Академический Документы
Профессиональный Документы
Культура Документы
Post-transcriptional
Gene Control
Portion of a "lampbrush chromosome" from an oocyte of the newt
Nophtha/mus viridescens; hnRNP protein associated with nascent RNA
transcripts fluoresces red after staining with a monoclonal antibody.
[Courtesy of M. Roth and J. Gall.]
n the previous chapter, we saw that most genes are regulated that -95 percent of human genes give rise to alternatively
OUTLINE
8.1 Processing of Eukaryotic Pre-mRNA 348 8.4 Cytoplasmic Mechanisms of Post -transcriptional
Control 370
8.2 Regulation of Pre-mRNA Processing 360
8.5 Processing of rRNA and tRNA 384
8.3 Transport of mRNA Across the Nuclear Envelope 365
FiJ:i!J:ii RNAs Discussed in Chapter 8
mRNA Fully processed messenger RNA with 5' cap, introns removed b} RNA splicing, and a poly(A) tail
pre-mRNA An mRNA precursor conraming introns and not cleaved at the poly(A) site
hnRNA Heterogeneous nuclear RNAs. These include pre-mRNAs and RNA processing intermediates containing one or
more inrrons.
snR~A Five small nuclear RNAs that function in the removal of introns from pre-mRNAs by RNA splicing, plus rwo
small nuclear RNAs that substitute for the first two at rare inrrons
pre-tRNA A tRNA precursor containing additional transcribed bases at the 5' and 3' ends compared to the mature tRNA.
Some pre-tRNAs also contain an intron in the anti-codon loop.
pre rR~A The precursor to mature J8S, 5.8S, and 28S ribosomal RNAs. The mature rRNAs are processed from this long
precursor RNA molecule by cleavage, removal of bases from the ends of the cleaved products, and modification
of specific bases. '
snoRNA Small nucleolar RNAs. These base-pair with complementary regions of the pre-RNA molecule, directing
cleavage of the RNA chain and modification of bases during maturation of the rRNAs.
siRNA Short interfering RNAs, -22 bases long, that arc each perfectly complementary to a sequence in an mRNA.
Together with associated proteins, siRNAs cause cleavage of the "target" RNA, leading to its ra~id degradation.
m1RNA M1cro RNAs, -22 bases long, that base-pa1r extensively, but not completely, with mRNAs, especially over the
SIX base pairs at the 5' end of the miRNA. Th1s inhibits translation of the "target" mRNA.
because cytokine mRNAs are extremely unstable. Conse- expressed in the multiple types of human cells. Although some
quently, the concentration of the mRNA in the cytoplasm have recently been discovered to function through inhibition
falls rapidly once its synthesis is stopped. In contrast, mRNAs of target gene expression in the appropriate tissue and at the
encoding proteins required in large amounts that function appropriate time in development, the functions of the vast
over long period.s, such as ribosomal proteins, are extremely majority of human miRNAs are unknown and are the subject
stable so that multiple polypeptides are transcribed from each of a growing new area of research. If most miRNAs do indeed
mRNA. have significant functions, miRNA genes constitute an impor-
In addition to regulation of pre-mRNA processing, nu - tant subset of the -25,000 human gene~- A closely related
clear export, and translation, the cellular locations of many, process called RNA interference (RNAi) leads to the degrada-
if not most, mRNAs are regulated so that newly synthesized tion of viral RNAs in infected cells and the degradation of
protein is concentrated where it is needed. Particularly strik- transposon-encoded RNAs in many eukaryotes. This is of tre-
ing examples of this occur in the nervous systems of multi- mendous significance to biological researchers because it is
cellular animals. Some neurons in the human brain generate possible to design short interfering RNAs (siRNA) to inhibit
more than 1000 separate synapses with other neurons. Dur- the translation of specific mRNAs experimentally by a process
ing the process of learning, synapses that fire more frequently called RNA knockdown. This makes it possible to inhibit the
than others increase in size many times, while other synapses function of any desired gene, even in organisms that arc not
made by the same neuron do not. This can occur because amenable to classic genetic methods for isolating mutants.
mRNAs encoding proteins crittcal for synapse enlargement We refer to all the mechanisms that regulate gene expres-
are stored at all synapses, but translation of these localized, sion following transcription as post-transcriptional gene con-
stored mRNAs is regulated at each synapse independently by trol (Figure 8-1 ). Since the stability and translation rate of an
the frequency at which it initiates firing. In this way, synthe- mRNA contribute to the amount of protein expressed from a
sis of synapse-associated protein<, c;1n hP regulated independ- gene, these post-transcriptional processes are important com-
ently at each of the many synapses made by the same neuron. ponents of gene control. Indeed, the protein output of a gene
Another type of gene regulation that has recently come to is regulated at every step in the life of an m RNA from the ini-
light involves micro RNAs (miRNAs), which regulate the sta- tiation of its synthesis to its degradation. Thus genetic regula -
bility and translation of specific target mRNAs in multicellu- tory processes act on RNA as well as DNA. In this chapter,
lar animals and plants. Analyses of these short miRNAs in we consider the events that occur in the processing of mRNA
vanous human tissues indicate that there are -500 miRNAs following transcription initiation and promoter proximal
Pre-rR NA
Pre-mRNA transcription
transcription 5S rRNA
~
\
~~p..
Pre-tRNA
transcription
Ribosomal
subunit ,Sf)
Exc1sed
synthesis in
nucleolus pre-rRNA
a q ~ =~~i~Tn~NA mD
.......-----------~-
1'U:111 polyadenylation
Cleavage'
~
.-------------~-
...-
Improperly
processed Exosome
mRNA ~
~0 m ~d
pre-tRNA
mANA
export Nucleus
~AAAAA
liJ iI
Cytoplasmic
Poly(A) pol
Cytoplasmic
exosome
~
Cytoplasmic
De~~j CJ
enzyme Deadenylase
~ liJ
polyadenylation
~AAAAA
miRNA \ IJ /
i
~~AAAAA
miRNA
t ranslation inhibition Translation Cytoplasmic
initiation deadenylation
FIGURE 8-1 Overview of RNA processing and post- by degradation by cytoplasmic exosomes. The degradation rate of each
transcriptional gene control. Nearly all cytoplasmic RNAs are mRNA is controlled, thereby regu lating the mRNA concentration and,
processed from primary transcripts in the nucleus before t hey are consequently, the amount of protein translated. Some mRNAs are
exported to the cytoplasm. For protein-coding genes transcribed by synthesized without long poly(A) tails. Their translation is regulated by
RNA polymerase II, gene cont rol can be exerted through 0 the choice [iJ controlling the synthesis of a long poly(A) tail by a cytoplasmic
of alternative exons during pre-mRNA splicing and f) the choice of poly(A) polymerase. fJ Translation is also regulated by other mecha-
alternative poly(A) sites. Improperly processed mRNAs are blocked nisms including miRNAs. When expressed, t hese - 22-nucleotide RNAs
from export to the cytoplasm and deqraded 11 by a large complex inhibit translation of mRNAs to whic.h they hybridize, usually in the
called the exosome that contains multiple ribonucleases. Once 3'-untranslated region. tRNAs and rRNAs are also synthesized as
exported to the cytop l asm, ~ translation initiation factors bind to t he precursor RNAs that must be (;) processed before they are functional.
mRNA 5' -cap cooperatively with poly(A)-binding protein I bound to Regions of precursors cleaved from the mature RNAs are degraded by
m
the poly(A) tail and initiate translation (see Figure 4-28). mRNA is nuclear exosomes ~ . [Adapted from Houseley, et. al., 2006, Nat. Rev. Mol. Cell
degraded in the cytoplasm by de-adenylation and decapping followed Bioi. 7:529.)
Poly(A) Termination
site sites
DNA
Primary RNA
Cap
tII Transcription, 5' capping
3'
transcript
5'
Endo~ucle
tfJ Cleavage at poly(A) site
"'J
ro
3:xJ
5'
A polymetase
tIJ Polyadenylation
3'
z
l>
'0
0
5'
tIIJ RNA splicing
A1oo-2so3' C)
(!)
(/)
!:'!.
::J
co
mRNA 5' A100-2so 3 ' J
FIGURE 8 - 2 Overview of mRNA processing in eukaryotes. Shortly adenosine (A) residues is added (step iJ). The poly(A) tail contains - 250 A
after RNA polymerase II initiate~ trdmc.ription at the first nucleotide of the residues in mammals, - 1SO in insects, and - 100 in yeasts. For short
first exon of a gene, the 5' end of the nascent RNA is capped with primary transcripts with few introns, splicing (step 9 ) usually follows cleav-
7-methylguanylate (step 0 ). Transcription by RNA polymerase II age and polyadenylation, as shown. For large genes with multiple introns,
terminates at any one of multiple termination sites downstream from the introns often are spliced out of the nascent RNA during its transcription,
poly(A) site, which is located at the 3' end of the final exon. After the i.e., before transcription of the gene is complete. Note that the 5 ' cap and
primary transcript is cleaved at the poly(A) site (step f)), a string of sequence adjacent to the poly(A) tail are retained in mature mRNAs.
l
Gua~ine 7-mot~ +CH 3 from
II so that all of its transcripts are capped during the earliest
t ansfe S-Ado-Met phase of elongation. As discussed in Chapter 7, in metazoans,
during the initial phase of transcription the polymerase elon-
gates the nascent transcript very slowly due to association of
N-i@ij,I;J@f!l
NELF (negative elongation factor) with RNA polymerase II
l+CH 3 from in the promoter proximal region (see Figure 7-20). Once the
S-Ado-Met 5' end of the nascent RNA is capped, phosphorylation of the
RNA polymerase CTD at position 2 in the heptapeptide re-
peat and of NELF and DSIF by the CDK9-cyclin T protein
kinase causes the release of NELF. This allows RNA polymer-
FIGURE 8-3 Synthesis of 5' -cap on eukaryotic mRNAs. The 5' end ase Il to enter into a faster mode of elongat_ion that rapidly
of a nascent RNA contains a 5 '-triphosphate from the initiating NTP. transcribes away from the promoter. The net effect of this
The-y-phosphate is removed in the first step of capping, while the mechanism is that the polymerase waits for the nascent RNA
remaining a- and (3-phosphates (orange) remain associated with the to be capped before elongating at a rapid rate.
cap. The third phosphate of the 5',5'-triphosphate bond is derived
from the ex-phosphate ofthe GTP that donates the guanine. The
methyl donor for methylation of the cap guanine and the first one
or two riboses of the mRNA is 5-adenosylmethionine (5-Ado-Met). A Diverse Set of Proteins with Conserved
[From S. Venkatesan and B. Moss, 1982, Proc. Nor/. Acad. Sci. USA 79:304.] RNA-Binding Domains Associate
with Pre-mRNAs
As noted earlier, neither nascent RNA transcripts from protein-
mRNAs (see Figure 4-14 ). The 5' cap marks RNA molecules coding genes nor the intermediates of mRJ:\A processing, col-
as mRNA precursors and protects them from RNA-digesting lectively referred to as pre-mRNA, exist as free RNA molecules
enzymes (5' -exoribonucleascs) in the nucleus and cytoplasm. in the nuclei of eukaryotic cells. From the time nascent tran-
This initial step in RNA processing is catalyzed by a dimeric scripts first emerge from RNA polymerase II until mature
capping enzyme, which associates with the phosphorylated mRNAs are transported into the cytoplasm, the RNA mole-
carboxyl-terminal domain (CTD) of RNA polymerase II. Re- cules are associated with an abundant set of nuclear proteins.
call that the CTD becomes phosphorylated by the TFIIH These are the major protein components of heterogeneous ribo-
general transcription facto.r at multiple serines at the 5 posi- nucleoprotein particles (lmRNPs), which contain heterogene-
tion in the CTD heptapeptide repeat during transcription ous nuclear RNA (hnRNA), a collective term referring to
initiation (see Figure 7-17). Binding to the phosphorylated pre-mRNA and other nuclear RNAs of various sizes. These
CTD stimulates the activity of the capping enzymes so that hnRNP proteins contribute to further steps in RNA processing,
they are focused on R NAs containing a 5'-triphosphate that including splicing, polyadenylation, and export through nu-
emerge from RNA polymerase II and nor on RNAs tran- clear pore complexes to the cytoplasm.
scribed by RNA polymerases I or III, which do not have a Researchers identified hnRNP proteins by first exposing
CTD. This is important because pre-mRNA synthesis ac- cultured cells to high-dose UV irradiation, which causes cova-
counts for only -80 percent of the total RNA synthesized in lent cross-links to form between RNA bases and closely associ-
replicating cells. About 20 percent is preribosomal RNA, ated proteins. Chromatography of nuclear extracts from treated
which is transcribed by RNA polymerase I, and 55 rRNA, cells on an oligo-dT cellulose column, which binds RNAs with
tRNAs, and other stable small RNAs, which are transcribed a poly( A) tail, was used to recover the proteins that had become
by RNA polymerase IlL The two mechanisms of (1) binding cross-linked to nuclear polyadenylared RNA. Subsequent treat-
of the capping enzyme to initiated RNA polymerase II spe- ment of cell extracts from un-irradiated cells with monoclonal
cifically through its unique, phosphorylated CTD and (2) antibodies specific for the major proteins identified by this
.
......
.~!
FIGURE 8-4 Human hnRNP A1 protein can cycle in and out of the right of the oval-shaped Xenopus nucleus. (b, c) When the same
cytoplasm, but human hnRNP C protein cannot. Cultured Hela cells preparation was viewed by fluorescence microscopy, the stained
and Xenopus cells were fused by treatment with polyethylene glycol, hnRNP C protein appeared green and thi stained hnRNP A 1 protein
producing heterokaryons containing nuclei from each cell type. The appeared red. Note that the unfused Xenopus cell on the left is
hybrid cells were treated with cycloheximide immediately after fusion unstained, confirming that the antibodies are specific for the human
to prevent protein synthesis. After 2 hours, the cells were fixed and proteins. In the heterokaryon, hnRNP C protein appears only in the
stained with fluorescent-labeled antibodies specific for human hnRNP Hela-cell nucleus (b), whereas the A 1 protein appears in both the
C and A 1 proteins. These antibodies do not bind to the homologous Hela-cell nucleus and the Xenopus nucleus (c). Since protein synthesis
Xenopus proteins. (a) A fixed preparation viewed by phase-contrast was blocked after cell fusion, some of the human hnRNP A 1 protein
microscopy includes unfused Hela cells (a rrowhead) and Xenopus cells must have left the Hela-cell nucleus, moved through the cytoplasm,
(dotted arrow), as well as fused heterokaryons (solid arrow). ln the and entered the Xenopus nucleus in the heterokaryon. [SeeS. Pinoi-Roma
heterokaryon in this micrograph, the round Hela-cell nucleus is to the and G. Dreyfuss, 1992, Nature 355:730; courtesy of G. Dreyfuss.]
cross-linking technique revealed a complex set of abundant out of the cytoplasm, suggesting that they function in the
hnRJ\.rp proteins ranging in size from -30 to - 120 kDa. transport of mRNA (Figure 8-4).
Like transcription factors, most hnR, P proteins have a
modular structure. They contain one or more RNA-binding Conserved RNA-Binding Motifs The RNA recognztion motif
domains and at least one other domain that interacts with (RRM), also called the RNP motif and the RNA-binding do-
other proteins. Several different RNA-binding motifs have main (RBD), is the most common RNA-binding domain in
been identified by creating hnRNP proteins with missing hnRNP proteins. This -SO-residue domain, which occurs in
amino acid seq uences and testing their ability to bind RNA. many other RNA-binding proteins, contains two highly con-
served sequences (RNP1 and RNP2) that are found across
Functions of hnRNP Proteins The association of pre-mRNAs organisms ranging from yeast to human-indicating that
with hnRNP proteins prevents the pre-mRNAs from forming like many D A-binding domains, they evolved early in
short secondary structures dependent on base pairing of com- eukaryotic evolution.
plementary regions, thereby making the pre-mRNAs accessi- Structural analyses have shown that the RRM domain con-
ble for interaction with other RNA molecules or proteins. sists of a four-stranded ~sheet flanked on one side by two a
Pre-mRNAs associated with hnRNP proteins present a more helices. To interact with the negatively charged RNA phos-
uniform substrate for subsequent processing steps than would phates, the~ sheet forms a positively charged surface. The con-
free, unbound pre-mRNAs, in which each mRNA forms a served RNPl and RNP2 sequences lie side by side on the two
unique secondary structure due to its specific sequence. central ~ strands, and their side chains make multiple contacts
Binding studies with purified hnRNP proteins indicate that with a single-stranded region of RNA that lies across the sur-
different hnRNP proteins associate with different regions of a face of the 13 sheet (Figure 8-5).
newly made pre-mRNA molecule. For example, the hnRNP The 45-residue KH motif is found in the hnRNP K pro-
proteins A1, C, and D bind preferentially to the pyrimidine- tein and several other RNA-binding proteins. The three-
rich sequences at the 3' ends of introns (see Figure 8-7). Some dimensional structure of representative KH domains is similar
hnRNP proteins interact with the RNA sequences that specify to that of the RRM domain but smaller, consisting of a
RNA splicing or cleavage/polyadenylation and contribute to three-stranded 13 sheet supported from one side by two a
the structure recognized by RNA-processing factors. Finally, helices. Nonetheless, the KH domain interacts with RNA
cell-fusion experiments have shown that some hnRNP proteins much differently than does the RRM domain. RNA binds to
remain localized in the nucleus, whereas others cycle in and the KH domain by interacting with a hydrophobic surface
FIGURE 8-5 Structure of the RRM domain and its interaction with regions, in shades of red. The pre-mRNA is bound to the surfaces of the
RNA. {a) Diagram of the RRM domain showin g the two n helices positively charged [3 sheets, making most of its contacts with the RNP 1
{green) and four [3 strands {red) that characterize this motif. The and RNP2 regions of each RRM. {c) Strikingly different orientation of
conserved RNPl and RNP2 regions are located in the two central RRM domains in a different hnRNP, the polypyrimidine tract binding
[3 stra nds. (b) Surface representation of the two RRM domains in (PTB) protein, illustrating that RRMs are oriented in different relative
Drosophila Sex-lethal (Sxl) protein, which bind a nine-base sequence in positions in different hnRNPs; colors are as in (b). Polypyrimidine (p{Y))
transformer pre-mRNA (yellow). The two RRMs are oriented like the two single-stranded RNA is bound to the upward (RRM3) and downward
parts of an open pair of castanets, with the [3 sheet of RRMl facing (RRM4) facing [3-sheets. RNA is shown in yellow. [Part (a) adapted from
upward and the [3 sheet of RRM2 facing downward. Positively charged K. Nagai et al., 1995, Trends Biochem. Sci. 20:235. Part (b) after N. Harada et al.,
regions in Sxl protein are shown in shad es of blue; negatively charged 1999, Nature 398:579. Part (c) after F. C. Oberstrass et al., 2006, Science 309:2054.)
formed by the o: helices and one 13 strand. The RGG box, the polyadenylated end of mRNA processing intermediates
another RNA-binding motif found in hnRNP proteins, con- in hnRNA are retained in the mature mRNA in the cyto-
tains five Arg-Gly-Gly (RGG} repeats with several interspersed plasm. The solution to this apparent conundrum came from
aromatic amino acids. Although the structure of this motif the discovery of introns by electron microscopy of RNA-
has not yet been determined, its arginine-rich nature is simi- DNA hybrids of adenovirus DNA and the mRNA encoding
lar to the RNA-oinding domains of the HIV Tat protein. KH hexon, a major virion capsid protein (Figure 8-6). Other
domains and RGG repeats are often interspersed in two or studies revealed nuclear viral RNAs that were colinear with
more sets in a single RNA-binding protein. the viral DNA (primary transcripts), and RNAs with one or
two of the introns removed (processing intermediates). These
Splicing Occurs at Short, Conserved results, together with the earlier findings that the 5' cap and
3' poly(A) tai l at each end of long mRNA precursors are re-
Sequences in Pre-mRNAs via Two tained in shorter mature cytoplasmic mRNAs, led to the re-
Transesterification Reactions alization that introns are removed from primary transcripts
During formation of a mature, functional mRNA, the introns as exons are spliced together.
are removed and exons are spliced together. For short tran- The location of splzce sites-that is, exon-inrron junc-
scription units, RNA splicing usua lly follows cleavage and tions-in a pre-mRNA can be determined by comparing the
polyadenylation of the 3' end of the primary transcript, as sequence of genomic DNA with that of the eDNA prepared
depicted in Figure 8-2. However, for lo ng transcription units from the corresponding mRNA (see Figure 5-15). Sequences
containing multiple exons, splicing of exons in the nascent that are present in the genomic DNA but absent from the
RNA begins before transcription of the gene is complete. eDNA represent introns ;:~nd indicate the positions of splice
Early pioneenng research on the nuclear processing of sites. Such analysis of a large number of different mRNAs
mRNAs revealed that mRNAs are initially transcribed as revealed moderately conserved, short consensus sequences at
much longer RNA molecules than the mature mRNAs in the the splice sites flanking inrrons in eukaryotic pre-mRNAs; a
cytoplasm. It was also shown that RNA sequences near the pyrimidine-rich region just upstream of the 3' splice site also
5' cap added shortly after transcription initiation are re- is common (Figure 8-7). Studies of mutant genes with dele-
tained in the mature mRNA, and that RNA sequences near tions introduced into introns have shown that much of the
\
mRNA
center portion of introns can be removed without affecting net result of these two reactions is that two exons are ligated
splicing; generally only 30-40 nucleotides at each end of an and the intervening intron is released as a branched lariat
1ntron are necessary for splicing to occur at normal rates. structure.
Analysis of the intermediates formed during splicing of
pre-mRNAs in vitro led to the discovery that splicing of exons
proceeds via two sequential transesterification reactions (Fig-
During Splicing, snRNAs Base-Pair
ure 8-8). lntrons are removed as a lariat structure in which the
5' G of the intron is joined in an unusual2' ,5 '-phosphodiester with Pre-mRNA
bond to an adenosine ncar the 3' end of the intron. This A Splicing requires the presence of small n uclear RNAs
residue is called the branch point A because it forms an RNA (snRNAs), important for base pairing with the pre-mRNA,
branch in the lariat structure. In each transestcrification re- and - 170 associated proteins. Five U-rich snRNAs, desig-
action, one phosphoester bond is exchanged for another. nated U1, U2, U4, US, and U6, participate in pre-mRNA
Since the number of phosphoester bonds in the molecule is splicing. Ranging in length from 107-210 nucleotides, these
not changed in either reaction, no energy is consumed. The snRNAs are associated with 6- 10 proteins each in the many
Pre-mRNA
FIGURE 8 -7 Consensus se quences around splice sites in adenosine, also invariant, usually is 20-50 bases from the 3' splice site.
vertebrate pre-mRNAs. The only nearly invariant bases are the 5' GU The central region of the intron, which may range from 40 bases to
and the 3 ' AG of the intron (blue), although the flanking bases 50 kilo bases in length, generally is unnecessary for splicing to occur.
indicated are found at frequencies higher than expected based on a [SeeR. A. Padgett et al., 1986, Ann. Rev. Biochem. 55:1119, and E. B. Keller and
random distribution. A pyrimidine-rich region (hatch marked) near the W. A. Noon, 1984, Proc. Not'/. Acad. Sci. USA 81 :7417.]
3' end of the intron is found in most cases. The branch-point
(a)
~Ji~1snRNA
l
l
U2 snRNA
Sm
3' --
cap 5 '
Sm
3' - Gl - _ ca 5'
-----l.JJ. IIIIII P I I II II Py
5 ' ~UAAGU-- ----------UACUAC CAG G Exon 2 <-- 3'
PremRNA A
'-...._B ranch point
(b)
W.t. U1 snRNA 3 ' 1 - . cap 5' Mutant U1 snRNA 3 ' ( _ _ . . . U." cap 5'
t,;) VIDEO: Dynamic Nature of Pre-mRNA Splicing Factor Movement in Living Cells
FIGURE 8-10 Structures of a bulged A in an RNA RNA helix and (a) Self-complementary (c) Spliceosome structure
an intermediate in the splicing process. (a) The structure of an RNA sequence w ith bulging A
duplex w ith the sequence shown, cont aining bulged A residues (red) at
5'UACUA ACGU AGUA
position 5 in the RNA helix, was determined by x-ray crystallography.
AUGA UGCA UCAU 5'
(b) The bulged A residues extend from the side of an A-form RNA-RNA A
helix. The phosphate backbone of one strand is shown in green; the
other strand in blue. The structure on th e right is turned 90 degrees for (b) X-ray crystallog ra phy
a view down the axis o f the helix. (c) 40 A reso lution structure of a structure
spliceosomal splicing intermediate containing U2, U4, US, and U6 37oA
snRNPs, determined by cryoelectron microscopy and image recon-
struction. The U4/U6/US tri-snRNP complex has a similar structure to
th~ triangu lar body of this complex, suggesting that t hese snRNPs are
at the bottom o f the structure shown here and t hat the head is
composed largely of U2 snRNP. [Parts (a) and (b) from J. A. Berglund et al., As As
2001, RNA 7:682. Part (c) from D. Boehringer et al., 2004, Nor. Srruct. Mol. Bioi. (top) (bottom)
11 :463. See also H. Stark and R. Luhrmann, 2006, Annu. Rev. Biophys. Biomol.
Srruct. 35:435.]
G
point (see Figure 8-11, step 0 ). Some splicing factors also ex-
hibit sequence homologies to known RNA helicases; these are
probably necessary for the base-pairing rearrangements that
U6 (
occur in snRNAs during the spliceosomal splicing cycle.
. Following RNA splicing, a specific set of hnRNP proteins --o~P 3
remain bound to the spliced RNA approximately 20 nucle- s U5
otides 5' to each exon-exon junction, thus forming an exon-
junction complex. One of the hnRNP proteins associated with
the exon-junction complex is the RNA export factor (REF),
II 1 Second transesterification
~
~. Linker CTD
I< 28 nm 65 nm --------------+1
FIGURE 812 Schematic diagram of RNA polymerase II with the polymerase. The CTD of mammalian RNA polymerase II is twice as long.
CTD ext ended. The length of the fully extended yeast RNA polymerase In its extended form, the CTD can associate with mu ltiple RNA-processing
II carboxyl-terminal domain (CTD) and the linker region that connects it factors simultaneously. [From P. Cramer, D. A. Bushnell, and R. D. Kornberg,
to the polymerase is shown relative to the globular domain of the 2001, Science 292:1863.)
10-15 percent of the mRNAs in the nematode (roundworm) (-3500 bases). The longest introns contain upward of 500 kb!
Caenorhabditis elegans, an important model organism for Because the sequences of 5' and 3' splice sites and branch
studying embryonic development. Trans-splicing is carried po.ints are so degenerate, multiple copies are likely ro occur
out by snRNPs by a process similar to the splicing of exons random ly in long introns. Consequently, additional sequence
m a single pre-mRNA. information is required to define the exons that should be
spliced together in higher organisms with long introns.
Chain Elongation by RNA Polymerase II The information for defining the splice sites that demar-
cate exons is encoded within the sequences of the exons. A
Is Coupled to the Presence of RNA- family of RNA-binding proteins, the SR proteins, interact
Processing Factors with sequences within exons called exonic spJicing enhancers.
I fow is RNA processing efficiently coupled with the transcrip- SR proteins are a subset of the hnRNP proteins discussed
tion of a pre-mRNA? The key lies in the long carboxyl-terminal earlier and so contain one or more RRM RNA-binding do-
domain (CTD) of RNA polymerase II, which, as discussed in mains. They also contain several protein-protein interaction
Chapter 7, is composed of multiple repeats of a seven-residue domains rich in arginine (R ) and serine (S) residues called RS
(heptapeptide) sequence. When fully extended, the CTD do- domains. When bound to exonic splicing enhancers, SR pro-
main in the yeast enzyme is about 65 nm long (Figure 8-12); teins mediate the cooperative binding of Ul snRNP to a true
the CTD in human RNA polymerase II is about twice as long. 5' splice site and U2 snRNP to a branch point through a net-
The remarkable length of the CTD apparently allows multiple work of protein-protein interactions that span an exon (Fig- _I
proteins to associate simultaneously with a single RNA ure 8-13). The complex of SR proteins, snRNPs, and other
polymerase II molecule. For instance, as mentioned earlier, the splicing factors (e.g., U2AF) that assemble across an exon,
enzymes that add the 5' cap to nascent transcripts associate which has been called a cross-exon recognition complex, per-
with the CTD phosphorylated on multiple serines at the fifth mits precise specification of exons in long pre-mRNAs.
position in the heptapeptide repeat (Ser-5) during or shortly
after transcription initiation by a subunit of TFIIH. In addi- In the transcription units of higher organisms with
tion, RNA splicing and polyadenylation factors have been long introns, exons not only encode the amino acid
found to associate with the phosphorylated CTD. As a conse- sequences of different portions of a protein but also contain
quence, these processing factors are present at high local con- binding sites for SR proteins. Mutations that interfere with
centrations when splice sites and poly( A) signals are transcribed the binding of an SR protein to an exonic splicing enhancer,
hy the polymerase, enhancing the rate and specificity of RNA even if they do not change the encoded amino acid sequence,
processing. In a reciprocal fashion, the association of hnRNP prevent formation of the cross-exon recognition complex. As
proteins with the nascent RNA enhances the interaction of a result, the affected exon is "skipped" during splicing and is
RNA polymerase II with elongation factors such as DSIF and not included in the final processed mRNA. The truncated
CDK9-cyclin T (P-TEFb) (Figure 7-20), increasing the rate of mRNA produced in this case is either degraded or translated
transcription. As a consequence, the rate of transcription is into a mutant, abnormally functioning protein. This type of
coordinated with the rate of nascent RNA association with mutation occurs in some human genetic diseases. For exam-
hnRNPs and RNA-processing factors. This mechanism may ple, spinal muscular atrophy is one of the most common ge-
ensure that a pre-mRNA is not synthesized unless the machin- netic causes of childhood mortality. This disease results from
ery for processing it is properly positioned. mutations in a region of [he genumt: cumaining two closely
related genes, SMNJ and SMN2, that arose by gene duplica-
tion. SMN2 encodes a protein identical with SMNJ. SMN2
SR Proteins Contribute to Exon Definition
is expressed at a much lower level because a silent mutation
in Long Pre-mRNAs in one exon interferes with the binding of an SR protein.
The average length of an exon in the human genome is - 150 This leads to exon skipping in most of the SMN2 mRNAs.
bases, whereas the average length of an intron is much longer The homologous SMN gene in the mouse, where there is
U2 U1
~---11"-
-
1 \
- -.l...
Jr
U
2
U2AF65
A ..-yyyy. AG
<.....:f
3~ Iu GU
1
__;L.._
7r-
3'
only a single copy, is essential for cell viability. Spinal mus- fungi. Discovery of the catalytic activity of self-splicing in-
cular atrophy in huma ns resu lts from homozygous muta- trans revolutionized concepts about the functions of RNA.
tions that inactivate SMNl. The low level of protein translated As discussed in Chapter 4, RNA is now kn.own to catalyze
from the small fraction of SMN2 mRNAs that are correctly peptide-bond formation during protein synthesis in ribo-
spliced is sufficient to maintain cell viability during embryo- somes. Here we discuss the probable role of group II introns,
genesis and fetal development, but it is not sufficient to now found only in mitochondrial and chloroplast DNA, in
maintain viability of spi nal cord motor neurons in childhood, the evolution of snRNAs; the functioning of group I introns
resulting in their death and the associated disease. is considered in the later section on rRNA processing.
Approximately 15 percent of the single-base-pair muta- Even though their precise sequences are not highly con-
tions that cause human genetic diseases interfere with proper served, all group II introns fo ld into a conserved, complex
exon definition. Some of these mutations occur in 5' or 3' secondary structure containing numerous stem loops (Fig-
splice sites, often resu lting in the use of nearby alternative ure 8-14a). Self-splicing by a group II intron occurs via two
"cryptic" splice sites present in the normal gene sequence. ln transesterification reactions, involving intermediates and
the absence of the normal splice site, the cross-exon recogni- products analogous to those found in nuclear pre-mRNA
tion complex recognizes these alternative sites . Other muta- splicing. The mechanistic similarities between group II intron
tions that cause abnormal splicing result in a new consensus self-splicing and spliceosomal splicing led to the hypothesis
splice-site sequence that becomes recognized in place of the that snRNAs function analogously to the stem loops in the
normal splice site. Finally, some mutations can interfere with secondary structure of group II imrons. According to this hy-
the binding of specific SR proteins to pre-mRNAs. These pothesis, snRNAs interact with 5' and 3' splice sites of pre-
mutations inhibit splicing at normal splice sites, as in the case mRNAs and with each other to produce a three-dimensional
of the SMN2 gene, and thus lead to exon skipping. RNA structure functionally analogous to that of group II self-
splicing introns (Figure 8-14b).
An extension of this hypothesis is that introns in ancient
pre-mRNAs evolved from group II self-splicing introns
Self-Splicing Group II lntrons Provide
through the progressive loss of internal RNA structures,
Clues to the Evolution of snRNAs which concurrently evolved into trans-acting snRNAs that
Under certain nonphysio logical in vitro conditions, pure perform the same functions. Support for this type of evolu-
preparations of some RNA transcripts slowly splice out in- tionary model comes from experiments with group I! intron
trans in the absence of any protein. This observation led to mutants in which domain V and part of domain I are deleted.
the recognition that some introns are self-splicing. Two types Rl'\A transcripts containing such mutant introns are defective
of self-splicing introns have been discovered: group I introns, in self-splicing, but when RNA molecules equivalent to the
present in nuclear rRNA genes of protozoans, and group IT deleted regions are added to the in vitro reaction, self-splicing
introns, present in protein-coding genes and some rRNA and occurs. This finding demonstrates that these domains in group
tRNA genes in mitochondria and chloroplasts of plants and II introns can be trans-acting, like snRNAs.
5' e>o-----!I~~~U~AAA~I--*L--~ 3' specificity factor (CPSF) binds to the upstream AAUAAA poly(A) signal.
CStF interacts with a downstream GU- or U-rich sequence and with
CPSF, CStF, CFI, CFII i p,~mRNA bound CPSF, forming a loop in the RNA; binding of CFI and CFII helps
stabilize the complex. Binding of poly(A) polymerase (PAP) then
stimulates cleavage at a poly(A) site, which usually is 10-35 nucleotides
3' of the upstream poly(A) signal. The cleavage factors are released, as
CPSF is the downstream RNA cleavage product, which is rapidly degraded.
Bound PAP then adds - 12 A residues at a slow rate to the 3'-hydroxyl
group generated b y the cleavage reaction. Binding of poly(A)-binding
protein II (PABPII) to the initial short poly(A) tail accelerates the rate of
addition by PAP. After 200-250 A residues have been added, PABPII
signals PAP to stop polym erization.
1
3'
the poly(A)-bind ing protein present in the cytoplasm. PABPII
c....... binds to the short A tail initially added by PAP, stimulating the
rate of polymerization of additional A residues by PAP, result-
ing in the fast phase of polyadenylation (Figur.e 8-15). PABPII is
also responsible for signaling poly(A) polymerase to terminate
polymerization when the poly(A) tail reaches a length of 200-
250 residues, although the mechanism for controlling the length
of the ta il is not yet understood. Bi nding of PABPII to the
poly(A) tail is essential for mRNA export into the cytoplasm.
p~
J' + ATP pp.
Slow
polyadenylation Nuclear Exonucleases Degrade RNA
+ CStF, CFI, CFII I That Is Processed Out of Pre-mRNAs
Because the h uman genome contains long introns, only - 5
percent of the nucleotides that are polymerized by RNA
polymerase II during transcription are retained in mature,
5' A
processed mRNAs. Although this process appears ineffi-
cient, it probably evolved in mu lticellular organisms because
PABPIIi the process of exon shuffling facilitated the evolution of new
genes in organisms with long introns (Chapter 6). The in-
trons that are spliced out and the region downstream from
the cleavage and polyadenylation site are degraded by nu-
5' clear exoribonucleases that hydrolyze one base at a time
from either the 5 ' or 3' end of an RNA strand .
As mentioned earlier, the 2',5'-phosphodiester bond in
PABPIIF ATP Rapid excised introns is hydrolyzed by a debranching enzyme,
polyadenylation
PP; yielding a linear molecule with unprotected ends that can be
attacked by exonucleases (see Figure 8-11 ). The predomi-
nant nuclear decay pathway is 3'-4S' hydrolysis by 11 exo-
nucleases that associate with one another in a large protein
5' H 3' complex called the exosome. O ther proteins in the complex
include RNA helicases that disr upt base pairing and RNA-
protein interactions that wou ld o therwise impede the exonu-
cleases. Exosomes also function in the cytoplasm, as discussed
Pre-mRNAs mRNAs
'I!/
(a) sxl
' v / 'v /
------------------------
(b) tra 5~ ~
' v /
FIGURE 8 - 16 Cascade of regulated splicing that controls sex Rbpl and Tra2, activates splicing between exons 3 and 4 and cleavage/
determination in Drosophila embryos. For clarity, only the exons polyadenylation(An)at the 3' end of exon 4 in dsx pre-mRNA in female
(boxes) and introns (black lines) where regulated splicing occurs are embryos. In male embryos, which lack functional Tra, the SR proteins
shown. Splicing is indicated by red dashed lines above (female) and do not bind to exon 4, and consequently exon 3 is spliced to exon S.
blue dashed lines below (male) the pre-mRNAs. Vertical red lines in The distinct Dsx proteins produced in female and male embryos as the
exons indicate in-frame stop codons, which prevent synthesis of result of this cascade of regulated splicing repress transcription of
functional protein. Only female embryos produce functional Sxl genes required for sexual differentiation of the opposite sex. [Adapted
protein, which represses splicing between exons 2 and 3 in sxl pre- from M. J. Moore et al., 1993, in R. Gesteland and J. Atkins, eds., The RNA World,
mRNA (a) and between exons 1 and 2 in tra pre-mRNA (b). (c) In Cold Spring Harbor Press, pp. 303- 357.]
contrast, the cooperative binding ofTra protein and two SR proteins,
apoB
mRNA 5'
...
CAA
...
UAA
An 5'
CAA-+UAA UAA
~ ~
1 4536 1 2152
the relative concentrations of alternatively spliced mRNAs. RNA Editing Alters the Sequences
For example, the most common of these types of diseases, of Some Pre-mRNAs
myotonic dystrophy, is characterized by paralysis, cognitive
impairment, and personality and behavior disorders. Myo- In the mid-1980s, sequencing of numerous eDNA clones and
tonic dystrophy results from increased copies of either CUG corresponding genomic DNAs from multiple organisms led
repeats in one transcript, in some patients, or CCUG repeats to the unexpected discovery of another type of pre-mRNA
in another transcript, in other patients. When the number of processing. In this type of processing, called RNA editing, the
these repeats increases to 10 or more times the normal num- sequence of a pre-mRNA is altered; as a result, the sequence
ber of repeats in these genes, abnormalities are observed in of the corresponding mature mRNA differs from the exons
the level of two hnRNP proteins that hind to these repeated encoding it in genomic DNA.
sequences. This probably results because these hnRNPs are RNA editing is widespread in the mitochondria of proto-
bound by the abnormally high concentration of this RNA zoans and plants and also in chloroplasts. In the mitochon-
sequence in the.nuclei of neurons in such patients. The ab- dria of certain pathogenic trypanosomes, more than half the
normal concentrations of these hnRNP proteins are thought sequence of some mRNAs is altered from the sequence of the
to lead to alterations in the rate of splicing of different alter- corresponding primary transcripts. Additions and deletions
native splice sites in multiple pre-mRNAs normally regulated of specific numbers of U's fo llows temp lates provided by
by these hnRNP proteins. base-paired short "guide" RNAs. These RNAs are encoded
by thousands of mini-mitochondrial DNA circles catenated
to many fewer large mitochondrial DNA molecules. The rea-
Expression of Dscam lsoforms in Drosophila Retinal Neurons son for this baroque mechanism for encoding mitochondrial
The most extreme example of regulated alternative RNA proteins in such protOzoans is not clear. But this system does
processing yet uncovered occurs in expression of the Dscam represent a potential target for drugs to inhibit the complex
gene in Drosophila. Mutations in this gene interfere with the processing enzymes essential to the microbe that do not exist
normal synaptic connections made between axons and den- in the cells of their human or other vertebrate hosts.
drites during fly development. Analysis of the Dscam gene In higher eukaryotes, RNA editing is much rarer, and
showed that it contains 95 alternatively spliced exons that thus far, only single-base changes have been observed. Such
could be spliced to generate 38,016 possible isoforms! Re- minor editing, however, turns out to have significant func-
cent results have shown that Drosophila mutants with aver- tional consequences in some cases. An important example of
sion of the gene that can be spliced in only about 22,000 RNA editing in mamma ls involves the apoB gene. This gene
different ways have specific defects in connectivity between encodes two alternative forms of a c;erum protein central to
neurons. These results indicate that expression of most of the uptake and transport of cholesterol. Consequently, it is
the possible Dscam isoforms through regulated RNA splic- important in the pathogen ic processes that lead to athero-
ing helps to specify the tens of millions of different specific sclerosis, the arterial disease that is the major cause of death
synapti<.. connections between neurons in the Drosophila in the developed world. The apoB gene expresses both the
brain. In other words, the correct w iring of neurons in the serum protein apolipoprotein B-100 (apoB-100) in hepato-
brain requires regulated RNA splicing. cytes, the major cell type in the liver, and apoB-48, expressed
REF, ot her
'\Inner nuclear
adapter membrane
Lumen Luminal Nuclear
proteins
ring basket
Nucleus Nucleus
FIGURE 8 -20 Model of transporter passage through an NPC. in pu rple. The FG-domains of FG-nucleop'orins (tan worms) have an
(a) Diagram of NPC structure. The nuclear envelope lipid bilayers are extended, random-coil conformation that forms a molecular cloud of
represented in green. Transmembrane proteins represented in red continuously moving random-coil polypeptide. (b) Nuclear transport-
form a luminal ring around which the nuclear envelope membrane folds ers (NXF 1/NXT1) have hydrophobic regions on their surface that bind
to form the inner and outer nuclear membranes. Transmembrane reversibly to the FG-domains in the FG-nucleoporins. As a conse-
domains of these proteins are connected to globular domains on the quence, they can penetrate the molecular cloud in the NPC central
inside of the pore to which the other nucleoporins bind, forming the channel and diffuse in and out of the nucleus. [Adapted from D. Grunwald,
core scaffold. The globular domains of the FG-nudeoporins are shown R. H. Singer, and M. Rout, 2011 , Nature 475:333.)
enhancers. Thus SR proteins associated with exons function Protein filaments extend from the core scaffold into the
to direct both the splicing of pre-mRNAs and the export of nucleoplasm forming a "nuclear basket " (see Figure 8-20a).
fully processed mRNAs through NPCs to the cytoplasm. Protein filaments also extend into the cytoplasm. T hese fila-
mRNPs are probably bound along their length by multiple ments assist in mRNP export. Gle2, an adapter protein that
NXFl/NXTl mRNP exporters, which interact with the FG- reversibly binds both NXFl and a nucleoporin in the nuclear
domains of FG-nucleoporins to faci litate export of mRNPs basket, brings nuclear mRNPs to the pore in preparation for
through the NPC central channel (Figure 8-20b). export. A nucleoporin in the cytoplasmic filaments of the NPC
CBC
Nucleus
Cytoplasm
II
Nucleoplsam
.
NPC
Cytoplasm
lmportin
AAAAAAA
II AAAAAAA
~NXF1/NXT1
NXF1/N~
II
e a NXF1/NXT1
FIGURE 8 -22 Reversible phosphorylation and direction of mRNP Skyl phosphorylates Npl3 in the cytoplasm, causing lit dissociation of
nuclear export. Step 0 :The yeast SR protein Npl3 binds nascent the mRNP exporter and phosphorylated Npl3, probably through the
pre-mRNAs in its phosphorylated form. Step fJ: When polyadenylation action of an RNA helicase associated with NPC cytoplasmic filaments.
has occurred successfully, the Glc? nuclear phosphatase essential for mThe mRNA transporter and phosphorylated Npl3 are transported
mRNP export dephosphorylates Npl3, promoting the binding of the back into the nucleus through NPCs. 6 Transported mRNA is available
yeast mRNP exporter, NXFl /NXTl . Step 11:The mRNP exporter allows for translation in the cytoplasm. [From E. lzaurralde, 2004, Nat. Struct. Mol.
diffusion of the mRNP complex through the central channel of the Bioi. 11 :210-212. See W. Gilbert and C. Guthrie, 2004, Mol. Ce/113:201-212.]
nuclear pore complex (NPC). Step m: The cytoplasmic protein kinase
Recent studies in yeast have shown that a nuclear protein HIV Rev Protein Regulates the Transport
that associates with a nucleoporin in the NPC nuclear basket of Unspliced Viral mRNAs
is required to retain pre-mRNAs associated with snRNPs in
the nucleus. If either this protein or the nucleoporin to which As discussed earlier, transport of mRNPs containing mature,
it binds is deleted, unspliced prc-mRNAs are exported. functional mRNAs from the nucleus to the cytoplasm entails
a complex mechanism that is crucial to gene expression (sec
Many cases of thalassemia, an inherited disease that re- Figures 8-21, 8-22, and 8-23). Regulation of this transport
sults in abnormally low levels of globin proteins, are due theoretically could provide another means of gene control,
to mutations in globin-gene splice sites that decrease the effi- although it appears to be relatively rare. Indeed, the only
ciency of splicing but do not prevent association of the pre- known examples of regulated mRNA export occur during
mRNA with snRNPs. The resulting unspliced globin pre-mRNAs the cellular response to conditions (e.g., heat shock) that
are retained in reticulocyte nuclei and are rapidly degraded. cause protein denaturation or during viral infection when
m RNA
virus-induced alterations in nuclear transport maximize viral have some mechanism for overcoming this block, permitting
replication. Here we describe the regulation of mRNP ex- export of the longer viral mRNAs. Some retroviruses have
port mediated by a protein encoded by human immunodefi- evolved a sequence called the collstitutive transport element
ciency virus (HIV). (CTE), which binds to the NXFl/NXTl mRNP exporter with
A retrovirus, HJV integrates a DNA copy of its RNA ge- high affinity, thereby permitting export of unspliced retroviral
nome into the host-cell DNA (see Figure 4 -49). The integrated Rl"'A into the cytoplasm. HJV solved the problem differently.
viral DNA, or provirus, contains a single transcription unit, Studies with H IV mutants showed that transport of un-
which is transcribed into a. single primary transcript by cell ular spliced 9-k b and singly spliced 4 -kb viral mRNAs from the
RNA polymerase II. The HIV transcript can be spliced in alter- nucleus to the cytoplasm requires the virus-encoded Rev pro-
native ways to yield three classes of mRNAs: a 9-kb unspliced tein. Subsequent biochemical experiments demonstrated that
mRNA; ~4-kb mRNAs formed by removal of one intron; and Rev binds to a specific Rev-response element (RRE) present in
~2-kb mRNAs formed by removal of two or more introns HJV RNA. In cells infected with HJV mutants lacking the RRE,
(Figure 8-24). After their synthesis in the host-cell nucleus, all unspliced and singly spliced viral mRNAs remain in the nu -
three classes of HJV mRNAs are transported to the cytoplasm cleus, demonstrating that the RRE is required for Rev-mediated
and translated into viral proteins; some of the 9-kb unspliced stimulation of nuclear export. Early in an infection, before
RNA is used as the viral genome in progeny virions that bud any Rev protein is synthesized, only the multiply spliced 2-kb
from the cell surface. mRNAs can be exported. One of these 2-kb mRNAs encodes
Since the 9-kb and 4-kb HIV mRNAs contain splice sites, Rev, which contains a leucine-rich nuclear export signal that
they can be viewed as incompletely spliced mRNAs. As dis- interacts with transporter Exportin 1. As discussed in Chapter
cussed earlier, association of such incompletely spliced mRNAs 13, translation and nuclear import of Rev results in export of
with snRNPs in spliceosomes normally b locks their export the larger unspliced and singly spliced HIV mRNAs through
from the nucleus. Thus HJV, as well as other retroviruses, must the nuclear pore complex.
~~----------------~~--~c==
/
NUCLEAR mRNAs
l RRE
Transcription, splicing
CYTOPLASMIC mRNAs
9-kb +Rev
('
Unspliced 9 kb
4-kb ~'
Singly spliced 4 kb
2-kb ~
-Rev 0:>.::;;;;;;;;;;;;:;~ _____., 0 Rev protein
Multiply spliced ' 2 kb Translation
FIGURE 8-24 Transport of HIV mRNAs from the nucleus to the RNA species are translated into different viral proteins. Rev protein,
cytoplasm. The HIV genome, which contains several coding regions, is encoded by a 2-kb mRNA, interact s with the Rev-response element
transcribed into a single 9-kb primary transcript. Several -4-kb mRNAs (RRE) in the unspliced and singly spliced mRNAs, stimulating their
result from alternative splicing out of any one of several introns transport to the cytoplasm. [Adapted from B. R. Cullen and M. H. Malim, 1991,
(dashed lines) and several -2-kb mRNAs from splicing out oftwo or Trends Biochem. Sci. 16:346.]
more alternative introns. After transport to the cytoplasm, the various
.
(a) miRNA ~translation inhibition (b) siRNA ~RNA cleavage
,o ~ OH I 1 I I ;1'-~""'l ~..,.~,..,1
:"T"IT"""j ;~~
II"'TI"T"Inii'"T'I'I"1111"'TI'T'l:-;
I I I L.LI I I I I I I I I I I I I LLr.
Target RNA Target RNA t
uc
C A
C A
5' -UCCCUGAGA GUGUGA 3' ~-UAGGUAGUUUCAUGUUGUUGGG-3'
11111 1 11 I I II I 1111111111111 111111111
3' -UCCAGGGACUCAACCAACACUCAA- 5' 3' - CUUAUCCGUCAAAGUACAACAACCUUCU- 5'
lin-4 miRNA and lin-14 mRNA (C.elegans) miR-196a and HOXBB mRNA (H. sapiens)
CXCR4 m iRNA and target mRNA (H. sapiens) miR-166 and PHAVOLUTA mRNA (A. thaliana)
FIGURE 8-25 Base pairing with target RNAs distinguishes miRNA mRNA. (b) siRNA hybridizes perfectly with its target mRNA, causing
and siRNA. (a) miRNAs hybridize imperfectly with their target mRNAs, cleavage of the mANA at the position indicated by the red arrow,
repressing translation of the mRNA. Nucleotides 2 to 7 of an miRNA triggering its rapid degradation. [Adapted from P. D. Zamore and B. Haley,
(highlighted blue) are the most critical for targeting it to a specific 2005, Science 3 09:151 9.]
mRNA. Consequently, these newly discovered mechanisms that they regulate need not be perfect (Figure 8-25). In fact,
contribute significantly to the regulation of gene expression. considerable experimentation with synthetic miRNAs has
siRNAs, involved in the process called RNA interference, are shown that complementarity between the six or seven 5 ' nucle-
also an important cellular defense against viral infection and otides of an miRNA and its target mRNA 3' untranslated
excessive transposition by transposons. region are most critical for target mRNA selection.
Most miRNAs are processed from RNA polymerase II tran-
scripts of several hundred to thousands of nucleotides in length
Micro RNAs Repress Translation
called pri (for primary transcript)-miRNAs (figure 8-26). Pri-
of Specific mRNAs miRNAs can contain the sequence of one or more miRNAs.
Micro RNAs (miRNAs) were fim discovered during analysis miRNAs are also processed out of some excised introns and
of mutations in the lin-4 and let-7 genes of the nematode C. from 3' untranslated regions of some pre-mRNAs. Within
elegans, which influence development of the organism, Clon- these long transcripts are sequences that fold into hairpin struc-
ing and analysis 'o f wild-type lin-4 and let-7 revealed that they tures of -70 nucleotides in length with imperfect base pairing
encode not protein products but rather RNAs only 21 and 22 in the stem. A nuclear RNase specific for double-stranded
nucleotides long, respectively. The RNAs hybridize to the 3' RNA called Drosha acts with a nuclear double-stranded RNA-
untranslated regions of specific target mRNAs. For example, binding protein called DGCR8 in humans (Pasha in Dro-
the lin-4 miRNA, which is expressed early in embryogenesis, sophila) and cleaves the hairpin region out of the long precursor
hybridizes to the 3' untranslatcd regions of both the lin-14 RNA, generating a pre-miRNA. Pre-miRNAs are recognized
and lin-28 mRNAs in rhe.cytoplasm, thereby repressing their and bound by a specific nuclear transporter, Exportin5, which
translation by a mechanism discussed below, Expression of interacts with the FG-domains of nucleoporins, allowing the
lin-4 miRNA ceases later in development, allowing translation complex to diffuse through the inner channel of the nuclear
of newly synthesized lin-14 and lin-28 mRNAs at that time. pore complex, as discussed above (see Figure 8-20, and Chap-
Expression of let-7 miRNA occurs at comparable times dur- ter 13). Once in the cytoplasm, a cytoplasmic double-stranded
ing embryogenesis of all bilaterally symmetric animals. RNA-specific RNase called Dicer acts with a cytoplasmic
miRNA regulation of translation appears to be widespread double-stranded RNA-binding protein called TRBP in
in a ll multicellular plants and animals. In the past few years, humans (for Tar binding protein; called Loquacious in Dro-
small RNAs of 20- 26 nucleotides have been isolated, cloned, sophila) to further process the pre-miRNA into a double-
and sequenced from various tissues ot multiple model organ- stranded miRNA. The double-stranded miRNA is approximately
isms. Recent estimates suggest the expression of one-third of two turns of an A-form RNA helix in length, with strands
all human genes is regulated by -500 human miRNAs iso- 21-23 nucleotides long and two unpaired 3'-nucleotides at
lated from various tissues. The potential for regulation of mul- each end. Finally, one of the two strands is selected for assem-
tiple mRNAs by one miRNA is great because base pairing bly into a mature RNA-induced silencing complex (RISC)
between the miRNA and the sequence in the 3' ends of mRNAs containing a single-stranded macure miRNA bound by a
~
translation by separately regulating the transcription of two or
Drosha more different pri-miRNAs, which are processed to miRNAs
Pasha that are required in combination tO suppress the translation
of a specific target mRNA.
pre-miR-1-1
The binding of several RISC complexes to an mRNA in-
LO Nucleus hibits translation initiation by a mechanism currently being
c
e analyzed. Binding of RISC complexes causes the bound
0
c. mRNPs to associate with dense cytOplasmic domains many
X
TRBP w Cytoplasm times the size of a ribosome called cytoplasmic RNA-processing
Dicer bodies, or simply P bodies. P bodies, which will be described
in greater detail below, are sites of RNA degradation that
TRBP Dicer '\
contain no ribosomes or translation factors, potentially ex-
"'JGAAcc
. s -p CAUACUUCUUUAUAUGCCCAUA U plaining the inhibition of translation. The association with P
pre-m1R-1-1 1111111111111 11 IIII I G
3' -AUGUAUGAAGAAAUGUA G GGUAUC C bodies may also explain why expression of an miRNA often
----~ GAAU decreases the stability of a targeted mRNA.
5
l
pCAUACUUCUUUAUAUGCCCAUA- 3'
As mentioned earlier, approximately 500 different human
miRNAs have been observed, many of them expressed only
miR-1-1 111111111111111 Ill in specific cell types. Determining the function of these miRNAs
3'-AUGUAUGAAGAAAUGUA G GGUp- s
is currently a highly active area of research. In one example,
1 - - - - - :UUUUAU AAUAAA-A
I I I I
mANA I I
CPE Poly(A)
signal
FIGURE 8-28 Model for control of cytoplasmic polyadenylation specificity factor (CPSF) then binds to the poly(A) site, interacting with
and translation initiation. (Left) In immature oocytes, mRNAs both bound CPEB and the cytoplasmic form of poly(A) polymerase
containing the U-rich cytoplasmic polyadenylation element (CPE) have (PAP). After the poly(A) tail is lengthened, multiple copies of the
short poly(A) tails. CPE-binding protein (CPEB) mediates repression of cytoplasmic poly(A)-binding protein I (PABPI) can bind to it and
interact with eiF4G, which functions with other initiation factors to
... translation through the interactions depicted, which prevent assembly
of an initiation complex at the 5' end ofthe mRNA. (Right) Hormone bind the 405 ribosome subunit and initiate translation. [Adapted from
stimulation of oocytes activates a protein kinase that phosphorylates R. Mendez and J. D. Richter, 2001, Nature Rev. Mol. Cell Bioi. 2:521 .]
CPEB, causing it to release Maskin. The cleavage and polyadenylation
I~wo
- - - - - - AAAAAA - - - - - - AAAAAA - - - - - - AAAAAA
1
1a
- -----A
Poly{A) shortenmg
-----~- AAAAAA
Endonucleolytic
cleavage
- - - - - - AAAAAA ------ A
5->3 / Exosome
Exonucleolytic
c decay
A
FIGURE 8 -29 Pathways for degradation of eukaryotic mRNAs. may either (1) be decapped and degraded by a 5' -t3' exonuclease or
In the deadenylation-dependent (middle) pathways, the poly(A) tail is (2) be degraded by a 3 '-t5' exonuclease in cytoplasmic exosomes.
progressively shortened by a deadenylase (orange) until it reaches a Some mRNAs (right) are cleaved internally by an endonuclease and the
length of 20 or fewer A residues, at which point the interaction with fragment s degraded by an exosome. Oth;r mRNAs (left) are decapped
PABPI is destabilized, leading to weakened interactions between the before they are deadenylated and then degraded by a 5' -t3' exonucle
5' cap and translation-initiation factors. The deadenylated mRNA then ase. [Adapted from M. Tucker and R. Parker, 2000, Ann. Rev. Biochem. 69:571.]
Many short-lived mRNAs in mammalian cells contain mul- translational modifications such as phosphorylation. Such
tiple, sometimes overlapping copies of the sequence AUUUA in mechanisms affect the translation rate of mpst mRNAs and
their 3' untranslated region. Specific RNA-binding proteins hence the overall rate of cellular protein synthesis.
have been found that both bind to these 3' AU-rich sequences
and also interact with a deadenylating enzyme and with the TOR Pathway The TOR pathway was discovered through
exosome. This causes rapid deadenylation and subsequent research into the mechanism of action of rapamycin, an an-
3'-t5' degradation of these mRNAs. In this mechanism, the tibiotic produced by a strain of Streptomyces bacteria, which
rate of mRNA degradation is uncoupled from the frequency of is useful fo r suppressing t he immune response in organ
translation. Thus mRNAs containing the AUUUA sequence can transplant patients . The target of rapamycin (TOR) was
be translated at high frequency yet also be degraded rapidly, identified by isolating yeast m utants resistant to rapa mycin
allowing the encoded proteins to be expressed in short bursts. inhibition of cell growth. TOR is a large (-2400 amino acid
As shown in Figure 8-29, some mRNAs are degraded by residue) protein kinase that regulates several cellular pro-
an endonucleolytic pathway that docs not involve decapping cesses in yeast cells in response to nutritional status. In mul-
or significant deadenylation. One example of this type of path- ticellular eukaryotes, metazoan TOR (mTOR) also responds
way is the RNAi pathway discussed above (see Figure 8-25). to multiple signals from cell-surface-signaling proteins to co-
Each siRNA-RISC complex can degrade thousands of targeted ordinate cell growth with developmental programs as well as
RNA molecules. The fragments generated by internal cleavage nutritional status.
then are degraded by exonucleases. Current understanding of the mTOR pathway is sum-
marized in Figure 8-30. Active mTOR stimulates the overall
P Bodies As mentioned above, P bodies are sires of transla-
rate of protein synthesis by phosphorylating two critical pro-
tional repression of mRNAs bound by miRNA-RISC com-
teins that regulate translation directly. mTOR also activates
plexes. They arc also the major sites of mRNA degradation in
t ranscription factors that contr o l exp ression of ribosomal
the cytoplasm. These dense regions of cytoplasm contain the
components, tRNAs, and tra nslation fac tors, furthe r activat-
dccapping enzyme (Dcp 1/Dcp2 in yeast), activators of decap-
ing protein synthesis and cell growth.
ping (Dhh, Patl, Lsml-7 in yeast), the major 5'-t3' exonucle-
Recall that the first step in translation of a eukaryotic
ase (Xrnl), as well as densely associated mRNAs. P bodies arc
mRNA is binding of the ei F4 initiation complex to t he 5 ' cap
dynamic structures that grow and shrink in size depending on
via its eiF4E cap-bind ing subunit (see Figure 4-24). The con-
the rate at which mR.t"iPs associate with them, the rate at which
centration of active elF4E is regulated by a small family of
mRNAs are degraded, and the rate at which mRNPs exit P
homologous elf4E-binding proteins (4E-BPs) that inhibit
bodies and reenter the pool of translated mRNPs. mRNAs
Lhe iutera<.:tion of e!F4E with mRNA 5' caps. 4-BPs are di-
whose translation is inhibited by imperfect base-pa iring of
rect targets of mTOR. When phosphorylated by mTOR, 4E-
miRNAs (Figure 8-25) are major components of P-bodies.
BPs release elF4E, stimulating translation initiation. mTOR
also phosphorylates and activates another protein kinase
Protein Synthesis Can Be Globally Regulated (56K) that phosphorylates the small ribosomal subun it pro-
Like proteins involved in other processes, translation initia- tein S6 and probably additional substrates, leading to a fur-
tion factors and ribosomal proteins can be regulated by post- ther increase in the rate of protein synthesis.
Cytoplasm
n utrients
~~/\
Protein
synthesis
Rib osom e Pol Ill M acroautophagy
bio g enesis transcript ion
FIGURE 8-30 mTOR pathway. mTOR is an active protein mTOR protein kinase activity. Low nutrient concentration also
kinase when bound by a complex of Rheb and an associated GTP regulates Rheb GTPase activity, by a mechanism that does not require
(lower /eft).ln contrast, mTOR is inactive when bound by a complex TSClfTSC2. Active mTOR phosphorylates 4E-BP, causing it to release
of Rheb associated with GDP (lower right). When active, the TSCl fTSC2 eiF4E, stimulating translation initiation. It also phosphorylates and
Rheb-GTPase activating protein (Rheb-GAP) causes hydrolysis of Rheb- activates 56 kinase (S6K), which in turn phosphorylates ribosomal
bound GTP to GDP, thereby inactivating mTOR. The TSClfTSC2 proteins, stimulating translation. Activated mTOR also activates
Rheb-GAP is activated (arrows) by phosphorylation by AMP kinase transcription factors for RNA polymerases I, II, and Ill, leading to
(AMPK) when cellular energy charge is low and by other cellular stress synthesis and assembly of ribosomes, tRNAs, and translation factors.
responses. Signal-transduction pathways activated by cell-surface In the absence of mTOR activity, all of these processes are inhibited. In
growth factor receptors lead to phosphorylation of inactivating sites contrast, activated mTOR inhibits macroautophagy, which is stimulated
on TSClfTSC2, inhibiting its GAP activity. Consequently, they leave a in cells with inactive mTOR. [Adapted from S. Wullschleger et al., 2006, Cell
higher fraction of cellular Rheb in the GTP conformation that activates 124:471.]
Translation of a specific subset of mRNAs that have a string translation factor genes. Finally, mTOR stimulates process-
of pyrimidines in their 5' untranslated regions (called TOP ing of the rRNA precursor (Section 8.5). As a consequence of
mRNAs for tract of oligopyrimidine) is stimulated particularly phosphorylation of these several mTOR substrates, the syn-
strongly by mTOR. The T0P mRNAs encode ribosomal pro- thesis and assembly of ribosomes as well as the synthesis of
teins and translation elongation factors. mTOR also activates translation factors and tRNAs are greatly increased. Alterna-
the RNA polymerase I transcription factor TIF-lA, stimulating tively, when mTOR kinase activity is inhibited, these sub-
transcription of the large rRNA precursor (see Figure 7-52). strates become dephosphorylated, greatly decreasing the rate
mTOR activates transcription by RNA polymerase III as of protein synthesis and the production of ribosomes, transla-
well, by phosphorylating and thereby activating protein ki- tion factors, and tRNAs, thus halting cell growth.
nases that phosphorylate MAFl, a protein inhibitor of RNA mTOR activity is regulated by a monomeric small G pro-
polymerase III transcription. MAFl phosphorylation causes it tein in the Ras protein family called Rheb. Like other small G
to be exported from the nucleus, relieving repression of RNA proteins, Rheb is in its :=~ctive conformation when it is bound
polymerase III transcription. When mTOR activity falls , to GTP. RhebGTP binds the mTOR complex, stimulating
MAFl in the cytoplasm is rapidly dephosphorylated and im- mTOR kinase activity, probably by inducing a conformation
ported into the nucleus where it represses transcription by change in its kinase domain. Rheb is in turn regulated by a
RNA polymerase III. heterodimer composed of subunits TSCl and TSC2, named
In addition, mTOR activates two RNA polymerase II ac- for their involvement in the medical syndrome tuberous scle-
tivators that stimulate transcription of ribosomal protein and rosis complex, as discussed below. In the active conformation,
~
that remain associated with a spliceosome.
High iron H2 "! Another mechanism called nonsense-mediated decay
5' ~B!!IIIl!II!!!D- An ~ ~ (NMD) causes degradation of mRNAs in wh ich o ne or more
exons have been incorrectly spliced. Such incorrect splicing
Inactive IRE-BP ~ Translated
often will alter the open reading frame of the mRNA 3' to the
v
NMD can also result from a mutation creating a stop codon
(b) TfR mRNA IREs within a gene or a frame-shifting deletion or insertion. NMD
..::.:~~;.. gJ1
AU-rich region was initially discovered during the'study of patients with 13-
~ ,,,~~ thalasemia, who produce a low level of 13-globin protein asso-
ciated with a low level of 13-globin mRNA (Figure 8-32a, b).
5 A ---+ ',,.,.,
n 1"':,'- J 1 A search for possible molecular signals that might indi-
( .1( - ,
Inactive IRE-BP ~ I,.,,. --:._, cate the positions of splice junctions in a processed mRNA
01
Degraded led to the discovery of exon-junction complexes. As noted
mononucleotides
already, these complexes of several proteins. (including Y14,
Active IRE-BP
Magoh, eiF4IIIA, UPF2, UPF3, and REF), bind -20 nucle-
otides 5' to an exon-exon junction following RNA splicing
~ ~ ~
(Figure 8-32c), stimulate export of mRNPs from the nucleus
Low iron
by interacting with the mRNA exporter (see Figure 8-21 ).
5' .ii!ffiii.I.WQ An -If--+ Little Analysis of yeast mutants indicated that one of the proteins
degradation
in exon-junction complexes (UPF3) functions in nonsense-
FIGURE 8 -31 Iron-dependent regulation of mRNA translation mediated decay. In the cytoplasm, this component of exon-
and degradation. The iron response element-binding protein (IRE-BP) j unction complexes interacts with a protein (UPFl) and a
controls (a) translation of ferritin mRNA and (b) degradation of protein kinase (SMGl) that phosphorylates UPFl, causing
transferrin-receptor (TfR) mRNA. At low intracellular iron concentra-
the mRNA to associate with P bodies, repressing translation
tions IRE-BP binds to iron-response elements (IREs) in the 5' or 3'
of the mRNA. An additional protein (UPF2) associated with
untranslated regiori of these mRNAs. At high iron concentrations,
the mRNP complex binds a P-body associated deadenylase
IRE-BP undergoes a conformational change and cannot bind either
mRNA. The dual control by IRE-BP precisely regulates the level of free
that rapidly removes the poly(A) tail from an associated
iron ions within cells. See the text for discussion.
mRNA, leading to its rapid decapping and degrada tion by
the P-body associated 5' ~3' exonuclease (see Figure 8-29).
In the case of properly spliced mRNAs, the exon-junction
complexes associate with the nuclear cap-binding complex
aminolevulinate (ALA) synthase, a key enzyme in the synthe- (CBP80, CBP20) as the mRNP is transported through a nu-
sis of heme. Similarly, in vitro studies have shown that the clear pore complex, thereby protecting the mRNA from deg-
mRNA encoding the milk protein casein is stabilized by the radation. The exon-junction complexes arc thought to be
hormone prolactin and rapidly degraded in its absence. dislodged from the mRNA by passage of the first "pioneer"
ribosome to translate the mRNA. However, for mRNAs with
a stop codon before the final exon junction, one or more
Surveillance Mechanisms Prevent Translation
exon-junction complexes remain associated with the mRNA,
of Improperly Processed mRNAs resulting in nonsense-mediated decay (Figure 8-32).
Translation of an improperly processed mRNA could lead to
production of an abnormal protein that interferes with the Localization of mRNAs Permits Production
gene's normal function. This effect is equiva lent to that re
of Proteins at Specific Regions
suiting from dominant-negative mLJtations, discussed in
Chapter 5 (Figure 5-44). Several mechanisms collectively Within the Cytoplasm
termed mRNA surveillance help cells avoid the translation of Many cellular processes depend on localization of particular
improperly processed mRNA molecules. We have previously proteins to specific structures or regions of the cel l. In later
mentioned two such surveillance mechanisms: the recogni- chapters we examine how some proteins are transported after
tion of improperly processed pre-mRNAs in the nucleus and their synthesis to their proper cellular location. Alternatively,
.. ..
wt ~- ~0- transiently
globin thalasemia or weakly
interact PTC
- + - + Act D
+-
CBP80 and UPF1
promote SMG1-UPF1
binding to eRF1-eRF3
to promote SURF
complex formation
l
SMG1 CBP80
phosphorylates CBP20
m Gppp llip')-~--11!11-lllild ..I!II~AAAAA
l
7
UPF1
t t t
AUG PTC Norm Ter
FIGURE 8-32 Discovery of nonsense-mediated mRNA decay (3-thalasemia had much less (3-globin mRNA than the patient with
(NMD). (a) Patients with (3-thalasemia express very low levels of a wild-type (3-g lobin gene (- Act D). The mutant (3-globin mRNA
(3-globin mRNA. A common cause of this syndrome is a single-base- decayed rapidly when transcription was inhibited ( + Act D), whereas
pair deletion in exon 1 or exon 2 of the (3-globin gene. Ribosomes the wild-type (3-globin mRNA remained stable. (c) Current model of
translating the mutant mRNA read out of frame following the deletion NMD. PTC. premature termination codon. Norm Term, the normal
and encounter a stop codon in the wrong reading frame before they termination codon. SURF, complex of protein kinase SMG1 , UPF1 , and
translate across the last exon junction in the mRNA. Consequently, translation termination factors eRF1 and eRF3. Formation of the SURF
they do not displace an exon-junction complex (EJC) from the mRNA. complex leads to phosphorylation of UPF1 and association of
Cytoplasmic proteins associate with the EJC and induce degradation phospho-UPF1 with a UPF2-UPF3 complex bound to any exon-exon
of the mRNA. (b) Bone marrow was obtained from a patient with a junction complexes that were not displaced from the mRNA by the
wild-type (3-globin gene and from a patient with (3-thalasemia. RNA first, pioneer ribosome to translate the message. This leads to the
was isolated from the bone marrow cells shortly after collection, or association ofthe PTe-containing mRNA with P-bodies, removal of the
30 min after incubation in media with Actinomycin D, a drug that poly(A) tail, and degradation of the mRNA. [Part (b) from L. E. Maquat et al.,
inhibits transcription. The amount of (3-globin RNA was measured 1981, Ce// 27:543. Part (c) adapted from J. Hwang et al., 2010, Mol. Ce//39:396.]
using the S1-nuclease protection method (arrow). The patient with
protein localization can be achieved by localization of mRNAs of 3000 mRNAs analyzed were localized to specific subcellular
to specific regions of the cytoplasm in which their encoded pro- regions, raising the possibility that this is a much more general
teins function. In most cases examined thus far, such mRNA phenomenon than previously appreciated.
localization is specified by sequences in the 3' untranslated re-
gion of the mRNA. A recent genomic-level study of mRNA Localization of mRNAs to the b ud in S. cerevisiae The most
localization in Drosophila embryos revealed that -70 percent thoroughly understood example o f mRNA localization occurs
M
sequences in the ASH I mRNA and also binds to She3 protein. This
protein in turn binds to a myosin motor, Myo4, which moves along (b)
actin filaments into the bud. [SeeS. Koon and B. J. Schnapp, 2001, Curr.
Biology 11 :R166.]
Ash1
mRNA
>---c~~
in the budding yeastS. cerevisiae. As discussed in Chapter 7,
whether a haploid yeast cell exhibits the a or a mating type
is determined by whether a or a genes are present at the ex-
pressed MAT locus on chromosome III (see Figure 7-33). ~ She2
.... J9 ~~
Myo4 ""
The process that transfers a or a genes from the silent mating- Actin
type locus to the expressed MAT locus is initiated by a se-
quence-specific endonuclease ca lled HO. Transcription of
the HO gene is dependent on the SWI/SNF chromatin-
remodeling complex (see Chapter 7, Section 7.5). Daughter
yeast cells arising by budding from mother cells contain a
transcriptional repressor called Ash 1 (for Asymmetric syn-
thesis of HO) that prevents recruitment of the SWIISNF tion signal to which She2 binds, usually in their 3' UTR. The
complex to the HO gene, thereby preventing its transcrip- process can be visualized in live cells by the experiment
tion. The absence of Ashl from mother cells allows them to shown in Figure 8-34. RNAs can be fluorescently labeled by
transcribe the HO gene. As a consequence mother cells including in their sequence high-affinity binding sites for
switch their mating type, while daughter cells generated by RNA-binding proteins, such as bacteriophage proteins MS2
budding do not (Figure 8-33a). coat protein and bacteriophage }..N protein, that bind to dif-
Ashl protein accumulates only in daughter cells because ferent stem loops of specific sequence (Figure 8-34a). When
the mRNA encoding it is localized to daughter cells. The lo- such engineered mRNAs are expressed in budding yeast cells
calization process requires three proteins: She2 (for SWI- along with the bacteriophage proteins fused to proteins that
dependent HO expression), an RNA-binding protein that fluoresce different colors, the fusion proteins bind to these
binds specifically to a localization signal with a specific RNA specific RNA sequences, thereby labeling the RNAs that
structure in the ASHl mRNA; Myo4, a myosin motor pro- contain them with different colors. In the experiment shown
tein that moves cargos on actin filaments (see Chapter 17); in Figure 8-34b, ASHl mRNA was labeled by the binding of
and She3, which links She2 and therefore ASHl mRNA to green fluorescent protein fused to ;\N. Another mRNA local-
Myo4 (Figure 8-33b). ASHl mRNA is transcribed in the nu- ized to the bud by this system, the IST2 mRNA encoding a
cleus of the mother cell before mitosis. Movement of Myo4 component of the growing bud membrane, was labeled by
with its bound ASHl mRNA along actin filaments that ex- the binding of red fluorescent protein fused to M$2 coat
tend from the mother cell into the bud carries the ASHl protein. Video of a budding cell showed that the differently
mRNA into the growing bud before cell division. labeled ASHl and IST2 mRNAs accumulated in the same
At least 23 other mRNAs were found to be transported large cytoplasmic RNP particle containing multiple mRNAs
by the She2, She3, Myo4 ~ystem. All have an RNA localiza- in the mother cell cytoplasm, as can be seen from the merge
A
(b)
...
~
. M ' '..
:
,, .,
Binding sites for RFP-MS2
N
(/)
::E " " ' 't
" 'l " "
~ N
, ,.
1-
!a
'
t
1""1 ,.
I j I
') .~
I
,.
EXPERIMENTAL FIGURE 834 Transport of mRNP particles the right, GFP-A.N and RFP-MS2 were independently visualized by using
from a yeast mother cell into the bud. (a) Yeast cells were engineered millisecond alternating laser excitation of GFP and RFP. (b) Frames from
to express an ASH1 mRNA with binding sites for the bacteriophage A.N a video of fluorescing cells are shown. The nucleus next to the large
protein in its 5' untranslated region and an IST2 mRNA with binding vacuole in the mother cell near the center of the micrographs, as well
sites for bacteriophage MS2 coat protein in its 3' untranslated region. A as nuclei in neighboring cells, was observed by green and red
fusion of green fluorescent protein to A.N protein (GFP-A.N) and a fusion fluorescence as shown in the top and middle rows. A merge of the two
of red fluorescent protein to MS2 coat protein (RFP-MS2) also were images is shown in the bottom row, which also indicates the time
expressed in the same cells. In other experiments, these fluorescently elapsed between images. An RNP particle containing both the ASH 1
tagged sequence-specific RNA-binding proteins were shown to bind mRNA with A.N-binding sites and the IST2 mRNA with MS2-binding
to their own specific binding sites engineered into the ASH1 and IST2 sites was observed in the mother cell cytoplasm in the left column of
mRNAs, and not to each others' binding sites. Both fluorescently images (arrow). The particle increased in intensity between 0.00 and
tagged proteins also contained a nuclear localization signal so that the 46.80 seconds, indicating that more of these mRNAs joined the RNP
fluorescent proteins that were not bound to their high-affinity binding particle. The RNP particle was transported into the bud between 46.80
sites in these mRNAs were transported into nuclei through nuclear and 85.17 seconds and then became localized to the bud tip.
pore complexes (see Chapter 13). This was necessary to prevent high [From 5. Lange et al., 2008, Traffic 9:1256. See this paper to v1ew the v1deo.]
fluorescence from excess GFP-A.N and RFP-MS2 in the cytoplasm. At
of the green and red fluorescent signals. The RNP particle short poly(A) tails that do not allow translation initiation.
was then transported into the bud within about one minute. Once again, large RNP particles containing multiple mRNAs
bearing localization signals form in the cytoplasm near the
Localization of mRNAs to synapses in the mammalian ner- cell nucleus. In this case, the RNP particles arc transported
vous system As mentioned earlier, in neurons, localization down the axon to synapses by kinesin motor proteins that
of specific mRNAs at synapses far from the nucleus in the cell travel down microtubules extending the length of the axon
body plays an essential function in learning and memory (Fig- (see Chapter 18). Electrical activity at a given synapse may
ure 8-35). Like the localized mRNAs in yeast, these mRNAs
contain RNA localization signals in their 3' untranslated re-
gion. Some of these mRNAs are initially synthesized with EXPERIME TAL FIGURII:: 835 A specific neuronal mRNA
localizes to synapses. Sensory neurons from the sea slug Ap/ysia
californica were cultured with target motor neurons so that processes
from the sensory neurons formed synapses with processes from the
motor neurons. The micrograph at the left shows motor neuron
processes visualized with a blue fluorescent dye. GFP-VAMP (green)
was expressed in sensory neurons and marks the location of synapses
formed between sensory and motor neuron processes (arrows). The
micrograph on the right shows red fluorescence from in situ hybridiza-
tion of an antlsensonn mHNA probe. Sensorin is a neurotransmitter
expressed by the sensory neuron only; sensory neuron processes are
not otherwise visualized in this preparation, but they lie adjacent to the
motor neuron processes. The in situ hybridization results indicate that
sensorin mRNA is localized to synapses. [From V. Lyles, Y. Zhao, and K. C.
Martin, 2006, Neuron 49:323.]
Nont ranscribed
} spacer Small Nucleolar RNAs Assist
in Processing Pre-rRNAs
Ribosomal subunit assembly, maturation, and export to the
cytoplasm are best understood in the yeast S. cereviswe.
However, nearly al l the proteins and RNAs involved are
Transcription highly conserved in multicellular eukaryotes, where the fun-
unit damental aspects of ribosome biosynthesis are likely to be
the same. As for pre-mRNAs, nascent pre-rRNA transcripts
arc immediately bound by proteins, forming preribosomal
ribonucleoprotein particles (pre-rRNPs). For reasons not yet
known, cleavage of the pre-rRNA does not begin until tran-
EXPERIMENTAL FIGURE 836 Electron micrograph of scription of the pre-rRNA is nearly complete. In yeast, it
pre-rRNA transcription units from the nucleolus of a frog oocyte. takes approximately six minutes for a pre-rRNA to be tran-
Each "feather represents multiple pre-rRNA molecules associated with scribed. Once transcription is complete, the rRNA is cleaved,
protein in a pre-ribonucleoprotein complex (pre-rRNP) emerging from and bases and riboses are modified in about 10 seconds. In a
a transcription unit. Note the dense " knob" at the 5' end of each rapidly growing yeast cell, -40 pairs of ribosomal subumts
nascent pre-RNP thought to be a processome. Pre-rRNA transcription are synthesized, processed, and transported to the cytoplasm
units are arran ged in tandem, separated by nontranscribed spacer every second. This extremely high rate of ribosome synthesis
regions of nucleolar chromatin. [Courtesy of Y. Osheim and 0. J. Miller, Jr.]
despite the seemingly long period required to transc ribe a
pre-rRNA is possible because pre-rRNA genes are packed
Primary
transcript
,
5- - - -- - - -- - - -
~ 3'----+ e ,
.. Rat1
Co transcr~pt1onal l
..,,.'11~-rucleolvt.c cleavage
355 ------------~---------------
l
~vie
,_ C+D s~r- -
L.a.o..ArA
V CH3 CH 3
~ ~~
t ----~-----------------
1 ~ I
355
Exosome -t') ~
1 Cleav
335 J~----------------------
Xrn1 r >
Rat1 \.....>
~ Cleavag.e l
'\.IR., qJl
325 ------~--------
- - - - - - -- 275A2
Xrn1
Rat1
G e
Xrn1 ~
Cleavage on
cytoplasm
Rat1 ~ -1--------- 275A3
Exxuclease prccesson:. 1
27585 --:l 275BL ~:+------
Q :essong
vage
ress.ng
svage
Xrn1
75 5 - D 75L - t)
l Exosom~ l Exosom)
- + - +
185 5.855 255 or 5.85L 255
FIGURE 8-38 rRNA processing. Endoribonuc!eases that make rRNAs occurs following the initial cleavage at the 3 ' end, before the
internal cleavages are represented as scissors. Exoribonuc!eases that initial cleavage at the 5' end. Proteins and snoRNPs known to partici-
digest from one end, either 5' or 3', are shown as Pac-Men. Most pate in these steps are indicated. [From J. Venema and D. Tollervey, 1999,
2' -0-ribose methylation (CH 3) and generation of pseudouridines in the Ann. Rev. Genetics 33:261.)
OH OH
Pseudouridine
FIGURE 8 - 39 snoRNP-directed modification of pre-rRNA. (a) A in the stems. Pre-rRNA hybridizes to the single-stranded bulges,
snoRNA called box C +D snoRNA is involved in ribose 2'-0-methylation. demarcating a site of pseudouridylation. (c) Conversion from uridine
Sequences in this snoRNA hybridize to two different regions in the to pseudouridine directed by the box H + ACA snoRNAs of part (b ).
pre-rRNA, directing methylation at the indicated sites. (b) Box H + ACA [Part (a) from T. Kiss, 2001 , EMBOJ. 2 0:3617. Part (b) from U. T. Meier, 2005,
snoRNAs fold into two stem loops with internal single-stranded bulges Chromosoma 114:1 .]
of each of these snoRNAs are precisely complementary to Some snoRNAs are expressed from their own promoters
sites on the pre-rRNA and direct the methyltransferase to by RNA polymerase II or III. Remarkabl}, however, the
specific riboses in the hybrid region (Figure 8-39a). A second large majority of snoRNAs are processed from spliced-out
major class of snoRNPs (containing box H + ACA snoRNAs) intron s of genes encoding functional mRNAs for proteins
positions the enzyme that converts uridine to pseudouridine involved in ribosome synthesis or translation. Some snoRNAs
(Figure 8-39b). This conversion involves rotation of the py- are processed from imrons spliced from apparently nonfunc-
rimidine ring (Figure 8-39c). Bases on either side of the mod- tional mRNAs. The genes encoding these mRNAs seem to
ified uridine in the pre-rRNA base-pair with bases in the exist only to express snoRNAs from excised introns.
bulge of a stem in the H + ACA snoRNAs, leaving the modified Unlike 185, 5 .85, and 285 genes, 55 rRNA genes are
uridine bulged out of the helical double-manded region, like the transcribed by RNA polymerase Ill in the nucleoplasm out-
branch point A bulges out in pre-mRNA spliceosomal splicing side the nucleolus. With only minor additional processing to
(see Figure 8-1 0). Other modifications of pre-rRNA nucle- remove nucleotides at the 3' end, 55 rRNA diffuses to the
otides, such as adenine dimethylation, are carried out by spe- nucleolus, where it assembles with the pre-rRNA precursor
cific proteins without the assistance of guiding snoRNAs. and remains associated with the region that is cleaved into
The U3 snoRNA is assembled into a large snoRNP contain- the precursor of the large ribosomal subunit.
ing -72 proteins called the small subunit (SSU) processomc, Most of the ribosomal proteins of the small 40S ribosomal
which specifies cleavage at site A 0 , the initial cut near the 5' subunit associate with the nascent pre-rRNA during transcrip-
end of the pre-rRNA (see Figure 8-38). U3 snoRNA base-pairs tion (figure 8-40). Cleavage of the full-length pre-rRNA in the
with an upstream region of the pre-rl~.NA to specify the loca- 90S RNP precursor releases a pre-405 particle that requires
tion of the cleavage. The processome is thought to form the only a few more remodeling steps before it is transported to the
"5' knob" visible in electron micrographs of pre-rRNPs (see cytoplasm. Once the pre-405 particle leaves the nucleolus, it
Figure 8-36). Base pairing of other snoRNPs specify additional traverses the nucleoplasm quickly and is exported through nu-
cleavage reactions that remove transcribed spacer regions. The clear pore complexes (NPCs), as discussed below. final matu-
first cleavage to initiate processing of t he 5.85 and 255 rRNAs ration of t he small ribosomal subunit occurs in the cytoplasm:
of the large subunit is performed by RNase M RP, a complex exonucleol) tic processing of the 205 rRNA into mature small
of nine proteins with an RNA. Once cleaved from pre-rRNAs, subunit 185 rRNA by the cytoplasmic 5' ~3 ' exoribonuclease
these sequences arc degraded by the same exosome-associated Xrn 1 and the dimethylation of two adjacent adenines near the
3'~5' nuclear exonucleases that degrade introns spliced from 3' end of 185 rRNA by the cytoplasmic enzyme Diml.
pre-mRNAs. Nuclear 5'~3' exoribonucleases (Ratl; Xrnl) In contrast to the pre-405 particle, the precursor of the
also remove some regions of 5' spacer. large subunit requires considerably more remodeling through
rONA
SSU processome
rRNA C) Helicases
RNA polymerase I 0 Intranuclear transport (Noc proteins)
FIGURE 8-40 Ril?osomal subunit assembly. Ribosomal proteins subunits in the cytoplasm. Other factors that associate transiently with
and RNAs in the maturing small and large ribosomal subunits are the maturing subunits are depicted in different colors, as shown in the
depicted in blue, with a shape similar to the icons for the mature key. [From H. Tschochner and E. Hurt, 2003, Trends Cell Bio/.13:255.]
many more transient interactions with nonribosomal pro- occur in the nucleoplasm, during passage from the nucleolus
teins before it is sufficiently mature for export to the cyto- to nuclear pore complexes (see Figure 8-40). Much remains
plasm. Consequently, it takes a considerably longer period to be learned about the complex, fascinating, and essential
for the maturing 60S subunit to exit the nucleus (30 minutes remodeling processes that occur during formation of the ri-
compared to 5 minutes for export of the 40S subunit in cul- bosomal subunits.
tured human cells). Multiple presumptive RNA helicases and The large ribosomal subunit is one of the largest struc-
small G proteins are associated w ith the maturing pre-60S tures to pass through nuclear pore complexes. Maturation of
subunits. Some RNA helicases arc necessary to dislodge the the large subunit in the nucleoplasm leads to the generation
snoRNPs that base-pair perfectly with pre-rRNA over up to of binding sites for a nuclear export adapter called Nmd3 .
30 base pairs. Other RNA helicases may function in the dis- Nmd3 is bound by the nuclear transporter Exportinl (also
ruption of protein-RNA interactions. The requirement for so called Crml ). This is another quality-control step, because
many GTPases suggests that there are many quality-control only correctl y assembled subunits can bind Nmd3 and be ex-
checkpoints in the assembly and remodeling of the large sub- ported. The small ~ubunit of the mRNP exporter (NXT 1) also
unit RNP, where one step must be completed before a GTPase becomes associated with the nearly mature large ribosomal
is activated to allow the next step to proceed. Members of the subunit. These nuclear transporters interact with FG-domains
AAA ATPase family are also bound transiently. This class of of FG-nucleoporins. This mechanism allows penetration of
proteins is often involved in large molecular movements and the molecular "cloud" that fills most of the central channel of
may be required to fold the complex, large rRNA into the the NPC (sec Figure 8-20). Several specific nucleoporins
proper conformation. Some steps in 60S subunit maturation without FG-domains are also required for ribosomal subunit
a
Spliceosome
.
5'
P~p
G
3' 5'
r1 HO
P+------'p/
A
3'
~
3'
1 1 1
__Q_G_3'0H
~p
D-
-- o~P ..;
1 1 1
p~ C\ _Q
- P HO --- p HO 3'
FIGURE 8-41 Splicing mechanisms in group I and group II involving th~ 2'-hydroxyl groups of branch-s1te As in group II introns
self-splicing introns and spliceosome-catalyzed splicing of and pre-mRNA introns spliced in spliceosomes {see Figure 8-8). The
pre-mRNA. The intron is shown in gray, the exons to be joined in red. subsequent transesterification that links the 5' and 3' exons is similar in
In group I introns, a guanosine cofactor {G) that is not part of the RNA all three splicing mechanisms. Note that spliced-out group I introns are
chain associates with the active site. The 3'-hydroxyl group of this linear structures, unlike the branched intron products in the other two
guanosine participates in a transesterification reaction with the cases. (Adapted from P. A. Sharp, 1987, Science 235:769.]
phosphate at the 5' end of the intron; this reaction is analogous to that
3' 3'
OH OH
Processing
Mature tRNATyr
FIGURE 8-42 Changes that occur during the processing of the stem loops are converted to characteristic modified bases (yellow).
tyrosine pre-tRNA. A 14-nucleotide intron (blue) in the anticodon Not all pre-tRNAs contain introns that are spliced out during process-
loop is removed by splicing. A 16-nucleotide sequence (green) at the ing, but they all undergo the other types of changes shown here.
5' end is cleaved by RNase P. U residues at the 3' end are replaced by D = dihydrouridine; ljJ = pseudouridine.
the CCA sequence (red) found in all mature tRNAs. Numerous bases in
Pst/Miu fragment
I<
Analyze the Data
~Region deleted in t1Sty
~1ost humans are infected with herpes simplex virus-1 (HSV-1),
Pst Mlu
the causative agent of cold sores. The HSV-1 genome com-
prises about I 00 genes, most of which arc expressed in in-
fected host cells at the site of oral sores. The infectious
process involves replication of viral DNA, transcription and
translanon of viral genes, assembly of new viral particles,
and death of the host cell as the viral progeny are released. 5' - GTGGCGGCCCGGCCCGGGGCCCCGG G :CAAGGGGCCCCGGCCCGGGGCCCCAc- 3'
Unlike most other types of viruses, herpesvirus also has a Stem (5' arm) LOOP Stem (3' arm) I
latent phase, 10 which the virus remains hidden in neurons.
These latently infected neurons are the source of active infec- c. RNA encoded within the Sty-Sty region is predicted to
tions, causing cold sores when latency is overcome. form a stem loop (see diagram in part b). Northern blot anal-
Interestingly, only a single viral transcript is expressed ysis was performed on total-cell RNA isolated from control
during latency. This transcript, LA T (latency-associated cells (mock ), cells infected with wild-type HSV-1, cells in-
transcript), does not encode a protein, and neurons mfected fected with an HSV-1 deletion mutant from which these-
with mutant HSV - I lacking the LA T gene undergo cell death quence between the two Sty site:, in the LA T gene was deleted
by apoprosis at a rate twice that of cells infected with wild- (DSty), and cells infected with a rescued DSry virus into which
type HSV-1. To determine if LAT functions to block apop- the deleted region was re-inserted into the viral genome
tosis by encoding a miRKA, the following studies were done (StyR). The probe used for the Northern blot was the labeled
(see Gupta et al., 2006, Nature 442:82-85). 3' stem region of the LAT RNA in the Sty-Sty region, as dia-
a. A cell line was transfected (a process in which foreign grammed in part (b). The RNAs recognized by this probe
DNA is inserted into a cell) with an expression vector that were either - S 5 nucleotidcs or 20 nucleotides, as shown in
References 395
Carthew, R. W., and F. J. Sontheimcr. 2009. Origins and Stmpson, L., et al. 2004. Mitochondrial proteins and complexes
mechamsms of miRNA~ and stRNAs. Cell 136:642-655. 111Letshmania and Trypanosoma involved 111 U-insertlon/deletion
Doma, \1. K., and R. Parker. 2007. RNA quality control tn RNA editing. RNA 10:159-170.
eukaryote~. Ce/1131:660-668. Siomi, M.. C., et al. 2011. PTWI-interacting small RNAs: the
Eulalio, A., I. Behm-Ansmant, and E. Izaurralde. 2007. P bodies: vanguard of genome defence. Nat. Rev. Mol. Cell Bzol. 12:246-258.
at the crossroads of post-transcriptional pathways. Nat. Rev. Mol. Willis, I. M., and R. D. Moir. 2007. Integration of nutritional and
Cell Bzol. 8:9-22. stress signaling pathways b) Mafl. Trends Biochem. SCI. 32:51-53.
Fabian, M. R., N. Sonenberg, and W. Filipowicz. 2010. Wullschleger, S., R. Loewith, and M. N. Hall. 2006. TOR
Regulation of mRNA translation and stability by microRNAs. signaling in growth and metabolism. Cell 124:471-484.
Annu. Rev. B10chem. 79:351-3 79. Zhang, H., J. M. Mamar, and A. Z. Fire. 2011. 'lnc-miRs':
Ghildiyal, .\1., and P. D. Zamore. 2009. Small silencing RNAs: funcnonal intron-interrupted miRNA genes. Genes Dev. 25:1589-
an expanding universe. Nat. Rev. Genet. 10:94-108. 1594. A. Z. Fire's Nobel Pnze lecture can be viewed at http://
Groppo, R., and j. D. Richter. 2009. Translational control from nohclprize.org/nobel_prizes/medicine/laureatcs/2006/announcement.
head to tail. Curr. Opi11. Cell Bioi. 21:444-451. html
Hirokawa, !':. 2006. mRNA transport in dendmes: RNA Zoncu, R., A. Efeyan, and D. M. Sahatmi. 201 I. mTOR: from
granules, motors, and tracks.]. Neuroscz. 26:7139-7142. growth signal integration to cancer, diabetes and ageing. Nat. Rev.
Huntzinger, E., and E. Izaurralde. 2011. Gene silencing by Mol. Cell Bioi. 12:21-35.
microRNAs: contributions of translational repression and mRNA
decay. Nat. Rev. Genet. 12:99-110. Processing of rRNA and tRNA
Jobson, R. W., andY. L. Qiu. 2008. Did RNA edtring in plant Evans, D., S.M. \1arquez, and ::-.l. R. Pace. 2006. RNase P: interface
organellar genomes originate under natural selecnon or through of the RNA and protein worlds. Trends Biochem. Sci. 31:333-341.
genetic drift? Bioi. Direct. 3:43. Farica, A., and D. Tollervey. 2002. Making ribosomes. Curr.
Kidner, C. A., and R. A. Marrienssen. 2005. The developmental Opm. Cell Bzol. 14:313-318.
role of microRNA in plants. Curr. Opm. Plant Bioi. 8:38-44. Hage. A. E., and D. Tollervey. 2004. A surfeit of factors: why ts
Leung, A. K., and P. A. Sharp. 2010. MicroRNA functions 111 nbosome assembly so much more complicated in eukaryores than
stress responses. Mol. Cell. 40:205-2 15. bacteria? RNA Bioi. 1:10-15.
Lodish, H. F., et al. 2008. Micromanagement of the immune Hamma, T., and A. R. Ferrc-D'Amarc. 2010. The box H/ACA
system by mtcroR;'\/As. Nat. Rev. lmmzmol. 8:120-130. ribonucleoprotein complex: mterplay of RNA and protem structures 111
Maquat, L. E., W. Y. Tarn, and 0. lsken. 2010. The pioneer post-transcripnonal RNA modification.]. Bzol. Chem. 285:805-809.
round of translation: features and functions. Cell 142:368-374. Handwcrger, K. E., and J. G. Gall. 2006. Subnuclear organelles:
Marrin, K. C., and A. Ephrussi. 2009. mRNA localization: gene new insights into form and function. Trends Cell Bzol. 16:19-26.
expression in the spatial dimension. Ce/1136:719-730. Kressler, D., E. Hurt, and J. Bassler. 2010. Drinng rihosomc
Mello, C. C., and D. Conte Jr. 2004. Revealing the world of assembly. Bioclnm. Biophys. Acta. 1803:673-683.
RNA Interference. Nature 431:338-342. C. C. :V1ello\ Nobel Pme Liang, B., and H. Li. 201 1. Structures of ribonucleoprotein
lecture can he viewed at http://nobelprize.org/nobel_prizcs/medicme/ particle modification enzymes. Q. Rev. Biophys. 44:95-122.
laureates/2006/announcement.html Marvin, M. C., and D. R. Engelke. 2009. RNase P: increased
Michels, A. A. 2011. MAF1: a new target of mTORCl. versatility through protein complexity? RNA Bioi. 6:40-42.
Biochem. Soc. TraJIS. 39:487-491. Ntzami, Z., S. Deryusheva, and J. G. Gall. 2010. The Cajal
Mihaylova, M. M., and R. j. Shaw. 2011. The AMPK signalling body and histone locus body. Cold Spnng Harb. Perspect. Bioi.
pathway coordinates cell growth, autophagy and metabolism. 2(7):a000653.
Nature Cell Bioi. 13:1016-1023. Phizicky, E. M., and A. K. Hopper. 2010. tRK'A biology charges
Parker, R., and H. Song. 2004. The enzymes and control of to the front. Genes Dev. 24:1832-1860.
eukaryotic mRNA turnover. Nat. Struct. Mol. Bzol. 11:121-127. Schmid, M., and T. H. Jemen. 2008. The exosome: a multipur-
Richter, J. D., and N. Sonenberg. 2005. Regulation of cap- pose RNA-decay machine. Trends Biochem. Sci. 33:501-510.
dependent translation by eiF4E inhibitory proteins. Nature Smhley, \1. R., and S. A. Strobel. 2006. RNA splicing: group I
433:4..,--480. mtron crystal structures reveal the basts of splice site ~election and
Ruvkun, G. B. 2004. The tiny RNA world. Haruey Lect. 99:1-21. metal ton catalysis. Curr. Opm. Struct. Rio/. 16:319-326.
Shaw, R. J. 2008. mTOR signaling: RAG GTPases transmit the Tschochner, H., and E. Hurr. 2003. Pre-ribosomes on the road
amino acid signal. Trends Riochem. Sci. 33:565-568. from the nucleolus to the cytoplasm. Trends Cell Bioi. 13:255-26 ."'!.