See

discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/272840760

Aptamer-Based Sensing of -Casomorphin-7

Article in Journal of Agricultural and Food Chemistry February 2015

DOI: 10.1021/acs.jafc.5b00007 Source: PubMed

CITATIONS READS

2 63

3 authors, including:

Yudhishthir Rajput Rajan Sharma

National Dairy Research Institute National Dairy Research Institute
58 PUBLICATIONS 268 CITATIONS 54 PUBLICATIONS 206 CITATIONS

SEE PROFILE SEE PROFILE

Available from: Rajan Sharma

Retrieved on: 10 November 2016
 Article

pubs.acs.org/JAFC

Aptamer-Based Sensing of Casomorphin7

Abhishek Parashar, Yudhishthir S. Rajput,*, and Rajan Sharma

Animal Biochemistry Division, National Dairy Research Institute, Karnal-132001, India

Dairy Chemistry Division, National Dairy Research Institute, Karnal-132001, India

*
S Supporting Information

ABSTRACT: -Casomorphin-7 (BCM-7), a seven amino acid peptide, is released during digestion of -casein A1 variant of
milk which is speculated to be associated with certain diseases. Fifteen ssDNA aptamers having high anity toward BCM-7 were
identied from a 72 nt long random library after ten rounds of systematic evolution of ligands by exponential enrichment.
Dissociation constant values of selected aptamers were in the range of 7.7156.7 nM. Seq6 aptamer exhibited the lowest Kd
value. Nine aptamers were evaluated for their binding toward BCM-7, BCM-9A1, and BCM-9A2 peptides, and binding was
variable. SeqU5 exhibited the lowest binding with BCM-9A1 and BCM-9A2. Aptamer-coated gold nanoparticles (GNPs)
resulted in color change of GNPs in the presence of BCM-7, thereby establishing recognition of BCM-7 by aptamers. The
enzyme-linked aptamer-sorbent assay (ELASA) was evaluated as an assay of BCM-7 in biological uids. BCM-7-peroxidase
competed with BCM-7 in ELASA, performed with BCM-7 solution and BCM-7 spiked urine pretreated with urease, plasma, and
-casein digest samples.
KEYWORDS: aptamer, -casein, -casomorphin-7, SELEX, gold nanoparticles, ELASA

INTRODUCTION
Aptamers are ssDNA or RNA oligonucleotides having high
anity toward target molecules and are selected from random
oligonucleotide library through repetitive systematic evolution
of ligands by exponential enrichment (SELEX) rounds.1 Each
round of SELEX results in enrichment of the oligonucleotide
interacting with the target. The specicity of the oligonucleo-
tide is enhanced through negative and counter selection.
Aptamers have been selected against numerous molecules
including T-2 toxin,2 Salmonella typhimurium,3 acetamiprid,4
botulinum neurotoxin,5 tobramycin,6 and ochratoxin A.7 The
aptamers can be used for development of sensors for
tetracycline,8 estimation of kanamycin,9 and can replace
antibodies in immunoassays of tularemia.10 -casein A1 variant
of milk (Type A1) on its breakdown in human intestine
produces the nine amino acid peptide -casomorphin-9A1
(BCM-9A1) which is further degraded into -casomorphin-7
peptide (BCM-7, a seven amino acid peptide), while -casein
A2 variant (Type A2 milk) on its digestion produces only -
casomorphin-9A2 peptide (BCM-9A2), which is not further
degraded. The susceptibility of -casein A1 toward proteolytic
degradation is dierent from that of -casein A2. This is
because of the dierence in one amino acid at the 67th position
of -casein. Proline is present at the 67th position in A2 variant,
whereas this amino acid is substituted by histidine in A1
variant.11 Histidine at the 67th position in the A1 variant allows
cleavage of the peptide bond between the 66th and 67th amino
acid residues by intestinal protease, which results in formation
of BCM-7.12 BCM-7 from the intestine can be transported to
blood in infants and people suering from autistic and
schizophrenic disorders having high intestinal permeability
and low activity of Dpp-iv (Dipeptidyl peptidase-4) enzyme. In
blood, BCM-7 is further degraded to -casomorphin-5
(BCM-5) by Dpp-iv enzyme. Milk containing -casein A1
variant is speculated to be associated with certain non-
communicable diseases such as type I diabetes, coronary
heart disease, schizophrenia, and autism.13,14 A recent study has
also indicated higher amounts of BCM-7 in the urine of autistic
patients,15 although the role of BCM-7 in this disease and
others is still not understood. Nevertheless, the measurement of
BCM-7 in the blood or urine of patients may provide evidence
of a possible link between type A1 milk and these diseases.
Because of the health concerns associated with Type A1 milk,
selective breeding is being adopted in some countries to
produce A2 milk only. At present, the PCR-based method is
used for distinguishing between animals that will produce Type
A1 or Type A2 milk. The method requires isolation of DNA
from blood, somatic cells, or skin from animals16,17 and its
subsequent amplication by A1 or A2 allele-specic primers.
The methods for identifying BCM-7 in milk require isolation of
-casein from milk and its digestion prior to HPLC.18 For
developing a detection method, suitable anity agents which
can recognize BCM-7 are required. Here we report the
selection of 15 unique DNA aptamers that exhibited high
anity to BCM-7 and can be used for developing an enzyme-
linked aptamer-sorbent assay (ELASA) for BCM-7 in urine,
plasma, and -casein digest.
MATERIALS AND METHODS
Safety. Gold nanoparticles, magnetic beads, and chemicals such as
ethidium bromide were used during the experiment. However, all the
materials were disposed of safely according to Institute regulations.
Human and Animal Rights Issues. The work is in vitro in nature
and does not include any human or animal trials.
Received: October 2, 2014
Revised: February 23, 2015
Accepted: February 25, 2015

XXXX American Chemical Society A DOI: 10.1021/acs.jafc.5b00007

J. Agric. Food Chem. XXXX, XXX, XXXXXX
Journal of Agricultural and Food Chemistry Article

Table 1. Conditions Used in Various Rounds of SELEX

round selection number of washings with binding buer number of elutions with elution buer eluate used in next round/cloning
1. positive: BCM-7 beads 6 6 sixth eluatea
2. positive: BCM-7 beads 5 5 fth eluatea
3. positive: BCM-7 beads 5 5 fth eluatea
4. positive: BCM-7 beads 6 6 sixth eluateb
negative: magnetic beads unbound from magnetic beadsa
5. positive: BCM-7 beads 5 5 fth eluateb
counter: BCM-5 beads unbound from BCM-5 beadsa
6. positive: BCM-7 beads 5 5 fth eluateb
counter: BCM-9A1 beads unbound from BCM-9A1beadsa
7. positive: BCM-7 beads 5 5 fth eluateb
counter: BCM-9A2 beads unbound from BCM-9A2 beadsa
8. positive: BCM-7 beads 5 5 fth eluatea
9. positive: BCM-7 beads 5 5 fth eluatea
10. positive: BCM-7 beads 5 5 fth eluatec
a
Eluate used in next round of SELEX. bFraction used in negative or counter selection. cEluate used for cloning.

Conjugation of BCM-7, BCM-5, BCM-9A1, and BCM-9A2
Peptides to Magnetic Beads. BCM-7, BCM-5, BCM-9A1, and
BCM-9A2 peptides (Technoconcept) were conjugated to tosyl
activated Dynabeads M-280 (Invitrogen) as per manufacturer
protocol. A 100 mM borate buer was prepared by adding 6.18 g of
boric acid in 800 mL of water. The pH was adjusted to 7.8 by 1 N
NaOH; the nal volume of the solution was made to be 1000 mL by
the addition of water. A sample of 2 108 beads were washed four
times with 100 mM borate buer (pH 7.8). To the washed beads were
added 100 L of peptide (1 mg/mL in water); 50 L of 100 mM
borate buer, pH 7.8; and 100 L of 3.0 M ammonium sulfate
(prepared in borate buer, pH 7.8). The contents were incubated for
20 h at 37 C. The unconjugated peptides were removed by washing
the beads with borate buer. The remaining sites on the beads were
blocked by immersing beads in 0.5% bovine serum albumin (BSA)
prepared in phosphate buer saline (PBS), pH 7.4, for 1 h at 37 C.
After the blocking solution was removed, peptide conjugated beads
were suspended in 0.1% BSA-PBS, pH 7.4, stored at 4 C, and used
within 15 days.
Amplication of ssDNA Library. A 500 ng sample of 72 nt long
ssDNA (MW = 22 067 Da) library19 (Integrative DNA technology,
IDT) was amplied in 5 parallel reactions by PCR. This will essentially
have (500 109)(6.023 1023)/22 067 = 1.36 1013 molecules.
Total randomness possible from 36 variable nucleotides in the 72 nt.
long library will be 436 = 4.7 1021. However, the maximum
randomness from a 500 ng library will be limited to 1013. Each reaction
mixture was composed of 50 mM (NH4)2SO4, 100 mM Tris-HCl, 2.0
mM MgCl2, 0.2 mM dNTPs, 100 ng of ssDNA library, 1.0 M each of
forward primer (5-ATCCGTCACACCTGCTCT-3) and phosphory-
lated reverse primer (5-P-ATACGGGAGCCAACACCA-3), and 1.5
U Taq DNA polymerase in a volume of 50 L. The amplication
conditions used are as follows: an initial heat activation step at 95 C
for 5 min and 30 cycles of 95 C for 1 min, 55 C for 1 min, 72 C for
1 min, and an extension step of 2 min at 72 C. Amplication of the
library was conrmed by resolving PCR product on 3% agarose gel
electrophoresis.
Conversion of dsDNA into ssDNA. Amplied PCR product
without further purication was digested by exonuclease20
(Fermentas) and digestion reaction was monitored on 3% agarose
gel electrophoresis. After 100 min of digestion, the reaction was
stopped by inactivating exonuclease, which was achieved by heating
at 85 C for 10 min. The product was puried by Qiax II gel extraction
kit (Qiagen). The preparation (pure DNA) was stored at 20 C until
further use. On the day of SELEX, the contents were thawed and
diluted with 100 L of binding buer (20 mM Tris HCl, 100 mM
NaCl, 2.0 mM MgCl2, 5.0 mM KCl, 1.0 mM CaCl2, and 0.02% Tween
20, pH 7.6). The undigested reverse strands were further separated by
snap cooling, which was achieved by heating of puried product at 90
C for 15 min and immediately placing on ice for 5 min.21
SELEX. An amplied ssDNA library (10 g) was incubated with
BCM-7 conjugated beads (2 108) in 100 L of binding buer for 1 h
at 28 C with intermittent tapping of tubes to prevent settling of
magnetic beads. Then, the beads were washed with 100 L of binding
buer to remove unbound ssDNA, while bound ssDNA was eluted
with elution buer (20 mM Tris HCl, 10.0 mM EDTA, 3.5 M Urea,
and 0.02% Tween 20, pH 8.0) at 80 C for 10 min. Ten rounds of
SELEX were performed to enrich target-specic oligonucleotides
(aptamers). To enhance the specicity of the selected oligonucleo-
tides, negative selector and counter selectors (BCM-5, BCM-9A1, and
BCM-9A2 coated magnetic beads) were used. In negative selection,
tosyl activated magnetic beads were blocked by 0.5% BSA (prepared in
PBS) for 1 h at 37 C. In each round of SELEX, ssDNA eluted from
the last elution was amplied. Amplication conditions used are as
follows: an initial heat activation step at 95 C for 3 min and 17 cycles
of 95 C for 14 s, 55 C for 23 s, 72 C for 17 s, and an extension step
of 2 min at 72 C. The concentration of PCR product was determined
by nanophotometer and was digested by addition of 10U
exonuclease for every 2.0 g of amplied product. The digested
PCR product was puried by using Qiax II gel extraction kit, snap
cooled, and used for the next round of SELEX. The conditions in
various rounds of SELEX are provided in Table 1.
Enrichment of BCM-7 specic aptamer after each round of SELEX
was evaluated by amplication of 1.0 L of aliquot taken from each
round of washings and elutions. The PCR reaction conditions used
were the same as those mentioned above. The PCR product was
conrmed by resolving on 3% agarose gel electrophoresis. The amount
of DNA was calculated by gel analysis software (SynGene, Synoptis).
The aptamers obtained after the last round of SELEX were amplied
by using forward primer (5-ATCCGTCACACCTGCTCT-3) and
reverse primer (5-ATACGGGAGCCAACACCA-3). The PCR
product was inserted into pGEM T cloning vector (Promega). The
recombinant vector was cloned into Escherichia coli (DH5). A total of
41 clones were selected for sequencing (SciGenom).
Determination of Dissociation Constant. Prior to use, BCM-7
conjugated magnetic beads were washed and suspended in binding
buer. A 100 L sample of 5325 nM, 5(6)-carboxyuorescein
labeled aptamer (IDT) (prepared in binding buer) was mixed with 50
L of BCM-7 conjugated beads (1 108) for 1 h at 28 C. Unbound
aptamers were collected by ve quick successive washing with binding
buer of 100 L each. Bound aptamers were eluted with ve
successive treatments of beads with elution buer of 100 L each at 80
C for 10 min.22 The unbound and bound aptamers were separately
pooled. Labeled aptamers were measured at 494 nm excitation and
520 nm emission wavelengths (Varian, Cary Eclipse Fluorescence
Spectrophotometer). The dissociation constant (Kd) was calculated by
nonlinear regression analysis using Graph Pad Prism 5 software.
Binding Selectivity of BCM-7 Apatmers. Selected aptamers
were tested for their ability to bind with BCM-7/BCM-9A1/BCM-

B DOI: 10.1021/acs.jafc.5b00007
J. Agric. Food Chem. XXXX, XXX, XXXXXX
Journal of Agricultural and Food Chemistry
9A2 by following the protocol as described by Niazi et al.23 In brief,
500 ng of 5(6)-carboxyuorescein labeled aptamer (dissolved in 100
L of binding buer) was mixed with 50 L of peptide-coated beads
(1 108) and incubated for 1 h at 28 C. The unbound and bound
aptamers were collected as mentioned above, and the uorescence was
measured.
Secondary Structure Prediction of Aptamers. Secondary
structures of the aptamers were obtained by online program Mfold
(http://mfold.rit.albany.edu/?q=mfold/DNA-Folding-Form) at 100
mM NaCl, 2.0 mM MgCl2, and 28 C to determine the possible
interacting regions of the aptamers.
Gold Nanoparticles-Aptasensor. Gold nanoparticles (GNPs)
were prepared by reduction of gold(III) chloride trihydrate (Sigma) by
sodium citrate (Sigma).24 The concentration of gold nanoparticles was
calculated from the molar extinction coecient value of 2.43 108
M1 cm1 at 520 nm25 for 23 nm GNPs. A 20 L sample of 100 M
aptamers was mixed with 10.0 mL of 5.0 nM GNPs suspended in
water, and the mixture was incubated for 1 h26,27 at 25 C. Aptamer-
coated GNPs were pelleted by centrifugation (8000 rpm, 20 min). The
supernatant was discarded. The pelleted GNPs were resuspended in
water. A 25 L sample of varied concentration of BCM-7 from 1 to 30
g/mL (prepared in water) were mixed with 200 L of 5.0 nM
aptamer-coated GNPs. After 1 h of incubation, 25 L of 350 mM
NaCl was added, and the contents were gently but quickly mixed. The
color change of GNPs was recorded within 3 min.
Enzyme-Linked Aptamer-Sorbent Assay. Aptamers were
evaluated for their potential use for the estimation of BCM-7 content
using an enzyme-linked aptamer-sorbent assay. A 12 L sample of 10
M of each of ve biotinylated aptamers (seq1, seq7, seq10, seqU4,
and seqU5) (IDT), were mixed and further diluted by adding 1140 L
of 5X SSCT buer (75 mM sodium citrate, 750 mM sodium chloride,
and 0.05% Tween 20), pH 7.0. A 100 L portion of the aptamer-mix
was added to each well in a 96-well streptavidin coated plate (Nunc).
After 1 h of incubation at room temperature, wells were washed three
times with 2X SSCT (30 mM sodium citrate, 300 mM sodium
chloride, and 0.05% Tween 20), pH 7.0 to remove unbound
biotinylated aptamers. Then, wells were blocked by treating overnight
with 1.5% BSA at 4 C. Wells were washed three times with 1X
phosphate saline buer (PBS) at pH 7.4 to remove excess BSA. Then,
100 L of BCM-7 at variable concentration (101000 ng/mL,
prepared in water) were added, and the plate was incubated for 90 min
at 25 C. The wells were washed three times with 1X PBS at pH 7.4.
Then, wells were treated with 1/2000 times diluted 100 L of BCM-7-
peroxidase conjugate (Merck) for 90 min at 25 C. After incubation
with conjugate, the plate was washed ve times with 1X PBS, pH 7.4,
to remove unbound BCM-7-peroxidase conjugate followed by addition
of 100 L of 3,3,5,5-tetramethylbenzidine (TMB) (Sigma). The plate
was further incubated for 15 min at 37 C, and then the reaction was
stopped by adding 100 L of 2 N HCl. The absorbance was recorded
at 450 nm. in ELISA plate reader (BioTek).
Cross reactivity of individual BCM-7 specic aptamers (seq1, seq10,
seq7, seqU5, seq3, seq4, seq6, seqU2, and seqU4) with BCM-5, BCM-
9A1, and BCM-9A2 peptides was determined in a manner similar to
that described above using 500 nM biotinylated BCM-7 aptamers and
500 ng/mL concentration of BCM-7/BCM-5/BCM-9A1/BCM-9A2
peptide.
BCM-7 aptamers (seqU4) were also evaluated for their possible use
in development of ELASA method applicable to blood, urine, and -
casein digest. For this purpose, plasma (rat), urine (human), and -
casein digest (bovine) were spiked with BCM-7 peptide (3.2200 g/
mL). A 15 mL sample of urine was treated with 50 L (187 U) of
urease at room temperature for 1 h to remove urea from urine; -
casein from bovine (sigma) was digested according to Jinsmaa and
Yoshikawa protocol.12 The 50 L of urine or plasma or -casein digest,
50 L binding buer, and 100 L, 1/4000 times diluted BCM-7-
peroxidase (diluted in binding buer) were added simultaneously to
each well. The 96-well plate was incubated for 90 min at room
temperature and then subjected to peroxidase assay as described
above.
Article
RESULTS
Selection of Aptamers. An in vitro selection of ssDNA
that binds to BCM-7 conjugated to tosyl activated magnetic
beads by the SELEX process was conducted. DNA aptamers
specic to BCM-7 were selected from a pool of 1013 random
DNA library. A total of ten SELEX rounds including negative
and counter selections made gradual enrichment of oligonu-
cleotides. The percentage of ssDNA binding to BCM-7 from
DNA pool was signicantly increased with increasing the
SELEX rounds. Before the fth round of selection, the negative
selection was performed by using magnetic beads. BCM-5,
BCM-9A1, and BCM-9A2 counter selector peptides were used
after SELEX round number 5, 6, and 7 respectively. The
negative and counter selections were used to improve the
specicity of aptamers for BCM-7. Sequences of inserts from 41
independent clones revealed a total of 15 dierent aptamers.
Out of 15 aptamers, seq10, seq1, seqU1, seqU3, seqU4, seq7,
and seq4 were present in 10, 6, 5, 4, 3, 3, and 2 of the
independent clones, respectively (Table 2), indicating enrich-
ment of aptamers. Thirteen aptamers were 72 nt long, and the
remaining two aptamers (seq6 and seq9) were 71 nt long. Seq9
and seq10 aptamers have one base dierence as seq9 lacked
guanosine base at the 43rd position. Loss of one nucleotide in
71 nt long aptamer can happen during PCR amplication.
Dissociation Constant and Binding Selectivity Study
of BCM-7 Specic Aptamers. The dissociation constant
values of BCM-7 aptamers were in the range of 7.69156.66
nM. Seq6 showed the lowest dissociation constant value (7.69
nM), while seq8 showed the highest value (156.66 nM) (Table
2).
Binding selectivity of nine aptamers, viz., seq1, seq10, seq7,
seqU5, seq3, seq4, seq6, seqU2, and seqU4, toward BCM-7,
BCM-9A1, and BCM-9A2 peptides was evaluated. In general,
the binding of uorescent labeled aptamers to BCM-7 was
generally higher in comparison to BCM-9A1 or BCM-9A2
(Figure 1). Aptamers seq10, seqU5, seq4, seq6, seqU2, and
seqU4 bind to a similar extent to BCM-9A1 and BCM-9A2.
However, seq7 and seq3 aptamers cross-reacted preferably to
BCM-9A1. Also, seq10, seq7, seqU5, and seqU4 aptamers
exhibited lower cross-reaction with BCM-9A1 and BCM-9A2
(Figure 1).
Predicted Secondary Structure of BCM-7 Aptamers.
Secondary structure of the selected aptamers was predicted by
online program Mfold. Five structural motifs common in at
least two aptamers were obtained by Mfold software (Figure 2
and Supporting Information). The selected aptamers were
classied into six groups based on presence or absence of motifs
(Table 3). Nine aptamers showed one common motif with at
least one aptamer. The remaining six aptamers had no common
motifs and hence were grouped in group 6. These motifs are
present in the form of loops which are predominantly created
by G-C linkage. For several aptamers, more than one Mfold
structure were predicted. There are four aptamers in group 1,
three aptamers in group 2, and two aptamers each in groups 3,
4, and 5. The remaining six aptamers which lacked conserved
motif structure were grouped in group 6.
Recognition of BCM-7 by Aptamer-Coated Gold
Nanoparticles. Selected aptamers from Mfold groups
(seqU4, seq1, seqU5, seq10, seqU2, and seq7) were evaluated
for their recognition at dierent concentrations of BCM-7
ranging from 1 to 30 g/mL. The visible color change (pink to
purple) in GNP was noted at 1030 g/mL concentration of
C DOI: 10.1021/acs.jafc.5b00007
J. Agric. Food Chem. XXXX, XXX, XXXXXX
 Table 2. Sequences of BCM-7 Specic Aptamers
aptamer sequence length no. of independent clones containing Kd (nM)
namea sequence (53) (nt.) identied aptamer (mean SEM)
seq1(R) ATACGGGAGCCAACACCATAAGTCTAAAAAACTGGGAGTAAACACAATGTGTATAGAGCAGGTGTGACGGAT 72 6 14 1.16
seq2(F) ATCCGTCACACCTGCTCTCCTCGAACTAGTTAGACCCTCCTCCAAGTCAACTTGTGGTGTTGGCTCCCGTAT 72 1 81 8.08
seq3(R) ATACGGGAGCCAACACCACTCTTATTTCCGGAAGTGGTTCTTCAACAGAGGAATAGAGCAGGTGTGACGGAT 72 1 18.77 2.83
seq4(R) ATACGGGAGCCAACACCAACAAAACTAGCAAATTAGAGCCGTATCGGAGCCTATAGAGCAGGTGTGACGGAT 72 2 141.26 19.85
seq5(F) ATCCGTCACACCTGCTCTCGAATAGAGTATTCGATACTGACTTTATTTACCGTCTGGTGTTGGCTCCCGTAT 72 1 10.23 2.40
seq6(R) ATACGGGAGCCAACACCAAAGTAAGATCATCACCCGGACGCGGACATAATAGGAGAGCAGGTGTGACGGAT 71 1 7.69 1.68
seq7(R) ATACGGGAGCCAACACCACAAGTTGACTTGGAGGAGGGTCTAACTAGTTCGAGGAGAGCAGGTGTGACGGAT 72 3 48.66 5.78
seq8(R) ATACGGGAGCCAACACCACCAACATTATCAGAGTATGTTACTTATAGTGGTGGCAGAGCAGGTGTGACGGAT 72 1 156.66 6.36
seq9(R) ATACGGGAGCCAACACCAGACGGTAAATAAAGTCAGTATCGATACTCTATTCGAGAGCAGGTGTGACGGAT 71 1 37.66 4.66
seq10(R) ATACGGGAGCCAACACCAGACGGTAAATAAAGTCAGTATCGAGTACTCTATTCGAGAGCAGGTGTGACGGAT 72 10 37.53 2.15
seqU1(F) ATCCGTCACACCTGCTCTTGTAGGGTTCCCACCCAATTCAGTTCCGTTAAACCATGGTGTTGGCTCCCGTAT 72 5 36.33 2.33
seqU2(F) ATCCGTCACACCTGCTCTCCCCGGCGTCCGTTTATTAGCAGACTTTGGCGGAATTGGTGTTGGCTCCCGTAT 72 1 41.85 3.41
seqU3(R) ATACGGGAGCCAACACCACAACAAGATAAAGTATCAATCTGGTTGACGGACGTGAGAGCAGGTGTGACGGAT 72 4 21.43 3.84
Journal of Agricultural and Food Chemistry

seqU4(R) ATACGGGAGCCAACACCAATTCCGCCAAAGTCTGCTAATAAACGGACGCCGGGGAGAGCAGGTGTGACGGAT 72 3 23.11 2.94

seqU5(F) ATCCGTCACACCTGCTCTATACACATTGTGTTTACTCCCAGTTTTTTAGACTTATGGTGTTGGCTCCCGTAT 72 1 42 2.30
a
R or F in parentheses indicates aptamer generated from reverse strand or forward strand of amplied library, respectively.

D
a
group
bases.)

group 6
group 5
group 4
group 3
group 2
group 1

motif 5
motif 4
motif 3
motif 2
motif 1
motif

5CAGGTGTG 3

no conserved motif
5 CGGNNNCCG 3
5 ACACANTGTGT 3
5GGAGCCAACACC 3

5CTCTATTCGAGAG 3
Table 3. Groups of Aptamers

seq10(2)

seqU3(2)
seqU4(4)
seqU5(5)
seqU4(4)

seq9(2) and
seq1(5) and

seqU2(2) and
and seq8(1)
seq6(2), and

seqU1(2), and
seq2(3), seq3(1),
seq1(5), seq6(2),
seq1(5), seq4(3),

seq5(1), seq7(3),
name of aptamersa
and counter selector peptides (BCM-9A1 and BCM-9A2).

presence of BCM-7 is shown in Supporting Information.

Figure in parentheses indicates number of predicted structures.
10.2381.0
14.7142.0
Article

41.8523.11
37.5337.66
7.69156.66
7.69141.26
Kd range (nM)

DOI: 10.1021/acs.jafc.5b00007
Figure 1. Percentage of bound aptamers for target peptide (BCM-7)

streptavidin coated plate. A mixture of ve biotinylated

for their binding to BCM-7 by ELASA method in a 96-well
ELASA for BCM-7. The selected aptamers were evaluated
color change in other aptamers coated on GNPs in the
BCM-7. A typical color change in seqU4 coated GNP at

J. Agric. Food Chem. XXXX, XXX, XXXXXX

dierent concentration of BCM-7 is shown in (Figure 3). The
Figure 2. Five dierent motifs in BCM-7 aptamers. (N indicates any
Journal of Agricultural and Food Chemistry
Figure 3. Color change in gold nanoparticles (GNPs): (a) NaCl
addition at indicated concentrations (mM) to GNPs, (b) NaCl
addition at indicated concentrations in mM to GNPs conjugated to
aptamer (seqU4), and (c) color change in GNPs conjugated with
aptamer (seqU4) on incubation with dierent concentrations (g/
mL) of BCM-7 and 350 mM NaCl.
aptamers (seq1, seq7, seq10, seqU4, and seqU5) was allowed to
bind to the plate using biotinavidin interaction. BCM-7 and
BCM-7 peroxidase conjugate competed for limited amount of
aptamer. There was an inverse relationship between peroxidase
Figure 4. ELASA for BCM-7. The extent of displacement of the BCM-7 peroxidase conjugate by (a) BCM-7 peptide at dierent concentration and
(b) BCM-7, BCM-5, BCM-9A1, and BCM-9A2 at xed concentration.
E DOI: 10.1021/acs.jafc.5b00007
Article
activity and BCM-7 concentration. The IC50 value was 250 ng/
mL for BCM-7 (Figure 4a).
Cross recognition of selected nine aptamers to BCM-5,
BCM-9A1, and BCM-9A2 peptides was also checked. In a 96-
well plate format, BCM-7-peroxidase competed with BCM-5,
BCM-7, BCM-9A1, or BCM-9A2. The extent of binding of
these peptides is reected in the extent of the drop in
absorbance. For example, seqU5 aptamer has failed to
recognize all the peptides including BCM-7. Seq7 has cross
reacted with BCM-5, BCM-9A1, and BCM-9A2. Seq3, seq4,
seq6, and seqU4 have shown lower cross-recognition among
the nine aptamers tested (Figure 4b).
The ELASA method was used to evaluate whether aptamers
could recognize spiked BCM-7 in biological uids. Urine
contains urea which may interfere in recognition of BCM-7 by
aptamer; therefore, the urine sample was treated with urease
before its use in ELASA. BCM-7-peroxidase competed with
spiked BCM-7 present in urine, plasma, and -casein digest
samples as indicated by lowered absorbance with increasing
concentration of BCM-7 (Figure 5). Results also suggest that
some component of urine and plasma interferes in the assay
(see absorbance value in corresponding control and blank
samples) (Figure 5).
DISCUSSION
BCM-7 has been linked with certain noncommunicable diseases
such as type I diabetes, coronary heart disease, schizophrenia,
and autism; suitable ligands which can recognize BCM-7 are
required for method development. This paper describes in vitro
selection of aptamers that bind to BCM-7 with high anity.
Out of 15 aptamers, ve aptamers are generated with forward
primer while ten aptamers start with reverse primer. This
J. Agric. Food Chem. XXXX, XXX, XXXXXX
Journal of Agricultural and Food Chemistry
Figure 5. ELASA for BCM-7 in urine, plasma, and -casein digest. Control and blank represent peroxidase activity in the absence of BCM-7 in
binding buer, urine, plasma, or -casein digest, respectively.
clearly indicates that exonuclease was not able to fully digest
the dsDNA. Available protocol for digestion of dsDNA by
exonuclease requires prior purication of PCR product.
However, there is a loss in yield that occurs during purication.
In the present work, PCR product was digested with
exonuclease without prior purication. This results in
incomplete digestion. In fact, 13% dsDNA (GelQuant
software) was found in DNA-digest by exonuclease, based
on the intensity of dsDNA and ssDNA bands after their
separation on agarose gel electrophoresis. Thus, the remaining
dsDNA was converted to ssDNA by snap cool method.
The mean Kd values of forward strand aptamer (mean Kd =
42.0 nM) and reverse strand aptamers (mean Kd = 50.2 nM)
suggest that both groups of aptamers have similar binding
anity for the target. The Kd values of repeat-aptamers were
also compared with those of nonrepeat aptamers, and it was
found that the mean Kd values of repeat-aptamers (mean Kd =
42.0 nM) were similar to that of nonrepeat aptamers (mean Kd
= 49.5 nM).
Nine aptamers (seq1, seq10, seq7, seqU5, seq3, seq4, seq6,
seqU2, and seqU4) were used for comparing their specicity in
two dierent experimental designs (Figures 1 and 4b). The
results suggest that the extent of cross reaction of aptamers with
BCM-9A1 and BCM-9A2 was not similar and was dependent
on the experimental format used. In one format, aptamer was
labeled with 6-carboxyuorescein, while in the other format,
aptamers were labeled with biotin. Thus, it appears that
modication of the aptamer with a label might result in
structural changes which eect recognition of BCM-7 and cross
reaction with BCM-9A1 and BCM-9A2. Also, it is to be noted
that in the ELASA method aptamers are in an immobilized
form, whereas in other experimental deigns using magnetic
beads (binding selectivity), aptamers remain in the free form.
Gold nanoparticles (GNPs), a colorimetric-based method,
was used to establish proof of principle of recognition of BCM-
7 by aptamers. The aptamer-coated gold nanoparticles
exhibited stability toward NaCl higher than that of naked
GNPs. The enhanced stability is an indication of coating of
aptamer on GNP surface because this results in enhanced
negative charge on GNPs. Because of high anity of aptamer
for BCM-7, the later is removed from GNPs surface. Such
GNPs lack enhanced stability and aggregate at lower NaCl
concentration.
BCM-7-peroxidase competed with BCM-7 in spiked bio-
logical uids in ELASA, suggesting that aptamers can work in
the 96-well format. However, it appears that some component
of urine and plasma interferes in the assay. Even the ELISA
F DOI: 10.1021/acs.jafc.5b00007
Article
base method for assaying BCM-7 from urine requires prior
extraction for determination of BCM-7 concentration.15
*
ASSOCIATED CONTENT
S Supporting Information
Mfold structure of aptamers and photos of aptamers showing
color change at dierent concentrations of BCM-7. This
material is available free of charge via the Internet at http://
pubs.acs.org.
AUTHOR INFORMATION
Corresponding Author
*Phone: +91184-2259129. E-mail: ys_rajput@redimail.com.
Notes
The authors declare no competing nancial interest.
ACKNOWLEDGMENTS
Research funding and fellowship was provided by National
Dairy Research Institute, Karnal-132001, India.
REFERENCES
(1) Ellington, A.; Szostak, J. In vitro selection of RNA molecules that
bind specific ligands. Nature 1990, 346, 818822.
(2) Chen, X.; Huang, Y.; Duan, N.; Wu, S.; Xia, Y.; Ma, X.; Zhu, C.;
Jiang, Y.; Wang, Z. Screening and identification of DNA aptamers
against T-2 toxin assisted by graphene oxide. J. Agric. Food Chem.
2014, 62, 1036810374.
(3) Duan, N.; Wu, S.; Chen, X.; Huang, Y.; Xia, Y.; Ma, X.; Wang, Z.
Selection and characterization of aptamers against Salmonella
typhimurium using whole-bacterium systematic evolution of ligands
by exponential enrichment (SELEX). J. Agric. Food Chem. 2013, 61,
32293234.
(4) He, J.; Liu, Y.; Fan, M.; Liu, X. Isolation and identification of the
DNA aptamers target to acetamiprid. J. Agric. Food Chem. 2011, 59,
15821586.
(5) Wei, F.; Ho, C. M. Aptamer-based electrochemical biosensor for
botulinum neurotoxin. Anal. Bioanal. Chem. 2009, 393, 19431948.
(6) Fernandez, E. G.; A lvarez, N. D. L. S.; Non, M. J. L. C.; Ordieres,
A. J. M.; Blanco, B. T. N. Impedimetric aptasensor for tobramycin
detection in human serum. Biosens. Bioelectron. 2011, 26, 23542360.
(7) Bonel, L.; Vidal, J. C.; Duato, P.; Castillo, J. R. An electrochemical
competitive biosensor for ochratoxin A based on a DNA biotinylated
aptamer. Biosens. Bioelectron. 2011, 26, 32543259.
(8) Luo, Y.; He, L.; Zhan, S.; Wu, Y.; Liu, L.; Zhi, W.; Zhou, P.
Ultrasensitive resonance scattering (RS) spectral detection for trace
tetracycline in milk using aptamer-coated nanogold (ACNG) as a
catalyst. J. Agric. Food Chem. 2014, 62, 10321037.
(9) Zhu, Y.; Chandra, P.; Song, K. M.; Ban, C.; Shim, Y. B. Label-free
detection of kanamycin based on the aptamer-functionalized
J. Agric. Food Chem. XXXX, XXX, XXXXXX
Journal of Agricultural and Food Chemistry Article

conducting polymer/gold nanocomposite. Biosens. Bioelectron. 2012,

36, 2934.
(10) Vivekananda, J.; Kiel, J. L. Anti-francisella fularensis DNA
aptamers detect tularemia antigen from different subspecies by
aptamer-linked immobilized sorbent assay. Lab. Invest. 2006, 86,
610618.
(11) Ng-Kwai-Hang, K.; Grosclaude, F. Genetic polymorphism of
milk proteins: Relationships with production traits, milk composition
and technological properties. Adv. Dairy Chem. (3rd Ed.) 2003, 1,
405455.
(12) Jinsmaa, Y.; Yoshikawa, M. Enzymatic release of neo-
casomorphin and -casomorphin from bovine -casein. Peptides
1999, 20, 957962.
(13) Cade, R.; Privette, M.; Fregly, M.; Rowland, N.; Zhongjie, S.;
Zele, V.; Wagemaker, H.; Edelstein, C. Autism and schizophrenia:
Intestinal disorders. Nutr. Neurosci. 2000, 3, 5772.
(14) Beales, P.; Elliott, R.; Scott, F. A multi-centre blinded
international trial of the effect of A1 and A2 -casein variants on
diabetes incidence in two rodent models of spontaneous Type I
diabetes. Diabetologia 2002, 45, 12401246.
(15) Sokolov, O.; Kost, N.; Andreeva, O.; Korneeva, E.; Meshavkin,
V.; Tarakanova, Y.; Dadayan, A.; Zolotarev, Y.; Grachev, S.; Mikheeva,
I.; Varlamov, O.; Zozulya, A. Autistic children display elevated urine
levels of bovinecasomorphin-7 immunoreactivity. Peptides (New York,
NY, U.S.) 2014, 56, 6871.
(16) Keating, A. F.; Smith, T. J.; Cairns, M. T. A note on the
evaluation of a beta-casein variant in bovine breeds by allele-specific
PCR and relevance to -casomorphin. Irish J. Agric. Food Res. 2008, 47,
99104.
(17) Barroso, A.; Dunner, S.; Canon, J. Technical note: Detection of
bovine kappa-casein variants A, B, C, and E by means of polymerase
chain reaction-single strand conformation polymorphism (PCR-
SSCP). J. Anim. Sci. (Savoy, IL, U.S.) 1999, 77, 26292632.
(18) De Noni, I. Release of -casomorphins 5 and 7 during simulated
gastro-intestinal digestion of bovine -casein variants and milk-based
infant formulas. Food Chem. 2008, 110, 897903.
(19) Bruno, J. G.; Carrillo, M. P.; Phillips, T. Development of DNA
aptamers to a foot and mouth disease peptide for competitive FRET-
based detection. J. Biomol. Tech. 2008, 19, 109115.
(20) Citartan, M.; Tang, T. H.; Tan, S. C.; Gopinath, S. C. B.
Conditions optimized for the preparation of single-stranded DNA
(ssDNA) employing lambda exonuclease digestion in generating DNA
aptamer. World J. Microbiol. Biotechnol. 2011, 27, 11671173.
(21) Chen, F.; Hu, Y.; Li, D.; Chen, H.; Zhang, X. L. CS-SELEX
generates high-affinity ssDNA aptamers as molecular probes for
Hepatitis C virus envelope glycoprotein E2. PLoS One 2009, 4, e8142.
(22) Stoltenburg, R.; Reinemann, C.; Strehlitz, B. FluMag-SELEX as
an advantageous method for DNA aptamer selection. Anal. Bioanal.
Chem. 2005, 383, 8391.
(23) Niazi, J. H.; Lee, S. J.; Kim, Y. S.; Gu, M. B. Single strand DNA
aptamers that selectively bind oxytetracycline. Bioorg. Med. Chem.
2008, 16, 12541261.
(24) Turkevitch, J.; Stevenson, P. C.; Hillier, J. A study of the
nucleation and growth processes in the synthesis of colloidal gold.
Discuss. Faraday Soc. 1951, 11, 5575.
(25) Liu, X.; Atwater, M.; Wang, J.; Huo, Q. Extinction coefficient of
gold nanoparticles with different sizes and different capping ligands.
Colloids Surf., B 2007, 58, 37.
(26) Kim, Y. S.; Kim, J. H.; Kim, I. A.; Lee, S. J.; Jurng, J.; Gu, M. B. A
novel colorimetric aptasensor using gold nanoparticle for a highly
sensitive and specific detection of oxytetracycline. Biosens. Bioelectron.
2010, 26, 16441649.
(27) Song, M. K.; Jeong, E.; Jeon, W.; Cho, M.; Ban, C. Aptasensor
for ampicillin using gold nanoparticle based dual fluorescence-
colorimetric methods. Anal. Bioanal. Chem. 2012, 402, 21532161.

G DOI: 10.1021/acs.jafc.5b00007
J. Agric. Food Chem. XXXX, XXX, XXXXXX