Plant Mol Biol Rep
DOI 10.1007/s11105-014-0699-z
ORIGINAL PAPER
Effects of Postharvest Hot Air Treatment on Gene Expression
Associated with Ascorbic Acid Metabolism in Peach Fruit
Ke Wang & Xingfeng Shao & Yifu Gong & Feng Xu &
Hongfei Wang
# Springer Science+Business Media New York 2014
Abstract The effect of postharvest heat treatment (37 C,
3 days) on ascorbic acid (AsA) metabolism related to chilling
resistance in peach fruit stored at 5 C has been studied.
Chilling injury (CI) index and hydrogen peroxide (H2O2)
levels as well as gene expression levels of mitochondrial L-
galactono-1, 4-lactone-dehydrogenase (GalLDH) related to
AsA synthetic metabolism, cytosolic ascorbate peroxidase
(APX), chloroplastic APX, peroxisomal APX1-3, cytosolic
monodehydroascorbate reductase (MDAR), chloroplastic
MDAR, chloroplastic dehydroascorbate reductase (DHAR),
and chloroplastic glutathione reductase (GR) related to AsA
regeneration cycle metabolism were measured. Treated fruit
maintained its initial H2O2 levels after heat conditioning,
showing significantly higher levels when compared with
non-heated fruit. However, during cold storage, heat-treated
fruit exhibited lower H2O2 levels than control fruit; heated
fruit had the lowest CI index at the end of storage. The
transcription levels of all of genes (GalLDH, APX, MDAR,
and DHAR), except for GR, sharply increased, and were
higher than those of control fruit, immediately after heat
treatment. Then, transcription levels sharply declined to levels
lower than control fruit at 714 days. Little difference of gene
expression was observed in the end of storage. These results
suggest that AsA metabolism gene expression was temporar-
ily and sharply induced by higher H2O2 levels after heat
treatment, which might inhibit the elevation of H2O2 level at
the initial period of cold storage, and followed by lower genes
K. Wang : X. Shao (*) : F. Xu : H. Wang
Department of Food Science, Ningbo University,
Ningbo 315211, Zhejiang, Peoples Republic of China
e-mail: shaoxingfeng@nbu.edu.cn
Y. Gong
Department of Biotechnology and Marine Science, Ningbo
University, Ningbo 315211, Zhejiang, Peoples Republic of China
expression of AsA metabolism accompanied by lower H2O2
levels following transfer to cold storage.
Keywords Prunus persica . Heat treatment . Ascorbic acid .
Chilling injury
Introduction
Peaches are of important nutritional and commercial value,
and deteriorate quickly at ambient temperature. Cold storage
has been confirmed as an effective and economic way to
maintain quality and extend shelf life. However, physiological
disorders, collectively designated as chilling injury (CI) symp-
toms, are often observed in fruit during prolonged low-
temperature storage, appearing primarily as internal browning
(Cao et al. 2010).
By controlling rotting rate and preserving or even improv-
ing the fruit flavor (Lurie 1998; Chen et al. 2012), heat
treatment, including hot air, hot water dips, and hot water
brushing, is effective and non-damaging physical protocols
to control CI on a number of chilling susceptible commodities
(Jin et al. 2009; Wang et al. 2012). In peaches, heat treatment
or combination with other treatments proves effective in re-
ducing CI (Murray et al. 2007; Jin et al. 2009; Cao et al. 2010).
Resistance to CI via heat stress was closely linked with
oxidative-metabolic modifications of the heated tissue
(Mittler et al. 2004; Vicente et al. 2006; Wang et al. 2012).
Heat stress, for example, elicits the generation of reactive
oxygen species (ROS), which are toxic molecules detrimental
to plasma membrane, as well as the generation of signal
molecules, which have been proposed to induce antioxidant
systems to control its level (Knight and Knight 2001; Quan
et al. 2008). The functional membrane and efficient antioxi-
dant system facilitate the acquisition of CI tolerance. Albeit
the effects of heat treatment have been investigated with

integration in levels of transcripts (Sapitnitskaya et al. 2006),
proteome (Zhang et al. 2011), enzyme, and metabolite (Lara
et al. 2009; Lauxmann et al. 2013), most studies focused on
fruit during either heat treatment or heat-treated fruit during
their subsequent cold storage. Therefore, a comprehensive
successive monitoring experiment was necessary to uncover
explicit alterations that occur during the transition from heat
stress to cold stress to allow us to identify the authentic
effective factors and reveal the mechanisms governing ac-
quired chilling resistance via heat treatment.
Ascorbic acid (AsA) metabolism is composed of the AsA
regeneration cycle (ascorbic acidglutathione, AsA-GSH) and
biosynthesis pathway, and is an important mechanism to
reduce ROS. AsA is converted to dehydrogenascorbate and
monodehydrogenascorbate, functioning as an electron donor
via ascorbate peroxidase (APX). Dehydrogenascorbate reduc-
tase (DHAR), monodehydrogenascorbate reductase (MDAR),
and glutathione reductase (GR) are responsible for
glutathione-dependent regeneration of AsA. L-galactono-1,
4-lactone-dehydrogenase (GalLDH), as the last limiting en-
zyme of the AsA biosynthesis pathway with a substrate of L-
galactono-1, 4-lactone, serves as an indicator of its capacity. It
has been widely held that AsA metabolism was linked with
tolerance to CI in terms of negative control for ROS, particu-
larly, hydrogen peroxide (H2O2) (Cao et al. 2009). Benefiting
from enhancement of the H2O2-scavenging system, including
AsA metabolism, the tolerance to CI was increased in heated
banana fruit (Ambuko et al. 2012). However, induction of
AsA metabolism has also been proposed (Morita et al. 1999;
Shigenaga et al. 2005). Therefore, investigation of AsA me-
tabolism in heated fruit under cold stress, and its relationship
with H2O2, is warranted. No reports are available on the
effects of heat treatment and extended cold storage on expres-
sion patterns for AsA metabolism related to CI.
In an effort to clarify the effects of heat treatment (37 C
for 3 days) on AsA metabolism and its contribution to chill-
ing tolerance in peach fruit, we observed the development of
CI and levels of H 2 O 2 during cold storage at 5 C.
Meanwhile, transcription levels of related enzyme genes in-
volved in AsA metabolism were also detected in conditioned
fruit immediately after heat treatment and during subsequent
cold storage.
Materials and Methods
Plant Materials and Experiment Design
Peach fruits (Prunus persica L. Batsch cv. Yulu) were har-
vested at day 138 after full bloom in Fenghua, Zhejiang
Province, China. Uniform-sized fruits without any defects
were selected and randomly divided into two groups of 108
fruits. In the control group (CK), fruits were untreated and
Plant Mol Biol Rep
directly placed into cold storage at 5 C and 902 % relative
humidity (RH) for 28 days. In the second group, heat treat-
ment (HT), fruits were treated at 37 C and 952 % RH for
3 days in a 500-L heating chamber (HWS-500, Ningbo
Jiangnan Instrument Factory, Ningbo, Peoples Republic of
China) with thermostatic control and air circulation prior to
storage. The treated fruits were then stored (5 C and 902 %
RH) with the CK group.
Slices of mesocarp (approximately 1 cm thick) were com-
bined, frozen in liquid nitrogen, and stored at 80 C for
further use. Three replicates, consisting of six fruits per repli-
cate, were used for biochemical as well as molecular analysis,
and the experiment was conducted twice.
Measurements of the CI Index
Postharvest, CI was assessed at 7-day intervals as the percent-
age of internally browned area visible on the mesocarp surface
following a cut parallel to the axial diameter. The severity of
internal browning in the peach fruit was evaluated on a scale
of 04: 0 (no signs of internal browning), 1 (<5 %), 2 (5
25 %), 3 (2550 %), and 4 (>50 %). The results are expressed
as the CI index, calculated using the following formula: CI
index=[(CI scale)(number of fruit at that CI)]/(4total
number of fruit in each group).
Measurements of the H2O2 Level
One gram of frozen tissue was homogenized with 5 ml ace-
tone pre-chilled at 20 C, and the homogenates were centri-
fuged for 20 min at 14000g at 4 C. Hydrogen peroxide
content was determined using a kit (Nanjing Jiancheng
Company, China) following the manufacturers instructions,
and expressed as mol g1 FW.
RNA Isolation and Real-time Quantitative PCR (RT-qPCR)
Total RNA was obtained from 2 to 3 g peach fruit mesocarp
using cetyltrimethyl ammonium bromide protocol described
by Meisel et al. (2005). RNA samples were treated with
RNase-free DNase (TaKaRa, Japan) to remove residual
DNA according to the instruction manual. The final RNA
quality and quantity was assessed by measuring the
A260/280 and A260/240 ratios using a spectrophotometer
(Nanodrop 1000, Thermal, USA). Integrity was tested by
electrophoresis on a 1 % agarose gel. RNA samples were
stored at 80 C.
An aliquot (2 g) of total RNA was used for first-strand
cDNA synthesis with SYBR PrimerScrip RT-PCR kit II
(TaKaRa, Japan), according to the manufacturers instruc-
tions. All cDNA samples were stored at 20 C and diluted
1:10 with RNase-free water before being used as template in
RT-qPCR analysis.
Plant Mol Biol Rep
3 race of genes encoding enzymes related to AsA metabo-
lism were carried out based on the P. persica expressed
sequence tag (EST) database (TIGR Plant Transcript
Assemblies; http://plantta.tigr.org) (Childs et al. 2007). RT-
qPCR primer pairs corresponding to these genes were de-
signed on the basis of 3-untranslated region using AlleleID
6.0 (Premier Biosoft International, Palo Alto, California,
USA) to produce complicons of 100250 bp in size. Gene-
specificity of these primer sets was tested according to the
method described by Wang (Wang et al. 2013).
RT-qPCR experiments were performed using Real Master
Mix (Takara), the SYBR Green kit II (Takara, Japan), and
gene-specific primers in a total volume of 20 l, including
2 l of cDNA, 0.4 l of each primer (10 M), 10 l of Master
Mix, and 7.2 l of RNase-free water. All experiments were
performed in triplicate with the same thermal cycling condi-
tions, which consisted of pre-incubation at 95 C for 2 min
followed by 40 cycles of 94 C for 15 s, 56 C for 20 s, and
72 C for 20 s. Potential genomic DNA contamination was
checked with reverse-transcribed negative control. Reaction
mix without template was also amplified to detect reagent
contamination. Translation elongation factor 2 (JQ732180.1)
was selected for normalization of small differences in template
amounts of target genes for its high expression stability (Tong
et al. 2009). The expression was calculated as previously
described (Thomsen et al. 2010). The full list of primer se-
quences is shown in Table 1.
Statistical Analysis
The experiments were conducted by a completely randomized
design. Standard errors (SE) were calculated by Microsoft
Excel, and figures were made with OriginPro 8.6 G
(Microcal Software Inc., Northampton, MA, USA). The
means of low-temperature samples were separated by the least
significant difference (LSD) test (p=0.05) via SPSS software
(SPSS Inc., Chicago, IL, USA).
Table 1 Oligonucleotide sequences of primers used for real-time RT-PCR analysis
Gene Forward primer (53)
Cytosolic APX GGACGAGGACGCTTTCTTTGC
Peroxisomal APX1 ACTACGCAGTGTCACACAAGAAAC
Chloroplastic APX AGATTCGGGCAGAGTATCAAGCTGT
Peroxisomal APX2 TTCTACTAACACAGCAAAGGACAG
Peroxisomal APX3 CTGGTTTTGATGGTCCTTGG
Chloroplastic GR GCACGACATGGCTCCTGAAG
Cytosolic MDAR TTCTCAGGACGCACATTCGG
Chloroplastic MDAR CCGGGTCATCGTTATAGGCT
Chloroplastic DHAR ATTCATCCAGCAGCCTCTACAG
Mitochondrial GalLDH TCATACGCCCATACCACCAG
TEF2 TGAAGGAGAGGGAAGGTGAAAG
Results and Discussion
CI and H2O2 Level
Compared with the control group, heat treatment at 37 C for
3 days delayed and reduced the CI index in peach fruit during
the cold storage. CI was expressed as internal browning
(Fig 1). The H2O2 concentration of the control group slightly
decreased during the first 3 days and then sharply increased to
a peak at the 7th day before declining (Fig. 2). Heat treatment
did not alter the concentration of H2O2, which were main-
tained at similar level as harvest time. H2O2 concentrations
were 20 % higher in heated fruit than those of control fruit
immediately after treatment (p<0.01), but then declined to
levels lower than those of the control group once the fruits
were transferred to cold storage (p<0.01). The treated group
showed 29 and 38 % lower H2O2 levels than the control at
days 7 and 14, respectively.
The positive effects of heat treatment on alleviation of
internal browning have been confirmed in a variety of
chilling-sensitive fruit such as peaches (Jin et al. 2009; Cao
et al. 2010), loquats (Rui et al. 2010), citrus (Porat et al. 2002),
bananas (Chen et al. 2008), and pomegranates (Mirdehghan
et al. 2007). H2O2, generated from dismutation, acts as an
agent of oxidative stress. It shows the strongest toxicity among
ROS for its stability and hence diffusion, which leads to the
development of CI by destroying membrane integrity and
initiating programmed cell death under cold stress. Some
researchers observed that heat-treated tissues had higher
H2O2 production than unheated tissues at the end of treatment
or the end of storage, which benefited the delay of senescence
in the broccoli florets (Shigenaga et al. 2005) and extended
postharvest life of spinach leaves (Gmez et al. 2008). In the
present study, heat-treated peach fruit also maintained a higher
level of H2O2 than control immediately after treatment. In
contrast to the control group, no peak value was found in the
treated fruit during cold storage. Meanwhile, the treated group
Reverse primer (53) Amplicon size (bp)
CAAGCCACCGCTGCCTTATTT 111
AGCAACGGCAACTCCCACAG 119
TAGGCAACCAATGCAACTCT 151
AGGTAATTGGCTAAGCAAGTCTAC 138
GGAAGTTTCAACAGCCCCTC 100
CTGAAGCGGAAACCTACTCTACC 199
GGGTTTCTTTCTAACAGTCACAGC 189
CATGAGGGCATCTAAACAGC 141
CGACGCCTGACGGAGTTG 110
CCACTGAAGGATGCTTCTCA 247
GGTGTGACGATGAAGAGTGATG 129

Fig. 1 CI index in peach fruit under cold storage at 5 C after no
conditioning (CK) or conditioning of hot air treatment at 37 C for 3 days
(HT). Each value is the mean of three replicate samplesSE. Vertical bars
represent the standard errors of the means
exhibited significantly lower levels of H2O2, which is similar
to the results from strawberries (Vicente et al. 2006) and
loquats (Shao and Tu 2012). Lower levels of relative conduc-
tivity and malondialdehyde, reflecting the deterioration of
membrane by ROS, were also observed in heated fruit during
cold storage (Chen et al. 2008; Mirdehghan et al. 2007). These
data indicate that peaches benefit from heat treatment, which
assists in coping with oxidative stress.
The Transcripts of Genes Encoding Enzymes
in AsA-GSH Cycle
Accumulated H2O2 needs to be scavenged promptly by effec-
tive AsA-GSH cycle, which is the hub of antioxidant system.
Fig. 2 Effect of hot air treatment at 37 C for 3 days on H2O2 content in
peach fruit under cold storage at 5 C. Values are expressed as the meanSE
of triplicate assays. Vertical bars represent the standard errors of the means
Plant Mol Biol Rep
Fruits exposed at 37 C for 3 days had varying degrees of
increase (from 1- to 24-fold) in levels of cytosolic APX
transcripts, followed by a sharp decline after the fruits were
transferred to 5 C (Fig. 3a), thereafter not being significantly
different from control fruit. Compared with harvest time, the
transcripts of chloroplastic APX (Fig. 3b) and peroxisomal
APX1-3 (Fig. 3ce) increased almost 3-, 2.5-, 1.8-, and 4-fold
after the treatment, respectively. However, they declined
sharply to levels lower than control fruit at days 7 and 14.
Transcripts of these genes were similar in heated and control
fruits after 14 days.
Though transcripts of GR (Fig. 4d) were not significantly
different from those of fruits at harvest, steep increases (ap-
proximately 4-fold) in levels of chloroplastic DHAR (Fig. 4a),
cytosolic MDAR (Fig. 4b), and chloroplastic MDAR (Fig. 4c)
transcription were observed in fruits just after heat treatment.
Similar to APXs, these levels of transcripts were also signif-
icantly (p<0.01) lower than those of control fruit, during 7
14 days, with almost no higher levels afterwards.
AsA-GSH cycle, including APX, GR, DHAR, and
MDAR, has been proposed to contribute to the scavenging
of H2O2 to avoid its overproduction. However, H2O2 also
operates as a signal, secondary messenger, and regulator of
some gene expression for the activation of stress responses
and defense pathways (Knight and Knight 2001; Quan et al.
2008). In rice seedlings, heat treatment elevated levels of APX
and GR, accompanied by enhancement of H2O2 content,
whereas heat-enhanced levels of APX and GR were blocked
after the inhibition of H2O2 accumulation (Chou et al. 2012),
which indicates the involvement of H2O2 in induction of AsA
metabolism under heat stress. Shigenaga et al. (2005) also
suggested that the higher H2O2 generated by the heat treat-
ment might induce activation of enzymes related to the AsA-
GSH cycle in broccoli florets. Sato et al. (2001) reported that
elevated cytosolic APX mRNA levels under heat stress en-
hanced chilling tolerance for rice seedlings, perhaps associat-
ed with heat-shock cis-element located in the promoter for
cytosolic APX. The heat-shock element is a functional com-
ponent of the Arabidopsis APX1 gene promoter (Sato et al.
2001). Some regulatory elements of APX has also been re-
ported in Beet (Beta vulgaris ) (Dunajska-Ordak et al. 2013).
Our research found a temporary and sharp up-regulation in
transcript levels of APXs (Fig. 3), MDARs, and DHAR
(Fig. 4). These effects may be induced by the higher H2O2
concentrations at the end of treatment. The higher activity of
AsA-GSH cycle could play important role in scavenging
H2O2, which contributed to reducing the accumulation of
H2O2 at the initial time of cold stress (Fig. 2). That may be
the reason why no peak value of H2O2 in treated fruit could be
observed in the first stage of cold storage. After transferred to
refrigerated storage up to day 14, the treated fruit showed
lower transcription of the AsA-GSH cycle than control fruit,
which was concomitant with lower levels of H2O2.
Plant Mol Biol Rep
Fig. 3 Changes in the transcript level of APX genes in peach fruit treated
at 37 C for 3 days and subsequent cold storage at 5 C. ae cytosolic
APX, choloroplastic APX, peroximal APX1-3
Fig. 4 Transcript levels of reductase genes for AsA-GSH cycle in peach
fruit treated at 37 C for 3 days and subsequent cold storage at 5 C: a
cytosolic MDAR; b choloroplastic MDAR; c choloroplastic DHAR; d
choloroplastic GR. Values are expressed as the meanSE of triplicate
assays. Vertical bars represent the standard errors of the means
The Transcripts of GalLDH
Heat treatment-induced transcripts of GalLDH showed 1.2-
fold higher levels than those of the control group (Fig. 5).
After transfer of fruit to cold storage, GalLDH transcripts
gradually declined in heated fruit, and were lower than the

Fig. 5 Changes in the transcript level of mitochondrial GalLDH of peach
fruit treated at 37 C for 3 days and subsequent cold storage at 5 C. Each
value is the mean of three replicate samplesSE. Vertical bars represent
the standard errors of the means
control group at days 7 and 14 (p<0.01). No significant
difference was observed between two groups thereafter.
GalLDH, acting as terminal step of AsA biosynthesis in
plant, has been proven to correlate with AsA levels in tobacco
(Kato and Esaka 1999) and Arabidopsis (Tabata et al. 2001).
However, overexpression and silencing of a GalLDH gene did
not change the level of AsA in wheat (Bartoli et al. 2005) and
tomato leaves (Alhagdow et al. 2007). Negative regulation of
AsA content by GalLDH in transcriptional level might exist in
tomato mutants (Zhang et al. 2013). Notably, silencing of
GalLDH in tomatoes caused the fluctuations of AsA redox
state and significant changes of mitochondrial function, and
induced stress-related genes (Alhagdow et al. 2007). GalLDH
located in mitochorial complex I, in Arabidopsis, was modu-
lated by the activity of electron transport chain (Millar et al.
2003). Therefore, it is conceivable that GalLDH may have
multiple roles in fruit exposure to abiotic stress except its links
with AsA biosynthesis. Intriguingly, synergetic changes of
GalLDH transcripts with AsA cycling pathway were observed
in peach fruit during heat treatment and cold storage. The
influence of heat treatment on the cycling and synthesis path-
way showed high consistency, which indicates that coordinat-
ed modulation of AsA cycling and synthesis pathways play an
important role in response to heat and cold stress.
Conclusion
In this study, we investigated the effect of hot air on AsA
metabolism related to CI in peaches. Heat-treated fruit showed
a lower sensitivity to chilling stress compared with control
fruit, which might be attributed to lower level of H2O2. After a
3-day heat treatment, AsA biosynthesis and regeneration cycle
metabolism in fruit were dramatically induced, significantly
higher than those in control fruit and concomitant with higher
level of H2O2, which contributed to reducing the accumula-
tion of H2O2 levels and led to no peak value at the initial
Plant Mol Biol Rep
period of cold stress. During cold storage, lower potency of
AsA metabolism was accompanied by lower H2O2 concen-
trations in treated fruit.
Acknowledgement This study was sponsored by the National Science
Foundation of China (No. 31000825), the Natural Science Foundation of
Zhejiang Province (No. Y3090537), and the K. C. Wong Magna Fund at
Ningbo University.
References
Alhagdow M, Mounet F, Gilbert L, Nunes-Nesi A, Garcia V, Just D, Petit
J, Beauvoit B, Fernie AR, Rothan C (2007) Silencing of the mito-
chondrial ascorbate synthesizing enzyme L-galactono-1, 4-lactone
dehydrogenase affects plant and fruit development in tomato. Plant
Physiol 145:14081422
Ambuko J, Zanol GC, Sekozawa Y, Sugaya S, Gemma H (2012)
Reactive oxygen species (ROS) scavenging in hot air precondition-
ing mediated alleviation of chilling injury in banana fruits. J Agric
Sci 5:319
Bartoli CG, Guiamet JJ, Kiddle G, Pastori GM, Di Cagno R, Theodoulou
FL, Foyer CH (2005) Ascorbate content of wheat leaves is not
determined by maximal L-galactono-1, 4-lactone dehydrogenase
(GalLDH) activity under drought stress. Plant Cell Environ 28:
10731081
Cao SF, Hu ZC, Zheng YH, Lu BH (2010) Synergistic effect of heat
treatment and salicylic acid on alleviating internal browning in cold-
stored peach fruit. Postharvest Biol Technol 58:9397
Cao SF, Zheng YH, Wang KT, Jin P, Rui HJ (2009) Methyl jasmonate
reduces chilling injury and enhances antioxidant enzyme activity in
postharvest loquat fruit. Food Chem 115:14581463
Chen JY, He LH, Jiang YH, Wang Y, Joyce DC, Ji ZL, Lu WJ (2008)
Role of phenylalanine ammonialyase in heat pretreatment-induced
chilling tolerance in banana fruit. Physiol Plant 132:318328
Chen M, Jiang Q, Yin XR, Lin Q, Chen JY, Allan AC, Xu CJ, Chen KS
(2012) Effect of hot air treatment on organic acid- and sugar-
metabolism in Ponkan (Citrus reticulata) fruit. Sci Hortic 147:
118125
Childs KL, Hamilton JP, Zhu W, Ly E, Cheung F, Wu H, Rabinowicz PD,
Town CD, Buell CR, Chan AP (2007) The TIGR plant transcript
assemblies database. Nucleic Acids Res 35:D846851
Chou TS, Chao YY, Kao CH (2012) Involvement of hydrogen peroxide
in heat shock-and cadmium-induced expression of ascorbate perox-
idase and glutathione reductase in leaves of rice seedlings. J Plant
Physiol 169:478486
Dunajska-Ordak K, Skorupa-Kaput M, Kurnik K, Tretyn A, Tyburski J
(2013) Cloning and expression analysis of a gene encoding for
ascorbate peroxidase and responsive to salt stress in beet (Beta
vulgaris). Plant Mol Biol Rep. doi:10.1007/s11105-11013-10636-
11106
Gmez F, Fernndez L, Gergoff G, Guiamet JJ, Chaves A, Bartoli CG
(2008) Heat shock increases mitochondrial H2O2 production and
extends postharvest life of spinach leaves. Postharvest Biol Technol
49:229234
Jin P, Zheng Y, Tang S, Rui H, Wang CY (2009) A combination of hot air
and methyl jasmonate vapor treatment alleviates chilling injury of
peach fruit. Postharvest Biol Technol 52:2429
Kato N, Esaka M (1999) Changes in ascorbate oxidase gene expression
and ascorbate levels in cell division and cell elongation in tobacco
cells. Physiol Plant 105:321329
Knight H, Knight MR (2001) Abiotic stress signalling pathways: speci-
ficity and cross-talk. Trends Plant Sci 6:262267
Plant Mol Biol Rep
Lara MV, Borsani J, Budde CO, Lauxmann MA, Lombardo VA, Murray
R, Andreo CS, Drincovich MF (2009) Biochemical and proteomic
analysis of Dixilandpeach fruit (Prunus persica) upon heat treat-
ment. J Exp Bot 60:4315
Lauxmann MA, Borsani J, Osorio S, Lombardo VA, Budde CO,
Bustamante CA, Monti LL, Andreo CS, Fernie AR,
Drincovich MF (2013) Deciphering the metabolic pathways
influencing heat and cold responses during postharvest phys-
iology of peach fruit. Plant Cell Environ. doi:10.1111/pce.
12181
Lurie S (1998) Postharvest heat treatments. Postharvest Biol Technol 14:
257269
Meisel L, Fonseca B, Gonzlez S, Baeza-Yates R, Cambiazo V, Campos
R, Gonzlez M, Orellana A, Retamales J, Silva H (2005) A rapid
and efficient method for purifying high quality total RNA from
peaches (Prunus persica) for functional genomics analyses. Biol
Res 38:8388
Millar AH, Mittova V, Kiddle G, Heazlewood JL, Bartoli CG,
Theodoulou FL, Foyer CH (2003) Control of ascorbate synthesis
by respiration and its implications for stress responses. Plant Physiol
133:443447
Mirdehghan S, Rahemi M, Martnez-Romero D, Guilln F, Valverde J,
Zapata P, Serrano M, Valero D (2007) Reduction of pomegranate
chilling injury during storage after heat treatment: role of poly-
amines. Postharvest Biol Technol 44:1925
Mittler R, Vanderauwera S, Gollery M, Van Breusegem F (2004)
Reactive oxygen gene network of plants. Trends Plant Sci 9:
490498
Morita S, Kaminaka H, Masumura T, Tanaka K (1999) Induction of rice
cytosolic ascorbate peroxidase mRNA by oxidative stress; the in-
volvement of hydrogen peroxide in oxidative stress signalling. Plant
Cell Physiol 40:417422
Murray R, Lucangeli C, Polenta G, Budde C (2007) Combined pre-
storage heat treatment and controlled atmosphere storage reduced
internal breakdown of Flavorcrestpeach. Postharvest Biol Technol
44:116121
Porat R, Pavoncello D, Ben-Hayyim G, Lurie S (2002) A heat treatment
induced the expression of a Na+ / H+ antiport gene (cNHX1) in citrus
fruit. Plant Sci 162:957963
Quan LJ, Zhang B, Shi WW, Li HY (2008) Hydrogen peroxide in plants:
a versatile molecule of the reactive oxygen species network. J of
Integr Plant Biol 50:218
Rui H, Cao S, Shang H, Jin P, Wang K, Zheng Y (2010) Effects of heat
treatment on internal browning and membrane fatty acid in loquat
fruit in response to chilling stress. J Sci Food Agric 90:15571561
Sapitnitskaya M, Maul P, McCollum GT, Guy CL, Weiss B, Samach A,
Porat R (2006) Postharvest heat and conditioning treatments activate
different molecular responses and reduce chilling injuries in grape-
fruit. J Exp Bot 57:29432953
Sato Y, Murakami T, Funatsuki H, Matsuba S, Saruyama H, Tanida M
(2001) Heat shockmediated APX gene expression and protection
against chilling injury in rice seedlings. J Exp Bot 52:145151
Shao X, Tu K (2012) Hot air treatment improved the chilling resistance of
loquat fruit under cold storage. J Food Process Preserv. doi:10.1111/
jfpp.12019
Shigenaga T, Yamauchi N, Funamoto Y, Shigyo M (2005) Effects of heat
treatment on an ascorbateglutathione cycle in stored broccoli
(Brassica oleracea L.) florets. Postharvest Biol Technol 38:152159
Tabata K, ba K, Suzuki K, Esaka M (2001) Generation and properties of
ascorbic aciddeficient transgenic tobacco cells expressing antisense
RNA for L-galactono-1, 4-lactone dehydrogenase. Plant J27:139148
Thomsen R, Slvsten CAE, Linnet TE, Blechingberg J, Nielsen AL
(2010) Analysis of qPCR data by converting exponentially related
Ct values into linearly related X0 values. J Bioinf Comput Biol 8:
885900
Tong Z, Gao Z, Wang F, Zhou J, Zhang Z (2009) Selection of reliable
reference genes for gene expression studies in peach using real-time
PCR. BMC Mol Biol 10:71
Vicente AR, Martnez GA, Chaves AR, Civello PM (2006) Effect of heat
treatment on strawberry fruit damage and oxidative metabolism
during storage. Postharvest Biol Technol 40:116122
Wang H, Zhang Z, Xu L, Huang X, Pang X (2012) The effect of delay
between heat treatment and cold storage on alleviation of chilling
injury in banana fruit. J Sci Food Agric 92:26242629
Wang K, Shao XF, Gong YF, Zhu Y, Wang HF, Zhang XL, Yu DD, Yu F,
Qiu ZY, Lu H (2013) The metabolism of soluble carbohydrates
related to chilling injury in peach fruit exposed to cold stress.
Postharvest Biol Technol 86:5361
Zhang L, Yu Z, Jiang L, Jiang J, Luo H, Fu L (2011) Effect of post-harvest
heat treatment on proteome change of peach fruit during ripening. J
Proteomics 74:11351149
Zhang YY, Han L, Ye ZB, Li HX (2013) Ascorbic acid accumulation is
transcriptionally modulated in high-pigment-1 tomato fruit. Plant
Mol Biol Rep. doi:10.1007/s11105-11013-10602-11103