Вы находитесь на странице: 1из 7

Clinical Nutrition xxx (2015) 1e7

Contents lists available at ScienceDirect

Clinical Nutrition
journal homepage: http://www.elsevier.com/locate/clnu

Original article

Enterally delivered dipeptides improve small intestinal inammatory


status in a piglet model of intestinal resection*
Matthew G. Nosworthy, M. Elaine Dodge, Robert F. Bertolo, Janet A. Brunton*
Department of Biochemistry, Memorial University of Newfoundland, St. John's, NL, Canada A1B 3X9

a r t i c l e i n f o s u m m a r y

Article history: PepT1, a di/tripeptide transporter, is preferentially preserved over free amino acid transporters in situ-
Received 8 September 2014 ations of gut stress. Therefore, our objective was to determine the impact of enterally delivered
Accepted 24 May 2015 dipeptide-containing diets on indices of intestinal adaptation in neonatal piglets after intestinal
resection.
Keywords: Methods: Piglets (n 25, 10 1 d old) underwent an 80% jejuno-ileal resection and were provided 50% of
PepT1
nutritional support as TPN, and 50% as one of ve, enteral test diets: 1) a control diet containing free
Piglet
amino acids, or the same diet but with equimolar amounts of free amino acids replaced by 2) alanyl-
Intestinal resection
Dipeptide
alanine, 3) alanyl-glutamine, 4) cysteinyl-glycine, or 5) both alanyl-alanine and cysteinyl-glycine. After
Inammation 4 d of enteral feeding, indices of intestinal adaptation were assessed. Outcome measures included plasma
Enteral nutrition and mucosal amino acid concentrations, morphological and histological parameters, protein synthesis,
PepT1 mRNA and protein expression, and mucosal cytokine concentrations.
Results: Intestinal length, organ weight and protein synthesis rates were not different amongst groups.
All of the dipeptide-containing diets reduced pro-inammatory cytokine concentrations in the mucosa
(TNF-a, IFN-g). The cysteinyl-glycine diet supported greater villus height compared to all other di-
peptides and greater crypt depth compared to alanyl-glutamine; however, none of the dipeptide diets
altered intestinal morphology compared to the free amino acid control diet.
Conclusions: This study showed that while there was no explicit morphological benet of enteral di-
peptides over their constituent free amino acids, there was the potential for the amelioration of intestinal
inammation by reducing pro-inammatory cytokines. Enteral provision of dipeptides impacted intes-
tinal adaptation, but the response was dipeptide-specic.
2015 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.

1. Introduction is maintained or increased, in contrast to other nutrient trans-


porters which typically decline in number [2e4]. In addition to
Peptide transporter 1 (PepT1) is responsible for absorption of being preserved during gut stress, PepT1 expression is also sub-
small peptides, two or three residues, from the lumen of the small strate driven [5e7]. When the uptake of dietary protein is
intestine. Evidence suggests that PepT1 population and/or activity compromised due to intestinal injury, such as inammation or
can be altered by manipulating the nutritional status or health of surgery, it may be advantageous to provide small peptides, rather
the animal [1]. In situations of gut stress such as malnutrition, than free amino acids, in the diet to stimulate PepT1 at the brush
fasting, intestinal failure or surgical intervention, PepT1 expression border and exploit its capacity for nitrogen transport.
Short bowel syndrome (SBS) is a clinical condition induced
through the surgical removal of intestinal tissue. Causes for intes-
Abbreviations: PepT1, peptide transporter 1 (SLC15A1); CysGly, cysteinyl- tinal resection are varied, and include vascular emergencies such as
glycine; AlaGln, alanyl-glutamine; AlaAla, alanyl-alanine. bowel ischemia, inammatory disorders such as Crohn's disease
*
Conference Presentation: Presented at Experimental Biology 2011, and ulcerative colitis, tumors, physical trauma and infection such as
Washington DC, USA. necrotizing enterocolitis (NEC) [8,9]. NEC is an aggressive, anaer-
* Corresponding author. Tel.: 1 709 864 8533; fax: 1 709 864 2422.
obic infection that develops rapidly in the gastrointestinal tract in
E-mail addresses: mnosworthy@mun.ca (M.G. Nosworthy), edodge@mun.ca
(M.E. Dodge), rbertolo@mun.ca (R.F. Bertolo), jbrunton@mun.ca (J.A. Brunton). approximately 10% of all very low birth weight infants, with up to a

http://dx.doi.org/10.1016/j.clnu.2015.05.013
0261-5614/ 2015 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.

Please cite this article in press as: Nosworthy MG, et al., Enterally delivered dipeptides improve small intestinal inammatory status in a piglet
model of intestinal resection, Clinical Nutrition (2015), http://dx.doi.org/10.1016/j.clnu.2015.05.013
2 M.G. Nosworthy et al. / Clinical Nutrition xxx (2015) 1e7

34% mortality rate in the lowest birth weight category [10]. Intes- electrocautery. Continuity of the small intestine was restored by
tinal resection results in a dramatic loss of absorptive capacity [11] end-to-end anastomosis. Finally, a gastric catheter was implanted
leading to a requirement for long term parenteral nutrition (PN). to facilitate infusion of the enteral diets. A purse string suture was
A recent study from our laboratory in a piglet model of SBS placed in the body of the stomach and an incision was made in the
demonstrated that enteral feeding of an elemental diet (EN), in center of the area delineated by the suture. The gastric catheter was
combination with PN, induced intestinal adaptation including then inserted into the stomach through this incision and secured by
greater cell mass and intestinal length compared to PN alone [12]. the tightening of the purse string suture; subsequently, a second
Due to the substrate driven expression of PepT1, we hypothesized purse string suture was added that encompassed both the initial
that providing enteral amino acids as peptides may stimulate the suture and the catheter.
up-regulation of PepT1, leading to greater amino acid transport Post-surgery, piglets were given intravenous antibiotics (20 mg
potential. trimethoprim and 100 mg sulfadoxine; Borgal, Intervet Canada Ltd.,
Certain amino acids such as glutamine and cysteine are involved Ontario, Canada) and analgesic (0.03 mg/kg buprenorphine hy-
in intestinal barrier function and the regulation of oxidative stress. drochloride; Temgesic, Ontario, Canada). The intravenous and
Glutamine may be necessary for the localization of tight junction gastric catheters were secured by placing the piglets in jackets that
proteins, thereby linking glutamine directly to intestinal integrity attached to a tether-swivel system with dual-infusion ports (Lomir
[13]. Decline in the B0 transporter after surgical resection [2] may Biomedical, Quebec, Canada). This facilitated continuous infusion of
prevent adequate absorption of glutamine, which could interfere both I.V. and enteral diets. Piglets were individually housed in
with the maintenance of the intestinal barrier. With PepT1 poten- metabolic cages (circular, 1 m diameter), and each had aural and
tially up-regulated following surgery, and single amino acid visual contact with other piglets, and toys were provided for
transporters possibly depressed, the provision of enteral glutamine enrichment. The room temperature was between 23  C and 28  C,
as a dipeptide may be particularly advantageous to the remaining but piglets were also provided with heat lamps. Borgal was given
intestine. daily and analgesic every 12 h for the rst 3 days postoperatively.
Cysteine is a conditionally essential amino acid and has been Blood was sampled daily, the plasma collected and stored at 80  C.
linked to increased cellular proliferation of intestinal cells [14,15]. Piglet weights were measured daily beginning 48 h after surgery.
Cysteine is also one of the amino acid residues in glutathione (g-
Glu-Cys-Gly, GSH) and contributes to controlling cellular redox 2.2. Parenteral/enteral diets
states in the gut [16,17]. Humans with inammatory bowel disor-
ders requiring surgical resection have compromised redox status Following surgery, parenteral nutrition was infused into the
[18]. Inclusion of cysteine-containing peptides in enteral diets may jugular vein at half the rate of the targeted intake. The rate of
enhance cysteine availability and increase the generation of GSH, infusion was advanced to 75% on the rst morning after surgery,
leading to improved recovery and intestinal adaptation. and then to full rate by the end of day 1 (13.5 mL kg1 d1). The
In this study, we utilized a Yucatan miniature piglet model of complete parenteral solution provided 1.1 MJ of metabolizable
intestinal adaptation [12] to investigate the potential benets of energy$kg1 d1. Glucose (24.5 g kg1 d1) and lipid (20% Intralipid,
alanyl-glutamine and cysteinyl-glycine when provided enterally to Pharmacia, Stockholm, Sweden) each supplied half of the non-
piglets with an 80% proximal resection of the small intestine. protein energy. Protein, supplied as free amino acids, were pro-
vided at 15 g kg1 d1. The amino acid composition was (per gram
2. Materials and methods of L-amino acids): ala, 107 mg; arg, 67 mg; asp, 61 mg; cys, 14 mg;
glu, 105 mg; gly, 27 mg; his, 31 mg; iso, 46 mg; leu, 104 mg; lys-HCl,
2.1. Surgical procedures 102 mg; met, 19 mg; phe, 55 mg; pro, 83 mg; ser, 56 mg; tau, 5 mg;
thr, 41 mg; trp, 21 mg; tyr, 8 mg; and val, 53 mg. Vitamins (Multi-
Twenty-ve (25) Yucatan miniature piglets, 10e12 days of age 12K1 Pediatric, Quebec, Canada), trace minerals (at 200% of NRC
(Animal Care Services, Memorial University of Newfoundland, recommendations [19]), lipid, and iron dextran (Fe, 3.0 mg/kg;
Newfoundland and Labrador, Canada) were randomized to one of Vetoquinol Canada Inc., Quebec, Canada) were added to the diets
ve experimental groups. The study was approved by the Institu- immediate before use. On day 2, the resolution of ileus was tested
tional Animal Care Committee and followed the guidelines of the for by introducing a 10-mL bolus of the parenteral diet via the
Canadian Council of Animal Care. An intramuscular injection of gastric catheter. The volume of the stomach contents was measured
ketamine hydrochloride (22 mg/kg; Bimeda Canada, Ontario, Can- after 2 h. Gastric emptying was conrmed by the inability to
ada) and acepromazine (0.5 mg/kg; Vetoquinol Canada Inc., retrieve the dietary bolus from the stomach. Once gastric emptying
Quebec, Canada) was used to induce anesthesia. After atropine was evident, then enteral feeding was initiated on the following
sulfate injection (0.05 mg/kg; Rafter Dex, Canada), the piglets were day, increased over the subsequent 24 h to achieve 50% of total
intubated. Anesthesia was maintained with 1.0e1.5% isourane nutritional intake, and maintained for an additional 3 days. The
(Abbott Laboratories Ltd., Quebec, Canada) and oxygen at a ow balance of nutrients was provided as parenteral nutrition; all pig-
rate of 1.5 L/min. Two venous catheters were implanted; one lets received the same parenteral formulation as described above.
catheter was introduced into the left femoral vein and advanced to Nutritional support (I.V. and enteral) was provided continuously
the inferior vena cava just caudal to the heart. A second catheter (24 h/d) via peristaltic pumps.
was placed into the left external jugular vein and advanced to the The piglets were randomized to one of 5 experimental enteral
superior vena cava just cranial to the heart. The femoral catheter diets (n 5 per group). The experimental diets were based on the
was used for blood sampling and drug delivery, while the jugular elemental diet used for parenteral nutrition, with nitrogen pro-
was used to deliver parenteral nutrition. Subsequently, a laparot- vided as free L-amino acids, except for dipeptide treatments
omy was conducted and approximately 80% of the proximal small (described below). Also, the parenteral formula contained gluta-
intestine (SI) was resected. 100 cm of the distal ileum proximal to mate, whereas in the enteral diet, glutamate was replaced with free
the ileocecal valve was left in situ. The length of intestine left intact glutamine or glutamine-dipeptide. Specically, the enteral test
was identied by locating the ileocecal valve and following the formulations were: 1) free amino acids as a control diet (Control),
ileum proximally for 100 cm using a pre-measured string. The in- or the equimolar replacement of free amino acids with the
testine proximal to the 100 cm mark was removed via following dipeptides (Bachem, California, USA); 2) alanyl-alanine

Please cite this article in press as: Nosworthy MG, et al., Enterally delivered dipeptides improve small intestinal inammatory status in a piglet
model of intestinal resection, Clinical Nutrition (2015), http://dx.doi.org/10.1016/j.clnu.2015.05.013
M.G. Nosworthy et al. / Clinical Nutrition xxx (2015) 1e7 3

(AlaAla), 3) alanyl-glutamine (AlaGln), 4) cysteinyl-glycine (CysGly) 2.5. Real-time RT-PCR


or 5) the combination of alanyl-glutamine and cysteinyl-glycine
(AlaGln CysGly). All enteral diets were isonitrogenous. The PepT1 mRNA was measured in mucosa sampled from the
amino acid composition of the enteral diets is given in Table 1. remnant intestine. RNA was extracted using the Qiagen RNEasy
Necropsy of all piglets occurred four days after the initiation of Mini kit (Qiagen Inc., Quebec, Canada) according to the manufac-
enteral feeding. Four hours prior to the initiation of necropsy, BrdU turer's protocol. Concentration, purity and integrity were deter-
was provided intravenously to investigate crypt cell proliferation. A mined using the Agilent 2100 Bioanalyzer and the Agilent
ooding dose of 3H-phenylalanine was also provided via the Eukaryotic Total RNA Nano Kit (Agilent Technologies, Ontario,
femoral catheter, 30 min after which the piglets were anesthetized, Canada). cDNA was created according to the protocol outlined in
and samples of liver and mucosa from the remnant intestine were the QuantiTect (Qiagen Inc., Quebec, Canada) reverse transcriptase
taken for analysis of rates of protein synthesis [20]. manual. 800 ng of total RNA was used in the reverse transcription
reaction. Roche Faststart DNA master Sybr Green I kit (Roche,
Quebec, Canada) was used for the qPCR reaction. The sequences of
2.3. Histological analyses
the primers were as follows: PepT1 forward primer 50
d CTGGAGTTCTCCTATTCTCA 30 , reverse primer 50 d AACAGC-
Sections of intestine were xed in 10% buffered formalin (Fisher
CACGGTCAACAG 3; b-actin was used as an internal control with
Scientic, Pennsylvania, USA), processed and stained with hema-
the following sequences: forward primer 50 d CCCAGCACGAT-
toxylin and eosin (Fisher Scientic, Pennsylvania, USA) as previ-
GAAGA 30 , reverse primer 50 d CGATCCACACGGAGTC 3. The
ously described [12]. Ten measurements of villus height and crypt
accession numbers for the template sequences were AY180903.1
depth were measured in a blinded manner by a single investigator
for PepT1 [23] and AY550069 for b-actin. The qPCR instrument
(MGN) using a Zeiss Axiostar microscope (Carl Zeiss Toronto,
(Mastercycler, Eppendorf, Ontario, Canada) was set to the following
Ontario, Canada). Images were captured with an Innity 1 camera
conditions: 10 min at 95  C, 40 cycles of 15 s at 95  C and 15 at
and Innity Analyze software (Lumenera Corporation, Ontario,
58  C, and 63  C incubation for 15 s. Reaction efciency for PepT1
Canada). Immunohistologic analyses were conducted to determine
was 0.87 0.04 and b-actin reaction efciency was 0.89 0.04.
the incorporation of BrdU into proliferating cells within the intes-
Samples were repeated in duplicate and analyzed using the 2ddCt
tinal crypts with visualization based on DAB substrate (Vector
method [24].
Laboratories, Ontario, Canada).
Proliferation was expressed as the percentage of total crypt cells
that were labeled with BrdU (10 crypts per animal). 2.6. PepT1 protein analysis

2.6.1. Brush border membrane vesicle (BBMV) preparation


2.4. Protein synthesis and tissue/plasma amino acid determination
Brush border membrane vesicles were isolated from mucosal
scrapings. Briey, tissues were homogenized in 100 mM mannitol,
Amino acid concentrations in plasma and tissue samples were
2 mM HEPES/Tris pH 7.1 and 0.1 mM PMSF. 2 mL of homogenate
analyzed using PITC derivatization [21] with norleucine as the in-
was used for protein and marker enzyme analysis; the remaining
ternal standard. Specic radioactivity of the tissue free phenylala-
sample was centrifuged at 500  g for 12 min. Then, 1 M MgCl2 was
nine and the protein-bound phenylalanine was determined as
added to the supernatant to a nal concentration of 10 mM; this
described previously [22]. In brief, phenylalanine fractions were
solution was incubated on ice for 20 min prior to centrifugation at
isolated using reverse-phase HPLC combined with fraction collec-
3000  g for 15 min. The supernatant was collected and centri-
tion. The radioactivity associated with these fractions was deter-
fuged at 30,000  g for 30 min. The pellet was then resuspended in
mined by scintillation counting.
20 mL of 100 mM mannitol, 2 mM HEPES/Tris pH 7.4 and 1 mM
MgSO4 and centrifuged at 30,000  g for 30 min to isolate BBMVs.
The nal pellet was resuspended in 300 mM mannitol, 20 mM
Table 1
HEPES/Tris pH 7.4 and 0.1 mM MgSO4 (400 mL/g wet tissue) and
Amino acid composition of the enteral diets (g/L).
stored at 80  C. BBMVs were analyzed for sucrase activity as
Amino acid Control AlaAla AlaGln CysGly AlaGln CysGly previously described [25].
Alanine 4.40 0 1.03 4.40 1.03
Arginine 3.59 3.59 3.59 3.59 3.59
Aspartate 3.27 3.27 3.27 3.27 3.27 2.6.2. Western Blot
Cysteine 1.10 1.10 1.10 0 0 BBMVs were analyzed for protein content using the BCA
Glutamate 0 0 0 0 0 protein assay (Pierce Chemicals, Illinois, USA). Equivalent
Glutamine 5.50 5.50 0 5.50 0
amounts of protein (50 mg) were electrophoresed on 8% SDS-
Glycine 1.47 1.47 1.47 0.80 0.80
Histidine 1.67 1.67 1.67 1.67 1.67 polyacrylamide gels. After transfer to nitrocellulose membrane,
Isoleucine 2.48 2.48 2.48 2.48 2.48 blots were stained with Ponceau Red (SigmaeAldrich, Ontario,
Leucine 5.61 5.61 5.61 5.61 5.61 Canada) to assess the equivalency of protein loading. Blots were
Lysine 5.58 5.58 5.58 5.58 5.58 blocked in 3% milk-TBST (Tris-buffered saline and Tween 20 at
Methionine 1.04 1.04 1.04 1.04 1.04
Phenylalanine 2.95 2.95 2.95 2.95 2.95
0.2% v/v) for 45 min at room temperature and incubated with
Proline 4.46 4.46 4.46 4.46 4.46 primary antibodies overnight at 4  C. Primary antibodies used
Serine 5.19 5.19 5.19 5.19 5.19 were PepT1 (1:600, gift provided by E.A. Wong, Virginia Tech),
Taurine 0.24 0.24 0.24 0.24 0.24 and b-actin (1:600 SigmaeAldrich, Ontario, Canada). Blots were
Threonine 2.18 2.18 2.18 2.18 2.18
visualized using the Immun-Star Western C Kit (Bio Rad,
Tryptophan 1.14 1.14 1.14 1.14 1.14
Tyrosine 0.42 0.42 0.42 0.42 0.42 Quebec, Canada) and images obtained using a Gel Documenta-
Valine 2.86 2.86 2.86 2.86 2.86 tion System (Alpha Innotech, California, USA). Band intensity
Alanyl-alanine 0 4.40 0 0 0 was analyzed using AlphaVIEW SA (ProteinSimple, Ontario,
Alanyl-glutamine 0 0 8.87 0 8.87 Canada) and PepT1 expression was assessed relative to b-actin
Cysteinyl-glycine 0 0 0 1.77 1.77
for each sample.

Please cite this article in press as: Nosworthy MG, et al., Enterally delivered dipeptides improve small intestinal inammatory status in a piglet
model of intestinal resection, Clinical Nutrition (2015), http://dx.doi.org/10.1016/j.clnu.2015.05.013
4 M.G. Nosworthy et al. / Clinical Nutrition xxx (2015) 1e7

2.7. Tissue and plasma glutathione 3.2. Histology

Plasma and mucosal concentrations of reduced and total Although villus height for the CysGly group was similar to
glutathione were measured using the Biovision Glutathione assay control treatments, it was signicantly greater than all other
kit (Biovision, California, USA) according to their protocol. dipeptide groups (P < 0.05) (Fig. 1). Enteral CysGly also resulted in
signicantly greater crypt depth when compared to AlaGln
(P < 0.05) (Fig. 1). Provision of enteral dipeptides did not alter
2.8. TNF-a/IFN-g cellular proliferation, as determined by BrdU incorporation (data
not shown).
Mucosal TNF-a and IFN-g concentrations were determined us-
ing porcine ELISA kits (Pierce, Illinois, USA). Tissue supernatants 3.3. GSH, TNF-a and IFN-g
were prepared by homogenizing tissue in PBS containing Protease
Inhibitor Cocktail III (Calbiochem, California, USA) and 1 mM PMSF Total and reduced glutathione was quantied in both plasma
(Sigma, Ontario, Canada). Homogenates were centrifuged at and mucosal tissue with no signicant differences among treat-
>10,000  g to allow for analysis of tissue supernatants according ments (data not shown). The inclusion of AlaGln or CysGly in the
to the protocol provided by the supplier. Linear regression was used enteral diets signicantly reduced the concentration of IFN-g to less
to calculate the nal concentration of cytokine in the supernatant than 40% of control (P < 0.05) (Fig. 2a). The inclusion of any of the
which was reported as concentration per gram of mucosa. dipeptides in the diets resulted in a dramatic reduction in TNF-a, to
less than 27% of control (P < 0.01) (Fig. 2b).
2.9. Statistics
3.4. PepT1 mRNA/protein
The results were expressed as mean standard deviation for
each group. Data were analyzed by one-way ANOVA with Bonfer- Samples of mucosa taken from the remnant intestine were used
roni's protected means separation test; variances were shown to be to determine PepT1 mRNA and protein concentration. No signi-
equal through the application of Bartlett's test for equal variances. cant difference was found in PepT1 protein or mRNA among dietary
Sample size was n 5 piglets per dietary treatment and differences treatments (data not shown).
were noted as signicant if P < 0.05 (GraphPad Prism 4.0, California,
USA). 4. Discussion

In a previous study, we demonstrated that early provision of an


3. Results elemental enteral diet in tandem with parenteral nutrition resulted
in massive adaptive responses in a piglet model of short bowel
3.1. Morphologic measurements syndrome [12]. In the current study, we utilized this model to
assess whether metabolically important amino acids (cysteine and
Final body weights were not different amongst treatment glutamine) delivered as dipeptides would further enhance adap-
groups (Table 2). Also, there were no differences in weight gain per tation of the remnant intestine. Unfortunately, no structural or
kg per day (determined for the period after initiation of EN), or in functional benets of either dipeptide were found when compared
the percentage increase in body weight (Table 2). Total liver and to the free amino acid treatment. Even more surprising were the
kidney weights were also not different among treatment groups results that suggested the substitution of alanine and glutamine
(Table 2). No signicant differences were observed in plasma amino with alanyl-glutamine may actually be detrimental to mucosal re-
acid concentrations among treatment groups (data not shown). covery. Despite these results, the provision of enteral dipeptides did
Protein synthesis rates in the liver and intestinal mucosa were also lead to a signicant reduction in pro-inammatory cytokines in
similar among dietary treatments (Table 2). The length of the mucosal tissue, suggesting that the form of the dietary amino acids
remnant intestine increased by more than 70% in all groups after can alter the inammatory state of the small intestine.
one week of enteral feeding, from the remnant 100 cm left after The trigger for the mucosal inammatory response in our study
surgery; however, there was no effect of treatment on length or is uncertain, but could be related to bacterial overgrowth in the
total weight in the remnant small intestine (Table 2). The AlaGln remnant small intestine. Bacterial overgrowth is a common and
treatment resulted in lower mucosa weight in the proximal 50 cm potentially serious complication of short bowel syndrome in infants
of the remnant intestine when compared to the control diet [26]. Some pro-inammatory bacterial peptides are known sub-
(Table 2). strates for PepT1; tri-DAP l-Ala-g-d-Glu-meso-DAP [27] and

Table 2
Comparison of morphological and metabolic changes in piglets receiving different enteral diets.

Control AlaAla AlaGln CysGly AlaGln CysGly

Final body weight (kg) 3.3 0.5 3.3 0.3 3.2 0.5 2.9 0.3 3.4 0.4
Weight gain (g kg1 d1) 59 18 53 24 47 15 53 10 52 18
Weight gain (%) 21 3 23 6 15 8 23 4 20 8
Remnant intestine length (cm) 185 21 196 15 170 36 174 31 180 25
Weight of the proximal 50 cm of remnant intestinal mucosa (g) 14.03 4.74a 9.86 1.41ab 8.51 1.66b 9.86 2.36ab 8.27 1.33b
Remnant intestine relative weight (g/cm) 0.31 0.07 0.23 0.04 0.26 0.10 0.31 0.10 0.28 0.09
Individual kidney weight (g/kg) 3.67 0.41 3.54 0.72 4.40 0.89 4.37 0.75 3.70 0.38
Liver weight (g/kg) 37.4 3.9 38.9 3.7 40.1 7.0 41.8 7.9 38.3 2.5
Mucosal protein synthesis (%/day) 78 27 90 13 85 23 98 14 83 14
Liver protein synthesis (%/day) 114 38 71 19 75 30 88 35 80 14

Values are mean SD, one-way ANOVA with Bonferroni's protected means separation test. Values across a row not sharing a superscript are signicantly different (P < 0.05).

Please cite this article in press as: Nosworthy MG, et al., Enterally delivered dipeptides improve small intestinal inammatory status in a piglet
model of intestinal resection, Clinical Nutrition (2015), http://dx.doi.org/10.1016/j.clnu.2015.05.013
M.G. Nosworthy et al. / Clinical Nutrition xxx (2015) 1e7 5

within the enterocytes as well as from macrophages and mono-


cytes recruited into the submucosal space by chemoattractants
released from the enterocytes [30,31]. In this circumstance, the
presence of any dietary peptides in the intestinal lumen could serve
to lower bacterial peptide uptake through competitive inhibition.
Indeed, we found that the provision of any of the test dipeptides
resulted in a reduction of TNF-a compared to the free amino acid
treatment, suggesting this effect is related to PepT1 activity rather
than provision of constituent amino acids.
In addition to protecting the intestine through competitive in-
hibition, there are other potential anti-inammatory mechanisms
that are dipeptide-specic. All test dipeptides lowered the TNF-a
concentration, but the mucosal IFN-g concentration was lower only
in groups exposed to CysGly and/or AlaGln. Others have found that
supplementation of an enteral diet with free cysteine attenuated
the inammatory response in a piglet model of DSS-induced colitis
through the suppression of chemotactic gene expression and pro-
inammatory gene expression [32]. Thus, CysGly may have resul-
ted in more intracellular cysteine which modulated intracellular
signaling to suppress immune cell recruitment and mucosal IFN-g
concentrations. However, this did not translate into better struc-
tural or functional outcomes compared to the free amino acid
treatment. We found no difference in protein synthesis rate or
mucosal weight compared to free amino acids. While not different
than free amino acids, piglets receiving the cysteine-dipeptide did
have greater villus height compared to the groups provided the
glutamine dipeptide (AlaGln or AlaGln CysGly), with no differ-
ence in cellular proliferation at necropsy. This discrepancy between
the morphological outcomes and cellular growth data could be due
to the time at which the samples were taken for analysis. Samples
were removed approximately one week after surgery. Previous
Fig. 1. Villus height and crypt depth distal to the site of anastomosis in piglets fed diets work in our lab using an identical surgical model demonstrated
containing either all free amino acids (Control), or one of alanyl-alanine (AlaAla),
that within 24 h of initiating enteral feeding, there was a period of
alanyl-glutamine (AlaGln), cysteinyl-glycine (CysGly) or both AlaGln and CysGln
(AlaGln CysGly). N 5 piglets per group, values are mean SD. Data were analyzed
rapid cellular proliferation that was not detectable one week later
by 1-way ANOVA with Bonferroni's protected means separation test. Bars with [12]. It is possible that this period of rapid growth was missed in our
differing letters are signicantly different P < 0.05. study protocol.
The detrimental effect of alanyl-glutamine on intestinal
morphology is perhaps the most puzzling result from this study.
formyl-methionyl-leucyl-phenylalanine [28,29] are examples of Not only did alanyl-glutamine limit growth of the remnant intes-
bacterially derived pro-inammatory substrates for PepT1. In the tine, but it also offset the benets conferred by cysteinyl-glycine.
healthy small intestine, bacterial peptides are found in very low The small intestine is a major consumer of glutamine and gluta-
concentrations in the proximity of PepT1. If bacterial overgrowth mate, and both are important to the energy economy of the mucosa
occurs, as is common in recovery from resection [26], the PepT1- [33]. Under normal conditions, the splanchnic tissues extract
mediated transport of bacterial products could induce a pro- greater than 60% of the glutamine provided in the diet, and most of
inammatory cytokine response through NFkb signaling from that is oxidized for energy [33]. Dietary glutamate is extracted to an

Fig. 2. Concentration of A) IFN-g and B) TNF-a in intestinal mucosa of piglets fed diets containing either all free amino acids (Control), or one of alanyl-alanine (AlaAla), alanyl-
glutamine (AlaGln), cysteinyl-glycine(CysGly), or both AlaGln and CysGly (AlaGln CysGly). N 5 per group. Values are mean SD. Data were analyzed by 1-way ANOVA.
Bars with differing letters are signicantly different P < 0.05.

Please cite this article in press as: Nosworthy MG, et al., Enterally delivered dipeptides improve small intestinal inammatory status in a piglet
model of intestinal resection, Clinical Nutrition (2015), http://dx.doi.org/10.1016/j.clnu.2015.05.013
6 M.G. Nosworthy et al. / Clinical Nutrition xxx (2015) 1e7

even greater extent in young pigs, with only 6% entering the portal Sources of funding
blood; however, extraction of glutamate from the arterial blood is
negligible [34]. Our parenteral diet contained glutamate, but the Supported by grants from the Ajinomoto Amino Acid Research
enteral diets were void of glutamate, in essence depriving the gut of Program (3ARP 08-03) and the Canadian Institutes of Health
a source of glutamate. The AlaGln treatment contained no free Research (MOP-86679).
glutamine. We speculate that the delivery of glutamine in the form
of a dipeptide actually reduced glutamine availability to the intes- Contributions of the authors
tinal epithelial cells, such that it was transported out of the cell as
an intact dipeptide. In healthy adult men fed equal amounts of MGN, MED, RFB, and JAB were responsible for designing the
glutamine as L-glutamine or alanyl-glutamine, plasma glutamine study and conducting the surgeries, MGN and MED carried out the
concentration peaked at the same time, but the alanyl-glutamine laboratory analysis, MGN performed the statistical analyses, MGN
treatment resulted in a signicantly higher peak, and took 2 h and JAB drafted the manuscript. All authors contributed to and
longer to return to baseline [35]. This suggests that greater amounts approved the nal version of the manuscript.
of glutamine bypassed the small intestine. In our model this would
be a distinct disadvantage to intestinal regeneration and recovery,
Conict of interest
especially in the absence of enteral glutamate, the other key energy
substrate for enterocytes [33].
There is no conict of interest by any of the authors. The authors
Alanyl-glutamine appeared to be detrimental to mucosal
alone are responsible for the content and writing of this paper.
growth, but it was effective at suppressing the inammatory
response, likely through competitive inhibition, and perhaps via
References
the modulation of the immune response. Bacterial peptides can
trigger an inammatory response through two distinct routes. [1] Daniel H. Molecular and integrative physiology of intestinal peptide transport.
Transport into intestinal cells via PepT1 will stimulate NFkb activity, Annu Rev Physiol 2004;66:361e84.
resulting in the production of proinammatory cytokines and [2] Satoh J, Tsujikawa T, Fujiyama Y, Banba T. Enteral alanyl-glutamine supple-
ment promotes intestinal adaptation in rats. Int J Mol Med 2003;12(4):
chemokines that are released from the cell [30]. In addition, 615e20.
disruption of the mucosal barrier allows for transcellular move- [3] Vazquez JA, Morse EL, Adibi SA. Effect of starvation on amino acid and peptide
ment of bacterial peptides, which may interact with immune cells transport and peptide hydrolysis in humans. Am J Physiol 1985;249(5 Pt 1):
G563e6.
in the lamina propria to augment the inammatory process. The
[4] Ihara T, Tsujikawa T, Fujiyama Y, Bamba T. Regulation of PepT1 peptide
importance of glutamine to cells of the immune system, including transporter expression in the rat small intestine under malnourished condi-
macrophages, neutrophils and lymphocytes, has been well tions. Digestion 2000;61(1):59e67.
described [36]. Specically in pigs, glutamine was shown to down- [5] Walker D, Thwaites DT, Simmons NL, Gilbert HJ, Hirst BH. Substrate upregu-
lation of the human small intestinal peptide transporter, hPepT1. J Physiol
regulate the early immune response by lowering NFkb activity in 1998;507(Pt 3):697e706.
the jejunum [37]. Another study using an Escherichia coli challenge [6] Erickson RH, Gum Jr JR, Lindstrom MM, McKean D, Kim YS. Regional
in young pigs, found that enteral glutamine suppressed pro- expression and dietary regulation of rat small intestinal peptide and amino
acid transporter mRNAs. Biochem Biophys Res Commun 1995;216(1):249e57.
inammatory cytokine production [38]. We suspect that gluta- [7] Shiraga T, Miyamoto K, Tanaka H, Yamamoto H, Taketani Y, Morita K, et al.
mine availability within the cells was limited in the AlaGln groups Cellular and molecular mechanisms of dietary regulation on rat intestinal H/
due to the dipeptide form; however, in the submucosal space, Peptide transporter PepT1. Gastroenterology 1999;116(2):354e62.
[8] Goulet OJ, Revillon Y, Jan D, De Potter S, Maurage C, Lortat-Jacob S, et al.
adequate free glutamine may have been available to immune cells, Neonatal short bowel syndrome. J Pediatr 1991;119(1 Pt 1):18e23.
either from extracellular hydrolysis of the dipeptide or from the [9] Sodhi C, Richardson W, Gribar S, Hackam DJ. The development of animal
arterial blood supply. models for the study of necrotizing enterocolitis. Dis Model Mech
2008;1(2e3):94e8.
An important aspect to consider in this study is the bioavail-
[10] Fitzgibbons SC, Ching Y, Yu D, Carpenter J, Kenny M, Weldon C, et al. Mortality
ability of the dipeptides that we included in the diets. Stability and of necrotizing enterocolitis expressed by birth weight categories. J Pediatr
clearance of plasma cysteinyl-glycine have not been as clearly Surg 2009;44(6):1072e5. discussion 5e6.
[11] Sukhotnik I, Siplovich L, Shiloni E, Mor-Vaknin N, Harmon CM, Coran AG.
delineated as for alanyl-glutamine. However, cysteinyl-glycine is a
Intestinal adaptation in short-bowel syndrome in infants and children: a
product of GSH degradation and numerous peptidases have been collective review. Pediatr Surg Int 2002;18(4):258e63.
shown to hydrolyze cysteinyl-glycine (leucyl amino peptidase, [12] Dodge ME, Bertolo RF, Brunton JA. Enteral feeding induces early intestinal
alanyl peptidase) [39]. Certain characteristics of dipeptides may adaptation in a parenterally fed neonatal piglet model of short bowel syn-
drome. J Parenter Enteral Nutr 2012;36(2):205e12.
predict their afnity for transport via PepT1. A study by Vig et al. [13] Li N, Lewis P, Samuelson D, Liboni K, Neu J. Glutamine regulates Caco-2 cell
detailed the effect of peptide size, hydrophobicity, composition and tight junction proteins. Am J Physiol Gastrointest Liver Physiol 2004;287(3):
charge on dipeptide transport [40]. Although cysteine-containing G726e33.
[14] Noda T, Iwakiri R, Fujimoto K, Rhoads CA, Aw TY. Exogenous cysteine and
dipeptides were not studied, their results can be used to make in- cystine promote cell proliferation in CaCo-2 cells. Cell Prolif 2002;35(2):
ferences regarding the bioavailability of cysteinyl-glycine. All X-gly 117e29.
dipeptides were transported via PepT1 and neutral dipeptides [15] Bauchart-Thevret C, Stoll B, Chacko S, Burrin DG. Sulfur amino acid deciency
upregulates intestinal methionine cycle activity and suppresses epithelial
resulted in higher activation than charged peptides, suggesting that growth in neonatal pigs. Am J Physiol Endocrinol Metab 2009;296(6):
cysteinyl-glycine is a viable substrate for PepT1. E1239e50.
In conclusion, we measured the impact of enterally-delivered [16] Wu G, Fang YZ, Yang S, Lupton JR, Turner ND. Glutathione metabolism and its
implications for health. J Nutr 2004;134(3):489e92.
dipeptides on indices of intestinal adaptation, with the hypothe- [17] Nkabyo YS, Gu LH, Jones DP, Ziegler TR. Thiol/disulde redox status is oxidized
sis that there would be benets as a result of enhanced uptake of in plasma and small intestinal and colonic mucosa of rats with inadequate
metabolically important amino acids via peptide transport. On the sulfur amino acid intake. J Nutr 2006;136(5):1242e8.
[18] Sido B, Hack V, Hochlehnert A, Lipps H, Herfarth C, Droge W. Impairment of
contrary, we found no morphological benets of dipeptides over
intestinal glutathione synthesis in patients with inammatory bowel disease.
the constituent free amino acids in this short duration study. Gut 1998;42(4):485e92.
Despite the lack of structural and functional differences in the [19] NRC. Nutrient requirements of swine. 10th ed. Washington, D.C.: National
mucosa, dietary dipeptides did lower pro-inammatory cytokine Academy Press; 1998.
[20] Garlick PJ, McNurlan MA, Preedy VR. A rapid and convenient technique for
concentrations, suggesting an important therapeutic role for spe- measuring the rate of protein synthesis in tissues by injection of [3H]
cic peptides in intestinal inammatory disease. phenylalanine. Biochem J 1980;192(2):719e23.

Please cite this article in press as: Nosworthy MG, et al., Enterally delivered dipeptides improve small intestinal inammatory status in a piglet
model of intestinal resection, Clinical Nutrition (2015), http://dx.doi.org/10.1016/j.clnu.2015.05.013
M.G. Nosworthy et al. / Clinical Nutrition xxx (2015) 1e7 7

[21] Bidlingmeyer BA, Cohen SA, Tarvin TL. Rapid analysis of amino acids using inammation and inammatory bowel disease. Am J Physiol Gastrointest
pre-column derivatization. J Chromatogr 1984;336(1):93e104. Liver Physiol 2012;302(5):G484e92.
[22] Brunton JA, Baldwin MP, Hanna RA, Bertolo RF. Proline supplementation to [31] Pan WW, Li JD, Huang S, Papadimos TJ, Pan ZK, Chen LY. Synergistic activa-
parenteral nutrition results in greater rates of protein synthesis in the muscle, tion of NF-{kappa}B by bacterial chemoattractant and TNF{alpha} is mediated
skin, and small intestine in neonatal Yucatan miniature piglets. J Nutr by p38 MAPK-dependent RelA acetylation. J Biol Chem 2010;285(45):
2012;142(6):1004e8. 34348e54.
[23] Klang JE, Burnworth LA, Pan YX, Webb Jr KE, Wong EA. Functional charac- [32] Kim CJ, Kovacs-Nolan J, Yang C, Archbold T, Fan MZ, Mine Y. L-Cysteine sup-
terization of a cloned pig intestinal peptide transporter (pPepT1). J Anim Sci plementation attenuates local inammation and restores gut homeostasis in a
2005;83(1):172e81. porcine model of colitis. Biochim Biophys Acta 2009;1790(10):1161e9.
[24] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real- [33] Bertolo RF, Burrin DG. Comparative aspects of tissue glutamine and proline
time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods metabolism. J Nutr 2008;138(10):2032Se9S.
2001;25(4):402e8. [34] Stoll B, Burrin DG, Henry J, Yu H, Jahoor F, Reeds PJ. Substrate oxidation by the
[25] Dahlqvist A. Assay of intestinal disaccharidases. Anal Biochem 1968;22(1): portal drained viscera of fed piglets. Am J Physiol 1999;277(1 Pt 1):E168e75.
99e107. [35] Harris RC, Hoffman JR, Allsopp A, Routledge NB. L-Glutamine absorption is
[26] Cole CR, Frem JC, Schmotzer B, Gewirtz AT, Meddings JB, Gold BD, et al. The enhanced after ingestion of L-alanylglutamine compared with the free amino
rate of bloodstream infection is high in infants with short bowel syndrome: acid or wheat protein. Nutr Res 2012;32(4):272e7.
relationship with small bowel bacterial overgrowth, enteral feeding, and in- [36] Newsholme P. Why is L-glutamine metabolism important to cells of the im-
ammatory and immune responses. J Pediatr 2010;156(6):941e7. 7 e1. mune system in health, postinjury, surgery or infection? J Nutr 2001;131(9
[27] Dalmasso G, Nguyen HT, Charrier-Hisamuddin L, Yan Y, Laroui H, Demoulin B, Suppl):2515Se22S. discussion 23Se24S.
et al. PepT1 mediates transport of the proinammatory bacterial tripeptide L- [37] Zhong X, Li W, Huang X, Wang Y, Zhang L, Zhou Y, et al. Effects of glutamine
Ala-{gamma}-D-Glu-meso-DAP in intestinal epithelial cells. Am J Physiol supplementation on the immune status in weaning piglets with intrauterine
Gastrointest Liver Physiol 2010;299(3):G687e96. growth retardation. Arch Anim Nutr 2012;66(5):347e56.
[28] Shi B, Song D, Xue H, Li J, Li N. Abnormal expression of the peptide transporter [38] Ewaschuk JB, Murdoch GK, Johnson IR, Madsen KL, Field CJ. Glutamine sup-
PepT1 in the colon of massive bowel resection rat: a potential route for plementation improves intestinal barrier function in a weaned piglet model of
colonic mucosa damage by transport of fMLP. Dig Dis Sci 2006;51(11): Escherichia coli infection. Br J Nutr 2011;106(6):870e7.
2087e93. [39] Cappiello M, Lazzarotti A, Buono F, Scaloni A, D'Ambrosio C, Amodeo P, et al.
[29] Carlson RM, Vavricka SR, Eloranta JJ, Musch MW, Arvans DL, Kles KA, et al. New role for leucyl aminopeptidase in glutathione turnover. Biochem J
fMLP induces Hsp27 expression, attenuates NF-kappaB activation, and confers 2004;378(Pt 1):35e44.
intestinal epithelial cell protection. Am J Physiol Gastrointest Liver Physiol [40] Vig BS, Stouch TR, Timoszyk JK, Quan Y, Wall DA, Smith RL, et al. Human
2007;292(4):G1070e8. PEPT1 pharmacophore distinguishes between dipeptide transport and bind-
[30] Ingersoll SA, Ayyadurai S, Charania MA, Laroui H, Yan Y, Merlin D. The role and ing. J Med Chem 2006;49(12):3636e44.
pathophysiological relevance of membrane transporter PepT1 in intestinal

Please cite this article in press as: Nosworthy MG, et al., Enterally delivered dipeptides improve small intestinal inammatory status in a piglet
model of intestinal resection, Clinical Nutrition (2015), http://dx.doi.org/10.1016/j.clnu.2015.05.013