Вы находитесь на странице: 1из 7

Plant Mol Biol Rep

DOI 10.1007/s11105-014-0699-z

ORIGINAL PAPER

Effects of Postharvest Hot Air Treatment on Gene Expression


Associated with Ascorbic Acid Metabolism in Peach Fruit
Ke Wang & Xingfeng Shao & Yifu Gong & Feng Xu &
Hongfei Wang

# Springer Science+Business Media New York 2014

Abstract The effect of postharvest heat treatment (37 C, expression of AsA metabolism accompanied by lower H2O2
3 days) on ascorbic acid (AsA) metabolism related to chilling levels following transfer to cold storage.
resistance in peach fruit stored at 5 C has been studied.
Chilling injury (CI) index and hydrogen peroxide (H2O2) Keywords Prunus persica . Heat treatment . Ascorbic acid .
levels as well as gene expression levels of mitochondrial L- Chilling injury
galactono-1, 4-lactone-dehydrogenase (GalLDH) related to
AsA synthetic metabolism, cytosolic ascorbate peroxidase
(APX), chloroplastic APX, peroxisomal APX1-3, cytosolic Introduction
monodehydroascorbate reductase (MDAR), chloroplastic
MDAR, chloroplastic dehydroascorbate reductase (DHAR), Peaches are of important nutritional and commercial value,
and chloroplastic glutathione reductase (GR) related to AsA and deteriorate quickly at ambient temperature. Cold storage
regeneration cycle metabolism were measured. Treated fruit has been confirmed as an effective and economic way to
maintained its initial H2O2 levels after heat conditioning, maintain quality and extend shelf life. However, physiological
showing significantly higher levels when compared with disorders, collectively designated as chilling injury (CI) symp-
non-heated fruit. However, during cold storage, heat-treated toms, are often observed in fruit during prolonged low-
fruit exhibited lower H2O2 levels than control fruit; heated temperature storage, appearing primarily as internal browning
fruit had the lowest CI index at the end of storage. The (Cao et al. 2010).
transcription levels of all of genes (GalLDH, APX, MDAR, By controlling rotting rate and preserving or even improv-
and DHAR), except for GR, sharply increased, and were ing the fruit flavor (Lurie 1998; Chen et al. 2012), heat
higher than those of control fruit, immediately after heat treatment, including hot air, hot water dips, and hot water
treatment. Then, transcription levels sharply declined to levels brushing, is effective and non-damaging physical protocols
lower than control fruit at 714 days. Little difference of gene to control CI on a number of chilling susceptible commodities
expression was observed in the end of storage. These results (Jin et al. 2009; Wang et al. 2012). In peaches, heat treatment
suggest that AsA metabolism gene expression was temporar- or combination with other treatments proves effective in re-
ily and sharply induced by higher H2O2 levels after heat ducing CI (Murray et al. 2007; Jin et al. 2009; Cao et al. 2010).
treatment, which might inhibit the elevation of H2O2 level at Resistance to CI via heat stress was closely linked with
the initial period of cold storage, and followed by lower genes oxidative-metabolic modifications of the heated tissue
(Mittler et al. 2004; Vicente et al. 2006; Wang et al. 2012).
Heat stress, for example, elicits the generation of reactive
K. Wang : X. Shao (*) : F. Xu : H. Wang
oxygen species (ROS), which are toxic molecules detrimental
Department of Food Science, Ningbo University, to plasma membrane, as well as the generation of signal
Ningbo 315211, Zhejiang, Peoples Republic of China molecules, which have been proposed to induce antioxidant
e-mail: shaoxingfeng@nbu.edu.cn systems to control its level (Knight and Knight 2001; Quan
et al. 2008). The functional membrane and efficient antioxi-
Y. Gong
Department of Biotechnology and Marine Science, Ningbo dant system facilitate the acquisition of CI tolerance. Albeit
University, Ningbo 315211, Zhejiang, Peoples Republic of China the effects of heat treatment have been investigated with
Plant Mol Biol Rep

integration in levels of transcripts (Sapitnitskaya et al. 2006), directly placed into cold storage at 5 C and 902 % relative
proteome (Zhang et al. 2011), enzyme, and metabolite (Lara humidity (RH) for 28 days. In the second group, heat treat-
et al. 2009; Lauxmann et al. 2013), most studies focused on ment (HT), fruits were treated at 37 C and 952 % RH for
fruit during either heat treatment or heat-treated fruit during 3 days in a 500-L heating chamber (HWS-500, Ningbo
their subsequent cold storage. Therefore, a comprehensive Jiangnan Instrument Factory, Ningbo, Peoples Republic of
successive monitoring experiment was necessary to uncover China) with thermostatic control and air circulation prior to
explicit alterations that occur during the transition from heat storage. The treated fruits were then stored (5 C and 902 %
stress to cold stress to allow us to identify the authentic RH) with the CK group.
effective factors and reveal the mechanisms governing ac- Slices of mesocarp (approximately 1 cm thick) were com-
quired chilling resistance via heat treatment. bined, frozen in liquid nitrogen, and stored at 80 C for
Ascorbic acid (AsA) metabolism is composed of the AsA further use. Three replicates, consisting of six fruits per repli-
regeneration cycle (ascorbic acidglutathione, AsA-GSH) and cate, were used for biochemical as well as molecular analysis,
biosynthesis pathway, and is an important mechanism to and the experiment was conducted twice.
reduce ROS. AsA is converted to dehydrogenascorbate and
monodehydrogenascorbate, functioning as an electron donor Measurements of the CI Index
via ascorbate peroxidase (APX). Dehydrogenascorbate reduc-
tase (DHAR), monodehydrogenascorbate reductase (MDAR), Postharvest, CI was assessed at 7-day intervals as the percent-
and glutathione reductase (GR) are responsible for age of internally browned area visible on the mesocarp surface
glutathione-dependent regeneration of AsA. L-galactono-1, following a cut parallel to the axial diameter. The severity of
4-lactone-dehydrogenase (GalLDH), as the last limiting en- internal browning in the peach fruit was evaluated on a scale
zyme of the AsA biosynthesis pathway with a substrate of L- of 04: 0 (no signs of internal browning), 1 (<5 %), 2 (5
galactono-1, 4-lactone, serves as an indicator of its capacity. It 25 %), 3 (2550 %), and 4 (>50 %). The results are expressed
has been widely held that AsA metabolism was linked with as the CI index, calculated using the following formula: CI
tolerance to CI in terms of negative control for ROS, particu- index=[(CI scale)(number of fruit at that CI)]/(4total
larly, hydrogen peroxide (H2O2) (Cao et al. 2009). Benefiting number of fruit in each group).
from enhancement of the H2O2-scavenging system, including
AsA metabolism, the tolerance to CI was increased in heated Measurements of the H2O2 Level
banana fruit (Ambuko et al. 2012). However, induction of
AsA metabolism has also been proposed (Morita et al. 1999; One gram of frozen tissue was homogenized with 5 ml ace-
Shigenaga et al. 2005). Therefore, investigation of AsA me- tone pre-chilled at 20 C, and the homogenates were centri-
tabolism in heated fruit under cold stress, and its relationship fuged for 20 min at 14000g at 4 C. Hydrogen peroxide
with H2O2, is warranted. No reports are available on the content was determined using a kit (Nanjing Jiancheng
effects of heat treatment and extended cold storage on expres- Company, China) following the manufacturers instructions,
sion patterns for AsA metabolism related to CI. and expressed as mol g1 FW.
In an effort to clarify the effects of heat treatment (37 C
for 3 days) on AsA metabolism and its contribution to chill- RNA Isolation and Real-time Quantitative PCR (RT-qPCR)
ing tolerance in peach fruit, we observed the development of
CI and levels of H 2 O 2 during cold storage at 5 C. Total RNA was obtained from 2 to 3 g peach fruit mesocarp
Meanwhile, transcription levels of related enzyme genes in- using cetyltrimethyl ammonium bromide protocol described
volved in AsA metabolism were also detected in conditioned by Meisel et al. (2005). RNA samples were treated with
fruit immediately after heat treatment and during subsequent RNase-free DNase (TaKaRa, Japan) to remove residual
cold storage. DNA according to the instruction manual. The final RNA
quality and quantity was assessed by measuring the
A260/280 and A260/240 ratios using a spectrophotometer
Materials and Methods (Nanodrop 1000, Thermal, USA). Integrity was tested by
electrophoresis on a 1 % agarose gel. RNA samples were
Plant Materials and Experiment Design stored at 80 C.
An aliquot (2 g) of total RNA was used for first-strand
Peach fruits (Prunus persica L. Batsch cv. Yulu) were har- cDNA synthesis with SYBR PrimerScrip RT-PCR kit II
vested at day 138 after full bloom in Fenghua, Zhejiang (TaKaRa, Japan), according to the manufacturers instruc-
Province, China. Uniform-sized fruits without any defects tions. All cDNA samples were stored at 20 C and diluted
were selected and randomly divided into two groups of 108 1:10 with RNase-free water before being used as template in
fruits. In the control group (CK), fruits were untreated and RT-qPCR analysis.
Plant Mol Biol Rep

3 race of genes encoding enzymes related to AsA metabo- Results and Discussion
lism were carried out based on the P. persica expressed
sequence tag (EST) database (TIGR Plant Transcript CI and H2O2 Level
Assemblies; http://plantta.tigr.org) (Childs et al. 2007). RT-
qPCR primer pairs corresponding to these genes were de- Compared with the control group, heat treatment at 37 C for
signed on the basis of 3-untranslated region using AlleleID 3 days delayed and reduced the CI index in peach fruit during
6.0 (Premier Biosoft International, Palo Alto, California, the cold storage. CI was expressed as internal browning
USA) to produce complicons of 100250 bp in size. Gene- (Fig 1). The H2O2 concentration of the control group slightly
specificity of these primer sets was tested according to the decreased during the first 3 days and then sharply increased to
method described by Wang (Wang et al. 2013). a peak at the 7th day before declining (Fig. 2). Heat treatment
RT-qPCR experiments were performed using Real Master did not alter the concentration of H2O2, which were main-
Mix (Takara), the SYBR Green kit II (Takara, Japan), and tained at similar level as harvest time. H2O2 concentrations
gene-specific primers in a total volume of 20 l, including were 20 % higher in heated fruit than those of control fruit
2 l of cDNA, 0.4 l of each primer (10 M), 10 l of Master immediately after treatment (p<0.01), but then declined to
Mix, and 7.2 l of RNase-free water. All experiments were levels lower than those of the control group once the fruits
performed in triplicate with the same thermal cycling condi- were transferred to cold storage (p<0.01). The treated group
tions, which consisted of pre-incubation at 95 C for 2 min showed 29 and 38 % lower H2O2 levels than the control at
followed by 40 cycles of 94 C for 15 s, 56 C for 20 s, and days 7 and 14, respectively.
72 C for 20 s. Potential genomic DNA contamination was The positive effects of heat treatment on alleviation of
checked with reverse-transcribed negative control. Reaction internal browning have been confirmed in a variety of
mix without template was also amplified to detect reagent chilling-sensitive fruit such as peaches (Jin et al. 2009; Cao
contamination. Translation elongation factor 2 (JQ732180.1) et al. 2010), loquats (Rui et al. 2010), citrus (Porat et al. 2002),
was selected for normalization of small differences in template bananas (Chen et al. 2008), and pomegranates (Mirdehghan
amounts of target genes for its high expression stability (Tong et al. 2007). H2O2, generated from dismutation, acts as an
et al. 2009). The expression was calculated as previously agent of oxidative stress. It shows the strongest toxicity among
described (Thomsen et al. 2010). The full list of primer se- ROS for its stability and hence diffusion, which leads to the
quences is shown in Table 1. development of CI by destroying membrane integrity and
initiating programmed cell death under cold stress. Some
Statistical Analysis researchers observed that heat-treated tissues had higher
H2O2 production than unheated tissues at the end of treatment
The experiments were conducted by a completely randomized or the end of storage, which benefited the delay of senescence
design. Standard errors (SE) were calculated by Microsoft in the broccoli florets (Shigenaga et al. 2005) and extended
Excel, and figures were made with OriginPro 8.6 G postharvest life of spinach leaves (Gmez et al. 2008). In the
(Microcal Software Inc., Northampton, MA, USA). The present study, heat-treated peach fruit also maintained a higher
means of low-temperature samples were separated by the least level of H2O2 than control immediately after treatment. In
significant difference (LSD) test (p=0.05) via SPSS software contrast to the control group, no peak value was found in the
(SPSS Inc., Chicago, IL, USA). treated fruit during cold storage. Meanwhile, the treated group

Table 1 Oligonucleotide sequences of primers used for real-time RT-PCR analysis

Gene Forward primer (53) Reverse primer (53) Amplicon size (bp)

Cytosolic APX GGACGAGGACGCTTTCTTTGC CAAGCCACCGCTGCCTTATTT 111


Peroxisomal APX1 ACTACGCAGTGTCACACAAGAAAC AGCAACGGCAACTCCCACAG 119
Chloroplastic APX AGATTCGGGCAGAGTATCAAGCTGT TAGGCAACCAATGCAACTCT 151
Peroxisomal APX2 TTCTACTAACACAGCAAAGGACAG AGGTAATTGGCTAAGCAAGTCTAC 138
Peroxisomal APX3 CTGGTTTTGATGGTCCTTGG GGAAGTTTCAACAGCCCCTC 100
Chloroplastic GR GCACGACATGGCTCCTGAAG CTGAAGCGGAAACCTACTCTACC 199
Cytosolic MDAR TTCTCAGGACGCACATTCGG GGGTTTCTTTCTAACAGTCACAGC 189
Chloroplastic MDAR CCGGGTCATCGTTATAGGCT CATGAGGGCATCTAAACAGC 141
Chloroplastic DHAR ATTCATCCAGCAGCCTCTACAG CGACGCCTGACGGAGTTG 110
Mitochondrial GalLDH TCATACGCCCATACCACCAG CCACTGAAGGATGCTTCTCA 247
TEF2 TGAAGGAGAGGGAAGGTGAAAG GGTGTGACGATGAAGAGTGATG 129
Plant Mol Biol Rep

Fruits exposed at 37 C for 3 days had varying degrees of


increase (from 1- to 24-fold) in levels of cytosolic APX
transcripts, followed by a sharp decline after the fruits were
transferred to 5 C (Fig. 3a), thereafter not being significantly
different from control fruit. Compared with harvest time, the
transcripts of chloroplastic APX (Fig. 3b) and peroxisomal
APX1-3 (Fig. 3ce) increased almost 3-, 2.5-, 1.8-, and 4-fold
after the treatment, respectively. However, they declined
sharply to levels lower than control fruit at days 7 and 14.
Transcripts of these genes were similar in heated and control
fruits after 14 days.
Though transcripts of GR (Fig. 4d) were not significantly
different from those of fruits at harvest, steep increases (ap-
proximately 4-fold) in levels of chloroplastic DHAR (Fig. 4a),
cytosolic MDAR (Fig. 4b), and chloroplastic MDAR (Fig. 4c)
Fig. 1 CI index in peach fruit under cold storage at 5 C after no
conditioning (CK) or conditioning of hot air treatment at 37 C for 3 days transcription were observed in fruits just after heat treatment.
(HT). Each value is the mean of three replicate samplesSE. Vertical bars Similar to APXs, these levels of transcripts were also signif-
represent the standard errors of the means icantly (p<0.01) lower than those of control fruit, during 7
14 days, with almost no higher levels afterwards.
exhibited significantly lower levels of H2O2, which is similar AsA-GSH cycle, including APX, GR, DHAR, and
to the results from strawberries (Vicente et al. 2006) and MDAR, has been proposed to contribute to the scavenging
loquats (Shao and Tu 2012). Lower levels of relative conduc- of H2O2 to avoid its overproduction. However, H2O2 also
tivity and malondialdehyde, reflecting the deterioration of operates as a signal, secondary messenger, and regulator of
membrane by ROS, were also observed in heated fruit during some gene expression for the activation of stress responses
cold storage (Chen et al. 2008; Mirdehghan et al. 2007). These and defense pathways (Knight and Knight 2001; Quan et al.
data indicate that peaches benefit from heat treatment, which 2008). In rice seedlings, heat treatment elevated levels of APX
assists in coping with oxidative stress. and GR, accompanied by enhancement of H2O2 content,
whereas heat-enhanced levels of APX and GR were blocked
after the inhibition of H2O2 accumulation (Chou et al. 2012),
The Transcripts of Genes Encoding Enzymes which indicates the involvement of H2O2 in induction of AsA
in AsA-GSH Cycle metabolism under heat stress. Shigenaga et al. (2005) also
suggested that the higher H2O2 generated by the heat treat-
Accumulated H2O2 needs to be scavenged promptly by effec- ment might induce activation of enzymes related to the AsA-
tive AsA-GSH cycle, which is the hub of antioxidant system. GSH cycle in broccoli florets. Sato et al. (2001) reported that
elevated cytosolic APX mRNA levels under heat stress en-
hanced chilling tolerance for rice seedlings, perhaps associat-
ed with heat-shock cis-element located in the promoter for
cytosolic APX. The heat-shock element is a functional com-
ponent of the Arabidopsis APX1 gene promoter (Sato et al.
2001). Some regulatory elements of APX has also been re-
ported in Beet (Beta vulgaris ) (Dunajska-Ordak et al. 2013).
Our research found a temporary and sharp up-regulation in
transcript levels of APXs (Fig. 3), MDARs, and DHAR
(Fig. 4). These effects may be induced by the higher H2O2
concentrations at the end of treatment. The higher activity of
AsA-GSH cycle could play important role in scavenging
H2O2, which contributed to reducing the accumulation of
H2O2 at the initial time of cold stress (Fig. 2). That may be
the reason why no peak value of H2O2 in treated fruit could be
observed in the first stage of cold storage. After transferred to
Fig. 2 Effect of hot air treatment at 37 C for 3 days on H2O2 content in
refrigerated storage up to day 14, the treated fruit showed
peach fruit under cold storage at 5 C. Values are expressed as the meanSE lower transcription of the AsA-GSH cycle than control fruit,
of triplicate assays. Vertical bars represent the standard errors of the means which was concomitant with lower levels of H2O2.
Plant Mol Biol Rep

Fig. 4 Transcript levels of reductase genes for AsA-GSH cycle in peach


fruit treated at 37 C for 3 days and subsequent cold storage at 5 C: a
cytosolic MDAR; b choloroplastic MDAR; c choloroplastic DHAR; d
choloroplastic GR. Values are expressed as the meanSE of triplicate
assays. Vertical bars represent the standard errors of the means

The Transcripts of GalLDH

Fig. 3 Changes in the transcript level of APX genes in peach fruit treated Heat treatment-induced transcripts of GalLDH showed 1.2-
at 37 C for 3 days and subsequent cold storage at 5 C. ae cytosolic
fold higher levels than those of the control group (Fig. 5).
APX, choloroplastic APX, peroximal APX1-3
After transfer of fruit to cold storage, GalLDH transcripts
gradually declined in heated fruit, and were lower than the
Plant Mol Biol Rep

period of cold stress. During cold storage, lower potency of


AsA metabolism was accompanied by lower H2O2 concen-
trations in treated fruit.

Acknowledgement This study was sponsored by the National Science


Foundation of China (No. 31000825), the Natural Science Foundation of
Zhejiang Province (No. Y3090537), and the K. C. Wong Magna Fund at
Ningbo University.

References

Fig. 5 Changes in the transcript level of mitochondrial GalLDH of peach


fruit treated at 37 C for 3 days and subsequent cold storage at 5 C. Each Alhagdow M, Mounet F, Gilbert L, Nunes-Nesi A, Garcia V, Just D, Petit
value is the mean of three replicate samplesSE. Vertical bars represent J, Beauvoit B, Fernie AR, Rothan C (2007) Silencing of the mito-
the standard errors of the means chondrial ascorbate synthesizing enzyme L-galactono-1, 4-lactone
dehydrogenase affects plant and fruit development in tomato. Plant
Physiol 145:14081422
control group at days 7 and 14 (p<0.01). No significant Ambuko J, Zanol GC, Sekozawa Y, Sugaya S, Gemma H (2012)
difference was observed between two groups thereafter. Reactive oxygen species (ROS) scavenging in hot air precondition-
ing mediated alleviation of chilling injury in banana fruits. J Agric
GalLDH, acting as terminal step of AsA biosynthesis in Sci 5:319
plant, has been proven to correlate with AsA levels in tobacco Bartoli CG, Guiamet JJ, Kiddle G, Pastori GM, Di Cagno R, Theodoulou
(Kato and Esaka 1999) and Arabidopsis (Tabata et al. 2001). FL, Foyer CH (2005) Ascorbate content of wheat leaves is not
However, overexpression and silencing of a GalLDH gene did determined by maximal L-galactono-1, 4-lactone dehydrogenase
(GalLDH) activity under drought stress. Plant Cell Environ 28:
not change the level of AsA in wheat (Bartoli et al. 2005) and 10731081
tomato leaves (Alhagdow et al. 2007). Negative regulation of Cao SF, Hu ZC, Zheng YH, Lu BH (2010) Synergistic effect of heat
AsA content by GalLDH in transcriptional level might exist in treatment and salicylic acid on alleviating internal browning in cold-
tomato mutants (Zhang et al. 2013). Notably, silencing of stored peach fruit. Postharvest Biol Technol 58:9397
Cao SF, Zheng YH, Wang KT, Jin P, Rui HJ (2009) Methyl jasmonate
GalLDH in tomatoes caused the fluctuations of AsA redox reduces chilling injury and enhances antioxidant enzyme activity in
state and significant changes of mitochondrial function, and postharvest loquat fruit. Food Chem 115:14581463
induced stress-related genes (Alhagdow et al. 2007). GalLDH Chen JY, He LH, Jiang YH, Wang Y, Joyce DC, Ji ZL, Lu WJ (2008)
located in mitochorial complex I, in Arabidopsis, was modu- Role of phenylalanine ammonialyase in heat pretreatment-induced
chilling tolerance in banana fruit. Physiol Plant 132:318328
lated by the activity of electron transport chain (Millar et al. Chen M, Jiang Q, Yin XR, Lin Q, Chen JY, Allan AC, Xu CJ, Chen KS
2003). Therefore, it is conceivable that GalLDH may have (2012) Effect of hot air treatment on organic acid- and sugar-
multiple roles in fruit exposure to abiotic stress except its links metabolism in Ponkan (Citrus reticulata) fruit. Sci Hortic 147:
with AsA biosynthesis. Intriguingly, synergetic changes of 118125
Childs KL, Hamilton JP, Zhu W, Ly E, Cheung F, Wu H, Rabinowicz PD,
GalLDH transcripts with AsA cycling pathway were observed Town CD, Buell CR, Chan AP (2007) The TIGR plant transcript
in peach fruit during heat treatment and cold storage. The assemblies database. Nucleic Acids Res 35:D846851
influence of heat treatment on the cycling and synthesis path- Chou TS, Chao YY, Kao CH (2012) Involvement of hydrogen peroxide
way showed high consistency, which indicates that coordinat- in heat shock-and cadmium-induced expression of ascorbate perox-
idase and glutathione reductase in leaves of rice seedlings. J Plant
ed modulation of AsA cycling and synthesis pathways play an Physiol 169:478486
important role in response to heat and cold stress. Dunajska-Ordak K, Skorupa-Kaput M, Kurnik K, Tretyn A, Tyburski J
(2013) Cloning and expression analysis of a gene encoding for
ascorbate peroxidase and responsive to salt stress in beet (Beta
vulgaris). Plant Mol Biol Rep. doi:10.1007/s11105-11013-10636-
Conclusion 11106
Gmez F, Fernndez L, Gergoff G, Guiamet JJ, Chaves A, Bartoli CG
In this study, we investigated the effect of hot air on AsA (2008) Heat shock increases mitochondrial H2O2 production and
metabolism related to CI in peaches. Heat-treated fruit showed extends postharvest life of spinach leaves. Postharvest Biol Technol
49:229234
a lower sensitivity to chilling stress compared with control Jin P, Zheng Y, Tang S, Rui H, Wang CY (2009) A combination of hot air
fruit, which might be attributed to lower level of H2O2. After a and methyl jasmonate vapor treatment alleviates chilling injury of
3-day heat treatment, AsA biosynthesis and regeneration cycle peach fruit. Postharvest Biol Technol 52:2429
metabolism in fruit were dramatically induced, significantly Kato N, Esaka M (1999) Changes in ascorbate oxidase gene expression
and ascorbate levels in cell division and cell elongation in tobacco
higher than those in control fruit and concomitant with higher cells. Physiol Plant 105:321329
level of H2O2, which contributed to reducing the accumula- Knight H, Knight MR (2001) Abiotic stress signalling pathways: speci-
tion of H2O2 levels and led to no peak value at the initial ficity and cross-talk. Trends Plant Sci 6:262267
Plant Mol Biol Rep

Lara MV, Borsani J, Budde CO, Lauxmann MA, Lombardo VA, Murray Rui H, Cao S, Shang H, Jin P, Wang K, Zheng Y (2010) Effects of heat
R, Andreo CS, Drincovich MF (2009) Biochemical and proteomic treatment on internal browning and membrane fatty acid in loquat
analysis of Dixilandpeach fruit (Prunus persica) upon heat treat- fruit in response to chilling stress. J Sci Food Agric 90:15571561
ment. J Exp Bot 60:4315 Sapitnitskaya M, Maul P, McCollum GT, Guy CL, Weiss B, Samach A,
Lauxmann MA, Borsani J, Osorio S, Lombardo VA, Budde CO, Porat R (2006) Postharvest heat and conditioning treatments activate
Bustamante CA, Monti LL, Andreo CS, Fernie AR, different molecular responses and reduce chilling injuries in grape-
Drincovich MF (2013) Deciphering the metabolic pathways fruit. J Exp Bot 57:29432953
influencing heat and cold responses during postharvest phys- Sato Y, Murakami T, Funatsuki H, Matsuba S, Saruyama H, Tanida M
iology of peach fruit. Plant Cell Environ. doi:10.1111/pce. (2001) Heat shockmediated APX gene expression and protection
12181 against chilling injury in rice seedlings. J Exp Bot 52:145151
Lurie S (1998) Postharvest heat treatments. Postharvest Biol Technol 14: Shao X, Tu K (2012) Hot air treatment improved the chilling resistance of
257269 loquat fruit under cold storage. J Food Process Preserv. doi:10.1111/
Meisel L, Fonseca B, Gonzlez S, Baeza-Yates R, Cambiazo V, Campos jfpp.12019
R, Gonzlez M, Orellana A, Retamales J, Silva H (2005) A rapid Shigenaga T, Yamauchi N, Funamoto Y, Shigyo M (2005) Effects of heat
and efficient method for purifying high quality total RNA from treatment on an ascorbateglutathione cycle in stored broccoli
peaches (Prunus persica) for functional genomics analyses. Biol (Brassica oleracea L.) florets. Postharvest Biol Technol 38:152159
Res 38:8388 Tabata K, ba K, Suzuki K, Esaka M (2001) Generation and properties of
Millar AH, Mittova V, Kiddle G, Heazlewood JL, Bartoli CG, ascorbic aciddeficient transgenic tobacco cells expressing antisense
Theodoulou FL, Foyer CH (2003) Control of ascorbate synthesis RNA for L-galactono-1, 4-lactone dehydrogenase. Plant J27:139148
by respiration and its implications for stress responses. Plant Physiol Thomsen R, Slvsten CAE, Linnet TE, Blechingberg J, Nielsen AL
133:443447 (2010) Analysis of qPCR data by converting exponentially related
Mirdehghan S, Rahemi M, Martnez-Romero D, Guilln F, Valverde J, Ct values into linearly related X0 values. J Bioinf Comput Biol 8:
Zapata P, Serrano M, Valero D (2007) Reduction of pomegranate 885900
chilling injury during storage after heat treatment: role of poly- Tong Z, Gao Z, Wang F, Zhou J, Zhang Z (2009) Selection of reliable
amines. Postharvest Biol Technol 44:1925 reference genes for gene expression studies in peach using real-time
Mittler R, Vanderauwera S, Gollery M, Van Breusegem F (2004) PCR. BMC Mol Biol 10:71
Reactive oxygen gene network of plants. Trends Plant Sci 9: Vicente AR, Martnez GA, Chaves AR, Civello PM (2006) Effect of heat
490498 treatment on strawberry fruit damage and oxidative metabolism
Morita S, Kaminaka H, Masumura T, Tanaka K (1999) Induction of rice during storage. Postharvest Biol Technol 40:116122
cytosolic ascorbate peroxidase mRNA by oxidative stress; the in- Wang H, Zhang Z, Xu L, Huang X, Pang X (2012) The effect of delay
volvement of hydrogen peroxide in oxidative stress signalling. Plant between heat treatment and cold storage on alleviation of chilling
Cell Physiol 40:417422 injury in banana fruit. J Sci Food Agric 92:26242629
Murray R, Lucangeli C, Polenta G, Budde C (2007) Combined pre- Wang K, Shao XF, Gong YF, Zhu Y, Wang HF, Zhang XL, Yu DD, Yu F,
storage heat treatment and controlled atmosphere storage reduced Qiu ZY, Lu H (2013) The metabolism of soluble carbohydrates
internal breakdown of Flavorcrestpeach. Postharvest Biol Technol related to chilling injury in peach fruit exposed to cold stress.
44:116121 Postharvest Biol Technol 86:5361
Porat R, Pavoncello D, Ben-Hayyim G, Lurie S (2002) A heat treatment Zhang L, Yu Z, Jiang L, Jiang J, Luo H, Fu L (2011) Effect of post-harvest
induced the expression of a Na+ / H+ antiport gene (cNHX1) in citrus heat treatment on proteome change of peach fruit during ripening. J
fruit. Plant Sci 162:957963 Proteomics 74:11351149
Quan LJ, Zhang B, Shi WW, Li HY (2008) Hydrogen peroxide in plants: Zhang YY, Han L, Ye ZB, Li HX (2013) Ascorbic acid accumulation is
a versatile molecule of the reactive oxygen species network. J of transcriptionally modulated in high-pigment-1 tomato fruit. Plant
Integr Plant Biol 50:218 Mol Biol Rep. doi:10.1007/s11105-11013-10602-11103