Вы находитесь на странице: 1из 14

Amino acid

DNA, RNA, TRANSCRIPTION, TRANSLATION & PROTEIN SYNTHESIS

Learning Objectives

Define the terms gene,DNA, RNA


Describe transcription ,Translation
Over view Protein synthesis.

Simple Facts About Genes

The information for development and specific function is stored in genes


A gene is portion of genetic information definable according to the
structure and functions
Genes lie on Chromosomes in the nuclei of the cells
Chromosomes are made up of long chains of DNA and proteins

Deoxyribonucleic Acid

Components of DNA
Sugar
Ribose

Nitrogenous Bases
Amino acid

Phosphate Group
Ester bond
Anhydride bond

Nucleoside and Nucleotides

Requirements for Transcription

Nucleotide triphosphates

ATP
GTP
CTP

UTP
Coding strand of DNA
Energy
Enzymes (RNA Polymearse)
Factors

Steps of Transcription in Prokaryotes


Initiation
Amino acid

Core enzyme + factor = holoenzyme


Pribnow Box (TATAAT) at -10
-35 sequence
Elongation
Only one enzyme
Reads 3 5
Makes 5 3
Termination
Rho () dependent & independent

Palindromic sequence
Definitions
Palindromic sequence:
A DNA sequence whose 5'-to-3' sequence is identical on each DNA strand. The
sequence is the same when one strand is read left to right and the other strand is
read right to left

ACTTGCAAGTTGAACGTTCA

RNA Polymerases and Genes

Steps of Transcription in Eukaryotes

Euchromatin (histone acetylation)


Heterochromatin (DNA methylation)
Initiation
Hogness Box (TATAAT) at -25
CG box (cis-acting genetic elements)
CAAT Box -70 - -80 sequence
Enhancers and Inhibitors
Elongation
Reads 3 5
Amino acid

Makes 5 3
Termination

Typical Human Structural Gene

Typical Human Structural Gene


Transcription initiation Transcription termination

Non Coding
strand Exon 1 Exon 2 Exon 3
5 3
Promoter Intron 1 Intron 2
Region Translation Translation
initiation termination
codon (ATG) codon (TAA)

3 5
Coding strand
Amino acid

Step One:

RNA Polymerase unwinds and unzips the DNA double helix.

Step Two:

RNA polymerase adds on free-floating nucleotides

5 3 polymerizing

No proof reading

RNA Polymerase

An enzyme which catalyze transcription

Sigma factor + polymerase = Holoenzyme


Binds to the promoter sequence on the DNA strand

Differs from DNA Polymerase

Doesnt proofread the nucleotide sequence whereas DNA does


Amino acid

Step Three:

RNA detaches from the template DNA

Matured RNA

Clinical Consequences

5 capping and 3 poly A tail


Amino acid

Defective movement

No protein
Abnormal splicing

SLE Clinical Consequences

Non addition of CCA sequence at 3 end

No activation of proteins
No charging of tRNA
No protein formation
Amazing

New mRNA is identical to the non-coded strand of DNA

Mechanism of Translation

Translation Generates Proteins According to the Instructions

mRNA is translated by moving through a groove in the ribosome.


The ribosome is a multicomponent entity, composed of ribosomal RNAs and 78 different
proteins.
It is organized in two subunits:

A 40S and a 60S subunit.

Phases of Translation

Translation is divided into three stages: initiation, elongation and termination.

Initiation
Amino acid

brings the mRNA to the ribosome and uses a large number of initiation
factors to assemble the ribosome and begin translation.

Elongation
then continues to assemble amino acids to form the protein.

Termination
stops the addition of further amino acids and terminates the process

Protein synthesis
This is a molecule of messenger RNA.
It was made in the nucleus by
transcription from a DNA molecule.
codon
A U G G G C U U AAA G C A G U G C A C G U U

mRNA molecule
Amino acid

A ribosome on the rough endoplasmic


reticulum attaches to the mRNA
molecule.

ribosome

A U G G G C U U AAA G C A G U G C A C G U U

Amino acid

tRNA molecule

A transfer RNA molecule arrives.


It brings an amino acid to the first three
bases (codon) on the mRNA.
anticodon The three unpaired bases (anticodon)
on the tRNA link up with the codon.
UAC
A U G G G C U U AAA G C A G U G C A C G U U
Amino acid

Peptide bond

A peptide bond forms between the


two amino acids.

A U G G G C U U AAA G C A G U G C A C G U U
Amino acid

The first tRNA molecule releases its amino


acid and moves off into the cytoplasm.

A U G G G C U U AAA G C A G U G C A C G U U

The ribosome moves along the mRNA to


the next codon.

A U G G G C U U AAA G C A G U G C A C G U U
Amino acid

Another tRNA molecule brings


the next amino acid into place.

A U G G G C U U AAA G C A G U G C A C G U U
Amino acid

A peptide bond joins the second


and third amino acids to form a
polypeptide chain.

A U G G G C U U AAA G C A G U G C A C G U U

The process continues.

The polypeptide chain gets longer.

This continues until a termination


(stop) codon is reached.

The polypeptide is then complete.

A U G G G C U U AAA G C A G U G C A C G U U

References
Harper Biochemistry
Lippincott's Biochemistry
Amino acid

Kaplan Biochemistry & medical Genetics