Supplementary Information

Radiation induces senescence and a bystander effect through metabolic

alterations

En-Chi Liao1#, Ying-Ting Hsu1#, Qiu-Yu Chuah1, Yi-Jang Lee2, Jing-Yi Hu1, Tsui-Chin
Huang3, Pei-Ming Yang3* and Shu-Jun Chiu1,4*

1
Department of Life Sciences, Tzu Chi University, Hualien, Taiwan
2
Department of Biomedical Imaging and Radiological Sciences, National Yang-Ming
University, Taipei, Taiwan
3
The Ph.D. Program for Cancer Biology and Drug Discovery, College of Medical
Science and Technology, Taipei Medical University, Taipei, Taiwan
4
Institute of Radiological Sciences, Tzu Chi Technology College, Hualien, Taiwan

*Correspondence:
S-J Chiu, Department of Life Sciences, Tzu Chi University, 701, Section 3, Chung-
Yang Road, Hualien 970, Taiwan; Phone: +886-3-8565301 ext. 2631; FAX: +886-3-
8572526; E-mail: chiusj@mail.tcu.edu.tw; P-M Yang, The Ph.D. Program for Cancer
Biology and Drug Discovery, College of Medical Science and Technology, Taipei
Medical University, 250, Wu-Hsing Street, Taipei 11031, Taiwan; Phone: +886-2-
27361661 ext. 7629; FAX: +886-2-26558562; E-mail: yangpm@tmu.edu.tw

#
These authors contributed equally to this work.

Supplementary information includes:

1. Supplementary Materials and Methods
2. Legends to Supplementary Figures
Supplementary Materials and Methods

Two-dimensional (2D) gel electrophoresis analysis

2D gel electrophoresis was performed with three biological replicates for each
group using isoelectric focusing (IEF) as the first dimension (IPGphor, Amersham
Biosciences, Uppsala, Sweden) followed by sodium dodecyl sulfate polyacrylamide
gel electrophoresis (SDS-PAGE) (Bio-Rad Protean II xi cell, Hercules, CA) as the
second dimension. For the 2DGE experiment, 100 g of the protein pellet was mixed
with 350 l rehydration solution containing 7 M urea, 2 M thiourea, 2% 3-[(3-
cholamidopropyl) dimethylammonio] propanesulfonate, 20 mm dithiotreitol, and
0.5% IPG buffer. IEF was run using a stepwise incremental voltage program: 30 V for
16 h, 500 V for 1 h, 1000 V for 1 h, and 8000 V for 4 h, with a total power of 34 kV-
hr. After IEF, the strips were subjected to a two-step equilibration in equilibration
buffers containing 6 M urea, 30% glycerol, 2% SDS, and 50 mm Tris-HCl (pH 8.8)
containing 1% w/v dithiotreitol for the first step or 2.5% w/v iodoacetamide for the
second step. The strips were then transferred onto the second-dimensional SDS-PAGE
and run using 1.0-mm thick 12% polyacrylamide gels at 15 C. The gels were fixed in
water containing 40% ethanol and 10% acetic acid overnight and then incubated in a
buffer solution containing 30% ethanol, 6.8% w/v sodium acetate, and 0.312% w/v
sodium thiosulfate for 30 min. After three washes in water for 5 min each, the gels
were stained in a 0.25% w/v silver nitrate solution containing 0.02% formaldehyde for
30 min. The gels were developed for 10 min in a solution consisting of 2.5% sodium
carbonate and 0.01% formaldehyde. An acetic acid solution (5% v/v) was used to stop
the development, and the stained gels were then washed three times in water for 5 min
each. The stained gels were scanned using an ImageScanner operated by the software
LabScan 3.00 (Amersham Biosciences). Intensity calibration was performed using an
intensity step-wedge before gel image capture. The image analysis was performed
using the software PDQuest. The smallest spot and the most significant cluster are
first defined. Then, the software uses autodetection to identify the protein spots. After
detection equilibratio, approximately one thousand detected spots remained on each
of the two gels. These spots were then matched between the two gels, and the matched
spot quality was checked manually. After the confirmation of the matched sets, the
LOWESS method was used to quantify the difference between the protein abundance
one the two gels. Finally, the spot clusters with greater than two fold difference were
selected for further analyses.

Mass spectrometry
NanoLC-MS/MS analysis was performed using an integrated nanoLC-MS/MS
system (QSTAR XL) comprising compoa LC Packings NanoLC system with an
autosampler and a QSTAR XL Q-Tof mass spectrometer (AB Sciex) fitted with a
nano-LC sprayer. The injected samples were first trapped and desalted on a LC-
Packings PepMap C18-Precolumn Cartridge (5 m, 30 m I.D. x 5mm; Dionex,
Sunnyvale, CA, USA). Next, the peptides were eluted from the precolumn and
separated on an analytical LC-Packings PepMap C18 column (3m, 15 cm x 75 m
I.D.) with an inline connection to the mass spectrometer. The procedure used a 200
nl/min flow rate and a 45 min gradient of 5% to 60% acetonitrile in 0.1% formic acid.
The online nanoESI-MS survey scan and data-dependent acquisition of CID MS/MS
were fully automated and synchronised with the nanoLC runs controlled by the
software AnalystQS. Prior to the online analysis, the nanoLC sprayer source
parameters were tuned and optimised. Argon was used as the collision gas for CID
MS/MS. The product ions generated from the fragmentation of the doubly charged
renin molecular ion were used for calibration. For routine analysis of protein
identification, the 1 s survey scans were acquired over a mass range of 400 1600
m/z, and a maximum of 10 concurrent MS/MS acquisitions were triggered for the 2+,
3+ and 4+ charged precursors detected at an intensity greater than the predefined
threshold. Each MS/MS acquisition were completed and returned to the survey scan
when the precursor intensity was less than the predefined threshold or after a
maximum of 6 s acquisitions. After the data acquisition, the individual MS/MS
spectra acquired for each of the precursors within a single LC run were combined and
output as a single Mascot-searchable peak list file. The peak list files were used to
query the Swiss-Prot database using the Mascot program with the following
parameters: peptide mass tolerance, 250 ppm; MS/MS ion mass tolerance, 0.25 Da;
up to one missed cleavage was permitted. Only hits defined as significant by the
Mascot probability analysis were considered initially. In addition, the threshold of
acceptance was arbitrarily set as a minimum total score of 20 with a peptide match of
ion score preater than 20.

Realtime PCR
The DNA sequence was evaluated using the Primer Express software and the
following primers: human PSMD9-F (AAGCCCGAGCTGCCTTAACT) and
PSMD9R (TGGATAATACCCGACTGCATGTC). Total RNA was extracted using the
TRIZOL reagent (Invitrogen). RNA samples were quantified using a NanoDrop ND-
1000 (Thermo Scientific). RNA samples were reverse-transcribed for 120 min at 37 oC
with the High Capacity Reverse Transcription Kit according to the suppliers standard
protocol (Applied Biosystems). Quantitative PCR was performed using the following
conditions: 10 min at 95oC and 40 cycles of 15 sec at 95oC and 1 min at 60oC. The 2X
Power SYBER Green PCR Master Mix (Applied Biosystems) and 200 nM of forward
and reverse primers were used. Each assay was performed on an Applied Biosystems
7300 Real-Time PCR system in triplicate, and the fold-changes in expression were
derived using the comparative CT method.
Legends to Supplementary Figures

Fig. S1. Proteomic study of irradiated securin-depleted MDA-MB-231-2A human

breast cancer cells. (A) The MDA-MB-231-2A cells were exposed to 6 Gy radiation.
After 4 h of recovery, total cell extracts were prepared for 2D gel electrophoresis. Two
down-regulated (blue) and eight up-regulated (red) spots were selected for further
validation by mass spectrometry. (B) The mRNA expression of identified proteins was
quantified by readtime Q-PCR analysis.

Fig. S2. Effect of radiation on GAPDH and LDH enzymatic activity in MDA-
MB-231-2A cells. The MDA-MB-231-2A cells were exposed to 6 Gy radiation
followed by various recovery periods. The GAPDH (A) and LDH (B) enzymatic
activity was measured by colorimetric assay kits as described in Materials and
Methods. p<0.01(**) indicates significant differences compared to time zero.

Fig. S3. Effect of radiation on glycolysis-related protein expression in parental

MDA-MB-231 cells. The MDA-MB-231 cells were exposed to 6 Gy radiation
followed by various recovery periods. The protein expression was examined by
western blot analyses.

Fig. S4. Radiation induced metabolic alterations in MCF-7 cells. The MCF-7 cells
were exposed to 6 Gy radiation followed by various recovery periods. The securin
expression (A) and AMPK phosphorylation (C) were examined by western blot
analyses. The extracellular lactate concentration (B) was examined by protocols
described in the Materials and Methods. p<0.01(**) indicates significant differences
compared to time zero. In (D), MCF-7 cells were pretreated with 5, 10 or 20 M
compound C for 2 h, and then exposed to 6 Gy radiation. After a 8-h recovery period,
The AMPK phosphorylation was examined by western blot analyses.

Fig. S5. Effect of compound C on MCT1 expression in MDA-MB-231-2A cells.

The MDA-MB-231-2A cells were treated with 5-20 M compound C for 10 h. The
protein expression was examined by western blot analyses.

Fig. S6. Effect of radiation on NF-B signalling pathway in MCF-7 cells. (A)
MCF-7 cells were exposed to 6 Gy radiation followed by various recovery periods.
The protein expression was examined by western blot analyses. (B) MCF-7 cells were
pretreated with 5-20 M compound C for 2 h and then exposed to 6 Gy radiation.
After an 8-h recovery period, the protein expression was examined by western blot
analyses.

Fig. S7. Effect of BMS-345541 on the LDH enzymatic activity in MDA-MB-231-

2A cells. MDA-MB-231-2A cells were pretreated with 5 or 10 M BMS-345511 for 2
h and then exposed to 6 Gy radiation. After a 24-h recovery period, the LDH
enzymatic activity was examined by protocols described in the Materials and
Methods. p<0.01(**) indicates significant differences between control and irradiated
cells. p<0.05(#) and p<0.01(##) indicates significant differences between inhibitor-
treated and untreated cells.