Вы находитесь на странице: 1из 45

{ 78 } O grande livro da oliveira e do azeite { 79 } O grande livro da oliveira e do azeite

3
Evoluo
tecnolgica
em Olivicultura
{ 80 } O grande livro da oliveira e do azeite { 81 } O grande livro da oliveira e do azeite

Evoluo Tecnolgica propriamente dita, representando cada uma delas um ob- em que a produtividade no para de subir medida que
da Olivicultura jectivo cultural. Assim elas podiam aparecer associadas a novas tecnologias vo sendo utilizadas, proporcionando
zonas de horta ou defesas mais ou menos protegidas, bor- custos de produo unitrios cada vez menores. Aqui j
Prof. J. Mota-Barroso; Prof dejando caminhos ou dividindo parcelas e propriedades, existe uma preocupao de cultura associando as rvo-
Peas, Prof. Dias, Prof. Pinheiro, Podiam ainda ser o resultado da enxertia de zambujeiros res de forma a facilitar as diversas intervenes sobretudo
Prof Peixe. selvagens aproveitando a sua implantao natural. De co- ao solo, procedendo-se ao seu alinhamento. Neste sistema
mum este sistema tinha o facto de possuir uma reduzida de cultivo a utilizao do solo em geral exclusiva, embora
densidade, em geral menos de 70 rvores por ha, no re- nem sempre, existindo a preocupao em realizar opera-
Tecnologias culturais presentar uma utilizao exclusiva do solo, estando asso- es de manuteno do solo, para combater as infestantes,
A evoluo dos sistemas de conduo da oliveira ciado a outras utilizaes mais ou menos intensivas con- em geral mobilizaes do tipo gradagens ou escarificaes
Embora na literatura clssica sobre esta espcie lenho- soante as regies, e no ser alvo de grandes cuidados na superficiais, e a poda das arvores j obedece a um plano
sa a terminologia de sistemas de conduo no seja mui- sua manuteno. A nica operao cultural utilizada para prvio, em que quer a forma da copa, altura do tronco, in-
to comum, pensamos que a sua utilizao se justifica ple- alem da colheita dos frutos, era a poda da copa, em geral tervalo entre intervenes est estabelecido. A utilizao
namente pela analogia com o que se passa em outras cul- drstica, reduzindo a copa ao mnimo possivel, e mesmo de factores de produo ainda muito reduzida, sendo a
turas lenhosas, bem como por facilitar bastante a compre- assim a sua pratica dependia mais da oportunidade ou ne- pratica da fertilizao por exemplo uma ateno nem sem-
enso da maioria das prticas e tcnicas culturais utiliza- cessidade de utilizao da sua lenha que dum plano pr- pre respeitada, mas onde a mecanizao das mobilizaes
das ao longo dos tempos e que geralmente se justificam vio e justificado da operao. Mais recentemente estas r- se comeou a generalizar medida que a oferta de meios
em funo de uma perspectiva mais integrada da cultura. vores mesmo dispersas comearam a receber alguns tra- foi aparecendo no mercado e variando tambm muito com
Assim entendemos por sistema de conduo no apenas a tamentos fitossanitrios ocasionais, mas devido sua im- a dimenso das exploraes. A utilizao de animais como
forma da copa dada s rvores, mas todas as componentes plantao muitas vezes em zonas inacessveis e monta- nica fora de traco nos trabalhos em exploraes mais
do sistema de cultivo que se consideram mais ou menos fi- nhosas a grande maioria foi resistindo sem qualquer cui- pequenas e familiares chegou at ao final do sculo XX. A
xos durante a vida das mesmas, como o compasso, a orien- dado a esse nvel. Grande parte deste olival est hoje aban- utilizao da mo de obra em todas as operaes era a re-
tao, a armao e manuteno do solo, o sistema de poda, donado pela sua baixa produtividade e inviabilidade eco- gra, na poda e queima da respectiva lenha que ocorria em
a altura e forma da copa e o tipo de rega e fertilizao entre nmica, e constitui uma reserva botnica e gentica apre- geral de sete em sete anos, na colheita, nos poucos trata-
outros. De facto embora a renovao da copa na Oliveira civel, sendo ainda um manancial aprecivel para a utili- mentos fitossanitrios efectuados utilizando pulverizado-
seja uma condio indispensvel manuteno da sua boa zao de velhas rvores transplantadas para novos jardins res de jacto manejados a partir do solo.
produo, porque produz apenas em jovens ramos de um e parques. As variedades mais comuns neste olival so rs- Este olival estava em geral associado pequena pro-
ano de idade, a sua elevada rusticidade e facilidade de ci- ticas e resistentes s pragas e doenas mais comuns, es- priedade, mesmo em regies de grande propriedade como
catrizao da sua madeira, permitem muitas e diversas es- tando muito bem adaptadas a cada regio. Em Portugal a o Alentejo, e muitas vezes consociado com outras culturas
tratgias de gesto da copa, que so em geral consequncia mais frequente a Galega vulgar. como a vinha ou mesmo hortcolas onde se dispunha de
de outros factores de conduo da cultura. gua. A consociao com a vinha respondia necessidade
Olival tradicional alinhado de obter rendimento mais rpido, sendo o olival uma cul-
Olival tradicional disperso Com uma densidade inferior a 120 arvores por h, tura de tardia entrada em produo, e isto era particular-
O sistema mais tradicional de cultivar a oliveira em este olival representa ainda hoje quase 50% de todo o oli- mente importante na pequena explorao onde as alter-
toda a zona mediterrnica, correspondia a situaes de r- val mediterrnico, estando fortemente ameaado na sua nativas de outras culturas no existiam. Os longos pero-
vores mais ou menos dispersas, cuja implantao das mes- viabilidade econmica, pelo facto da sua conta de cultu- dos de juventude das rvores so consequncia da exces-
mas no obedecia a nenhuma ideia de cultura continua ra no resistir concorrncia dos sistemas mais intensivos siva ateno dada poda de formao, em que a constitui-
o de um esqueleto grande e robusto constitua a priori-
Fig, 000- Cultura da oliveira em mezza luna. Olivaes e Lagares,
dade dos primeiros anos da cultura, secundarizando a en-
Mota Prego.
trada em produo. A produtividade tpica deste olival va-
ria de 500 a 1500 kg de azeitona por ha e a sua extrema ir- Fig.000 Olival na meia encosta. Olivaes e Lagares, Mota Prego.
regularidade e alternncia so a sua imagem de marca. As
podas muito espaadas e intensas que eliminavam a gran- Fig.000 Exemplo de velho olival disperso.
de parte da copa j velha e improdutiva, obrigando a espe-
Fig.000 Tradicional olival alinhado de sequeiro
rar algum tempo para que a mesma se recompusesse, asso-
ciadas a prticas de colheita da azeitona no muito respei- Fig.000 Moderno olival intensivo com rega gota a gota
tadoras dos pequenos ramos portadores dos frutos e dos
gomos florais so a principal causa.
Este um olival em geral de sequeiro, embora
{ 82 } O grande livro da oliveira e do azeite { 83 } O grande livro da oliveira e do azeite

Olival alta densidade


recentemente em casos muito pontuais e onde era poss-
vel dispor de gua para rega alguns agricultores tenham A alta densidade representa a evoluo natural do sis-
instalado sistemas de rega tipo gota a gota, com resultados tema intensivo, estando muito dependente das solues
muito positivos ao nvel da produtividade por rvore. No de apanha mecnica disponveis. A densidade deste siste-
entanto as pequenas densidades de rvores por ha e pouca ma sobe para 600-800 arvores, essencialmente como con-
eficincia na conduo e poda da copa, limitam as produ- sequncia da maior aproximao das rvores na linha. O
es potenciais, que dificilmente mesmo nestes casos so- sistema de conduo da copa pode ser na mesma o vaso
bem acima dos 3000 kg por ha nos melhores anos. alto, mas o eixo central ganha predominncia, pela maior
facilidade de poda mecanizada e pela dificuldade de man-
Olival intensivo ter um centro aberto em rvores muito apertadas na linha.
Como a palavra intensivo sugere, neste sistema exis- A filosofia geral do sistema a de manter uma sebe cont-
te a preocupao de tirar o mximo partido da rea ocu- nua de vegetao ao longo da linha, deixando de haver in-
pada com a cultura, aumentando as densidades de plan- dividualidade de copas no que diz respeito sua conduo.
tas para as 200 a 450 por ha, consoante solos e variedades, Se para muitas operaes como os tratamentos fitossani-
e introduzindo a rega geralmente localizada do tipo gota a trios esta conduo no tem grandes implicaes, j para
gota como factor essencial da produtividade. As produti- a colheita esta soluo implica a utilizao de vibradores
vidades podem atingir as 7 ou 9 toneladas por ha, por ve- laterais ou sacudidores de copa, mquinas menos divul-
zes mesmo mais, dependendo do nvel de utilizao de ou- gadas e geralmente s ao alcance das grandes plantaes.
tros factores sobretudo da fertilizao e controlo de pragas A reduo de custos da cultura a principal preocupao
e doenas. Aspecto importante deste sistema a distribui- deste sistema, e a mecanizao tende a ser total, incluin-
o das plantas em rectngulo, existindo sempre uma dife- do a poda, o que implica que alguns detalhes da conduo
rena de 2 a 3m entre a distancia das plantas na entre-linha da copa sejam esquecidos. Mais importante que a produti-
para as plantas na linha. Esta exigncia tem a ver com as vidade por ha procura-se aqui reduzir ao mximo o custo
exigncias de mecanizao, sobretudo na apanha mecani- por kg de azeitona produzido.
zada com vibradores de tronco, e a dimenso dos tractores Sendo um sistema de muito baixo custo de operao,
utilizados como se falar mais frente. Mas tambm o re- pode ainda compatibilizar a elevada densidade de plan- a Arbequina e da existncia de uma tecnologia desen- Fig. Exemplo de olival super-intensivo aps a realizao da
sultado da massificao na utilizao da rega gota-a-gota tas por ha com a utilizao de variedades vigorosas, dis- volvida para a vinha a mquina de vindimar cavalgado- poda anual
que ao colocar o tubo de distribuio de agua num dos sen- pensando a necessidade de controlar a altura das arvores e ra com barras que permitem sacudir lateralmente a copa.
tidos do alinhamento das arvores, corta assim a possibili- permitindo a utilizao de mquinas de colheita de gran- Com densidades de plantao ultrapassando as 1500 rvo-
dade de a passarem as maquinas. de produtividade. O potencial de produo deste sistema res por ha, permite uma entrada em produo ultra-preco-
Ainda assim neste sistema, as copas das arvores so ge- compete com o super-intensivo superando as 12 tonela- ce, logo ao terceiro ano, porque combina o reduzido pero-
ralmente conduzidas em vaso alto mas no se tocam na li- das por ha e embora tenha uma entrada em produo mais do de juventude caracterstico das variedades pouco vigo-
nha, constituindo copas independentes e cuja captao de lenta em virtude de ser necessrio mais tempo at plena rosas com a elevada densidade e proximidade entre siste-
luz radiante se estende a todo o permetro. Uma boa con- ocupao do espao disponvel, pode ter uma maior longe- mas radiculares, que reduz ainda mais esse perodo. as-
duo da copa implica a constante interveno no centro vidade na generalidade das variedades utilizadas. O equi- sim possvel atingir produes de cruzeiro a partir do 6
da copa para retirar os ramos vigorosos que fecham o cen- lbrio do vigor e produo mais fcil de controlar a par- ano, que facilmente ultrapassam as 12 toneladas e cuja co-
tro, evitando que o vaso se transforme num globo, o que tir dos 10-12 anos, porque a dimenso final das rvores se lheita extremamente facilitada pela utilizao da j refe-
reduz em muito a relao superfcie/ volume do sistema aproxima mais do seu tamanho natural. As distncias de rida maquina vindimadora que colhe em contnuo de um
com consequncias negativas para a produtividade. plantao podem reflectir o diferente vigor das variedades e outro lado da sebe. dispor de conhecimento e monitorizao adequado.
Existe neste sistema a preocupao de optimizao e pode assim variar de 6 x 2,5 nas menos vigorosas at 7 x 4 As grandes vantagens deste sistema residem na extra-
de dois factores essenciais para a produtividade da olivei- ou 8 x 4 nas mais vigorosas. ordinria precocidade da entrada em produo, permitin- A mecanizao
ra: exposio dos ramos luz e disponibilidade de agua ao do obter elevadas colheitas logo entre o 3 e o 8 ano com
longo do ciclo. As podas passam a ser anuais e constitudas Olival super intensivo uma manuteno da copa muito reduzida, e a facilidade da Colheita mecanizada de azeitona Portugal
por intervenes mais racionais, em que os objectivos so Representou a grande revoluo na cultura do oli- apanha mecanizada. Os pontos negativos esto na dificul- acompanhando a evoluo
a eliminao dos ramos ladres e madeira velha improdu- val, porque permitiu obter em 10 anos de cultura a mes- dade de controlo do vigor das rvores, estando a sua utili- Nos olivais tradicionais, com pouco menos de 100 a
tiva, mantendo sempre uma copa bem preenchida de jo- ma produo acumulada de um olival tradicional de se- zao restrita s variedades de muito reduzido vigor, e na pouco mais de 200 rvores/ha, a colheita mecanizada re-
vens ramos produtivos. O objectivo dever ser o de manter queiro em 70 anos. Resultado de uma extraordinria vi- sua curta vida econmica. Claro que o potencial deste sis- corre sobretudo a vibradores de tronco montados em ve-
a maior relao possvel de madeira nova vs madeira velha. so de aproveitamento de uma variedade j muito antiga, tema intensivo s plenamente aproveitado em regime de culos especializados (fig. 1) ou em tratores agrcolas (fig.
mas com a rara caracterstica de ser muito pouco vigorosa rega e fertilizao sem restries, para o qual necessrio 2). A recolha efetuada em panais ou lonas estendidos por
{ 84 } O grande livro da oliveira e do azeite { 85 } O grande livro da oliveira e do azeite

operadores na projeo das copas e transferidos de rvore num vibrador de tronco e apara frutos revelou uma capaci-
para rvore ao longo da linha. O nmero de operadores, a dade de trabalho (rvores/h) entre 77 a 100% do valor ob-
sua experincia e o modo de contrato (pagamento ao dia tido na cadeia baseada no mesmo vibrador de tronco e re-
ou em funo da massa de azeitona recolhida) determi- colha em panais. Contudo em termos de rvores/homem-
nam a capacidade de trabalho. -hora a cadeia do vibrador de tronco e apara frutos apre-
A figura 1 tem a particularidade de mostrar um equi- sentou valores 3.5 a 4 vezes superiores, mostrando clara-
pamento marcante da fase pioneira da mecanizao da mente o seu potencial em termos de custos.
olivicultura. Tal se deve viso esclarecida do Engenhei- Naturalmente, o dimetro do tronco pode inviabili-
ro Jos Franco de Oliveira Falco que, aps viagem aos Es- zar a utilizao do vibrador de tronco pela impossibilida-
tados Unidos da Amrica em 1973, importou dois vibrado- de deste abraar a rvore. O recurso a vibrao de perna-
res automotrizes utilizados na colheita de frutos secos e das no constitui uma verdadeira alternativa em virtude
empreendeu a tarefa de modific-los para melhorar a sua de penalizar fortemente a capacidade de trabalho (Almei-
prestao na colheita da azeitona. A campanha de 1974, da et al., 2001). Em particular, a forma do tronco pode im-
em que pela primeira vez se efetuou, a colheita por vibra- possibilitar a armao do apara frutos em torno da rvore.
o ao tronco na Herdade de Torre das Figueiras um mar- A elevada carga no eixo frontal do trator conjugada com a
co histrico na mecanizao da olivicultura no Alentejo. fraca capacidade de sustentao dos solos na altura da co-
Foi igualmente na dcada de 70 que, pela iniciati- lheita (inverno) outra limitao desta opo. A elevada
va do Engenheiro Camilo Antnio de Almeida Gama Le- carga imposta fora do entre-eixos do trator motivo para
mos Mendona, se importaram e difundiram no Nordes- especiais cuidados na descida de declives os quais, se ne-
te Transmontano os primeiros modelos de equipamen- cessrio, devem ser negociados em marcha atrs.
tos para a colheita de azeitona, constitudos por vibrador Nos olivais intensivos, com 260 a 550 rvores/ha, a
e apara frutos. mecanizao da colheita recorre sobretudo a vibradores
A figura 2 tem a particularidade de mostrar o primeiro de tronco montados em tratores agrcolas (fig. 4). A reco-
equipamento da Estao de Olivicultura (Elvas), constitu- lha efetuada em panais ou lonas estendidos por opera-
do por uma cabea de vibrao fabricada pelo Engenheiro dores na projeo das copas e transferidos de rvore para
Jos Franco de Oliveira Falco na Herdade de Torre das Fi- rvore ao longo da linha. A proximidade das rvores torna
gueiras em Monforte. difcil ou impossvel o recurso a apara frutos.
Os modernos tratores equipados com transmisses de As empresas olivcolas de maior dimenso tm aposta-
comando eletro-hidrulico facilitam a manobra do opera- do no olival intensivo e consequentemente investido em
dor do trator. Contudo, so os veculos especialmente con- equipamentos de grande capacidade de manobra (fig. 5).
cebidos vibradores automotrizes que, servindo-se de Contudo, reconhecem a sria dependncia em mo-de-
transmisses hidrostticas e grande facilidade de mudar -obra na colheita deste tipo de olival, pelo que esto sem-
de direo e sentido, permitem elevados valores de capa- pre recetivos a alternativas de colheita.
cidade de trabalho. Nas campanhas de 2001 a 2003, num mbito dum pro-
A utilizao de um apara frutos como sistema de re- jeto de investigao levado a cabo pelo Departamento de
colha, associado ao vibrador de tronco (fig. 3), sur- Engenharia Rural da Universidade de vora, Escola Supe-
ge como uma alternativa para reduzir a dependncia da rior Agrria do Instituto Politcnico de Bragana e Depar-
mo-de-obra. tamento de Olivicultura da Estao Nacional de Melho-
Fig. 1 Vibrador automotriz (Herdade da Torre das Figueiras,
Nas campanhas de 1995 a 1998, num mbito dum pro- ramento de Plantas, foi construdo e avaliado um equipa-
Monforte, 2001).
jeto de investigao levado a cabo Departamento de En- mento denominado semirreboque enrolador de panos,
genharia Rural da Universidade de vora, Escola Superior concebido para a recolha de azeitona destacada por vibra- Fig. 2 Vibrador montado em tractor (Herdade da Calada,Elvas,
Agrria do Instituto Politcnico de Bragana e Departa- dor de tronco (fig. 6). 2001).
mento de Olivicultura da Estao acional de Fruticultu- Nos ensaios realizados em 2 olivais no Alentejo com
Fig. 3 e 3a Vibrador com apara-frutos (Herdade da Torre das
ra Vieira da Natividade, foram avaliadas a capacidade rela- 400 rvores por hectare (Pea et al., 2005), a cadeia ba-
Figueiras, Monforte, 2007).
tiva das duas tcnicas referidas (Almeida et al,. 2003). Os seada no vibrador de tronco e panais estendidos manual-
ensaios foram realizados em 5 olivais no Alentejo e 5 oli- mente mostrou valores de capacidade de trabalho de 77 Fig. 4 Colheita de azeitona num olival intensivo
vais em Trs-os Montes, com densidades variando entre a 91 rvores/h, ou seja, 11 a 13 rvores/homem-hora; a ca- (Herdade de Monte Branco dos Terreiros, Fronteira, 2003).
87 e 237 rvores por hectare. deia baseada no mesmo vibrador de tronco servindo dois
Nas mesmas condies de trabalho a cadeia baseada semirreboques de enrolar panos, trabalhando em paralelo Fig. 5 Colheita com vibrador automotriz em olival intensivo
(Herdade de Alcobaa, Elvas, 2001).

Fig. 6 Semirreboque enrolador de panos (Olival de Vale


Pradoso, Mirandela, 2003).
{ 86 } O grande livro da oliveira e do azeite { 87 } O grande livro da oliveira e do azeite

(fig. 7), mostrou ser possvel valores semelhantes de 80 colocadas radialmente em mastros verticais.
rvores/h (11.4 rvores/homem-hora).
Ainda que o esforo requerido aos operadores na ca- A mecanizao na poda
deia do enrolador de panos seja inferior, de facto, no exis- Tradicionalmente a poda da oliveira era executada
te reduo de mo-de-obra, pelo que a soluo no vingou. manualmente com serrote e machado. O aparecimento
Uma diferente abordagem est presentemente a ser da motosserra, em particular o modelo em altura (fig. 11)
seguida para a colheita do olival intensivo; trata-se de que permite efectuar a poda sem necessidade de subir s
substituir a vibrao do tronco pela vibrao da copa. Des- rvores, contribuiu para aumentar o nvel de mecanizao
ta forma a energia para o destaque colocada mais per- da poda da oliveira.
to do fruto e, sobretudo, substitui-se um mtodo baseado Na fase inicial de conduo do olival, quando as in-
numa rotina de operaes realizadas rvore a rvore, por tervenes de poda so ligeiras, so particularmente teis
um mtodo contnuo de colheita com uma substancial re- os equipamentos de poda manual assistida mecanicamen-
duo de mo-de-obra. te, como as tesouras pneumticas ou as tesouras elctri-
Num mbito dum projeto de investigao levado a cas (fig. 12).
cabo pelo Departamento de Engenharia Rural da Univer- A necessidade de aumentar o nvel de mecanizao da
sidade de vora e a Empresa Vtor Cardoso Lda. com a co- poda da oliveira, como forma de reduo de custos, levou a
laborao de Torre das Figueiras Sociedade Agrcola, que, em 1997, se iniciasse a avaliao da utilizao da m-
Lda., est a ser concebido e avaliado um equipamento de- quina de podar de discos (fig. 13) na poda da oliveira (Dias
nominado Mquina de Colheita em Contnuo de Azeito- et al., 1998). Em trabalhos efectuados em olivais tradicio-
na (fig. 8). Os resultados preliminares das campanhas de nais, obteve-se uma capacidade de trabalho com a mqui-
2009 a 2011 sugerem um grande potencial para esta tcnica na de podar de discos que variou entre as 150 e as 200 rvo-
e, consequentemente, que a tecnologia devidamente tes- res por hora enquanto na poda com motosserra a capaci-
tada ter impacto na olivicultura moderna. dade de trabalho variou entre 10 a 20 rvores podadas por
Nos olivais superintensivos, em que os mais frequen- hora x homem (Dias, et al., 2001). A utilizao da mqui-
tes em Portugal tm 1850 a 2100 rvores/ha, a colheita me- na de podar de discos permite reduzir os custos de poda e
canizada recorre a mquinas de colheita automotrizes cuja simultaneamente manter as rvores sem quebras de pro-
conceo se baseia na mquina de vindimar automotriz duo comparativamente com as podadas manualmente,
(fig. 9), possibilitando capacidades de trabalho de 3h/ha durante um perodo de 6 a 7 anos (Dias, 2006).
(Baslio, 2008). Tal tem contribudo para que esta tcnica de poda te-
O crescimento das rvores e a consequente limitao nha vindo a ganhar mais adeptos, situao bem eviden-
para o desempenho deste tipo de mquinas tem levado ao te nos olivais superintensivos, onde a necessidade de con-
aparecimento de variantes especficas para a olivicultura trolar a dimenso das rvores para permitir a utilizao de
(fig. 10) cujo tamanho permite, inclusivamente, o seu uso mquinas cavalgadoras na colheita da azeitona, tem leva-
em olivais intensivos nos primeiros anos de produo. do os olivicultores a optarem por esta soluo, visto per-
Nestes tipos de mquinas, o destaque da azeitona mitir reduzir consideravelmente os custos de poda.
efetuado interatuando, de um lado e do outro da copa, bar- A necessidade de controlar mecanicamente a dimen-
ras com movimento lateral oscilatrio ou varetas vibrantes so da parte inferior da copa das oliveiras para permitir a

Fig. 7 Recolha de azeitona com dois semirreboques de enrolar Fig. 11 Poda com motosserra em altura (Quinta de Vale de
panos em paralelo (Herdade de Monte Branco dos Terreiros, Lobos, Santarm,2011).
Fronteira, 2003)
Fig. 12 Poda com tesoura elctrica (Herdade da Torre das
Fig. 8 Mquina de Colheita em Contnuo de Azeitona Figueiras, Monforte, 2012).
(Herdade da Torre das Figueiras, Monforte, 2011)
Fig. 13 Corte horizontal da copa mquina de podar de discos
Fig. 9 Colheita com mquina de vindimar em olival (Herdade Torre das Figueiras, Monforte, 2001).
superintensivo (Quinta de Vale de Lobos, Santarm, 2006).
Fig. 14 Corte de ramos pendentes na parte inferior da copa
Fig. 10 Colheita com mquina automotriz em olival intensivo (Herdade Torre das Figueiras, Monforte, 2007).
(Herdade do Marmelo, Ferreira da Alentejo, 2010).
{ 88 } O grande livro da oliveira e do azeite { 89 } O grande livro da oliveira e do azeite

colocao do vibrador + apara-frutos para a colheita da superfcie do solo (fig. 21).


azeitona, levou a que se desenvolvesse uma barra de corte Estando os olivais plantados em zonas de declive acen-
com um menor nmerodediscos parapermitirapassagemda tuado a mobilizao favorece a eroso hdrica do solo (fig.
mquina de cada um dos lados do tronco da oliveira (fig.14). 22). O arrastamento de grandes massas de solo, e de ferti-
No caso dos olivais intensivos onde os ramos das oliveiras lizantes, para as linhas de gua contribui para a reduo da
so mais flexveis este tipo de interveno realizado por fertilidade do solo dos olivais e para a diminuio da quali-
uma mquina de podar com barra de corte de facas (fig. dade da gua e, como tal, influencia negativamente o am-
15). No caso do olival superintensivo, existem mquinas de biente. As massas de solo arrastadas tm igualmente efei-
podar com barra de corte de facas que permitem podar, si- tos negativos em diferentes infra-estruturas contribuin-
multaneamente, duas linhas de rvores (fig. 16). do para a imagem negativa associada actividade agrco-
la (Pinheiro, 2005).
A mecanizao na eliminao da rama de poda As alteraes provocadas na superfcie do solo dificul-
A eliminao da rama de poda era tradicionalmente tam o trnsito dos tractores e dos diferentes equipamen-
efectuada por queima, prtica cuja utilizao tem limita- tos, nomeadamente os utilizados na colheita da azeitona,
es ambientais. A soluo alternativa a fragmentao reduzindo a capacidade de trabalho dos mesmos. (fig. 23).
em pedaos de menor dimenso que ficam depositados na As mobilizaes tradicionais comearam a ser substi-
superficie do solo (Dias et al., 2005). Para a mecanizao tudas, nos finais do sculo passado, por prticas alternati-
integral do processo utiliza-se uma mquina de encordo- vas como o caso do fomento das faixas com coberto vege-
ar (fig. 17) para retirar os ramos da projeco da copa das tal onde a vegetao controlada mecanicamente (fig. 24).
rvores e formar um cordo na zona central da entrelinha. Em 1998, no mbito de um projecto de investigao
Esse cordo posteriormente fragmentado em pedaos de que inclua membros do Departamento de Engenharia
pequena dimenso pela mquina de destroar (fig. 18). Rural e do Departamento de Biologia da Universidade de
vora, da Direco Regional de Agricultura do Alentejo e
A mecanizao no maneio do solo do Departamento de Olivicultura da Estao Nacional de
A mobilizao do solo, com grades de discos (fig. 19) Melhoramento de Plantas, foi instalado um ensaio, na her-
e escarificadores foi, e contnua a ser, prtica comum para dade dos Lameires em Safara, onde a influncia de dois
controlar as infestantes dos olivais. Num passado recente maneios do coberto vegetal, mobilizao tradicional e en-
era opinio generalizada, entre os olivicultores, que estas relvamento (fig.25), nas caractersticas do solo tem vindo
prticas favoreciam a infiltrao de gua, durante a esta- a ser estudada. As observaes feitas e os dados recolhidos
o das chuvas, aumentando a sua disponibilidade para as permitem concluir que o enrelvamento, em particular, o
rvores durante a estao seca. Consideravam importante aumento da proporo de solo coberto por leguminosas e
ter o solo limpo para facilitar a colheita e eventual apanha gramneas, beneficia o olival, visto que aumenta a infiltra-
da azeitona do cho (fig. 18). o de gua no solo, principalmente no incio da estao
No entanto caso o solo esteja nu a energia das gotas pluviosa e diminuiu as perdas de gua por evaporao na
de gua das primeiras chuvas outonais desagrega o solo e estao seca, particularmente em anos de precipitao re-
promove o seu arrastamento, provocando graves proble- duzida. Para alm disso, melhora as condies de transita-
mas de eroso, j que a gua em vez de se infiltrar escorre bilidade dos equipamentos na poca da colheita e reduz os

Fig. 15 - Controlo dos ramos pendentes num olival intensivo Figura 19 Grade de discos em trabalho num olival
(Herdade de Malheiro, Vidigueira, 2011). (Herdade dos Lameires; Safara,2004).

Fig. 16 - Controlo dos ramos pendentes num olival Figura 20 Aspecto do solo dum olival depois de gradado
superintensivo. (Quinta de Vale de Lobos, Santarm, 2007). (Herdade dos Lameires; Safara,2006).

Fig. 17 Mquina de encordoar (Herdade Torre das Figueiras, Figura 21 Aspecto de um olival depois de ser ter registado
Monforte,2003). precipitao (Figueira de Cavaleiros, 2012).

Fig. 18 Mquina de destroar (Monte do Abreu, Elvas, 2004). Figura 22 Sulcos num olival provocados pela escorrncia da
gua da chuva (Herdade Torre das Figueira, Monforte, 2004).

Figura 23 Vibrador automotriz a atravessar um sulco


(Herdade Torre das Figueira, Monforte, 2004).
{ 90 } O grande livro da oliveira e do azeite { 91 } O grande livro da oliveira e do azeite

custos de produo da azeitona. Este tratamento parece, sensor que assegura que a distribuio da calda feita ape-
assim, aumentar a disponibilidade global de gua no solo, nas na copa das oliveiras, impedindo que haja pulveriza-
minorando simultaneamente os riscos de eroso, sem pre- o entre as rvores. Deste modo contribui-se para econo-
juzo da produo. (Belo, 2003) mizar na quantidade de produto fitossanitrio distribudo
O enrelvamento da entre linha dos olivais tem vindo a reduzindo o impacto ambiental da aplicao de fitossani-
ter uma grande adeso por parte dos olivicultores. A vege- trios nos olivais.
tao das faixas centrais controlada usando meios mec-
nicos, capinadeiras ou destroadores de ervas, sempre que A mecanizao na plantao do olival
a competio para a gua comea. A plantao de novos olivais em Portugal teve um
O controlo da vegetao na linha das oliveiras fei- grande incremento com a adeso Unio Europeia. Nos
to usando equipamentos que permitem aplicar os herbici- olivais intensivos ( 400 rvores/ha), aps a preparao do
das diludos em gua (fig. 26) ou sob a forma pura (fig. 27). terreno com mobilizaes do solo profundas, normalmen-
Os equipamentos que permitem a aplicao sob a for- te por ripagem, a plantao realiza-se colocando as rvo-
ma pura tm vantagens pois permitem maiores capacida- res em covas abertas previamente com rectroescavadora
des de trabalho, reduo da compactao do solo e maior ou com uma broca perfuradora montada em tractor.
economia de gasleo contribuindo assim para a reduo Nos olivais superintensivos, com densidades de cerca
dos custos de produo da azeitona. de 2000 rvores por hectare, faz-se a utilizao de planta-
dores mecnicos (fig. 30) que, alm de colocarem a plan-
A mecanizao na aplicao de fitofrmacos ta no solo, tambm colocam os tutores, sendo a marcao
A aplicao de fitofrmacos no olival ter-se- inicia- das linhas de plantao efectuada recorrendo ao guiamen-
do em Portugal na dcada de 50 do sculo XX, na regio to por satlite (GPS).
do Baixo Alentejo. Estas aplicaes visavam o controlo da
mosca da azeitona e a preveno do aparecimento da gafa.
Evoluiu-se da aplicao manual dos fitossanitrios
para pulverizadores semi-rebocados de jacto transporta-
do (fig. 28) . Estes pulverizadores dispem de reservat-
rios de grande volumetria e de ventiladores de grande di-
metro que geram o caudal de ar necessrio para assegurar
a penetrao da calda na folhagem das oliveiras.
Para otimizar a aplicao de fitossanitrios utilizam-
-se pulverizadores com sonar (fig. 29). Trata-se de um

Fig. 24 Destroador de vegetao em trabalho (Herdade dos


Lameires; Safara, 2004).

Fig. 25 Olival com enrelvamento na entrelinha e o controlo


de vegetao com herbicida na linha (Herdade Torre das
Figueiras, Monforte, 2003).

Fig. 26 Controlo da vegetao na linha usando pulverizadores,


herbicida diludo (Herdade dos Lameires; Safara,2003).

Fig. 27 Controlo da vegetao na linha usando aplicadores de


herbicida puro. (Herdade dos Lameires; Safara,2004).

Fig. 28 - Pulverizador de jacto transportado (Herdade do


Malheiro, Vidigueira, 2012).

Fig. 29 - Equipamento sonar (Herdade do Malheiro, Vidigueira,


2012).

Fig.30 Plantador guiado por GPS.


{ 92 } O grande livro da oliveira e do azeite { 93 } O grande livro da oliveira e do azeite

quasitas ma niet quis et evenducipiet eturi nonsectur sim Ur sinvel mossi reptus dolupitatur? Quid mod ulluptae parum escid esciend enimendi accabores dolor sandae evenihil is-
Referncias
sum esserum vidi sequas vollorpore, cum qui debis solupta- voluptae nest, od quas accus. sit aut restiunt lam, ipidis debis remque omnimus il iur sa-
Almeida, A.; Pea, J.O.; Pinheiro, A.C.; Dias, A.B.; Santos, L.;
tur sum repro entorerspe pliquidest, commos aut que venec- Eperaeptatur magnatus, ellique vollore ptiandic temquo omnihil pel eatusam quibus magname rehent, cullandi cuscient.
Reynolds de Souza, D.; Lopes, J. (2003) - Estudo comparati-
tur ratem fugitaquo cum ea velicia pelit placeri namusam fu- inctur? Ectatin ciumqui ut mincitat. Nus nonsedi que essequo oditas con re odi cusa dolum im fuga.
vo do desempenho de trs sistemas de colheita mecnica de
gita quam con excearum faceria estis de apienis quiam, au- Sam alitium, volupta temporia ea nonsed qui aliquis am velecta- Et am, quiasperiost dis velit ima cupis esequiducit occum
azeitona. Atas Portuguesas de Horticultura 13. III Simpsio
tae voleseque mil ex eos et que volorit rest quosti ommolore- tur? Exped et de aute venima doloria vit et doluptate quam, etur mint re, imint ut omnimpore porepelit ad et alibus sam
Nacional de Olivicultura: 172 - 178
pel intur, tet repra voluptatist, ipsundendae nonsece prehe- consenimusam ad minveruptat re nobisciis asperibus de ut rehendaerio. Nam, commodi piendi con porerat istrup-
Almeida, A.; Pea, J.O.; Pinheiro, A.C.; Dias, A. B.; Santos, L.;
nim explibusam quid ut in cusam enias atiam, consed et ve- nonse eicid utaspere non prest omnimpor aut qui a non et tatur autam rempori busdae pre nobitis sed qui sunt, sed
Reynolds de Souza, D.; Lopes, J. (2001) - Influncia da vibra-
libus aute porum facerereprat officab orporepudis auditaque hario. Agnietur sus estia se ene et volore quae. Berume ven- ut doloruptae auda volore dolore volupta imus moluptate il
o ao tronco ou s pernadas na capacidade de trabalho e
volorestiost et voluptatecab isinciatecat fuga. Nequia nesci dipsam nientis evelit fuga. Asperios assitio. Maximaxim la- minum volor ma iunt in natiore et eatur sum con prae nos-
nos custos de colheita mecnica de azeitona. Revista das Ci-
omnient doloreri aut odis et a nimin nis eria quiaspi dundem cest, sundunti debitem estiunt, te nieniet aut dolum hit, sunto volorum in rercitas nonseque omnisciis et il ma vel
ncias Agrrias, vol. XXIV, n 1 e 2. II Simpsio Nacional de
ut eum sundem eaquamuscit, il molla veris doluptate lit, sen- cuptam elit, volescid modi occus, sit lam inum ist eum late iniminc iliquos eum volupta sperion sendantotat.
Olivicultura: 81-88.
dundios doloreproris autat et maximin ctorepudit, natur? cusamusciur, cus eum aut que et, voluptatqui unto quam, Ferum am fugit volorpo rempor ad quundel liquuntio et quamus
Baslio, A. (2008), Estudo do trabalho em olival superintensivo
Rumquunt laut ilit eostiis non renis illab in etum ex et que offici sandani molecum ex eturempor alias et iumquibus volorem est intempost rero evelignam in reicimintio. Ucia senitese-
(2004-2008), MADRP, DRAP LVT.
optae vel id mint. ut eum qui te lam fuga. Ovit que venis mi, ut quunt hic- que dolenda erferum a eatur, voloreiunt quati occulparum et
Belo, A.F., Castro, C., Pinto-Cruz, C., Simes, M.P., SILVA, L.L.,
Atenduntis maiorum iusam repercia dolorio eseque ipsandit mi, tendunt ilicius sit aperem exceped quas non eiciend emodis exceseque sinulpa vernam laccus digenih illuptat.
Pinheiro, A. (2003) Estudo comparativo de duas tcnicas de
aliquo ipsam re aut mi, se del moles sita aut min comnis- molore volum fugiat quametur? Rem qui as expel ipsandis et hillaciae non et velique omnis sape
maneio do solo de olivais da regio de Moura, 3 Simpsio
qui rehendeliam, tota velibus magnias dolessincte aut qui in Ga. Tistiur audaest ianiata quo quam quam sus sequibus, occae. venturitat quibusant ma nonsequam repudio nsequis et
Nacional de Olivicultura, ESACB, Castelo Branco.
prorro ercimpo ribus, ex et minimporitis ute volorectiat mo- Nequat. quas ipsani blaut quatur?
Dias, A. B. (2006). A mecanizao da poda do olival. Contribui-
diaepera volupta tectem ist odis mil molupienis diorro ma- Nam, tet ius nistio. Itatisc ientior erferib usandel laccatibus eos Git, sunture persperferum et eos ni dolore nonsernatqui omnim-
o da mquina de podar de discos. Tese de Doutoramento.
xim is quasseque dolutat. rae mos mo tem a quis ut et dolo is eturit in re poruptatquo po remped ut et mo con ex et latquo temperuptat.
Universidade de vora.
On num fugit, es reperum volorrore explia pelitibus. qui cum sunt. Int quia volo debis as aut eum quisi de nonsed quam dit paribus.
Dias, A.B., Pea, J.O., Santos, L., Pinheiro, A.C., Costa, R., Morais,
Ebis seque voluptatur arum alit occatiam quiatibusame iur, ei- Re dolecab orenimus, cusam as eum ut alibusdam qui doloriat.
N., Pereira, A.G. (2005). A mecanizao da poda e da elimi- Uga. Nem et ut moluptamet volore nosam que num et,Bis
cia pa in rerae volorepe cus ium restemq uiaspe por sandus Totas inumqui doluptatem quid mod ut labore nis res aut quo
nao dos seus resduos na olivicultura. Revista das Cincias
et, comnim qui de nimagnatus ma quamus quia quis con- occulpa dolesti berferferis ne quiat as dolorro quis erum si
Agrrias, Vol. XXVIII, n 3/4. I Simpsio Nacional de Enge-
sequat etur? Lorerib eruptatur autatetur sam, sundiatio eo- tem is aperspid maximol upistiore nonseque nia volupta-
nharia Rural, p. 443-456.
sam amusam et a dolore latur, tendia voluptatquam denda tem nus exped qui ad moluptatur abor ra cum, nus, veres-
Dias, A.B., Santos, L., Pea, J.O., Pinheiro, A.C., Reynolds de Sou-
qui niamus. tiis pelescid quibus dolore velecto te labori omnis dolup-
za, D., Pereira, A.G., Morais, N., Miranda, A. (2001). A poda
Hentotaquia veligni squatusam sitaquia con re numquo offictu tios volut arum, sam, offictota volupieni imporiae sus mo-
mecnica na olivicultura alentejana. Dois anos de ensaios.
repudan tectotas sam cum et, sae volentus modis dolut volo- dist aces aruptur, occatet atquisimusam et abo. Et res eveli-
Revista das Cincias Agrria, Vol. XXIV, n 1 e 2. II Simpsio
reh enihictiam corempo reptatur? ciae. Itatur?
Nacional de Olivicultura, p. 74-80.
Quia cullorum fuga. Aperspit molupta cupta conserum reprovid Essinum vitio. Epera dolorernatae voluptat aut aut ant, aceperi
Dias, A.B., Santos, L., Pea, J.O., Pinheiro, A.C., Reynolds de Sou-
unt et et laboreped qui cus et at ad qui renit lictotatur maio- atisitaecus eatempo stempor eprovita velita que quaspie ni-
za, D., Morais, N., Pereira, A.G. (1998). Aplicao da poda
nem doluptatio mincia quis aut ut ad quat. mendem essit et modis idistrum facimos autem que nimus
mecnica na olivicultura moderna. Revista das Cincias
As est rem in consectur? eiuritassed quatus deliquibus, idelibu sanderate ent.
Agrrias.Vol. XXI, n 1 a 4. I Simpsio Nacional de Olivicul-
Deriam ipsam aribus eate quis dolorum fuga. Ut esequam sus Me mo quiatqui bea quidunt aut eaquist, ipsam sit am, quibu-
tura, Jan. a Dez. p. 149-156.
dem in cus acit pos nonempo ritiberum di vendiciet, conse- sa numquo explit, optati digendi dios dolor ratur aspe di do-
Pea, J.O.; Almeida, A.; Pinheiro, A.C.; Dias, A.B.; Santos, L.; Lo-
cus eum non plit int es aligentur aliamusamus ullignis duci- luptat eatios volora none odis alitatiur? Rit, tore aut repe-
pes, J.; Gomes, J.A.; Reynolds de Souza, D. (2005) - Aes re-
litas doloria voles dignim volut liquam fugiantini vent volli- rum, con re licatem quis duntur aut estrum acest pelis mo-
centes de investigao e desenvolvimento experimental na
ge ndelit remposam alicto volorestiis rerferi dolecea rchilia luptatur, cusae consequam remquat ectium a quunto offic-
colheita mecanizada de azeitona em Portugal. Revista das
ndictiusam sam ratatur alique nonsed molupid quati ut et, ti onsequodisto officil maxim acessitam repudaes dolori du-
Cincias Agrrias, vol. XXVIII, n 3/4. I Simpsio Nacional
conectist veles et qui dolores ati velitat eum reriosam, ea do- cius repudit isciur, solo temo exerum faccusa meturibus vo-
de Engenharia Rural, Lisboa, 13 e 14 de Novembro: 399-410.
loribus, omnimodiat. lum iscidel laborem harum esequi des quia as inctatio om-
Pinheiro, A.C. (2005) - Soil and water management for olive or-
Luptatem. Raectur molestibus, tem repel modiae. Nam quo- nissequam facea volor sim vellore peligentia de nosam inti-
chards in Portugal. An overview FAO Land and Water Bulle-
di odit ipsapit atureri oruptatias voluptatem quam ut assin- busa ditatur? Quiae pla qui consecaecum ipidiciderum er-
tin n 10 Integrated soil and water management for orchard
tis evenitianis et volorerias dolorumquo maximporera eum, cianimus debisqui quas estorecus exces ant.
development, pp. 35-40 Rome.
quia volum re, aciurios aliqui sitatem voluptaque que nus Nem qui re porporiae quidenit untusae porit a sitae. Ita veliquu
restissi consequodit es mincien ihitatibus, que duci sit et res ntiunt eat aliqui cus dolupti onsendae nihil minihicid modi-
Reperrum as imus, sum inus.
ulparum qui te este cum dollantis pratemp oribeati cus milit ciam sequo venia simin recus aut re soluptate odicitatur si-
Bus sus del molutem rem nullab imilliquid expere desedis res
qui aturi aut quiate velicitio. Nem quam, nonet, quia sapita- tissitio mi, od qui blaborumet, sin nonsed eostiur?
duci reribusto tendam, sam, si doluptat dis ut velisto bea dic
tio. Nihilis re simaion conseque si con et elignat. Ut harchil luptas num aut minusdant laborepudame nienducit,
to destibu sdaest ut ditassimus quo inihici dolo et endit, sim
Olores nonsece struptasi ilis illecestis dolectatem aspediciae quas que ped maximolenti dolor sum abo. Bus.
fugitis sinihil litium ius, con niaepera nat quatentias presto
pliquatiis as esti volo omnimus, sae. Nam fuga. Nametus do- Ullignimi, corro et remquae explabor mossit, nost parum et esto-
ent voluptasped earciet, consequam, simus, sundiassimet a
lorio nsecatet explit etur? ra dis nonecum ut ernatur arionsed quiat.
vollit, sitint.
Bitinveri non pratur a imin esera ipsapitio et harchitia sum essi Tempos autem solum qui dis dolum fuga. Aquam illiqua ssita-
Udandit quis autas nus.
dolore vellign iantia di nobis incil esto odiaectur mos excea- mentio consecabor autenimagnim aut que perum ipsant.
Equaecatur, te repero bea nonse eseribusa vitae nisque enti vo-
tentus dem re nis exped mi, omnis eos quam inciis experepe- Pererferes dit evendaesto doloris cidigendit ipsum fuga. Nam
luptatio di reria etus.
dion pari ut illam inus. intibus cidendis explitatur sam aci doles accabore peruptis
Solesti onsequi saperun debiti dolore consequis prem harcia
{ 94 } O grande livro da oliveira e do azeite { 95 } O grande livro da oliveira e do azeite

A importncia da rega gua no solo e as condies atmosfricas prevalentes. Em na abertura estomtica, fruto dessas diversas causas, leva No caso do olival regado, a curva anual do Kc apresen-
no olival. geral, valores de potencial hdrico de madrugada (de base) a uma grande variao da transpirao e, consequente- ta um padro de comportamento invertido em compara-
entre -0,5 e 0,8 MPa so aceites como indicadores de boa mente, da fotossntese. costume dizer-se que a transpi- o com a curva tpica do Kcdas culturas herbceas. A se-
Conceitos e prtica. disponibilidade de gua no solo, decrescendo progressi- rao o preo que a rvore paga para produzir os assimi- guinte figura, adaptada de Testi et al.,(2005) apresenta a
vamente esse potencial com o evoluir do dia e, tambm lados necessrios (fotossntese) formao de folhas, bo- variao anual dos valores mensais do coeficiente cultu-
Francisco L. Santos, Ph.D. ao longo do tempo, com a diminuio da disponibilida- tes florais, madeira e frutos. Ou permite a mxima entra- ral (Kc) para um olival em Crdoba (Espanha) e em Fres-
de de gua, at ao um limiar deextrao de gua dispon- da de CO2 pelos estomas e fotossintetiza assimilados, ou no (Califrnia), com precipitao anual da ordem de 592
Instituto de CinciasAgrrias e Ambientais vel no solo considerado crtico. Abaixo dos valores de po- fecha-os para limitar ao mximo as perdas de gua para mm e 306 mm, respectivamente.
Mediterrnicas (ICAAM) tencial hdrico para essa condio (indicador de dfice h- a atmosfera (transpirao) e inexoravelmente a fotossn-
Universidade de vora drico), deve-se regar. Os potenciais hdricos observados ao tese. Umdilema de todas as plantas superiores (Fererese-
1.6
e-mail: fls@uevora.pt meio-dia solar so sempre mais negativos que os de ma- tal., 2005).
Crdova
drugada, podendo-o ser mesmo para rvores bem rega- Fresno

Nas regies de clima Mediterrnico no vero as plan- das, quando o dfice de presso de vapor da atmosfera Transpirao, evapotranspirao e a rega
1.2
tas esto sujeitas a elevadas temperaturas e intensidades elevado. Os potenciais medidos ao meio dia solar, em fo- Nas condies climticas da regio Mediterrnica a si-
de radiao solar e baixa humidade relativa, indutoras de lhas sombra e de ramos prximos do tronco e protegidas tuao de conforto hdrico e produtividade mxima das
crescimento e produtividade mas tambm de condies durante meia-hora dentro de um saco de papel (ou outra culturas, incluindo a oliveira, bem adaptada secura esti-

Kc
0.8
de dfice e stress hdricos. A oliveira, por ser uma cultu- tcnica semelhante) antes de serem separadas do ramo e val, s possvel com a rega. Tal exige, para alm de se sa-
ra mediterrnica milenria, uma espcie hipoestomti- usadas para a medio do potencial (potencial do ramo), ber quando regar, saber-se quanto regar, por quantifica-
ca bem adaptadaa essas condies ambientais, em que as substituem os de madrugada, evitando-se os inconvenien- o das necessidades hdricas da cultura. Isso requer co- 0.4
folhas toleram baixos potenciais hdricos foliares e os te- tes de medies antes do amanhecer. nhecer-se a evapotranspirao diria e sazonal das cultu-
cidos hidratam-se rapidamente aps perdas considerveis ras, isto as perdas de gua por transpirao e por evapo-
de gua.Essa adaptao a condies de dfice hdrico tem Condutncia estomtica e a rega rao direta de gua do solo. Essas componentes so dif- 0
permitido a expanso do olival de sequeiro com produes As trocas gasosas entre as folhas e a atmosfera do- ceis de quantificar, uma vez que so influenciadas por fac-

jan

fev

mar

abr

mai

jun

jul

ago

set

out

nov

dez
aceitveis em zonas de clima mediterrnico com estao -se fundamentalmente atravs dos estomas, sendo o grau tores vrios, como a idade das rvores, densidade de plan-
seca de cinco a seis meses e precipitaes mdias anuais dessa abertura estomtica um indicador indireto do esta- tao, arquitetura, condutncia estomtica e sistemas de Fig.000 variao anual dos valores mensais do coeficiente
de cerca de 500 mm. do hdrico da folha, geralmente avaliada atravs da cha- rega, o que tem levado adopo de informao expedita cultural (Kc) para um olival em Crdoba (Espanha) e em Fresno
Nessas situaes, caracterizadas por um elevado po- mada condutncia estomtica, com maiores aberturas as- que permita quantificar essas necessidades. (Califrnia), com precipitao anual da ordem de 592 mm
e 306 mm, respectivamente
der evaporativo da atmosfera (dfice de presso de vapor) sociadas a aumentos de turgidez nas clulas-guarda dos A estimativa da evapotranspirao da oliveira (ETc)
o fecho dos estomas umas das defesas que a oliveira usa estomas e as menores no caso inverso. Com os estomas a geralmente obtida recorrendo ao procedimento clssico
para controlar e diminuir as perdas de gua por transpira- responderem prontamente a vrios estmulos ambientais da FAO que faz uso de coeficientes culturais (Kc) e da eva- Durante os meses de Inverno os valores de Kc so nor-
o, mantendo uma certa hidratao interna, o que nor- e endgenos, estudos recentes na oliveira indicamque os potranspirao de referncia (ET0), que geralmente de malmente elevados, podendo ser superiores unidade,
malmente avaliada pelo potencial hdrico foliar de ma- estomas reduzem a sua atividade a potenciais hdricos fo- uma cultura de referncia,normalmente a relva, que refle- devido principalmente componente evaporao do solo.
drugada (mxima hidratao, antes do nascer do sol) e liares (base) inferiores a -0,90MPa, correspondendo a va- te o efeito das condies climticas nas suas necessidades Contudo isso tm uma importncia relativa na rega em cli-
ao meio dia solar (mnima hidratao). O fecho estom- lores cada vez mais decrescentes de condutncia estom- hdricas. O coeficiente cultural (Kc), geralmente tabelado, mas mediterrnicos, j que ela conduzida normalmente
tico (relacionado com a condutncia estomtica) contro- tica e de taxa fotossinttica. Tais observaes permitem a representa o efeito das caractersticas da cultura nas suas a partir dos meses de abril e maio, prolongando-se at se-
la a taxa de transferncia de gua e de carbono (CO2) entre caracterizao e o relacionamento do comportamento das necessidades hdricas e obtido experimentalmente. Nes- tembro ou outubro. Para o olival tradicional na regio de
a planta e a atmosfera e uma condutncia estomtica ele- trocas gasosas de variedades de oliveira sujeitas a diferen- ta abordagem, as necessidades de rega (ETc) so obtidas Moura (var. Cordovil) recentemente submetido rega, o
vada (baixa resistncia estomtica) tende a favorecer uma tes condies de disponibilidade hdrica com a condutn- multiplicando ET0 pelo Kc (ETc = Kc * ET0), ainda que seguinte quadro apresenta a relao entre a transpirao
elevada taxa de transpirao e de fotossntese, resultan- cia estomtica, relacionando-as com a disponibilidade de se saiba que os coeficientes culturais tabelados podem va- (T) e ET0 obtida de um ensaio de rega conduzido na Her-
do consequentemente numa diminuio do contedo de gua no solo e na planta, para o estabelecimento de valo- riar entre locais, e at mesmo entre anos, dependendo das dade dos Lameires, em Safara, onde o tratamento A de
gua no solo, o que por sua vez far diminuir a condutn- res-limite de condutncia e/ou potencial hdrico (das fo- condies atmosfricas locais e inter-anuais. O mtodo de rega plena, em que se aplicou bastante gua de rega, da or-
cia estomtica com o tempo. Dai ter que se regar. No olival lhas e/ou do solo) abaixo dos quais se deve aplicar gua clculo de Kc mensal pressupe integrar as quatro com- dem dos 800 mm, o tratamento B de rega deficitria sus-
essa rega vai sendo praticada com sistemas de rega gota a de rega. Na verdade, a transpirao da oliveira contro- ponentes da evapotranspirao (ETc), a saber: transpira- tentvel, com aproximadamente 60% dagua aplicada no
gota, que favorecem elevadas eficincias e uniformidades lada pela condutncia estomtica, que por sua vez mui- o da planta (Kp), evaporao direta da gua intercep- tratamento A, o tratamento C, de rega deficitria contro-
de aplicao de gua. to sensvel s variaes diurnas da radiao fotossinteti- tada pela copa (Kpd), evaporao do solo (Ks1) e evapora- lada, em que se regou apenas em alguns perodos conside-
camente ativa absorvida pelas rvores (fPAR), ao dfice de o da reas molhada pelos gotejadores(Ks2), e requer in- rados crticos e tratamento D, desequeiro, sem rega e com
Potencial hdrico foliar e a rega presso de vapor, temperatura da folha, condutividade formao sobre a densidade de plantao e do volume da as rvores usando apenas a gua das chuvas,armazenada
Trabalhos experimentais tm indicado valores de po- hidrulica no interior da planta e ao contedo hdrico do copa, ET0, fraco do solo molhada pelos gotejadores e in- no perfil do solo durante o outono-inverno. (Ramos e San-
tencial hdrico a variar com as cultivares, o contedo de solo nas zona das razes. Desta forma, qualquer flutuao tervalo entre regas (Orgazetal., 2006). tos, 2009).
{ 96 } O grande livro da oliveira e do azeite { 97 } O grande livro da oliveira e do azeite

T/ET0, tratamento e smbolo


1.2
Propagao da oliveira; rediferenciao de vrios tipos de clulas como as dos teci-
Ms A (u) B ()
C ( D)
D (X) 1.1
metodologias dos sub-epidrmicos, do crtex, cmbio, floema secund-
rio, periciclo, ou feixes vasculares (Ono et al., 1996).
Mar 0.75 0.92 0.88 0.65 1.0

e sua evoluo Em oliveira, a capacidade de desenvolvimento das ra-
Abr 0.80 1.02 1.03 0.59
0.9

Por Augusto Peixe, M Leonilde zes adventcias provou ser extremamente varivel entre as
Mai 0.69 0.73 0.88 0.40

Jun 0.61 0.70 0.67 0.46


0.8 Santos e Sara Porfrio cultivares (Salama et al., 1987, El-Said et al., 1990, Fouad et

T/ET0


al., 1990). Diferenas na estrutura anatmica das estacas
Jul 0.60 0.74 0.57 0.39 0.7
foram propostas para explicar esta dependncia do gen-
Ago 0.67 0.84 0.44 0.37
0.6


Introduo tipo, com vrios autores a afirmarem que a presena de um
Set 0.91 1.01 0.39 0.49
Nas oleceas, famlia botnica onde se inclui a olivei- anel contnuo de esclernquima entre o floema e o crtex,
0.5
Out N/A N/A 1.04 0.70

ra, para alm da multiplicao por via sexuada (semente), pode por vezes atuar como uma barreira mecnica para a

0.4 a capacidade que as clulas vegetais tm de expressar a sua emergncia das razes (Ciampi e Gellini, 1963, Salama et

Uma anlise cuidada desses dados de T/ET0 indicam 0.3
totipotncia permite tambm a multiplicao por via asse- al., 1987, Qrunfleh et al., 1994). Outros autores no entan-
que a relao T/ET0 mais elevada nos meses de maro fev mar abr mai jun jul ago set out nov xuada ou vegetativa (estacaria, enxertia, mergulhia, etc..). to referem que a incapacidade de vrias cultivares de oli-
e abril, reduzindo-se progressivamente durante o vero, Se no primeiro caso, especialmente em espcies alogmi- veira para formar razes adventcias, est associada a cau-
para voltar a aumentar a partir de setembro. Tambm se Fig. 001 Transpirao (mm d-1) em olival nas diferentes cas como oliveira se obtm uma descendncia que mani- sas genticas, bioqumicas ou fisiolgicas, e no a aspetos
modalidades de rega (satisfao das necessidades mximas da
observa que esses valores no so mais elevados no tra- festa sempre caractersticas que refletem a variabilidade ligados estrutura anatmica do caule (Bakr et al., 1977,
cultura, satisfao de 60% das necessidades mximas, rega
tamento A do que em B, facto curioso e de grande impor- durante trs perodos crticos do ciclo vegetativo) e em sequeiro
gentica dos dois progenitores, dando origem a produtos Fabbri, 1980).
tncia na gesto da rega do olival. Por mais gua que se (). hbridos, j no segundo se obtm clones, genotpica e fe-
aplique ao olival (como no tratamento A), esta espcie no notipicamente idnticos planta da qual se retirou o pro- A propagao da oliveira
responde com maiores incrementos de transpirao, ha- das folhas, permitindo estabelecer os valores-limite, crti- pgulo vegetativo utilizado no processo de multiplicao
vendo um ptimo de gua que preciso atingir, e que neste cos, dessas ltimas variveis, a partir dos quais se deve ini- escolhido.
da antiguidade ao incio
caso se apresenta prximo da gua aplicada ao tratamen- ciar a rega. De um modo geral a formao de razes adventcias do Sc. XX
to B. Da o sucesso da rega dita deficitria. Curioso tam- 6 um passo obrigatrio na propagao vegetativa e, na oli- Propagao por estacaria
bm de notar que o valor de T/ET0 aumenta substancial- ??????????? veira, assim como em muitas outras espcies, dificuldades Desde a antiguidade que o mtodo mais utilizado para
???????
mente a partir de setembro, devido s primeiras chuvas de 5
????????? associadas a este processo resultam frequentemente em propagar a oliveira tem sido a estacaria. A ele j se refe-
??????? ???
outono, facto que crucial para a manuteno do olival de perdas econmicas significativas. re Columela (s.d., traduo de Tinajero, 1897) na sua obra
sequeiro. Em anos de pouca disponibilidade de gua para 4 Inicialmente o enraizamento adventcio foi considera- Os Doze Livros de Agricultura, que remonta ao perodo do
Transpirao, mm/dia-1

a rega, deve-se reduzir a aplicao de gua durante o vero do como um processo caracterizado por uma s fase, sob Imprio Romano. Em 1902, Cmara define em pormenor
e aplicar essa gua nos meses de setembro e outubro, caso 3 o controlo de um regulador de crescimento especfico (ri- oito tipos de estacas lenhosas, destas, trs so para utiliza-
haja falta de chuva (como aconteceu em 2011, p.ex.). Este zocalina). No entanto, progressos considerveis foram fei- o direta no local definitivo de plantao (estacas de he-
facto no de todo indito no Alentejo e h que regar nes- 2 tos nas ltimas dcadas para uma melhor compreenso do mifuste, de tanchoeira e de tancho), enquanto os cinco
sas alturas. enraizamento, caracterizando-o como um processo evolu- restantes (estacas de troos, de talo, de polas, de raz e de
A transferncia dos valores do quadro anterior para a 1 tivo, que consiste numa srie de fases, sucessivas e inter- protuberncias), implicam a colocao prvia do propgu-
seguinte forma grfica (Ramos e Santos, 2009) mostra que dependentes (iniciao, induo e expresso), cada uma lo em viveiro com posterior transplantao para o local de-
as curvas resultantes (simbologia no quadro anterior) se- 0 apresentando necessidades fisiolgicas e ambientais espe- finitivo da planta j enraizada.
guem o padro de comportamento invertido, o que se deve 15 fev 16 mar 14 abr 13 mai 11 jun 10 jul 8 ago 6 set 5 out 3 nov 2 dez cficas (Moncousin et al., 1988, Gaspar et al., 1992, Gaspar Ao longo dos anos, algumas das designaes apresen-
ao efeito combinado da descontinuidade da precipitao et al., 1994, Rout et al., 2000). tadas por Cmara (1902) para os vrios tipos de material
que caracteriza o regime mediterrnico, da incompleta co- A fase de induo caracterizada por modificaes a lenhoso utilizado na propagao da oliveira, ou deixaram
bertura do solo e da natureza fisiolgica da oliveira. Referncias nvel molecular e bioqumico sem alteraes visveis ana- de se utilizar, como a caso das estacas de hemifuste, ou
A seguinte figura apresenta essa dinmica do uso da Testi, L., Villalobos, F.J., Orgaz, F. eFereres, E. (2005). tomicamente. A fase de iniciao caracteriza-se por divi- sofreram alteraes nas suas designaes, como o caso
gua pelo olival (transpirao), obtida de informao for- Waterrequirementsofoliveorchards I:simulationofdaily ses celulares que podem por um lado originar a forma- das estacas de protuberncias, atualmente designadas por
necida por sensores de fluxo de seiva, que introduzidos no evapotranspiration for scenarioanalysis. IrrigationScien- o do calo de cicatrizao e, por outro, conduzem orga- vulos. Em 1952, Galvo, na 2 edio do Manual do Olivi-
tronco das rvores permitem detectar a velocidade do flu- ce24: 69-76. nizao dos primrdios da raiz, eventos estes j detetveis cultor, apenas refere as tanchoeiras, as estacas de viveiro,
xo circulante e da inferir em tempo real a transpirao Orgaz, F., Testi, L., Villalobos, F.J., eFereres, E. (2005). histologicamente. Por ltimo, a fase de expresso, caracte- os vulos e as plas, como formas de multiplicao da oli-
(T).Esses valores podem ser usados para desencadear e Waterrequirementsofoliveorchards- II: determiningthe- riza-se pelo crescimento dos primrdios radicais e emer- veira por estacaria lenhosa.
quantificar a rega(quando e quanto regar) ou podem ser cropcoefficients for irrigationscheduling. IrrigationScien- gncia da raiz, conduzindo a significativas alteraes na A facilidade com que a maior parte das variedades de
relacionados com a evoluo do contedo de gua no solo ce24: 77-84. morfologia externa da estaca (Li et al., 2009). oliveira enrazam por estaca lenhosa, no est totalmente
e/ou com o potencial hdrico e a condutncia estomtica Ramos, A.F. & Santos, F.L. (2009). Water use, trans- As razes adventcias podem originar-se a partir da esclarecida. sabido que no se deve existncia de razes
piration, andcropcoefficients for olives (cv. Cordovil),
growninorchardsin Southern Portugal.Biosystemsengine-
ering 102: 321333.
Fereres, E., Orgaz, F., Pastor, M. (2005). Relaciones
Suelo-gua-Planta. In Cultivo delOlivoconRiego Loca-
lizado. Ed. Miguel Pastor Muoz-Cobo. Mundi-Prensa e
Junta de Andalucia.
{ 98 } O grande livro da oliveira e do azeite { 99 } O grande livro da oliveira e do azeite

areas, que nunca foram observadas no gnero Olea, mas longo do tempo deveu-se principalmente ao facto de a assim como a transplantao, tanto do primeiro para o se- em conta aquilo que se pretende de um olival, outras,
pode ser devida, como referem Fabbri et al. (2004), exis- planta enraizar diretamente no local definitivo, sem ne- gundo viveiro, como destes para o local definitivo, deve ser como uma mais fcil difuso de variedades com caracte-
tncia de pontos meristemticos latentes nos caules mais cessidade de viveiros ou posteriores transplantes. Assim, feita no incio da Primavera. Esta utilizao de dois vivei- rsticas interessantes, o aproveitamento de propriedades
antigos, que tero grande facilidade de evoluir para novos no obstante as desvantagens referidas anteriormente, ros no sendo muito comum, proposta por Galvo (1952), particulares de alguns porta-enxertos ou a reduo do pre-
rebentos ou novas razes, dependendo das condies a que este foi at ao incio do sc. XX o sistema de propagao como forma de adaptar as plantas s condies que vo en- o de produo das plantas, tm sido apontadas ao longo
so submetidos. preferido por muitos agricultores, principalmente nas re- contrar no local definitivo e tambm para melhorar a qua- do tempo pelos defensores da tcnica.
gies onde os viveiros de oliveiras no existiam. lidade do sistema radical.
Tanchoeiras Relativamente a esse assunto, Cidraes (1939), para De acordo com este autor, as razes formadas neste Enxertia de garfo sobre plantas de semente
A tanchoeira (garrote para os Espanhis) ser de todos alm de tambm referir os inconvenientes da utilizao da tipo de estaca so finas, compridas e pouco ramificadas. Atualmente o mtodo de enxertia mais utilizado em
estes mtodos o mais antigo (Galvo, 1952). A ele j faziam tanchoeira como forma de propagao da oliveira, salien- Deste modo, a transplantao para o segundo viveiro aps viveiros para a obteno de plantas enxertadas o de garfo
referncia DHerrera (1645) ou Dalla-Bella (1786), mas, ain- ta ainda a importncia da instalao de viveiros por for- 2 anos no viveiro inicial e a poda radical ento efetuada, por incrustao de topo sobre plantas de semente (Fig. 5).
da segundo Galvo (1952), ser tambm o que mais proble- ma a fornecer plantas de melhor qualidade para os novos obriga a uma ramificao das razes originando um siste- Este mtodo j foi tambm testado para enxertia de plan-
mas apesenta. De entre estes o autor destaca a baixa qua- olivais. Acrescenta ainda que os viveiros industriais ento ma radical de melhor qualidade. Para o segundo viveiro tas auto-enraizadas, tentando assim tirar-se partido da
lidade do sistema radical (poucas razes e no uniforme- existentes em Portugal se situavam no norte do pas e no deve escolher-se um solo semelhante ao que vai ser utili- utilizao de porta-enxertos clonais, mas devido ao eleva-
mente distribudas no permetro do tronco) e tambm a Algarve e, ainda que possuindo capacidade para colocar zado para a plantao do olival. do valor a que estas plantas tm de ser vendidas por forma
impossibilidade de utilizar a pastagem no olival, principal- plantas em todo o pas, produziam material de qualida- Normalmente neste viveiro no se efetuavam regas de a tornar a tcnica economicamente vivel para o viveirista,
mente quando se recorre tanchoeira curta. Esta designa- de duvidosa. modo a promover a adaptao das plantas s condies no tem encontrado grande expresso.
o de tanchoeira longa e curta mais recente, tendo a l- Segundo o mesmo autor os primeiros viveiros particu- naturais de desenvolvimento no campo. A enxertia sobre plantas de semente remonta a tem-
tima designao substitudo o que Cmara (1902) designa- lares estavam ento a instalar-se na regio de Elvas e Cam- Atualmente o processo de multiplicao por estaca le- pos imemoriais e, de um modo geral, at s mais recen-
va por estaca de tancho. A tanchoeira longa referia-se a po-Maior levando a uma menor utilizao da tanchoei- nhosa ainda tem alguma expresso e de acordo com Fab- tes comunicaes sobre o assunto, os problemas identifi-
uma estaca de 3-4 anos, com 4-10 cm de dimetro e 1,5-2 m ra nesta regio onde anteriormente era to comum. Tam- bri et al. (2004), cerca de 5 milhes de plantas de olivei- cados so sempre os mesmos; - dificuldade de germinao
de comprimento, enquanto a curta se referia a uma estaca bm na margem direita do Guadiana a tanchoeira estava a ra ainda so produzidas anualmente por este processo. Na das sementes e tempo necessrio para produzir uma plan-
do mesmo tipo mas apenas com 0,8-1 m de comprimento. deixar de utilizar-se, mas, neste caso, devido s condies maior parte dos casos j no se recorre a viveiro em solo fa- ta capaz de ser enxertada.
A persistncia deste processo de multiplicao ao edfo-climticas pouco propcias da regio. zendo-se a plantao das estacas verticalmente em sacos Um endocarpo extremamente duro e a dormncia
J nos concelhos da margem esquerda onde os terrenos
conservavam alguma frescura durante o vero, a tanchoei-
ra, baixa no concelho de Moura e alta na Granja-Amarele-
ja, continuava a ser a forma mais comum de propagao, o
mesmo acontecendo no concelho de Castelo-Branco.
Nesta ltima regio as tanchoeiras eram protegidas
por um entranado de palha de centeio (Fig.1), enquanto
no resto do pas a proteo se fazia com o recurso a mon-
tculos de terra (Fig.2), onde se colocava um tubo que per-
mitia humedecer o solo junto estaca (D, na Figura 2).

Estacas de viveiro
A estacaria lenhosa de viveiro, outro processo de pro-
pagao vegetativa utilizado para a propagao da olivei-
Fig.000 Esquema ilustrando uma tanchoeira protegida por Fig.000 (A) Estacas lenhosas em viveiro antes de serem
ra, tambm remonta segundo Fabbri et al. (2004) po- de plstico (Fig.4).
um montculo. ( de terra. Note-se assinalado por (D), o tubo cobertas com terra. Colocao horizontal sobre a superfcie
que depois de retirado originava o canal para colocao da gua ca dos Fencios, Romanos e rabes, mas, ao contrrio das do solo (Fonte - Fabri et al. 2004). (B) Estaca com novos
junto estaca. (Fonte - Galvo, 1939, 1952) tanchoeiras, ainda hoje continua a ter alguma expresso. Propagao por enxertia lanamentos e com razes, neste caso, de uma estaca inicial
As estacas de viveiro devem ser retiradas de ramos com Quase to antigo como a propagao por estaca lenho- obtinham-se e novas plantas (Fonte Peixe, 1997).
Fig. 000 Tanchoeiras protegidas por um entranado de palha 2-6 cm de dimetro sendo depois cortadas com serra em sa o processo de propagao por enxertia, Columela (s.d.,
de centeio em plantao de novo olival na regio de Castelo- Fig.000 Estacas lenhosas na posio vertical em sacos de
troos com aproximadamente 25-40 cm. O solo escolhi- traduo de Tinajero,1897), a ele se refere, ainda que no
Branco. (Fonte - Galvo, 1939, 1952) plstico (Fonte Peixe, 1997).
do para a instalao do viveiro deve ser frtil, bem drenado o apresente como forma de multiplicar a oliveira e Dalla-
e fresco (especialmente se o viveiro no for regado), mas -Bella (1786), no s a ele se refere, como diz ser esta a me-
sem apresentar tendncia para o encharcamento. lhor forma de obter plantas de oliveira produtivas, vigoro-
As estacas podem ser colocadas no viveiro tanto ho- sas e de grande longevidade.
rizontalmente (Fig.3) como verticalmente e a plantao, Para alm destas vantagens, hoje questionveis tendo
{ 100 } O grande livro da oliveira e do azeite { 101 } O grande livro da oliveira e do azeite

Fig. 000 Diferentes fases


da produo de plantas
Outras tcnicas de
enxertadas a partir da propagao utilizando
germinao de sementes.
(A) Bancadas de germinao
material lenhoso
de sementes. (B) Pormenor
das plantas enraizadas. vulos
(C) Enxertia de garfo sobre
Esta tcnica foi inicialmente conhecida como propa-
as plantas germinadas.
(D) Pormenor da enxertia. gao por estacaria de protuberncias (Cmara, 1902) e s
(E) Estufa com plantas j mais tarde passou a ser designada de propagao por ma-
enxertadas. (Adaptado milos radicferos (Galvo, 1939) ou por vulos (Cidraes,
de COI - http://www. 1939), que os espanhis designam por zuecas e os italia-
internationaloliveoil.org/ nos por ovoli.
projects/paginas/Section-c.
Consiste em aproveitar as excrescncias em forma de
htm)
mamilo que naturalmente se formam no tronco, colo ou
sapata da oliveira adulta (Fig. 8). De acordo com Cidra-
es (1939), so formadas por tecido parenquimatoso tenro,
mais ou menos esbranquiado, rico em substncias de re-
serva e possuindo grande nmero de gomos adventcios.
Quando separados da planta original e plantados em vi-
veiros, estes vulos emitem vulgarmente um tufo de re-
bentos e razes, bastando depois fazer a sua diviso com
um instrumento de corte em tantas sees quantos os re-
bentos com raiz que se formam.
Segundo Galvo (1939, 1952) o mtodo tem a vanta-
gem de reduzir ao mnimo a quantidade de madeira velha
fisiolgica do embrio, so as principais causas da dificul- Enxertias de placa que fica na nova planta, mas, de acordo com o mesmo au-
dade de germinao das sementes. Os textos mais antigos A enxertia de placa sobre plantas com 3-5 anos de tor e com Cidraes (1939), tem o inconveniente de a extra-
referem a possibilidade de alimentar animais com as azei- idade, realizada ainda em viveiro (no solo ou em conten- o dos vulos, mesmo quando feita no Inverno, em pero-
tonas e a posterior recolha das sementes nos dejetos, como tores), ou j no local definitivo (Fig. 6), tem apresentado do de reduzida atividade vegetativa e recorrendo a instru-
uma forma de amolecimento do endocarpo (autor??????).. taxas de sucesso elevadas. mentos bem afiados, mutilar significativamente a planta
Atualmente o endocarpo pode ser retirado por meios me- Segundo Fabbri et al. (2004), so multiplicadas anu- dadora. Como normalmente estas estruturas se formam
cnicos sem danificar o embrio procedendo-se depois almente por enxertia 7 milhes de plantas todo o mundo. em plantas j velhas, o corte pode condenar a mesma irre-
germinao em cmaras de ambiente controlado em subs- Mas a enxertia da oliveira no tem utilizao apenas mediavelmente. Assim, como referido por Cidraes (1939),
tratos estreis, o que reduz significativamente os proble- para a obteno de plantas destinadas a novas planta- a tcnica s deve ser utilizada se a rvore de onde so reti-
mas apontados. es, a tcnica tem tambm sido utilizada para a substi- rados os vulos estiver condenada ao arranque.
Como referimos anteriormente, a enxertia de jovens tuio da variedade produtora em olivais j instalados ou
plantas multiplicadas vegetativamente no tem conduzido para a reparao de rvores danificadas quer por ao de Plas
aos resultados esperados, devido ao fraco vigor destas plan- mquinas quer por acidentes climticos. As plas ou ps-de-burro desenvolvem-se na base do
tas durante o primeiro e segundo anos aps o enraizamento Nesses casos, com as devidas adaptaes tendo em tronco de oliveiras adultas tendo a sua origem em vu-
das estacas. Mas o interesse atual de obteno de porta-en- conta o grau de lenhificao dos ramos onde se faz a en- los. A elas j autores como Dalla-Bella (1786) faziam refe-
xertos ananicantes adaptados aos novos sistemas de condu- xertia, o processo continua a ser a enxertia de placa. Na fi- rncia indicando-as como forma de multiplicar facilmen-
o em alta densidade e ainda a importncia de se conse- gura 7, apresenta-se a sequncia de operaes destinada te a oliveira. Como os rebentos tm dificuldade em enrai- Fig,000 Enxertia de placa em plantas jovens no local
guir resistncia a fatores biticos e abiticos, como sejam substituio de uma variedade num olival adulto. zar quando separados da planta me antes de terem for- definitivo. (A B) Preparao da placa a partir de um
por exemplo a resistncia ao Verticillium dahliae, problema mado o seu prprio sistema radical (Galvo, 1939; 1952), lanamento com 1-2 anos de idade. (C D) Abertura da janela
premente em algumas zonas olecolas espanholas, e sali- so normalmente retirados da rvore, quando adquiriram de enxertia numa zona de entren no tronco da jovem planta.
nidade, devido cada vez pior qualidade das guas de rega, suas prprias razes e por isso no podem ser considerados ( E ) Colocao da placa na janela de enxertia. (F) Fixao e
proteo do enxerto. (Fonte Web - autor desconhecido).
so razes que levaram a estudar adaptaes tcnica de estacas em sentido estrito.
enxertia de garfo utilizada nas plantas de semente. Para ajudar ao enraizamento dos rebentos assim for- Fig. 000 (A) Pormenor de vulos (*) na base do tronco
mados, a base da rvore coberta com uma fina camada de uma oliveira. (B) Esquema ilustrativo do desenvolvimento
de uma nova planta de oliveira a partir de um vulo.
(Fonte: Fabri, 2004).
{ 102 } O grande livro da oliveira e do azeite { 103 } O grande livro da oliveira e do azeite

Fig. 000 Transplante de rvores adultas. (A) Identificao da


de solo. A anielagem dos novos rebentos junto base ten- rvore a transplantar. (B) Preparao para o transplante. (C)
de a favorecer ainda mais a formao de razes adventcias. Arranque da rvore. (D e E) Transporte para o novo local. (F)
Na Primavera, as plas enraizadas so separadas da planta rvore recuperada no novo local.
me juntamente com um pouco de madeira velha, e trans-
plantadas para viveiro antes de serem plantadas no local
definitivo. Embora este mtodo de multiplicao possa ser
usado para a substituio de um pequeno nmero de r- mas, a partir do momento em que a oliveira comeou a ser
vores, ele no pode ser utilizado ao nvel do viveiro porque encarada como uma planta ornamental, transplantam-se
lento e dispendioso (Fabbri et al., 2004). agora rvores centenrias dos seus locais de origem para
jardins pblicos ou privados e para outros espaos de la-
Tcnicas de Transplantao zer (Figura 13).
A descoberta aps a 2 Guerra Mundial dos polme-
ros sintticos como o poliestireno, o polietileno e o vinil e A propagao da oliveira
a sua forte difuso na vida quotidiana, na indstria e mes-
mo na agricultura, possibilitaram a utilizao de sacos e
de meados do Sc. XX
vasos de dimenses variveis e eliminaram em grande par- atualidade
te a necessidade de transplante das plantas obtidas pelos A expanso da rea de olival tanto nas regies tradicio-
processos de propagao at aqui referidos, mas, anterior- nalmente produtoras, como em novas regies, motivada
mente, o transplante entre viveiros e destes para o local por um acrscimo significativo do consumo de azeite a n-
Fig. 000 Enxertia de placa em rvores adultas. (A) rvore
definitivo era uma operao delicada. vel mundial, teve como consequncia natural um aumen-
a ser utilizada no processo de enxertia. (B) Preparao da
rvore por eliminao das pernadas principais. (C) Preparao Para facilitar essas operaes foram desenvolvidos v- to da procura de plantas.
do local de enxertia. (D) Preparao da placa a ser utilizada, rios equipamentos, cujo nvel de complexidade era dire- Atualmente a produo anual de oliveiras nos princi-
a partir de um ramo com 2-3 anos de idade. (E) Colocao da tamente proporcional ao tamanho da planta a transplan- pais pases olecolas do mundo de cerca de 40 milhes,
placa na janela de enxertia. (F) Fixao da enxertia com cordel. tar. Cmara (1902) descreve com pormenor alguns destes com 32 milhes na bacia do Mediterrneo e 8 milhes no
(G) Proteco da zona de enxertia com papel de embrulho. (H)
transplantadores, que aqui se apresentam nas figuras 9 a resto do mundo (COI 2000). De acordo com a mesma fon-
Aspeto dos novos rebentos evoluindo
12. te, 28 milhes destas plantas so obtidas anualmente por
a partir das enxertias efetuadas. (Fotos gentilmente cedidas
pelo Eng. Luis Santos) Estes artefactos que hoje mais fazem lembrar instru- meio de propagao de estacaria semi-lenhosa sob nebu-
mentos de tortura, no tm j qualquer utilidade prtica, lizao. Esta tcnica que se dispersou amplamente entre
Fig. 000 Fazer as legendas a partir do livro Cmara (1902), de mas o transplante de plantas de oliveira continua a fazer- 1950 e 1960 assim o mtodo de propagao mais comum,
onde foram retiradas as imagens. -se, no entre viveiros nem destes para o local definitivo, nos casos onde no h nenhuma restrio financeira ou
{ 104 } O grande livro da oliveira e do azeite { 105 } O grande livro da oliveira e do azeite

tcnica. Os materiais de propagao utilizados vm do vi- e refere-se ainda aos ramos estiolados indicando que con- Estas bancadas so frequentemente construdas em A nebulizao feita por aspersores sobre as banca-
veiro propriamente dito (campos de ps-me), de viveiros duzem a melhores resultados que aqueles expostos luz cimento, com a base perfurada para assegurar a drenagem. das que funcionam 5-10 segundos em cada 20-30 minutos,
prximos ou de olivais de produo, geralmente situados a solar direta. Nos seus ensaios chega a resultados que vo Sobre a base assenta uma camada de calhaus rolados, hoje durante o dia e mais espaadamente noite.
no mais de 50 a 100 quilmetros do viveiro. de encontro quilo que hoje se sabe sobe a fisiologia do frequentemente substitudos por argila expandida Leca, A radiao solar controlada por um painel solar, in-
enraizamento em estacas semi-lenhosas, ainda que em para fcil escoamento da gua de rega. Superiormente terior, regulado por um sensor exterior estufa. Este pai-
Propagao por estacaria semi-lenhosa alguns casos apresente justificaes para esse comporta- existe uma camada de areia, sendo colocada no meio dela, nel abre ou fecha automaticamente, em funo da radia-
Cidraes (1939) j fala brevemente sobre este mtodo, mento que atualmente so questionveis. uma resistncia eltrica ou tubos de circulao de gua o solar existente.
dando-lhe o nome de propagao por estaca verde. Refe- Na verdade, sabemos atualmente que as condies quente, dependendo do tipo de sistema de aquecimento A temperatura das bancadas controlada por term-
re o autor que se trata de um mtodo poca j muito uti- ambientais, os substratos de enraizamento e os regulado- utilizado e que abrangem toda a bancada, de forma a man- metros de mercrio vermelho, que, com maior ou menor
lizado nos EUA (Califrnia) mas, devido necessidade de res de crescimento, para alm do prprio gentipo, consti- ter a temperatura desejada no substrato de enraizamento. preciso, permitem registar os valores da temperatura da
equipamento sofisticado e mo-de-obra qualificada ainda tuem os principais fatores que afetam o enraizamento das So vrios os substratos que podem ser utilizados: perlite.
pouco utilizado na Europa. Natividade (1943) na sua obra estacas semi-lenhosas. - Vermiculite - apresenta boas condies de arejamen- A humidade relativa e a temperatura ambiente da es-
A heterofilia da oliveira do ponto de vista da propagao O processo tem vindo a ser melhorado, com estufas to e de reteno de gua. Tem elevada capacidade de inter- tufa so controladas por um termohigrgrafo.
vegetativa apresenta os primeiros resultados da aplicao cada vez mais sofisticadas. cmbio catinico e geralmente uma certa quantidade de A propagao vegetativa por estacaria consiste na pos-
do mtodo em Portugal, referindo quase com alguma sur- As estufas so coberturas transparentes radiao potssio e magnsio assimilvel; sibilidade de criar novos indivduos auto-enraizados, ob-
presa que possvel obter plantas perfeitamente enraiza- solar visvel de pequeno comprimento de onda (400 a - Perlite material amorfo, de origem vulcnica, sem tidos de ramos colhidos em plantas bem seleccionadas e
das em 90-120 dias e que estas podem atingir os 50 cm de 700nm), mas opacas s radiaes de grande comprimen- elementos nutritivos e sem capacidade de intercmbio ca- existentes num campo de ps-mes. Utilizam-se peque-
altura em 180-210 dias. to de onda (infravermelhos > 1000nm), emitidas pelo solo tinico. Granulado rugoso, cuja funo ser s o de servir nas estacas 15cm de material semi-lenhoso (Fig. 17) que
O autor ter testado diferentes perodos de recolha das e pelas plantas e que causam o chamado efeito de estufa de suporte s estacas e de reter uma quantidade de gua so sujeitas s diferentes fases do processo.
estacas obtendo os melhores resultados no perodo que (Joyce, 1996). necessria estaca. Tem uma boa porosidade, pH neutro,
medeia entre a colheita e o incio do abrolhamento prima- Nas estufas existem bancadas de enraizamento (Fig. no um meio propcio formao de algas e pode ser fa- A Fase de enraizamento
veril, testou tambm a influncia do posicionamento da 14), com sistema de rega automatizado, sistema de aqueci- cilmente esterilizada (FAO- 1976). Esta fase inicia-se com a recolha do material vegetal a
estaca na rvore me, concluindo que os ramos da base mento individualizado por bancada e com sistema regula- Em 1993, Surez et al. utilizaram tambm cortia, cor- ser utilizado num Campo de ps mes. Este constitudo
do tronco tm uma melhor aptido para o enraizamento dor de ambiente (temperatura e humidade). tia lavada, e misturas de perlite com cortia. Os resulta- por plantas perfeitamente identificadas e seleccionadas,
dos obtidos na percentagem de enraizamento com estes
Fig. 000 Pormenor de uma bancada de enraizamento. substratos no apresentaram diferenas significativas, e,
Meio de segundo os autores, pode existir um efeito txico nos res-
Fig. Estufa de nebulizao bancadas com perlite enraizamento
Bicos de
(perlite) duos de cortia no lavada.
(Foto - Leonilde Calado, 1994) nebulizao
Ardaz et al. (1993) utilizaram l de rocha, substn-
Fig. 000 Bicos de nebulizao e painis higroscpicos. cia mineral que, pela sua extenso, forma parte importan-
te da massa terrestre. Material ligeiro, fibroso, esponjo-
Rede so, absorvente e estril. Tem uma elevada capacidade de
QUADRO Resistncias reteno de gua, e boas condies de arejamento. Alm
ELTRICO eltricas
desta matria os autores utilizaram tambm sepiolite, ou
Areia
seja um hidrosilicato de magnsio, com boas condies de
Cascalho arejamento.
Relgio
Tambm foi ensaiada areia, gravilha, areia+vermiculite,
Intervalo
areia+gravilha e gravilha+vermiculite (Khalidy et al., 1972),
Durao no entanto, o substrato que continua a ter uma maior utili-
zao neste processo a perlite (Fig. 15)
Orifcios A temperatura de enraizamento deve ser na ordem
de drenagem
dos 24-26C, devendo a estufa manter uma temperatura
Termostato
Vlvula ambiental entre os 21-24C, durante o dia e cerca de 15C
noite.
A humidade relativa dentro da estufa dever ser sem-
Torneira pre da ordem dos 100 %. Mantm-se esta taxa de humida-
de por um sistema de nebulizao, cujo mecanismo se re-
gula em funo do aumento ou diminuio da temperatu-
Entrada de gua ra ambiental cooling system.
para nebulizao
{ 106 } O grande livro da oliveira e do azeite { 107 } O grande livro da oliveira e do azeite

de p franco e com um bom desenvolvimento vegetativo folhas com uma tnue pelcula de gua, que provoca uma
Estes campos devem obedecer a determinadas prti- diminuio da temperatura dos tecidos da folha e, por sua
cas culturais: podas anuais proporcionando sempre uma vez, um aumento da tenso de vapor, reduzindo a transpi-
rebentao vigorosa, e dar rvore o aspecto de arbusto rao e por conseguinte mantendo as folhas na estaca at
baixo, facilitando a recolha das estacas; favorecer o desen- emisso das razes (Figs. 19 e 20).
volvimento vegetativo, promovendo adubaes e regas, Com a presena de humidade ser tambm permitido
tendo em ateno o estado sanitrio das rvores e evitar a aproveitar o mximo de luminosidade natural, sem que os
produo de gomos florais tecidos das folhas sejam sujeitos a temperaturas crticas.
A melhor poca para a colheita do material a prima- Nestas condies, os rgos ativos e elaborantes da esta-
vera, ainda que esta seja possvel durante todo o perodo ca esto em condies de um desenvolvimento de assimi-
de crescimento anual. As colheitas devem ser efetuadas lao e transformao, tanto de natureza trfica como fito
durante a manh e o material vegetal deve ser conservado hormonal, que influenciam a rizognese.
em local fresco e hmido at sua preparao. A capacidade de enraizamento das estacas de olivei-
Depois de preparadas e antes da sua colocao na ban- ra est dependente do estado fenolgico das rvores e do
cada de enraizamento, as estacas so submetidas a um tra- tipo de estaca utilizada. Os ramos do ano, com 45-60 cm
tamento com uma soluo de cuprovite 5 g/l, tendo-se o de comprimento e destinados multiplicao, podem ser
cuidado de molhar bem as folhas. divididos em trs partes e dar origem a trs espcies de es-
Depois disso segue-se o tratamento base das mesmas tacas: - basais, mdias e apicais.
com uma soluo hormonal base de cido indol-3-butri- Estes trs tipos de estacas apresentam uma capacida-
co (IBA). A aplicao de auxinas na base das estacas deter- de de enraizamento diferente, que, se pode relacionar com
mina um aumento da capacidade de enraizamento das es- a diferente composio qumica que os ramos apresentam
tacas. As hormonas promotoras de enraizamento podem- na base ou na extremidade. Normalmente as estacas api-
-se aplicar na forma de p, misturadas com talco, como cais oferecem melhores resultados, quando os ramos se
pasta, misturadas com lanolina ou em solues hidro-al- obtm no comeo da atividade vegetativa, enquanto as es-
colicas de 50 a 100%. tacas mdias e basais podem ter resultados mais satisfat-
Os melhores resultados tm sido obtidos com regula- rios no Vero.
dores de crescimento do tipo auxnica: cido indolbutri- As estacas colhidas no Inverno so caracterizadas por
co (IBA), cido indol-actico (IAA), cido naftaleno-ac- uma menor capacidade de enraizamento, devido aos n-
tico (NAA), em concentraes variveis entre 2500 a 7500 veis de temperatura e luminosidade serem mais baixos.
partes por milho (ppm) durante 10 a 15 (Fig. 18). O tra- Na Primavera, a atividade metablica da rvore m-
tamento mais usual a aplicao de IBA a 3500ppm em so- xima e as reservas so mais mobilizadas para assegurar o
luo hidro-alcolica a 50% durante 10. crescimento de novos rebentos e o desenvolvimento de r-
Em trabalho apresentado anteriormente (Cala- gos florais.
do-1992) pode-se concluir que os reguladores de nature- Os melhores resultados foram obtidos em ensaios com
za auxnica, aumentam a capacidade de enraizamento das estacas colhidas de Fevereiro a Abril e de Julho a Agosto.
diversas cultivares de oliveira, embora, sem dvida, esta As estacas enraizadas aps os 60 (Fig. 21) dias so en-
capacidade esteja muito dependente da cultivar e do esta- sacadas e passaram para um estufim onde permaneceram
do do material utilizado. Neste trabalho, (Calado-1992) foi mais 60 dias.
Fig. 000 Estacas preparadas para serem colocadas na estufa Fig. 000 Estacas enraizadas (Foto - Leonilde Calado, 1994)
possvel incrementar o enraizamento das estacas com tra-
de enraizamento (Foto - Alberto Miranda, 2012)
tamentos ricos em hidratos de carbono, ou com a imerso B Fase de endurecimento Fig. 000 Estufa de aclimatizao com as plantas provenientes
Fig. 000 Estacas sujeitas ao tratamento hormonal de IBA da base das estacas em solues de pH cido. A fase de endurecimento comea quando as estacas da estufa de enraizamento. (Foto - Alberto Miranda, 2012).
(Foto - Alberto Miranda, 2012). As estacas assim preparadas e tratadas so ento colo- enraizadas no substrato so levantadas e colocadas em sa-
cadas nas bancadas de enraizamento onde permanecem cos numa mistura de terra e turfa em propores adequa- Fig. 000 Estufim utilizado com o mesmo objetivo, utilizado
Fig. 000 Estacas colocadas nas bancadas da estufa durante em perodos do ano com temperatura mais amena
entre 60 a 120 dias, dependendo da capacidade de enraiza- das. Estes sacos so colocados em estufins, estruturas com
60 dias (Foto - Leonilde Calado, 1994). (Foto - Alberto Miranda, 2012)
mento da variedade. cobertura, que, sendo transparentes radiao solar vi-
Fig. 000 Rega por asperso (Foto - Leonilde Calado, 1994). A presena de folhas numa estaca determina uma cer- svel, deixam contudo passar parte da radiao infraver-
ta perda de gua (transpirao), que a planta procura con- melha. Caso das coberturas de plstico (polietileno) com
trolar, evitando a abertura dos estomas ou eliminando as um controle de temperatura e rega. As plantas mantm-se
folhas. No processo de nebulizao procuramos manter as nestes estufins, numa fase de crescimento at irem para o
local definitivo (Figs. 22 A e B)
{ 108 } O grande livro da oliveira e do azeite { 109 } O grande livro da oliveira e do azeite

Propagao in vitro da sua instalao em meios artificiais sob condies de as- natural da espcie, no so alternativa uma vez que pe- sua substituio por gua de coco e BAP. No entanto, tanto
A propagao in vitro atravs da cultura de meriste- sepsia total e este o principal problema na fase de insta- las razes apontadas, apresentam uma enorme variabili- o tidiazuro, com a gua de coco utilizada, ainda so com-
mas, tem-se apresentado como uma tcnica importan- lao. Tem-se verificado uma enorme dificuldade em ob- dade gentica. postos qumicos muito caros pelo que os benefcios eco-
te para a limpeza sanitria de variedades em processo de ter culturas no contaminadas quando se utilizam plantas O desenvolvimento recente de produtos com ao nmicos da sua utilizao como substitutos da zeatina no
seleo, mas, recorrendo proliferao axilar de segmen- adultas de oliveira, quer crescendo em condies de cam- fungicida e bactericida, que podem ser adicionados ao se mostraram relevantes.
tos uni-nodais, organognese, embriognese som- po quer em estufa, como fonte de explantes iniciais. meio de cultura sem prejudicar o desenvolvimento dos te- Outro componente importante de todos os meios de
tica ou mesmo microenxertia, as tcnicas de cultura in A utilizao de embries zigticos obtidos a partir cidos vegetais (ex: Plant Preservative Mixture PPM), cultura como referimos a fonte de energia. A sacarose,
vitro podem constituir-se em si mesmo como uma alter- da germinao in vitro de sementes no apresenta este tm ajudado a ultrapassar os problemas relacionados com ainda que amplamente utilizada para tal fim, no mostrou
nativa vivel para a propagao de variedades de difcil problema, mas, devido alogamia e heterozigocidade a fase de instalao assptica das culturas, fazendo com ser ideal para a oliveira. A esse respeito, Leva et al. (1992,
enraizamento. que as estacas uni-nodais (Fig. 23) recolhidas na extremi- 1994) trouxeram uma contribuio significativa ao propor
Quadro ?? Composio do meio de cultura OM dade de ramos do ano em fase de crescimento ativo sejam a substituio de sacarose por manitol, hoje amplamente
Micropropagao (Olive Medium) (adaptado de Fabbri et al., 2004) neste momento o material de eleio para iniciar um pro- utilizado em protocolos de micropropagao da oliveira.
A micropropagao pode ser considerada como um cesso de micropropagao na oliveira Eles observaram que o aumento dos preos devido utili-
tipo especfico de propagao por estacaria, uma vez que Macronutrientes mg/L As taxas de multiplicao obtidas in vitro condicio- zao de manitol era altamente compensado pelas maio-
a tcnica assenta na multiplicao de rebentos axilares so- KNO3 11oo
nam a utilizao da tcnica como forma de multiplicao res taxas de multiplicao e capacidade de crescimento
bre um segmento caulinar uninodal. Em oliveira os pri- em larga escala de uma espcie. Taxas de multiplicao in- dos explantes. Observaes similares relativamente ao de-
NH1NO3 412
meiros trabalhos sobre este tema datam dos anos 70 e des- feriores a 3 em 30 dias, dificilmente conduzem a um pro- senvolvimento da parte area e quebra de dominncia api-
de ento que tentam otimizar-se as condies a que os ex- Ca(NO3)24H2O 600 cesso economicamente competitivo, tendo em conta a sua cal pela utilizao de manitol em ensaios com a cultivar
plantes so submetidos em cada um dos estdios da cultu- CaCl22H2O 440 exigncia em mo-de-obra e energia. Manzanillo foram relatados por Garcia et al. (2002).
ra, tanto os que decorrem in vitro (instalao, multiplica- Os esforos da investigao tm-se por isso concen- Apesar dos estudos extensivos realizados nos ltimos
KCL 500
o/alongamento, enraizamento) como os que decorrem trado no desenvolvimento de meios de cultura que permi- anos com o objetivo de melhorar as condies de cultura
in vivo (escolha do explante e aclimatizao). MgSO47H2O 1500 tam atingir esses objetivos e, a formulao mineral e vita- para algumas cultivares de oliveira, as taxas de sucesso da
Todo o processo de cultura in vitro, independentemen- KH2PO4 340 mnica, assim como o tipo e concentrao de reguladores micropropagao so ainda limitadas. A taxa de prolifera-
te do tipo de explante de partida, baseia-se na possibilidade de crescimento, ou a presena de uma fonte de energia sob o dos explantes geralmente baixa e dependente da cul-
Micronutrientes
a forma de hidratos de carbono, so aspetos crticos no de- tivar (Dimassi-Theriou, 1994; Bartolini et al., 1990), a for-
FeSO47H2O 27.8 senvolvimento de um meio de cultura eficaz. mao de razes adventcias em muitas cultivares micro-
Na2EDTA 37.5 Quanto formulao mineral e vitamnica, o meio propagadas de oliveira ainda difcil e a percentagem de
MnSO44H2O 22,3 base OM (Tab. 1), atualmente o mais utilizado na mi- perdas ps transplante permanece elevada (Briccoli-Bati
cropropagao da oliveira. Foi desenvolvido por Rugini em et al., 1999; Rugini et al., 1999).
H3BO3 12.4
1984 especificamente para a estimulao de gomos axila- Dado que um dos maiores problemas associados ao
ZnSO47H2O 14.3 res e crescimento de rebentos. As principais diferenas sucesso das culturas de oliveira a capacidade de enrai-
Na2M0O42H2O 0.25 deste meio em relao a um dos meios que mais se utiliza zamento das microestacas, interessante ver que alguns
em cultura in vitro, o meio MS (Murashige e Skoog, 1962) autores tm encontrado nos microrganismos simbiti-
CuSO45H2O 0.25
so uma maior concentrao de Ca, Mg, S, P, B, Cu e Zn, a cos uma alternativa possvel. Peyvandi et al. (2010) des-
CoCl26H2O o.025 utilizao da glutamina como fonte de azoto orgnico (no crevem o efeito promotor no enraizamento de rizobact-
Kl 0.83 meio MS utilizada a glicina). rias Pseudomonas fluorescent em microestacas da cultivar
Vitaminas Quanto aos reguladores de crescimento, desde o j re- Rowghani. Segundo estes autores, as rizobactrias foram
ferido trabalho de Rugini (1984) que zeatina tem sido am- mais eficazes que o IBA na induo da formao de razes.
Fig. 000 Aspeto das estacas uni-nodais utilizadas para iniciar Myo-inositol 100
plamente aceite como a nica citocinina capaz de indu- No trabalho de Binet et al. (2007), a inoculao de plntu-
a cultura in vitro em oliveira (Peixe, 2007).
Tiamina HCl 0.5 zir um crescimento satisfatrio em explantes de olivei- las Laragne com micorrizas arbusculares (do fungo Glo-
Piridoxina HCl 0.5 ra cultivados. Tem sido geralmente usada em concentra- mus mosseae) provocou um aumento significativo na so-
es que variam entre 4,56 a 45,62 M. No entanto, devi- brevivncia e posterior desenvolvimento das plantas.
cido nicotnico 5
do ao seu elevado custo, h tambm uma opinio genera- Por outro lado, h autores que desenvolveram mto-
Biotina 0.05 lizada de que uma substituio alternativa deve ser alcan- dos de enraizamento ex vitro, como o caso de Leva (2011).
cido flico 0.5 ada para uso em protocolos de micropropagao comer- Neste trabalho, as microestacas tratadas com NAA foram
cial (Mencuccini et al., 1997, Briccoli et al., 2002). Alterna- plantadas em pequenos vasos previamente humedecidos
Aminocidos
tivas para a zeatina foram relatadas por Garca et al-Ferriz. e submetidas a elevados nveis de humidade (80-85%) du-
Glicina 2
(2002), que a substituiu por Tidiazuro (TDZ) e 6-Benzila- rante a fase de induo radicular. Por fim, de realar o
Glutamina 2194 minopurina BAP ou por Peixe et al. (2007) que propem a trabalho de Padilla et al. (2009) que desenvolveram um
{ 110 } O grande livro da oliveira e do azeite { 111 } O grande livro da oliveira e do azeite

Fig. 000 Aspecto dos explantes de Galega vulgar nas


primeiras fases da cultura in vitro. (A) Aps o abrolhamento em explante original. Apesar de ser o mtodo mais comum em capacidade embriognica.
meio de iniciao. (B) Aps 30 dias em meio de multiplicao. espcies lenhosas, a embriognese somtica indirecta im- Apesar dos relatos acima referidos, apenas a embrio-
(C) 45-50 dias aps a segunda repicagem no meio de plica o estmulo dos explantes com reguladores de cresci- gnese somtica a partir de explantes de plantas adultas
multiplicao. (D) Forma de corte dos explantes: (D-1) O pice
mento (tais como o acido 2,4- Diclorofenoxiactico (2,4- tem interesse para a propagao e transformao de cul-
e 1(s) entre-ns seguem para enraizamento; (D-2) Estacas
uninodais e bases vo reiniciar a fase de multiplicao.
D)) para induzir a produo e proliferao de linhas em- tivares de oliveira (Fabbri et al., 2004). Em 1995, Rugini e
briognicas callus competentes para a formao de em- Caricato desenvolveram um sistema cclico de embriog-
bries somticos. A principal desvantagem do processo nese somtica a partir de tecidos adultos de oliveira e de
indirecto de embriognese somtica a introduo de va- recuperao de plantas, que permite a obteno contnua
riaes somaclonais, ou seja, a existncia de variabilida- de embries somticos. Neste trabalho, os embries ori-
de gentica entre os embries produzidos. Por no envol- ginaram-se a partir de massas morfognicas derivadas de
ver a formao de razes, a embriognese somtica muito plantas micropropagadas, facto que veio a ser classifica-
importante para a regenerao de plantas de oliveira, uma do como um sistema de dupla regenerao (Fabbri et al.,
mtodo alternativo de induo do enraizamento com base vez que permite ultrapassar a falta de capacidade de enrai- 2004). Nas massas embriognicas eram visveis, alm dos Fig. 000 (A e B) Imagens das fases de enraizamento in vitro
em pulsos elctricos. zamento de algumas cultivares. embries somticos, embries fundidos, estruturas clavi- com pormenor do sistema radical desenvolvido; (C) Plantas
j aclimatadas, prontas para ser transplantadas para o local
Para a cultivar Portuguesa Galega vulgar, Peixe et al. Em Olea europaea a embriognese somtica j foi con- formes e cotildones anmalos (fig. 26), mas estas estru-
definitivo.
(2007) desenvolveram um protocolo eficiente de multipli- seguida a partir de explantes embrinicos (embries zig- turas no se desenvolveram alm disso.
cao in vitro por rebentamento axilar, com taxas de mul- ticos maduros ou imaturos) e somticos (tecidos retirados Mais recentemente, Cerezo et al. (2011) desenvolve- Fig. 000 Embriognese somtica em oliveira (cv. Canino) a
tiplicao de 4-5 em 80-90 dias, com taxas de enraizamen- de plntulas e petolas) (Rugini et al., 2011). Os primeiros ram um sistema de regenerao de plantas com base na partir de pecolos de rebentos regenerados por organognese
to de 75-80% e com baixas perdas de plantas durante a fase estudos em embriognese somtica em oliveira remontam formao indirecta de embries somticos a partir de rad- direta e indireta (A) Embrio somtico obtido em meio lquido;
de aclimatizao. O processo est a ser utilizado a nvel co- a 1988, quando Rugini testou a capacidade embriognica culas (fig. 27) recolhidas de sementes maduras. Os autores (B) Embries fundidos, cotildones anmalos e estruturas
claviformes (adaptado de Rugini e Caricato, 1995)
mercial pela empresa Biomelhora S.A e encontra-se es- de discos foliares e embries zigticos. Neste trabalho o testaram duas adaptaes do meio OM e utilizaram mem-
quematizado nas figuras 24 e 25. autor concluiu que o processo de embriognese somtica branas de acetato de celulose para estimular a maturao
em oliveira possvel, mas apenas quando se utilizam em- dos embries, tendo este tratamento aumentado a taxa de
Novas abordagens na propagao in vitro bries zigticos jovens como explante inicial. Desde ento, converso de embries maduros em plantas regeneradas.
da oliveira tem sido descrita a utilizao de diferentes explantes tais
Nos ltimos anos tm-se tentado desenvolver outros como cotildones (Leva et al., 1995; Trabelsi et al., 2003), Sementes sintticas e microenxertia uma semente natural e germinada de forma a produzir um
mtodos de regenerao in vitro de oliveiras, de onde se embries zigticos maduros (Orinos e Mitrakos, 1991) e Uma das aplicaes mais relevantes da embriognese rebento ou uma plntula somtica, consoante o explan-
destacam a embriognese somtica, a produo de semen- radculas isoladas de embries maduros (Mitrakos et al., somtica a possibilidade de produo de sementes sin- te que foi encapsulado. A designao semente sinttica
tes sintticas e a microenxertia. 1992; Cerezo et al., 2011). De facto, Rugini et al. (2005) des- tticas. Este conceito foi inicialmente proposto por Mu- normalmente aplicada quando o explante encapsulado
crevem vrios protocolos para a obteno de embries so- rashige (1978) e desde ento j foram produzidas semen- um embrio somtico. Quando se utiliza outro tipo de ex-
Embriognese somtica mticos a partir de embries zigticos maduros e imatu- tes sintticas em vrias espcies (McKersie et al., 1989; plante, d-se ao produto final o nome de cpsula. A en-
O processo de embriognese somtica consiste no de- ros, tecidos maduros, estudos histolgicos e regenerao Ipecki e Gozukirmizi, 2003; Kumar et al., 2005; Aquea et capsulao garante ao explante proteco fsica, nutrien-
senvolvimento de um embrio a partir de clulas somti- de plntulas. Segundo Therios (2009), entre os diferentes al., 2008). Sementes sintticas so compostas por um ex- tes, reguladores de crescimento, antibiticos, fungicidas,
cas. A formao do embrio pode ocorrer de forma direta, explantes, aqueles que permitem uma maior taxa de indu- plante (um gomo ou um embrio somtico) encapsula- etc. (Kitto e Janick, 1985; Redenbaugh et al., 1991). Dos v-
a partir d e clulas de um explante cultivado in vitro; ou de o de tecido caloso so as razes. No entanto, de acordo do num gel que acaba por solidificar. Aps a solidificao rios compostos testados para o gel (alginato de clcio ou
forma indireta, no tecido caloso que se formou a partir do com Rugini (1988) os embries imaturos possuem maior do gel de encapsulao, a semente pode ser tratada como sdio, gelrite, gelatina, xido de polietileno, etc.) aquele
{ 112 } O grande livro da oliveira e do azeite { 113 } O grande livro da oliveira e do azeite

A capacidade de enraizamento resultante muito


limitada;
O nmero de micropropgulos viveis passveis de
serem utilizados na produo de sementes sintticas
limitado;
Verifica-se um desenvolvimento anmalo e dessincro-
nizado dos embries somticos;
A incorreta maturao dos embries somticos torna-
-os incapazes de germinar normalmente e originar novas
plantas;
O armazenamento das sementes produzidas restrin-
gido pela falta de dormncia e tolerncia ao stress dos em-
bries somticos; Fig. 000 Microenxertia em Olea europaea L. (cv. Arbequina).
A baixa taxa de converso micropropgulo planta au- (A) Rebentos apicais maduros enxertados em porta-enxertos
menta os custos da tecnologia de produo das sementes, jovens desenvolvidos in vitro; (B) Crescimento do rebento aps
Fig.000 Regenerao de plantas a partir de callus 30 dias em meio de proliferao. As setas realam o anel de
o que reduz o seu valor comercial.
embriognico em Olea europaea L. (a) e (b) Aparecimento silicone que assegura o posicionamento de enxertia.
de calli embriognico aps 4 semanas de cultura; (c) e (d)
Em oliveira a aplicao de sementes sintticas foi j
(Adaptado de Revilla et al., 1996)
Maturao de embries somticos; (e) Embries somticos em conseguida em algumas cultivares. Em 1998, Micheli et
fase globular; (f) Culturas aps diferenciao em acetato de al., desenvolveram um mtodo de sntese de sementes sin-
celulose; (g) Embries somticos maduros em fase de cotildone tticas utilizando gomos apicais e nodais da cultivar Mo-
(cotiledonary SE); (h) Embrio somtico germinado (12 raiolo encapsulados em alginato. Contudo, o enraizamen-
semanas); (i) Planta regenerada em fase de aclimatao.
to das sementes germinadas era insatisfatrio. Mais tarde,
Em todas as imagens, as barras correspondem a 5 mm (retirado
de Cerezo et al., 2011)
foram produzidas sementes sintticas das cultivares Ca-
nino e Moraiolo utilizando como explantes iniciais em-
Fig. 28 Produo de sementes sintticas em Olea europaea bries somticos (cv. Canino) e segmentos uninodais de
L. (A) Segmentos uninodais (explante inicial); (B) Matriz de rebentos micropropagados (cv. Moraiolo) (Micheli et al., Em oliveira, a microenxertia foi conseguida por alguns
alginato; (C) Sementes sintticas da cv. Moraiolo; (D) Rebentos 2002). Recentemente, Micheli et al. (2007) realizaram um autores (Revilla et al., 1996; Troncoso et al., 1999; Vidoy-
resultantes da germinao das sementes aps sementeira
estudo sobre o efeito do armazenamento a diferentes tem- -Mercado et al., 2008; Farahani et al., 2011). No trabalho de
(retirado de Micheli et al., 2007)
peraturas durante vrios perodos de tempo no desenvol- Revilla et al. (1996) os autores utilizaram a tcnica como
vimento dos rebentos germinados em sementes sintti- forma de rejuvenescimento de plantas da cv. Arbequina
cas da cv. Moraiolo. Neste trabalho os autores observa- (fig.29). As estacas obtidas aps a poda das plantas pro-
ram a formao de dois rebentos de tamanho semelhan- duzidas por microenxertia revelaram total recuperao da
te como resultado da germinao das sementes produzi- capacidade de enraizamento.
das (fig. 28). A microenxertia representa para a oliveira uma opor-
A microenxertia consiste na transferncia de peque- tunidade de rejuvenescer gentipos recalcitrantes s con-
nos pices caulinares para micro-porta-enxertos (Deber- dies in vitro (Rugini e Pesce, 2006). Contudo, e apesar
gh, 2008) e pode ser til na obteno de plantas livres de dos relatos de sucesso j referidos, a tcnica precisa ainda
vrus, no isolamento de vrus especficos em infeces de melhorias adicionais antes de ser considerada uma al-
que tem produzido melhores resultados o alginato de nutricional ao embrio encapsulado. mistas e no estudo da incompatibilidade entre enxerto e ternativa vivel.
clcio (Bajaj, 1995). De acordo com Bajaj (1995), a produo de sementes porta-enxerto bem como dos aspectos histofisiolgicos
De forma a estimular a germinao do embrio som- sintticas ganha relevncia nas seguintes situaes: (1) em da enxertia (Navarro, 1988). Os porta-enxertos mais uti- Resumo dos trabalhos recentes
tico, podemos distinguir trs tipos de sementes sintticas, culturas que no produzem sementes e onde a propagao lizados so plntulas recm-germinadas, embora por ve- Nos ltimos anos, o nmero de trabalhos publicados
de acordo com o revestimento de alginato (Therios, 2009): vegetativa difcil; (2) quando so produzidas pequenas zes tambm se utilizem microestacas enraizadas. O pro- em micropropagao de oliveira tem vindo a aumentar
Micro-cpsulas, que libertam sacarose para a matriz quantidades de sementes e, (3) em culturas cujas semen- cesso pode ser desenvolvido in vivo ou in vitro (mais co- (tabela 2). O aumento do nmero de publicaes est re-
de alginato; tes zigticas so recalcitrantes e a conservao de germo- mum) e especialmente importante a existncia de cuida- lacionado com os esforos para melhorar a tcnica e resol-
Cpsulas em que a esfera de alginato se quebra de for- plasma no possvel. dos durante a aclimatao das plantas enxertadas. No en- ver os problemas at aqui encontrados.
ma autnoma e facilita a germinao do explante; Esta tcnica tem, no entanto, algumas desvantagens tanto, nesta fase no so essenciais as condies de assep-
Cpsulas do tipo farmacutico, que contm meio associadas (Ara et al., 2000; Fabbri et al., 2004), que limi- sia e podem mesmo utilizar-se porta-enxertos crescidos in Concluses
de cultura no seu interior de forma a garantir uma fonte tam a sua utilizao prtica: vivo (Debergh, 2008). Desde os primrdios da sua cultura e at segunda
{ 114 } O grande livro da oliveira e do azeite { 115 } O grande livro da oliveira e do azeite

Cidraes, F. (1939) - Mtodos de reproduo da oliveira, Direco


Quadro ?? Exemplos de cultivares de Olea europaea L. utilizadas em trabalhos de micropropagao embora a disponibilidade de porta-enxertos clonais seja
Geral dos Servios Agricolas, Folha de Divulgao, Srie II,
em diferentes pases produtores de azeite. atualmente bastante limitada, a investigao est envolvi-
6: 1-21.
da na seleo de gentipos que podem melhorar a aptido Conselho Olecola Internacional- COI (2000) Web document:
Cultivar Pas Tcnica utilizada Meio de cultura* Referncia cultural das variedades existentes ao influenciar o seu vi- Olive nursery production and plant production techniques
(explante inicial) gor, rendimento, eficincia e tolerncia a stress. Em Itlia, Section C: Plant production and growing techniques, http://
Arbequina Brasil Multiplicao de rebentos OM, MS e WPM c/ zeatina Donini et al. (2008) o principal produtor mundial de plantas de oliveira, a en- www.internationaloliveoil.org/projects/paginas/Section-c.
axilares (segmentos nodais) xertia ainda hoje representa cerca de 30% das plantas pro- htm.
Canino, Frantoio, Itlia Multiplicao de rebentos OM modificado c/ dikegulac Gyves et al. (2008) duzidas anualmente. Columela, M.J.L. (S/D) - De los planteles de olivos y de su culti-
Moraiolo, Rosciola e axilares (segmentos nodais) (substituto da zeatina) vo en ellos; del trasplante y del cultivo despus de ste. In: Los
Piantone di Moiano Doce Libros de Agricultura Libro Quinto Capitulo IX , Ed.
Referncias bibliogrficas
Oueslati Turquia Multiplicao de rebentos OM Rkhis et al. (2011) Aquea, F., Poupin, M., Matus, J., Gebauer, M., Medina, C., Ar- Don Vicente Tinajero (1879), Imprenta de Miguel Ginesta,
axilares (segmentos nodais) ce-Johnson, P. (2008) - Synthetic seed production from so- Madrid, 247-251.
matic embryos of Pinus radiate. Biotechnology Letters, 30, Columela, M.J.L. (S/D) - De los ingertos, In: Los Doce Libros
Koroneiki Grcia Multiplicao de rebentos Driver-Kuniyuki (meio para avel) Roussos e Pontikis
axilares (segmentos nodais) modificado c/ zeatina-ribsido, (2002) 18471852. de Agricultura Libro Quinto Capitulo XI , Ed. Don Vi-
2-iP, BAP e TDZ Ara, H., Jaiswal, U., Jaiswal, V., (2000) - Synthetic seed: prospects cente Tinajero (1879), Imprenta de Miguel Ginesta, Madrid,
and limitations. Current Science, 78:12, 1438-1445. 256-260
Chetoui Tunsia Embriognse somtica em OM (base, modificadopara cultura Trabelsi et al. (2011)
Ardiz, C. M. W. & Ruiz, M. J. (1993) - Propagacin por estaquilla DHerrera, A. (1645) - Agricultura General, Ed-Facsmile Univer-
cultura em suspenso (callus de callus e para embriognese
derivado de folhas) somtica) leosa de Vitis vinifera L., var.Zalema. Denominao de ori- sidad Politcnica de Madrid 1994, 243p. In: Libro Tercero
gem-Condado de Huelva. Viticultura/Enologia Professional En que trata de los arboles , 40-86.
Nebbiara Itlia Multiplicao de rebentos OM c/ zeatina, manitol GA e IBA Zacchini e Agazio
3 - 25:29-39. Da Camara, M. S. (1902) - Estudo da oliveira, In: Boletim da Direc-
axilares (segmentos nodais) MS c/ sacarose, BAP e IBA (2004)
Bajaj, Y., (1995) - Somatic embryogenesis and synthetic seed I. o Geral da Agricultura, Ano 7, n 6, Ed. Imprensa Nacional,
Galega vulgar Portugal Multiplicao de rebentos OM c/ zeatina, BAP, gua de coco Peixe et al. (2007) Springer, Berlin-Heildelberg, New York. Lisboa, Portugal, 527-751.
axilares (segmentos nodais) e manitol Dalla-Bella, J. A. (1786) - Memria sobre a Cultura das oliveiras
Bakr, E., Selim, H., Nour, G., Gabr, M. (1977) - Developmental ana-
*Componentes dos meios utilizados nas fases de multiplicao e enraizamento tomy of adventitious roots on stem cuttings of Wetaken olive em Portugal, Ed. Real Officina Typografica da Universidade
cultivar. Egyptian Journal of Horticulture, 4, 91-97. de Coimbra. 137p.Dalla-Bella (1786)
Bartolini, G., Leva, A.R. and Benelli, A. (1990) Advances on in vi- Debergh, P. (2008) - Micropropagation: Uses and Methods, in:
tro culture of the olive propagation of cv Maurino. Acta Hor- George, E., Hall M., De Klerk G. (Eds.), Plant Propagation
metade do sc. XIX a oliveira foi propagada vegetativa- funcionamento e manuteno.
ticulturae, 286: 4144. by Tissue Culture 3rd edition, Springer Netherlands, 29-64.
mente atravs de material lenhoso, estacas, vulos e plas. Em menos de duas dcadas, a propagao direta de
Binet, M., Lemoine, M., Martin, C., Chambon, C., Gianinazzi, S. Dimassi-Theriou, K. (1994) - In vitro propagation of cv. Kalamon
Dalla-Bella (1786) e Caruso (1883) questionavam estes m- oliveira por estacaria semi-lenhosa tornou-se uma realida-
(2007) - Micropropagation of olive (Olea europaea L.) and olives (Olea europaea sativa L.). Adv. Hortic., 8: 185189.
todos de multiplicao direta, defendendo que a enxertia de e, no obstante tenha desde ento vindo a registar v- Donini, L., Schuch, M., Ribeiro, M., Souza, J., Soares, G. (2008) -
application of mycorrhiza to improve plantlet establishment.
era a nica forma de multiplicao que conduzia obten- rias melhorias para aumentar a sua eficincia, os conheci- Estabelecimento in vitro de oliveira cv. Arbequina para incio
In Vitro Cellular and Developmental Biology Plant, 43,
o de rvores vigorosas, produtivas e com grande longe- mentos fundamentais para a sua utilizao estavam dispo- 473478. da micropropagao. Cincia Rural, 38:6, 1769-1772.
vidade. Assim, embora como refere Fabbri et al. (2004) v- nveis em meados dos anos 1950. Briccoli, C., Godino, G. and Nuzzo, V. (2002) - Preliminary agro- El-Said, M., Ikram, S., Youssef, N. (1990) - Studies on some fac-
rios investigadores tenham demonstrado desde h mui- Depois de dcadas de investigao em vrias estaes nomic evaluation of two cultivars of olive trees obtained tors affecting ability of leafy olive cuttings. Zagazig Journal of
to que a multiplicao direta permite obter rvores com experimentais a produo de oliveira por tcnicas de mi- from micropropagation methods, Acta Horticulturae, 586: Agricultural Research, 17, 851-853.
um desempenho agronmico comparvel ao das plan- cropropagao est atualmente ganhando terreno, contri- 876-870. Fabbri, A., Bartolini, G., Lambardi, M., Kailis, S. (2004) - Olive
tas enxertadas, a verdade que esta tcnica se generali- buindo para aumentar a dominncia dos mtodos de mul- Briccoli-Bati C., Fodale A., Mule R. and Trombino T. (1999) - Propagation Manual, Csiro Publishing, Australia.
zou, no propriamente pela qualidade das plantas produ- tiplicao direta sobre os mtodos indiretos. Trials to increase in vitro rooting of Olea europaea L. cuttin- Fabbri, A. (1980) - The effect of various anatomical characteris-
zidas (onde a heterogeneidade devida ao uso de porta-en- Mas no se pense que com esta supremacia reconquis- gs. Acta Horticulturae, 474: 9194. tics on the rooting of cuttings in olive, cv. Frangivento. Rivista
Calado, M. L. (1992) - Reconverso Olivcola- Experimentao Dalla Ortoflorofrutticoltura Italiana, 64:4, 325-335.
xertos francos at era desfavorvel), mas sim porque per- tada da multiplicao direta a questo est resolvida para
sobre a influncia de diversos tratamentos no enraizamento FAO (1976) - Olivicultura moderna. Centro de mejoramiento y de-
mitia obter um nmero de plantas significativamente su- sempre. Tal como acontece com muitas outras fruteiras, a
de estacas herbceas de algumas cultivares de oliveira, Olea monstracion de la tecnica oleicola. C.E.M.E.D.E.T.O.-FAO-
perior aos mtodos diretos clssicos, aspeto que era funda- enxertia uma tcnica que provavelmente ir acompanhar
europaea L.. Trabalho de sntese para acesso a Assistente de -I.N.I.A.- Ministerio de Agricultura - Cordoba. Espaa
mental para uma indstria de azeite em expanso. para sempre a produo de plantas de oliveira. As razes Farahani, F., Razeghi, S., Peyvandi, M., Attaii, S., Mazinani, M.
Investigao. I.N.I.A.
Este panorama acaba por alterar-se na dcada de 40, para isso so inmeras, mas alguns so particularmente (2011) - Micrografting and micropropagation of olive (Olea
Caruso, G. (1883) - Monografia dellolivo. In: Enciclopedia Agraria
quando se descobre, por um lado, que as auxinas esto importantes. Em primeiro lugar, nem todas as variedades Italiana, Vol.3 Part.5, UTET, Turin, Italy. europea L.) Iranian cultivar: Zard. African Journal of Plant
diretamente envolvidas no processo de formao das ra- so facilmente (i.e. economicamente) propagadas a partir Cerezo, S., Mercado, J., Pliego-Alfaro, F. (2011) - An efficient re- Science, 5:11, 671-675.
zes adventcias e se comprova a sua eficcia na indu- de estacas ou in vitro. Em segundo lugar, a multiplicao generation system via somatic embryogenesis in olive. Plant Fouad, M., Fayek, M., Selim, H., El-Sayed, M. (1990) - Rooting
o do enraizamento de estacas semi-lenhosas de olivei- direta envolve o uso de estruturas mais ou menos comple- Cell Tissue and Organ Culture, 106, 337344 of eight olive cultivars under mist. Acta Horticulturae, 286,
ra e, por outro, quando se conseguem sistemas de contro- xas, necessitando de dinheiro e formao que em muitas Ciampi, C., Gellini, R. (1963) - The origin and development of ad- 57-60.
lo ambiental em estufa com um baixo custo de instalao, situaes podem no estar disponveis. Em terceiro lugar, ventitious roots in Olea europaea: the importance of anato- Galvo, J.M. (1952) - Manual do Olivicultor, 2 Edio, In: Bi-
mical structure in rootlet development. G. Bot. Ital. 70, 62-74. blioteca de Agricultura Alentejana, Vol X, Ed. Minerva
{ 116 } O grande livro da oliveira e do azeite { 117 } O grande livro da oliveira e do azeite

Comercial, Beja-Portugal, 378p. Li, S.W., Xue, L., Xu, S., Feng, H., An, L. (2009) - Mediators, Ge- zeatin in olive (Olea europaea L.) micro-propagation. Scien- rooting ability of some olive cultivars propagated by lea-
Garca, J. L., Troncoso J., Sarmiento R., Troncoso A. (2002) - In- nes and Signaling in Adventitious Rooting. The Bot Rev, 75: tia Horticulturae, 113, 1-7. fy cuttings under mist. Annals of Agricultural Science, 32:1,
fluence of carbon source and concentration on the in vi- 2, 230-247. Peyvandi, M., Farahani, F., Mazinani, M., Noormohamadi, Z., 577-590.
tro development of olive zygotic embryos and explants rai- McKersie, B., Senaratna, T., Bowley, S., Brown, D., Krochko, J., Ataii, S., Asgharzade, A. (2010) - Pseudomonas fluores- Surez, M. P., Lpez-Rivares, E. P., Ordovs, J. (1993) -Enraiza-
sed from them. Plant Cell, Tissue and Organ Culture, 69: Bewley, J. (1989) - Application of artificial seed technology in cent and its ability to promote root formation of olive mi- miento de estaquillas de adelfe, olivo y geranio en substrato
95100. the production of hybrid alfalfa (Medicago sativa L.). In Vitro croshoots. International Journal of Plant Production, 4:1, de corcho. ll Congreso Ibrico de Cincias Hortcolas : 1185
Garca-Frriz, L., Ghorbel, R., Ybarra M., Mar, A., Belaj A., Tru- Cellular&Developmental Biology, 25, 1183-1188. 63-66. - 1190.
jillo I. (2002) - Micropropagation from adult olive trees, Mencuccini, M., Micheli, M., Standardi, A. (1997) - Micropropa- Qrunfleh, M., Rushdi, Y., Musmar, T., Rushdi, L. (1994) - Root Therios, I. (2009) Olives. Crop Production Science in Horticul-
Acta Horticulturae, 586: 879-882. gazione dellolivo: effetto di alcune citochinine sulla prolife- formation in cuttings of the Nabali olives with uniconazole ture vol. 18, CABI, Wallingford, UK
Gaspar, T., Kevers, C., Hausman, J., Ripetti, V. (1994) - Peroxida- razione. Italus Hortus, 4 (6): 32-37. and indolebutyric acid. Dirasat: Agricultural Sciences, 21:6, Trabelsi, E., Bouzid, S., Bouzid, M., Elloumi, N., Belfeleh, Z., Be-
se activity and endogenous free auxin during adventitious Micheli, M., Hafiz, I., Standardi, A. (2007) - Encapsulation of in 71-79. nabdallah, A., Ghezel, R. (2003) - In-Vitro Regeneration of
root formation, in: Lumsden, P.J., Nicholas, J.R., Davies, vitro-derived explants of olive (Olea europaea L. cv. Moraio- Redenbaugh, K., Fujii, J., Slade, D. (1991) - Synthetic seed techno- Olive Tree by Somatic Embryogenesis. Journal of Plant Bio-
W.J. (Eds.) Physiology Growth and Development of Plant lo) II. Effects of storage on capsule and derived shoots perfor- logy, in: Vasil, K.I. (Ed.) Scale-up and Automation in Plant logy. 46:3, 173-180.
in Culture, Kluwer Academic Publishers, Dordrecht, The mance. Scientia Horticulturae, 113, 286292. Propagation. Cell Culture and Somatic Cell Genetics of Trabelsi, E., Naija, S., Elloumi, N., Belfeleh, Z., Msellem, M.,
Netherlands, 289298. Micheli, M., Mencuccini, M., Standardi, A. (1998) - Encapsula- Plants, Vol. 8, Academic Press Inc., New York, 3574. Ghezel, R., Bouzid, S. (2011) - Somatic embryogenesis in cell
Gaspar, T., Kevers, C., Hausman, J., Berthon, J., Ripetti, V. (1992) tion of in vitro proliferated buds of olive. Advances in Horti- Revilla, M., Pacheco, J., Casares, A., Rodriguez, R. (1996) - In vi- suspension cultures of olive Olea europaea (L.) Chetoui.
- Practical uses of peroxidase activity as a predictive marker cultural Science, 12, 163-168. tro reinvigoration of mature olive trees (Olea europaea L.) ActaPhysiologiae Plantarum, 33, 319324.
of rooting performance of micropropagated shoots. Agro- Micheli, M., Standardi, A., DellOrco, P., Mencuccini, M. (2002) - through micrografting. In vitro Cellular and Developmental Troncoso, A., Linan, J., Cantos, M., Acebedo, M., Rapoport, H,
nomie, 12, 757765. Preliminary results on the synthetic seed and encapsulation Biology Plant, 32, 257261. (1999) - Feasibility and anatomical development of an in vi-
Gyves, E., Mira, F., Ruiu, F., Rugini, E. (2008) - Stimulation of technologies of vitro-derived olive explants. Acta Horticultu- Rkhis, A., Maalej, M., Drira, N., Standardi, A. (2011) - Micropro- tro olive cleft-graft. Journal of Horticultural and Science
node and lateral shoot formation in micropropagation of rae, 586, 911-914 pagation of olive tree Olea europaea L. Oueslati. Turkish Biotechnology, 74, 584587.
olive (Olea europaea L.) by using dikegulac. Plant Cell Tis- Mitrakos, K., Alexaki, A., Papadimitriou, P. (1992) - Dependence Journal of Agriculture and Forestry, 35, 403-412. Vidoy-Mercado, I., Imbroda-Solano, I., Barcel-Muoz, A., Vi-
sue and Organ Culture, 92, 233238. of olive morphogenesis on callus origin and age. Journal of Roussos, P., Pontikis, C. (2002) - In vitro propagation of olive ruel, M., Pliego-Alfaro, F. (2008) - The influence of in vitro
Hartmann, H. T. (1946) - The use of root promoting substan- Plant Physiology, 139:3, 269-273. (Olea europaea L.) cv. Koroneiki. Plant Growth Regulation, micrografting on vegetative propagation of the olive cultivar
ces in the propagation of olives by softwood cuttings. Proce- Moncousin, C., Favre, F., Gaspar, T. (1988) - Changes in peroxi- 37, 295304. Arbequina. Acta Horticulturae (ISHS), 949, 31-34.
edings American Society for Horticultural Science-Michi- dase activity and endogenous IAA levels during adventitious Rout, G., Samantaray, S., Das, P. (2000) - In vitro rooting of Pso- Zacchini, M., Agazio, M. (2004) - Micropropagation of a local oli-
gan.48 : 303-308. rooting in cuttings, in: Kutacek, M., Bandurski, R.S., Kreku- ralea corylifolia Linn: Peroxidase activity as a marker. Plant ve cultivar for germplasm preservation. Biologia Plantarum,
Ipekci, Z., Gozukirmizi, N., (2003) - Direct somatic embryoge- le J. (Eds.), Physiology and Biochemistry of Auxins in Plants, Growth Regulation, 305, 215219. 48:4, 589-592.
nesis and synthetic seed production from Paulownia elonga- Academia, Prague, Czech Republic, 331337. Rugini, E. (1988) - Somatic embryogenesis and plant regenera-
te. Plant Cell Reports, 22, 1624. Murashige, T. (1978) - The impact of plant tissue culture on agri- tion in olive (Olea europaea L.). Plant Cell, Tissue and Organ
Joyce, A. (1996) - Controlo ambiental de estufas de produo. culture, in: Thorpe, T. (Ed.), Frontiers of plant tissue culture, Culture, 14, 207-214.
I.N.E.T.I. - Instituto de Tecnologias Energticas, 64 p. IAPTC, University of Calgary, Alberta, Canad, 15-26. Rugini, E., Caricato, G. (1995) - Somatic embryogenesis and
Khalidy, R., Khan, I., Kridich, A.R. (1972) - Rapport sur la multi- Murashige, T., Skoog, F. (1962) - A Revised Medium for Rapid Gro- plant recovery from mature tissues of olive cultivars (Olea
plication vegetative des oliviers. Inf. Olicoles Intern. - 58- wth and BioAssays with Tobacco Tissue Cultures. Physiolo- europaea L.) Canino and Moraiolo. Plant Cell Reports, 14,
59 : 45-47. gia Plantarum, 15, 473-497. 257260.
Kitto, S., Janick, J. (1985) - Production of synthetic seeds by en- Natividade, J. V. (1943) - A heterofilia da oliveira do ponto de vis- Rugini, E., Pesce, P. (2006) - Genetic improvement of olive. Po-
capsulating asexual embryos of carrot. Journal of the Ame- ta da propagao vegetativa, Ed. Oficinas da Tipografia Al- mologia Croatica, 12, 4374.
rican Society for Horticultural Science, 110, 227-282. cobacense, 185p. Rugini, E., Depace, C., Gutirrez-Pesce, P., Muleo, R. (2011)
Kumar, M., Vakeswaran, V., Krishnasamy, V. (2005) - Enhance- Navarro, L. (1988) - Application of shoot-tip grafting in vitro to Olea, in: C. Kole (Ed.), Wild Crop Relatives: Genomic and
ment of synthetic seed conversion to seedlings in hybrid rice. woody species. Acta Horticulturae, 227, 43-55. Breeding Resources, Temperate Fruits, Springer-Verlag Ber-
Plant Cell Tissue and Organ Culture, 81, 97100. Ono, E.O., Rodrigues, J.D., Pinho, S.Z. (1996) - Action of auxins lin Heidelberg, 79-117.
Leva, A. (2011) - Innovative protocol for ex vitro rooting on oli- and/or boron, in the process of root formation in cuttings of Rugini, E., Mencuccini, M., Biasi, R., Altamura, M. (2005) - Oli-
ve micropropagation. Central European Journal of Biology, coffee (Coffea arabica L. cv. Mundo Novo). Boron In Agricul- ve (Olea europaea L.), in: Jain, S.M., Gupta, P.K., (Eds.), Pro-
6:3, 352-358. ture, Wigginton. 16:2, 14-14. tocol for Somatic Embryogenesis in Woody Plants, Springer,
Leva, A., Muleo, R., Petruccelli, R. (1995) - Long-term somatic Orinos, T., Mitrakos, K. (1991) - Rhizogenesis and somatic em- Netherlands, 345-360.
embryogenesis from immature olive cotyledons. Journal of bryogenesis in calli from wild olive (Olea europaea var. syl- Rugini, E., Gutierrez-Pesce, P. and Sampinato, P.L. (1999) - New
Horticultural Science, 70:3, 417-421. vestris (Miller) Lehr) mature zygotic embryos. Plant Cell, perspective for biotechnologies in olive breeding: morphoge-
Leva, A., Petruccelli, R., Bartolini, G. (1994) - Mannitol in vitro Tissue and Organ Culture, 27, 183-187. nesis, in vitro selection and gene transformation. Acta Hort.
culture of Olea europaea L. (cv. Maurino). Acta Horticultu- Padilla, I., Vidoy, I., Encina, C. (2009) - Influence of indole-bu- 474: 107110.
rae, 356, 4346. tyric acid and electro-pulse on in vitro rooting and develop- Rugini, E. (1984) - In vitro propagation of some olive (Olea euro-
Leva, A.R., Petruccelli, R., Goretti, R.,Panicucci, M. (1992) - ment of olive (Olea europea L.) microshoots. Plant Cell Re- paea sativa L.) cultivars with different root-ability, and me-
Ruolo di alcuni microelementi e carboidrati nella prolifera- ports, 28, 14111420. dium development using analytical data from developing
zione in vitro di cv. di olivo (Olea europaea L.). Atti Conv. Peixe, A., Raposo, A., Loureno, R. S., Cardoso, H., Santos Mace- shoots and embryos. Scientia Horticulturae, 24, 123134.
Olive oil quality, Firenze 1992, 333-334. do, E. (2007) - Coconut water and BAP successfully replaced Salama, M., Zahran, M., Hassan, M. (1987) - Comparing the
{ 118 } O grande livro da oliveira e do azeite { 119 } O grande livro da oliveira e do azeite

A proteco sanitria
do olival
Eng Teresa Carvalho

Doenas da oliveira.
Gafa
A doena da oliveira, conhecida, em Portugal, por
gafa bastante agressiva provocando graves leses es-
sencialmente no fruto, acompanhadas de destruio da
polpa e, consequentemente, elevadas perdas quantitativas
e qualitativas, de produo.
Os ataques elevados do-se quando os Outonos so
chuvosos uma vez que o fungo precisa de elevada humida-
de relativa para se desenvolver
O agente causal da doena foi identificado pela pri-
meira vez em 1898 em Portugal por Almeida, classifican-
do-o ento como Gloeosporium olivarum Alm.(Almeida,
1899). Cem anos depois , por Von Arx em 1957 tendo mais
meios de diagnstico disponveis reclassificou-o e inclu-
do-o na espcie Colletotrichum gloeosporioides. A esp-
cie Colletotrichum acutatum, que fora identificada em
frutos afetados de podrido por Simonds (1965) foi iso-
lado por Margarita et. al.(1986) em oliveira de amostras

provenientes da China. Mais tarde Martin e Garcia (1999)


em Espanha e Cacciola et. al.(1996) em Itlia e Carvalho
et.al e Talhinhas et.al (2003) em Portugal identificaram a
espcie Colletotrichum acutatum em oliveira.
O conjunto dos trabalhos realizados nestes trs pases
europeus indica claramente que a antracnose da oliveira
est associada presena de uma ou das duas espcies Col-
letotrichum gloeosporioides e Colletotrichum acutatum.
Os ataques elevados do-se quando os Outonos so
chuvosos uma vez que o fungo precisa de elevada humida-
de relativa para se desenvolver.
Os sintomas so caratersticos e fceis de identificar.
Comea por aparecer umas manchas depressionrias onde
Fig. 000 Sintomas de gafa no fruto maduro Fig. 000 . Sintomas de verticilose de secagem lenta
posteriormente se desenvolvem os esporos de colorao
Fig. 000 Isolado Colletotrichum acutatum em meio Fig. 000 Sintomas de verticilose de apoplexia rpida rosa-alaranjada que com o tempo se torna parda.
de cultura (PDA)
Fig. 000 Sintoma de tuberculose na rama Olho de pavo
Fig. 000 Sintomas de gafa no fruto verde Olho de pavo o nome vulgar da doena da oliveira
Fig. 000 Sintomas de tuberculose no fruto
causada pelo fungo Spilocaea oleagina (Cast.) Hughes que
Fig. 000 Sintomas de olho de pavo
afecta principalmente as folhas , podendo em condies
Fig. 000 Sintomas de tuberculose no tronco
Fig. 000 Leso de olho de pavo coberta de miclio de exceo atacar o pednculo e mesmo os frutos.
Fig. 000 Sintomas de tuberculose nas folhas Esta doena tem duas fases de desenvolvimento que
Fig. 000 Desfoliao intensa provocada pelo olho de pavo acompanham a poca das chuvas com temperaturas sua-
ves que so de Fevereiro a Abril e de Setembro a Novembro
{ 120 } O grande livro da oliveira e do azeite { 121 } O grande livro da oliveira e do azeite

O sintoma mais caraterstico o aparecimento de Pragas principais Traa da oliveira


manchas escuras com um halo amarelo de tamanho vari- da oliveira Prays oleae
vel. Quando se forma o miclio este cor branca. A traa da oliveira um lepidptero da famlia Ypo-
Mosca da oliveira nomeutidae, esta perfeitamente adaptada ao seu principal
Verticiolose (Bactrocera oleae Gmel.) um inseto da classe dos hspede, a oliveira.
Esta doena tem como agente causal o fungo de solo dpteros e famlia Tephritidae e considerada a praga que Esta praga passa por trs geraes anuais que se suce-
Verticillium dahliae Kleb.que entra pela raiz da oliveira e maiores prejuzos causa produo do olival. Afeta qua- dem ao longo da campanha, em perfeita sincronia com a
infecta os vasos condutores da planta impedindo a circu- se em exclusivamente a oliveira. O adulto tem cerca de evoluo fenolgica da oliveira.
lao da seiva at ao cimo da rvore o que leva sua mor- 4-5mm de comprimento por 10-20 de envergadura (Can- A primeira gerao a filfaga que se desenvolve nas
te. A doena tem duas maneiras distintas de atacar, uma tero,1997 Cit. Torres (coodenao),2007). A cabea gran- folhas. Os adultos , durante o ms de outubro e novembro
a apoplexia rpida e a outra uma secagem lenta. de de cor amarelada, os olhos so grandes com reflexos fazem a postura dos ovos nas folha e as larvas recm nas-
A tuberculose da oliveira causada pela bactria Pseu- verde-violeta. O trax pubescente com trs linhas lon- cidas mantm-se em galerias interiores durante o inverno
domonas syrigae pv. savastanoi . Os sintomas so visveis gitudinais de cor mais escura e sem pelos O abdmen . Em fevereiro aumenta a sua atividade, mudam varias ve-
em forma de tumores em todas as partes da planta poden- de cor castanha encarniado com 5 segmentos amarela- zes de folha e saindo para o exterior onde se alimentam de
do tomar grandes propores nos ramos e tronco. dos no dorso em que nas fmeas o quinto est modifica- de gemas de folhas. A pupao d-se geralmente na pgi-
do para constituir o oviscapto que tem forma cnica e 1mm na inferior da folha no interior de um casulo, mas tambm
Bibliogafia de comprimento o que torna muito fcil a identificao de podem faze-lo no tronco e no solo.
Almeida, M.J.V., 1899. La gaffa ds olives en Portugal. Bulletin de uma fmea. As asas so transparentes com as extremida- A sintomatologia fcil de identificar porque se ob-
la Socit Mycologique de France 15:90-94. des escuras. As fmeas so um pouco maiores que os ma- servam galerias nas folhas com diferentes configuraes.
Cacciola, S.O.; Agosteo, G.E.; Pane, A. & Magnano di San Lio, chos e no final do abdmen tm o oviscapto (Fig.) (de la Mais tarde, no incio da primavera as lagartas deslocam-se
1996. Observazione sullepidemiologia dellantracnosi Rosa et al.). para os rebentos novos destruindo-os.
dellolivo in Calabria. Informatori Fitopatologico 46: 27-32. Os adultos voam quase todo o ano, baixando as suas A segunda gerao a antfaga. Em abril e maio os
Carvalho, M.T.; Piteira, M. C. & Clara, M.I. 2003. Identificao populaes at quase desaparecer em abril e maio. A par- adultos que provm da gerao anterior depositam os ovos
de Colletotrichum acutatum em Olea europaea afectada pela tir de junho, quando as temperaturas so suaves, inicia-se nos botes florias fechados com preferncia pelo clice
doena da gafa. . III Simpsio de Olivicultura. Castelo Bran- a postura na azeitona dependendo a sua intensidade dos Pelekassis, 1962 e Bellido 1977). A fecundidade das fme-
co Portugal. anos e das zonas. Estes ovos sofrem uma grande mortali- as grande. As larvas neonatas penetram diretamente no
Guerber, J. C. & Correll, J. C. 2001. Characterization of Glomerella dade devido s temperaturas e falta de humidade dos me- gomo floral e alimentam-se fundamentalmente das ante-
acutata the teleomorph of Colletotrichum acutatum. Myco- ses de vero. No outono a mosca torna-se muito ativa, au- ras e do plen (Silvestris, 107 citado por Pelekasis, 1962) ou
logie 93:216-229. mentando progressivamente os ndices de azeitona picada estames e pistilos (Bellido, 1962). Pupam nos rebentos fru-
Martin, M.P. & Garcia-Figueres, F. 1999. Colletotrichum acuta- e rapidamente comea a encontrar-se todos os estados de tferos protegendo-se por restos de flores secas unidas por
tum and C. gloeosporioides cause anthracnose on olives. Eu- desenvolvimento, sobrepondo-se as geraes. Este nme- sedas. Esta a gerao que se desenvolve mais rapidamen-
ropean Journal of Plant Pathology 105: 733-741. ro muito varivel, dependendo anualmente da climato- te completando-se em mdia num ms e meio. O ataque
Simmonds, J.H. 1965. A study of the species of Colletotrichum logia e a predisposio das cultivares. verifica-se pela existncia de fios de sedosos a envolver os
causing ripe fruit rots in Qeensland. Queensland Journal of Os ovos so brancos de forma alongada de tamanho cachos florais nos quais se acumulam excrementos e res-
Agricultural and Animal Science 22:437-459. (cit in Guerber aproximado de 0,7mm de comprimento por 0,2mm de tos de ptalas.
& Correll,2001) largura. A gerao carpfaga inicia-se com a postura dos adul-
Sutton, B.C.,1992. The genus Glomerella and its anamorph Col- A larva poda de forma cilindro-cnica branca em tos sobre os frutos jovens. A durao da incubao situa-se
letotrichum acutatum. Biology, Pathology and Control. J.A. que a tonalidade mais ou menos clara depende da matura-
Fig. 000 Adulto mosca da oliveira.
Bailey & M.J. (eds), CAB International, Wallingford, 1-26. o do fruto, esta dividida em 12 segmentos e possui umas
Talhinhas,P.; Ferreira,P.; Neves-Martins, J.; Sreenivasaprasad, mandbulas fortes com armadura bocal mastigadora. Fig. Adultos da mosca da oliveira, a fmea ( esquerda)
S. & Oliveira, H. 2003. Colletotrichum acutatum: Principal A larva apresenta 3 estados de desenvolvimento iden- e o macho ( direita).
agente causal da gafa da oliveira. III Simpsio de Olivicultu- tificveis pelo seu comprimento: L1 (at 1mm), L2 (1-3mm)
ra. Castelo Branco Portugal. e L3 (3-8mm). Passados estes estados larvares sofre meta- Fig. 000 Aspeto exterior da azeitona depois da picada
da mosca.Fig. 000 Ovo da mosca da azeitona (no interior da
Von Arx, J.A.,1957. Die arten der gattung Colletotrichum Cda. morfose e transforma-se em pupa que de forma eltica
azeitona aspeto em corte).
Phytopathologishe Zeitschrif 29:413-468 (cit in Sutton, com cerca de 4-4mm de comprimento e 2mm de largura a
B.C.,1992). sua cor varia entre o amarelo-ocre e branco-areia confor- Fig. Adultos da mosca da oliveira, a fmea ( esquerda)
me se vai desenvolvendo. e o macho ( direita).

Fig. 000 Larva amarelada no meio das pupas.


{ 122 } O grande livro da oliveira e do azeite { 123 } O grande livro da oliveira e do azeite

entre ts a seis dia (Arambururg,1964). Aps a ecloso, a


larva penetra diretamente no fruto pelo lado do pedn-
culo escavando umas pequenas galerias (Azevedo,1965).
Uma vez no interior do fruto devoram o interior do caroo
durante um perodo de tempo que pode ir aos 150 dias (Ra-
mos et al., 1976) e saem novamente para o exterior. A pu-
pao d-se normalmente no solo, uma vez que o fruto cai
e no caso de no cair pupa em folhas ou no tronco (Torres,
(coordenao) 2007).
Os sintomas observam-se facilmente lupa os ovos no
clice dos frutos, em junho. Mais tarde d-se uma queda
de frutos sobretudo a partir de do fim de Junho e mais tar-
de em setembro. Seccionando os frutos podem ver-se as
galerias de penetrao das lagartas. Nos frutos cados, em
setembro/outubro, pode ver-se o orifcio de sada das la-
gartas para pupa, geralmente na zona de insero do pe-
dnculo (Torres, (coordenao) 2007).

Cochonilha
A cochonilha negra, Saissetia oleae Oliv. um homp-
tero da famlia Coccidae. Trata-se de uma espcie ovpe-
ra com reproduo partenogentica (os machos so muito
escassos) (Paparatti, 1986).
A euzofera, Euzophera pinguis Hawor. um lepidp-
tero da famlia Pyralidae muito comum, como hospedeiro
da oliveira, na regio Mediterrnica. Durante alguns anos Bern. um coleptero da famlia Curculionidae e consi- Fig. 000 Euzofera, Euzophera pinguis Hawor adulto.
esta praga era considerada na pennsula ibrica de impor- derada uma praga secundria na medida em est presen-
Fig. 000 Euzofera, Euzophera pinguis Hawor lagarta.
tncia econmica mdia. Contudo, nos ltimos anos os te nos olivais com baixa incidncia e apenas se desenvolve
seus ataques tm-se agravado e j considerada por Al- em rvores debilitadas (Torres,2007). Fig. 000 Adulto do caruncho-da-oliveira
cade (2003) (Cit. Torres,2007) como a terceira praga com
maior incidncia no olival. Bibliografia Fig. 000 Larva do caruncho-da-oliveira
As lagartas abrem galerias na unio dos ramos princi- Alcalde, A.E.2003. Feromona sexual da euzophera pinguis Haw.
pais provocando o colapso dos mesmos. Em olivais novos a para el cotrol del agusanado del olivo. Phytoma Espaa, 147:
lagarta pode anilhar o tronco principal provocando a mor- 60-61.
te integral da oliveira. O controlo no fcil uma vez que Arambourg, Y. 1964. Caactristiques du peuplement entomolo-
as lagartas se desenvolvem dentro dos troncos da oliveira e gique de llivar dans le Sahel de Sfax. Thse Docteur Facult
os inseticidas tm dificuldade em l chegar. des Sciences LUniversit de Paris, 137 p. taxonomy, ecology and the natural parasitization of the oli-
Fig. 000 Adulto da gerao filfoga O adulto uma borboleta de 2-2,5 de envergadura de Azevedo, A. 1965. A defesa da oliveira contra as pragas e doenas ve kernel borer. Ann. Inst. Phytopath. Benaki. 3: 185-308.
cor bege escuro com uma banda basal clara. no quadro da moderna olivicultura. Palestra proferida em Ramos, P., Campos, M. & Ramos, J. Dados sobre la co-biolo-
Fig 000 Lagarta da gerao antfoga O ovo de forma oval, achatado, de 1mm de compri- Abrantes como chefe dos Servios de Fitopatologia da Dire- gie de Prays olea Bern (lepidptero, Plutellidae) en el sur de
mento de cor clara que vai escurecendo. A postura feita o-Geral dos Servios Agrcolas. Espaa. II Generacin carpfoga. Cuad. C. Biol., 5: 159-170.
Fig. 000 Ovo da gerao carpfoga
em grupos de 5-6 ovos nas gretas do crtex ou nos ndu- Bellido, L.1977. El Prays del olivo. Biologia, daos, parasitismo Rosa, J. L. de la; Herrera,B.; Coleto, F.; Zamorano, F.; Caballero,
Fig 000 Cochonilha negra adulto los da tuberculose. y dinmica de poblacin. Tesis Doctoral, Universidad Cr- F.; Garrudo, L. & Barn,J. Control Sanitario del Olivar. Con-
A lagarta cilndrica, coberta de sedas de cor verde dova, 149 p. sejeria de Agricultura y Pesca, Junta de Andalucia
Fig. 000 Cochonilha negra, ovos. clara com a cabea bem diferenciada. Cantero, F. de A. 1997. Enfermedades e plagas del olivo. 3 ed. Ri- Torres, L. (Coordenao) 2007. Manual de Proteo Integrada do
A pupa tem 10-12mm de comprimento de cor clara e quel y Vargas Ediciones, S.L., Jan, 646p. Olival. 433pp. ISBN 978-972-9001-92-5
vai escurecendo. Paparatti,B. 1986. Lecaniidae. Saissetia oleae Olivier. Entomolo-
Pragas secundrias da oliveira gie oleicole. Conseil Oleicole International. Madrid: 173-186.
O Caruncho da oliveira, Pholoeotribus scarabaeoides Pelenkassis,C.1962. A contribution to the study of nomenclature,
{ 124 } O grande livro da oliveira e do azeite { 125 } O grande livro da oliveira e do azeite

Desequilbrios As folhas apresentam inicialmente uma colorao proceder-se, ainda, a aplicaes por via foliar de sulfato de
nutricionais mais amarelada na sua extremidade - clorose apical - que evolui magnsio ou nitrato de magnsio em concentraes de 2 a
para necrose (Figura 1). As zonas necrosadas podem atin- 3%, sendo uma das pocas o incio da primavera.
comuns em olivAis gir grande parte do limbo, sendo acentuada a separao
Portugueses entre estas e o resto do limbo verde, no existindo zona de Carncia de boro
transio. Simultaneamente com a necrose apical podem Nas folhas, os primeiros sintomas manifestam-se pelo
Pedro Jordo & Maria surgir necroses marginais. aparecimento de uma clorose apical, verde clara a verde
Os sintomas iniciam-se nas folhas mais velhas e in- amarelada, enquanto a parte restante permanece verde. A
Encarnao F. Marcelo tensificam-se no outono ou inverno, particularmente em clorose, frequentemente em forma de V, vai progredindo,
anos de safra, podendo evoluir para as folhas mais jovens. podendo atingir grande parte do limbo (Figura 3 A). Por
A sintomatologia visual uma forma de diagnstico Quando a carncia acentuada existe desfoliao intensa vezes, as folhas com cloroses so mais pequenas e apresen-
de desequilbrios nutritivos em que estes so reconheci- e seca dos ramos da periferia da copa. tam-se deformadas. Podem, igualmente, observar-se fo-
dos por aspetos particulares da planta, especialmente das A deficincia de potssio ocorre principalmente em lhas com necroses na sua extremidade, existindo com uma
folhas, embora o aspeto geral da rvore ou de alguns ou- solos pobres em potssio, em solos ricos em carbonato de zona de transio, amarelada, entre a parte apical e a parte
tros rgos permitam reforar a convico da presena dos clcio e/ou magnsio, com teores de argila muito altos, su- inferior que se mantm verde (Figura 3 B).
mesmos. O diagnstico de deficincias ou de excessos a jeitos a aplicaes elevadas de azoto na forma amoniacal, Os sintomas de carncia de boro podem incluir uma
partir de sintomas visuais apresenta, todavia, algumas li- em anos secos, em especial no caso dos olivais de sequeiro, intensa desfoliao, a morte dos gomos apicais, ficando a
mitaes. Refira-se, por exemplo, o facto de quando tais e em anos de elevada produo. rvore com aspeto arbustivo e emanjericado, inicialmente
sintomas se manifestam de forma percetvel j os desequi- As situaes de carncia de potssio podem corrigir-se em apenas alguns dos quadrantes. Por vezes aparecem de-
lbrios nutritivos so to marcados que a produo est atravs de aplicaes por via foliar de nitrato de potssio formaes nos frutos (Figura 3 c).
afetada. Por outro lado, notria a dificuldade de iden- (concentraes entre 2 e 3%) ou sulfato de potssio (con- Os sintomas comeam a manifestar-se nas folhas mais
tificao de aspetos anmalos que resultam da ocorrncia centraes entre 2 e 4%), particularmente quando o teor jovens e desenvolvem-se principalmente durante o outono
de sintomas pouco caractersticos, da sobreposio de ca- de humidade do solo insuficiente ou o olival se encontra e inverno, especialmente em anos secos. Evoluem depois
rncias ou excessos que conduzem a alteraes dos sinto- instalado em solos calcrios. Estas aplicaes devero ser para as folhas mais velhas (Figura 3 c).
mas usuais, bem como de alteraes devidas a aplicaes realizadas, entre outras pocas, antes da florao e no final A carncia de boro, largamente difundida em Portu-
de produtos fitofarmacuticos, ocorrncia de pragas, do- do vero ou incio do outono. As aplicaes de potssio por gal, ocorre em diversos grupos de solos, em especial nos
enas ou condies climatricas adversas que podem ser via foliar no devem dispensar a sua aplicao ao solo que, pobres neste elemento e arenosos. mais frequente em si-
confundidos ou ocultar os provocados por uma nutrio em olivais de regadio, poder ser atravs da gua de rega. tuaes de deficincia hdrica, especialmente notria em
desequilibrada. olivais de sequeiro.
Apesar das suas limitaes, este meio de diagnstico Carncia de magnsio Para corrigir a carncia de boro deve proceder-se sua
eficaz quando os sintomas visuais so tpicos e a pessoa Os sintomas de carncia de magnsio manifestam-se aplicao ao solo. necessrio, tambm, aplicar por via fo-
que os observa experimentada/conhecedora. um dos sobretudo nas folhas, que ficam clorticas. A colorao liar produtos solveis com boro em concentraes de 0,2
meios considerados mais eficazes, por exemplo, no diag- verde-clara ou amarelada pode surgir quer na parte apical a 0,5%, opo que particularmente importante em oli-
nstico da carncia de ferro. das folhas quer nas suas duas margens. Neste caso, a clo- vais de sequeiro. Poder ser necessrio efetuar mais do que
A confirmao dos desequilbrios nutritivos deve ser rose evolui da periferia para o centro, permanecendo ver- uma aplicao s folhas, devendo uma destas ser realizada
efetuada atravs da anlise foliar. Esta, independente- de a base, o topo e a nervura principal das folhas (Figura cerca de um ms antes da florao. Para aumentar a absor-
mente da sua ocorrncia, deve ser realizada anualmente, 2). Em algumas folhas podem surgir necroses. As folhas o do boro, recomenda-se acrescentar ureia na concen-
na altura do endurecimento do caroo, de modo a preve- caiem prematuramente. trao de 1% soluo com este elemento.
Figura 1 Carncia de potssio na cv. Galega Vulgar
nir a ocorrncia dos citados desequilbrios. Para alm des- Os sintomas de carncia de magnsio manifestam-se
Castelo Branco
te meio de diagnstico do estado nutricional das culturas, especialmente nas folhas da base dos crescimentos do ano, Carncia de ferro
necessrio o recurso anlise de terra e, em olivais de re- sendo mais facilmente visveis a partir do outono. As folhas apresentam uma clorose generalizada (Figu-
Figura 2 Carncia de magnsio na cv. Verdeal Transmontana
gadio, anlise da gua de rega para fundamentar uma fer- A deficincia de magnsio ocorre sobretudo em solos ra 4 A), embora as nervuras se mantenham verdes na fase - Mirandela
tilizao racional que dever ter igualmente em conta as pobres neste nutriente, especialmente de reao cida, em inicial da carncia. Os ramos tm um crescimento reduzi-
caractersticas do olival e as prticas culturais efetuadas. solos ricos em potssio e em olivais em que houve uma do, o mesmo acontecendo com as folhas. Figura 3 A Carncia de boro na cv. Galega Vulgar
Os sintomas que a seguir se descrevem de forma su- adubao potssica excessiva. Os sintomas de carncia de ferro manifestam-se ini-
mria traduzem as principais carncias de nutrientes ob- Para a correo desta carncia recomenda-se a apli- cialmente nas folhas mais novas (Figura 4 b), mas podem Figura 3 B Carncia de boro na cv. Galega Vulgar
servadas em olivais do nosso pas. cao ao solo de um adubo com magnsio ou, no caso estender-se a ramos inteiros (Figura 4 c) ou mesmo a toda
de solos com pH baixo e pobres em clcio e magnsio, a a planta. Figura 3 c Carncia de boro na cv. Galega Vulgar

Carncia de potssio aplicao de calcrio magnesiano ou dolomtico. Deve A carncia de ferro ocorre especialmente em solos
{ 126 } O grande livro da oliveira e do azeite { 127 } O grande livro da oliveira e do azeite

calcrios e em solos pobres em ferro.


As aplicaes de ferro por via foliar conduzem a resul-
Plen e Polinizao natureza pectocelulsica tendo funo de proteco do
tados muito transitrios na correo da carncia do nu- Helena Ribeiro1, Leonilde contedo celular do gro de plen, e a exina, camada mais
triente. O emprego de quelatos de ferro injetados ao tron- Calado2, Ana Cruz3, Juan de Dios externa, constituda essencialmente por esporopolinina,
co das rvores ou ao solo nas proximidades do tronco, em Alch4, Ilda Abreu2 e Augusto que lhe confere resistncia e proteco contra agentes fsi-
olivais de sequeiro, ou aplicados atravs da gua de rega, cos, qumicos e biolgicos. Esta ltima camada possui zo-
em olivais de regadio, apresenta-se como a forma mais efi-
Peixe5 nas com aberturas e apresenta-se dividida em duas cama-
caz de remediar esta carncia. A sua preveno atravs do Morfologia polnica das, a endexina, camada mais interna sendo homognea e
uso de porta-enxertos/cultivares resistentes clorose fr- O gro de plen o gametfito masculino das plantas contnua, e a ectexina, que pode ser esculpida apresentan-
rica surge como a medida mais adequada. com semente que se forma e desenvolve na antera a par- do uma estrutura complexa formada por colunas ou bcu-
tir de clulas especializadas (clulas esporognicas), sen- las que podem estar unidas superiormente por uma cama-
Outros sintomas anmalos do posteriormente lanado para a atmosfera. Para alm de da que forma o tecto. Este pode apresentar-se compacto
Muitos dos sintomas anmalos que se observam nas ser uma estrutura de diminutas dimenses (2 a 200 m) ou possuir perfuraes, ser liso ou ornamentado exibindo
folhas, ramos ou frutos podem ter outras origens que no parte integrante do ciclo de vida de uma planta, possuindo picos ou outro tipo de salincias.
as de ordem nutricional (pragas, doenas, acidentes fisio- todas as suas caractersticas e potencialidades genticas. As inmeras combinaes entre a polaridade, sime-
lgicos, etc.) ou aparecer simultaneamente com os sinto- Sendo uma estrutura biolgica sem mobilidade prpria, o tria, tamanho, forma, estratificao e ornamentao da
mas de alguns desequilbrios. Acresce que certos sintomas seu transporte desde as anteras at ao estigma da mesma parede do gro de plen, tipo, nmero e repartio das
de carncia so semelhantes aos de toxicidade, como pode flor ou de outra flor da mesma espcie deve ser assegurado aberturas possibilitam a distino morfolgica e identifi-
acontecer com os de boro nas folhas. por vrios agentes biticos e abiticos. Este transporte de- cao entre os gneros e at mesmo entre espcies da mes-
Os desequilbrios podem envolver mais do que um signa-se por Fluxo Polnico, sendo caso da oliveira maiori- ma famlia, uma vez que a estrutura do plen e o padro da
nutriente, conduzindo a sintomas pouco caractersticos, tariamente assegurado pelo vento. exina so geneticamente estveis.
como o caso dos apresentados na Figura 5, que inclui o A palinologia a cincia que estuda a morfologia ex- Assim, recorrendo a microscopia tica, microsco-
azoto. terna do gro de plen, a sua emisso e disperso na at- pia eletrnica de varrimento e microscpia eletrnica de
Apesar da relevncia que a carncia de azoto assume mosfera, bem como aplicaes destes estudos em diversas transmisso foi possvel determinar valores mdios de v-
em vrios olivais do pas, difcil diagnostic-la exclusi- reas do conhecimento entre as quais a agricultura. Neste rios parmetros do gro de plen da oliveira como rea
vamente atravs da sintomatologia visual, tal como, alis, contexto, os estudos palinolgicos podero dar uma con- (A), dimetro mximo (Pa) e mnimo (Eq) do gro de p-
acontece com outros nutrientes. tribuio importante no desenvolvimento cientfico e tec- len o padro da exina como largura e altura do muri (Wm,
Na Figura 6 observam-se folhas com necroses apicais, nolgico da Olivicultura. Hm), rea dos orbculos (Oa) e distncia entre os elemen-
passveis de serem confundidas com uma carncia de po- Na generalidade, e em particular o gro de plen da tos de ornamentao (Dse) ou mesmo parmetros da pa-
tssio. No o caso, pois as necroses do pice das folhas oliveira, revestido por uma parede inerte, a esporoder- rede do gro de plen como a largura da ectexina (Ect),
resultam da sua infeo pelo Coleophoma oleae, fungo de- me, sendo constituda por duas camadas: a intina, de da camada basal (Fl), da endexina (End), da intina (Int),
tetado no olival. As folhas encontram-se, ainda, afetadas
pela carncia de magnsio que mascarada pela ocorrn-
cia da referida infeo.

Figura 4 A Carncia de ferro na cv. Arbequina

Figura 4 B Carncia de ferro na cv. Arbequina

Figura 4 C Carncia de ferro na cv. Arbequina 1 Grupo de Ambiente e Sociedade, Centro Geologia da UP, Rua Fig. 1. Parmetros morfolgicos do gro de plen de Olea
do Campo Alegre, 687, 4169-007 Porto, Portugal; email: helena. europaea L. medidos ao microscpio ptico (A), electrnico
Figura 5 Folha da cv. Arbequina com distrbio associado ribeiro@fc.up.pt; ianoronh@fc.up.pt. de varrimento (B) e electrnico de transmisso (C). Gro de
carncia de azoto, clcio e magnsio 2 INRB, I.P./INIA, Herdade do Reguengo, Elvas, Portugal; email: plen da Olea europaea L. acetolisados, vista ao microscpio de
leonilde.santos@inrb.pt varrimento (D a I). Barras: D = 50m; E a H = 10m; I = 30m.
Figura 6 Folhas da cv. Verdeal Transmontana infetadas com A aplicao inadequada de alguns herbicidas ao oli- Gro de plen da Olea europaea L. acetolisados,
3 Servio Patologia Clnica, Laboratrio de Imunologia do
Coleophoma oleae e com carncia de magnsio val pode conduzir ao aparecimento de cloroses nas folhas, Centro Hospitalar Vila Nova de Gaia, Portugal. vista ao microscpio ptico (J e K). Barras = 10 m.
como as que se apresentam na Figura 7. 4 Estacin Experimental del Zaidn. CSIC. Granada. Spain;
Figura 7 - Folhas afetadas pela aplicao de herbicida 5 Universidade de vora ICAAM, Ap. 94, 7002-557 vora,
Portugal, apeixe@uevora.pt
{ 128 } O grande livro da oliveira e do azeite { 129 } O grande livro da oliveira e do azeite

0 5 10 15 20 25

Redondil
Verdeal de Serpa
Galega
Maanilha de Almendra
Negrinha
Conserva de Elvas
Carrasquenha
Verdeal de Trs-os-Montes
Maanilha de Tavira
Cobranosa
Blanqueta
Ascolana

Fig. 2 -Valores mdios e desvio padro dos parmetros


morfolgicos (dimenso, ornamentao da exina e elementos
da exina) de 12 variedades de Olea europaea L.
das columelas (Col) e a distncia entre as columelas (Dcol)
(Fig. 1). Fig. 3. Dendrograma obtido aps anlise de clusters a partir dos
Na Figura 2 esto representados valores mdios das di- valores dos parmetros morfolgicos e ultraestruturais do gro
versas medidas efectuadas em amostras de plen de 12 va- de plen medidos nas 12 variedades.
riedades de oliveira: Ascolana, Blanqueta, Carrasquenha,
Cobranosa, Conserva de Elvas, Galega Vulgar, Maanilha
de Almendralejo, Maanilha de Tavira, Negrinha, Redondil,
Verdeal de Serpa, Verdeal de Trs-os-Montes, recolhidas em
Elvas, nos campos de ensaio do Instituto Nacional dos Re-
cursos Biolgicos.
O plen das 12 variedades de oliveira possuem na ge-
neralidade simetria radial, forma subprolada a esferoidal-
-prolada, tamanho pequeno a mdio (mdia de 26,01m podero ser descritores relevantes para o conhecimento
de Pa e 18,12m de Eq). A exina apresenta granulosida- das diferenas fenotpicas existentes no germoplasma de
de, tectada com ornamentao reticulada (Dse mdia de uma regio, constituindo um bom parmetro taxonmico
0,33m e Oa de 0,67m), formada por uma malha larga de identificao.
(largura e altura mdias do muri de 0,56m e 0,73m res- Dado a existncia de grande nmero de variedades de
pectivamente) contnua, com columelas espessas e irregu- oliveira espalhados por vrias partes do mundo, com ca-
lares (valores mdios das Col e Dcol de 0,42m e 0,63m). ractersticas morfolgicas muito semelhantes que tor-
No entanto, foram observadas diferenas inter-varie- na por vezes difcil a sua correcta identificao, induzin-
tais a nvel dos parmetros do gro de plen medidos, o do frequentemente existncia de variedades homnimos
que permitem a diferenciao entre as variedades de Olea ou sinnimos, a caracterizao morfolgica do gro de p-
europaea L., e estabelecer relaes filogenticas (Fig. 3), len poder auxiliar a caracterizao taxonmica e identifi-
demonstrando que a morfologia e ultraestrutura polnicas cao de variedades.
{ 130 } O grande livro da oliveira e do azeite { 131 } O grande livro da oliveira e do azeite

Previso quantitativa de colheita modo obteno de um modelo de previso do potencial II) Modelo
Um dos aspectos que tem merecido destaque nos l- de produo modelo aeropalinolgico. Bioclimtico
timos anos a possibilidade de estimar antecipadamente A utilizao da FPA na previso da produo anual FPA
II) Modelo
Tmed e R
a produo anual de azeitona. A previso da produo de de fruto tem ainda duas vantagens adicionais. A primei- Bioclimtico
necessidades hdricas
fruto, fivel, precoce e operacional poder ser um elemen- ra permitir a integrao de vrios factores pr-florais de- FPA
estado fitossanitrio
Tmed e R
to importante no auxlio tomada de decises, tornan- terminantes na colheita. Assim, condicionalismos associa-
do possvel ao agricultor o planeamento de todas as acti- dos a stress hdrico, trmico, fitossanitrio ou nutricionais Fecundao e Maturao
vidades relacionadas com a colheita (quantidade de mo- ocorridos no ano ou anos anteriores reflectem-se no n- Vingamento do fruto
-de-obra, escalonamento das parcelas a colher, transpor- mero de flores produzido e na quantidade de plen emiti-
te at ao lagar), transformao (organizao da extraco do para a atmosfera. A outra vantagem a adaptao auto-
FEV MAR ABR MAI JUN JUL AGO SET OUT NOV DEZ JAN
e armazenamento) e comercializao (definio do volu- mtica do modelo ao longo das campanhas seguintes uma
me de stocks, campanhas de promoo, definio de pre- vez que a plantao de novos ou reestruturao de antigos
Florao Crescimento
os e contactos com exportadores) e aos organismos pbli- olivais e mudana no processo produtivo de semi-intensi- Fig. 5. Metodologia e variveis
do fruto
cos na determinao das ajudas econmicas anuais a atri- vo para intensivo e at mesmo superintensivo, reflectem- I) Modelo explicativas dos modelos de
buir produo ou no caso de compensaes decorrentes -se na quantidade de plen que emitido para a atmosfera. Aeropalinolgico III) Modelo previso estimados ao longo
de catstrofes naturais. A FPA de oliveira de uma determinada regio obti- FPA Bioclimtico do ciclo de desenvolvimento da
FPA oliveira. FPA: Fraco Polnica
A utilizao da fraco polnica atmosfrica total da pela amostragem atmosfrica do plen durante a flora-
Tmed e R Atmosfrica
(FPA) na elaborao de um modelo de previso de colheita o de Maio a Junho podendo recorrer-se a diferentes ti- necessidades

baseia-se no princpio que o nmero de flores de uma de- pos de equipamentos envolvendo, todos eles, uma compo- hdricas
terminada espcie por unidade de rea superior nos anos nente instrumental e vrios princpios operacionais que se
mais produtivos, originando assim maior emisso polnica baseiam essencialmente na gravimetria, no impacto e/ou
e por isso mais quantidade de plen presente na atmosfe- na suco. trs fases de desenvolvimento ao longo da campanha: i) evapotranspirao de referncia (ET0) e da evapotrans-
ra. Partindo deste princpio possvel correlacionar as va- Estes equipamentos foram instalados em locais es- florao; ii) crescimento do fruto; e iii) maturao do fru- pirao cultural (ETc) a partir de dados meteorolgicos
riaes inter-anuais da FPA com a produo de frutos de tratgicos da regio (representao geogrfica do olival e to (Fig. 5). e do coeficiente cultural (Kc) (Ribeiro et al., 2009). O Ifit
orientao dos ventos dominantes) (Fig. 4). O modelo de previso, para alm da varivel indepen- foi calculado com base nas condies meteorolgicas con-
Atravs da monitorizao dos fluxos polnicos deter- dente IPR, integra tambm variveis ps-florais uma vez sideradas favorveis ao desenvolvimento de pragas e do-
minado o perodo principal de polinizao da oliveira, ou que durante o perodo entre a florao e a colheita, as plan- enas do olival. Este ndice representado pelo somat-
seja, o perodo onde se regista uma maior FPA, pelo ajus- tas ficam expostas a condies ambientais que podero al- rio dos dias de ocorrncia de precipitao com temperatu-
te de um modelo logstico s emisses polnicas (Ribeiro et terar o potencial de produo determinado durante o pe- ras mdias amenas entre os 15 e 25C para o perodo entre
al., 2007). Este modelo permite determinar o perodo efec- rodo da florao. No caso do olival, o longo perodo en- Setembro-Outubro.
tivo de polinizao e o clculo de um ndice polnico regio- tre a florao e a colheita da azeitona potencia o aumento O ajuste dos modelos de previso foi efectuado por re-
nal (IPR), que ser utilizado na estimao dos modelos de dos riscos de ocorrncia de factores de stress para a plan- gresso multilinear com os valores referentes quantidade
previso da produo de azeitona. ta e que no so considerados pelos modelos de previso de azeitona oleificada pelos lagares (toneladas), para as re-
Aps alguns anos de amostragem dos fluxos polnicos baseados unicamente na amostragem aeropolnica. As- gies do Alentejo e de Trs-os-montes e Alto Douro, obti-
da oliveira nas regies de Trs-os-Montes e Alto Douro e sim, incorporou-se a influncia das condies ps-florais, dos a partir da base de dados do Instituto Nacional de Es-
no Alentejo, foi desenvolvido um modelo bioclimtico de tais como stress trmico ou hdrico e a ocorrncia de do- tatstica. Aps este ajuste, verificou-se que o ndice polni-
previso da produo anual de fruto, que actualizado em enas e/ou pragas, que podem ter influncia determinante co regional foi a varivel independente com maior influn-
nas fases de crescimento e maturao dos frutos com con- cia, mostrando uma capacidade explicativa da variabilida-
Fig. 4. Captadores Tipo Hirst (A) e Tipo Cour (B) apresentando
sequncias na produtividade da cultura, atravs da intro- de inter-anual de produo foi de 58% em Trs-os-Montes
um interceptor de fluxo, orientam-se de acordo com a direco
do vento. duo por exemplo de ndices derivados de pr-processa- e Alto Douro e de 66% no Alentejo, evidenciando a impor-
mento dos dados meteorolgicos brutos modelo biocli- tncia do perodo pr-floral e floral nas flutuaes inter-
mtico de previso. -anuais de produo de fruto. Consequentemente, com o
Este modelo incluiu duas variveis ps-florais: ndi- modelo aeropalinolgico torna-se possvel conseguir, 7 a 8
ce conforto hdrico-ICH e ndice estado fitossanitrio do meses antes da colheita, uma previso da produo de fru-
fruto - Ifit. O ICH foi calculado mensalmente, de Junho to, obtendo-se uma primeira avaliao do potencial pro-
a Agosto, pela diferena entre a evapotranspirao cul- dutivo da planta.
tural (ETc) e o volume de precipitao (R), sem conside- A incluso, no modelo, das variveis ps-florais ate-
rar a reserva hdrica do solo, de acordo com a equao de nuou os desvios observados na previso, complementando
Hargreeves (Allen et al., 1998), para determinar o valor da a explicabilidade da varivel independente ndice polnico
{ 132 } O grande livro da oliveira e do azeite { 133 } O grande livro da oliveira e do azeite

Modelo de previso de colheita Alentejo


O conhecimento da existncia de problemas de auto e temperaturas mximas e mdias registadas no perodo de
Modelo Aeropalinolgico Modelo Bioclimtico inter-incompatibilidade na oliveira mais recente, razo Fevereiro a Maio condicionam a data e a durao da flo-
Florao Crescimento do fruto Maturao do fruto pela qual, ainda hoje, raro pensar-se na necessidade de rao, nomeadamente um somatrio das temperaturas
utilizao de polinizadoras durante os estudos de imple- mximas elevado, que corresponde a uma antecipao da
120 Observado 120 Observado -2% 120 Observado

Previsto
-22%
Previsto

Previsto
5%
mentao de novos olivais. poca de florao (Cordeiro e Martins, 2002). Na varieda-
100 100 100 Sobre este aspeto, Pinillos e Cuevas (2009) referem de Manzanilla de Sevilla registaram-se diferentes respos-
80
-26% -9%
80
-4% -3%
80 -4% 2% que, em Espanha, a maioria dos olivais monovarietal e tas de incompatibilidade em anos diferentes, tendo sido
Produo (t x1000)

Produo (t x1000)

Produo (t x1000)
21% 37%
27% 3%
-6%
26% -5%
0% que este facto deve-se crena dos agricultores de que a atribudas a um efeito das temperaturas elevadas durante
60 60 4% 12% 60 -14% 13% 13%
-21% -7%
-20%
-6%
9% oliveira no requer polinizao cruzada. Os mesmos auto- o perodo de florao (Griggs et al., 1975).
40 40 40 res referem ainda que, no caso de pases onde o patrim- Cuevas (1992) refere no entanto que no inexiste um
nio varietal olecola rico, a polinizao livre suficien- efeito direto das altas temperaturas no processo de incom-
20 20 20
te para assegurar a necessria polinizao cruzada, sendo patibilidade mas apenas um efeito indireto, devido sua
0 0 0 por isso natural que os agricultores no compreendam a influncia na qualidade da flor (Cordeiro et al., 2004).
1999 2000 2001 2002 2003 2004 2005 2006 2007 1999 2000 2001 2002 2003 2004 2005 2006 2007 1999 2000 2001 2002 2003 2004 2005 2006 2007
necessidade de introduo de polinizadoras. O estudo das relaes de compatibilidade tem sido efe-
Modelo de previso de colheita Trs-os-Montes
Cuevas e Pollito (1997), j tinham referido que nos ca- tuado com base em processos de polinizao cruzada ar-
120 Observado 120 Observado 120 Observado
sos de auto-polinizao a maioria dos tubos polnicos era tificial e subsequente observao do crescimento do tubo
2%
-28% -5%
Previsto Previsto Previsto
100
7%
100
7%
100
-6%
incapaz de crescer atravs do estilete e alcanar o vulo por polnico (Bartoloni e Guerriero 1995; Cuevas et al., 2001)
80
11% -7% 44%
80 -7% -4%
-2%
80
-10% forma a consumar a fertilizao. Os mesmos autores refe- e das taxas iniciais de vingamento (Singh e Kar 1980). Foi
Produo (t x1000)

Produo (t x1000)

Produo (t x1000)
-1% -2% 1%
1% -10% 15% -5%
6%
rem que, o plen de outras variedades que chega ao estig- com base neste tipo de metodologia que Cuevas (2005),
-12% -14% 3%
60 60 38% 60
19% ma de uma flor, atravs de polinizao cruzada, desenvol- classificou as principais variedades Espanholas de oliveira
4%
40 40 40 ve tubos polnicos que apresentam um rpido crescimen- em trs grandes grupos; -auto-compativeis, -parcialmente
to ao longo do estilete e asseguram fertilizao, dados que auto-incompativeis e auto-incompativeis (Fig.7).
20 20 20
apontam claramente para a existncia de um sistema de Nestes estudos assume-se que o tubo polnico atinge
0 0 0 auto-incompatibilidade em oliveira. o saco embrionrio, que a fertilizao bem-sucedida e
1998 1999 2000 2001 2002 2003 2004 2005 2006 1998 1999 2000 2001 2002 2003 2004 2005 2006 1998 1999 2000 2001 2002 2003 2004 2005 2006
Desde essa altura a ideia de que todas a variedades de que o fruto atinge a maturidade. No entanto, acontece fre-
Fig. 6. Diferenas, em percentagem, entre produo observada e em cada ano, mas apenas aproximadamente 1,2% des- oliveira so auto-compativeis foi abandonada e a espcie quentemente que aps um desenvolvimento inicial obser-
estimada pelos modelos de previso Aeropalinolgico (na etapa tas vo dar origem a fruto (Cuevas, 2005). Para esta bai- passou a ser considerada como parcialmente auto-incom- va-se uma elevada taxa de abciso de frutos, mostrando
de florao) e Bioclimticos (no final das etapas de crescimento
xa taxa de vingamento contribuem aspetos como as con- patvel. Os mecanismos de controlo da incompatibilidade que outros fatores no necessariamente relacionados com
e de maturao do fruto).
dies ambientais durante a florao, a esterilidade mas- em oliveira ainda no esto totalmente esclarecidos, Cue- a compatibilidade esto envolvidos nas quedas de frutos
culina e feminina e ainda problemas de incompatibilida- vas e Polito (1997), propuseram que se trataria de um siste- ps-fertilizao.
de plen-pistilo. ma de incompatibilidade gametoftico, mas nos sistemas De la Rosa et al., (2004) constataram a existncia de
A esterilidade morfolgica feminina ocorre quando se de incompatibilidade sob controlo gametoftico, de es- um elevado nvel de contaminao por plen estranho, ao
formam flores que possuem um ovrio muito rudimentar perar encontrar relaes reciprocas de compatibilidade / realizarem testes de paternidade baseados em quarto mar-
ou no o possuem de todo, so as chamadas flores estami- incompatibilidade entre cultivares e, se em muitos casos cadores microssatlites (SSR) com o objetivo de identifi-
nadas e a esterilidade morfolgica masculina deve-se au- isso acontece (Lewis 1994; Sedgley 1994), em outros (Mou- car os progenitores envolvidos na produo de plantas h-
sncia de anteras funcionais e a anomalias no desenvol- tier, 2002; Lavee et al.,2002), esta relao de reciprocidade bridas que se pensava terem sido obtidas por auto-poli-
vimento do plen (Loussert e Brousse, 1980). J a incom- no pode ser confirmada. nizao e por polinizao cruzada. Os resultados obtidos
regional. A varivel ndice de conforto hdrico (ICH) per- patibilidade um tipo de esterilidade caracterizado pela Lavee et al. (2002) sugerem que a diversificada origem surpreenderam e pela primeira vez colocaram em causa os
mitiu um aumento da explicabilidade dos modelos de pre- existncia de estruturas reprodutivas funcionais, que no da espcie Olea europaea L. ter dado origem a um com- procedimentos utilizados para a realizao de poliniza-
viso para 93% em Trs-os-Montes e Alto Douro e para formam descendncia devido a um obstculo fisiolgico plexo sistema de controlo da auto-compabilidade e por es controladas, especialmente quando os sacos de pro-
92% no Alentejo, enquanto o ndice do estado fitossani- que impede a fecundao. Esse obstculo pode ser a no esse motivo, necessrio continuar os trabalhos de inves- teo das inflorescncias no so colocados bastante an-
trio (Ifit) permitiu um aumento da explicabilidade para germinao do plen ou alteraes ao normal desenvolvi- tigao neste domnio por forma a entender o processo e tes da antese.
97% em ambas as regies (Fig. 6). No final as diferenas mento do tubo polnico. os genes que o controlam. Diz et al., (2006) corroboram as afirmaes de De la
mdias obtidas a entre produo prevista pelos modelos A existncia de flores anormais em oliveira quer por Mas independente dos mecanismos de controlo da Rosa et al., (2004) referindo que as deficincias metodo-
estimados e observada foram de 6% em Trs-os-Montes e atrofia dos rgos reprodutores masculinos quer dos fe- imcompatibilide, sabe-se tambm que a resposta condi- lgicas detetadas em alguns estudos sobre anlise da in-
Alto Douro e 7% no Alentejo. mininos conhecida desde h muito, mas, devido baixa cionada pelas condies climticas. As temperaturas ele- compatibilidade podem ter conduzido a uma constata-
percentagens de flores polinizadas necessria para se ob- vadas no perodo de florao podem afetar a recetivida- o errada de autocompatibilidade. Estes autores desen-
Polinizao e vingamento ter anualmente uma boa produo, o problema nunca sus- de do estigma, a longevidade do vulo e o crescimento do volveram um trabalho em que, tal como De la Rosa et al.,
Uma nica oliveira pode produzir 500.000 flores citou grande interesse. tubo polnico (Griggs et al., 1975; Cuevas et al., 1995). As (2004), utilizam marcadores SSR para avaliar o nvel de
{ 134 } O grande livro da oliveira e do azeite { 135 } O grande livro da oliveira e do azeite

Quadro 1 Classificao de 48 variedades espanholas em funo do seu nvel de auto-incompatibilidade, me-

Verdeal de Trs-os-Montes

Verdeal de Trs-os-Montes

Verdeal de Trs-os-Montes
Maanilha de Almendra

Maanilha de Almendra

Maanilha de Almendra
dida no final da fase de vingamento dos frutos. A negrito identificam-se as principais variedades.

Maanilha de Tavira

Maanilha de Tavira

Maanilha de Tavira
Conserva de Elvas

Conserva de Elvas

Conserva de Elvas
Verdeal de Serpa

Verdeal de Serpa

Verdeal de Serpa
Carrasquenha

Carrasquenha

Carrasquenha
(Adaptado de Cuevas, 2005)

Cobranosa

Cobranosa

Cobranosa
Blanqueta

Blanqueta

Blanqueta
Negrinha

Negrinha

Negrinha
Ascolana

Ascolana

Ascolana
Redondil

Redondil

Redondil
Galega

Galega

Galega
MW MW MW
Classe ndice de Variedades1 (KDa) (KDa) (KDa)
(n. de variedades) auto-compatibilidade 75
50
34
Variedades >0,8 Arbequina, Alameo de Cabra, Bolvino, Callosina, Cornezuelo 37 34 32
32
auto-compatveis de Jan, Empeltre, Gordal Sevillana, Habichuelero de Baena,
(18) Imperial, Jaropo, Limoncillo, Manzanilla de Jan, Manzanilla de 25
20 17
Tortosa, Morrut, Nevadillo Blanco de Lucena, Ocal, Picual de 16
Estepa e Verdilla de Calatayud. 18
15 16
A B C
Variedades 0,5 - 0,8 Blanqueta, Caballo, Campanita de cija, Cornicabra,
Soro classe 2 (anticorpos IgE especficos a Olea = 1,35 kU/L) Soro classe 2 (anticorpos IgE especficos a Olea = 1,01 kU/L)
parcialmente Escarabajuelo, Hojiblanca, Imperial de Jan, Lechin de
auto-incompatveis (18) Granada, Manzanilla Cacerea, Morona, Negrillo de Arjona,

Verdeal de Trs-os-Montes

Verdeal de Trs-os-Montes

Verdeal de Trs-os-Montes
Maanilha de Almendra

Maanilha de Almendra

Maanilha de Almendra
Nevadillo de Santisteban del Puerto, Nevado Azul, Pajarero,

Maanilha de Tavira

Maanilha de Tavira

Maanilha de Tavira
Perillo de Jan, Picual, Picudo e Verdial de Huvar.

Conserva de Elvas

Conserva de Elvas

Conserva de Elvas
Verdeal de Serpa

Verdeal de Serpa

Verdeal de Serpa
Carrasquenha

Carrasquenha

Carrasquenha
Cobranosa

Cobranosa

Cobranosa
Blanqueta

Blanqueta

Blanqueta
Variedades 0 - 0,5 Alameo de Montilla, Changlot Real, Dulzal de Carmona,

Negrinha

Negrinha

Negrinha
Ascolana

Ascolana

Ascolana
Redondil

Redondil

Redondil
Galega

Galega

Galega
auto-incompativeis (12) Manzanilla de Sevilla, Manzanilla del Piquito, Nevadillo Negro
de Jan, Nevadillo Blanco de Jan, Pavo, Pico Limn, Rapasayo, MW MW MW
(KDa) (KDa) (KDa)
Sevillenca e Zarzariega de Orcera
45 42
32 38
autoincompatibilidade das cultivares Picual e Arbequi- Tabela 1. Nmero de embries atribudos a cada um
30 30
na. Na cultivar Arbequina encontraram uma total ausn- dos provveis dadores de plen, em dois anos de
18
cia de frutos resultantes de auto-polinizao, enquanto na observaes.
19 19
Picual observaram um baixa taxa de auto-fecundao. Pollen donor: Bar. Fra. Kor. Kal. Miss. Kat.
17 17
15 16
Estes resultados esto claramente em contradio com os D E
15
F
anteriormente apresentados por Cuevas (2005), que clas- Mother Tree 0 4 0 18 30 3 2 Soros classe 3 (anticorpos IgE especficos a Olea = 9,69 e 9,64 kU/L) 2 Soros classe 3 (anticorpos IgE especficos a Olea = 18; 10,9 e 12,6 kU/L) Soro classe 2 (anticorpos IgE especficos a Olea = 5,72 kU/L)
Barnea
sificam estas cultivares respectivamente como auto-com- espcie naturalmente elevada, como acontece em toda a das protenas solveis do plen e sua quantificao segun-
pativel (Arbequina) e parcialmente auto-compativel (Pi- Frantoio 1 0 0 29 45 1 bacia mediterrnica, mas, em zonas onde a oliveira no do um mtodo colorimtrico. Assim, para pesquisa de di-
cual), comprovando as deficincias metodolgicas referi- Koroneiki 3 0 0 12 68 4 uma espcie endmica, a instalao de novos olivais mo- ferenas na reatividade entre as variedades, foram utiliza-
das e provando que a auto-incompatibilidade a forma de Kalamata 0 26 87 0 3 0 novarietais ou mesmo a falta de cuidado na escolha dos das tcnicas bioqumicas, nomeadamente SDS-PAGE para
compatibilidade mais frequente em oliveira. polinizadores, pode levar a grandes problemas de produti- anlise dos perfis proteicos, e Western-blotting, para an-
Mission 1 6 82 0 2 1
Guerin e Sedgley (2007) tambm utilizaram marcado- vidade das plantaes. lise da alergenicidade, usando como anticorpo primrio
Os nomes dos cultivares foram abreviados da seguinte forma:
res SSR para determinar quais os dadores de plen para Alergenicidade do plen soros doentes sensibilizados ao plen de oliveira.
Bar, Barnea; Fra, Frantoio; Kor, Koroneiki; Kal, Kalamata; Mis,
cinco cultivares, Barnea, Frantoio, Koroneiki, Kalama- Mission. (Adaptado de Guerin e Sedgley, 2007). A alergia pode ser entendida como uma resposta exa- Foram verificadas diferenas nos perfis proteicos e
ta e Mission, plantadas em olivais no sul da Austrlia, em cerbada do sistema imunitrio a substncias estranhas ao alergenicidade diferenciada entre o plen das diversas va-
regime de polinizao livre. Os autores pem em relevo o Kalamata e Koroneiki e Koroneiki e Mission parecem organismo, estando dependente de vrios fatores como a riedades estudadas (Fig. 8).
facto de as oliveiras estudadas raramente serem auto-po- ser reciprocamente inter-compatveis, ao contrrio do par natureza e a durao de exposio aos alergnios. Comparando os perfis proteicos das diferentes varie-
linizadas: apenas foram observados 2 casos de auto-poli- Frantoio e Koroneikique exibem inter-incompatibilida- No plen de oliveira foram j identificadas cerca de 11 dades, verifica-se a presena dos mesmos polipeptdeos
nizao num total de 800 estudados e ambos do cultivar de recproca. Os autores sublinham que o polinizador do- protenas capazes de induzir reao do sistema imunit- mas alguns deles apresentam diferenas de intensidade
Mission (Tab 1). minante no necessariamente o vizinho mais prximo, rio humano e provocar alergias respiratrias (Salamanca de colorao das bandas dependendo da variedade. Esta
Ainda de acordo com os dados apresentados na tabe- indicando que a compatibilidade desempenha um papel et al., 2010). Este facto aliado caracterstica do ciclo re- maior intensidade de colorao indica-nos a presena de
la 1, os autores realam que o cv. Barnea receptivo ao p- central no sucesso da polinizao. produtivo da oliveira que consiste na produo de gran- maior quantidade desse polipeptdeo. Estas diferenas a
len de vrios dadores; que a maioria dos embries do cv. des quantidades de plen que conjuntamente com a eleva- nvel do perfil proteico refletiram-se em variaes na re-
Mission resultam da polinizao por Koroneiki, cultivar Como concluso pode dizer-se que os estudos mais re- da densidade de olival existente nas principais regies oli- atividade mdia dos soros de doentes alrgicos aos extra-
que tambm dador relativamente ao cv. Kalamata. Fa- centes provam de forma irrefutvel a existncia de uma au- vcolas, potenciam a ocorrncia de doenas respiratrias tos de plen.
zem ainda notar que o facto de nenhum dos embries de to-incompatibilidade dominante na maioria da cultivares alrgicas tornando-se um constrangimento importante no Entre as diversas variedades analisadas, Conserva de
Frantoio e Barnea ser atribudo ao cv. Koroneiki, apesar de oliveira e tambm a existncia de casos de inter-incom- quotidiano dos trabalhadores do olival e mesmo dos habi- Elvas e Galega apresentaram menor alergenicidade en-
da proximidade fsica das rvores em estudo, sugere uma patibilidade. Como referem Pinillos e Cuevas (2009) este tantes destas regies. quanto a Verdeal de Serpa foi sempre a mais reativa. A me-
possvel incompatibilidade entre estes cultivares. Os pares facto pode no ser um fator determinante para condicio- As 12 variedades utilizadas na anlise da morfologia nor ou maior reatividade indicada pela afinidade menor
de cultivares Frantoio e Kalamata, Frantoio e Mission, nar a produo em regies onde a diversidade gentica da polnica foram tambm analisadas relativamente ao seu ou maior imunoglobulina E (IgE), anticorpo responsvel
potencial alergolgico. Para isso procedeu-se extrao pela reao do organismo a alergnios como as protenas
{ 136 } O grande livro da oliveira e do azeite { 137 } O grande livro da oliveira e do azeite

do plen, que dada pela menor ou maior espessura das Publication No 07/169, RIRDC Project No UA-65A, Octo- A OLIVICULTURA BIOLGICA Ferreira (2010), faz uma anlise profunda do rendi-
bandas marcadas nos immunoblots resultantes do wes- ber 2007, p.51. Carola Meierrose mento da cultura. Indica como rendimento lquido sem e
ternblot. O plen das variedades Cobranosa, Redondil, Lavee, S., Taryan, J., Levin, J., Haskal, A. (2002). Importancia de com subsdio os valores referentes s exploraes mdias
Verdeal de Trs-os-Montes, Ascolana e Negrinha tambm la polinizacion cruzada en distintas variedades de olivo culti- de 26 hectares (Quadro 1).
apresentaram grande reatividade, dependendo dos soros vadas en olivares intensivos de regadio. Olivae, 91:2536. O cultivo em modo biolgico Deste quadro ressalta que o modo biolgico de culti-
testados. Loussert, R.., Brousse, G. (1980) El olivo. Ediciones Mundi-Pren- A olivicultura biolgica um modo de produo que vo o mais rentvel, economicamente, desde que se possa
sa, Madrid, Espaa. 533p utiliza os recursos naturais de uma forma sustentvel e contar com os subsdios actualmente praticados. Um fac-
Bibliografia Moutier, N. (2002) Self-fertility and inter-compatibilities of sixte- contribui para a segurana e qualidade alimentar. A agri- tor importante, que pesa nos rendimentos a parcial au-
Allen, R.G., Smith, M., Raes, D., Pereira, L.S. (1998) Crop evapo- en olive varieties. Acta Hort. 586:209212. cultura biolgica no recorre a organismos geneticamen- sncia de vias de comercializao por parte dos olivicul-
transpiration: Guidelines for computing crop requirements. Pinillos, V., Cuevas, J. (2009) Open-pollination provides sufficient te modificados, a pesticidas, fertilizantes, promotores de tores em regime biolgico, de produtos de alto valor tais
Roma, FAO. levels of cross-pollen in Spanish monovarietal olive orchards. crescimento ou hormonas de sntese (Poas,2003, em como a azeitona de mesa, o azeite, a pasta de azeitona e
Bartoloni, S., Guerriero, R (1995) Self-compatibility in several clo- HortScience, 44: 499-502. Ferreira, 2010). demais produtos provenientes do regime de silvi-pastor-
nes of oil olive cv. Leccino. Advances Horticultural Science, Ribeiro, H., Cunha, M., Abreu, I. (2007) Definition of the main Este tipo de agricultura baseia-se no funcionamen- cia em agricultura biolgica . Os mercados internacionais
9: 71-74. pollen season using a logistic model. Annals of Agricultural to do ecossistema agrrio e recorre a prticas agrcolas que recompensam o esforo investido nestes produtos sobre-
Cordeiro, A.M., Martins, P. (2002) pocas de Florao de Varie- and Environmental Medicine, 14:159-167. fomentam o seu equilbrio e biodiversidade, dando um tudo na gama de alimentos gourmet.
dades de Oliveira na Regio de Elvas. Melhoramento, 38 : Ribeiro, H., Cunha, M., Abreu, I. (2009) A bioclimatic model importante contributo para a reduo da degradao e Os tratamentos fitossanitrios so responsveis por 11-
205-214 for forecasting olive yield. Journal of Agricultural Science, poluio ambiental (Associao Portuguesa de Agricul- 14% dos custos globais (Quadro 2).
Cordeiro, A. M., Martins, P., Rosa, M. M., Mouro, F., Botelho, 147:647-656. tura Biolgica, em Ferreira, 2010). A agricultura biolgi-
R., Ramos, A. (2004) Incompatibilidade plen/pistilo em va- Salamanca, G., Rodrguez, R., Quiralte, J., Moreno, C., Pas- ca respeita os ciclos da natureza (Alcobia, Ribeiro, 2001). O ecossistema
riedades de oliveira (Olea europaea L.), Melhoramento, 39: cual, C.Y., Barber, D. (2010) Pectin methylesterases of pol- Os objectivos subjacentes a este tipo de cultura so:- A olivicultura biolgica pode considerar-se a forma
114-121. len tissue, a major allergen in olive tree. FEBS Journal, (1) preservar o solo e desenvolver a sua fertilidade, (2) me- natural e original de conduo do olival, desde os tempos
Cuevas, J., Diaz-Hermoso, A.J., Galian, D., Hueso, J.J., Pinillos, 277(13):2729-2739. lhorar as produes, (3) preservar a fauna auxiliar do olival, em que a oliveira cultivada na regio mediterrnea.
V. M. P., Sola, D., Polito, V.S. (2001) Response to cross polli- Sedgley, M. (1994) Self-incompatibility in woody horticultu- (4) obter produtos finais de qualidade superior, (5) valori- A extraordinria longevidade das oliveiras garante a
nation and choice of pollinisers for the olive cultivars (Olea ral species, In: E.G. Williams, A.E. Clarke, and B.R. Knowx zar o produto e (6) aumentar o rendimento do olivicultor. conservao da biodiversidade nos locais da sua implan-
europaeaL.) Manzanilla de Sevilla, Hojiblanca and Picual. (eds.). Genetic control of self-incompatibility and reproduc- Em 2008, o Alentejo foi a regio do pas com maior tao, abrangendo tanto pragas e doenas, os seus antago-
Olivae, 85: 26-32. tive development in owering plants. Kluwer, Dordrecht, rea de olival biolgico (GPP, 2010), situada, predominan- nistas naturais e,, bem assim, um sem nmero de partici-
Cuevas, J. (2005) Incompatibilidad polen-pistilo, In: Variedades The Netherlands, 141163 temente, na zona entre Serpa e Moura. pantes indiferentes.
de olivo em Espaa, Rallo, L. et al. (Eds), Ediciones Mundi- Singh, R.P., Kar, P.L. (1980) Compatibility studies in some olive Uma importante parte destes olivais, de plantao tra- Estes organismos indiferentes no lesam a olivei-
-Prensa, Madrid, Espaa, 301-308. cultivars. Progressive Horticulture, 12: 9-15. dicional, apresenta uma densidade de 100 oliveiras por ra, nem os fitfagos ou seus antagonistas. Pelo contrrio,,
Cuevas, J., Rapoport, H.F., Rallo, L. (1995) Relationship among hectare, e possui em mdia 26 hectares geridos em uso muitas vezes alimentam elos do ecossistema tais como
reproductive processes and fruitlet abscission in Arbequina misto com a silvi-pastorcia. Nalguns dos olivais biolgi- predadores ou parasitides polfagos, durante perodos
olive. Advances in Horticultural Science, 9: 92-96. cos pratica-se a rega para aumento da produo. em que as pragas potenciais se encontram em estado de
Cuevas, J., Polito V. (1997) Compatibility relationships in Man-
zanillo olive. HortScience, 32:10561058. Quadro 1: Resultados econmicos globais, com e sem subsdio (Ferreira, 2010)
De la Rosa, R., James, C.M., Tobutt, K.R. (2002) Isolation and
characterization of polymorphic microsatellites in olive Biolgico de sequeiro Biolgico de sequeiro Biolgico com rega Biolgico com rega
12 m x 12 m 10 m x 10 m 10 m x 10 m 7mx5m
(Olea europaea L.) and their transferability to other genera
in the Oleaceae. Mol. Ecol. Notes, 2:265267. Valor Bruto da Produo 14040 23400 45240 93600
De la Rosa, R., James, C.R., Tobutt, K.R. (2004) Using microsa- Custos Operacionais 13321 17459 32680 57931
tellites for paternity testing in olive progenies. HortScience,
Resultados da Actividade 719 5941 12560 35669
39:351354.
Diz, A., Martin, A., Rallo, P., Barranco, D., De la Rosa, R. (2006) Total de Outros Custos 666 696 5321 9074
Self-incompatibility of Arbequina and Picual olive assessed Rendimento Lquido 53 5245 7239 26595
by SSR markers. J. Amer. Soc. Hort. Sci., 131:250255 sem Ajudas
Griggs, W.H., Hartmann, H.T., Bradley, M.V., Iwakiri, B.T., Whis- Resultados da Actividade 6567 11789 23270 46379
ler, J.E. (1975) Olive pollination in California. California Agr. com Ajudas
Expt. Sta. Bul., 869:150. Rendimento Lquido 5901 11093 17949 37305
Guerin, J., Sedgley, M. (2007) Cross pollination in olive culti- com Ajudas
vars. Australian Government - Project Report - RIRDC Nota: Valores apresentados para uma rea de 26 hectares.
{ 138 } O grande livro da oliveira e do azeite { 139 } O grande livro da oliveira e do azeite

Quadro 2: Peso das intervenes nos custos associados cultura (Ferreira, 2010) produtividade do seu hospedeiro. outras informaes imprescindveis a uma profunda com-
Na presena de populaes abundantes de inimi- preenso do sistema oliveira em contexto natural.
Grupo de Operaes Biolgico de sequeiro Biolgico de sequeiro Biolgico com rega Biolgico com gos naturais das potenciais pragas, o sistema regula-se de Tabela 1 resume os antagonistas da mosca da olivei-
Culturais 12 m x 12 m 10 m x 10 m 10 m x 10 m rega
modo a que, nomeadamente em olivais antigos, no se ve- ra, enquanto a tabela 2 se debrua sobre o complexo dos
ou irregular 7mx5m
rificam, em todos os anos, nveis econmicos de ataque inimigos naturais da traa da oliveira. Em Torres, encon-
Preparao do Terreno 11% 12% 7% 4% das pragas potenciais,. tram-se os dados necessrios para elaborar mais tabelas
Podas 16% 18% 9% 12% Do mesmo modo , em termos percentuais, nenhum do complexo dos antagonistas das demais pragas poten-
dos antagonistas, isoladamente, consegue controlar as ciais do olival.
Fertilizao (a) 11% 13% 18% 20%
principais pragas porque a sua biologia os limita ao para-
Tratamentos Fitossanitrios 14% 11% 12% 11%
sitismo ou predao dos ovos. Outras espcies parasitam A Modernizao do olival
Rega 0% 0% 10% 9% apenas larvas ou so predadores de ninfas, outras alimen- ponto assente que solues de proteco puramente
Colheitas 40% 40% 37% 40% tam-se de pupas, e por fim, outras espcies, eventualmen- qumica criam novas pragas (pelos desequilbrios entre fi-
te vertebrados, so predadoras de adultos. tfagos e os seus antagonistas provocados pelos produtos)
Carga e Transportes 5% 4% 2% 1%
As relaes trficas que se estabelecem entre o corte- e, no pior dos casos, as principais pragas tornam-se resis-
Factores de produo jo dos antagonistas, composto por espcies que partilham tentes aos pesticidas. A curto prazo, ter-se- de recorrer a
Mquinas e Equipamentos 39% 38% 34% 36% entre si o recurso praga consoante os diferentes estados largadas de auxiliares, investimento oneroso porque no
de desenvolvimento ovo, larva ou ninfa, pupa e adulto, basta uma espcie chave, como veremos nas tabelas dos
Mo-de-Obra 39% 40% 31% 34%
faz com que se houver necessidade de escolher uma esp- auxiliares ou inimigos naturais
Consumos Intermdios 22% 22% 35% 31% cie para biofabricao e largada nos olivais modernos, ne- Se, nos olivais antigos, a situao fitossanitria se en-
Nota: (a) No inclui custos com a instalao de enrelvamento, pois esta rubrica est includa no item preparao do terreno nhum antagonista seja, a priori, candidato nico para uma contra, em princpio, favorvel a um equilbrio flutuan-
por se considerar que para alm da disponibilizao de azoto, adquire extrema importncia ao nvel da manuteno e melhoria das aco,. Uma aco concertada, tal como se verifica, predo- te relativamente, pois no faltam conhecimentos porme-
caractersticas do solo. minantemente, nos olivais antigos, constitui um servio norizados relativos aos equilbrios ecolgicos e sua ma-
gratuito do ecossistema que convm preservar e fomentar nuteno em condies tradicionais, a situao apresen-
dormncia, em fases crpticas do seu ciclo de desenvolvi- espcies de predadores generalistas tais como aranhas e como medida complementar da olivicultura biolgica ou ta-se bem diferente na zona de expanso da olivicultura
mento, ou, de outra maneira, inacessveis aos seus inimi- aves. Estes nmeros evidenciam que, em caso de desequi- integrada. (Hinesman1, Torres et al., 2007). Tentar substi- moderna.
gos naturais. Assim, os indiferentes garanteam a diversi- lbrio do complexo ecossistema olival no existe uma so- tuir este sistema seria no s muito complicado como in- Neste modo de conduo, alteram-se, de sbito, mui-
dade funcional indirecta do ecossistema. Todos fazem fal- luo nica contra todas as pragas, mas a concertao en- comportavelmente oneroso. tos dos principais parmetros da cultura: aumenta-se a su-
ta e , se possvel, no devem ser perturbados com produ- tre todos estes participantes permite uma produtividade A Luta Biolgica pode, no entanto, eleger inimigos na- perfcie de cultivo muito alm dos 26 hectares em mdia
tos agro-qumicos, se possvel. regular da oliveira e a sua extraordinria longevidade. turais das pragas especializadas em estados iniciais dos fi- verificados nos olivais tradicionais. Passa-se de uma den-
Assim, na zona da olivicultura clssica, cada velha r- A oliveira constitui assim abrigo e alimento directo ou tfagos, tais como ovos e larvas jovens, largando-os em sidade de 82 ou 100 rvores por hectare a 150 ou mesmo
vore comporta em si no s os potenciais problemas, mas indirecto para todas estas espcies e as suas populaes. momentos exactos da oviposio da praga visada, assegu- 1500 rvores por hectare, no deixando oliveiras centen-
igualmente as solues destes problemas, que possam Os estados fenolgicos da oliveira, susceptveis aos di- rando que os olivicultores no usam insecticidas e assim rios nos arredores. Recorre-se a material gentico (outras
surgir de maneira acentuada nos olivais modernos. versos ataques dos seus consumidores parciais, atraem e permitir a invaso gratuita do olival pelas outras espcies variedades de oliveira) oriundo de outras regies geogrfi-
A composio da biodiversidade actual na biocenose favorecem ou no - o sucesso de um dado consumidor auxiliares naturais. cas. Introduz-se a rega como factor de cultivo intenso, al-
olival foi estudada em grande pormenor nas principais re- de rgos tais como inflorescncias, frutos em formao, Estes conhecimentos detalhados e muito exactos rela- terando assim, de vez, o micro-clima da cultura, criando-
gies de implantao da oliveira em Portugal (Torres et folhas jovens, ramos e lenho, ou rizoma. Por outro lado, tados por Torres et al. (2007), constituem uma excelente -se condies extremamente favorveis para certos orga-
al., 2007, Rei, 2006), e tambm em toda a regio mediter- os factores climticos, regem o momento de emergncia e ferramenta para a planificao eficaz e a prtica da protec- nismos consumidores, potenciais pragas do olival.
rnica. Os resultados constituem uma ferramenta indis- a dinmica populacional das potenciais pragas, dos seus o biolgica do olival moderno, em que a densidade das rvores jovens esro, no momento de transplante,
pensvel para a olivicultura biolgica moderna, com res- antagonistas e, bem assim, das doenas. Cada espcie tem oliveiras pode atingir at 1500 plantas por hectare. isentas tanto de pragas potenciais, como dos seus inimi-
peito proteco fitossanitria. as suas necessidades trmicas, nomeadamente: limiares gos naturais. Os primeiros colonizadores, tm um grande
Torres (2007) reuniu numa lista de pragas, doenas e inferior e superior de temperatura, humidade, resposta Alguns antagonistas das potenciais pragas avano sobre as populaes inimigas dos fitfagos. Se, na
antagonistas da oliveira, identificados at ao nvel de es- ao ciclo luminoso, intensidade luminosa, resistncia ou principais margem dos arvoredos, ainda se existe uma biodiversida-
pcie - 23 pragas potenciais entre insectos e caros, 18 no seca. Conforme as condies anuais do microclima, As tabelas 1 e 2 exemplificam quantos elementos com- de aceitvel, no interior destes olivais instalam-se primei-
agentes de doenas fngicas e bacterianas, 9 virus patog- uns so favorecidos e outros no. pem a biocenose directamente ligada ao hospedeiro oli- ro as pragas que encontram uma situao muito favorvel
nicos, 20 espcies de nemtodos e, curiosamente, 6 esp- Tendo em conta as minsculas dimenses dos insec- veira, mostrando a riqueza deste servio gratuito do ecos- ao seu desenvolvimento.
cies de infestantes. tos e caros e o seu diminuto consumo da matria vege- sistema. Os dados so oriundos da obra de Torres, 2007, Se no olival tradicional o servio do ecossistema gra-
Como inimigos naturais de insectos e caros, foram tal, perante a quantidade de rgos da planta hospedei- e da verso Wikipedia em Ingls, em que se encontram tuito e conta com centenas de anos de co-evoluo nos lo-
identificados, no mesmo sistema, 49 espcies de para- ra oliveira-, fica patente que apenas populaes de pra- preciosas informaes complementares sobre a bioecolo- cais da sua implantao, no olival moderno, este ecossis-
sitides, 32 espcies de predadores mais especficos e 6 gas muito densas podem interferir negativamente na gia, taxas de eficcia de certos inimigos naturais, e muitas tema est profundamente alterado e desequilibrado, o que
{ 140 } O grande livro da oliveira e do azeite { 141 } O grande livro da oliveira e do azeite

impe actividades de proteco fitossanitria onerosas, Para conseguir rapidamente um equilbrio ecolgi-
quer seja em modo de produo integrada, quer seja em co nestes novos olivais, recomenda-se uma proteco in- Quadro 4 Antagonistas da traa da oliveira Prays oleae (Bernard)
modo biolgico. tegrada baseada no conhecimento da biocenose existente
Nos novos olivais, coloca-se, de maneira aguda, o pro- nos olivais antigos, associando insecticidas muito selecti-
blema da proteco fitossanitria. Favorvel seria a exis- vos e em aplicaes pontuais raras, respeitando as biolo- Hospedeiro Parasitides Predadores
tncia de algumas das oliveiras centenrias na proximida- gias das pragas e dos seus antagonistas, cujo conhecimen-
Prays oleae Especfico Polifago de ovos de lagartas Predadores
de das novas plantaes, porque so biofbricas naturais to profundo j existe para importantes regies da olivicul- (Bernard) ocasionais
e gratuitas dos auxiliares com que a evoluo presentiou tura portuguesa. 3 geraes sobre (de larvas,
a oliveira pupas, adultos)
a olivicultura.
Encirtdeo Crisopideos Crisopideos
A. fuscicollis Chrysoperla carnea Chrysoperla carnea
30-76%, 80% eficcia 80-90% de ovos
Quadro 3 Antagonistas da mosca da oliveira nalgumas situaes,
larvas e pupas

Hospedeiro Parasitides Hyper- Predadores Calciddeos Dichochrysa Dichochrysa flavifrons


parasitides flavifrons (Brauer) (Brauer)

Bactrocera (Daculus) Generalistas de ovos Generalistas, Predadores ocasionais Trichogrammatideos Eulofdeos


oleae Gmelin (Diptera, Em larvas de adultos (de larvas, pupas, 40% de mortalidade P. agraules, 20% ou
Tephritidae) adultos) dos ovos menos

Opius concolor Lasioptera berlesiana Araneidae (adultos) Eulofdeos Antocordeos Antocordeos


(Ichneum.,Bracon.) Paoli (Dipt. E. flabellatus A. nemoralis A. nemoralis
Endoparasitide Cecidom.) (at 30%) Ectoparasita, e
hiperparasitide de
Pniglio agraules Chrysoperla carnea, Carabidae, outros auxiliares
Walker (Hym., Chalcid.) Neuropt. Coleoptera
Ectoparasitide Ichneumondeos Vespdeos
Diagegma armillatum
Eupelmus martellii Masi Eupelmus Staphylinidae, Ovelhas consumidoras (Gravenhorst)
Hym.Chalcidoidea) urozonus Coleoptera de azeitonas atacadas e 0,1-2,9% eficcia
Ectoparasitide cadas ao solo (larvas,
pupas) Sirfdeos
X. comptus (+ de 100
Eurytoma martellii Eupelmus Forficulidae Aves consumidores lagartas/ indivduo)
Domenichini, urozonus (bicho-cadela) de azeitonas atacadas
(Hymeoptera, Chalcidoidea (larvas, pupas) Bracondeo Bracondeo Sirfdeos
Ectoparasitide C. elaeaphilus A. xanthostigma Phytomyptera
(47% nalgumas Postura nas lagartas nitidiventris Rondani
Cyrtoptyx latipes Formicidae Pequenos Mamferos situaes) jovens do hospedeiro
Rondani (Hym., (formigas) (larvas, pupas) postura nos ovos do (30% eficcia)
Chalcidoidea), hospedeiro
Ectoparasitide
Acariddeos Aranhas
Fontes: L. Torres, 2007; Wikipedia Olive Fruit Fly, em Ingls, consult. Julho 2012, ACTA caros Salticus sp.

Para alem dos insectos e demais animais mencionados usou-se Bacillus thuringiensis, mas com pouco sucesso devido biologia Coccineldeos Aranhas
crptica desta praga. Scymnus (pullus) Philodromus
suturalis Thunberg sp.

Formigas Aranhas
Tapinoma nigerrimum Icius hamatus
(Nylander) (C.L.Koch)
{ 142 } O grande livro da oliveira e do azeite { 143 } O grande livro da oliveira e do azeite

Bibliografia
L. Torres, 2007, Manual de Proteco Integrada do Olival, Viseu,
Joo Azevedo, Ed., 433pp. ISBN 978-972-9001-92-5
F. Rei, 2006, A artropodofauna associada ao olival no mbito da
proteco da cultura contra pragas. Tese de Doutoramento,
297 pp. Universidade de vora
Poas, E. M. (2003). As Medidas Agro-Ambientais e o Olival: O
Caso Particular do Olival Biolgico. Lisboa: Trabalho de Fim
de Curso ISA, Lisboa. In Ferreira, D.J.B., 2010 - O olival em
modo de produo biolgico: Custos e Rentabilidade na re-
gio de Moura, Alentejo, Tese de Mestrado, 95pp, Lisboa
Ferreira, D.J.B., 2010 - O olival em modo de produo biolgico:
Custos e Rentabilidade na regio de Moura, Alentejo, Tese de
Mestrado, 95pp, Lisboa
Alcobia, M. D. & Ribeiro, J. R. 2001. Manual do olival em agricul-
tura biolgica. Terra S. Alij, I II pp.
Ciberreferncias
Consultadas em Julho 2012
1. http://www.ehow.com/how_4523425_care-olive-trees.html).
2.http://sbrtv3.ibict.br/resposta-tecnica/downloadsRT/
MjEyMTg=
3. http://eur-lex.europa.eu/LexUriServ/LexUriServ.do?uri=OJ:L
:2007:189:0001:0023:PT:PDF
4. http://en.wikipedia.org/wiki/Olive_fruit_fly
{ 144 } O grande livro da oliveira e do azeite { 145 } O grande livro da oliveira e do azeite

4
Melhoramento
em Olivicultura
{ 146 } O grande livro da oliveira e do azeite { 147 } O grande livro da oliveira e do azeite

Do melhoramento alimentares provenientes de outras oleaginosas, nomea- Macro mutaes espontneas (sports) so raras e, nor- M. Ivonne Clara e Serrano (1995) comprovaram uma
tradicional seleco damente os vindos do ultramar (dendm, amendoim ) malmente, so eliminados com a seleco (Becker, 1982). forte reduo da capacidade de enraizamento de estacas
desenvolveu-se, nos ltimos anos, uma conscincia de semi - lenhosas de Oliveira em casos da infeco por v-
clonal em Portugal. sade (alto teor em cidos gordos insaturados) e ambien- Tcnicas rus. No caso da variedade Galega vulgar a infeco pos v-
tal, qual se associou o sucesso dos azeites italianos (leo rus responsvel pelo fracasso no enraizamento de esta-
Hans Jrg Bhm Sasso, leo Dante e azeite de alta qualidade e caro de pe-
de melhoramento cas semi - lenhosas.
quenos agricultores). Tal levou a que se tenha desenvol- para eliminao
vido, mundialmente, uma nova tendncia a favor do azei- de fenmenos Tcnicas de deteco: Dentre as tcnicas utilizadas
A escola de rvores fruteiras
Com o reconhecimento de variabilidade dentro da
te da oliveira.
A cultura da variedade de oliveira nanicante Arbore-
de degradao na deteco de virus citam-se:
O teste Elisa (Enzyme Linked Immuno Sorbent Assay),
mesma espcie de rvores fruteiras, o homem sedentrio quina na Andaluzia, Espanha, face condio do seu de Seleco sanitria da Oliveira transmisso mecnica em indicador, dsRNA (RNA de du-
do neoltico foi seleccionando as que apresentavam maior Terroir favorvel (elevada capacidade de reteno de agua Na tentativa de obter material clonal de oliveiras, Por- pla hlice), RT-PCR (Reverse-Transcription Polimerase
valor alimentar . Face grande variabilidade entre as dife- no solo) e na Catalunha, praticando uma cultura regada, tugal, desde incio, considerou indispensvel a diagno- Chain Reaction)
rentes plantas, comeou a experimentar tcnicas de pro- superintensiva, comprovaram a rentabilidade sustent- se de infeces por microrganismos patognicos sist-
pagao vegetativa que lhe permitissem manter o gen- vel destas culturas. Nos anos 80, o governo portugus re- micos e transmissveis como critrio de eliminao na O envelhecimento ontognico
tipo. Tal aconteceu com muitas espcies, nomeadamen- conheceu a necessidade de melhorar os olivais existentes. multiplicao. Segundo Becker (1982) o envelhecimento ontogni-
te com a Olea europaea var. silvestris at obter as cultiva- Nesse tempo, mais de 50% do azeite consumido era im- co provoca uma diferenciao das castas em culturas es-
res consideradas O. sativa. Na antiguidade, esta tcnica portado. Para simplificar e possibilitar novas plantaes Bactrias: a tuberculose da oliveira, Pseudominea tveis e culturas instveis. Os clones mais velhos podem
estava aperfeioada como se reconhece, ainda hoje, com a em larga escala, foram desenvolvidas novas tcnicas de syringae pv. savastonoi, ser objecto de seleco diplontica visto que, na na mes-
existncia de rvores milenrias. Dos pases de marinhei- propagao (mist-propagation) por Paiva Caldeira (anos Fungus: Verticillium dahliae Klebahn, e as doenas ma planta se encontram diferentes tipos de tecidos (qui-
ros tais como dos Fencios e especialmente dos Gregos, ge- 80) que se deparou com o problema da qualidade do ma- radiculares: Rosellinia negatrix Pillieux, Armillaria meras somticas). Os tecidos dominantes dominam os
ntipos produtivos e com boa qualidade de azeite migra- terial vegetativo. A tcnica da seleco clonal, conhecida mellea (Vahl:Fr) menos fortes e causam a eliminao somtica destes (Be-
ram, em vrias ondas, do Este do mediterrneo em direc- pelo seu grande sucesso na viticultura pois levou recu- Fitoplasma da Oliveira. cker, 1982). Para manter um clone de uma espcie de fru-
o ao Oeste atingindo a Pennsula ibrica. As tcnicas de perao de variedades com alto valor enolgico que, an- Vrus: Foram detectadas, em Portugal, doenas cau- ticultura homogneo e estvel, os materiais de multiplica-
propagao deste tempo eram adequadas ao transporte e tes da seleco, eram praticamente improdutivas (Touri- sadas por vrus, alguns apresentando sintomas evi- o devem ser reinstalados de novo, regularmente, origi-
encontram-se descritas no captulo sobre propagao . ga Nacional, Cercial, Encruzado) foi adoptada tendo em dentes. M. Ivone Clara (2007) refere a presena de 15 nando, assim, sub-clones novos (Becker 1982). Uma outra
vista a produo sustentvel de azeite de qualidade. diferentes viroses na Oliveira. So eles: tcnica para obteno de clones estveis e homogneos
O melhoramento cultural de Olea europaea por No passado, as espcies de fruticultura eram melho- Nepovirus: Arabismosaic (ArMV), Cherry leaf roll vi- utilizada no novo mundo vitcola e na fruticultura. A cul-
seleco radas por seleco com base nas suas melhores caracters- rus (CLRSV), tura in vitro de plantas (Fevereiro, 1977) de clones impor-
O homem moderno reconheceu a instabilidade entre ticas. Uma vez seleccionadas muitas so utilizadas ainda Strawberry latent ringspot virus (SLRSV), tantes pode servir para produzir gerar clones rejuvenesci-
indivduos da mesma variedade, resultante de causas v- hoje. A plantao homognea com plantas apresentando Olive latent ringspot virus (OLRSV), dos de plantas com interesse econmico (Fevereiro, 1977).
rias e comeou a eliminar indivduos com base em crit- as mesmas caractersticas fenotpicas, foi possvel atravs Cumcumovirus: Vrus do Mosaico das Cucurbitce- Esta tcnica serve, ao mesmo tempo, para eliminar even-
rios de decadncia na plantao em novos olivais (seleco da propagao vegetativa. Mas nos sculos passados, por as (CMV), tuais re - infeces com micrbios patognicos sistmicos.
eliminatria). Mais tarde, comearam a multiplicar ape- razes vrias, apareceram, na descendncia,novos genti- Oleavirus: Olive latent vrus (OLV-2),
nas gentipos que apresentassem a melhor expresso das pos ligeiramente alteradas, na sua maioria em desfavor das Necrovirus: Olive latent (OLV-1), Micro - mutaes espontneas.
caractersticas fenotpicas desejadas (seleco massal). caractersticas desejadas. Vrus da Necrose do tabaco (TNV-D) As variedades de oliveira, mesmo em estado jovem e
A experincia adquirida com a espcie Vitis vinfera A falta de homogeneidade intra- varietal , ao longo do Tobamovirus: Vrus do Mosaico do tabaco (TMV) considerado estatisticamente estvel, sofrem, com a mito-
nos finais do sculo XIX, permitiu aperfeioar a tcnica tempo, pode resultar de: Potexvirus: Olivevein yellowing-assotiated virus se, um certo nmero de mutaes somticas. Na sua maio-
da seleco da Olea europaea. Em lugar de multiplicar ma- Infeco sistmica natural por microrganismos pato- (OVYaV) ria, estas mutaes so suprimidas pelo tecido original.
terial vegetativo de todos as plantas identificadas e mar- gnicos ou transmisso mecnica na propagao. Closterovirus: Olive yellow mottling and decline-as- Outras permanecem e so responsveis pela variabilida-
cadas, foram sistematicamente estudadas as caractersti- Envelhecimento ontognico da planta artificialmente sociated (OLYMDaV) de intra-varietal (Martins, 2007). Para diferenciar entre
cas do produto final de plantas individuais no local da sua prolongado com a propagao vegetativa repetida. Na fase No classificados: Olive latent (OLV-3), Olive mild a variao fenotpica (reversvel) causada pela influncia
plantao e definidos alguns, poucos, indivduos que fo- final considerada como de senilidade, a populao de uma mosaic (OMMV) , Olive semi latent (OSLV) ambiental, e a micro- mutao no gentipo (estvel) fo-
ram consideradas cabea de clone. Aps estudos de adap- variedade pode perder a sua estabilidade e homogeneida- ram realizadas plantaes experimentais englobando um
tao em diferentes situaes edafo-climticas, foram de- de na expresso das caractersticas observadas. Sintomas da infeco por virus: grande nmero de cultivares de oliveira, estruturadas em
finidos clones distintos adequados a diferentes objectivos Mutaes somticas ocorridas, regularmente, nas di- Na oliveira, M. Ivonne Clara (2007:318) referindo Mar- conformidade com as regras estatsticas que servem como
e localidades para futura implantao. ferentes fases de replicao celular (mitose), com conse- telli (1998, 1999) : identificou os seguintes sintomas: Para- base de uma futura seleco clonal em conformidade com
Aps a grave decadncia e o abandono de olivais por- quentes alteraes nas caractersticas das plantas e no pro- lisia parcial, deformao foliar, folha fauciforme, amarelo o potencial econmico da variedade.
tuguesas, no ltimo sculo, face concorrncia de leos duto final (produtividade, lcool, acidez, entre outras). infeccioso, Spherosis (Olive micro spheroblasts ).
{ 148 } O grande livro da oliveira e do azeite { 149 } O grande livro da oliveira e do azeite

A seleco clonal em Um exemplo de resultado obtido em Espanha para os A discriminao generalizada de micrbios sistmicos com 5 repeties e 2 plantas instaladas por gentipo.
Olea Europaea diferentes critrios de seleco:
Aptido para o enraizamento: Clone M-44 Mancanila
na seleco sem conhecer a sua patogenicidade para o clo-
ne em questo, limita excessivamente o espectro gentico.
Na valorao da gentica A. Martins refere a seguin-
te formula:
Cappelletti (1998) refere que esta cultura, historica- d.S. apresenta 62,5%, - a mdia 19,5% Por isso Martins a favor da utilizao de um conjunto po-
R = . I . h2
mente implantada em reas difceis como bordaduras ou Produo de azeitona (Kgs/planta): Clone M-44 Man- liclonal, incluindo clones de plantas pr-imunizadas (in- R = vantagem gentica,
zonas de valor agrcola marginal, apresenta uma forte retro canila d.S. apresenta 78,6%, - a mdia 53,1% fectadas com virus inactivos) se estes estiverem conformes = desvio tpico do fentipo
i = intensidade da seleco
orientao. A inovao tecnolgica orientada para a cultu- Peso do fruta (gs): Clone M-44 Mancanila d.S. no com os critrios estatsticos da seleco. h2 = hereditabilidade
ra sustentvel, provocou diviso entre dois tipos de olivi- apresenta diferenas Segundo Fausto Leito, o projecto PAMAF IED n
cultores - tradicional, e com filosofia comercial-, pelo que A prospeco das caractersticas desta variedade foi 2009 (inicio anos 90) - Valorizao das cultivares de Olea Por falta de apoios ao agricultor instalador desta plan-
esta espcie no foi ainda muito afectada por programas realizada nas diferentes localidades DOP (Denomina- europaea L. Negrinha de Freixo (denominao de ori- tao no havia rega suficiente e a plantao no permitiu
de melhoramento gentico. Algums programas de melho- o de Origem Protegida), (19 municpios e 7 comarcas), gem) e Santulhana em Trs-os-Montes reuniu uma equi- a obteno de dados adequados para uma anlise matem-
ramento por seleco clonal deram origem a variedades englobando um total de 109 cultivares distintas. Em Mas pa multidisciplinar e interinstitucional com objectivo de tica. A variedade Galega apresenta recalcitrncia ao enrai-
com importncia econmica. Mas, o melhoramento tem Bov foram multiplicados 15 diferentes clones, observado melhorar a qualidade dos produtos tradicionais e o esta- zamento (ndice mdio de enraizamento: 14,1 %). Na pro-
limitado interesse quando se trata de seleco intravarie- a regularidade da produo e o volume da azeitona, tendo belecimento de novos olivais. Neste sentido, a obteno pagao dos diferentes gentipos verificou-se uma grande
tal . Capelletti(1998) apresenta um catlogo exaustivo dos estas analisadas tendo em vista a avaliao da produtivida- de clones mais produtivos e isentos de vrus, resultantes variabilidade na capacidade de desenvolver razes adven-
objectivos do melhoramento da oliveira e refere estrat- de, quantidade e composioem cidos gordos, homoge- da seleco Por outro lado o material vegetativo a obter tcias (drasticamente condicionada pela presena de virus
gias, seguidas internacionalmente, na maioria orientadas neidade, estabilidade e caractersticas sensoriais do azeite. poder, posteriormente, estar disponvel para ser certifi- (Ivone Clara, 2007). A capacidade elevada de enraizamen-
para a obteno de caractersticas genticas desejadas por O Instituto da Oliveira em Sfax (Tunsia). A proble- cado e entregue actividade viveirista. to de alguns clones da Galega vulgar obtidos, inicialmente,
cruzamentos controlados . mtica da olivicultura na Tunsia no comparvel com na propagao efectuada em Elvas, parece depender ainda
A prtica da seleco clonal pode ser diferenciada de qualquer outra, devido reduzida densidade de plantao O melhoramento tradicional da Oliveira de outros factores. A propagao em larga escala (Viveiros
acordo com o seu objectivo. Para obter rapidamente mate- (17 plantas/ha) e em condies de extrema secura sem uti- em Portugal PLANSEL) dos 10 clones de maior pegamento no surtiu
rial de propagao em condies favorveis para o sector lizao de rega. Apesar estas condies to distintas foram Em meados dos anos 90, do sec.xx, na ento estao o mesmo efeito.
produtivo empresarial, serve seleccionar plantas com ca- tambm desenvolvidas tcnicas de avaliao de dados tc- de Olivicultura em Elvas, Luis Santos, aps os resultados A. Martins acompanhou um outro ensaio clonal das
ractersticas favorveis mantidas durante uma certa fase. nicos em plantas individuais com resultados vizando a dis- menos favorveis do primeiro programa de dinamizao castas Cobranosa e Madural (colaborao Elvas/Miran-
Para servir este sistema, a comunidade Europaea optou tino de clones. do olival nacional com base na multiplicao da varieda- dela). Enquanto o ensaio de Madural falhou devido a di-
pela certificao (e tambm pela norma CAC, aplicada em Em Portugal foi iniciada experimentao sistemti- de Blanqueta, optou pela variedade tradicional do pais: a ficuldades na propagao vegetativa por enraizamento di-
Portugal) do material de propagao da oliveira. O objec- ca com vista ao melhoramento da oliveira, mas no resul- Galega vulgar. A seleco de gentipos de Galega, em pra- recto, a Cobranosa apresentou um ndice de enraizamen-
tivo era pragmtico e orientado para a competitividade nos tou em certificao. Os estudos efectuados dizem respeito ticamente todo o Pas, resultou numa primeira plantao to de 36,4%. Foram seleccionados 104 clones da varieda-
mercados e para uma rpida resposta por parte do mate- a gentica quantitativa e os ensaios foram realizados com na quinta do Leo no Alentejo. A plantao foi orienta- de Cobranosa em 9 diferentes conselhos (das quais 50%
rial de propagao. o objectivo primrio de eliminar, ao mximo, o efeito am- da por Antero Martins (1997), tendo em vista os seguin- em Macedo de Cavaleiro e Mirandela) e multiplicados em
Rosati/ Itlia (2008) refere a riqueza gentica da oli- biental no fentipo da planta. A. Martins (1997) assinalou tes objectivos: Mirandela. A plantao foi efectuada realizou-se em 1996.
veira, com a existncia de 2600 variedades e um ainda vrias fragilidades no sistema da certificao comunitria. Avaliao da variabilidade gentica das sub - popu- Estes clones foram avaliados estatisticamente por A. Mar-
maior nmero de sinonimias. Assim considera que o ob- A base da seleco deve corresponder existncia real laes regionais com vista obteno de melhorias tins de acordo com os seguintes critrios: teor em cidos
jectivo da seleco clonal, em combinao com a seleco de sub populaes de diferentes gentipos, diferenciados, genticas. gordos e produtividade estvel e elevada nos anos 1999 a
sanitria, permite fixar o gentipo e obter material con- naturalmente, nas diferentes regies com presena tradi- Estudo da presena de virus e do seu efeito nas carac- 2003. O material policlonal desta plantao foi fornecido
forme com o original - trueness to type -. Para aumen- cional da variedade. Devem ser seleccionadas cultivares tersticas analisados, para relacionar a importncia da a multiplicadores. A plansel escolheu, com o apoio de
tar a biodiversidade este autor sugere a utilizao de tc- em conformidade com a sua densidade na zona respectiva. sanidade com a gentica. A. Martins, os 10 melhores clones que se encontram plan-
nicas de cruzamentos controlados tendo em vista objecti- Para conhecer as caractersticas genotpicas de um clo- Utilizao das seguintes caractersticas de seleco: tados em Montemor.
vos especficos. ne deve ser eliminado o efeito ambiental no fentipo da capacidade de enraizamento, produtividade, estabi- At agora no foi possvel a certificao oficial em Por-
Rallo/ Espanha (2005) considera a seleco clonal cultivar. Para tal, foi desenvolvido e utilizado um novo m- lidade da produo, reduo do desprendimento da tugal para qualquer das variedades.
um procedimento tradicional para melhoramento genti- todo de avaliao de matemtica quantitativa que pressu- fruta (Galega); obteno de colheitas com bom rendi-
co da oliveira. Segundo Rallo plantas com melhoramento pe, a recolha dos dados, a sua anlise e a validade esta- mento e com elevado teor de cidos gordos e grande Actividades de I&D
gentico e sanitrio em comparao com o conjunto varie- tstica do ensaio. estabilidade oxidao.
tal objectivo principal da seleco, no sentido de optimi- No considerado correcto multiplicar clones indi- Para avaliar o efeito ambiental numa seleco exclu-
para enraizamento
zar o material de propagao. Este autor considera correc- viduais, antes de conhecer o comportamento dos clones sivamente fenotpica foi realizada uma plantao experi- direto da Galega vulgar
tos os programas de seleco realizados na Catalunha (Ar- nas diferentes situaes edafo-climticos do Pas. A. Mar- mental em grande escala, com base numa larga prospec-
bequina), na Andaluzia (Mancanilla de Sevilla) e no Val de tins recomenda a utilizao policlonal, aps uma segun- o de plantas mes nas diferentes regies como segue: no A variedade Galega vulgar representa, de longe,
Ebro (Empeltre) visto que foram baseados numa metodo- da fase de seleco e limitao do volume a 10% da selec- caso da Galega vulgar foi avaliado um total de 128 genti- a maior superfcie olecola em Portugal. Esta varieda-
logia sistemtica. o inicial. pos (25 na Beira Litoral, 46 no Ribatejo, 57 no Alentejo), de produz azeite de elevada qualidade. Historicamente,
{ 150 } O grande livro da oliveira e do azeite { 151 } O grande livro da oliveira e do azeite

a multiplicao utilizando a zambujeira (Olea silvestris) do Ambiente e Vida, Associao Agricultores do Ribatejo. Referencias bibliogrficas Melhoramento
como porta-enxerto resulta bem. Esta tcnica, porm, Direco Regional Agricultura Ribatejo-Oeste (DRARO); Becker Helmut, (1982), Mutation und Klonenzchtung im Wein-
bau, in Deutsches Weinbau Jahrbuch, Waldkirchner Ver-
por hibridao
perdeu a sua validade quando esto em causa programas Estao Nacional de Melhoramento de Plantas Elvas, Vi-
lagsgesellschaft p. 15 32
de restruturao em grande escala, com exigncias de per- veiros PLANSEL e Lacrome.
Fevereiro Pedro et al., (1997), Cultivo in vitro de variedades por-
odos de tempo para implementao muito curtos e de cus- A propagao por enraizamento directo melhorou sig- tuguesas da Olea europaea L. Objectivos e resultados, Oli-
Antnio Cordeiro
tos por instalao muito abaixo dos possveis usando esta nificativamente com o aperfeioamento da tcnica. O con- vae n 66 p. 54-55
tcnica tradicional. Na Galega a propagao directa por es- trolo de factores como o tempo de permanncia na estu- Fontanazzo Guiseppe et al., (1998), Aspectos genticos e tcnicas No melhoramento gentico por cruzamento a planta
tacaria semi lenhosa (tipo mist-propagation) no aplic- fa, temperatura na cmara de cultura , estado fisiolgico de propagao para cultivo intensivo. In Enciclopdia mun- regenerada a partir da semente. A variabilidade na des-
vel, pelo que, a reestruturao do olival quase no conside- da planta a estabelecer em cultura, qualidade sanitria do dial da Oliveira, Conselho olecula internacional, Plaza & Ja- cendncia previsvel atendendo a que a oliveira uma
ns Editores Barcelona, p.111-134
rou a manuteno desta variedade autctone. material vegetativo utilizado permitem uma multiplicao espcie vegetal heterozigtica e alopoliplide (Couti-
Clara Maria Ivone et al (2007), Os Virus, in Manual de proteco
Foram os seguintes os projectos desenvolvidos no sen- in vitro adequada. Mas o problema de insucesso total em integrada do Olival, Joo Azevedo Editor, Viseu p.318-340. nho, 1956). Na descendncia sexuada de cultivares de
tido de proporcionar a manuteno do olival de Galega alguns programas de enraizamento, certamente relaciona- Leito F., Serrano J. M.. et al (1996) Estudos de seleccin clonal oliveira, diversos autores (Coutinho, 1956; Bellini,
para produo industrial: dos com o gentipo, limita o interesse do viveirista para se del Olivo cv. Negrinha, en la provncia de Trs os Montes. 1993; LAVEE, 1990; Natividade, 1968; Santos-An-
1998/2001 projecto Progalega Agncia de inovao dedicar a esta cultura em grande escala. Os viveiros PLAN- Olivae, no 62: 38-45 tunes et al., 1997) verificaram a existncia de acentuado
(Adi - IC-PME ) Estratgias para propagao da varieda- SEL, com o apoio da Universidade de vora, optaram pela Leito F, Serrano J.M. et al, (1997), Seleccin clonal y sanitria de polimorfismo durante a fase juvenil e que a descendncia
10 cultivares de Olea europaea L. en el sur de Portugal, Oli-
de Galega. Parceiros do projecto: consultor- Ruggini (Vi- micropropagao clonal. Foi instalada uma estao de mi- F1 de grande importncia no processo de seleo. Fiori-
vae, no 66: 51-53
terbo - Italia); participantes - ex-Estao de melhoramen- cropropagao, utilizando material oriundo de clones da Martelli, Giovanni P. (1998) Enfermedades infecciosas y certifi- no (2004), alm de confirmar essa variabilidade, conside-
to nacional (olivicultura Elvas), Universidade de vora, Vi- (Fig.1) seleco sanitria da cv. Galega, dos quais existem j cacin del olivo: Panorama general. Phytoma, 102: 180-186 ra ainda que a oliveira uma espcie onde existiu uma re-
veiros PLANSEL. resultados positivos (Fig.1). Martins Antero et al. (1997) Seleccin de las variedades antguas duzida seleo.
2004 AGRO 683 Desenvolvimento integrado de es- Com a revoluo a favor das plantaes regadas inten- de olivo Galega y Cobranosa, Olivae, cincia y tcnica, Ma- A semente encontra-se no interior do fruto, a azeitona
tratgias de reabilitao da cv. Galega vulgar como cultivar sivas e super- intensivas e a entrada em Portugal, em for- drid, n 66 Abril. e est constituda pelo embrio, os rgos de reserva e os
Martins Antero (2007), Variabilidade gentica intravarietal das
de charneira no patrimnio olecola nacional. Parceiros do a, de empresas olivcolas espanholas, nas grandes super- tecidos de proteo. O embrio resulta da unio entre g-
castas. In Portugal vitcola, o grande livro das castas, Cha-
projecto: Universidade de vora, Escola Superior Agrria fcies do Alentejo, na ultima dcada, o paradigma a favor ves Ferreira p.53 metas femininos e masculinos, durante o processo de fe-
de Santarm, Instituto Superior de Agronomia, Instituto do melhoramento das variedades autctones mudou com- Mohsen Khelif,( 2008) Observations preliminaires a une selec- cundao. Os cotildones so os rgos de reserva da futu-
pletamente. Com a importao de castas de plantas nani- tion clonale de la variet dlivier Chamlali (Olea europaea) ra plntula e onde tambm se encontram os fito regulado-
cantes (Abequina, Koroneiki, Chiquitita) e das castas es- revista nacional Tunisia ano p. 71 75 res endgenos. Os tecidos de proteo so formados pelo
panholas Picual e Hojiblanca para restruturao do olival Rallo Luis, (Plana J., Ordovas J.), 2004, Seleccin clonal en Varie- tegumento e pelo endocarpo. O endocarpo ou caroo inicia
dades, in Variedades de Olivo en Espaa, mundi prensa, Ma-
portugus de acordo com sistemas muito bem organiza- o seu desenvolvimento a partir da fecundao e aumenta
drid: 397-404
dos do vizinho espanhol, o interesse nas variedades autc- Rosati A.et al, (2008), Genetic improvment of olive from clon- de tamanho nos dois meses seguintes. Na fase final deste
tones foi marginalizado. Assim o melhoramento por selec- al selection to cross-breeding programs, Adv. Horticultural crescimento, o embrio e o endocarpo alcanam o seu
o clonal das variedades portuguesas perdeu, nas duas l- science, 22(2): 73-86 tamanho mximo e ocorre o endurecimento (esclerifica-
timas dcadas, o interesse por parte dos profissionais da o) do endocarpo. Este procedimento alm de facilitar
olivicultura. a disperso e o armazenamento das sementes, controla a
A variedade Cobranosa tem condies para ser certi- germinao (Rapoport, 2001)
ficada. Apesar das dificuldades descritas, a variedade Ga- A implementao de um programa de melhoramento
lega continua a apresentar um certo interesse embora de por cruzamento exige que se definam objetivos e estrat-
forma limitada. A micropropagao clonal desta variedade gias. Nas ltimas dcadas, diversos programas de melho-
apresenta alguma viabilidade no caso da seleco de clones ramento foram iniciados: na China (Anno, 1980, segundo
com produo elevada e homognea. A preocupao com Lavee, 1999), em Espanha (Len et al., 1998; Rallo et al.,
a originalidade regional das variedades autctones, pela 1998; Santos-Antunes et al., 1997), em Israel (Lavee, 1990,
sua reduzida dimenso, no tem justificado o desenvolvi- 1994), em Itlia (Bellini, 1990, 1993; Fontanazza e Baldo-
mento de dispendiosos e morosos programas de seleco ni, 1990), na Tunisia (Msallen, 1995), na Turquia (irik,
clonal, com riscos para a perda e a utilizao de gentipos 1994) ou em Portugal (Cordeiro et al., 2003). Nos progra-
Fig.1 Plntulas obtidas por micropropagao de gentipos com caractersticas de elevado valor acrescentado. mas em curso os objetivos so diversos, destacam-se por
da cv Galega. (foto Plansel) procurar obter novas cultivares de oliveira resistentes ao
frio (Anno, 1980, segundo Lavee, 1999), cultivares para
conserva (Bellini, 1993; Msallen, 1995), cultivares produti-
vas e adaptadas aos sistemas intensivos, resistentes seca
e ao olho de pavo (Lavee, 1994), cultivares produtivas e
{ 152 } O grande livro da oliveira e do azeite { 153 } O grande livro da oliveira e do azeite

adaptadas a sistemas super intensivos (Rallo, 1995), cul- e Cordovil de Serpa, escolhidas pela produtividade e qua- eficcia e menores danos para a semente. A dormncia
tivares produtivas e regulares, com maior rendimento em lidade do azeite, rendimento e caractersticas pomolgi- embrionria est controlada pelo embrio e pelos tecidos
gordura e composio em cidos gordos similar ao proge- cas, precocidade e hbitos de crescimento e pela qualida- que rodeiam a semente, a cobertura e o endocarpo. Segun-
nitor feminino e tolerantes gafa (Cordeiro et al. 2003). de do azeite. do Lavee (1990), a oliveira desenvolveu um mecanismo en-
Os diferentes programas de melhoramento por cruza- Existem ainda outras possveis fontes de genes: 1) dgeno que limita a germinao ao perodo entre o final
mento tem por objetivo obter plantas com caractersticas Como a maioria das cultivares autctones so proceden- do inverno e o princpio da primavera (condies edafo cli-
bastante precisas e com uma elevada e constante produ- tes de selees fenotpicas de populaes de zambujeiros, mticas favorveis). Esta evidncia confirmada pela ne-
tividade, otimizados com o ambiente. Atravs do cruza- separadas 1 a 2 geraes do prprio zambujeiro a explora- cessidade de frio e humidade relativa elevada (estratifica-
mento intervarietal ou interespecfico procura-se acumu- o do potencial gentico da Olea europaea L. est ainda o) que o embrio isolado requer para a germinao.
lar numa s entidade as caractersticas desejadas de cada muito limitada (Lavee, 1999). 2) As espcies prximas, es- A estratificao de sementes de oliveira sem endocar-
um dos progenitores (Fiorino, 2004). treitamente relacionadas e parcialmente auto frteis com a po tem sido objeto de estudo por diversos autores. Crisos-
oliveira, tais como Olea chrysophilla e Olea ferruginea po- to e Sutter (1985); Sottomayor e Caballero (1990); Alvara-
Seleo de progenitores dem tambm ser uma importante fonte de genes (Lavee, do (1994), Santos-Antunes (1999) estratificaram tempe-
100,0
A implementao de um programa de melhoramen- 1999). Nas ltimas dcadas foi implementado na China ratura de 14 - 15C e obtiveram taxas de germinao muito
to exige a idealizao de um modelo de planta a obter. Tra- um programa de melhoramento gentico da oliveira para elevadas. Botelho et al. (2006), aps rutura mecnica dos
80,0
ta-se, como referiram Fiorino e Fettini (1995), de conceber a resistncia ao frio que inclui genes de outras espcies do endocarpos estratificaram sementes das cultivares Blan-
a planta ideal nos diferentes aspetos: produtivo, morfol- gnero Olea (Anno, 1980 segundo Lavee, 1999). 3) Ape- o queta de Elvas, Cobranosa, Cordovil de Castelo Branco

60,0
gico, fisiolgico, de adaptabilidade ao ambiente, capaz de sar da variabilidade intervarietal existente, alguns autores a e Galega vulgar e determinaram a taxa de germinao aos
n
i
proporcionar um produto em quantidade e em qualidade tm tambm recorrido induo de mutaes com o obje- m
r 32, 46 e 68 dias (GRFICO). A germinao foi progressi-
e 40,0
adequada ao seu destino azeite ou azeitona de mesa re- tivo de conseguir numa planta uma maior e mais significa- g Blanqueta Elvas va, com maiores acrscimos no perodo entre os 32 e os
%
sistente s pragas e doenas e aos estresses biticos e abi- tiva presena das caractersticas consideradas necessrias 20,0
Cobranosa
46 dias. A viabilidade das sementes aos 68 dias foi mui-
Cord. C.Branco
ticos mais comuns. (Donini e Roselli, 1973). to elevada, taxas de germinao variando entre 63 e 92%.
Galega vulgar
A seleo dos progenitores tem sido realizada com 0,0 Observaram-se diferenas entre cultivares, maior taxa de
base no conhecimento agronmico, sanitrio e tecnolgico Germinao das sementes 32 dias 46 dias 68 dias germinao em Galega vulgar e Blanqueta de Elvas (92
dias de estratificao
atravs de avaliaes em coleo e/ou em ensaios compa- A germinao a primeira etapa no estudo da des- e 85%, respetivamente) e menor em Cordovil de Castelo
rativos e/ou em condies controladas. Os resultados ob- cendncia em oliveira e est considerada finalizada com Fig. 2 Endocarpos de oliveira (ou Azeitona)? Branco 63%.
tidos confirmam a grande variabilidade intervarietal exis- o aparecimento da radcula (Sottomayor, 1989). A germi-
Fig.3 Evoluo da germinao de sementes de oliveira
tente e para todas as caractersticas estudadas (Caballero nao um processo de reativao do aparelho metabli- Encurtamento do perodo juvenil
et al., 1990; Cimato, 1997). Em Portugal a informao dis- co da semente e compreende trs etapas (Hartmann e Kes- O prolongado perodo juvenil na oliveira constituiu
ponvel acerca das cultivares de oliveira autctones ainda ter, 1987): desde sempre o principal obstculo ao melhoramento por
escassa e incompleta (ver capitulo 5.2 Cultivares de oli- 1) Ativao, inicia-se pela fase de embebio de gua, de polinizao. Scaramuzzi (1957) citado por Sottomayor cruzamento. Na sua reviso bibliogrfica Hackett (1985),
veira identificao e caractersticas principais). Na atua- posteriormente ocorre a sntese de enzimas e o alonga- (1989), obtiveram taxas entre 20 a 25% enquanto Sotto- indica que no desenvolvimento das plantas lenhosas a par-
lidade existem colees em Elvas (Herdade do Reguengo, mento de clulas e emergncia da radcula; mayor (1989), obteve apenas 14% na taxa de germinao. tir de semente, existe um perodo denominado, perodo
INIAV) e em Mirandela (Quinta do Valongo, DRAPN), que 2).Digesto e translocao, caracterizada pela digesto Para que ocorra a germinao, a semente deve ser vi- juvenil, durante o qual a florao no ocorre nem pode ser
incluem cultivares autctones e estrangeiras. de substncias de reserva e a sua translocao aos locais de vel, ter superado o perodo de dormncia e existirem con- realizada. Em certas espcies este perodo muito longo.
A maioria dos programas tem optado por utilizar a va- crescimento; dies ambientais adequadas. A dormncia da semente Na oliveira a sua durao varia, segundo Fontanazza e Bal-
riabilidade que nos foi legada no processo histrico de se- 3) Crescimento da plntula, caracterizada por uma pode ser definida como uma suspenso temporal do cres- doni (1990), entre 15 e os 20 anos, mas pode, como referiu
leo. Na Tunsia escolheram como progenitores, as culti- fase de diviso celular ativa, a expanso de estruturas da cimento induzida por condicionalismos externos ou in- Natividade (1972), alcanar os 50 anos.
vares Meski e.Manzanilla de Sevilha - a principal cultivar planta emergncia - e a ativao da fotossntese e o incre- ternos que impedem a sua germinao. Entre as diferen- Aps a germinao o crescimento vegetativo inicial da
de azeitona de mesa. Em Espanha escolheram como pro- mento da taxa respiratria. tes formas de dormncia, existe a evidncia em oliveira da plntula rpido, alcanando a plntula um tamanho ra-
genitores nomeadamente as cultivares Arbequina, Fran- Em condies naturais a germinao lenta e progres- dormncia mecnica e da dormncia embrionria. O en- zovel num curto perodo de tempo. Durante o perodo ju-
toio e Picual selecionadas pela precocidade, vigor e pro- siva (Natividade, 1968; Ruggini, 1990). Esta espcie desen- docarpo constitui um impedimento externo para a germi- venil, na oliveira observam-se alteraes morfolgicas nas
dutividade, respetivamente. Em Portugal e na 1 fase do volveu diversos mecanismos de sobrevivncia das semen- nao do embrio tendo nomeadamente Crisosto et al:, folhas: mais notrias na cutcula, na grossura, na forma
programa optou-se pelo cruzamento em polinizao li- tes. O desfasamento representado pelo tempo necessrio (1985), obtido uma quase nula germinao de sementes e na pigmentao (em geral folhas mais pequenas e arre-
vre de oliveiras Galega vulgar e Cobranosa estabeleci- para a rutura do endocarpo, permite qua a germinao ape- com endocarpo enquanto a germinao de sementes sem dondadas e de cor mais intensa); no elevado nmero de
das numa parcela com mais de vinte cultivares diferen- nas ocorra quando as condies so favorveis e que man- endocarpo alcanou valores prximos de 100%. A escarifi- lanamentos axilares e no padro de ramificao; e na ca-
tes, com o objetivo de melhorar algumas das suas carac- tenha a capacidade germinativa por vrios anos. A percen- cao de endocarpos tem sido preconizada atravs de v- pacidade para formar razes adventcias. As folhas alon-
tersticas agronmicas. Presentemente, est em curso a 2 tagem de sementes ss em oliveira varivel, tendo nome- rios procedimentos, sendo que, a rotura mecnica adotada gadas aparecem ao final do perodo juvenil e a partir do
fase do programa que inclui cruzamentos controlados en- adamente Fernndez-Escobar et al. (1981) encontrado para por Sottomayor e Caballero (1990), tem mostrado maior seu surgimento, as plantas podem ser induzidas florao
tre as cultivares Galega vulgar, Cobranosa, Arbequina certas cultivares um efeito maior da cultivar que do tipo (Lavee, 1986). Entre o perodo juvenil e o perodo adulto
{ 154 } O grande livro da oliveira e do azeite { 155 } O grande livro da oliveira e do azeite

existe uma fase de transio em que a planta adquire as existir algum mecanismo hormonal que atravs das razes pela escolha dos progenitores: este autor encontru uma distribuio normal sem domi-
caractersticas morfolgicas de uma oliveira adulta mas controla o comeo da fase adulta. Nas diferentes combinaes realizadas Bellini (1993), nncia. Este autor tambm refere que nos primeiros anos
onde ainda no ocorreu a florao / frutificao (Alvara- Outra metodologia para o encurtamento do perodo verificou que todas as descendncias dos cruzamentos da o tamanho pode ser notvel mas nos anos seguintes com
do, 1994). Na copa das rvores a maturidade sexual verifi- juvenil a enxertia de lanamentos no estado juvenil em cv. Leccino apresentaram um perodo juvenil mais curto. o aumento da produo varia consideravelmente. Relati-
ca-se das partes mais externas para as mais internas. porta-enxertos adultos. Os resultados so contraditrios. Resultado similar foi tambm obtido para a descendncia vamente forma do fruto Bellini (1993), encontrou a for-
semelhana de outras fruteiras a foragem do Segundo Zimmerman (19729 citado por Alvarado (1994) a da cv. Verdale como progenitor masculino. As descendn- ma arredondada como a mais representativa nas descen-
crescimento constituiu o ponto fulcral na reduo do sua eficcia apenas se verifica quando as plantas j se en- cias das cultivares Coratina, Picholine e Tanche foram dncias estudadas. Por sua vez, Lavee (1999), refere a do-
perodo juvenil (Hackett, 1985; Lavee, 1990). De acordo contram na fase de transio, isto sem as caractersticas as que apresentaram o perodo juvenil mais prolongado. minncia da forma alongada na descendncia dos cruza-
com Lavee (1989) no perodo posterior germinao, as morfolgicas verificadas no perodo juvenil. No entanto No programa de cruzamentos com as cultivares Ar- mentos das cultivares kalamata e Barnea.
boas condies culturais para o crescimento das plntu- para Lavee (1989) este procedimento em oliveira apresen- bequina, Frantoio e Picual Santos-Antunes et al. (1997), Outras caractersticas, como o contedo em gordura
las (temperatura e humidade adequadas, nutrio racio- ta um efeito contrrio, por conduzir ao prolongamento do observaram que a cv. Arbequina conhecida pela sua pre- e o potencial frutfero apenas se estabilizam depois de 2
nal e rega controlada) e a poda dos lanamentos laterais perodo juvenil. cocidade transmitiu essa caracterstica s descendncias. a 3 anos de produo. Lavee (1999) observou a ausncia
so a chave do xito. Com este procedimento Lavee (1989) No sentido inverso, o comportamento tardio de Fran- de dominncia na heritabilidade dos nveis de rendimen-
antecipou o perodo juvenil a 4 5 anos. Outros autores, Quadro: ano de entrada em florao de gentipos toio apenas se viu melhorado quando Arbequina esteva to em azeite. Na descendncia de Galega polinizada livre-
Clavero e Pliego (1993) e Santos-Antunes et al. (1997), para de semente aps a plantao presente. mente foram encontrados gentipos com diferentes nveis
alm dos procedimentos culturais genricos, utilizaram o Ano aps Descendncia Descendncia A cultivar Galega vulgar apresenta uma entrada em de rendimentos, alguns dos quais com rendimento bas-
plantao de Galega vulgar de Cobranosa
fotoperodo contnuo mediante a iluminao noturna que produo precoce enquanto em Cobranosa mdia. As tante superior do progenitor feminino.
favoreceu o crescimento das plantas em altura. Clavero e 1 ano 5% 0% descendncias de Galega vulgar e Cobranosa poliniza- A capacidade de enraizamento tambm uma carac-
Pliego (1993) submetendo plantas de semente de oliveira das livremente (quadro ), entraram em produo um ano e terstica muito importante j que o estabelecimento de
2 anos 17% 3%
a fotoperodo continuo e plantas a fotoperodo de 12 horas dois aps plantao em campo, respetivamente. novas plantaes depende das plantas auto enraizadas.
3 anos 44% 31%
verificaram que 31% e 8% das plantas, respetivamente, en- O vigor nas descendncias tambm condicionado Estudos realizados com descendncias F1 de Manzanilla
traram em florao ao 4 ano. Santos-Antunes et al. (1997) 4 anos 78% 57% pelos progenitores selecionados. Durante a fase juvenil (capacidade de enraizamento elevada) polinizada livre-
com plntulas conduzidas a um eixo revestido e a poda dos Bellini (1993), observou um predomnio de plantas de vi- mente mostraram uma ampla variabilidade na aptido ao
lanamentos laterais aumentou o dimetro e a altura das A entrada em florao /frutificao (final do perodo gor mdio, mas em todas as combinaes foram identifi- enraizamento mas poucos gentipos apresentaram uma
plntulas. Utilizando este procedimento, 28 meses conta- juvenil) de plantas de semente de oliveira progressiva. cados gentipos com muito e pouco vigor. A autopoliniza- capacidade superior do progenitor. Na descendncia F1
dos desde a germinao de sementes as primeiras plntu- No quadro apresentamos a evoluo de entrada em flora- o tambm condiciona o vigor das plntulas. Todas as po- de Kalamata (enraizamento difcil) polinizada livremen-
las tinham alcanado a florao. o de descendncias de polinizao livre de Galega vul- pulaes de semente de hbridos obtidos a partir da auto- te um elevado nmero de gentipos apresentou maior ca-
Na figura apresentamos o procedimento experimen- gar e Cobranosa. Os primeiros gentipos entraram em polinizao realizados por Lavee (1999), deram origem a pacidade de enraizamento que a planta me (Wiesman
tal, proposto por Santos Antunes (1999) para o encurta- florao um ano aps a sua plantao em campo. Ao 4 ano plntulas de vigor mais dbil comparativamente s que se e Lavee, 1993). De forma similar nas descendncias F1 de
mento do perodo juvenil. A semente extrada do endo- aps plantao ainda nem todos os gentipos eram adul- desenvolveram a partir de cruzamentos ou de populaes Galega (enraizamento difcil) e Cobranosa (capacida-
carpo aps rutura mecnica, sendo as perdas irrisrias. As tos e mesmo ao final do 8 ano desde a plantao ainda de semente procedente de polinizao livre. A autopolini- de de enraizamento elevada) polinizadas livremente hou-
sementes so posteriormente sujeitas a uma estratificao existiam gentipos no perodo juvenil. zao provocou tambm na maioria dos casos uma dimi- ve uma resposta similar. A propagao vegetativa de des-
em ambiente com humidade relativa prxima da satura- nuio acentuada do vingamento. cendentes F1 de Galega polinizada livremente registou
o e a uma temperatura favorvel. A germinao ocorre Avaliao das descendncias O porte das rvores verificou-se estar condicionado uma maior capacidade de enraizamento que a planta me
ao fim de 30 a 45 dias e taxa de sucesso pode ser superior O conhecimento atual da heritabilidade das diferen- pelos progenitores selecionados. Nas descendncias dos mas so ainda necessrios trabalhos complementares para
a 75%. As plantas assim obtidas so colocadas em cresci- tes caractersticas na oliveira ainda reduzido. De acor- cruzamentos da cultivar Manzanilla as rvores so maio- confirmar.
mento forado at alcanarem aproximadamente 1,80m, do com Lavee (1999), o potencial gentico estuda-se ge- ritariamente pequenas e apresentam um porte de cresci- A avaliao / seleo da resistncia a doenas e pra-
aps o que so transferidas para o campo onde se inicia a ralmente atravs da expresso das diferentes caractersti- mento choro enquanto as dos cruzamentos de Barnea gas ainda difcil pois necessrio as plantas alcanarem
primeira etapa da avaliao, a seleo de gentipos indivi- cas nas descendncias F1 e F2, em hbridos obtidos por au- as rvores apresentam um porte ereto e estreito (Lavee, o estado adulto. A susceptibilidade a algumas doenas, de
duais F1. topolinizao ou em cruzamentos dirigidos. 1999). Bellini (1993) verificou o porte ereto nas descendn- acordo com Lavee (1999), considerada maior em pln-
Durante o perodo juvenil a poda demasiado inten- A durao do perodo juvenil refere-se ao perodo de cias das cultivares Grossane e Verdale (progenitor mas- tulas no perodo juvenil que em adultas. Particularmen-
sa condiciona o dimetro dos troncos e afeta a durao da tempo a partir do qual um dado gentipo alcana o esta- culino) e o porte choro nas descendncias de Verdale e te observou que a suscetibilidade ao fungo olho de pavo
fase (Santos-Antunes, 1997). Natividade (1972), descreve do adulto, inicia a florao / frutificao e a normalmen- Picholine. (Spilocaea oleagnea L.) em folhas juvenis das plntulas
a evoluo de zambujeiros na regio da Serra d Aire sub- te a primeira caracterstica a ser avaliada numa descen- A poca de florao e de maturao de azeitona das consideravelmente maior que as folhas adultas. Esta ob-
metidos a um constante pastoreio de animais onde encon- dncia de um cruzamento. A relevncia desta caracters- descendncias de Galega vulgar e Cobranosa polini- servao permitiu ao autor para realizar com xito a sele-
trou zambujeiros em perodo juvenil com uma idade que tica a sua manuteno durante a fase adulta. Aquando zadas livremente apresentaram uma distribuio normal o para esta doena.
poderia chegar aos 50 anos. Da sua observao concluiu do estabelecimento de um olival comercial o material ve- sem dominncia.
que qualquer fator que possa afetar negativamente o de- getal mais precoce tem tambm uma entrada em produ- Das caractersticas pomolgicas o tamanho do fruto, Referncias Bibliogrficas:
senvolvimento radicular e o equilbrio raiz copa, provoca o mais cedo. Num programa de melhoramento por cru- de acordo com Lavee (1999), varia consideravelmente nos (A ENVIAR POR CORREIO ELECTRONICO)
uma maior durao do perodo juvenil e considerou poder zamento esta caracterstica est claramente determinada primeiros anos de produo, pois com o aumento de pro-
duo diminuiu o tamanho. Nos cruzamentos realizados
{ 156 } O grande livro da oliveira e do azeite { 157 } O grande livro da oliveira e do azeite

A diversidade recentemente, de referir a descrio fenotpica de vinte escrevia que A dificuldade de caracterizao das cultiva- de gentipos resultantes de cruzamentos efectuados pelo
biomolecular da oliveira e duas variedades cultivadas, trabalho realizado na dcada res, acrescida pela confusa sinonmia olivcola nas diver- homem.
de 1980 por Leito, Potes, Calado e Almeida (1986). sas regies do Pas, ainda agravada pela interferncia dos A utilizao de marcadores moleculares permitiu no
portugus Actualmente, reconhece-se em Portugal um nme- factores mesolgicos na fisiologia da rvore, por sua vez s uma identificao inequvoca de indivduos, clones, va-
ro significativo de variedades cultivadas, que constituem susceptvel de expresso morfolgica. riedades e espcies, mas tambm o estudo e esclarecimen-
Pedro Fevereiro o germoplasma portugus da oliveira cultivada. Nas trs Embora seja possvel a utilizao de parmetros carpo- to das origens e da estrutura gentica da oliveira. Marcado-
coleces pblicas existentes na Herdade do Reguengo mtricos (dimenses do endocarpo semente - da azeito- res moleculares so protenas ou sequncias de DNA que
A oliveira cultivada (Olea europaea L. subs europa- em Elvas (D.O./ENMP/actual INIAV), na Herdade dos So- na) (figura 2) para identificao e discriminao varietal, apresentam polimorfismos (diferentes formas) quando
ea var. europaea) (figura 1) uma entidade biolgica que dos (DRARO) em Santarm e na Quinta do Valongo em tal s possvel quando as rvores se encontram em fase feita uma comparao entre indivduos, populaes ou
apresenta grande variabilidade, como pode verificar-se em Mirandela (DRATM) encontram-se, pelo menos, 40 cul- de frutificao. Em regra, s possvel a partir do tercei- grupos taxonmicos. Estes marcadores so transmissveis
Portugal, onde se encontram disseminadas variadssimas tivares portuguesas distintas, com as seguintes denomi- ro ano de crescimento e, mesmo assim, necessria uma descendncia e a sua transmisso monitorizvel. Poli-
cultivares com caractersticas bem diversas, algumas das naes: Azeiteira; Bical de Castelo Branco; Bico de Cor- anlise estatstica comparativa para se ter fiabilidade na morfismos so pequenas variaes na sequncia de prote-
quais fundamentais para a composio distintiva da maio- vo; Blanqueta de Elvas; Borrenta; Carrasca Comprida; Car- identificao. No entanto, a discriminao das cultivares nas, que no alteram a sua funo, ou no DNA da sequn-
ria dos azeites nacionais, sobretudo os produzidos nas re- raspana; Carrasquenha; Carrasquinha de Elvas; Cobrano- torna-se muito difcil, se no impossvel, quando as rvo- cia que constitui o marcador. Estas alteraes resultam de
gies DOP. sa; Conserva de Barranlas; Conserva de Elvas; Cordovil de res so jovens. Esta discriminao fundamental para se mutaes espontneas e a sua frequncia varia conforme o
O germoplasma portugus da oliveira objecto de es- Castelo Branco; Cordovil de Elvas; Cordovil de Serpa; Cor- garantir a qualidade e a denominao de origem quer do tipo de multiplicao (vegetativa ou por semente) e com o
tudo e referncia h mais de dois sculos. De facto, o scio dovil de Trs-os-Montes; Cornicabra; Curtideira; Galega azeite quer da azeitona de mesa, pois ambas dependem, tipo de marcador molecular utilizado.
da Real Academia das Cincias, Joo Antnio Dalla-Bella de Monforte da Beira; Galega Vulgar; Galego de vora; Ga- em grande parte, das cultivares utilizadas na sua produ- A utilizao de zonas do DNA como marcadores que
refere trs variedades (espcies) de oliveira - Durazia; Cor- lego Grado de Serpa; Gulosinha; Lentrisca; Maanilha de o. A diversidade existente pode ser considerada uma ri- discriminam as cultivares tem-se mostrado valiosa. No fi-
dovezas e Verdeaes - nas suas Memrias sobre a cultu- Elvas; Maanilha Algarvia; Maanilha de Tavira; Madural; queza patrimonial importante pois confere singularidade nal do sculo XX utilizaram-se marcadores moleculares
ra das oliveiras em Portugal, cuja primeira edio da- Moral; Negro Estanqueiro; Negrinha de Freixo Planal- aos produtos produzidos em Portugal e, em ltima anli- aleatrios denominados RAPDs e ISSRs (RAPD polimor-
tada de 1786. O conhecimento acerca do nmero, origem to; Quinta do Portado; Redondal; Santulhana; Tentilheira; se, uma fonte de diferenciao valiosa se, a essa diferen- fismos de DNA amplificados ao acaso - ou os ISSR regies
e caractersticas das variedades de oliveira cultivadas em Verde Verdelho; Verdeal Alentejana; Verdeal de Elvas; Ver- ciao, for associado um selo de qualidade. do DNA amplificadas entre microssatlites) para discrimi-
Portugal sofreu incremento com trabalhos de vrios au- deal de Trs-os-Montes. Existe ainda, na Quinta do Valon- nar com sucesso cultivares portuguesas de oliveira (Gemas
tores nos finais do sculo XIX e incio do sculo XX. Mais go em Mirandela, uma coleco de 27 ectipos, recolhidos
pela equipa de Fausto Leito. Carrasquenha
D(87%); CC(100%)
A par das oliveiras cultivadas, persistem em Portugal, Cobranosa
D(85%); CC(56%)
populaes de zambujeiros, algumas em reas naturais Verdeal T. M.
D(84%); CC(87%)
protegidas, da variedade silvestre da oliveira (Olea euro- D(96%); CC(100%) Negrinha

paea L. subs europaea var. sylvestris), tambm denomina- D(87%); CC(100%)


Azeiteira

das de oleaster que provavelmente estiveram na origem D(83%); CC(79%)


Maanilha de T.
Cordovil de C. B.
de algumas das variedades cultivadas portuguesas. Subsis- D(88%); CC(100%)
D(78%); CC(83%) Redondil
tem tambm exemplares assilvestrados que correspon-
Madural
dero a plantas de semente resultantes quer de cruzamen- D(77%); CC(86%)
Blanqueta
D(73%); CC(90%)
tos entre cultivares, quer de cruzamentos entre cultivares Galega
e zambujeiros.
A identificao e a variabilidade das caractersticas das Fig. 2 Endocarpos das cultivares Galega Vulgar, Verdeal
cultivares de oliveira sempre constituiram dilemas de di- Alentejana e Cordovil de Serpa.
fcil resoluo. Durante os anos 50 do sculo passado co- A diversidade gentica da sub-espcie europaea deve-
Fig. 3 Fenograma de 11 cultivares portuguesas, obtido por
meou a verificar-se que o germoplasma portugus da oli- -se predominncia de auto-incompatibilidade que pro-
marcadores RAPD. A distncia gentica foi calculada com
veira se caracteriza por uma grande variabilidade. Esta va- move a polinizao cruzada entre as variedades e entre as o ndice de semelhana de Dice, o mtodo de aglomerao
riabilidade foi verificada no s a nvel fenotpico, (Couti- cultivares e fcil disperso do plen e das sementes, estas utilizado foi o UPGMA. Os valores indicados nos ns de cada
nho (1955) mostrou a presena, numa s rvore de Cor- ltimas facilmente transportadas pelas aves e outros ani- ramo representam respectivamente: D- distncia gentica
dovil, de seis troncos com caractersticas completamente mais. Segundo de Casas e colaboradores (2006), bastante em percentagem de identidade, CC coeficiente de correlao
cofentica. Neste fenograma possvel verificar que Negrinha
distintas), mas tambm a nvel gentico. A este propsito, improvvel a existncia de isolamento reprodutivo. A pro-
e Azeiteira so sinnimos e que a Galega a cultivar mais
quer Almeida (1955), quer Coutinho (1956) observaram a pagao vegetativa e enxertia, executadas pelo homem, fi-
distinta entre as que foram estudadas (Verdeal de T.M
variabilidade do nmero de cromossomas e de alteraes xam e reproduzem determinados gentipos, mantendo al- Verdeal de Trs-os-Montes; Maanilha de T. Maanilha de
cromossomais existentes em diversas variedades portu- guma diferenciao gentica entre as cultivares, mas tam- Tavira; Cordovil de C.B. Cordovil de Castelo Branco). (Gemas
Fig. 1 Oliveira Centenria. Pedras del Rei, Tavira. guesas e estrangeiras. Em 1982, Francisco Jos de Almeida bm permitem propagar novas variedades seleccionadas e colaboradores 2004).
{ 158 } O grande livro da oliveira e do azeite { 159 } O grande livro da oliveira e do azeite

e colaboradores 2004) (figura 3). Em alguns pases, como germoplasma portugus. Os microssatlites so sequn- na Herdade do Escarambunheiro em Mirandela (Martins
na vizinha Espanha, a certificao das cultivares feita cias repetidas de DNA, geralmente neutras (no influen- e colaboradores, 1998) mostrou que, mesmo numa culti-
com recurso a este tipo de marcadores moleculares, cuja ciam as caractersticas observveis dos organismos), que var cuja origem se julga ser em Trs-os-Montes e que at
identificao rpida, pouco dispendiosa e necessita ape- so sujeitos a frequncias relativamente elevadas de mu- h poucos anos apresentava uma distribuio geogrfica
nas de uma pequena poro da planta (duas folhas), mes- tao, normalmente por alterao do nmero de repeti- bastantes restrita, se pode encontrar mais do que um ge-
mo quando se trata de plantas recm-enraizadas. es ladeadas por sequncias nicas de DNA. Com a pos- ntipo (Alves, M. 2007), o que pressupe ou uma origem
Os RAPD e os ISSR, marcadores, baseados em zonas sibilidade de sequenciar de forma simples e eficaz o geno- policlonal desta cultivar ou uma variao clonal bastante
aleatrias do DNA permitiram reconhecer a existncia ma dos organismos, a descoberta destas regies tornou- rpida. De facto, quando aos dados obtidos se aplica uma
de diversidade intra-cultivar, mais acentuada em algumas -se cada vez mais simples. Esto actualmente disponveis, anlise de coordenadas principais possvel reconhecer,
das cultivares do que noutras. o caso da cultivar Gale- centenas de sequncias de microssatlites de oliveira. pelo menos, 3 grupos genticos distintos de cobranosas
ga, a mais disseminada em Portugal (figura 4) onde ocu- (figura 6).
pa mais de 60 por cento da rea de olival (MADRP, 2007). tgtatgttaaaatttgctctctctctctctctctctctctacacattatgatgttagtac
O estudo de coleces de rvores desta cultivar provenien-
tes de diferentes regies do pas permitiu verificar que no As oliveiras so plantas diplides, ou seja apresentam
se trata de uma entidade constituda por indivduos clo- uma duplicao do seu genoma estruturado em pares de
nais (como se esperaria de uma variedade cujas plantas so cromossomas homlogos. O uso dos microssatlites per-
propagadas vegetativamente) mas sim de um conjunto de mite uma maior reproducibilidade dos resultados e tam-
rvores com variabilidade genotpica (Gemas e colabora- bm a distino entre rvores homozigticas que apresen-
dores 2004) (figura 5). tam a mesma sequncia de unidades repetidas nos dois
Os estudos de Gemas e colaboradores (2004) permi- cromossomas, no mesmo local (locus), e heterozigticas
tiram tambm a associar os gentipos identificados com que apresentam dois alelos com variao no nmero de
a sua localizao geogrfica. Foi possvel associar a regio repeties das unidades do microssatlite para o mesmo
de provenincia das galegas estudadas com os perfis de locus.
marcadores desenvolvidos, atravs da verificao dos n- A utilizao de microssatlites no germoplasma portu-
veis de diversidade existentes em cada uma das regies es- gus de oliveira permitiu a discriminao entre as diferen-
tudadas. De facto ambos os ndices de diversidade aplica- tes cultivares e confirmar a existncia de variabilidade ge-
dos (Shannon e Simpson) (tabela 1) demonstram que a re- ntica intra-cultivar. Os dez marcadores utilizados na ca-
gio Ribatejo Santarm a que contm maior diversidade racterizao molecular das cultivares [GAPU101 sequncia
e, portanto, aquela a partir da qual esta cultivar se deve ter repetida - (GA)8(G)3(AG)3; GAPU103A sequncia repetida
difundido para o resto do pas. - (TC)26; GAPU71B sequncia repetida - GA(AG)6(AAG)8;
UDO99028 sequncia repetida - (CA)23(TA)3; EMO3 se-
Tabela 1 Medida da diversidade intra-cultivar quncia repetida - (CA)7; ssrOeUA-DCA15 sequncia re-
em 77 rvores da cultivar galega. petida - (CA)3G(AC)14; ssrOeUA-DCA18 sequncia repeti-
AER aH bt-test cH
g h da - (CA)4CT(CA)3(GA)19; ssrOeUA-DCA3 sequncia repe-
Fig. 4 Ramo de Galega Vulgar com frutos Alto Alentejo (V) 4.01 0,73 tida - (GA)19; ssrOeUA-DCA9 sequncia repetida - (GA)23 ; Fig. 6 Microssatlite presente no gene da enzima lupeol
e PA(GA)5 sequncia repetida - (GA)12], tendo sido j pro- sintase de oliveira constitudo por uma repetio de 12 CTs (a
Fig. 5 Aglomerao no hierrquica tridimensional entre Beira Litoral (II) 4.01 0,70 amarelo). (GenBank accession AB025343.1)
postos para constituir um conjunto de referncia para des-
77 gentipos da cultivar Galega baseada nos componentes Baixo Alentejo (IV) 4.11 IV V* 0,79 crever a variabilidade molecular da oliveira, foram escolhi-
principais de uma anlise discriminante. Os eixos X-, Y- e Z- so Figura 6 Anlise de coordenadas principais da genotipagem
RibatejoAbrantes (III) 5.99 III IV* 0.69 dos por serem os mais utilizados pela comunidade inter-
respectivamente a primeira, segunda e terceira componente, com dez microssatlites da coleco de Cobranosas mantida
representando, respectivamente, uma percentagem de
nacional e por apresentarem um grau elevado de polimor- na Herdade do Escarambunheiro, com a diferenciao de
Ribatejo Santarm (I) 6.23 I III* 0.88
discriminao de 49%, 27% e 14%, com um nvel de confiana de fismo (nmero elevado de alelos). Repare-se que 5 micros- trs grupos genticos distintos. As trs dimenses explicam
0.001. Cada agrupamento constitudo por rvores colhidas nas Hg - ndice de diversidade de Shannon. Hh - ndice de diversidade de satlites com 5 alelos, igualmente distribudos numa po- respectivamente 58% (1 dimenso), 30% (2 dimenso) e 8%
regies identificadas na figura. Os valores de H correspondem Simpson. O test T foi aplicado para confirmar a diferenciao entre os pulao, podem permitir discriminar entre 700.000 gen- (3 dimenso) da variabilidade existente, num total 96%.
ao ndice de diversidade de Shannon aplicado aos dados gentipos das diferentes regies. (Alves, M. 2007)
* = p< 0,001 (Gemas e colaboradores 2004) tipos distintos. Tambm para as cultivares portuguesas es-
genotpicos. (Gemas e colaboradores 2004).
tes marcadores se mostraram teis e discriminantes.
A utilizao de marcadores moleculares de DNA do A aplicao destes marcadores a uma coleco de 77 Os mesmos marcadores foram utilizados para estudar
tipo microssatlite (figura 6), s disponveis na oliveira rvores consideradas antigas (mais de 80 anos), da cultivar as trs coleces de oliveiras cultivadas j referidas atrs. A
a partir do incio do sculo XXI, permitiu esclarecer v- Cobranosa, recolhidas por Antero Martins em 9 regies anlise da genotipagem das rvores destas coleces, atra-
rios aspectos relacionados com a diversidade gentica do de Trs-os-Montes e mantidas em ensaio de provenincia vs da aglomerao hierrquica com recurso ao algoritmo
{ 160 } O grande livro da oliveira e do azeite { 161 } O grande livro da oliveira e do azeite

Azeiteira E
Azeiteira S
Azeiteira TM
Carrasca Comp. E
Carrasquinha de Elvas E
Carraspana E
Carrasquenha E
Tentilheira E
Cobranosa E
Borrenta S
Curtideira E
Verdeal de Elvas E
Verdeal de Elvas S
Cordovil de Elvas E
Maanilha de Tavira S
Maanilha Algarvia TM
Cordovil de Trs-os-Montes S
Cordovil de Serpa TM
Galega de Monforte E
Galego de vora E
Bico de Corvo E
Cordovil de Castelo Branco E
Galego Grado E
Redondal E
Cobranosa S
Bical de Castelo Branco E
Conserva de Elvas E
Santulhana E
Conserva Barranlas E
Cordovil de Serpa E
Maanilha de Elvas E
Verde Verdelho E Figura 8 - Anlise de coordenadas principais da genotipagem Figura 9 - Anlise de coordenadas principais da genotipagem
Cornicabra E com dez microssatlites da coleco de Cobranosas com seis microssatlites de 38 rvores galega e de 120
Verdeal Alentejana TM
Negro Estanqueiro S mantida na Herdade do Escarambunheiro, e de Zambujeiros zambujeiros pertencentes a cinco populaes naturais
Planalto E pertencentes a cinco populaes naturais portuguesas. portuguesas. Z- zambujeiro; G - Galega. As trs dimenses
Quinta Portado E
Verdeal de Trs-os-Montes E Z- zambujeiro; C- cobranosa. As trs dimenses explicam explicam um total de 52% da variabilidade existente. (Fevereiro
Gulosinha S 41% (1 dimenso), 19% (2 dimenso) e 11% (3 dimenso) da et al 2011)
Blanqueta de Elvas E
Blanqueta TM variabilidade existente, num total 71%. (Alves, M. 2007)
Lentisca S
Galega Vulgar E
Galega Vulgar S
Galega Vulgar TM
Moral E
No entanto, tal no acontece quando a mesma anlise
Madural E feita entre as rvores de Galega e os zambujeiros (figura
Madural S
9) (Fevereiro et al 2011). Neste caso, praticamente impos-
0.06 0.24 0.41 0.59 0.77
Coeficiente svel discriminar entre as rvores denominadas de Galega
Figura 7 - Fenograma das cultivares mantidas nas coleces pblicas portuguesas, genotipadas com 10 microssatlites. As distncias genticas calculadas para o inverso dos alelos e os zambujeiros. Esta anlise corroborada por uma an-
partilhados
Fig. foram aglomeradas
7 Fenograma atravs domantidas
das cultivares mtodo UPGMA. A linha vertical a vermelho representa o erro do mtodo. As bifurcaes para a esquerda desta linha no representam
nas coleces Santulhana.
verdadeiras diferenas (Fevereiro, P. e colaboradores, 2011). As letras E, S e TM direita O mesmo
dos nomes das variedades se passascom
correspondem as (E
coleces denominaes deTM
- Elvas; S - Santarm; lise de identidade, de acordo com a qual, 7 rvores Galega
pblicas portuguesas,
Trs-os-Montes) genotipadas
de provenincia das rvorescom 10 microssatlites.
testadas. Os nomes inscritos sobre as reas sombreadas assinalam variedades referidas no texto.
Carrasca Comprida, Carrasquinha de Elvas e Carraspana. poderiam ser identificadas como zambujeiros, e 25 zam-
As distncias genticas calculadas para o inverso dos alelos
partilhados foram aglomeradas atravs do mtodo UPGMA. Por outro lado, verifica-se que em diferentes coleces se bujeiros poderiam ser identificados como pertencentes
A Linha a vermelho representa o erro do mtodo. encontram rvores com a mesma denominao mas com cultivar Galega (figura 10).
As bifurcaes para a esquerda desta linha no representam gentipos distintos, como o caso da cultivar cobranosa. Esta sobreposio entre as rvores da cultivar Galega
verdadeiras diferenas (Fevereiro, P. e colaboradores, 2011) Finalmente, possvel observar que a cultivar Galega Vul- e os Zambujeiros, associada s semelhanas encontradas
gar, juntamente com mais 4 cultivares, se distancia geneti- entre as caractersticas morfolgicas das duas variedades
UPGMA (Unweighted Pair Group Method with Arithme- camente das restantes cultivares portuguesas. e as relacionadas com a especificidade da Galega (cultivar
Figura 10 Anlise de identidade das rvores de Galega e de
tic Mean mdia aritmtica do emparelhamento no pon- A distanciao gentica e morfolgica da Galega Vul- reconhecida como exclusivamente portuguesa) e a sua dis-
Zambujeiro genotipadas, utilizando o programa GenAlEx6.
derado) sobre as distncias genticas computadas pelo in- gar, a sua expanso por todo o territrio e a sua rusticidade tribuio por todo o territrio nacional sugere que a Ga- Assumiram-se duas populaes, uma de Zambujeiros (crculos
verso dos alelos partilhados, mostra as relaes genticas serviu de mote para o estudo da sua relao gentica com lega uma cultivar domesticada a partir do germoplasma vermelhos) e uma de Galega (losangos verdes) (Fevereiro et al
entre estas cultivares (figura 7). A linha vertical vermelha os zambujeiros. Para esclarecer esta possvel relao, fo- de zambujeiro autctone ou que, eventualmente, resultou 2011)
corresponde ao limite do erro da tcnica e indica que as di- ram recolhidas amostras de zambujeiros em reas naturais do cruzamento de variedades trazidas do norte de frica
ferenas genticas para a sua esquerda no so reais. protegidas do litoral centro de Portugal. Depois de genoti- provavelmente por fencios ou cartagineses que, por cru-
Da observao do dendograma da figura 7 possvel pados foram comparados com uma populao de Cobran- zamento com os zambujeiros autctones teria originado a
verificar que em alguns casos diferentes denominaes osas e uma populao de Galegas, utilizando uma anlise variedade Galega. Esta cultivar apresenta uma domestica-
correspondem de facto a sinonmias, ou seja que a mes- de coordenadas principais. Como seria de esperar, as rvo- o policlonal, ou seja, no resulta da propagao vegeta-
ma cultivar apresenta diferentes denominaes. o caso res da cultivar cobranosa diferenciam-se completamente tiva de uma s rvore, mas antes provm da domesticao
da Bical de Castelo Branco, da Conserva de Elvas e da dos Zambujeiros (figura 8). de vrias rvores germinadas de semente, em diferentes
{ 162 } O grande livro da oliveira e do azeite { 163 } O grande livro da oliveira e do azeite

Vargas, P. (2006) Extensive gene flow blur phylogeographic but


momentos, que partilham caractersticas semelhantes. preservar a variabilidade existente, mas tambm para o es-
not phylogenetic signal in Olea europaea L. Theoretical and Ap-
A utilizao de marcadores moleculares permite suge- tabelecimento de um gentipo de referncia para cada cul- plied Genetics 113: 575-83
rir a ocorrncia, aps o ltimo evento glacial, de uma re- tivar e para a identificao de sinonmias e homonmias. Fevereiro, P., Leito, F., Potes, F., Gemas, V., Alves, M. and Favoretto,
colonizao da variedade sylvestris quer na zona este quer Dever ser levada a cabo uma anlise comparativa entre as P. 2011. The Portuguese Olive (Olea europaea subsp. europaea)
na zona oeste da Europa, (Breton et al. 2006). Assim de cultivares internacionais, em particular com as cultivares Germplasm. Acta Horticulturae. (ISHS) 924: 291-298
supor que algumas das cultivares da zona oeste, (incluin- da restante espanholas!! e as do norte de frica, com re- Gemas, V., Almadanim, M.C., Tenreiro, R., Martins, A., Fevereiro, P.
(2004) Genetic diversity in the Olive tree (Olea europaea subsp.
do as da pennsula Ibrica) tero sido originadas a partir curso a marcadores moleculares.
Europaea L.) Cultivated in Portugal revealed by RAPD and ISSR
de zambujeiros locais, o que suportado pela existncia Mesmo no caso de Cobranosa, uma cultivar local, markers Genetic Resources and Crop Evolution 51: 501511
de uma maior diversidade molecular nesta regio compa- ainda possvel encontrar alguma diversidade intra-culti- Leito, F., Potes, M.F.,Calado, M.L., e Almeida, F.J. (1986) Descrio
rativamente com a zona este do mediterrneo. Este mui- var. Mas, neste caso, no foi encontrada qualquer relao de 22 variedades de Oliveira cultivadas em Portugal Ministrio
to provavelmente o caso da variedade portuguesa Gale- com os zambujeiros portugueses. da Agricultura, Pescas e Alimentao
ga vulgar. A caracterizao simultnea do fundo gentico das MADRP (2007) Ministrio da Agricultura, do Desenvolvimento Ru-
ral e das Pescas. Olivicultura Diagnstico Sectorial. Gabinete
cultivares e a sua correlao com caractersticas fenotpi-
de Planeamento e Polticas. Lisboa, Portugal.
Concluso cas desejveis, um passo essencial para o estabelecimen- Martins A, Santos L, Lopes J e Gouveia J (1998). Primeiros resultados
Os marcadores moleculares so, actualmente, con- to de um programa de melhoramento gentico com con- da seleco da variedade de oliveira Cobranosa. Revista de Cin-
siderados ferramentas essenciais para compreender a di- sistncia cientfica. A caracterizao gentica das cultiva- cias Agrrias 21:35-46.
versidade e riqueza do patrimnio gentico das diferentes res regionais, a identificao dos recursos genticos uti- Zilho, I., Tenreiro, R. and Fevereiro, P. (2003) Olive and Olea. Cur-
culturas. No caso da oliveira, a sua aplicao tem permi- lizados na domesticao da oliveira e o reconhecimento rent Status, new avenues In Recent Research Developments in
Plant Biology 3:115-153 Edited by Research Signpost ISBN:81-271-
tido o estudo detalhado das relaes genticas entre cul- de que em outros habitats prosperam outras subspcies
tivares e entre estas e a variedade selvagem, bem como a de Olea europaea, que podem cruzar-se com as varieda-
percepo das caractersticas do material preservado nas des cultivadas, permite reconhecer a utilidade destes re-
coleces nacionais. A anlise dos resultados da aplicao cursos genticos. Estes conhecimentos podero ser utili-
destes marcadores permite ainda perspectivar estratgias zados, no futuro, para o melhoramento de cultivares actu-
futuras para o melhoramento da oliveira. ais com vista transferncia de resistncia a pragas e do-
A cultivar Galega vulgar caracterstica de Portugal, enas e adaptao s alteraes climticas previsveis (Zi-
no se encontrando nenhum paralelo com mais nenhu- lho et al. 2003). O estabelecimento de um programa de
ma cultivar existente no mundo. Tudo indica que esta cul- melhoramento da oliveira em Portugal, poderia potenciar
tivar, que caracteriza a qualidade dos azeites portugueses, a produtividade e a qualidade dos produtos da olivicultu-
foi domesticada no territrio nacional, provavelmente na ra, em particular do azeite portugus.
regio do Ribatejo, e que resultou da seleco de descen-
dentes de zambujeiros autctones ou do cruzamento des- Bibliografia referida
tes com alguma cultivar trazida do norte de frica. A exis- Almeida, F.J. (1955) A propsito dos cromossomas da Oliveira,
tncia de policlonalidade parece indicar que sucederam algumas consideraes sobre a seleco e melhoramento
desta espcie Boletim da Junta Nacional do Azeite 38: 27-40
vrios eventos de seleco mltipla
Almeida, F.J. (1982) O problema das cultivares de Oliveira Bo-
Algumas das mais utilizadas cultivares portuguesas letim do IAPO 2:1-30
de oliveira apresentam diversidade genotpica intra-culti- Alves, M. (2007) Caracterizao e Estrutura Genticas da Culti-
var, verificvel com o recurso a marcadores moleculares. var de Oliveira Cobranosa e sua Relao com o Zambujei-
Esta verificao demonstra a existncia de um problema ro Tese de Mestrado em Biologia Celular e Biotecnologia,
para a cultura destas variedades, pois se reflecte num pos- Faculdade de Cincias da Universidade de Lisboa
Breton, C., Tersac, M., and Bervill, A. (2006) Genetic diversity
svel grau de heterogeneidade nos olivais e numa corres-
and gene flow between the wild olive (oleaster, Olea euro-
pondente variabilidade da produtividade e qualidade do paea L.) and the olive: several Plio-Pleistocene refuge zones
produto final. No entanto, tal constitui uma oportunida- in the Mediterranean basin suggested by simple sequence
de para melhorar as cultivares portuguesas com recurso a repeats analysis Journal of Biogeography 33, 19161928
mtodos de seleco. Coutinho, L. L. A. (1955) Algumas projeces das caractersticas
A variabilidade no a mesma para as diferentes cul- Hereditrias da Oliveira Vida Rural 126:14-15
Coutinho, L.A. (1956) Subsdios para o estudo cariolgico da
tivares pelo que deve ser realizado um estudo detalhado
Olea europaea L. Gentica Ibrica 8: 1-40
para identificar o grau de variabilidade genotpica existen- Dalla-Bella, J.A. (1786) Memoria sobre a cultura das olivei-
te. Em particular, deve ser feita uma reviso cuidada do ras em Portugal Coimbra, Real Officina Typografica da
material existente nas coleces portuguesas, no s para Universidade
De Casas, R.R., Besnard, G., Schnswetter, P., Balaguer, L. and
{ 164 } O grande livro da oliveira e do azeite { 165 } O grande livro da oliveira e do azeite

Engenharia Gentica fungo Macrophoma dalmatica desenvolve-se sobre os fru- entre outras. Uma boa cultivar de oliveira dever produ- embries somticos a partir de tecidos jovens de algumas
da Oliveira tos, provocando a sua desidratao com consequente per- zir frutos grandes, de boa qualidade e facilmente desta- cultivares. Um sem nmero de dados foram publicados
da de peso do fruto e aumento da acidez do azeite. Quan- cveis, hbito erecto e compacto, ramos fortes, que faci- tendo em vista a definio de um protocolo reprodutvel
(Olea europaea) to ao fungo Gloeosporium olivarum ele infecta, de manei- litem a poda e a colheita. Quando est em causa a pro- para obteno de embries somticos a partir de tecidos
ra generalisada, o lenho, as folhas e os frutos. A oliveira pagao vegetativa da oliveira, indispensvel que exista jovens de plantas de oliveira (Rugini e Tarini, 1986), (Rugi-
Maria Salome Pais sensvel a uma panplia de insectos e outras pragas. Nos uma capacidade de enraizamento elevada seja das cultiva- ni,1988), (Grinos e Mitrakos, 1991), (Mitrakos et al.,1992),
Pases do Mediterrneo, a mosca da oliveira (Dacus ole- res em causa, seja do porta enxertos, quer se trate de olivei- (Leva et al., 1995) (Rugini e Caricato, 1995), (Lambardi et
Laboratrio de Biologia de Sistemas Vegetais (Centro ae) e a traa da oliveira (Prays eleaellus) so os insectos ras para produo de azeitona de mesa quer para produ- al, 1999), Peyvandi et al. (2001). S recentemente, Cape-
de Biodiversidade e Genmica Funcional e Integrativa mais comuns que afectam severamente a oliveira na maior o de azeite. A adaptabilidade da oliveira a diferentes ti- lo et al. (2010) desenvolveram um protocolo reprodutvel
BioFIG) & Academia das Cincias de Lisboa parte dos Pases produtores de azeitona. Dentre os fitfa- pos de clima e de solos uma preocupao, quando esto para obteno de embries somticos a partir de tecidos
R. da Academia das Cincias, n19, 1276- Lisboa, gos mais importantes citam-se a traa da oliveira (Prays em jogo programas de hibridao da oliveira, visto que as adultos.
Portugal oleae), a cochonilha negra (Saissetia oleae) e a mosca da condies ambientais condicionam fortemente a expres- A capacidade de obteno de embries somticos
azeitona (Bactrocera olea). A mosca da azeitona a maior so do fentipo. um pr-requisito para a manipulao gentica da oliveira.
A Oliveira no Mediterrneo praga, causando prejuzos muito avultados na produo Ao pretender implementar programas de hibridao A existncia de protocolos reprodutveis de regenerao a
A oliveira (Olea europaea L.) a maior cultivar agr- de azeitona afectando no s a extraco e a qualidade do da oliveira h que ter em conta constrangimentos impor- partir de tecidos jovens e adultos so o garante da possibi-
cola na Bacia do Mediterrneo. A sua cultura teve origem, azeite mas tambm a qualidade da azeitona de mesa com tantes:- (1) A oliveira uma planta lenhosa pereniflia de lidade de utilizao da manipulao gentica no melhora-
provavelmente, no leste desta regio h mais de 6000 elevadas perdas econmicas. ciclo longo; (2) O crescimento dos tubos polnicos s se mento da oliveira.
anos. Nas diferentes reas de produo na orla mediter- A oliveira tambm afectada por factores abiticos processa correctamente se a temperatura do ar for ade- As primeiros tentativas de transformao gentica da
rnica, tm sido envidados esforos no sentido de melho- tais como geadas tardias, encharcamento, secura ou al- quada com temperaturas mais baixas os tubos polni- oliveira por transferncia de genes de interesse para em-
rar quer a oliveira quer a produo e a qualidade do azei- teraes significativas na humidade e temperatura do ar cos crescem lentamente e podem no atingir os vulos ou bries zigticos imaturos da cultivar Moraiolo, mediada
te. Embora, historicamente, a oliveira seja considerada um causadoras de desidratao da extremidade do fruto. atingi-los aps a sua degenerescncia; (3) Temperaturas por Agrobacterium tumefaciens, datam dos anos 80 (em
rvore bem adaptada a climas secos, como o mediterrni- elevadas inibem a germinao do plen e retardam ou pa- Rugini e Fedeli, 1990). Nos anos 90 do sculo XX foi noti-
co, a fisiologia da oliveira bem como a produo de azei- Melhoramento da Oliveira ram o crescimento do tubo polnico (Bartolini e Guerrie- ciada, em Itlia, a obteno da primeira oliveira transgni-
tona a qualidade e quantidade de leo so afectadas por Ao longo do tempo, foram obtidas novas variedades ro, 1995); (4) Condies de secura e temperaturas elevadas ca obtida a partir de embries zigticos imaturos da cul-
situaes de seca intensa, o que tem levado a que a cul- de oliveira como resultado de cruzamentos espontne- diminuem o perodo de receptividade do estigma (Martin tivar Moraiolo transformados por transferncia de genes
tura da oliveira e a consequente melhoria da produo e os e disperso natural dos frutos ou sementes, inter-cru- et al., 2005); (5) A maioria dos tubos polnicos, quando no mediada por Agrobacterium.
da qualidade do azeite sejam hoje melhoradas com recur- zamentos, mutaes genticas, ou variao somaclonal estigma, so inibidos antes de penetrarem o tecido trans- Embries somticos da cultivar Canino foram trans-
so irrigao com gua reciclada. Reconhecidas as pro- (para uma reviso ver Rugini et al., 2011). Segundo Peyvan- mitivo do estilete (Ateyyeh et al., 2000); (6) As descen- formados com os genes heterlogos rolABC e osmotin,
priedades nutricionais do azeite, a oliveira (Olea europaea di et al. (2010), na cultura in vitro da oliveira, a variao dncias da oliveira tm um grande perodo de juvenilidade isolados de outras espcies de plantas . As plantas trans-
L.), tornou-se na sexta mais importante cultivar produto- somaclonal superior a 25%. Em 2006 Breton et al. desen- com a consequente retardamento da expresso das carac- gnicas obtidas encontram-se em avaliao em ensaios de
ra de leo a nvel mundial, com elevado valor acrescenta- volveram variedades especficas locais crusando popula- tersticas em avaliao (Rugini et al., 2011). campo em Itlia, tendo em vista a expresso dos genes in-
do, ao que se deve a sua expanso da sua regio de origem es de Olea com gentipos seleccionados segundo o cri- tegrados. No caso do gene rolABC est em avaliao o seu
- bacia do mediterrneo onde a rea tradicional de culti- trio dos produtores. Engenharia Gentica da Oliveira efeito na capacidade de enraizamento de estacas, no de-
vo atinge cerca de 95% das plantaes mundiais de olivei- A indstria da oliveira procura novas cultivares mais Quando comparada com os mtodos de melhoramen- senvolvimento do sistema radicular, na estrutura vegetati-
ra, para novas regies, nomeadamente da Austrlia Am- adequadas s modernas tcnicas de cultivo, com produ- to gentico tradicionais, a engenharia gentica constitui va e na reduo do nmero de flores por planta (Rugini e
ricas do Norte e do Sul (Argentina, Chile e Estados Uni- es mais elevadas e com resistncias a stresses biticos uma ferramenta de eleio para o melhoramento de plan- Pece, 2006). As oliveiras transgnicas obtidas aps transfe-
dos) e frica do Sul. e abiticos. Apesar de, na oliveira, o sucesso das hibrida- tas de plantas. A engenharia gentica permite acelerar o rncia do gene osmotin (Rugini , 2000) revelaram o papel
O elevado valor econmico da oliveira pode ser alta- es ser condicionado pelas caractersticas filogenticas, desenvolvimento de novos gentipos, por exemplo, com deste gene na morte cellular programada (PCD) associada
mente comprometido devido a diversas doenas e pragas morfolgicas, cariolgicas e fisiolgicas desta espcie, no- hbito desejado, resistncia a pragas e doenas ou com aclimatao, no bloqueio de mecanismos de sinalizao
que afectam quer a planta quer os frutos. Dentre as mais vas cultivares tm sido obtidas em Israel e na Itlia (Belli- melhores caractersticas organolticas quando se trate de do clcio induzidos pelo frio, e nas alteraes do citosque-
severas contam-se as causadas por :- a bactria Pseudomo- ni et al., 2008). Dentre as caractersticas com maior inte- azeitona de mesa (Rugini e Pesce, 2006). A investigao leto relacionadas com a resposta ao frio (DAngeli e Alta-
nas savastanoi cuja infeco produz tumores que inter- resse contam-se:- elevada produo, auto-fertilizao, h- levada a cabo por Rugini (1984) levou ao desenvolvimen- mura 2007). As plantas transgnicas nas quais foi integra-
rompem a circulao da seiva para a zona apical dos ra- bito adequado s modernas prticas culturais, resistncia to de um meio de cultura apropriado para a micropropa- do o gene osmotin que codifica a proteina PR5, relacionada
mos; o fungo Cycloconium oleaginum causador de esfo- a pragas e doenas por fungos e bactrias mais comuns, gao de gentipos de oliveira, etapa crucial para toda a com a patogenicidade esto sendo objecto de estudo para
liao e Verticillium dahlie destruidor do sistema radicu- bem como caractersticas organolticas, facilidade de pro- investigao que se lhe sucedeu, em particular nos dife- avaliao do efeito da expresso deste gene na tolerncia a
lar que, em consequncia, afecta o crescimento da plan- cessamento. No caso de azeitona de mesa, refere-se como rentes pases em que a cultura da oliveira tem particular fungos (DAngeli e Altamura, 2007).
ta. O fungo Capnodium elaeophilum, crescendo sobre exemplo:- baixo teor em leo, elevada quantidade de au- impacte. Dominada a tcnica de cultura in vitro, rapida- Continuando as tentativas para obteno de um pro-
a pgina superior das folhas, inibe a formao de cloro- cares redutores, boa firmeza do mesocarpo (polpa), eleva- mente se seguiu o desenvolvimento de metodologias para tocolo reprodutvel de transformao gentica da olivei-
fila o que, por seu turno, reduz a produo de frutos. O da resistncia do epicarpo (pele), cor estvel e uniforme, a obteno de protocolos adequados para a obteno de ra, Rugini et al. (2010) transformaram calli embriognicos
{ 166 } O grande livro da oliveira e do azeite { 167 } O grande livro da oliveira e do azeite

kroneiki. Journal of Sciences, Islamic Republic of Iran,. 12(l):


de oliveira, utilizando diferentes estirpes de Agrobacte- secundrio a nvel do fruto, nomeadamente, enoyl-Acyl References
9-15
rium tumefaciens contendo os plasmdeos binrios pBI- carrier protein redutase (ear), stearoyl- ACP desaturase, 6 Alagna, F.; DAgostino, N.;Torchia, L.; Servili, M.; Rao, R,; Pie-
Peyvandi, M.; Farahzadi,H.N.; Arbabian, S.; Noormohammadi,
NUbiGUSint ou pGUSINT para transferncia de genes de plastid desaturase (fad6), plastid denaturase (fad7), cyto- trella, M.; Giuliano, G.; Chiusano, M.L.; Baldoni, L. and Per-
Z..and Hosseini-Mazinani, M. (2010) Somaclonal Variation
rotta, G. (2009) Comparative 454 pyrosequencing of trans-
interesse. Segundo estes autores, de acordo com o proto- chrome b5 (cyt b5), cytoplasm desaturases (fad2), (fad3), Among Somatic-Embryo Derived Plants of Olea europaea L
cripts from twoolive genotypes during fruit development.
colo utilizado, foi possvel obter frequncias de transfor- acyl CoA diacylglycerol acyltransferase (DGAT), e oleosin cv. Kroneiki Adv. Hort. Sci., 2008 22(2): 73-86,
BMC Genomics, 10:99414
mao da ordem de 20 a 45% de que resultaram 100 li- (Giannoulia et al. 2007) constituem obstculos para a ob- Rugini, E., (1984) In vitro propagation of some olive cultivars
Ateyyeh, A.F.; Stosser, R.,and Qrunfleh, M. (2000) Reproductive
with different root-ability and medium development using
nhas transgnicas independentes, das quais 16 deram ori- teno de gentipos superiores de oliveira. Nos ltimos 2 biology of the olive (Olea europaea L.) cultivar Nabali Bala-
analitycal data from developing shoots and embryos. Scien-
gem a plantas. As plantas transgnicas obtidas, aps acli- anos, foi analisado um grande nmero de transcritos utili- di. J.of Appl. Bot.- Angewandte Botanik. 74: 255-270.
tia Horticulture 24:123-134.
matao e crescimento na estufa, mostraram-se fenotipi- zando a tecnologia de hibridao subtractiva (SSH) tendo Bartolini S. and Guerriero, R. (1995) Self-compatibility in several
Rugini, E., (1988) Somatic embryogenesis and plant regeneration
clones of oil olive cv. Leccino. - Adv. Hort. Sci., 9(2): 71-74.
camente idnticas s plantas me a partir das quais foram em vista a identificao de genes diferencialmente expres- in Olive (Olea europaea L.). Plant Cell, Tissue and Organ
Bellini, E. Giordani, E. and. Rosati ,A. (2008) Genetic improve-
obtidos os embries somticos. sos em diferentes situaes e/ou em diferentes cultivares e Culture 14, 207-214.
ment of olive from clonal selection to cross-breeding pro-
Recentemente, Jafarzadeh-Bajestani et al. (2011) numa espcies/variedades espontneas. O recurso tecnologia Rugini E.; Biasi, R.; Muleo, R. (2000), Olive (Olea europaea var.
grams, Adv. Hort. Sci., 22(2): 73-86
sativa) Transformation. In:Molecular Biology of Woody
tentativa de desenvolvimento de um mtodo reprodut- de piro-sequenciao 454 tem permitido a descoberta de Breton, C.; Tersa, M, and Berville, A.(2006) Genetic diversity and
Plants Vol. 2. S.M. Jain and S.C. Minocha (eds), KluwerAca-
vel de transformao gentica de Olea europaea cv. Zard, diferentes genes e a avaliao do seu padro de expresso gene flow between the wild olive (oleaster, Olea europaea
demic Publishers, pp 245-279
transformou embries somticos desta cultivar com Agro- na azeitona (Alagna et al. 2009). L.) and the olive: several Plio-Pleistocene refuge zones in the
Rugini, E. and Caricato G., (1995), Somatic embryogenesis and
Mediterranean basin suggested by simple sequence repeats
bacterium tumefaciens contendo o plasmdio pBI-P5CS, As plantas transgnicas existentes foram obtidas por plant 3306 recovery from mature tissues of olive cultivars
2713 analysis. J Biogeogr 33:19161928
em que P5CS um cDNA de Arabidopsis thaliana. A transformao utilizando vectores contendo sequncias (Olea europaea L.)\ Canino and Moraiolo. Plant Cell Rep
Capelo, A.; Silva S.; Brito, G. and Santos, C. (2010) Somatic em-
transformao e expresso do gene P5CS foram confirma- de genes de uma variedade de espcies vegetais, em par- 14: 257260
bryo- genesis induction in leaves and petioles of a mature
Rugini, E. ; De Pace, C.; Gutirrez-Pesce, P. and Muleo, R., (2011)
das pelo teste histoqumico da -glucuronidase e por an- ticular de Arabidopsis. A caracterizao de gentipos im- wild olive. Plant Cell Tiss Org Cult. Vol.103 (2), 237-242,
Olea, C. Kole (ed.), Wild Crop Relatives: Genomic and Bree-
lise de PCR (reaco de polimerase em cadeia) e de trans- portantes de oliveira como o caso da cultivar resistente DAngeli, S. and Altamura, M. M. (2007) Osmotin induces cold
ding Resources, Temperate Fruits, Chap. 5, DOI 10.1007/978-
crio reversa (RT-PCR). A sobrexpresso do gene P5CS Bianca de Tirana ou de outras com caractersticas de inte- protection in olive trees by affecting programmed cell death
3-642-16057-8_5, Springer-Verlag Berlin Heidelberg
and cytoskeleton organization. Planta 225:11471163
(um gene envolvido na biossntese da prolina) aumentou resse, dever continuar a ser implementada tendo em vis- Rugini E. and Fedeli E. (1990) Legumes and oilseed crops I. In:
Galla, G.; Barcaccia, G.; Ramina, A.; Alagna, F.; Baldoni, L.; Cul-
5.9 vezes o contedo em prolina livre, comparativamente ta o isolamento e a caracterizao de genes responsveis Biotechnology in Agriculture and Forestry, Vol. 10. Springer,
trera, N.G.M.; Martinelli, F. Sebastiani, L.; Tonutti P (2009)
com as plantas no transformadas, sugerindo que as plan- por caractersticas importantes da oliveira capazes de se- Y.P.S. Bajaj (ed) Berlin Heidelberg New York, pp. 593-641.
Computational annotation of genes differentially expressed
Rugini E.; Gutirrez-Pesce P, Muleo R (2008) Olive. In: Kole
tas transformadas com este gene sero mais tolerantes a rem utilizados em programas de melhoramento gentico along olive fruit development. BMC Plant Biol 9:128
C, Hall TC (eds) Compendium of transgenic crop plants,
stresses e apresentaro melhor crescimento em condies desta importante espcie tendo em vista a obteno de ge- Giannoulia, K.; Haralampidis, K.; Poghosyan Z.; Murphy, D.J. and
Transgenic temperate fruits and nuts, vol 4, pp 233258, Bla-
osmticas desfavorveis. De acordo com os autores, a eta- ntipos melhorados no que se refere a caractersticas tais Hatzopoulos, P. (2000) Differential expression of diacylgly-
ckwell, Oxford, UK,
cerol acyltransferase (DGAT) genes in olive tissues. Biochem
pa seguinte a avaliao da eficincia desta transformao como o hbito vegetativo, a compatibilidade sexual, a to- Rugini, E. and Gutirrez Pesce P. (2006) Genetic improvement of
Soc Trans 28:695697
na tolerncia a stresses abiticos e na performance das oli- lerncia a baixas temperaturas, a resistncia a stresses bi- olive, Pomologia Croatia, Vol. 12: 43-74
Jafarzadeh-Bajestani, M.; Khodai-Kalaki, M.; Motamed, N. and
veiras transgnicas em condies de stress osmtico. ticos e abiticos, capazes de acelerar os programas de me- Rugini E., Mencuccini M., Biasi R., Altamura M. M. (2005) Oli-
Noorayin, O. (2011) Genetic transformation of olive soma-
ve (Olea europea L.), In Protocol for Somatic Embryogenesis
A maioria da experimentao de engenharia gentica lhoramento tradicional. tic embryos through Agrobacterium tumefaciens and rege-
in Woody Plants, pp 345-360. (S. Mohan Jain and Pramod K.
da oliveira teve como base a transferncia de genes media- neration of transgenic plants African J. of Biotech.,10(28) :
Gupta eds) vol 77. Springer printed in the Netherlands (Ber-
da por Agrobacterim tumefaciens. Contudo Perez-Barran- 5468-5475
lin , Heidelberg, New York).
Lambardi, M.; Amorosi. S.; Caricato, G.; Benelli C.; Branca, C.
co (2009) desenvolveu um protocolo de transformao Rugini, E. and Tarini, P. , (1986), Somatic embryogenesis in oli-
and Rugini; E. (1999) Microprojectile-DNA delivery in so-
utilizando o bombardeamento de partculas para transfe- ve (Olea europaea L.). In: Moet Hennessy (Ed.), Proceedings
matic embryos of olive (Olea europaea L.). Acta Hortic
rncia de genes. Conference Fruit Tree Biotechnology - Paris (France). p.62.
474:505509
Torreblanca, R.; Cerezo, S.;Palomo-Rios, E.; Meracdo, J.A. and
O facto de: - o genoma da oliveira no estar sequen- Leva AR, Muleo R, Petruccelli R (1995) Long-term somatic em-
Pliego-Alfaro, F. , (2010) Development of a high throughput
ciado; de o conhecimento sobre o germoplasma das cul- bryogenesis from immature olive cotyledons. J Hortic Sci
system for genetic transformation of olive (Olea europaea
tivares de oliveira e das espcies / variedades espontne- 70:417421
L.) plants, Plant Cell Tissue Org. Culture, 103:61-69
Mitrakos K.; Alexaki, A. and Papadimitriou, P. (1992) Dependen-
as estar longe de estar terminado; de a base gentica das
ce of olive morphogenesis on callus origin and age. J Plant
caractersticas a ser melhoradas ser complexa (Rugini et Physiol 139:269273
al., 2011); a informao disponvel sobre o genoma, basea- Prez-Barranco, G.; Torreblanca, R.; Padilla, I. M.G.; Snchez-
da na identificao de ESTs (expressed sequence tags) di- -Romero, C.; Pliego-Alfaro, F. and Mercado, J.A. (2009) Stu-
zer respeito maioritariamente identificao e caracteri- dies on genetic transformation of olive (Olea europaea L.)
zao funcional de genes relacionados com alergenos do somatic embryos: I. Evaluation of different aminoglycoside
antibiotics for nptII select ion; II. Transient transformation
plen (Villalva et al, 2007) e com caractersticas da azeito-
via particle bombardment, Plant Cell Tissue Org. Culture,
na; uma grande quantidade de genes depositados no ban- 97: 243-251
co de genes so genes cloroplastidiais ou mitocondriais, Peyvandi M.; Dadashian, A.; Ebrahimizadeh, H. and Majd, A.
muitos deles codificando enzimas chave do metabolismo (2001) Embryogenesis and Rhizogenesis in mature zygotic
embryos of olive (Olea europaea L.) cultivar: mission and

Оценить