

experiments done in triplicate. Statistical analysis was performed by a one way ANOVA,
where *p < 0.05 and **p < 0.01, as compared to respective controls and as indicated on the
figure. (D) Nuclear extracts from HEK 293T cells were incubated with the putative [y32P]ATP-labeled C/EBP(3 DNA-binding site probes CEBP1, CEBP2, CEBP3 or C E B Plm ut
and anti-C/EBPp antibodies for electrophoretic mobility and supershift assays. DNAprotein complexes were separated from the free probe on a native polyacrylam ide gel.
C/EBPP DNA-binding and supershifted complexes are indicated by the bracket and the
supershifted complex by the star.
Results are representative o f three independent
experiments.

C/EBPp regulates

P 2Y2

expression in response to inflammatory conditions as well as

to mechanical stress
Caco-2 cells were treated with pro-inflammatory cytokines IFN-y, lipopolysaccharides
(LPS) (Fig. 2A) and dextran sulfate (DSS) (Fig. 2B).

The cell monolayer was also

subjected to mechanical stress by using a scratch wound model (Fig. 2C). It is known that
IFN-y and LPS are inflammatory mediators activating C/EBPp [24], Stimulation for 6 h
with IFN-y or LPS, o f Caco-2 cells transfected with the C/EBPp expression-vector and the
P 2 Y2-Luc promoter constructs, led to significantly increased transcription o f P 2 T? when
compared to unstimulated controls, respectivelyl.5 0.07 fold (p < 0.01) for IFN- y, and
1.4 0.03-fold (p < 0.001) for LPS (Fig. 2A). Again, treatment with DSS, a chemical
agent used in vivo to induce colitis in mice, increased P2Y2 expression by a 3.0 0.22-fold
(p < 0.001) (Fig. 2B). Interestingly, Caco-2 cell m onolayer wounding led to a significant
increase o f C/EBPP binding to the P2 Y2 promoter. Indeed, as showed in Fig. 2C, C/EBPP
was associated with the P 2 Y2 prom oter region in unwounded Caco-2 cells. However, 6 h
after wounding, there was a significant increase in the level o f C/EBPP associated with the
P 2 Y2 promoter region when compared to unwounded control (Fig. 2C).

C/EBPp and NF-kB p65 cooperate to induce

2 Y 2 transcription

We have previously identified a NF-kB p65 binding site in the P 2 Y2 prom oter [12]. This
binding m otif was located between base pairs -181 to -172 [12], proximal to the CEBP1
site (-229 bp to -220 bp) identified in this study.

To determine whether these two

transcription factors cooperate to increase P2T? transactivation, we transfected HEK 293T

116

cells with expression vectors for both transcription factors and performed luciferase assays.
As shown in Fig. 3A, N F-kB p65 and C/EBPp upregulated P 22 expression by 10- and 25fold, respectively. However, when both transcription factors were co-expressed, luciferase
activity was increased more than 45-fold (Fig. 3A).

These results suggest a synergistic

cooperation between N F-kB and C/EBPp in the regulation o f P22 expression. Indeed, reChlP assays o f Caco-2 chromatin extracts, in which the first immunoprcipitation was
performed with an NF-kB p65 antibody followed by a second immunoprcipitation o f the
eluted NF-kB p65 complex with an antibody against C/EBPp, show that both transcription
factors occupied the P 2 Y2 promoter region between -221 bp to -105 bp (Fig. 3B).
A

.A

_______

pGL4 10
P2Y:-Luc
C/EBPp

anti-C/EBPp
Wound

Fig. 2. Cytokine treatment or mechanical injury o f Caco-2 cell monolayers increase

C/EBPP transactivation and DNA-binding to the P 2 Y2 promoter.
Caco-2 cells were
transiently transfected with the P 2 Y2 full-length promoter-luciferase construct (prP2Y2-luc)
and the C/EBPP-expressing vector, or the empty pG L4.10 vector (control). Cells were

117

incubated with (A) 500 ng/ml IFN-y or 12.5 ng/m l LPS or (B) with 0.5% DSS for 6 h and
luciferase activity determined. Luciferase activity is expressed as the fold-increase relative
to the activity o f the empty vectors. Data are the means SEM o f results from at least 4
separate experiments done in triplicate. Statistical analysis was perform ed by one-way
ANOVA, where **p < 0.01 and ***p < 0.001, as compared to respective controls, and
where <t><[><|) p< 0.001 vs. non-DSS treated cells. (C) Caco-2 cell monolayers were wounded
with a pipet tip and ChIP assays were perform ed 6 h after wounding using an anti-C/EBPp
antibody or normal rabbit IgG antibody.
Quantification o f sam ples was done by
quantitative real-time RT-PCR analysis with oligonucleotides amplifying the -221 bp to 155 bp region o f the P2Y2 promoter, and was expressed as the fold-increase over negative
control normalized to input. Results are presented as the mean SEM o f 3 independent
experiments. Statistical significance was determined by an unpaired t-test, where * p <
0.05 and*** p < 0.001.

C/EBPp regulates

P 2Y 2

expression

in v iv o

CD-I mice were treated for 7 days with 4% DSS in drinking water. First, we showed that
C/EBPP protein expression was absent in C/EBP'7' murine colon (Supplem ental Fig. SI).
In response to DSS treatment, C/EBPp protein levels were increased in wild-type colonic
epithelial

cells,

as

assessed

by

W estern

blot

analysis

(Supplemental

Fig.

SI).

Immunofluorescence staining showed C/EBPp expression restricted to colonic epithelial

cell nuclei in normal mice (Fig 4A, 4B). However, increased C/EBPp nuclear as well as
cytoplasmic staining was observed in DSS-treated colon (Fig. 4C, 4D).

Staining was

specific since the non-immune controls were negative (Fig. 4E, 4F). To determine whether
P 2 Y 2 expression, previously found to be induced in IBD [7, 12], was regulated in part by
C/EBPs, we isolated total RNAs from colonic epithelial cells o f w ild-type and C /EB Pp7'
mice treated with or without DSS. Real time quantitative PCR analysis showed similar
levels o f P2Y2 expression in non-treated wild-type and C/EBPp7' mice.

However, P2Y2

expression was significantly reduced in C /EB Pp7' mice treated with DSS, as opposed to
control mice (Fig. 4G), suggesting that C/EBPp indeed regulates P2Y2 receptor expression
in inflamed IECs.

118

+
B

NF-*B pp65
NF-B
+ C/EBPp

0
Ctrl

w-ChlP

Fig. 3. C/EBPP and NF-kB p65 cooperate to induce P 2 Y2 transcription. (A) HEK 293T
cells were transiently transfected with the P 2 Y2 full-length prom oter-luciferase construct
(pGL 4 . 1 0 -prP 2 Y 2) with or without the C/EBPP and NF-kB p65-expressing vectors.
Luciferase activity was assayed 48 h after transfection. Luciferase activity is expressed as
the fold-increase relative to the activity o f the empty vectors. Data are the means SEM o f
results from at least 4 separate experiments done in triplicate. Statistical analysis was
performed by one-way ANOVA, where **p < 0.01 and ***p < 0.001, as compared to
controls. (B) Re-ChIP assay was perform ed with anti-C/EBPp antibody following the first
immunoprcipitation with anti-NF-xB p65 antibody. Samples were verified by quantitative
RT-PCR analysis with oligonucleotides amplifying the -221 bp to -105 bp region o f the
P 2 Y2 promoter and expressed as fold-increase over negative control normalized to input.
Representative results from 3 independent experiments are shown.

31. Discussion
We have previously shown that P 2 Y 2 receptor expression is increased in IBD [7,
12]. We have recently reported that NF-kB p65 is an important regulator o f P2Y:
transcription in IECs, in response to inflammation [12]. Beside NF-kB p65, C/EBPp is also
an important modulator o f intestinal inflammation, by regulating among others acute phase
protein expression [25-27], We have found that P 2 Y 2 is a novel C/EBPP target. Indeed, we
have identified a functional C/EBP DNA-binding site in the P 2 Y2 promoter, and we have
shown that C/EBPp transmits inflammatory signals to increase P 2 Y2 expression, from
cytokines such as IFN-y, from bacterial products such as LPS, from epithelial injury

inducers such as DSS and wounding.

In addition, we found a correlation between

increased C/EBPP and P2Y2 expression in colonic cells from DSS-treated mice. Indeed, the
absence of C/EBPp in C/EBPP'A mice reduces dramatically P2Y2 induction during DSSinduced colitis. Interestingly, both C/EBPp and NF-kB p65 synergize to transactivate P2Y'2,
and both bind simultaneously the P2Y2 promoter, with a close proximity o f the NF-kB p65
consensus motif [12] and the C/EBPp DNA-binding domain identified in this study. It is
possible that the synergy also depends on direct interactions between C/EBPp and NF-kB
p65, as proposed in other cell systems [29-31], as well as close recruitment. The exact
molecular interactions between C/EBPp and NF-kB p65 that allow the synergistic
transactivation of the P2 Y2 promoter remain to be determined.

wr

CEBPfP

WT

CEBP0'
OSS

Fig. 4. C/EBPp expression is increased during DSS-induced colitis in intestinal epithelial

cells. (A) C/EBPP expression in the colon of CD-I mice by indirect immunofluorescence.

120

C/EBPP is located in epithelial cell nuclei o f the colonic gland. (B) N uclear DAPI staining
o f colonic tissue. (C) CD-I mice were treated with 4% DSS in their drinking water for 7
days and C/EBPP expression was determined by indirect immunofluorescence. C/EBPP
expression is increased both in the nuclear as well as in the cytoplasmic compartments. (D)
N uclear DAPI staining o f DSS treated colonic tissue. (E-F) Non-immune control for
C/EBP staining and normal nuclear DAPI staining. M icrographs show typical results for at
least 4 different animals. (G) P22 mRNA expression was determined by quantitative RTPCR o f mRNAs obtained from DSS-treated wild-type or C/EBPP knock-out (C /EB Pp'7')
enriched colonic epithelial cells. Data are the means SEM o f results from at least 4
animals per group. Statistical analysis was perform ed by a One-way ANOVA, where *p <
0.05; **p < 0.01 and *** p < 0.001 as compared to controls.
In addition to the regulation o f pro-inflammatory gene expression, C/EBPP is also
involved in cell migration, as showed by his reported role in the mediation o f keratinocyte
growth factor-induced epidermis migration during wound healing [32] and in the promotion
o f melanocyte motility [33], C/EBPp also regulates the expression o f anti-inflamm atory
cytokines such as IL-24, which suppresses mucosal inflammation in IBD [28].

It thus

appears that C/EBPp could be involved in the regulation o f anti-inflammatory responses

aimed at protecting the intestinal epithelium.

Supporting this role for C/EBPP, we have

recently showed that P 2 Y 2 activation increases intestinal epithelial cell migration in vitro,
and the stimulation o f the rate o f remission o f mice suffering from DSS-induced colitis
[14]. In fact, in IBD, there are increasing evidences suggesting that anti-inflamm atory and
pro-healing responses are activated even in the presence o f acute inflammation, in order to
control the invasion o f pathogenic components and to rapidly reseal the mucosal breach [ 1,
34], In this context, C/EBPP may be a key player in the establishment o f an appropriate
intestinal mucosal response by regulating the expression o f pro-inflammatory genes
necessary to the recruitment o f immune cells at the site o f inflammation [24], and by
stimulating the expression anti-inflammatory and pro-healing components, such as IL-24
[28] and P 2 Y 2 receptor.

32. M aterials and methods

Reagents
Dulbeccos modified Eagle medium (DM EM ), penicillin-streptomycin, HEPES, and FBS
were purchased from W isent (St. Bruno, QC, Canada).

Fetal bovine serum (FBS) was

121

inactivated by heating at 50C for 60 min. Opti-M EM , GlutaMax, LipofectAM INE 2000
and Alexa Fluor 488 goat anti-rabbit IgG (H+L) were from Invitrogen Life Technologies
(Burlington, ON, Canada). Dextran sulfate sodium (DSS; Mr 36,000-50,000) was obtained
from MP Biochemicals (Solon, OH). The pGL4.10 and pcDNA3.1 vectors were purchased
from Promega (Madison, WI) and Invitrogen Life Technologies, respectively.

LPS

( Escherichia coli 0 5 5 :B5) and IFN-y were purchased from EMD (M ississauga, ON,
Canada)

and

BioShop

Canada

(Burlington,

ON,

Canada),

respectively.

The

pM SV/C/EBPp construct was kindly provided by Dr. Steven L. M cKnight (University o f

Texas Southwestern Medical School, Department o f Biochemistry, Dallas, TX, USA) and
was transferred into the pcDNA 3.1 vector.

The pcD N A3.1/NF- k B p 6 5 construct was

kindly provided by Dr. Marc Servant (Universit de M ontral, Facult de Pharmacie, QC,
Canada).

The rabbit anti-CEBPp and the mouse anti-NF-KB p65 were purchased from

Santa Cruz Biotechnology, Inc. (Santa Cruz, CA).

The m ouse monoclonal anti-P-actin

(clone C4), DAPI and ECL reagent were purchased from M illipore (M ississauga, ON,
Canada).

Horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG was from GE

Health Care Bio-Sciences Corp (Piscataway, NJ).

Cell culture
The human colon carcinoma cell line Caco-2 (ATCC, HTB-37) and the human embryonic
kidney cell line HEK 293T (ATCC, C R L -11268) were grown as previously described [12].
Cells were incubated in serum free medium for 24 h at 37C before experiments.

Animals and induction of colitis

Adult CD-I mice (30-35 g) were purchased from Charles River Laboratories (St. Constant,
QC, Canada) and heterozygous 129SV-C/EBPP mice were obtained from Peter F. Johnson
(National Cancer Institute, Frederick, MD) [35], Heterozygous mice were bred to C57BL/6
wild type mice (Jackson Laboratory, Bar Harbor, ME) to yield mice with a global knockout
o f C/EBPP on a C57BL6-129SV m ixed background (C/EBP';'). Acute DSS colitis was
induced by adding 4% or 3.5% DSS to the drinking water for 7 days or 5 days for C D -I or

122

C /E B P '- mice, respectively.

Colitis was assessed the following day using a previously

described scoring system [7, 9],

Excised colons were gently washed using phosphate

buffered saline (PBS) and used either for paraffin embedding and immunofluorescence
studies or epithelial cell enrichment and RNA isolation. All mice were maintained on a
12:12-h light-dark cycle at 23C, were given standard lab chow and had food and w ater ad
libitum.

All procedures were approved by the Universit de Sherbrooke Animal Care

Committee and performed according to the Canadian Guidelines for Care and Use o f
Experimental Animals.

Indirect immunofluorescence
Deparaffmized and rehydrated slides were subjected to microwave antigen retrieval as
previously described [7]. Slides were washed in PBS, and then blocked with 2% BSA in
PBS for 20 min at RT. The rabbit anti-C/EBPP (2 pg/pl) antibody was diluted 1:100 in
PBS containing 0.1% BSA and 0.2% Triton X-100 (PBT) and incubated with the sections
overnight at 4C. Slides were washed in PBS and incubated with Alexa Fluor 488 donkey
anti-rabbit IgG in PBT for 2 h at room temperature. Slides were washed in PBS, mounted
and images were captured on a Leica DMLB2 microscope using a Leica DC300 camera.

Western blots
Colons were excised from C/EBP' ' and wild-type control m ice and washed with ice-cold
PBS. Matrisperse-isolated intestinal epithelial cells [36] were homogenized in Triton buffer
(40 mM Tris (pH 7.5), 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.2 mM sodium
orthovanadate, 40 mM P-glycerophosphate, 0.1 mM PMSF, and protease inhibitor mixture
from

Sigma-Aldrich)

and

samples

were

processed

as

previously

described

[7].

Immunoblotting for C/EBPP expression was performed with a 1:1,000 dilution o f rabbit
anti-C/EBPp antibody. Specific protein bands were detected using a 1:10,000 dilution o f
HRP-conjugated anti-rabbit IgG and visualized on autoradiographic film using the
Millipore chemiluminescence system. Signal normalization was realized as described with
an anti-P-actin antibody [7],

123

Real-time PCR quantification

Total RNA was isolated with the Totally RNA

Kit (Ambion, Invitrogen

Life

Technologies, Burlington, ON, Canada) from murine colonic epithelial cells enriched with
BD cell recovery solution (BD Biosciences, M ississauga, ON, Canada) or from Caco-2
cells stimulated with 100 pM ATP or UTP. Complementary DNA was then synthesized
from 2 pg o f purified RNA by reverse transcription using the Superscript II system
(Invitrogen Life Technologies, Burlington, ON, Canada). Five percent o f the synthesized
cDNA was used as a template for real-time PCR using the Brilliant III Ultra-fast SYBR
Green QPCR M aster Mix (Agilent Technologies, Mississauga, ON, Canada).

The

sequence-specific primers for mouse P2Y2 were 5- GGC A AC AGC ACG TAC TTG AA3 and 5-CAG GCC TGT GCA TAT GTG A G -3.

Human P2Y2 promoter cloning and constructs

The human P2Y2 promoter, -15 7 2 bp to +93 bp relative to the putative transcription start
site, and the deletion mutant prP 2Y2A-350bp were cloned into pGL4.10, as previously
described [12]. Deletion o f the putative C/EBPP-binding motifs (CEBP1 to CEBP3) in the
prP2Y2A-350bp construct was done by overlap extension PCR by replacing the potential
binding m otif with a scrambled nucleotide sequence, as previously described [12].

The

upstream amplification was performed with the prP 2 Y 2/N h eI oligonucleotide prim er (5GCT AGC CAG GAA TGC AGT TTC CTC AGC TG -3) and the prP 2 Y 2A C E B P lR (5GTC TGT ACC GTC ATA ACG CGT GGA GGG TC G -3), prP2Y2ACEBP2R (5-TCC
CTG CGC TTA CCT ACG CGT CCG AAG C CG -3), or prP 2 Y 2ACEBP3R (5-CTG GGA
GCC CCC TAG GCT GGA TCC CTG C G C-3) primers. The downstream amplification
was performed with the prP 2Y2A C E B P lF (5 -CGA CCC TCC ACG CGT TAT GAC GGT
ACA GAC-3), prP 2Y2ACEBP2F (5 -CGG CTT CGG ACG CGT AGG TAA GCG CAG
GGA-3), or prP 2Y2ACEBP3F (5-GCG CAG GGA TCC AGC CTA GGG GGC TCC
CAG-3) and the prP2Y2/B glII (5-AGA TCT CGC CTT GTT CCC TCC A G A -3)
primers. Products resulting from these two PCRs were used as DNA tem plates for the final
PCR using the prP 2Y2/N hel and prP 2Y2/B glII oligonucleotides. The PCR fragments were
then cloned into the pGL4.10 luciferase vector. The presence o f the mutations was verified

124

by sequence analysis (McGill University and Genome Quebec Innovation Center,

Montral, QC, Canada).

Transient transfections and luciferase assays

Caco-2 cells or HEK 293T, at 80% confluence, were seeded in 24-well plates for 24 h. The
next day, 1 h before transfection, complete DMEM was replaced by 300 pi o f Opti-M EM ,
free o f antibiotics and antimycotics. Cells were co-transfected using LipofectAM INE 2000
with 0.1 pg o f pcD NA3.1/C /EBPfi and 0.1 pg o f the different P2Y2 promoter constructs or
0.1 pg o f pGL4.10 (control). The potential co-operation between NF-kB p65 and C/EBP(3
was determined by co-transfecting HEK 293T cells with 0.1 pg of pcD N A 3.l/C /EB Pf3 and
0.1 pg o f pcDNA3.1/NF-icB p65 and 0.1 pg o f the P 2 Y2 promoter construct or 0.1 pg o f
pG L4.10 (control). After 6 h, the Opti-M EM was replaced with complete DMEM. Two
days after transfection, luciferase activity was measured, as previously described [12]. In
some experiments, cells were stimulated for 6 h with DSS at a final concentration o f 0.5%
(w/v), with 500 ng/ml IFN-y or with 12.5 pg/ml LPS before measuring luciferase activity.
Results are normalized to Renilla luciferase expression.

Chromatin immunoprcipitation (ChlP) assays

ChIP assays were performed using the EZ ChlP assay kit protocol (M illipore, Billerica,
MA). Briefly, 80% confluent Caco-2 or HEK 293T cells were cross-linked with 1% (v/v)
formaldehyde for 10 min at 37C.

Following cross-linking, chromatin was sheared and

immunoprecipitated with 5 pg o f rabbit NF-kB p65 polyclonal antibody. Five micrograms

o f normal rabbit IgG (Upstate) were used as a negative control.

For re-ChIP assays, a

second immunoprcipitation was performed with 5 pg o f rabbit anti-C/EBPp polyclonal

antibody, after eluting the immunoprecipitated NF-kB p65-DNA complex from G protein
agarose beads. Input (10% o f the lysate before immunoprcipitation) was used to verify the
amount o f DNA in each immunoprcipitation. Immunoprecipitated DNA was purified and
amplified by real-time PCR using the QuantiTect SYBR green PCR Kit (Qiagen, Toronto,
ON) with P 2 Y2 upstream and downstream oligonucleotide primers amplifying the -221 bp

125

to -1 0 5 bp (5-ACC GGT ACA GAC ACG CTG A C -3 and 5- GGC GGA CTT TTG
ACT GAC C-3). Data are expressed as fold increase over background (negative control)
normalized to input, as previously described [ 1 2 ].

Electrophoretic mobility shift assay

Nuclear proteins were obtained as previously described [12]. Electrophoretic mobility shift
assays were performed with 5 pg o f nuclear protein extracts and 3.5 x 104 cpm o f 5 '-endlabeled [y-32P] ATP double-stranded oligonucleotides (Sense strand only is indicated;
CEBP1 (5- TCC CGT TGC AGC ACC GGT A -3), CEBP2 (5- TCG GGG TTG GGG
AGC AGC-3), CEBP3 (5- AGG GAG GTG GGT AGC C G G-3), CEBP1 mutated (5TCC ACG CGT TAT GAC GGT A -3)) in the presence o f 50 ng o f polydeoxyinosinepolydeoxycytidylate (Roche, Laval, QC) in buffer D (5 mM HEPES, 10% (v/v) glycerol,
0.05 mM EDTA, 0.125 mM PMSF).

DNA-protein complexes were separated on a

nondenaturing 5% (w/v) polyacrylamide gel run in Tris-glycine buffer, as described [12].

In supershift experiments, 3 pg o f rabbit polyclonal anti-C/EBPP antibody were used per
sample and added 20 min before the addition o f the radiolabeled probes. Gels were dried
and visualized by autoradiography.

Statistical analysis
Results are expressed as the mean SEM.

Statistical significance was determined by

performing unpaired t or ANOVA tests. The num ber o f replicates for each experiment is
presented in figure legends.

126

33. Acknowledgements
This research was supported by a Crohns and Colitis Foundation o f Canada Grant in Aid
o f Research (2009-2012) to F.P.G. and a C rohns and Colitis Foundation o f Canada Grant
in Aid o f Research (2011-2014) to C.A. and F.P.G. F.P.G. and C.A. are m em bers o f the
FRQ-S-funded Centre de Recherche Clinique tienne-Le Bel.

127

34. References
1. Abraham, C. & Cho, J. H. (2009) Inflammatory bowel disease, The New England
journal o f medicine. 361, 2066-78.
2. Laukoetter, M. G., Nava, P. & Nusrat, A. (2008) Role o f the intestinal barrier in
inflammatory bowel disease, World journal o f gastroenterology : WJG. 14, 401-7.
3. Sturm, A. & Dignass, A. U. (2008) Epithelial restitution and w ound healing in
inflammatory bowel disease, World journal o f gastroenterology : WJG. 14, 348-53.
4. Sandbom, W. (2004) Kirsner's Inflammatory Bowel Diseases, Elsevier Inc. edn,
Philadelphia.
5. Yoshida, H. & Granger, D. N. (2009) Inflammatory bowel disease: a paradigm for the
link between coagulation and inflammation, Inflammatory bowel diseases. 15, 1245-55.
6 . Danese, S. (2008) Nonimmune cells in inflammatory bowel disease: from victim to
villain, Trends Immunol. 29, 555-64.
7. Grbic, D. M., Degagne, E., Langlois, C., Dupuis, A. A. & Gendron, F. P. (2008)
Intestinal inflammation increases the expression o f the P2Y6 receptor on epithelial cells
and the release o f CXC chemokine ligand 8 by UDP, J Immunol. 180, 2659-68.
8. Ardizzone, S., Cassinotti, A., Duca, P., M azzali, C., Penati, C., Manes, G., M armo, R.,
Massari, A., Molteni, P., Maconi, G. & Porro, G. B. (2011) Mucosal healing predicts late
outcomes after the first course o f corticosteroids for newly diagnosed ulcerative colitis,
Clinical gastroenterology and hepatology : the official clinical practice jo u rn a l o f the
American Gastroenterological Association. 9, 483-489 e3.
9. Grbic, D. M., Degagn, E., Larrive, J. F., Bilodeau, M. S., Vinette, V., A rguin, G.,
Stankova, J. & Gendron, F. P. (2011) P2Y(6) receptor contributes to neutrophil recruitment
to inflamed intestinal mucosa by increasing CXC chemokine ligand 8 expression in an AP1-dependent manner in epithelial cells, Inflammatory bowel diseases.
10. Langlois, C. & Gendron, F. P. (2009) Promoting MPhi transepithelial m igration by
stimulating the epithelial cell P2Y(2) receptor, European jo u rn a l o f immunology. 39, 2895905.
11. Di Virgilio, F., Boenaems, J. M. & Robson, S. C. (2009) Extracellular nucleotides as
negative modulators o f immunity, Curr Opin Pharmacol. 9, 507-13.
12. Degagne, E., Grbic, D. M., Dupuis, A. A., Lavoie, E. G., Langlois, C., Jain, N.,
Weisman, G. A., Sevigny, J. & Gendron, F. P. (2009) P2Y2 receptor transcription is
increased by NF-kappa B and stimulates cyclooxygenase-2 expression and PGE2 released
by intestinal epithelial cells, J Immunol. 183, 4521-9.
13. Di Virgilio, F. & Robson, S. C. (2009) Identification o f novel immunosuppressive
pathways paves the way for drug discovery, Curr Opin Pharmacol. 9, 445-6.
14. Degagn, E., Degrandmaison, J., Grbic, D. M., Vinette, V., Arguin, G. & G endron, F.
P. (2012) P2Y2 receptor promotes intestinal epithelial cell migration through a Go protein
and integrin av pathway allowing microtubule stabilization and mucosal re-epithelization in
experimental colitis, J Cell Physiol, (in press).
15. Abbracchio, M. P. & Bumstock, G. (1994) Purinoceptors: are there families o f P2X
and P2Y purinoceptors?, Pharmacol Ther. 64, 445-75.
16. von Kugelgen, I. & Wetter, A. (2000) M olecular pharmacology o f P2Y-receptors,
Naunyn Schmiedebergs Arch Pharmacol. 362, 310-23.
17. Abbracchio, M. P., Bumstock, G., Boeynaems, J. M., Barnard, E. A., Boyer, J. L.,
Kennedy, C., Knight, G. E., Fumagalli, M., Gachet, C., Jacobson, K. A. & W eisman, G. A.

128

(2006) International Union o f Pharmacology LVIII: update on the P2Y G protein-coupled

nucleotide receptors: from molecular m echanisms and pathophysiology to therapy,
Pharmacological reviews. 58, 281-341.
18. Ferrero, M. E. (2012) Purinoceptors in inflammation: potential as anti-inflamm atory
therapeutic targets, Front Biosci. 17, 2172-86.
19. Mei, L., Du, W., Gao, W. & Mei, Q. B. (2010) Purinergic signaling: a novel
mechanism in immune surveillance, Acta Pharmacol Sin. 31, 1149-53.
20. Erb, L., Liao, Z., Seye, C. I. & W eisman, G. A. (2006) P2 receptors: intracellular
signaling, Pflugers Archiv : European jo u rn a l o f physiology. 452, 552-62.
21. Bilbao, P. S., Santillan, G. & Boland, R. (2010) ATP stimulates the proliferation o f
MCF-7 cells through the PI3K/Akt signaling pathway, Archives o f biochem istry and
biophysics. 499, 40-8.
22. Bagchi, S., Liao, Z., Gonzalez, F. A., Chma, N. E., Seye, C. I., W eisman, G. A. &
Erb, L. (2005) The P2Y2 nucleotide receptor interacts with alphav integrins to activate Go
and induce cell migration, The Journal o f biological chemistry. 280, 39050-7.
23. Erb, L., Liu, J., Ockerhausen, J., Kong, Q., Garrad, R. C., Griffin, K., Neal, C., Krugh,
B., Santiago-Perez, L. I., Gonzalez, F. A., Gresham, H. D., Turner, J. T. & W eisman, G. A.
(2001) An RGD sequence in the P2Y(2) receptor interacts with alpha(V)beta(3) integrins
and is required for G(o)-mediated signal transduction, J Cell Biol. 153, 491-501.
24. Ramji, D. P. & Foka, P. (2002) CCAAT/enhancer-binding proteins: structure, function
and regulation, Biochem J. 365, 561-75.
25. Boudreau, F., Blais, S. & Asselin, C. (1996) Regulation o f CCAAT/enhancer binding
protein isoforms by serum and glucocorticoids in the rat intestinal epithelial crypt cell line
IEC- 6 , Experimental cell research. 222, 1-9.
26. Gheorghiu, I., Deschenes, C., Blais, M., Boudreau, F., Rivard, N. & Asselin, C. (2001)
Role o f specific CCAAT/enhancer-binding protein isoforms in intestinal epithelial cells,
The Journal o f biological chemistry. 276, 44331-7.
27. Poli, V. (1998) The role o f C/EBP isoforms in the control o f inflammatory and native
immunity functions, The Journal o f biological chemistry. 273, 29279-82.
28. Andoh, A., Shioya, M., Nishida, A., Bamba, S., Tsujikawa, T., Kim -M itsuyam a, S. &
Fujiyama, Y. (2009) Expression o f IL-24, an activator o f the JAK1/STAT3/SOCS3
cascade, is enhanced in inflammatory bowel disease, J Immunol. 183, 687-95.
29. Cha-Molstad, H., Agrawal, A., Zhang, D., Samols, D. & Kushner, I. (2000) The Rel
family member P50 mediates cytokine-induced C-reactive protein expression by a novel
mechanism, J Immunol. 165, 4592-7.
30. Mukerjee, R., Sawaya, B. E., Khalili, K. & Amini, S. (2007) Association o f p65 and
C/EBPbeta with HIV-1 LTR modulates transcription o f the viral promoter, J Cell Biochem.
1 0 0 , 1 2 1 0 -6 .
31. Stein, B., Cogswell, P. C. & Baldwin, A. S., Jr. (1993) Functional and physical
associations between NF-kappa B and C/EBP family members: a Rel domain-bZIP
interaction, M ol Cell Biol. 13, 3964-74.
32. Koria, P. & Andreadis, S. T. (2007) KGF promotes integrin alpha5 expression through
CCAAT/enhancer-binding protein-beta, American journal o f physiology Cell physiology.
293, C l 020-31.
33. Damm, S., Koeflnger, P., Stefan, M., Weis, C., Mehes, G., Richtig, E., Kerl, H., Otte,
M. & Schaider, H. (2010) HGF-promoted motility in primary human m elanocytes depends

129

on CD44v6 regulated via NF-kappa B, Egr-1, and C/EBP-beta, J Invest Dermatol. 130,
1893-903.
34. Mammen, J. M. & Matthews, J. B. (2003) Mucosal repair in the gastrointestinal tract,
Crit Care Med. 31, S532-7.
35. Stemeck, E., Tessarollo, L. & Johnson, P. F. (1997) An essential role for C/EBPbeta in
female reproduction, Genes Dev. 11, 2153-62.
36. Perreault, N. & Beaulieu, J. F. (1998) Primary cultures o f fully differentiated and pure
human intestinal epithelial cells, Exp Cell Res. 245, 34-42.

35. Supplemental data

C/EBPp (LAP)

C/EBPp (LIP)
p-acPn
CBPp - CBPP"

CBPp-*> C/EBPft3 5% DSS

Fig. S I. Expression o f C /E B P p in the colon

o f wild-type and C /E B P p '' mice. Mice
received regular water or water supplemented
with 3.5% DSS for 5 days. Colons were
harvested and C /E B P p expression was deter
mined by western blots.

D ISC U SSIO N

Suivant la localisation du site d initiation de la transcription du gne du rcepteur

P 2 Y 2, nous avons effectu une analyse bioinformatique qui nous a permis de dterminer
que le promoteur du rcepteur P 2 Y 2 ne contient pas de bote TATA ce qui n est pas
surprenant puisquil est estim q u environ 76% des gnes humains ont un prom oteur sans
bote TATA (Yang et al., 2007). Cette analyse nous a aussi permis de dterm iner la
prsence d une rgion riche en nuclotide G et C caractristique des ilts CpG. Les ilts
CpG peuvent tre mthyls et ceci aura pour effet d empcher lexpression des gnes
auxquels ils sont associs. La mthylation des ilts CpG est retrouve dans diffrentes
maladies dont les M il (Lao et Grady, 2011; Olaru et al., 2012; Sanchez et al., 2011). Ainsi,
dans la muqueuse de patients atteints de M il, on observe une hyperm thylation d ilts CpG
de diffrents gnes dont les gnes pl6/IN K 4 et p l4 /A rf impliqus dans la rgulation du
cycle cellulaire (Hsieh et al., 1998; Lin et al., 2011; Wang et al., 2008). On pourrait croire
que lhypermthylation de ces gnes dans les M il pourrait prdisposer lapparition de
cancers colorectaux. Cependant, deux tudes rcentes ont dmontr que Thypermthylation
des ilts CpG joue un rle mineur dans lapparition de cancers colorectaux chez les patients
atteints de maladies inflammatoires intestinales (Olaru et al., 2012; Sanchez et al., 2011).
Ainsi, Thypermthylation des ilts CpG pourraient contribuer la rgulation de
lexpression du gne du rcepteur P 2 Y 2. Cependant, comme le rcepteur P 2 Y 2 est exprim
de faon ubiquitaire et que nous avons observ une augmentation de son expression chez
les patients atteints de maladies inflammatoires, il serait donc peu probable que
Thypermthylation du promoteur du rcepteur P 2 Y 2 soit impliqu dans la rgulation de son
expression (Grbic et al., 2008).
Lorsquun promoteur sans bote TATA est associ des ilts CpG, il contient
souvent des squences GC rptes prs du site d initiation de la transcription reconnue par
le facteur de transcription Spl (Briggs et al., 1986). Le facteur de transcription Spl peut
lui seul entraner le recrutement du complexe de facteurs de transcription gnraux TFIID
ainsi que de coactivateurs tels que p300 et des enzymes de remodelage de la chromatine
comme SWI/SNF et ainsi permettre la transcription basale de certains gnes (Kadam et
Emerson, 2003; Majello et al., 1998; Sadovsky et al., 1995; Soutoglou et al., 2001). Par

132

analyse bioinformatique, nous avons identifi trois sites de liaison potentiels pour le facteur
de transcription S p l. La mutagense dirige de chacun de ces sites seul ou en combinaison
pourrait nous indiquer limportance de ce facteur de transcription dans la rgulation de
lexpression du rcepteur P 2 Y 2. Ainsi nous pourrions nous attendre que la m utation des
sites de liaison pour Spl abolisse la transactivation basale du promoteur du rcepteur P2Y2.
De plus, Spl peut interagir directement avec NF-icB/p65 et entraner la transactivation des
promoteurs (Pazin et al., 1996; Perkins et al., 1994; Perkins et al., 1993). Puisque nous
avons montr que NF-icB/p65 peut transactiver le prom oteur du rcepteur P2Y2, nous
pourrions dterminer leffet de la cotransfection de ces deux facteurs de transcription sur la
transactivation du promoteur ainsi nous pourions peut-tre observer une synergie de la
transactivation du promoteur du rcepteur P2Y2.
Chez les patients atteints de maladies inflammatoires intestinales, linteraction entre
les cellules prsentatrices d antignes et la microflore locale contribue lactivation
incontrle des lymphocytes T CD4+ de la muqueuse entranant la relche de cytokines
pro-inflammatoires comme lIL- 6 , lIL-12, lIL-23, lIL-27 et lIL-17 (Derer et al., 2012;
M udter et Neurath, 2007; Perrier et Rutgeerts, 2011). Une tude prcdente de notre
laboratoire a montr que lexpression du rcepteur P2Y 2 tait augmente en condition
d inflammation intestinale (Grbic et al., 2008). Nous avons donc valid, laide de modles
cellulaires, ces observations en stimulant les cellules IEC - 6 et Caco-2 laide de la
cytokine pro-inflammatoires IL- 6 , le lipopolysaccharide (LPS) qui est une composante
antignique des parois bactriennes, et le DSS, une molcule utilise in vivo pour induire
des colites chimiques murines. Par cette approche, nous avons montr q u un stress
inflammatoire amenait la transactivation du prom oteur du rcepteur P2Y 2 et que cette
rgulation tait ralise par les facteurs de transcription C/EBPP et NF-icB/p65. Ces
rsultats taient les premiers, non seulement identifier et caractriser le prom oteur de ce
rcepteur mais aussi les premiers identifier formellement un mcanisme m olculaire et
cellulaire responsable de la rgulation de lexpression du rcepteur P2Y 2 et des rcepteurs
P2 en gnral. Bien que linteraction C\EBPp-NF-icB tait connu dans plusieurs types
cellulaires (Stein et al., 1993), mes travaux de recherche ont mis en lumire que ces deux
facteurs de transcription agissaient en synergie pour induire la transcription du rcepteur
P2Y 2 dans les CEI. En fait, les sites de liaison que nous avons identifis pour chacun de ces

133

facteurs de transcription sont situs moins de 40 bp lun de lautre. Il est donc possible,
que leffet synergique observ rsulte de la formation d un dimre N F-kB-C/EBPP au
niveau du promoteur comme il a t propos dans certaines tudes (Cha-M olstad et al.,
2000; M ukeijee et al., 2007). Les domaines protiques impliqus dans la dim risation de
ces deux facteurs pourraient comprendre le dom aine d homologie Rel de NF-icB/p65 et la
rgion bZIP de C/EBPj3 (M ukeijee et al., 2007). Cependant, une autre tude propose que la
formation de dimre NF-kB-C/EBPP

requiert la forme complte de NF-icB/p65 et le

domaine bZIP de C/EBPP (Khanjani et al., 2011). Il serait donc intressant de faire des
essais lucifrase en cotransfectant des constructions de ces deux facteurs de transcription
dont certains domaines auront t enlevs afin caractriser linteraction entre les deux
protines ncessaires la transactivation en synergie du promoteur du rcepteur P2Y i- De
plus, deux tudes ont rapport quun seul site de liaison pour C/EBP tait suffisant pour sa
coopration avec NF-kB et quun dimre de C/EBPP une fois li son site de liaison
lADN pouvait favoriser le recrutement de NF-kB son propre site de liaison (Cha-M olstad
et al., 2000; Mukerjee et al., 2007). Ainsi, il est possible que la synergie observe dans la
transactivation du promoteur du rcepteur P 2 Y 2 ne soit pas d la formation d un dimre
entre NF-kB et C/EBPP mais bien par un recrutement facilit, par exem ple de NF-kB,
suivant la liaison du dimre de C/EBPp.
Les facteurs de transcription de la famille des C/EBP reconnaissent tous la mme
squence concensus sur lADN (Ramji et Foka, 2002). Ainsi, on pourrait supposer que le
site de liaison de C/EBPp identifi sur le promoteur du rcepteur P2 Y 2 pourrait lier d autres
membres de cette famille. Parmi ceux-ci les facteurs de transcription C /EB Pa et C/EBP 8
seraient de bons candidats puisquils rgulent lexpression de gnes lis linflammation
dont des protines de la phase aigu (Boudreau et al., 1998; Dinic et al., 2005). Des
rsultats non publis ont dmontr autant en condition basale que suivant un traitement
avec le DSS que le facteur de transcription C /EB Pa transactive le prom oteur du rcepteur
P2Y 2 tel que dtermin par essais lucifrase (Voir annexe 3). Alors que le facteur de
transcription C/EBP 8 trnsactive la rgion du promoteur du rcepteur P2Y 2 seulement
aprs un traitement avec le DSS. (Voir annexe 3). Turgeon et collaborateurs ont dmontr
quen condition basale le facteur de transcription C/EBP 8 pouvait interargir avec lhistone
dactylase HDAC1 via le domaine bZIP de C/EBP 8 (Turgeon et al., 2008). Ceci

134

empchait la transcription de lhaptoglobine, un des gnes cibles de C/EBP, dans les

cellules pithliales intestinales. Cette inhibition de la transcription de lhaptoglobine tait
leve suivant un traitement avec lIL-1 (3 (Turgeon et al., 2008). Taide de Re-ChIP, il
serait intressant de vrifier si C/EBP et HDAC1 sont prsents en mme tem ps au
promoteur du rcepteur P 2 Y 2 en condition basale et en condition inflammatoire. Cependant,
d autres expriences seraient ncessaires pour affirm er que C/EBPa et C/EBP se lie au
promoteur du rcepteur P 2 Y 2 au mme site que celui identifi pour C/EBPp. Pour ce faire,
des essais lucifrase effectus en cotransfectant les cellules Caco-2 avec le vecteur
d expression des facteurs de transcription et la construction du promoteur contenant le site
de liaison de C/EBPp mut seraient tre ralises.
Les diffrentes molcules pro-inflammatoires relches lors de la phase aigu des
maladies inflammatoires intestinales peuvent entraner des modifications de la chromatine
changeant lexpression de certains gnes (Hazzalin et Mahadevan, 2005; Saccani et al.,
2002). Nous avons identifi quen condition basale, la rgion du prom oteur du rcepteur
P 2 Y 2 est actyle sur la lysine 14 et la lysine 8 des histones H3 et H4 respectivement.
Plusieurs tudes ont dmontr que ces actylations sont relis des rgions actives
transcriptionnellement (Li et al., 2007; Quina et al., 2006). Cependant, il serait intressant
de vrifier les modifications post-traductionnelles des histones suivant des stimuli pro
inflammatoires puisque lexpression du rcepteur P 2 Y 2 est augmente en ces conditions.
Ainsi, il pourrait y avoir des modifications post-traductionnelles des histones favorisant le
recrutement de coactivateurs comme p300 perm ettant la transcription du gne du rcepteur
P 2 Y 2 de faon plus importante en conditions inflammatoires. Des tudes ont rapport que
la stimulation au LPS favorisait la phosphorylation de lhistone H3 sur la srine 10 par p38
(Hazzalin et Mahadevan, 2005; Saccani et al., 2002). Cette phosphorylation de lH3S10
entraine le recrutement du facteur de transcription NF-icB/p65 (Hazzalin et Mahadevan,
2005; Saccani et al., 2002). Comme nous avons dmontr que lexpression du rcepteur
P 2 Y 2 est rgule en partie par NF-icB/p65 et que lexpression de ce rcepteur est augmente
suivant un stimulus avec une molcule pro-inflammatoire comme le LPS il serait
intressant de vrifier cette modification de lhistone H3 par immunoprcipitation de la
chromatine spcifiquement au niveau du prom oteur du rcepteur P2 Y 2.

135

Bien que nous n ayons pas abord cette hypothse dans les articles publis, il n est
pas exclure que la rgulation de lexpression du rcepteur P 2 Y 2 pourrait tre influence
par les micros ARN (miARN). Il est connu dans la littrature que lexpression d autres
membres de la famille des rcepteurs P2, soient les rcepteurs P2X7 et P 2 Y i 2, peut tre
rgule par des miARN (Landry et al., 2009; Rahman et al., 2010). De plus, de rcentes
tudes ont dmontr quil y a un profil d expression distinct de miRNA dans les cellules
pithliales intestinales de patients atteints de maladie de Crohn et de colite ulcreuse
comparativement aux tissus sains (Wu et al., 2011; Wu et al., 2010; Wu et al., 2008). Par
ailleurs, une analyse de la rgion 3 UTR de P 2 Y 2

l aide du logiciel RegRNA

(http://regma.mbc.nctu.edu.tw/html/prediction.html) a permis d identifier plusieurs miRNA

pouvant interargir avec lARNm du rcepteur P 2 Y 2 . Parmi les miRNA identifis, miR-19b
et miR-629 pourraient rguler lexpression du rcepteur P 2 Y 2. On observe chez les patients
atteints de la maladie de Crohn, une diminution de lexpression de ces mmes miRNA dans
les rgions inflammes (W u et al., 2010). Ainsi, la diminution de lexpression de m iR-19b
et miR-629 dans les tissus de ces patients pourraient permettre d expliquer en partie
laugmentation de lexpression du rcepteur P 2 Y 2 tel quidentifi prcdemm ent dans les
tissus de patients atteints de maladies inflammatoires intestinales (Grbic et al., 2008).
Nous avons dmontr que la stimulation du rcepteur P 2 Y 2 stimule lexpression de
la cyclooxygnase-2 (COX-2) et subsquemment la relche de PGE 2 par les CEI. La PGE 2
a rcemment t rapport pour avoir un rle protecteur dans linflammation et de favoriser
la rparation de blessures. Deux tudes ont aussi montr que PGE 2 avait un effet protecteur
suivant lactivation du rcepteur de type Toll 4 dans un modle murin de colite chimique
induit au DSS (Brown et al., 2007; Fukata et al., 2006; Fukata et al., 2005). Ces
observations nous ont donc pousss tudier le rle du rcepteur P 2 Y 2 dans la protection et
la rparation de lpithlium intestinal. L impact du rcepteur P 2 Y 2 sur les mcanism es de
rparation tissulaire avait pralablement t dcrit dans un modle de blessure de corne de
lapin (Crooke et al., 2009). Dans cette tude, les auteurs avaient montr que linhibition de
lexpression du rcepteur P 2 Y 2, par interfrence lARN, bloquait le processus de r
pithlisation de la corne en prsence d UTP (Crooke et al., 2009). Dans lintestin, les
travaux raliss par Dignass et collaborateur avaient montr que lATP entrainait une
augmentation de la rparation de blessure d une monocouche de cellules pithliales

136

intestinales (Dignass et al., 1998). Cependant, le ou les rcepteurs impliqus et les

mcanismes cellulaires n taient pas connus. M es rsultats ont, dans un prem ier temps,
confirms ceux obtenus par Dignass. Cependant, mes travaux ont perm is non seulement
d identifier que le rcepteur P 2 Y 2 tait responsable de ce phnomne, m ais ils ont aussi mis
en lumire le processus cellulaire impliqu. Il tait connu que lactivation du rcepteur
P 2 Y 2 peut stimuler la migration cellulaire en agissant entre autre sur le cytosquelette
d actine (Bagchi et al., 2005; Erb et al., 2001; Liao et al., 2007). En fait, dans un modle
cellulaire utilisant les astrocytomes 132IN I surexprimant le rcepteur P 2 Y 2, il a t
dmontr que la stimulation de P 2 Y 2 par lUTP induit la migration cellulaire par un
mcanisme dpendent du recrutement de la protine Go suite linteraction du rcepteur
P2 Y 2 avec lintgrine av(33 et/ou a v p 5 (Bagchi et al., 2005; Erb et al., 2001). Bien que
nous ayons aussi observ une certaine modulation du cytosquelette d actine, mes travaux
ont principalement mis en lumire que lactivation du rcepteur P 2 Y 2 en cooprant avec la
sous-unit a v des intgrines entrane la stabilisation des microtubules associs la
migration cellulaire tel que dmontr par immunofluorescence. Ces rsultats ont aussi t
confirms par immunobuvardage en utilisant un anticorps dirig contre la forme actyle de
la-tubuline (rsultats non publis).

Linteraction physique entre la sous-unit a v des

intgrines et le rcepteur P 2 Y 2 fut dmontre par les travaux de Erb et collaborateurs (Erb
et al., 2001) et ceux de Bagchi et collaborateurs (Bagchi et al., 2005). Cependant, ce type
interaction n a jam ais t dmontre dans un systme dont lexpression du rcepteur P 2 Y 2
tait endogne et encore moins dans les cellules pithliales intestinales. Nous pourrions
donc dterminer par immunoprcipitation linteraction physique du rcepteur P 2 Y 2 avec la
sous-unit a v de lintgrine. Par la suite, nous pourrions tablir plus en dtails le rle de la
stabilisation des microtubules dans la migration cellulaire des cellules pithliales
intestinales. Nous pourrions tout d abord nous intresser la dtyrosination de la tubuline
qui est une modification post-traductionnelle qui augmente la stabilit des m icrotubules et
favorise la migration cellulaire dans diffrents types cellulaires comme les fibroblastes
(Goulimari et al., 2005; Gundersen et Bulinski, 1988; Palazzo et al., 2004). Ainsi, nous
pourrions raliser des immunofluorescences suivant la stimulation du rcepteur P 2 Y 2 avec
ses agonistes en utilisant un anticorps dirig contre la forme dtyrosine de la tubuline.
Finalement, nous pourrions dmontrer limpact rel de la stabilisation des m icrotubules sur

137

la migration cellulaire d une monocouche de cellules pithliales intestinales blesses

suivant la stimulation avec les agonistes du rcepteur P 2 Y 2 en utilisant la colchicine qui a
pour rle de bloquer la stabilisation des microtubules (Escuin et al., 2005).
Malgr que mes travaux aient port principalement sur la stabilisation des
microtubules par le rcepteur P 2 Y 2, nous avons montr que lactivation du rcepteur P 2 Y 2
peut moduler le cytosquelette d actine. De plus, nous avons dmontr que lactivation du
rcepteur P 2 Y 2 entraine une augmentation du nombre de points focaux. Ces points focaux
ont un rle important dans la migration cellulaire puisquils permettent la cellule en
migration de garder le contact avec la matrice extracellulaire (Huttenlocher et Horwitz,
2011). Ils sont composs d agrgats (cluster) d intgrines qui s associent un large
complexe de molcule de signalisation comme les kinases d adhsions focales (FAK), la
taline, la vinculine, la paxilline et la-actinine qui sont lis au cytosquelette d actine
(Huttenlocher et Horwitz, 2011; Nagano et al., 2012). Les points focaux perm ettent ainsi
par leur interaction avec le cytosquelette d actine d tablir une force de traction pour
permettre la cellule d avancer et aussi fournir une plateforme pour la signalisation
cellulaire associe la migration (Huttenlocher et Horwitz, 2011). Par exemple, linhibition
de lexpression de lintegrin-linked kinase (ILK) retrouve aux points focaux dans les
cellules pithliales intestinales humaines a rvl une diminution de la m igration cellulaire
due une rduction de la dposition de fibronectine qui est une composante de la matrice
extracellulaire (Gagne et al., 2010). Ainsi, puisque la stimulation du rcepteur P 2 Y 2
augmente le nombre de points focaux, il serait intressant de dterminer la localisation
cellulaire de la sous-unit av des intgrines avec laquelle le rcepteur P 2 Y 2 peut cooprer.
D ailleurs, une tude ralise par Chm a et collaborateurs a m ontr que suivant la
stimulation des cellules U-937 avec les agonistes du rcepteur P 2 Y 2, il y avait une
redistribution des sous-units a v des intgrines aux point focaux dadhsion (Chm a et al.,
2007). Nous pourrions donc vrifier par immunofluorescence la localisation des sous-units
a v des intgrines suivant la stimulation du rcepteur P 2 Y 2 ainsi que la localisation du
rcepteur dans les cellules pithliales intestinales. Ainsi, le rcepteur P 2 Y 2 aurait un rle
central dans, la rorganisation du cytosquelette d actine et des microtubules et serait un
rgulateur cl dans la migration des cellules pithliales intestinales. Ces rsultats sont les

138

premiers montrer une corrlation entre lactivation d un rcepteur purinergique et les

microtubules dans la migration des cellules pithliales intestinales.
Bien que les rsultats obtenus semblent indiquer que lactivation du rcepteur P 2 Y 2
favorise la migration cellulaire en permettant la rorganisation du cytosquelette, il est aussi
mentionn dans la littrature que la stimulation du rcepteur augmente la prolifration
cellulaire (Burrell et al., 2003; Dixon et al., 1999). L augmentation de la migration
cellulaire pourrait donc ne pas tre la seule consquence suivant lactivation du rcepteur
P 2 Y 2 en contexte de rparation pithliale intestinale. Ainsi, il pourrait y avoir une
augmentation de la prolifration cellulaire qui contribuerait favoriser la rparation de
blessures. Deux quipes ont dmontr en utilisant des kratynocytes stimules avec lATP
et lUTP que lactivation du rcepteur P 2 Y 2 augmentait la prolifration cellulaire (Bilbao et
al., 2010; Burrell et al., 2003; Dixon et al., 1999). Ils concluaient que ce pourrait tre l un
rle important du rcepteur dans la rparation de blessures (Burrell et al., 2003; Dixon et
al., 1999). Dans les expriences ralises au chapitre 2 de cette thse, aucun agent antiprolifratif n a t ajout dans le milieu des cellules IEC -6 utilises pour les essais de
blessures. Ces cellules bien que prives de srum pouvaient prsenter une augm entation de
la prolifration cellulaire suivant une stimulation avec les nuclotides extracellulaires.
Cependant, aucune courbe de prolifration na t ralise lors de cette tude. Par contre,
ltude ralise par Dignass et collaborateurs, a dmontr que 24 h suivant la stimulation
des cellules IEC -6 avec 100 pM d ATP, quil y avait une diminution significative de la
prolifration cellulaire de plus de 50% comparativement aux cellules non stimules
(Dignass et al., 1998). Ainsi, des courbes de prolifration ou un marquage au BrDu (un
marqueur de prolifration cellulaire) seraient requis afin de dterminer si le rcepteur P 2 Y 2
promouvoit la rparation de blessure en augmentant aussi la prolifration cellulaire des
cellules IEC -6 bien que ltude ralis par Dignass et collaborateurs semblent indiquer que
ce ne serait pas le cas (Dignass et al., 1998).La rorganisation des m icrotubules suivant la
stimulation du rcepteur P 2 Y 2 pourraient aussi tre applicables au cancer. Les cellules
cancreuses se divisent constamment et dans ce contexte les microtubules jouent un rle
essentiel (Zhou et Giannakakou, 2005). En effet, les microtubules sont des composantes
essentielles la formation des fuseaux mitotiques qui doivent imprativement tre forms
pour que la mitose ait lieu (Alberts et al., 2008). Les microtubules vont sassem bler partir

139

des centrosomes qui servent de site pour la nuclation des microtubules (Alberts et al.,
2008). On compte deux centrosomes dans la cellule en division et ils sont localiss
chacun des ples de la cellule (Alberts et al., 2008). Ainsi, on retrouvera trois classes de
microtubules. Tout d abord les microtubules axiaux qui radient vers le cortex de la cellule,
les microtubules interpolaires qui interagissent avec les microtubules de lautre ple et
finalement les microtubules relis aux kintochores qui leur permettent de sattacher la
chromatide sur et de les aligner sur la plaque mitotique (Alberts et al., 2008). Les
microtubules reprsentent donc des cibles thrapeutiques de choix de lindustrie
pharmaceutique dans le traitement des cancers puisque la dstabilisation des microtubules
aura pour effet d empcher la formation des fuseaux mitotiques et ultimem ent de prvenir
la sgrgation des chromatides surs (Zhou et Giannakakou, 2005). Il en rsultera
lapoptose de la cellule puisque celle-ci ne pourra passer le point de contrle G2/M qui
consiste en la vrification que les chromatides surs sont aligns sur la plaque mitotique
(Alberts et al., 2008; Zhou et Giannakakou, 2005). Ainsi la cellule cancreuse sera donc
cible par des drogues comme le taxol, qui ont pour rle de dstabiliser les m icrotubules et
de les rendre ainsi susceptible lapoptose (Guo et al., 2010; Zhou et Giannakakou, 2005).
Il savre donc que mes travaux de recherche pourraient avoir une porte beaucoup plus
grande que les maladies inflammatoires intestinales, puisquen contrlant lactivation du
rcepteur par des agonistes slectifs nous pourrions, peut tre, agir sur la formation du
fuseau mitotique. Bien sur, cette hypothse demeure tre valide. Par contre, dans ce
contexte, il a t not que lexpression du rcepteur P 2 Y 2 tait augment dans les tumeurs
colorectales (Nylund et al., 2007). Ainsi bien que le rle du rcepteur P 2 Y 2 semble tre
bnfique pour favoriser la rparation de lpithlium intestinal, la stimulation du rcepteur
P 2 Y 2 en contexte tumorale pourrait favoriser la prolifration cellulaire en entranant la
stabilisation des microtubules ncessaires la formation des fuseaux mitotiques.
Comme mes travaux de recherche ne visaient pas seulement comprendre les
mcanismes molculaires rgulant lexpression du rcepteur P 2 Y 2, mais aussi identifier le
rle de ce rcepteur dans les maladies inflammatoires, nous avons dmontr dans un
modle murin de colite chimique induit au DSS que les souris qui ont reu des injections
intra-rectales de 2-thioUTP pendant la phase de rmission ont une diminution significative
de lindex de svrit de la maladie et des comptes histologiques. Le 2-thioUTP est un

140

agoniste de synthse du rcepteur P 2 Y 2 qui possde un E C 50 dix fois plus spcifique pour
ce rcepteur comparativement au rcepteur P 2 Y 4 (El-Tayeb et al., 2006). La concentration
utilise pour les injections intrarectales de 2 pg/g du poids de la souris pourrait donc aussi
activer le rcepteur P 2 Y 4. Par contre, aucune tude ne sest penche sur le rle du rcepteur
P2Y 4 dans la rparation pithliale. Puisquil n existe aucun agoniste spcifique pour ces
rcepteurs P2Y, lutilisation de souris transgnisque dont lexpression du rcepteur P 2 Y 4
ou P 2 Y 2 aurait t invalid serait essentielle pour conclure du rle du rcepteur P2Y 2 dans
la rmission des souris traites au DSS. Cependant, des souris P 2 Y 2_/ atteintes d une colite
chimique ont un index de svrit de la maladie significativement plus lev que les souris
de type sauvage (rsultats non publis, voir Annexe 2). Par ailleurs, la translocation des
bactries

dans la rate est significativem ent plus leve chez

les souris

P 2 Y 2' '

comparativement aux souris de type sauvage suivant un traitement au DSS (rsultats non
publis, voir Annexe 2). Ces rsultats bien que prliminaires indiquent que le rcepteur
P 2 Y 2 possdent un rle important dans le maintien de lintgrit de la barrire pithliale
intestinale.
Bien qu/'n vitro, nous avons dmontr que le rcepteur P2Y 2 favorise la migration
cellulaire suivant une blessure, il n est pas exclure que le rle exact du rcepteur P 2 Y 2 in
vivo implique d autres processus et la participation de cellules autre que les CEI. Le
rcepteur P 2 Y 2 est, en effet, exprim la surface de plusieurs cellules du systme
immunitaire dont les macrophages et les neutrophiles qui ont des rles essentiels dans la
rparation de blessures (Bowler et al., 2003; Chen et al., 2006). Comme mentionn dans
lintroduction, les macrophages activs suivant une blessure vont se retrouver prs de la
niche des cellules souches et favoriser leur prolifration et leur survie (Pull et al., 2005). De
plus, ils vont jouer un rle trs important en limitant lentre de pathognes et en
phagocytant les dbris cellulaires (Reichner et al., 2001). Finalement, les macrophages
permettent de contrler lactivit des neutrophiles en induisant lapoptose de ceux-ci
(M eszaros et al., 2000). Malgr leurs actions destructrices, laction des neutrophiles est
ncessaire au processus de rparation. Les neutrophiles vont scrter des facteurs de
croissance, des lipides mdiateurs de rparation comme les lipoxines et vont participer la
phagocytose des dbris cellulaires accum uls au site de la blessure (Fournier et Parkos,
2012). Il a t dmontr que les macrophages et les neutrophiles vont migrer par

141

chimiotaxie en suivant un gradient d agonistes du rcepteur P 2 Y 2 (Chen et al., 2006;

Kronlage et al., 2010). Ainsi, linstillation de 2-thioUTP pourrait favoriser le recrutement
par chimiotaxie de ces cellules pour leur permettrent d effectuer leurs rles dans la phase de
rmission. Une autre hypothse qui pourrait tre avance est que la stim ulation avec le 2thioUTP favoriserait la scrtion de mucus par les cellules caliciformes. Il a t dmontr
dans lpithlium pulmonaire que la stimulation du rcepteur P 2 Y 2 tait responsable de la
scrtion de mucus dans le poumon (Ehre et al., 2007). Ainsi, on pourrait supposer q u il en
serait de mme dans lintestin et que laugmentation de la scrtion de mucus par les
cellules caliciformes pourrait faciliter un retour lhomostasie intestinale en empchant
les bactries et antignes de la lumire de transloquer dans lintestin.
Les rsultats obtenus in vivo dmontrent que le rcepteur P 2 Y 2 pourrait tre une
cible de choix dans le traitement des maladies inflammatoires intestinales. La rparation de
blessures causes lors des maladies inflammatoires intestinales est essentielle pour la
rmission (Rieder et al., 2007). Toutefois, une rparation excessive pourrait favoriser
lapparition de zone fibrotique et m ener la stnose intestinale qui se caractrise par un
rtrcissement du diamtre de la lumire intestinale (Rieder et al., 2007). En fait, il a t
dmontr dans certaines tudes que le rcepteur P 2 Y 2 favorise la fibrose du muscle
cardiaque suivant une blessure (Braun et al., 2010; Lu et al., 2012). En effet, suivant la
stimulation du rcepteur P2 Y 2, il y a une augmentation de la prolifration et de la migration
des fibroblastes cardiaques au site de la blessure rsultant en la dposition m assive de
collagne qui est une composante de la matrice extracellulaire (Braun et al., 2010; Lu et al.,
2012). Ainsi, lactivation du rcepteur P 2 Y 2 doit tre bien rgule dans le tem ps puisque
ladministration d agonistes de ce rcepteur durant une longue priode de temps pourrait
ventuellement favoriser la prsence de fibrose intestinale. Il n en demeure pas moins que
mes travaux pavent la voie de nouvelles approches thrapeutiques visant non seulement
rduire linflammation, mais de faon plus importante stimuler le processus de rmission
suivant

un

pisode

aigu

dinflammation

intestinale.

CONCLUSION

Chez les patients atteints de maladies inflammatoires intestinales, une susceptibilit

gntique prdispose une drgulation de la rponse du systme immunitaire envers les
bactries de la microflore (Abraham et Cho, 2009). Ceci favorise la production et la
scrtion d une panoplie de mdiateurs inflammatoires dont les nuclotides extracellulaires
(Derer et al., 2012; Grbic et al., 2008; M udter et Neurath, 2007; Perrier et Rutgeerts, 2011).
Ceux-ci seront relchs par diverses sources comme les cellules endommages ou encore
suite l'activation des cellules du systme immunitaire. Leurs effets se font sentir par
l'activation slective des rcepteurs purinergiques (Eltzschig et al., 2006; Grbic et al., 2008;
Hart et al., 2008). Notre quipe a publi une tude dans laquelle nous dmontrions que
lexpression du rcepteur purinergique P 2 Y 2 tait augmente dans les tissus coliques de
patients atteints de maladies inflammatoires intestinales (Grbic et al., 2008). En plus de ces
travaux, plusieurs autres tudes avaient pralablement montr une augmentation de
lexpression de ce rcepteur dans dautres maladies inflammatoires (Schrader et al., 2005;
Seye et al., 2002). Ces rsultats nous ont pouss nous dem ander quels sont les
mcanismes transcriptionnels qui rgulent lexpression du rcepteur P 2 Y 2 et quel rle jouet-il dans les maladies inflammatoires intestinales.
Plus rcemment, une tude avait propos le facteur de transcription N F-kB comme
tant un possible rgulateur de lexpression du rcepteur P 2 Y 2 (Kong et al., 2009). Malgr
tout, les mcanismes molculaires contrlant lexpression du rcepteur P 2 Y 2 tait ce jour
inconnu.

Nous avons donc entrepris des tudes visant dterminer les mcanismes

transcriptionnels rgulant lexpression du rcepteur P 2 Y 2. Lidentification du

site

d initiation de la transcription ainsi que la caractrisation du promoteur du rcepteur P 2 Y 2

n avait jam ais t tudie dans aucun type cellulaire. J'ai donc identifi le site d'initiation de
la transcription du gne humain de P 2 Y 2 et m is en lumire que ce gne ne possde pas de
bote TATA.

J ai ensuite entrepris de caractriser la rgion du prom oteur du rcepteur

P 2 Y 2 et j ai identifi des sites de liaison pour les facteurs de transcription C/EBPp et NFKB/p65. Ces facteurs de transcription rgulent en partie lexpression du rcepteur P 2 Y 2 en
conditions physiologiques mais aussi en conditions inflammatoires tels que celles
retrouves chez les patients atteints de maladies inflammatoires intestinales. Ces rsultats

143

portant sur la caractrisation de la rgion du prom oteur du rcepteur P 2 Y 2 auront un impact

beaucoup plus important que celui appliqu aux MIL En effet, laugm entation de
lexpression du rcepteur P 2 Y2 dans plusieurs maladies inflammatoires est m ajoritairement
dfavorable la rsolution de la maladie (Schrader et al., 2005; Seye et al., 2002). Ainsi, la
connaissance des facteurs de transcription impliqus dans la rgulation de ce rcepteur en
conditions inflammatoires pourrait ouvrir la voie des traitements cibls de ces maladies.
Le rle du rcepteur P 2 Y 2 dans les M il demeurait ju sq u prsent inconnu.
Plusieurs travaux ont dmontr que lactivation du rcepteur P 2 Y 2 augmente la vitesse de
rparation de blessure en activant les voies de signalisation ncessaire la rorganisation
du cytosquelette d actine impliqu la migration cellulaire (Boucher et al., 2007; Crooke
et al., 2009; Kaczmarek et al., 2005; Liao et al., 2007). Ainsi, j ai dm ontr in vitro que
lactivation du rcepteur P 2 Y 2 favorise la migration des cellules pithliales intestinales en
favorisant la stabilisation des microtubules via lactylation de la-tubuline qui est une
modification post-traductionnelle des microtubules favorisant la m igration cellulaire
(Creppe et al., 2009). En consquence, ces rsultats sont les premiers dm ontrer que le
rcepteur P 2 Y 2 favorise la migration cellulaire par d autres voies de signalisation que celles
impliques dans la rorganisation du cytosquelette d actine. Le rcepteur P 2 Y 2 pourrait
donc

reprsenter l'une

des pierres

angulaires

essentielles au

ram nagem ent du

cytosquelette ncessaire la migration cellulaire.

Par ailleurs, ltude in vivo que j ai ralise a permis de dm ontrer que
ladministration intra-rectale de 2-thioUTP favorise la rmission de souris atteintes d une
colite chimique suivant un traitement au DSS. Bien que la dose utilise de 2pg/g de 2thioUTP n ait pas permis une rparation complte de lpithlium intestinale, lutilisation
prolonge ou une dose plus grande pourrait tre envisage afin de raccourcir la phase de
rparation menant la rmission complte. Les rsultats obtenus dans cette tude in vivo
permettent de proposer un rle important pour le rcepteur P2Y 2 dans les maladies
inflammatoires intestinales en faisant une cible thrapeutique de choix. La majorit des
traitements destins aux patients atteints de maladies inflammatoires intestinales ont pour
but de diminuer linflammation durant la phase chronique de la maladie, mais peu de
mdicaments favoriseent la phase de rparation (Ardizzone et al., 2011; Pineton de
Chambrun et al., 2010). Ges thrapies pourraient aider la rmission long terme puisque les

144

rechutes sont souvent associes une mauvaise rparation (Ardizzone et al., 2011). Ainsi,
la gnration d agonistes de synthse spcifiques et stables pourrait reprsenter une
nouvelle voie de traitement des maladies inflammatoires intestinales.
En conclusion, ltude de la rgulation de lexpression et du rle du rcepteur P 2 Y2
a permis de reconnatre que ce rcepteur est un joueur important dans les MIL
Lidentification du promoteur et des facteurs de transcription rgulant lexpression du
rcepteur P 2 Y 2 auront des impacts dans la comprhension des autres pathologies dans
lesquelles une augmentation de son expression est observe. De plus, les rsultats obtenus
indiquant que le rcepteur P 2 Y 2 favorise la rparation de blessure in vitro et la phase de
rmission in vivo ouvrent la voie toute une nouvelle catgorie de molcules au fort
potentiel thrapeutique pour les patients atteints de MIL

145

REMERCIEM ENTS

Je tiens tout d abord remercier les membres de mon jury soit les Professeurs JeanFranois Ct, Abdelaziz Amrani, Franois Boudreau et Femand-Pierre Gendron pour le
temps et lintrt quils ont investi dans la correction de cette thse.
Un remerciement tout spcial mon directeur de recherche, Pr Fem and-Pierre
Gendron (Patron), qui m a accueillie dans son laboratoire en juin 2006. Au cours de ces
annes passes dans ton laboratoire, j ai eu la chance d apprendre normment. La libert
scientifique que tu m as laisse a t tellement apprcie et m a permis de dcouvrir mon
potentiel scientifique. Tu as aussi fait preuve d une grande patience et confiance envers moi
qui parfois manque un peu dassurance! Je ressors de cette exprience grandie et prte
affronter de nouveaux dfis.
Je voudrais aussi remercier les membres prsents et passs du laboratoire. AndreAnne, Karine, Djordje, Christine, Valrie, Maude, Jean-Franois et Guillaume. On peut
dire quen toutes ces annes, on a eu du plaisir! Que de sorties et party mm orables on a eu
tous ensemble! Je tiens aussi rem ercier les autres membres du dpartement d anatomie et
biologie

cellulaire

particulirement Vronique

Giroux,

Grald

Bem atchez,

Benot

Marchand, Naomie Turgeon et Franois Brial sans qui m on heure de dner aurait t
particulirement moins anim! Je remercie aussi Valrie et Vronique pour les nombreux
desserts quelles ont apports au fil des annes et qui me remplissaient de bonheur chaque
fois! Aussi, je tiens remercier tous les tudiants avec lesquels j ai assist des congrs.
Ce ft un rel plaisir d apprendre vous connatre et de dcouvrir de nouveaux endroits
avec vous.
Je remercie mes parents qui ont su m appuyer dans toutes les tapes de mon
cheminement acadmique. Je veux videmment dire merci ma fille Lily qui a t trs
comprhensive avec sa maman! Finalement, je remercie m on mari Gabriel qui cette
russite appartient aussi puisque sans son support indfectible, mon cheminem ent aurait t
beaucoup plus ardu.

146

LISTES DES PUBLICATIONS

Abbracchio MP, Bumstock G, Boeynaems JM, Barnard EA, Boyer JL, Kennedy C, Knight
GE, Fumagalli M, Gachet C, Jacobson KA and W eisman GA (2006) International Union o f
Pharmacology LVIII: update on the P2Y G protein-coupled nucleotide receptors: from
molecular mechanisms and pathophysiology to therapy. Pharmacological reviews 58:281341.
Abraham C and Cho JH (2009) Inflammatory bowel disease. The New England jo u rn a l o f
medicine 361:2066-2078.
A kira S and Kishimoto T (1997) N F-IL 6 and NF-kappa B in cytokine gene regulation.
Advances in immunology 65:1-46.
Albers TM, Lomakina I and Moore RP (1995) Fate o f polarized m embrane components
and evidence for microvillus disassembly on migrating enterocytes during repair o f native
intestinal epithelium. Laboratory investigation; a jo u rn a l o f technical m ethods and
pathology 73:139-148.
Albert JL, Boyle JP, Roberts JA, Challiss RA, Gubby SE and Boarder M R (1997)
Regulation o f brain capillary endothelial cells by P2Y receptors coupled to Ca2+,
phospholipase C and mitogen-activated protein kinase. British journal o f pharm acology
122:935-941.
Alberts B, Johnson A, Lewis J, R aff M, Roberts K and W alter P (2008) M olecular Biology
o f THE CELL, Garland Science, Taylor & Francis Group, LLC.
Andoh A, Fujiyama Y, Hata K, Araki Y, Takaya FI, Shimada M and Bam ba T (1999)
Counter-regulatory effect o f sodium butyrate on tum our necrosis factor-alpha (TNF-alpha)induced complement C3 and factor B biosynthesis in hum an intestinal epithelial cells.
Clinical and experimental immunology 118:23-29.
Annese V, Piepoli A, Latiano A, Lombardi G, Napolitano G, Caruso N, Cocchiara E,
Accadia L, Perri F and Andriulli A (2005) HLA-DRB1 alleles may influence disease
phenotype in patients with inflammatory bowel disease: a critical reappraisal with review
o f the literature. Diseases o f the colon and rectum 48:57-64; discussion 64-55.
Ardizzone S, Cassinotti A, Duca P, Mazzali C, Penati C, M anes G, M armo R, M assari A,
Molteni P, Maconi G and Porro GB (2011) M ucosal healing predicts late outcomes after
the first course o f corticosteroids for newly diagnosed ulcerative colitis. Clinical
gastroenterology and hepatology : the official clinical practice journal o f the American
Gastroenterological Association 9:483-489 e483.
Atarashi K, Nishimura J, Shima T, Umesaki Y, Yamamoto M, Onoue M, Yagita H, Ishii N,
Evans R, Honda K and Takeda K (2008) ATP drives lamina propria T(H)17 cell
differentiation. Nature 455:808-812.
Bagchi S, Liao Z, Gonzalez FA, Chm a NE, Seye C l, W eisman GA and Erb L (2005) The
P2Y2 nucleotide receptor interacts with alphav integrins to activate Go and induce cell
migration. The Journal o f biological chemistry 280:39050-39057.
Ballerini P, Di Iorio P, Caciagli F, Rathbone MP, Jiang S, Nargi E, Buccella S, Giuliani P,
D'Alimonte I, Fischione G, Masciulli A, Romano S and Ciccarelli R (2006) P2Y2 receptor
up-regulation induced by guanosine or UTP in rat brain cultured astrocytes. International
journal o f immunopathology and pharm acology 19:293-308.

147

Batlle E (2008) A new identity for the elusive intestinal stem cell. Nature genetics 40:818819.
Bernstein CN, W ajda A, Svenson LW, M acKenzie A, K oehoom M, Jackson M, Fedorak R,
Israel D and Blanchard JF (2006) The epidem iology o f inflammatory bowel disease in
Canada: a population-based study. The Am erican jo u rn a l o f gastroenterology 101:15591568.
Bilbao PS, Santillan G and Boland R (2010) ATP stim ulates the proliferation o f M CF-7
cells through the PI3K/Akt signaling pathway. Archives o f biochemistry a nd biophysics
499:40-48.
Bjerknes M and Cheng H (1981) The stem-cell zone o f the small intestinal epithelium . IV.
Effects o f resecting 30% o f the small intestine. The Am erican journal o f anatom y 160:93103.
Blais S, Boudreau F, Beaulieu JF and Asselin C (1995) CCAAT/enhancer binding protein
isoforms expression in the colon o f neonatal mice. Developmental dynamics : an official
publication o f the American Association o f Anatomists 204:66-76.
Boarder MR and Hourani SM (1998) The regulation o f vascular function by P2 receptors:
multiple sites and multiple receptors. Trends in pharm acological sciences 19:99-107.
Boissan M, Dabemat S, Peuchant E, Schlattner U, Lascu I and Lacombe ML (2009) The
mammalian Nm23/NDPK family: from metastasis control to cilia movement. Molecular
and cellular biochemistry 329:51 -62.
Boucher I, Yang L, Mayo C, Klepeis V and Trinkaus-Randall V (2007) Injury and
nucleotides induce phosphorylation o f epidermal growth factor receptor: M M P and HBEGF dependent pathway. Experimental eye research 85:130-141.
Boudreau F, Blais S and Asselin C (1996) Regulation o f CCAAT/enhancer binding protein
isoforms by serum and glucocorticoids in the rat intestinal epithelial crypt cell line IEC- 6 .
Experimental cell research 222:1-9.
Boudreau F, Yu SJ and Asselin C (1998) CCAAT/enhancer binding proteins beta and delta
regulate alphal-acid glycoprotein gene expression in rat intestinal epithelial cells. DNA and
cell biology 17:669-677.
Bowler JW, Bailey RJ, North RA and Surprenant A (2003) P2X4, P2Y1 and P2Y2
receptors on rat alveolar macrophages. British jo u rn a l ofpharm acology 140:567-575.
Braun M, Lelieur K and Kietzmann M (2006) Purinergic substances promote murine
keratinocyte proliferation and enhance impaired wound healing in mice. Wound repair and
regeneration : official publication o f the Wound H ealing Society [and] the European
Tissue Repair Society 14:152-161.
Braun OO, Lu D, Aroonsakool N and Insel PA (2010) Uridine triphosphate (UTP) induces
profibrotic responses in cardiac fibroblasts by activation o f P2Y2 receptors. Journal o f
molecular and cellular cardiology 49:362-369.
Briggs MR, Kadonaga JT, Bell SP and Tjian R (1986) Purification and biochemical
characterization o f the promoter-specific transcription factor, S p l. Science 234:47-52.
Brown SL, Riehl TE, W alker MR, Geske MJ, Doherty JM, Stenson WF and Stappenbeck
TS (2007) M yd 8 8 -dependent positioning o f Ptgs2-expressing stromal cells maintains
colonic epithelial proliferation during injury. The Journal o f clinical investigation 117:258269.
Bumstock G (1976) Do some nerVe cells release more than one transmitter? Neuroscience
1:239-248.

148

Burrell HE, Bowler WB, Gallagher JA and Sharpe GR (2003) Human kratinocytes
express multiple P2Y-receptors: evidence for functional P2Y1, P2Y2, and P2Y4 receptors.
The Journal o f investigative dermatology 120:440-447.
Buscher R, Hoem ing A, Patel HH, Zhang S, A rthur DB, Grasemann H, Ratjen F and Insel
PA (2006) P2Y2 receptor polymorphisms and haplotypes in cystic fibrosis and their impact
on Ca2+ influx. Pharmacogenetics and genom ics 16:199-205.
Cesena TI, Cardinaux JR, Kwok R and Schwartz J (2007) CCAAT/enhancer-binding
protein (C/EBP) beta is acetylated at multiple lysines: actylation of C/EBPbeta at lysine 39
modulates its ability to activate transcription. The Journal o f biological chem istry 282:956967.
Cha-M olstad H, Agrawal A, Zhang D, Samols D and Kushner I (2000) The Rel family
member P50 mediates cytokine-induced C-reactive protein expression by a novel
mechanism. J Immunol 165:4592-4597.
Chen L, Fischle W, Verdin E and Greene WC (2001) Duration o f nuclear NF-kappaB
action regulated by reversible actylation. Science 293:1653-1657.
Chen LF, Mu Y and Greene WC (2002a) Actylation o f Rel A at discrete sites regulates
distinct nuclear functions o f NF-kappaB. The EM BO jo u rn a l 21:6539-6548.
Chen Y, Chou K, Fuchs E, Havran WL and Boism enu R (2002b) Protection o f the
intestinal mucosa by intraepithlial gam m a delta T cells. Proceedings o f the National
Academy o f Sciences o f the United States o f Am erica 99:14338-14343.
Chen Y, Corriden R, Inoue Y, Yip L, Hashiguchi N, Zinkem agel A, N izet V, Insel PA and
Junger WG (2006) ATP release guides neutrophil chemotaxis via P2Y2 and A3 receptors.
Science 314:1792-1795.
Chinen T, Komai K, Muto G, M orita R, Inoue N, Yoshida H, Sekiya T, Yoshida R,
Nakamura K, Takayanagi R and Yoshimura A (2011) Prostaglandin E2 and SOCS1 have a
role in intestinal immune tolerance. Nature communications 2:190.
Chm a NE, Chevres M, Santos-Berrios C, Orellano EA, Erb L and G onzalez FA (2007)
P2Y2 receptors induced cell surface redistribution o f alpha(v) integrin is required for
activation o f ERK 1/2 in U937 cells. Journal o f cellular physiology 211:410-422.
Ciacci C, Lind SE and Podolsky DK (1993) Transforming growth factor beta regulation o f
migration in wounded rat intestinal epithelial monolayers. Gastroenterology 105:93-101.
Communi D, Gonzalez NS, Detheux M, Brezillon S, Lannoy V, Parm entier M and
Boeynaems JM (2001) Identification o f a novel human ADP receptor coupled to G(i). The
Journal o f biological chemistry 276:41479-41485.
Communi D, Parmentier M and Boeynaems JM (1996) Cloning, functional expression and
tissue distribution o f the human P2Y6 receptor. Biochemical and biophysical research
communications 222:303-308.
Communi D, Robaye B and Boeynaems JM (1999) Pharmacological characterization o f the
human P2Y 11 receptor. British journal ofpharm acology 128:1199-1206.
Cook TA, Nagasaki T and Gundersen GG (1998) Rho guanosine triphosphatase mediates
the selective stabilization o f microtubules induced by lysophosphatidic acid. The Journal o f
cell biology 141:175-185.
Creppe C, M alinouskaya L, Volvert ML, Gillard M, Close P, Malaise O, Laguesse S,
Comez I, Rahmouni S, Ormenese S, Belachew S, M algrange B, Chapelle JP, Siebenlist U,
M oonen G, Chariot A and Nguyen L (2009) Elongator controls the m igration and
differentiation o f cortical neurons through actylation o f alpha-tubulin. Cell 136:551-564.

149

Crooke A, Mediero A, Guzman-Aranguez A and Pintor J (2009) Silencing o f P2Y2

receptor delays Ap4A-comeal re-epithelialization process. M olecular vision 15:1169-1178.
Danese S and Fiocchi C (2011) Ulcerative colitis. The New England jo u rn a l o f medicine
365:1713-1725.
Derer S, Till A, Haesler R, Sina C, Grabe N, Jung S, Nikolaus S, K uehbacher T,
Groetzinger J, Rose-John S, Rosenstiel PC and Schreiber S (2012) mTNF reverse
signalling induced by TNFalpha antagonists involves a GDF-1 dependent pathway:
implications for Crohn's disease. Gut.
Di Virgilio F, Chiozzi P, Ferrari D, Falzoni S, Sanz JM , Morelli A, Torboli M, Bolognesi G
and Baricordi OR (2001) Nucleotide receptors: an emerging family o f regulatory molecules
in blood cells. Blood 97:587-600.
Dignass A, Lynch-Devaney K, Kindon H, Thim L and Podolsky DK (1994a) Trefoil
peptides promote epithelial migration through a transforming growth factor betaindependent pathway. The Journal o f clinical investigation 94:376-383.
Dignass AU, Becker A, Spiegler S and Goebell H (1998) Adenine nucleotides modulate
epithelial wound healing in vitro. European jo u rn a l o f clinical investigation 28:554-561.
Dignass AU, Lynch-Devaney K and Podolsky DK (1994b) Hepatocyte growth
factor/scatter factor modulates intestinal epithelial cell proliferation and migration.
Biochemical and biophysical research communications 202:701-709.
Dignass AU and Podolsky DK (1993) Cytokine modulation o f intestinal epithelial cell
restitution: central role o f transforming growth factor beta. Gastroenterology 105:13231332.
Dignass AU and Podolsky DK (1996) Interleukin 2 modulates intestinal epithelial cell
function in vitro. Experimental cell research 225:422-429.
Dignass AU, Tsunekawa S and Podolsky DK (1994c) Fibroblast growth factors modulate
intestinal epithelial cell growth and migration. Gastroenterology 106:1254-1262.
Dinic S, Bogojevic D, Petrovic M, Poznanovic G, Ivanovic-M atic S and M ihailovic M
(2005) C/EBP alpha and C/EBP beta regulate haptoglobin gene expression during rat liver
development and the acute-phase response. M olecular biology reports 32:141-147.
Dixon CJ, Bowler WB, Littlewood-Evans A, Dillon JP, Bilbe G, Sharpe GR and Gallagher
JA (1999) Regulation o f epidermal homeostasis through P2Y2 receptors. British jo u rn a l o f
pharmacology 127:1680-1686.
Dong X, Smoll EJ, Ko KH, Lee J, Chow JY, Kim HD, Insel PA and Dong H (2009) P2Y
receptors mediate Ca2+ signaling in duodenocytes and contribute to duodenal mucosal
bicarbonate secretion. American journal o f physiology Gastrointestinal and liver
physiology 296:G424-432.
Drury AN and Szent-Gyorgyi A (1929) The physiological activity o f adenosine compounds
with especial reference to their action upon the mammalian heart. Journal o f physiology
68:213-237.
Dzeja P and Terzic A (2009) Adenylate kinase and AMP signaling networks: Metabolic
monitoring, signal communication and body energy sensing. International jo u rn a l o f
molecular sciences 10:1729-1772.
Eaton EM and Sealy L (2003) M odification o f CCAAT/enhancer-binding protein-beta by
the small ubiquitin-like modifier (SUM O) family members, SUMO-2 and SUM O-3. The
Journal o f biological chemistry 278:33416-33421.
Egan LJ, Eckmann L, Greten FR, Chae S, Li ZW, Myhre GM, Robine S, Karin M and
K agnoff MF (2004) IkappaB-kinasebeta-dependent NF-kappaB activation provides

150

radioprotection to the intestinal epithelium. Proceedings o f the N ational Academ y o f

Sciences o f the United States o f Am erica 101:2452-2457.
Ehre C, Zhu Y, Abdullah LH, Olsen J, N akayam a Kl, Nakayam a K, M essing RO and Davis
CW (2007) nPKCepsilon, a P2Y2-R downstream effector in regulated mucin secretion
from airway goblet cells. American jo u rn a l o fphysiology Cell physiology 293:01445-1454.
El-Tayeb A, Qi A and Muller CE (2006) Synthesis and structure-activity relationships of
uracil nucleotide derivatives and analogues as agonists at human P2Y2, P2Y4, and P2Y6
receptors. Journal o f medicinal chemistry 49:7076-7087.
Ellis RD, Goodlad JR, Limb GA, Powell JJ, Thompson RP and Punchard NA (1998)
Activation o f nuclear factor kappa B in Crohn's disease. Inflammation research : official
journal o f the European Histamine Research Society [et al] 47:440-445.
Eltzschig HK, Eckle T, Mager A, Kuper N, Karcher C, W eissmuller T, Boengler K, Schulz
R, Robson SC and Colgan SP (2006) ATP release from activated neutrophils occurs via
connexin 43 and modulates adenosine-dependent endothelial cell function. Circulation
research 99:1100-1108.
Enomoto K, Furuya K, Moore RC, Yamagishi S, Oka T and Maeno T (1996) Expression
cloning and signal transduction pathway o f P2U receptor in mammary tum or cells.
Biological signals 5:9-21.
Erb L, Garrad R, Wang Y, Quinn T, Turner JT and W eisman GA (1995) Site-directed
mutagenesis o f P2U purinoceptors. Positively charged amino acids in transmembrane
helices 6 and 7 affect agonist potency and specificity. The Journal o f biological chemistry
270:4185-4188.
Erb L, Liao Z, Seye Cl and W eisman GA (2006) P2 receptors: intracellular signaling.
Pflugers Archiv : European journ a l ofphysiology 452:552-562.
Erb L, Liu J, Ockerhausen J, Kong Q, Garrad RC, Griffin K, Neal C, Krugh B, SantiagoPerez LI, Gonzalez FA, Gresham HD, Turner JT and W eisman GA (2001) An RGD
sequence in the P2Y(2) receptor interacts with alpha(V)beta(3) integrins and is required for
G(o)-mediated signal transduction. The Journal o f cell biology 153:491-501.
Escuin D, Kline ER and Giannakakou P (2005) Both m icrotubule-stabilizing and
microtubule-destabilizing drugs inhibit hypoxia-inducible factor - 1alpha accumulation and
activity by disrupting microtubule function. Cancer research 65:9021-9028.
Faler BJ, M acsata RA, Plummer D, M ishra L and Sidawy AN (2006) Transform ing growth
factor-beta and wound healing. Perspectives in vascular surgery and endovascular therapy
18:55-62.
Fan Y, Mao R, Zhao Y, Yu Y, Sun W, Song P, Shi Z, Zhang D, Yvon E, Zhang H, Fu S
and Yang J (2009) Tumor necrosis factor-alpha induces Rel A degradation via
ubiquitination at lysine 195 to prevent excessive nuclear factor-kappaB activation. The
Journal o f biological chemistry 284:29290-29297.
Fournier BM and Parkos CA (2012) The role o f neutrophils during intestinal inflammation.
M ucosal immunology.
Fricks IP, Carter RL, Lazarowski ER and Harden TK (2009) Gi-dependent cell signaling
responses o f the human P2Y14 receptor in model cell systems. The Journal o f
pharmacology and experimental therapeutics 330:162-168.
Fukata M, Chen A, Klepper A, Krishnareddy S, Vamadevan AS, Thomas LS, Xu R, Inoue
H, Arditi M, Dannenberg AJ and Abreu MT (2006) Cox-2 is regulated by Toll-like
receptor-4 (TLR4) signaling: Role in proliferation and apoptosis in the intestine.
Gastroenterology 131:862-877.

151

Fukata M, M ichelsen KS, Eri R, Thomas LS, Hu B, Lukasek K, Nast CC, Lechago J, Xu R,
Naiki Y, Soliman A, Arditi M and Abreu MT (2005) Toll-like receptor-4 is required for
intestinal response to epithelial injury and limiting bacterial translocation in a murine
model o f acute colitis, American journal o f physiology G astrointestinal and liver
physiology 288:G1055-1065.
Gagne D, Groulx JF, Benoit YD, Basora N, Herring E, Vachon PH and Beaulieu JF (2010)
Integrin-linked kinase regulates migration and proliferation o f human intestinal cells under
a fibronectin-dependent mechanism. Journal o f cellular physiology 222:387-400.
Garcia-Verdugo I, Ravasio A, de Paco EG, Synguelakis M, Ivanova N, Kanellopoulos J
and Haller T (2008) Long-term exposure to LPS enhances the rate o f stimulated exocytosis
and surfactant secretion in alveolar type II cells and upregulates P2Y2 receptor expression.
American journal ofphysiology Lung cellular and molecular physiology 295:L708-717.
Garrad RC, Otero MA, Erb L, Theiss PM, Clarke LL, Gonzalez FA, Turner JT and
W eisman GA (1998) Structural basis o f agonist-induced desensitization and sequestration
o f the P2Y2 nucleotide receptor. Consequences o f truncation o f the C terminus. The
Journal o f biological chemistry 273:29437-29444.
Garrett WS, Gordon JI and Glimcher LH (2010) Homeostasis and inflammation in the
intestine. Cell 140:859-870.
Ghanem E, Robaye B, Leal T, Leipziger J, Van Driessche W, Beauwens R and Boeynaems
JM (2005) The role o f epithelial P2Y2 and P2Y4 receptors in the regulation o f intestinal
chloride secretion. British jo u rn a l ofpharm acology 146:364-369.
Gordon JL (1986) Extracellular ATP: effects, sources and fate. The Biochem ical jo u rn a l
233:309-319.
Goulimari P, Kitzing TM, Knieling H, Brandt DT, Offermanns S and Grosse R (2005)
G alphal2/13 is essential for directed cell migration and localized R ho-D ial function. The
Journal o f biological chemistry 280:42242-42251.
Grbic DM, Degagne E, Langlois C, Dupuis AA and Gendron FP (2008) Intestinal
inflammation increases the expression o f the P2Y6 receptor on epithelial cells and the
release o f CXC chemokine ligand 8 by UDP . J Immunol 180:2659-2668.
G regorieff A, Pinto D, Begthel H, Destree O, Kielman M and Clevers H (2005) Expression
pattern o f W nt signaling components in the adult intestine. Gastroenterology 129:626-638.
Groschwitz KR and Hogan SP (2009) Intestinal barrier function: molecular regulation and
disease pathogenesis. The Journal o f allergy and clinical immunology 124:3-20; quiz 2122 .
Gundersen GG and Bulinski JC (1988) Selective stabilization o f m icrotubules oriented
toward the direction o f cell migration. Proceedings o f the National Academ y o f Sciences o f
the United States o f Am erica 85:5946-5950.
Guo WJ, Chen TS, Wang XP and Chen R (2010) Taxol induces concentration-dependent
apoptotic and paraptosis-like cell death in human lung adenocarcinoma (ASTC-a-1) cells.
Journal o f X-ray science and technology 18:293-308.
Hall PA, Coates PJ, Ansari B and Hopwood D (1994) Regulation o f cell num ber in the
mammalian gastrointestinal tract: the importance o f apoptosis. Journal o f cell science 107 (
P t 12):3569-3577.
Hammond JW, Cai D and Verhey KJ (2008) Tubulin modifications and their cellular
functions. Current opinion in cell biology 20:71-76.

152

Haramis AP, Begthel H, van den Bom M, van Es J, Jonkheer S, Offerhaus GJ and Clevers
H (2004) De novo crypt formation and juvenile polyposis on BMP inhibition in mouse
intestine. Science 303:1684-1686.
Hardwick JC, Van Den Brink GR, Bleuming SA, Ballester I, Van Den Brande JM, Keller
JJ, Offerhaus GJ, Van Deventer SJ and Peppelenbosch MP (2004) Bone morphogenetic
protein 2 is expressed by, and acts upon, mature epithelial cells in the colon.
Gastroenterology 126:111 -121.
Hart ML, Henn M, Kohler D, Kloor D, M ittelbronn M, Gorzolla IC, Stahl GL and
Eltzschig HK (2008) Role o f extracellular nucleotide phosphohydrolysis in intestinal
ischemia-reperfusion injury. FASEB jo u rn a l : official publication o f the Federation o f
American Societies fo r Experimental Biology 22:2784-2797.
Hawkey CJ and Rampton DS (1965) Prostaglandins and the gastrointestinal mucosa: are
they important in its function, disease or treatment? Gastroenterology 89:1162-1188.
Hazzalin CA and M ahadevan LC (2005) Dynamic actylation of all lysine 4-methylated
histone H3 in the mouse nucleus: analysis at c-fos and c-jun. PLoS biology 3:e393.
Herbert JM and Savi P (2003) P2Y12, a new platelet ADP receptor, target o f clopidogrel.
Seminars in vascular medicine 3:113-122.
Hou M, M oller S, Edvinsson L and Erlinge D (2000) Cytokines induce upregulation o f
vascular P2Y(2) receptors and increased mitogenic responses to UTP and ATP.
Arteriosclerosis, thrombosis, and vascular biology 20:2064-2069.
Housley RM, Morris CF, Boyle W, Ring B, Biltz R, Tarpley JE, Aukerman SL, Devine PL,
Whitehead RH and Pierce GF (1994) Keratinocyte growth factor induces proliferation o f
hepatocytes and epithelial cells throughout the rat gastrointestinal tract. The Journal o f
clinical investigation 94:1764-1777.
Hsieh CJ, Klump B, Holzmann K, Borchard F, Gregor M and Porschen R (1998)
Hypermethylation o f the pl6IN K 4a prom oter in colectomy specimens o f patients with
long-standing and extensive ulcerative colitis. Cancer research 58:3942-3945.
Hungness ES, Luo GJ, Pritts TA, Sun X, Robb BW, Hershko D and Hasselgren PO (2002a)
Transcription factors C/EBP-beta and -delta regulate IL -6 production in IL-1 betastimulated human enterocytes. Journal o f cellular physiology 192:64-70.
Hungness ES, Pritts TA, Luo GJ, Hershko DD, Robb BW and Hasselgren PO (2002b) ILlbeta activates C/EBP-beta and delta in human enterocytes through a m itogen-activated
protein kinase signaling pathway. The international jo u rn a l o f biochemistry & cell biology
34:382-395.
Hunsucker SA, Mitchell BS and Spychala J (2005) The 5-nucleotidases as regulators o f
nucleotide and drug metabolism. Pharmacology & therapeutics 107:1-30.
Huttenlocher A and Horwitz AR (2011) Integrins in cell migration. C old Spring Harbor
perspectives in biology 3:a005074.
Isfort K, Ebert F, Bomhorst J, Sargin S, Kardakaris R, Pasparakis M, Bahler M, Schwerdtle
T, Schwab A and Hanley PJ (2011) Real-time imaging reveals that P2Y2 and P2Y12
receptor agonists are not chemoattractants and macrophage chemotaxis to com plem ent C5a
is phosphatidylinositol 3-kinase (PI3K)- and p38 mitogen-activated protein kinase
(MAPK)-independent. The Journal o f biological chemistry 286:44776-44787.
Ismail AS, Severson KM, Vaishnava S, Behrendt CL, Yu X, Benjamin JL, Ruhn KA, Hou
B, DeFranco AL, Yarovinsky F and Hooper LV (2011) Gammadelta intraepithlial
lymphocytes are essential mediators o f host-microbial homeostasis at the intestinal mucosal

153

surface. Proceedings o f the National Academ y o f Sciences o f the United States o f Am erica
108:8743-8748.
Ito T, Tanabe H, Ayabe T, Ishikawa C, Inaba Y, Maemoto A, Kono T, A shida T, Fujiya M
and Kohgo Y (2012) Paneth cells regulate both chemotaxis o f immature dendritic cells and
cytokine production from epithelial cells. The Tohoku jo u rn a l o f experim ental medicine
227:39-48.
Iwase T, Shinji H, Tajima A, Sato F, Tamura T, Iwamoto T, Yoneda M and M izunoe Y
(2010) Isolation and identification o f ATP-secreting bacteria from mice and humans.
Journal o f clinical microbiology 48:1949-1951.
Janssens R, Paindavoine P, Parmentier M and Boeynaems JM (1999) Human P2Y2
receptor polymorphism: identification and pharmacological characterization o f two allelic
variants. British journal o f pharmacology 127:709-716.
Kabashima K, Saji T, Murata T, Nagamachi M, M atsuoka T, Segi E, Tsuboi K, Sugimoto
Y, Kobayashi T, M iyachi Y, Ichikawa A and Narumiya S (2002) The prostaglandin
receptor EP4 suppresses colitis, mucosal damage and CD4 cell activation in the gut. The
Journal o f clinical investigation 109:883-893.
Kaczmarek E, Erb L, Koziak K, Jarzyna R, Wink MR, Guckelberger O, Blusztajn JK,
Trinkaus-Randall V, W eisman GA and Robson SC (2005) Modulation o f endothelial cell
migration by extracellular nucleotides: involvement o f focal adhesion kinase and
phosphatidylinositol 3-kinase-mediated pathways. Thrombosis and haemostasis 93:735742.
Kadam S and Emerson BM (2003) Transcriptional specificity o f hum an SW I/SNF BRG1
and BRM chromatin remodeling complexes. M olecular cell 11:377-389.
Kalvakolanu DV and Roy SK (2005) CCAAT/enhancer binding proteins and interferon
signaling pathways. Journal o f interferon & cytokine research : the official jo u rn a l o f the
International Society fo r Interferon and Cytokine Research 25:757-769.
Karam SM (1999) Lineage commitment and maturation o f epithelial cells in the gut.
Frontiers in bioscience : a journal and virtual library 4:D286-298.
Karrasch T and Jobin C (2008) NF-kappaB and the intestine: friend or foe? Inflammatory
bowel diseases 14:114-124.
Karrasch T, Steinbrecher KA, Allard B, Baldwin AS and Jobin C (2006) W ound-induced
p38M APK-dependent histone H3 phosphorylation correlates with increased COX-2
expression in enterocytes. Journal o f cellular physiology 207:809-815.
Katz S, Ayala V, Santillan G and Boland R (2011) Activation of the PI3K/Akt signaling
pathway through P2Y receptors by extracellular ATP is involved in osteoblastic cell
proliferation. Archives o f biochemistry and biophysics 513:144-152.
Kennedy C, Qi AD, Herold CL, Harden TK and Nicholas RA (2000) ATP, an agonist at the
rat P2Y(4) receptor, is an antagonist at the human P2Y(4) receptor. M ol Pharm acol 57:926931.
Kerstan D, Gordjani N, Nitschke R, Greger R and Leipziger J (1998) Luminal ATP induces
K+ secretion via a P2Y2 receptor in rat distal colonic mucosa. Pflugers Archiv : European
journal o f physiology 436:712-716.
Khanjani S, Terzidou V, Lee YS, Thornton S, Johnson MR and Bennett PR (2011)
Synergistic regulation o f human oxytocin receptor promoter by CCAAT/ enhancer-binding
protein and RELA. Biology f reproduction 85:1083-1088.

154

Kim TH, Escudero S and Shivdasani RA (2012) Intact function o f Lgr5 receptor-expressing
intestinal stem cells in the absence o f Paneth cells. Proceedings o f the N ational Academ y o f
Sciences o f the United States o f Am erica 109:3932-3937.
Kinnebrew MA, Buffie CG, Diehl GE, Zenewicz LA, Leiner I, Hohl TM, Flavell RA,
Littman DR and Pamer EG (2012) Interleukin 23 production by intestinal
CD103(+)CD1 lb(+ ) dendritic cells in response to bacterial flagellin enhances mucosal
innate immune defense. Immunity 36:276-287.
Kirschner M and Mitchison T (1986) Beyond self-assembly: from m icrotubules to
morphogenesis. Cell 45:329-342.
Kong Q, Peterson TS, Baker O, Stanley E, Camden J, Seye CI, Erb L, Simonyi A, Wood
WG, Sun GY and W eisman GA (2009) Interleukin-1beta enhances nucleotide-induced and
alpha-secretase-dependent amyloid precursor protein processing in rat prim ary cortical
neurons via up-regulation o f the P2Y(2) receptor. Journal o f neurochemistry 109:13001310.
Koshimizu TA, Tomic M, W ong AO, Zivadinovic D and Stojilkovic SS (2000)
Characterization o f purinergic receptors and receptor-channels expressed in anterior
pituitary cells. Endocrinology 141:4091-4099.
Kosinski C, Li VS, Chan AS, Zhang J, Ho C, Tsui WY, Chan TL, M ifflin RC, Powell DW,
Yuen ST, Leung SY and Chen X (2007) Gene expression patterns o f hum an colon tops and
basal crypts and BMP antagonists as intestinal stem cell niche factors. Proceedings o f the
National Academ y o f Sciences o f the United States o f America 104:15418-15423.
Kronlage M, Song J, Sorokin L, Isfort K, Schwerdtle T, Leipziger J, Robaye B, Conley PB,
Kim HC, Sargin S, Schon P, Schwab A and Hanley PJ (2010) Autocrine purinergic
receptor signaling is essential for macrophage chemotaxis. Science signaling 3:ra55.
Kuhnert F, Davis CR, Wang HT, Chu P, Lee M, Yuan J, Nusse R and Kuo CJ (2004)
Essential requirement for Wnt signaling in proliferation o f adult small intestine and colon
revealed by adenoviral expression o f Dickkopf-1. Proceedings o f the N ational Academ y o f
Sciences o f the United States o f Am erica 101:266-271.
Kukulski F, Levesque SA, Lavoie EG, Lecka J, Bigonnesse F, Knowles AF, Robson SC,
Kirley TL and Sevigny J (2005) Comparative hydrolysis o f P2 receptor agonists by
NTPDases 1, 2, 3 and 8 . Purinergic signalling 1:193-204.
Landry P, Plante I, Ouellet DL, Perron MP, Rousseau G and Provost P (2009) Existence of
a microRNA pathway in anucleate platelets. Nature structural & molecular biology
16:961-966.
Langlois C and Gendron FP (2009) Promoting MPhi transepithelial m igration by
stimulating the epithelial cell P2Y(2) receptor. European jo u rn a l o f im m unology 39:28952905.
Lao VV and Grady WM (2011) Epigenetics and colorectal cancer. Nature reviews
Gastroenterology & hepatology 8:686-700.
Laukoetter MG, Bruewer M and Nusrat A (2006) Regulation o f the intestinal epithelial
barrier by the apical junctional complex. Current opinion in gastroenterology 22:85-89.
Lazarowski ER and Boucher RC (2001) UTP as an extracellular signaling molecule. News
in physiological sciences : an international jo u rn a l o f physiology produced jo in tly by the
International Union o f Physiological Sciences and the American Physiological Society
16:1-5.

155

Lazarowski ER, Boucher RC and Harden TK (2003) Mechanisms o f release o f nucleotides

and integration o f their action as P2X- and P2Y-receptor activating molecules. Mol
Pharmacol 64:785-795.
Lazarowski ER and Harden TK (1999) Quantitation o f extracellular UTP using a sensitive
enzymatic assay. British journal o f pharm acology 127:1272-1278.
Lazarowski ER, Homolya L, Boucher RC and Harden TK ( 1997) Direct dem onstration o f
mechanically induced release o f cellular UTP and its implication for uridine nucleotide
receptor activation. The Journal o f biological chemistry 272:24348-24354.
Lazarowski ER, W att WC, Stutts MJ, Boucher RC and Harden TK (1995) Pharmacological
selectivity o f the cloned human P2U-purinoceptor: potent activation by diadenosine
tetraphosphate. British journal o f pharm acology 116:1619-1627.
Le Clainche C and Carlier MF (2008) Regulation o f actin assembly associated with
protrusion and adhesion in cell migration. Physiological reviews 88:489-513.
Lee SY, W olff SC, Nicholas RA and O'Grady SM (2003) P2Y receptors modulate ion
channel function through interactions involving the C-terminal domain. M ol Pharmacol
63:878-885.
Li A, Leung CT, Peterson-Yantomo K, M itchell CH and Civan MM (2010) Pathways for
ATP release by bovine ciliary epithelial cells, the initial step in purinergic regulation o f
aqueous humor inflow. American jo u rn a l o f physiology Cell physiology 299:C1308-1317.
Li B, Carey M and W orkman JL (2007) The role o f chrom atin during transcription. Cell
128:707-719.
Li L and Clevers H (2010) Coexistence o f quiescent and active adult stem cells in
mammals. Science 327:542-545.
Liao Z, Seye Cl, W eisman GA and Erb L (2007) The P2Y2 nucleotide receptor requires
interaction with alpha v integrins to access and activate G 12. Journal o f cell science
120:1654-1662.
Lin Z, Hegarty JP, Cappel JA, Yu W, Chen X, Faber P, W ang Y, Kelly AA, Poritz LS,
Peterson BZ, Schreiber S, Fan JB and Koltun WA (2011) Identification o f diseaseassociated DNA mthylation in intestinal tissues from patients with inflamm atory bowel
disease. Clinical genetics 80:59-67.
Liu J, Liao Z, Camden J, Griffin KD, Garrad RC, Santiago-Perez LI, Gonzalez FA, Seye
Cl, W eisman GA and Erb L (2004) Src homology 3 binding sites in the P2Y2 nucleotide
receptor interact with Src and regulate activities o f Src, proline-rich tyrosine kinase 2, and
growth factor receptors. The Journal o f biological chemistry 279:8212-8218.
Lolmede K, Campana L, Vezzoli M, Bosurgi L, Tonlorenzi R, Clementi E, Bianchi ME,
Cossu G, Manfredi AA, Brunelli S and Rovere-Querini P (2009) Inflammatory and
alternatively activated human macrophages attract vessel-associated stem cells, relying on
separate HMGB1- and M MP-9-dependent pathways. Journal o f leukocyte biology 85:779787.
Lu D, Soleymani S, M adakshire R and Insel PA (2012) ATP released from cardiac
fibroblasts via connexin hemichannels activates profibrotic P2Y2 receptors. FASEB jo u rn a l
: official publication o f the Federation o f American Societies fo r Experimental Biology.
Luttikhuizen DT, Harmsen MC, de Leij LF and van Luyn MJ (2004) Expression o f P2
receptors at sites o f chronic inflammation. Cell and tissue research 317:289-298.
Macdonald TT and Monteleone G (2005) Immunity, inflammation, and allergy in the gut.
Science 307:1920-1925.

156

Madrid LV, Mayo MW, Reuther JY and Baldwin AS, Jr. (2001) Akt stim ulates the
transactivation potential o f the RelA/p65 Subunit o f NF-kappa B through utilization o f the
Ikappa B kinase and activation o f the mitogen-activated protein kinase p38. The Journal o f
biological chemistry 276:18934-18940.
Majello B, Napolitano G, De Luca P and Lania L (1998) Recruitment o f human TBP
selectively activates RNA polymerase II TATA-dependent promoters. The Journal o f
biological chemistry 273:16509-16516.
Marcus AJ, Broekman MJ, Drosopoulos JH, Islam N, Pinsky DJ, Sesti C and Levi R (2003)
Metabolic control o f excessive extracellular nucleotide accumulation by CD39/ectonucleotidase-1 : implications for ischemic vascular diseases. The Journal o f pharm acology
and experimental therapeutics 305:9-16.
Matos JE, Robaye B, Boeynaems JM, Beauwens R and Leipziger J (2005) K+ secretion
activated by luminal P2Y2 and P2Y4 receptors in mouse colon. The Journal o f physiology
564:269-279.
Matos JE, Sorensen MV, Geyti CS, Robaye B, Boeynaems JM and Leipziger J (2007)
Distal colonic Na(+) absorption inhibited by luminal P2Y(2) receptors. Pflugers Archiv :
European journal ofphysiology 454:977-987.
May R, Sureban SM, Hoang N, Riehl TE, Lightfoot SA, Ramanujam R, W yche JH, Anant
S and Houchen CW (2009) Doublecortin and CaM kinase-like-1 and leucine-rich-repeatcontaining G-protein-coupled receptor m ark quiescent and cycling intestinal stem cells,
respectively. Stem Cells 27:2571-2579.
Medema JP and Vermeulen L (2011) M icroenvironmental regulation o f stem cells in
intestinal homeostasis and cancer. Nature 474:318-326.
Mediero A, Guzman-Aranguez A, Crooke A, Peral A and Pintor J (2008) Corneal reepithelialization stimulated by diadenosine polyphosphates recruits RhoA/ROCK and
ERK1/2 pathways. Investigative ophthalmology & visual science 49:4982-4992.
M eszaros AJ, Reichner JS and Albina JE (2000) M acrophage-induced neutrophil apoptosis.
J Immunol 165:435-441.
Milano J, McKay J, Dagenais C, Foster-Brown L, Pognan F, Gadient R, Jacobs RT, Zacco
A, Greenberg B and Ciaccio PJ (2004) M odulation o f notch processing by gammasecretase inhibitors causes intestinal goblet cell metaplasia and induction o f genes known to
specify gut secretory lineage differentiation. Toxicological sciences : an official jo u rn a l o f
the Society o f Toxicology 82:341-358.
M udter J and Neurath MF (2007) 11-6 signaling in inflammatory bowel disease:
pathophysiological role and clinical relevance. Inflammatory bowel diseases 13:1016-1023.
Mukerjee R, Sawaya BE, Khalili K and Amini S (2007) Association o f p65 and C/EBPbeta
with HIV-1 LTR modulates transcription o f the viral promoter. Journal o f cellular
biochemistry 100:1210-1216.
M uller CA, Autenrieth IB and Peschel A (2005) Innate defenses o f the intestinal epithelial
barrier. Cellular and molecular life sciences : CM LS 62:1297-1307.
Nagano M, Hoshino D, Koshikawa N, Akizawa T and Seiki M (2012) Turnover o f focal
adhesions and cancer cell migration. International jo u rn a l o f cell biology 2012:310616.
Nakajima T, Kinoshita S, Sasagawa T, Sasaki K, Naruto M, Kishimoto T and A kira S
(1993) Phosphorylation at threonine-235 by a ras-dependent mitogen-activated protein
kinase cascade is essential for transcription factor N F-IL 6 . Proceedings o f the National
Academy o f Sciences o f the United States o f Am erica 90:2207-2211.

157

N aser SA, Arce M, Khaja A, Fernandez M, Naser N, Elwasila S and Thanigachalam S

(2012) Role o f ATG16L, NOD2 and IL23R in Crohn's disease pathogenesis. World jo u rn a l
o f gastroenterology : WJG 18:412-424.
Nelson DE, Ihekwaba AE, Elliott M, Johnson JR, Gibney CA, Foreman BE, Nelson G, See
V, Horton CA, Spiller DG, Edwards SW, McDowell HP, U nitt JF, Sullivan E, Grimley R,
Benson N, Broomhead D, Kell DB and W hite M R (2004) Oscillations in NF-kappaB
signaling control the dynamics o f gene expression. Science 306:704-708.
Neumann M and Naumann M (2007) Beyond IkappaBs: alternative regulation o f NFkappaB activity. FASEB jo u rn a l : official publication o f the Federation o f American
Societies fo r Experimental Biology 21:2642-2654.
Nylund G, Hultman L, Nordgren S and Delbro DS (2007) P2Y2- and P2Y4 purinergic
receptors are over-expressed in human colon cancer. Autonom ic & autacoidpharm acology
27:79-84.
O'Dea E and Hoffmann A (2009) NF-kappaB signaling. Wiley interdisciplinary reviews
Systems biology and medicine 1:107-115.
Ohneda K, Ulshen MH, Fuller CR, D'Ercole AJ and Lund PK (1997) Enhanced growth o f
small bowel in transgenic mice expressing human insulin-like growth factor I.
Gastroenterology 112:444-454.
Olaru AV, Cheng Y, Agarwal R, Yang J, David S, Abraham JM , Yu W, Kwon JH, Lazarev
M, Brant SR, Marohn MR, Hutcheon DF, Harpaz N, M eltzer SJ and Mori Y (2012) Unique
patterns o f CpG island mthylation in inflammatory bowel disease-associated colorectal
cancers. Inflammatory bowel diseases 18:641-648.
Palazzo AF, Cook TA, Alberts AS and Gundersen GG (2001) m D ia mediates Rhoregulated formation and orientation o f stable microtubules. Nature cell biology 3:723-729.
Palazzo AF, Eng CH, Schlaepfer DD, M arcantonio EE and Gundersen GG (2004)
Localized stabilization o f microtubules by integrin- and FAK-facilitated Rho signaling.
Science 303:836-839.
Parham P (2003) Le systme immunitaire.
Park JH, M cCusker RH, V anderhoof JA, M ohammadpour H, Harty RF and M acDonald
RG (1992) Secretion o f insulin-like growth factor II (IGF-II) and IGF-binding protein-2 by
intestinal epithelial (IEC- 6 ) cells: implications for autocrine growth regulation.
Endocrinology 131:1359-1368.
Patel BA, Rogers M, W ieder T, O'Hare D and Boutelle MG (2011) ATP m icroelectrode
biosensor for stable long-term in vitro monitoring from gastrointestinal tissue. Biosensors
& bioelectronics 26:2890-2896.
Pazin MJ, Sheridan PL, Cannon K, Cao Z, Keck JG, Kadonaga JT and Jones KA (1996)
NF-kappa B-mediated chromatin reconfiguration and transcriptional activation o f the HIV1 enhancer in vitro. Genes & development 10:37-49.
Pelletier N, Boudreau F, Yu SJ, Zannoni S, Boulanger V and Asselin C (1998) Activation
o f haptoglobin gene expression by cAMP involves CCAAT/enhancer-binding protein
isoforms in intestinal epithelial cells. FE BS letters 439:275-280.
Perkins ND (2007) Integrating cell-signalling pathways with NF-kappaB and IKK function.
Nature reviews Molecular cell biology 8:49-62.
Perkins ND, A granoff AB, Pascal E and Nabel GJ (1994) An interaction between the
DNA-binding domains o f RelA(p65) and Spl mediates hum an immunodeficiency virus
gene activation. Molecular and cellular biology 14:6570-6583.

158

Perkins ND, Edwards NL, Duckett CS, A granoff AB, Schmid RM and Nabel GJ (1993) A
cooperative interaction between NF-kappa B and S p l is required for HIV-1 enhancer
activation. The EM BO jou rn a l 12:3551-3558.
Perrier C and Rutgeerts P (2011) Cytokine blockade in inflammatory bowel diseases.
Immunotherapy 3:1341-1352.
Pineton de Chambrun G, Peyrin-Biroulet L, Lemann M and Colombel JF (2010) Clinical
implications o f mucosal healing for the m anagem ent o f IBD. Nature reviews
Gastroenterology & hepatology 7:15-29.
Potten CS, Booth C and Pritchard DM (1997) The intestinal epithelial stem cell: the
mucosal governor. International jo u rn a l o f experimental pathology 78:219-243.
Potten CS, Owen G and Booth D (2002) Intestinal stem cells protect their genome by
selective segregation o f template DNA strands. Journal o f cell science 115:2381-2388.
Pull SL, Doherty JM, Mills JC, Gordon JI and Stappenbeck TS (2005) Activated
macrophages are an adaptive element o f the colonic epithelial progenitor niche necessary
for regenerative responses to injury. Proceedings o f the National Academ y o f Sciences o f
the United States o f America 102:99-104.
Qi AD, Kennedy C, Harden TK and Nicholas RA (2001) Differential coupling o f the
human P2Y(11) receptor to phospholipase C and adenylyl cyclase. British jo u rn a l o f
pharmacology 132:318-326.
Quina AS, Buschbeck M and Di Croce L (2006) Chrom atin structure and epigenetics.
Biochemical pharm acology 72:1563-1569.
Rahman OA, Sasvari-Szekely M, Szekely A, Faludi G, Guttman A and N em oda Z (2010)
Analysis o f a polymorphic microRNA target site in the purinergic receptor P2RX7 gene.
Electrophoresis 31:1790-1795.
Rajagopal M, Kathpalia PP, Thomas SV and Pao AC (2011) Activation o f P2Y1 and P2Y2
receptors induces chloride secretion via calcium-activated chloride channels in kidney inner
medullary collecting duct cells. American jo u rn a l o f physiology Renal physiology
301:F544-553.
Ramji DP and Foka P (2002) CCAAT/enhancer-binding proteins: structure, function and
regulation. The Biochemical journ a l 365:561-575.
Reichner JS, Fitzpatrick PA, Wakshull E and Albina JE (2001) Receptor-mediated
phagocytosis o f rat macrophages is regulated differentially for opsonized particles and non
opsonized particles containing beta-glucan. Im m unology 104:198-206.
Reinhard C and Rioux JD (2006) Role o f the IBD5 susceptibility locus in the inflammatory
bowel diseases. Inflammatory bowel diseases 12:227-238.
Ricardo SD, van Goor H and Eddy AA (2008) M acrophage diversity in renal injury and
repair. The Journal o f clinical investigation 118:3522-3530.
Rieder F, Brenmoehl J, Leeb S, Scholmerich J and Rogler G (2007) W ound healing and
fibrosis in intestinal disease. Gut 56:130-139.
Rioux JD, Xavier RJ, Taylor KD, Silverberg MS, Goyette P, Huett A, Green T, Kuballa P,
Barmada MM, Datta LW, Shugart YY, Griffiths AM, Targan SR, Ippoliti AF, Bernard EJ,
Mei L, Nicolae DL, Regueiro M, Schumm LP, Steinhart AH, Rotter JI, Duerr RH, Cho JH,
Daly MJ and Brant SR (2007) Genome-wide association study identifies new susceptibility
loci for Crohn disease and implicates autophagy in disease pathogenesis. Nature genetics
39:596-604.

159

Rogler G, Brand K, Vogl D, Page S, Hofm eister R, Andus T, Knuechel R, Baeuerle PA,
Scholmerich J and Gross V (1998) Nuclear factor kappaB is activated in m acrophages and
epithelial cells o f inflamed intestinal mucosa. Gastroenterology 115:357-369.
Saccani S, Pantano S and Natoli G (2002) p38-Dependent marking o f inflam matory genes
for increased NF-kappa B recruitment. Nature immunology 3:69-75.
Sadovsky Y, Webb P, Lopez G, Baxter JD, Fitzpatrick PM, Gizang-Ginsberg E, Cavailles
V, Parker MG and Kushner PJ (1995) Transcriptional activators differ in their responses to
overexpression o f TATA-box-binding protein. Molecular a nd cellular biology 15:15541563.
Sakaguchi S and Sakaguchi N (2005) Regulatory T cells in immunologic self-tolerance and
autoimmune disease. International reviews o f immunology 24:211-226.
Sanchez JA, Dejulius KL, Bronner M, Church JM and Kalady MF (2011) Relative role o f
methylator and tum or suppressor pathways in ulcerative colitis-associated colon cancer.
Inflammatory bowel diseases 17:1966-1970.
Sato T, Vries RG, Snippert HJ, van de W etering M, Barker N , Stange DE, van Es JH, Abo
A, Kujla P, Peters PJ and Clevers H (2009) Single Lgr5 stem cells build crypt-villus
structures in vitro without a mesenchymal niche. Nature 459:262-265.
Sattin A and Rail TW (1970) The effect o f adenosine and adenine nucleotides on the cyclic
adenosine 3'-5'-phosphate content o f guinea pig cerebral cortex slices. Molecular
pharmacology 6:13-23.
Schachter JB and Harden TK (1997) An examination o f deoxyadenosine 5'(alphathio)triphosphate as a ligand to define P2Y receptors and its selectivity as a low potency
partial agonist o f the P2Y1 receptor. British jo u rn a l ofpharm acology 121:338-344.
Schiller M, Javelaud D and Mauviel A (2004) TGF-beta-induced SM AD signaling and
gene regulation: consequences for extracellular matrix remodeling and w ound healing.
Journal o f dermatological science 35:83-92.
Schmitz ML, dos Santos Silva MA and Baeuerle PA (1995) Transactivation domain 2
(TA2) o f p65 NF-kappa B. Similarity to TA1 and phorbol ester-stimulated activity and
phosphorylation in intact cells. The Journal o f biological chemistry 270:15576-15584.
Schonhoff SE, Giel-M oloney M and Leiter AB (2004) Minireview: Development and
differentiation o f gut endocrine cells. Endocrinology 145:2639-2644.
Schrader AM, Camden JM and W eisman GA (2005) P2Y2 nucleotide receptor upregulation in submandibular gland cells from the NOD.B10 mouse model o f Sjogren's
syndrome. Archives o f oral biology 50:533-540.
Schreiber S, Nikolaus S and Hampe J (1998) Activation o f nuclear factor kappa B
inflammatory bowel disease. Gut 42:477-484.
Scoville DH, Sato T, He XC and Li L (2008) Current view: intestinal stem cells and
signaling. Gastroenterology 134:849-864.
Seiderer J, Elben I, Diegelmann J, Glas J, Stallhofer J, Tillack C, Pfennig S, Jurgens M,
Schmechel S, Konrad A, Goke B, Ochsenkuhn T, M uller-M yhsok B, Lohse P and Brand S
(2008) Role o f the novel T h l7 cytokine IL-17F in inflammatory bowel disease (IBD):
upregulated colonic IL-17F expression in active Crohn's disease and analysis o f the IL17F
p.H isl61 Arg polymorphism in IBD. Inflammatory bowel diseases 14:437-445.
Selleri S, Palazzo M, Deola S, Wang E, Balsari A, M arincola FM and Rumio C (2008)
Induction o f pro-inflammatory programs in enteroendocrine cells by the Toll-like receptor
agonists flagellin and bacterial LPS. International immunology 20:961-970.

160

Seminario-Vidal L, Okada SF, Sesma JI, Kreda SM, van Heusden CA, Zhu Y, Jones LC,
O'Neal WK, Penuela S, Laird DW, Boucher RC and Lazarowski ER (2011) Rho signaling
regulates pannexin 1-mediated ATP release from airway epithelia. The Journal o f
biological chemistry 286:26277-26286.
Seno H, Miyoshi H, Brown SL, Geske MJ, Colonna M and Stappenbeck TS (2009)
Efficient colonic mucosal wound repair requires Trem2 signaling. Proceedings o f the
National Academy o f Sciences o f the United States ofA m erica 106:256-261.
Seye CI, Kong Q, Erb L, Garrad RC, Krugh B, W ang M, Turner JT, Sturek M, Gonzalez
FA and W eisman GA (2002) Functional P2Y2 nucleotide receptors mediate uridine 5'triphosphate-induced intimai hyperplasia in collared rabbit carotid arteries. Circulation
106:2720-2726.
Seye Cl, Yu N, Jain R, Kong Q, M inor T, Newton J, Erb L, Gonzalez FA and W eisman GA
(2003) The P2Y2 nucleotide receptor mediates UTP-induced vascular cell adhesion
m olecule-1 expression in coronary artery endothelial cells. The Journal o f biological
chemistry 278:24960-24965.
Shao J, Sheng H, Aramandla R, Pereira MA, Lubet RA, Hawk E, Grogan L, Kirsch IR,
W ashington MK, Beauchamp RD and DuBois RN (1999) Coordinate regulation o f
cyclooxygenase-2 and TG F-betal in replication error-positive colon cancer and
azoxymethane-induced rat colonic tumors. Carcinogenesis 20:185-191.
Sheridan BS and Lefrancois L (2010) Intraepithlial lymphocytes: to serve and protect.
Current gastroenterology reports 12:513-521.
Simon J, Filippov AK, Goransson S, Wong YH, Frelin C, Michel AD, Brown DA and
Barnard EA (2002) Characterization and channel coupling o f the P2Y(12) nucleotide
receptor o f brain capillary endothelial cells. The Journal o f biological chemistry
277:31390-31400.
Singer, II, Kawka DW, Schloemann S, Tessner T, Riehl T and Stenson WF (1998)
Cyclooxygenase 2 is induced in colonic epithelial cells in inflammatory bowel disease.
Gastroenterology 115:297-306.
Smith PD, Smythies LE, Shen R, Greenwell-W ild T, Gliozzi M and Wahl SM (2011)
Intestinal macrophages and response to microbial encroachment. M ucosal immunology
4:31-42.
Smythies LE, Sellers M, Clements RH, M osteller-Bamum M, M eng G, Benjamin WH,
Orenstein JM and Smith PD (2005) Human intestinal macrophages display profound
inflammatory anergy despite avid phagocytic and bacteriocidal activity. The Journal o f
clinical investigation 115:66-75.
Soutoglou E, Viollet B, Vaxillaire M, Yaniv M, Pontoglio M and Talianidis I (2001)
Transcription factor-dependent regulation o f CBP and P/CAF histone acetyltransferase
activity. The EMBO journal 20:1984-1992.
Stefan C, Jansen S and Bollen M (2006) M odulation o f purinergic signaling by NPP-type
ectophosphodiesterases. Purinergic signalling 2:361-370.
Stein B, Cogswell PC and Baldwin AS, Jr. (1993) Functional and physical associations
between NF-kappa B and C/EBP family members: a Rel domain-bZIP interaction.
M olecular and cellular biology 13:3964-3974.
Sturm A and Dignass AU (2008) Epithelial restitution and wound healing in inflammatory
bowel disease. World journal o f gastroenterology : WJG 14:348-353.

161

Tamura K, Taniguchi Y, Minoguchi S, Sakai T, Tun T, Furukawa T and Honjo T (1995)

Physical interaction between a novel domain o f the receptor Notch and the transcription
factor RBP-J kappa/Su(H). Current biology : CB 5:1416-1423.
Tortora GJ and Grabowski S (2001 ) Principes d'anatomie et de physiologie.
Tsianos EV, Katsanos KH and Tsianos VE (2011) Role o f genetics in the diagnosis and
prognosis o f Crohn's disease. World jo u rn a l o f gastroenterology : WJG 17:5246-5259.
Tupin E, Kinjo Y and Kronenberg M (2007) The unique role o f natural killer T cells in the
response to microorganisms. Nature reviews Microbiology 5:405-417.
Turgeon N, Valiquette C, Blais M, Routhier S, Seidman EG and Asselin C (2008)
Regulation o f C/EBPdelta-dependent transactivation by histone deacetylases in intestinal
epithelial cells. Journal o f cellular biochemistry 103:1573-1583.
van den Brink GR, Bleuming SA, Hardwick JC, Schepman BL, Offerhaus GJ, K eller JJ,
Nielsen C, Gaffield W, van Deventer SJ, Roberts DJ and Peppelenbosch MP (2004) Indian
Hedgehog is an antagonist o f W nt signaling in colonic epithelial cell differentiation. Nature
genetics 36:277-282.
van Dop WA, Uhmann A, W ijgerde M, Sleddens-Linkels E, Heijmans J, Offerhaus GJ, van
den Bergh Weerman M A, Boeckxstaens GE, Hommes DW, Hardwick JC, Hahn H and van
den Brink GR (2009) Depletion o f the colonic epithelial precursor cell compartment upon
conditional activation o f the hedgehog pathway. Gastroenterology 136:2195-2203 e21912197.
Viatour P, Merville MP, Bours V and Chariot A (2005) Phosphorylation o f N F-kappaB and
IkappaB proteins: implications in cancer and inflammation. Trends in biochemical sciences
30:43-52.
Waldo GL, Corbitt J, Boyer JL, Ravi G, Kim HS, Ji XD, Lacy J, Jacobson KA and Harden
TK (2002) Quantitation o f the P2Y(1) receptor with a high affinity radiolabeled antagonist.
Mol Pharmacol 62:1249-1257.
Wang FY, Arisawa T, Tahara T, Takaham a K, W atanabe M, Hirata I and Nakano H (2008)
Aberrant DNA mthylation in ulcerative colitis without neoplasia. Hepatogastroenterology 55:62-65.
Wang XC, Jobin C, Allen JB, Roberts WL and Jaffe GJ (1999) Suppression o f NF-kappaBdependent proinflammatory gene expression in human RPE cells by a proteasome inhibitor.
Investigative ophthalmology & visual science 40:477-486.
Wang Z, Nakayama T, Sato N, Izumi Y, Kasamaki Y, Ohta M, Soma M, Aoi N, O zaw a Y
and M a Y (2010) The purinergic receptor P2Y, G-protein coupled, 2 (P2RY2) gene
associated with essential hypertension in Japanese men. Journal o f human hypertension
24:327-335.
Wang Z, Nakayama T, Sato N, Yamaguchi M, Izumi Y, Kasamaki Y, O hta M, Soma M,
Aoi N, Ozawa Y, Ma Y, Doba N and Hinohara S (2009a) Purinergic receptor P2Y, Gprotein coupled, 2 (P2RY2) gene is associated with cerebral infarction in Japanese subjects.
Hypertension research : official journal o f the Japanese Society o f Hypertension 32:989996.
Wang ZX, Nakayama T, Sato N, Izumi Y, Kasamaki Y, Ohta M, Soma M, Aoi N,
Matsumoto K, Ozawa Y, Ma YT, Doba N and Hinohara S (2009b) Association o f the
purinergic receptor P2Y, G-protein coupled, 2 (P2RY2) gene with myocardial infarction in
Japanese men. Circulation journ a l : official journal o f the Japanese Circulation Society
73:2322-2329.

162

Watanabe T, Noritake J and Kaibuchi K (2005) Regulation o f microtubules in cell

migration. Trends in cell biology 15:76-83.
W atson AJ, Chu S, Sieck L, Gerasimenko O, Bullen T, Campbell F, M cKenna M, Rose T
and Montrose MH (2005) Epithelial barrier function in vivo is sustained despite gaps in
epithelial layers. Gastroenterology 129:902-912.
W eaver CT, Hatton RD, Mangan PR and Harrington LE (2007) IL -17 family cytokines and
the expanding diversity o f effector T cell lineages. Annual review o f immunology 25:821852.
W ehkamp J, Harder J, W eichenthal M, Schwab M, Schaffeler E, Schlee M, Herrlinger KR,
Stallmach A, Noack F, Fritz P, Schroder JM, Bevins CL, Fellermann K and Stange EF
(2004) NOD2 (CARD15) mutations in Crohn's disease are associated with diminished
mucosal alpha-defensin expression. Gut 53:1658-1664.
W ehrle-Haller B and Im hof BA (2003) Actin, microtubules and focal adhesion dynamics
during cell migration. The international jo u rn a l o f biochemistry & cell biology 35:39-50.
W eisman GA, Wang M, Kong Q, Chorna NE, Neary JT, Sun GY, Gonzalez FA, Seye Cl
and Erb L (2005) M olecular determinants o f P2Y2 nucleotide receptor function:
implications for proliferative and inflammatory pathways in astrocytes. M olecular
neurobiology 31:169-183.
W u F, Guo NJ, Tian H, Marohn M, Gearhart S, Bayless TM, Brant SR and Kwon JH
(2011) Peripheral blood microRNAs distinguish active ulcerative colitis and Crohn's
disease. Inflammatory bowel diseases 17:241-250.
Wu F, Zhang S, Dassopoulos T, Harris ML, Bayless TM, M eltzer SJ, Brant SR and Kwon
JH (2010) Identification o f microRNAs associated with ileal and colonic Crohn's disease.
Inflammatory bowel diseases 16:1729-1738.
Wu F, Zikusoka M, Trindade A, Dassopoulos T, Harris ML, Bayless TM, Brant SR,
Chakravarti S and Kwon JH (2008) M icroRNAs are differentially expressed in ulcerative
colitis and alter expression o f macrophage inflammatory peptide-2 alpha. Gastroenterology
135:1624-1635 el624.
Yamada T (2009) Textbook o f gastroenterology, Blackwell Publishing Ltd.
Yang C, Bolotin E, Jiang T, Sladek FM and M artinez E (2007) Prevalence o f the initiator
over the TATA box in human and yeast genes and identification of DNA motifs enriched in
human TATA-less core promoters. Gene 389:52-65.
Yang Q, Bermingham NA, Finegold MJ and Zoghbi HY (2001) Requirement o f M athl for
secretory cell lineage commitment in the mouse intestine. Science 294:2155-2158.
Yegutkin GG (2008) Nucleotide- and nucleoside-converting ectoenzymes: Important
modulators o f purinergic signalling cascade. Biochimica et biophysica acta 1783:673-694.
Zhou J and Giannakakou P (2005) Targeting microtubules for cancer chemotherapy.
Current medicinal chemistry Anti-cancer agents 5:65-71.
Zimmermann H (2000) Extracellular metabolism o f ATP and other nucleotides. NaunynSchmiedeberg's archives o f pharmacology 362:299-309.
Zimmermann H (2001) Ectonuclotidases: Some recent developments and a note on
nomenclature. Drug development research 30:542-550.

ANNEXES
Annexe 1 : Articles publis en tant que deuxime auteur

Intestinal inflammation increases the expression o f the P2Y(6) receptor on epithelial

cells and the release o f CXC chemokine ligand 8 by UDP.
Auteurs : D.M. Grbic, Degagn, E., Langlois, C., Dupuis, A.A. et Gendron, F.P.
Statut de larticle : Publi dans Journal o f Immunology, volume 180, pages 2659-68, 2008.
Rsum de larticle: Epithelial cells participate in the immune response o f the intestinal
mucosa. Extracellular nucleotides have been recognized as inflammatory molecules. We
investigated the role o f extracellular nucleotides and their associated P2Y receptors in the
secretion o f cytokines by epithelial cells. The effect o f intestinal inflammation on P2Y(6)
receptor expression was determined by PCR in the mouse, rat, and human. Localization o f
the P2Y(6) receptor was determined by im munofluorescence microscopy in the colon o f
normal and dextran sulfate sodium-treated mice. The effect o f P2Y(6) activation by UDP
on cytokine expression and release by epithelial cells was determined using a combination
o f W estern blots, luciferase assays,

RT-PCR,

cytokine

Ab arrays, and ELISA.

Inflammation up-regulates P2Y(2) as well as P2Y(6) receptor expression in the m ucosa o f

the colon o f colitic mice. In vitro, we demonstrated that UDP could be released by Caco2/15 cells. We have confirmed the increased expression o f P2Y(6) by challenging intestinal
epithelial cell -6 and Caco-2/15 cells with TNF-alpha and IFN-gamma and showing that
stimulation o f epithelial cells by UDP results in an increased expression and release o f
CXCL 8 by an ERK1/2-dependent mechanism. The increase in CX CL 8 expression was
associated with a transcriptional activation by the P2Y(6) receptor. This study is the first
report demonstrating the implication o f P2Y receptors in the inflammatory response of
intestinal epithelial cells. We show for the first time that P2Y(6), as well as P2Y(2),
expression is increased by the stress associated with intestinal inflammation. These results
demonstrate the emergence o f extracellular nucleotide signaling in the orchestration o f
intestinal inflammation.

164

P2Y(6) receptor contributes to neutrophil recruitm ent to inflamed intestinal mucosa

by increasing CXC chemokine ligand 8 expression in an A P -l-dependent m anner in
epithelial cells.
Auteurs : D.M., Grbic, Degagn, E., Larrive, J.F., Bilodeau, M.S., Vinette, V., Arguin, G.,
Stankova, J., et Gendron, F.P.
Statut de F article : Sous presse dans Inflammatory Bowel Diseases, 2011.
Rsum de Particle :
BACKGROUND: Inflammatory bowel diseases are characterized by the presence o f
CXCL 8 at the site o f lesions resulting in neutrophil recruitm ent and loss o f tissue functions.
We report that P2Y(6) receptor activation stimulates CXCL 8 expression and release by
intestinal epithelial cells (IECs). In this context, we investigated if uridine 5'-diphosphate
(UDP) enemas stimulate neutrophil recruitment to the mucosa o f mice suffering from
colitis-like disease and we characterized the signaling events linking P2Y(6) to C X CL 8
expression

in

IEC.

METHODS:

Neutrophil

recruitment

was

monitored

by

immunofluorescence and FACS analysis. Expression o f C xcll, a mouse functional

homolog o f CXCL 8 , was determined by quantitative real-tim e polymerase chain reaction
(qPCR). Pharmacological inhibitors and interfering RNAs were used to characterize the
signaling pathway. The outcomes o f these treatments on protein phosphorylation and on
CXCL 8 expression were characterized by western blots, qPCR, luciferase, and chromatin
immunoprcipitation (ChIP) assays. RESULTS: M utation o f the AP-1 site in the CXCL 8
core promoter abolished the UDP-stimulating effect. The c-fos/c-jun dimer was identified
as the AP-1 complex regulating CX CL 8 in response to UDP stimulation. Regulation o f
CXCL 8 expression by P2Y(6) required PKC activation upstream o f the signaling pathway
composed o f M EK1/2-ERK1/2 and c-fos. UDP adm inistration to mice suffering from
colitis-like disease increased the number o f neutrophil infiltrating the mucosa, correlating
with

C xcll

increased

expression

in

IEC

and

the

severity

of

inflammation.

CONCLUSIONS: This study not only describes the P2Y(6) signaling mechanism
regulating CXCL 8 expression in IEC, but it also illustrates the potential o f targeting P2Y(6)
to reduce intestinal inflammation.

165

Annexe 2: DAI et transloquation bactrienne dans la rate de souris P2Y2A atteintes

dune colite chimique
Graphique 1 : Index de svrit de la maladie de souris P2Y2'/_ atteintes d une colite
chimique
20-1

1510 -

C57/BI6 WT

C57/BI6 P2Y2 KO

Une colite chimique a t induite en ajoutant, durant 7 jours, 3,5% de DSS dans leau de
boisson de souris C57/B16 de type sauvage (C57/B16 WT) ou invalides pour lexpression
du rcepteur P2Y2 (C57/B16 P2Y2 KO). Lindex de svrit de la m aladie est
significativement plus lev chez les souris C57/B16 P2Y2 KO (13.8 units arbitraires)
comparativement aux souris C57/B16 W T (4,7 units arbitraires). Les analyses statistiques
ont t dtermines par le Mann W hitney test (t test), ***, p< 0.002.

Graphique 2 : Transloquation des bactries dans la rate de souris P2Y2/_ atteintes

d une colite chimique

Q>
Q.

V)

u.

O)

-J

C57/BI6 WT

C57/BI6 P2Y2 KO

Une colite chimique a t induite en ajoutant, durant 7 jours, 3,5% de DSS dans leau de
boisson de souris C57/B16 de type sauvage (C57/B16 WT) ou invalides pour lexpression

166

du rcepteur P 2 Y 2 (C57/B16 P 2 Y 2 KO). Les souris C57/B16 P 2 Y2 KO prsentent 10 fois

plus de bactries qui ont transloqu la rate comparativement aux souris C57/B16 WT. Les
analyses statistiques ont t dtermines par le Mann W hitney test (t test), **, p< 0.005.

167

Annexe 3 : Transactivation du promoteur du rcepteur P 2 Y 2 dans les cellules Caco-2

par les facteurs de transcription C/EBPa et C/EBP.
A)
AAA

JS 15
.m

% 10
<0

ai

PCDNA3.1

+
+

pGL4.10
pcDNA 3.1-C /E B P a
p G L 4 .1 0 -p rP 2 Y 2

B)

<2 30-i

AAA

+
+

+
+

pcDNA3.1
pGL.4.10
pcDNA 3 .1 -C/EBPa
pGL4.10 - prP2Y2
DSS

168

C)
AAA

S 15n

+
+

+
+

pcDNA3.1
pGL4.10
pcDNA 3.1 - C/EBP
pGL4.10 - prP2Y2

D)

S 3<h

+
+
+
+

pcDNA3.1
pGL4.10
pcDNA 3 .1 -C/EBP5
pGL4.10 - prP2Y2
DSS

Les cellules Caco-2 ont t transfectes transitoirem ent avec la construction pGL4.10 prP2Y2 et le vecteur d expression de C/EBPa (A et B) ou C/EBP (C et D). Les cellules ont
t incubes en prsence (B et D) ou non (A et C) de 0,5% DSS, 6 h avant d effectuer les
essais lucifrase. Lactivit de la lucifrase est exprime par rapport lactivit de celles
des vecteurs vides. L analyse statistique utilise est le one-way ANOVA o **p < 0.01 et
***p < 0.001 comparativement leur contrle respectif et o AA p < 0.01 et AAA p < 0.001
comparativement leur contrle respectif.