DNA TYPING

DNA profiling also called DNA fingerprinting, DNA testing, DNA typing, or genetic
fingerprinting is a technique use by forensic scientists to distinguish between
individuals of the same species using samples of their DNA. Although the majority
(99.5%) of our DNA is the same, there are short pieces called microsatellites, which
repeat many times in a persons DNA. It's the pattern of repeats that are different
between individuals. Knowing these microsatellite DNAs. The process of DNA
profiling was invented by Alec John Jeffreys at the University of Leicester in
1985.equences is the basis of DNA profiling.

Stages of DNA typing

Step 1:
Cells are broken down to release DNA. If only a small amount of DNA is available it
can be amplified using polymerase chain reaction (PCR).
Step 2:
The DNA is cut into fragments using restriction enzymes. Each restriction enzyme
cuts DNA at a specific base sequence. The sections of DNA that are cut out are
called restriction fragments. This yields thousands of restriction fragments of all
different sizes because the base sequences being cut may be far apart (long
fragment) or close together (short fragment).

Step 3:
Fragments are separated on the basis of size using a process called gel
electrophoresis. DNA fragments are injected into wells and an electric current is
applied along the gel. DNA is negatively charged so it is attracted to the positive
end of the gel. The shorter DNA fragments move faster than the longer fragments.
DNA is separated on the basis of size.

A radioactive is added which combines with the DNA fragments to produce a

fluorescent image. A photographic copy of the DNA bands is obtained.

Step 4:
The pattern of fragment distribution is then analyzed.

RFLP TECHNIQUE
DNA is cut into fragments by restriction enzymes .DNA is chopped in to two pieces
at every place where GCGC pattern occurs. For Example,

GCGCATTGTTGCGCAAGAGCGC
Steps:
Sample is taken from sample sources like blood, semen, teeth, urine, and hair
etc.
DNA is extracted from the sample.
DNA is cut down in different fragments.
After that we separate DNA fragments by electrophoresis.
Transfer DNA fragments to a membrane (southern blot).
Then bind radioactive DNA probe to specific DNA fragment.
Wash off membrane to avoid of excess probes.
Then X-ray films are used to detect radioactive DNA pattern.
Sources of biological evidence:
Blood
Teeth
Semen
Saliva
Hair
Urine
Bone
Tissues

Applications:
Paternity disputes
Maternity test
Establishment of biological relationship
Identification of rapist
DNA profiling is used to solve crimes

Advantages:
Require small sample
Can be applied on very old stains
Most conclusive method

Disadvantages:
Very expensive
Cannot differentiate identical twins
Interpretation of results requires a great deal of expertise and experience.