China Pakistan Economic Corridor Socio-Cultural Cooperation and Its Impact PDF

Education Science and Social Science
2016 5th EEM International Conference on Education Science

and Social Science (EEM-ESSS 2016)
December 24-25, 2016, Sydney, Australia
Edited by
Garry Lee
Sponsored by Information Engineering Research Institute, USA
Technical co-sponsored by City University of Hong Kong, Hong Kong
INFORMATIONENGINEERINGRESEARCHINSTITUTE,USA
iii
Copyright 2016 IERI & PRESS
All rights reserved. Personal use of this material is permitted. However, permission to
reprint/republish this material for advertising or promotional purposes or for creating new collective
works for resale or redistribution to servers or lists, or to reuse any copyrighted component of this
work in other works must be obtained from the IERI & PRESS.
IERI & PRESS, USA

16672 Bellflower Blvd, Bellflower, CA 90706, USA
http://www.ieripress.com/
Volume 93 of
Advances in Education Research
ISSN: 2160-1070
ISBN: 978-1-61275-502-1
Electronically available at http://www.aerproceedings.org/
Distributed worldwide by Information Engineering Research Institute Canada Office

Address: #44-19128 65th Ave, Surrey, V4N 0Z1, BC, Canada
Tel: 1-647-405-2661
E-mail: garrylee@ier-institute.org
iv
EEM-ESSS 2016 Preface
2016 5th EEM International Conference on Education Science and Social Science (EEM-ESSS 2016)
will be held on December 24-25, 2016, Sydney, Australia. The previous four EEM conferences on
Education and Education Management, including EEM 2011, EEM 2012, EEM 2013 and EEM 2014,
were held respectively on June 25-26, 2011 in Xiamen, China, September 4-5, 2012 in Hong Kong,
November 15-16, 2013 in Singapore, and December 8-9, 2014 in Singapore. All papers of above
conferences have been indexed successfully by Conference Proceedings Citation Index - Social
Sciences and Humanities (CPCI-SSH).
EEM-ESSS 2016 is co-sponsored by Information Engineering Research Institute, USA and

Singapore Management and Sports Science Institute (SMSSI), Singapore. EEM-ESSS 2016 is also
technical co-sponsored by City University of Hong Kong, Hong Kong. The goal of EEM-ESSS 2016
is to provide researchers from Education Science and Social Science fields with a free exchanging
forum to share the new ideas, new innovation and solutions with each other.
There are altogether 336 Submissions. In order to ensure the proceedings quality and the relevance to
the conference, the organization committees have made their efforts to do the following things.
Firstly, poor quality papers have been refused after reviewing course by anonymous referee experts.
Secondly, periodically review meetings have been held around the reviewers about five times for
exchanging reviewing suggestions. Finally, 109 papers will be selected as regular papers to be
published in Advances in Education Research (ISSN: 2160-1070) by Information Engineering
Research Institute with an acceptance rate of 32.4 %. EEM-ESSS 2016 will have a wide range of
topics as follows:
Chapter 1: Public Administration and Occupational Health
Chapter 2: Literature, Art and Cultural Studies
Chapter 3: Economics, Finance and Management
Chapter 4: Education Science, Teaching, and Linguistics
Chapter 5: Social Science
During the organization course, we have got help from different people, different departments, and
different institutions. Here, we would like to thank the organization staff, the members of the
program committees and reviewers. They have worked very hard in reviewing papers and making
valuable suggestions for the authors to improve their work. We also would like to express our
gratitude to the external reviewers, for providing extra helps in the review process, and the authors
for contributing their research result to the conference.
We hope that all of participants can give us good suggestions to improve our working efficiency and
service in the future. And we also hope to get your supporting all the way. Next year, in 2017, we
look forward to seeing all of you at EEM-ESSS 2017.
Best Regards,
Garry Lee
v
Conference Committees
Keynote Speaker
Jun Wang, City University of Hong Kong, Hong Kong
General Chairs
Serap Akdemir, Namk Kemal University, Turkey
Ana Breda, University of Aveiro, Portugal
Publication Chairs
Garry Lee, Information Engineering Research Institute, USA
Carlo Pozzi, Department of Architecture, Pescara, Italy
IERI International Committee

Adela-Eliza Dumitrascu, Transilvania University of Brasov, Romania
Dorin-Ion Dumitrascu,Transilvania University of Brasov, Romania
Xinyue Kong, North China Electric Power University, China
Honglei Wang, Jiangxi Normal University, China
Wei Liu, Shenyang Aerospace University, China
Can Geng, Inner Mongolia Medical University, China
Jv Su, Qujing Normal University, China
Shihua Tong, Chongqing College of Electronic Engineering, China
Li Tang, Chengdu University of Technology, China
Zhenyu Chen, Wuhan University of Technology, China
Weiliu Yang, Zaozhuang University, China
Shuliang Liu, North China Electric Power University, China
Huafeng Chen, Guizhou University of Finance and Economics, China
Wenpei Chen, Qujing Normal University, China
Zhenhong Li, Jishou University, China
Yongfeng Zhao, Lingnan Normal University, China
Xin Deng, Qinzhou University, China
Dan Lu, Wuhan Polytechnic University, China
Shuyan Guan, South China University of Technology, China
vii
TableofContents
Volume 93
Chapter 1: Public Administration and Occupational Health
Effect of Tea Polyphenols on Anti Fatigue after Sports
Boliang Yi 3
Reasons of Affecting the Accurate Value of Spot Judgment of Basketball
Referees and Analysis
Xin Deng 7
Research on Integrated Development of the University Campus in Urban Fringe
and its Surrounding Community: Based on the Background of Aging Population
Bailing Zhou, Entian Qie and Yao Xiao 13
Study on SM22 Promoter Cioning and Its CArG Box Function Domain Point
Mutation
Mengmeng Qiang 18
The Change and Development of Cloud Computing Data Center Network
Xia Yang and Kai Wang 23
A Case Study on Qiqiao in The Golden Cangue from the Perspective of
Gender Alienation Theory in Marxist Feminism
Dan Lu and Lin Li 27
The Analysis of the Parking Problem and Its Solutions of Beijing City
Mingxin Shi and Peihong Chen 32
The Principal Risks of Public Technician Colleges in Guangzhou
Xu Fan, Shuyan Guan and Xiaohong Wei 36
The Plan for Urban Lifeline Systems on Coastal City under the Background of
Typhoon
Dinghua Zhang, Jiali Li and Yunru Kong 42
Chapter 2: Literature, Art and Cultural Studies

A Study on the Elements and Aesthetic Value of Folk Songs of Yi People in
Yunnan
Wenpei Chen 49
Changes and Transformation of Musical Culture of Tang and Song Dynasties in
Chinese Musical History
Wenpei Chen 53
Analysis of Music Theory and Solfeggio Integrating Teaching Function in the
Major of Musicology in Normal Universities
Wenpei Chen 57
On Anna of the Five Towns from the Perspective of Intertextuality
Chunming Li 62
ix
Analysis and Performance of the Piano Work Jumping Music with Yi
Minority Style in Southern Yunnan
Xianying Zhou 68
On the Artistic Features and Playing Skills of the Piano Music Sani Fantasia
Xianying Zhou 74
Study on Achievements and Difficulties of the Post-80s Singers of Zhuang
Minority-Taking Wulong Town in Shizong County as an Example
Gengsheng Zhang 80
Research on Cuju Cultural Creative Development on Linzi Qi Capital
International Cultural Tourism Festival
Zhenhong Li, Mengmeng Gao and Lin Li 84
Research on Natural Inheritance and Protection of Miao Peoples Strand-towels
Dance in Xiangxi from the Perspective of Intangible Cultural Heritage Cultural
Heritage Protection
Zhenghong Li, Lin Li and Lei Zhang 89
Research on Three Great Drum Living Inheritance of Laifeng County of Hubei
Province
Zhenghong Li, Lin Li, Lei Zhang and Benzheng Xiao 94
Investigation and Research on Living Inheritance of Rolling Dragon Lian Xiang
Dancing at Lijia River Village, Xuan En County in Hubei Province
Zhenghong Li, Lin Li, Lei Zhang and Wanxin Sun 99
The Recluse World of Tao Yuanming and W. B. Yeats
Lei Guo and Jixing Li 104
Analysis on the Present Situation and Integration of Tourism Industry in
Xianning, Yueyang and Jiujiang
Min Zhang, Juncheng Zhu and Guosong He 110
The Female Protagonists Journey to Construct Their Subjectivity in the Work
of the Woman Warrior
Haixia Zheng 115
Study on the Artistic Expression of Chinese Character Design in Modern
Packaging
Bing Liu and Fan Wang 121
The Research for Cultural Connotation of Marine Dragon Boat Racing in
Zhanjiang of China
Yongfeng Zhao, Lei Shi and Jianqun An 125
Variation and Social Value of Marine Dragon Boat Racing in Zhanjiang of
China
Jianqun An and Bing Yang 131
Analysis of Architectural Decoration and Function Expression
Tiejun Wang 137
Herman Melvilles Sources of Ecological Awareness
Na Wang 141
x
Chapter 3: Economics, Finance and Management
Study on the Applicability of the Scale of Social Financing as the Intermediate
Target of China's Monetary Policy
Xiaodong Liu 147
Forecasting Capital Requirements Based on Revised Percentage of Sales Method
Weiliu Yang 151
Problems and Countermeasures of Internal Control in Electric Power
Enterprises
Yi An 156
The Robust Optimization Applied in Supply Chain
Chunnian Wei and Chenlu Li 161
Evaluation of the Regional Innovation at the Provincial Level
Lixin Dai, Ying Chen and Ruifen Zhao 169
Analysis of the Behavior of Buying Fake Product on Purpose
Hongchao Ning and Fangzhong Shi 175
China Pakistan Economic Corridor: Socio-cultural Cooperation and its Impact
on Pakistan
Muhammad Ibrar, Jianining Mi and Muhammad Rafiq 179
The Correlation Analysis of Financial Performance and Goodwill of the Listed
Companies
Zehong Li and Huarui Sun 185
An Empirical Study on the Factors Influencing the Cash Dividend Payout of
Electric Power Listed Companies after the Reform of Non - tradable Shares
Shuliang Liu and Ang Li 192
Study on the Mode of Logistics Collaboration between Xian Land Port and Air
Port
Weixia Yang 198
Research on the Practice and Innovation Development of E-commerce Platform
in the Era of Big Data
Yao Liu and Junqiang Liu 204
Discussion on the Development of the Third Party E-commerce Platform in the
Internet Era
Yao Liu and Junqiang Liu 208
Analysis of Factors Restricting Rural Credit System Construction
Jing Chen 213
Simulation Research on Cooperation Game between Bank, Government and
Enterprise under Risk Compensation Mechanism
Huafeng Chen and Mu Zhang 217
On the QMS Operational Performance of Manufacturing Industry in the View
of Quality Manufacturing
Zhongmin Ma 222
Governance: Origin, Connotation and Application
Jiandang Liu, Jie Tang, Dong Wang and Senlin Zhu 228
xi
A Review of Researches on the Influencing Factors of Entrepreneurship
Meixia Wang 232
Chapter 4: Education Science, Teaching, and Linguistics

The Application of Modern Teaching Theory in Physical Education
Zhikang Qiu and Hao Wang 239
Focus on Experience, Enhance Communication, Explore the New Model of
Medical Humanities Education
Can Geng and Guozheng Wen 243
Research on Engineering Practice Teaching System of Civil Engineering and
Architectural Specialties Based on Interactive Network
Bailing Zhou, Donghua Liu and Entian Qie 247
Researching on the Reform of Physical Education Course in University of
Applied Technology
Wenbiao Ma 251
Risks Evaluation of Occupational Health and Safety in Accordance with OHSAS
18001:2007 in Educational Domain
Adela-Eliza Dumitrascu and Dorin-Ion Dumitrascu 255
Analysis of Situation of China's National Defence Education
Ming Xu, Xingyong Luo, Yuanyuan Wang, Guoyu Xu and Mei Ye 260
Translation Teaching in an Era of Technical University in China
Gan He 264
Discussion on Search Algorithms in Teaching of Data Structure
Bin Yang, Sanrong Liu and Caixia Liu 270
The Innovation Research of University MOOC Promotion
Jing Tian 273
Study on Curriculum Arrangement of Foreign Secretary Based on
Career-Development-Oriented
Na Liu 277
Research on Integration of College Art Education in Yunnan into Local Folk Art
Ju Su 282
Research on College Students' Listening Ability in View of World Englishes
Qibin He 286
Research on Pragmatic Competence in Business English Communication
Qibin He 292
Study of the Flying Geese Paradigm in the Development of Innovative Talents in
College and University
Yong Li, Xiaohu Wang, Liquan Han and Weijia Sun 298
On Cultural Introduction in College English Teaching -- A Case Study of the
Course Intensive Reading
Xiaomei Li 304
A Novel Digital Micro-teaching System
Haixia Lu 310
xii
Education Reform Enlightenment of the Foreign Military College for Chinese
Army Academy
Jian Du, Tao Shi, Jun Wang and Jing Xia 314
Research on Relationship between Bilingual Teaching and English Level in
Chinese University
Li Zhang 320
Cultivate Students' Innovation Ability through the Electronic Design Contest
Ming Sun 325
College English Teaching Model Prediction Based on Random Forest
Hao Wu 329
A Prospect of the Five-Step Method in College EFL Classrooms
Lixin Dai and Xiaodan Li 335
An Analysis of Air Traffic Controllers Needs for English Proficiency
Lixin Dai 340
Research of News-listening Teaching in CET4
Xiujuan Li and Xiangjun Xu 344
Significance of Research of China's National Defence Education Contents
Ming Xu, Xiangsheng Rong, Chengyan Zhang, Guoyu Xu and Mei Ye 348
Discuss on Statistics Professional Talent Training of Applied Undergraduate
Colleges under Big Data Era
Shan Li, Linan Sun and Fengling Wang 352
Application of Experiential Teaching in College Students Psychological Health
Education Curriculum
Zhenyu Chen 358
Study of Freshmen Entrance Education in University and College Based on
Collaboration
Zhen Zhu, Dong Wang and Guangfa Yang 364
The Application of Experiential Teaching Method in Marketing Survey Course
Xuan Chen and Dinghuihong Liu 370
Review of Research on the Development of Youth Campus Football
Xiaodong Zhu and Jing Zhong 374
Short Cuts of Administrative Management in Colleges and Universities
Jiang Zhuo 378
Research on Enhancing Employment Competitiveness of Higher Vocational
Students Based on Talent Development
Shihua Tong and Shaoqiang Mo 381
Research on the Key Problems and Countermeasures of the Convergence
between Secondary Vocational Education and Higher Vocational Education
Shihua Tong 386
Research on the Actuality of Education and Training for Grass-root Gymnastic
Coaches in China
Yongsheng Sun and Jiahui Zou 390
xiii
The Integration and Development of Intelligent Field and School Physical
Education
Chunrong Peng and Ting Cao 393
System Modeling of Online Collaborative Learning Activities
Wenxin Deng and Fang Lu 397
The Research on the Question Form in the Example Learning for the Electrical
College Student Innovations Project
Bo Hu and Zhaomin Ma 405
A Study on College English Mobile Learning Based on Smart Phones
Jianing Niu 408
Perspectives on College English Flipped Classroom Based on Micro Class
Jianing Niu 414
On the Training Measures of "TWO STRONG" Applied Talents in Non-
governmental General Colleges
Weiwei Xiong 420
Discussion on the Reform of Management Course Based on Constructivism
Li Tang 424
An Empirical Study on the Construction of Campus Soccer Talents Training
Base
Yi Zhang and Yong Yu 429
Study of the Skopos Theory in Guiding the Translation of Electric English
Hongping Chen and Yu Han 435
Explore and Analyze Cultivation on Judgement Ability of Students Who Major
in Soccer----Taking students from College of Physical Education, Jiangxi
Normal University Who Specialize in Soccer for Instance
Jikun Qian and Guorong Qian 441
Exploration on Training Talents in the Mode of 3+4 Connection in Secondary
Vocational Education and Undergraduate: A Case in Mechanical Design Manufacture
and Automation Major of Jiangsu University of Science and Technology
Yongmei Zhu, Wenxian Tang and Zhimin Zhang 446
A Review on Science and Technology Translation in China
Zhong Lin and Han Zhao 452
A Review on Science and Technology Translation in the Past 40 Years in China
Feng Wang and Qiong Zhang 459
Chapter 5: Social Science

Analysis on Questionnaire of Securities Transaction Practice-- Taking School of
Economics and Management of Hei He University as an Example
Rong Cheng, Chunlian Zhang and Ningyi Cao 469
The Problems and Countermeasures of Construction of Ecological City
Qian Dai 475
Set up "Ba-Han Culture" the Ankang of "Han Water Cultural"
Linlong Zhao 479
xiv
A Study on the Differences between Urban and Rural Areas in the
Implementation of the One Child Policy
Xinyue Kong 486
Dian Opera Intangible Cultural Heritage Inheritance Model to Explore
Xianghong Tian 489
Contemporary Football Match Typical Case Analysis and Reference
the Case of Portugal the Championship of the European Cup in 2016
Honglei Wang 494
How to Do the Work of Regular Rotation of Financial Personnel
YanKe Zhao 499
Application Techniques of Color in Black Humor Films
Ming Li 502
The Real-time Simulation of Smoke
Pengpeng Yu, Tao Tang, Lili Zhao, Fan Xiao and Xianglei Meng 508
The Improved Design of Turbo Codes in CDMA2000 System
Jinshi Yang, Lili Zhao, Pengpeng Yu, Mingshun Ai and Peng Chen 514
Research on the Prevent and Control Mechanism of Risk Diffusion in Supply
Chain Finance Based on the Perspective of the Bank
Pinfei Li and Xuejian Chu 520
The Development of Sports for the Disabled from the The thirteenth Five-Year
Plan
Yucong Dai and Ting Cao 526
The Analysis on the Competitiveness of Star-rated Tourist Hotel Industry in
Jilin Province Based on Principal Component Analysis
Guoxia Sun 531
The Research on the Visual Measurement of Ancient Building Appearance Size
Bo Hu and Zhaomin Ma 536
Analysis and Policy Suggestion on the Minimum Wage Law
Jin Zhang and Shicheng Hu 539
The Research of Yuan Dynasty Glazed Chiwen
Wei Liu, Ke Wu and YouRan Li 546
Current Situation Analysis on Choice Preference of Dividend Policy Payment
Based on Banking Listed Companies in China
Bing Bai, Xiao Li and Zhiqiong Guo 550
Research into Fujians Marine Silk Road Ethos Construction with a 5W1H
Model
Chengxiong Chen 555
Author Index 563
xv
Chapter 1:
Public Administration and Occupational Health
Effect of Tea Polyphenols on Anti Fatigue after Sports

Boliang Yi
Manzhouli 021400, Inner Mongolia, China
Department of physical education, Manzhouli College of Inner Mongolia University
Lyz20141011@126.com
Keywords: Tea Polyphenols; Sports; Anti fatigue; Effectiveness
Abstract. The influence of economic development, the public's spiritual life and the demand is also
changing. This point in the sports performance is obvious. Mass sports and competitive sports has
become one of the national and civic concerns and keen fitness activities, and the related research is
also increasingly extensive and professional. Among them, the research on the mechanism of anti
fatigue after sports has become a hot spot. Tea is a traditional drink in our country, which has a long
history and a wide range of planting area. Its part of the nutritional composition and the effectiveness
of the human body has been scientifically confirmed. Tea polyphenol is a kind of active substance in
tea, which has outstanding performance in anti oxidation. In this paper, the effect of tea polyphenols
on the anti fatigue of sports is studied and analyzed in this paper.
1. Introduction
In biology, tea polyphenols are defined as the derivatives of tea polyphony.tea polyphenols occupy a
large proportion in the tea, and has a certain pharmacological efficacy. Among them, after a large
number of related research, for the human body, tea polyphenols has a good antioxidant activity. In
sports, the human body will produce a large number of free radicals, so that the relevant personnel
have a sense of fatigue, and even damage to skeletal muscle. In order to effectively alleviate the above
symptoms, based on the antioxidant properties of tea polyphenols, related research recommended
after the completion of sports appropriate to drink tea with rich tea polyphenols. Below around this
application of the specific performance of a more comprehensive analysis and elaboration.
2. An overview of the antioxidant activities of tea polyphenols

Tea polyphenol is referred to as polyphenols and its derivative substances in tea. Which mainly
involves the yellow, brass, anthocyanins and phenol acids, such as many as 30 kinds of substances.In
terms of the total dry weight of tea, the proportion of tea polyphenols in the tea is 18% to 36%. By
chemical structure analysis, In the molecular structure of tea polyphenols, phenolic hydroxide group
is a proton donor. The latter has a very high antioxidant capacity. Compared with the public known
VE as well as the antioxidant activity of VC, tea polyphenols in this regard is more powerful. The
principle of the formation of the antioxidant activity of tea polyphenols is briefly summarized, can be
summarized as the following points:
1) Tea polyphenols have direct effect on the production of free radicals
2) Can be directly on the role of free radicals and its elimination
3) The formation of free radicals can be formed by chemical complexation with transition metals,
and the formation of free radicals can be reduced
4) Can promote the production of high effective antioxidants in human body
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
3
5) Capable of combining with other substances, in the synergistic effect of enhanced oxidation
6) To a certain extent, regulate the immunity of the body, so that it can reach the equilibrium state
3. The principle of fatigue after physical exercise

In the scientific community, usually defined as physical or mental fatigue, excessive consumption, a
certain amount of exercise, slow to react to non pathological causes hyperstimulation and other
physiological or psychological aspects, work efficiency is reduced when the state of the body. The
fatigue caused by the human body after physical exercise should be classified as sports physiological
fatigue. Specifically, participating in sports in the process of material oxidation in the respiratory
system reduction based on the human body will generate active oxygen, this process has a cycle. In
cellular respiration process, the body to produce free radicals. In addition, as its definition, its
formation is not limited to this. Example, in particular environmental conditions next, some enzyme
stimulated generation of free radicals.
In addition, the two kinds of sports state will increase the content of free radicals:One, violent
sports.In this state, the human body oxygen consumption will accelerate the rise, and ultimately, the
metabolism of oxygen free radical content increases;Second, the accumulation of excess metabolites
in the body, as well as the body part of the regional asphyxia.These factors will have a negative impact
on the oxidation of mitochondria, while increasing the amount of oxygen consumption, and thus
provide more opportunities for the generation of oxygen free radicals.If the fatigue status can not be
effectively alleviated and controlled, to a certain extent, it will affect the health of some tissues and
organs of the body.For example, will have adverse effects on muscle tissue, multiple cardiovascular
and respiratory system organization, will make the fatigue accumulation, eventually lead to
overtraining syndrome and other problems occur, making the body produce endocrine disorders,
decreased immunity of pathological symptoms. Therefore, has a certain value for the study of anti
fatigue expansion of human sports after exercise.
4. The effect of tea polyphenols on anti fatigue after sports

Sports colleges and universities sports coaches training teaching work of the undertaking unit, the
training work as an important part of the school teaching work, do a good job in training class
teaching, teaching management, training assessment and certification of the work.
Sports coaches training organization and management system is shown in Figure 2. Deputy
director of the General Administration, education secretary, director of the division of personnel
training leading group; business division, part of the coaches to participate in training, the steering
group composed of training teachers and researchers. This management system to meet the Chinese
Sports Coaches training work needs, effectively promote the the sports coaches to participate in the
training of coaches training organizations and relevant departments to work, provide a guarantee for
the training of coaches.
4.1. Inhibition and removal of free radicals
In the field of traditional Chinese medicine, tea has been more widely used in the study of medicinal
efficacy, and has achieved a lot of related research results.In addition, as mentioned above, is closely
related to the metabolism and fatigue free radicals in our body, excessive free radicals can lead to
fatigue. The severity of the human body will produce more or less radical inevitable in sports, it will
produce different degrees of fatigue. The body fatigue have an adverse effect on the body, so that
proposal shall actively recommend relevant personnel at the end of the sports after appropriate
drinking tea, tea polyphenols with which to eliminate free radicals, thereby effectively relieve sports
fatigue. In the human body, there is a balance system of oxidation and antioxidation, which can
effectively eliminate the oxygen free radicals, eliminate the toxic and side effects, protect the cell and
reduce the damage.The tissue injury and damage degree can be reflected by the index of its in vivo
4
superoxide dismutase level. Found in animal experiments, the test object, applying certain amount of
superoxide dismutase decreased, while MDA content significantly increased, indicating the
occurrence of lipid peroxidation induced by exercise in vivo test object.By giving the test object to
take treatment, tea polyphenol extracts showed that the symptoms were improved with different
degree, therefore, to alleviate fatigue, tea polyphenols have certain effectiveness. In addition, the
experimental results can be confirmed, and tea polyphenols on can effectively eliminate free radicals,
even the efficiency can reach 92% to 98%. through this, can clear the effectiveness of tea polyphenols
than vitamin C and vitamin E. in a variety of heavy free radicals, harmful to the human body of the
largest, strongest correlation for fatigue of hydroxyl radicals.Through the tests, found that compared
to the more powerful licorice extract, tea polyphenols catechins in scavenging hydroxyl radical, is 10
times the former. In addition, the antioxidant capacity of four kinds of substances in aqueous medium
strength order: EGCG based ester catechins > lycopene > vitamin C> E.
4.2. Activate free radical scavenging system
In the activation of the free radical scavenging system, the mechanism of the action of tea polyphenols
is mainly the following two channels:First, the reduction of oxidized vitamin E, which leads to the
cell in the prototype of vitamin E to regenerate;Second, the activation of a variety of types of enzymes
to improve their activity.Mainly related to superoxide dismutase, glutathione reductase and
glutathione transferase and so on.By the catalytic action of glutathione reductase, GSSG can be
reduced to GSH. which is water soluble antioxidants, and exist in the human body. Compared to the
human body fat soluble antioxidant vitamin E, antioxidant and its ability to clear free radical is more
effective and positive.Found in the human body, related research, taking tea polyphenols as drug test
objects, compared to the control group (without taking these drugs), the experimental group of human
superoxide dismutase (which can eliminate the harmful substances generated in the body, mainly for
the new supersedes the old. aspect of effective oxygen free radical) activity was significantly higher.It
can be known that the tea polyphenols can help the body to produce the superoxide dismutase, which
can effectively control and eliminate the oxygen free radicals in the body.
4.3. Improve the activity of lactate dehydrogenase and decrease the content of blood lactic acid
Physical exercise will directly lead to the occurrence of a series of muscle activity, the latter's
metabolic products mainly have lactic acid.In sports, muscle tissue will breed a lot of lactic acid, in
the rise of blood lactic acid under the influence of hydrogen ion concentration, the body began to
appear fatigue phenomenon, and gradually increased.Blood lactic acid was the main index in the
evaluation of the degree of fatigue of human body.In the human body, the blood lactate clearance rate
of lactate dehydrogenase is the lactate dehydrogenase, which determines the efficiency of the removal
of lactic acid. The increase of lactate dehydrogenase, will promote metabolism of excess blood lactic
acid in muscle tissue of the human body to a certain extent, the removal efficiency is accelerated,
thereby effectively delay, control the occurrence and the degree of fatigue, the fatigue eliminated as
soon as possible. Through the test, has confirmed that tea polyphenols can significantly enhance the
activity of lactate dehydrogenase, which makes the content of lactic acid decreased, effectively reduce
the degree of fatigue after sports. Thus, tea polyphenols can effectively control the production and
accumulation of lactic acid after physical exercise, so as to reduce the content of blood lactic acid, to
human body anti fatigue performance.
4.4. Lowering blood urea level, delaying the occurrence of fatigue
In the field of scientific research, it has been confirmed that the blood urea nitrogen is an important
indicator of the decomposition and metabolism of nitrogenous substances in the body. At the same
time, in a certain environment, can be effective and accurate evaluation of the human body in the
physical exercise of the physical load capacity. Through the tests, found that tea polyphenols taking
over a certain period, can effectively reduce the blood urea level after physical exercise. Thus, in
5
reducing blood urea levels, then inhibit and delay the occurrence of fatigue, the tea polyphenol has
good performance.
4.5. Has certain strong heart efficiency
In the related animal (mouse) test, it was found that when the subjects received the stimulation of tea
polyphenols, there was a significant increase in exercise endurance and the effect of heart rate
enhancement. Based on the scientific view of the human body, the blood circulation is improved, the
blood circulation is improved, and the natural flavonoids have remarkable effect on the expansion of
the coronary artery. By all the people, tea polyphenols is a kind of flavonoid derivatives. So, in effect,
roughly in line with the natural flavonoids. The specific analysis of the efficacy mechanism, found
that tea polyphenols and calcium channel activation cell, cell calcium current is closely related to
strengthening.
4.6. Has certain strong heart efficiency
In the above, has pointed out that after sports fatigue is not conducive to the immune balance. In sports,
especially stress more intense, rapid, sports, will accelerate the secretion of epinephrine and
corticosteroids, and in a certain extent, inhibit the phagocytosis of neutrophils. These will reduce the
body's immune function to a certain extent, the occurrence and degree of accelerated fatigue, in
addition, will also be the obstacles to the successful completion of endurance sports.Through the tests,
found that the analysis of the immune system in animal cells, the tea polyphenol has induced effect,
can promote interleukin and interferon synthesis. At the same time, can also activate natural killer
cells and B cells (immune cells of the immune system).In addition, the anti fatigue performance of tea
polyphenols, mainly through the activation of complement system to reflect the physical. This
function can effectively enhance the human body, the effective regulation of the immune system itself,
which makes the human body can effectively resist and relieve fatigue in sports. Through the above
analysis, it is clear that the free radical content of sports after tea polyphenols, blood lactate, lactate
dehydrogenase, serum urea nitrogen level, has a direct impact on heart strength, and these factors as
the key indicators of fatigue degree evaluation of human sports. By acting on the above indexes, tea
polyphenols can have a positive effect on anti fatigue.
5. Conclusion
Our country is the origin of the tea plant, in most areas of our country has been widely planted. Tea for
the health function of the human body as well as medicinal function has obtained a general consensus.
Tea polyphenols as the main tea extract, which determines the medicinal effect of tea and edible value
to a great extent. In this paper, a more comprehensive study of tea polyphenols in sports after the
human anti fatigue performance, according to the relevant theory and experimental analysis, can be
clear, its effectiveness is obvious.
References
[1] Juan Huang, The biological effect of tea polyphenols in physical exercise, Tea in Fujian, vol.2,
pp.29-30, 2016.
[2] Wang Li, The function of tea and its influence on the promotion of sports, Tea in Fujian, vol.3,
pp.33-34, 2016.
[3] Hao Wang, Study on the recovery of tea polyphenols on sports ability, Tea in Fujian, vol.3,
pp.30-31, 2016.
6
Reasons of Affecting the Accurate Value of Spot Judgment of

Basketball Referees and Analysis
Xin Deng
Institute of Physical Education, Qinzhou University, Qinzhou, Guangxi, 535011
Keywords: Basketball referee; Spot judgment; Accurate value
Abstract. In this paper, the reasons of affecting the accurate value of spot judgment of Guangxi
basketball referees as well as the reasonable analysis have been discussed through employing the
methods of literature review and the questionnaire survey so that the ability and the self-confidence
of referees can be further improved. The levels of the accurate value of spot judgment of
basketball referees are directly related to the quality as well as the smooth developing of the game.
For basketball referees, the accurate value is the pillar of self-confidence judgment and the source
of judgment power. They will be not in panic at the chaos and easily deal with various situations
with higher accurate value.
1. Introduction
Modern basketball is moving in a higher, faster and stronger direction. In games, the high-speed
contest and confrontation, the changes of skills and tactics and the intense competition have put
forward higher demands for the basketball referees on the spot. However, it is hard to avoid the
wrong and omission judges in the spot judgment for inexperienced basketball referees. The
accurate value of spot judgment is the ratio of the exact number of call times and the total number
of times in a match. The accurate value can directly reflect the ability levels of referees in the spot
judgment. In view of the various factors that can affect the accurate value of referees in sport
judgment, the reasons have been discussed in this paper and some countermeasures have been
provided. Then, the basketball referees can maintain a stable state of mind, give play to the normal
level and continuously improve the accurate value of spot judgment, which will provide some
help to become a good basketball referee[1].
2. Research objects and methods

2.1 Research objects
In this study, Guangxi basketball referees are chosen as the research objects.
2.2 Research methods
2.2.1 Method of literature review
According to the research objective and the content of this study, some relevant literatures at home
and abroad from library and the Internet have provided detailed basis for this research.
2.2.2 Method of questionnaire survey
Random questionnaire survey is conducted in the district of Guangxi. 82 questionnaires are issued
and 80 questionnaires are collected. The collecting rate is 97.6%. There are 80 valid questionnaires
and the effective rate is 100%(including 20 third-grade referees, 45 second-grade referees, 10
first-grade referees and 5 national-level referees).
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016

7
2.2.3 Method of logic analysis
It is required to sort, sum up and analyze the related conclusions. The survey data should be
conducted the data processing and the conclusions can be provided.
3. Results and analysis

3.1 Understanding of basketball rules for Guangxi basketball referees
The survey results show that Guangxi basketball referees have a better understanding for basketball
rules. 50% of them have a good understanding, 20% of them just understand the rules and 30% of
them have a better understanding for the rules (Table 1). The understanding of the rules can help the
basketball referees have a preliminary understanding for violations and fouls in their mind. At the
same time, the call scales can be formed and the violations as well as the fouls can be selected in a
large number of basketball moves for judgment.
Tab.1 Understanding levels of basketball rules
Better understanding Good understanding Understanding
Number of persons 24 40 16
Percentage (%) 30% 50% 20%
Tab. 2 Times of completely reading Basketball Rules and Basketball Referee Manual
Never One time Two times More times
Number of persons 5 25 40 10
Percentage (%) 6.25% 31.25% 50% 12.5%
In Table 2, it is found that 6.25% of referees have never completely read the Basketball Rules
and the Basketball Referee Manual. 31.25% of referees have completely read them for one time
and 50% of referees have completely read them for two times. 12.5% of referees have completely
read the Basketball Rules and the Basketball Referee Manual more than two times. Before
serving as a spot referee or obtaining the referee grade certificate, although the referees have
learned the basketball rules and the basketball referee laws, it is not enough for them to have a
thorough understanding for Basketball Rules and Basketball Referee Manual.
For basketball referees, they should pay more attention to the basic theoretical knowledge of
basketball judgment. The Basketball Rules is the basis of judgment for referees and the
Basketball Judgment Laws is the code of referees as well as the requirements for themselves. The
referees who are proficient in Basketball Rules and Basketball Referee Manual can better deal
with the various situations that occur on the court and better discipline themselves. Therefore, it is
necessary to strengthen the study of Basketball Rules and apply the method from the rules and
into the rules, which is greatly helpful to improve the accurate value of spot judgment of
basketball referees. The referees who are not familiar with the Basketball Referee Manual will
not well coordinate with the partners. They will directly lose the credibility and the dignity of
judgment. The understanding for Basketball Rules and Basketball Referee Manual will
determine the basic ability of judgment and it is also one of the entry criteria for basketball referees.
3.2 Psychological changes of spot judgment of Guangxi basketball referees
Tab. 3 Whether the referees judge key games
Yes No
Number of persons 20 60
Percentage% 25% 75%
In Table 3, it is found that only 25% of referees have judged the key games and 75% of them do
not have such experience. The competition of key games is very fierce and the outside atmosphere
8
is hot, which has a good training value for referees in spot judgment. When judging the key games
for the first time, the referees will inevitably have certain psychological fluctuations due to the
scenes that they have never met. They prone to producing all kinds of emotions to affect the
accurate value of spot judgment. After judging the key games, they will adapt and understand the
psychological changes and the situations on the field and they will be more calm in a similar
judgment. Meanwhile, the referees will be more appropriate and accurate to process the situation on
the field and their own judgment abilities will be greatly improved, which will promote them to take
a solid step toward the excellent referees.
Tab. 4 Whether the referees have changed their minds in spot judgment
Usually Occasionally Never
Percentage% 33.75% 58.75% 7.5%
In Table 4, it is found that only 7.5% of referees have never changed their minds in spot
judgment, 58.75% of referees have occasionally changed their minds and 33.75% have usually
changed their minds in spot judgment. It is not difficult to find that only a small part of referees
have never changed their minds in spot judgment. Their psychological qualities are relatively good.
Although there have wrong judgment and omission judgment, the referees will be not interfered.
Therefore, the accurate value of spot judgment will be less affected. More than half of the
referees have occasionally changed their minds in spot judgment. They will doubt themselves under
pressures due to the lack of confidence. However, most of them can avoid the pressures from wrong
judgment, team members, coaches and audiences. The influence on accurate value of spot
judgment is not very great. More than 30% of referees have usually changed their minds, which is
not the self-confident performance. When facing the outside or inside pressures, they are often
unbearable. The referees will produce great pressures or they will not control their own emotions.
Then, the tasks of games will not be completed and the influence on accurate value of spot
judgment is huge[2]. In a match, even the excellent referees will make the wrong judgment.
However, the referees should remain confident and believe that they will not make mistakes and
will not be back to the pressure side. They can be very good to complete the following game and
will not lose to their own pressures. The good mental conditioning ability is one of the basic skills
of excellent referees.
Tab. 5 Whether the referees can well judge a key game
Absolutely capable Barely capable Not sure Absolutely not capable
Percentage% 10% 16.25% 28.75% 45%
In Table 5, it is found that 45% of referees think that they can not judge a key game, 28.75% of
them have doubted themselves to well judge a key game, 16.25% of them believe that they are
barely capable to judge a key game and 10% of referees think they can be absolutely capable to
judge a key game. The key game requires the referees to have excellent judgment abilities. The
game is the stage to show their styles and the demands for accurate value of spot judgment will be
higher. According to the survey, it is found that the abilities of Guangxi basketball referees to judge
key games have great deficiencies and more spot accumulations are required to improve the
judgment abilities.
Due to the lack of experience and self-confidence, the basketball referees are more prone to
stage fright phenomenon in spot judgment. The stage fright of referees often changes the course
of a game. The lack of self-confidence will lead to the loss of judge authority of referees and they
will not control the whole games. Even some basketball referees with poor psychological quality
will forget the most basic judging procedures and ultimately the tasks can not be completed, which
will affect their basketball referee careers.
9
3.3 Spot accumulation of Guangxi basketball referees
Tab. 6 Number of judgments in the latest six months
More than 6 times 4-6 times 13 times none
Percentage% 25% 41.25% 31.25% 2.5%
In Table 6, it is found that 41.25% of referees have judged for 4-6 times in the latest six months,
31.25% of referees have judged for 1-3 times, 25% of them have judged more than 6 times and only
2.5% of them have not judged a game. The competition judgment is the direct opportunity for
basketball referees to accumulate the most basic field experience. The characteristics of competition
include: there is almost no bad moves and the fouls as well as the violations are more obvious.
Through the calls of competition, it is helpful to clear what the fouls and the violations are. At the
same time, it is also useful to establish a profound and clear understanding, which will lay a good
foundation for future judgment.
The domestic and international excellent basketball referees have thousands of field
accumulation. A large number of field accumulations are the basis to become excellent referees.
Different competitions have different situations and the sufficient practical experience will create
the future success. The spot practice is the main way to improve the ability and the level of referees.
The more the number of practice is, the faster the ability will be improved. Only there are more
blowing will the experience as well as the confidence be blew. The basketball referees should
take the initiative to find more opportunities to practice in the spot and continuously accumulate the
spot judgment experience as well as the spot harvest. At the same time, they should often exchange
experience with high-level basketball referees to obtain comments. Then, they can be quickly
improved.
3.4 Other factors affecting the spot judgment of Guangxi basketball referees
Tab. 7 Whether the physical exertion of referee is excessive in spot judgment
Percentage% 5% 65% 30%
In Table 7, it is found that 65% of referees physical exertion are occasionally excessive in spot
judgment, 30% of referees do not have this situation and 5% of referees physical exertion are
usually excessive. The adequate physical strength is the premise to ensure the referees to
successfully complete the spot works. The characteristics of modern basketball include the fast
speed, the fierce competition and the changeful tactics. According to statistics, the referees need to
run the distance of 3000-4000m in a game. Imagining if there is no sufficient physical strength, the
referees can actively run and move in the spot? They can find the reasonable observation distance
and the appropriate judging distance? If there is no appropriate judging distance, the ideal
observation angle will not be found. Meanwhile, it is also impossible to clearly see the actions of
offensive and defensive players and the judgment will not be accurate. The physical fitness is easily
overlooked by a lot of basketball referees. When they take part in some important games, the
physical exertion will be excessive[3].
Tab. 8 Whether the referees care about the returns
Percentage% 32.5% 50% 17.5%
In Table 8, it is found that 50% of referees occasionally care about the returns of judgment,
32.5% of them usually care about the returns and 17.5% of referees do not care about the returns.
10
Nowadays, with the improvement of price and living standards, some people need to improve the
living standards through the amateur extra money. And the basketball referee is a good part-time
job with a certain income. Therefore, whether there are some returns and the levels of returns will
affect the judging enthusiasm of basketball referees. The judging enthusiasm can determine the
levels of judging ability. The referees still pay more attention to the economic income of judgment
and they are good subsidies for personal life, which can prove themselves and reduce the burden of
family.
Tab. 9 Whether the referees will initiatively show partiality for acquaintance in a team
Percentage% 40% 45% 15%
In Table 9, it is found that only 15% of referees do not initiatively show partiality for
acquaintance in spot judgment, 40% of referees usually initiatively show partiality for acquaintance
and 45% of referees occasionally initiatively show partiality for acquaintances in a game. When the
referees initiatively show favor towards a team, they will lose the most basic judging ability and the
responding ability for fouls and violations. Then, the fouls, the violations and even some
intentionally wrong judgments will be easily occurred in a game. The credibility of referees can be
seriously affected in the field and the basketball game will lose the basic spirit of fair competition. It
is disrespectful for referees and their partners. Most of basketball referees are beginners and it is
required to put an end to such a situation. It is extremely unfavorable for the development of their
own referee career.
4. Conclusion and suggestions

4.1 Conclusion
1) The learning of Basketball Rules and Basketball Referee Manual for basketball referees is
insufficient. The well learning of Basketball Rules and Basketball Referee Manual is the
premise to improve the accurate value of spot judgment.
2) The psychological fluctuation of basketball referees spot judgment is obvious which can be
easily interfered by their own mistakes and off-site factors. They lack the spot judgment experience
and do not accept the baptism of important games. Meanwhile, they also have no suitable
psychological adjustment methods.
3) The number of the spot judgment of basketball referees is less, the call scale is not uniform
and the ability of controlling the game is poor.
4) Other factors. In spot judgment, the physical problems of basketball referees will not affect
the accurate value. The economic income is also one of the factors and the judging enthusiasm
can directly affect the accurate value of referees. If there are some acquaintances in a team, the
fairness of competitive sports may be lost.
4.2 Suggestions
4.2.1 Strengthening the psychological learning and counseling
It is required to regularly invite some teachers in psychology major both inside and outside school
to conduct psychological lectures and simulate the game scene for establishing the self-confidence
and enhancing self-control ability as well as self-suggestion ability. Then, the psychological
fluctuations can be avoided through improving the psychological quality[4]. The learning is helpful
for basketball referees to be more confident and capable in spot judgment. Meanwhile, it is also of
great help for the referees future work
4.2.2 Accumulating the spot judging experience
Currently, each city has the fixed games every year. However, there are more basketball referees
and the opportunities of spot judgment are less. It is required to change the previous referee
11
arrangement method. The method with one experienced referee, one medium-capacity referee and
one beginner can be employed, i.e. a high-capacity basketball referee conducts the spot judgment
with a medium-capacity basketball referee and a basketball referee beginner. The first half of the
game and the second half of the game can respectively have a group of referees. Then, the
basketball referees with medium capacity can be quickly improved and it is also helpful for
beginners to quickly learn some basic skills of spot judgment. Meanwhile, more referees can be
arranged to accumulate some experience. They should be more active in spot judgment outside the
school and make up for deficiency through improving the judging ability.
4.2.3 Avoiding the influence of economic factor and human factor
The economic income is necessary for basketball referees. Some games are the exercise platforms
without any income. It is required to give certain incentive income. When there are some
acquaintances in a team, the referees should initiatively apply for changing the game with other
referees. If not, they should be strict with themselves. Meanwhile, they need to bear in mind that
they are judges and do not do things that go against the fair competition.
References
[1] Huang Li. Study on Causes of Stage Fright Psychology of Basketball Referees and
Overcoming Methods[J]. Journal of Harbin Institute of Physical Education. 2006 (01).
[2] Sun Weibing et al. How for Basketball Referee to Keep Psychological Steady on the Spot.
Journal of Nanjing Institute of Physical Education, 2001 (06).
[3] Xia Chun et al. Major Factors Affecting the Value of Basketball Referees Right Judgement[J].
Journal of Shanghai Physical Education Institute, 2003 (01).
[4] Liu Fang et al. Research into the Reform of Judge Ability Cultivation of Selected Basketball
Course of Sports Major[J]. Journal of Chongqing Technology and Business, 2009 (01).
12
Research on Integrated Development of the University Campus in Urban

Fringe and its Surrounding Community: Based on the Background of
Aging Population
Bailing Zhoua,*, Entian Qieb, Yao Xiaoc

School of Urban Construction, Wuhan University of Science and Technology, Wuhan, China
a b c
cps.zhou@gmail.com, qieentian@wust.edu.cn, residence2006@163.com
*Zhou Bailing
Keywords: Integrated development; University campus in Urban Fringe; Pension community
Abstract. In this paper, the investigation and measurement of existing status in the community
around the university campus in urban fringe of Wuhan were carried out. furthermore, the relationship
between the villages and the universities was presented. It provided reasonable reference for the
integrated development between them: a new type of pension community.
1. Introduction
According to international standards, the total population of a country or region in the elderly
population over the age of 60 accounted for the proportion of the total population reached more than
10%, or 65 years old population proportion reached more than 7%, which is the national population
aging. In 2010, sixth census data show that aging has become an irreversible trend in our country at
present. Residential area is an important material space for the realization of home and community
care. "Suitable aging" should become a universal design elements, which is embodied in the
residential district planning and architectural design.
University city is generally based on tertiary institutions or scientific research institutions, with
residential areas and service facilities. In general, the university city population size is 5-10 million,
and contains many functions, such as education, research and development, and industrial
development. August 2000, Langfang Burapha University city opened the prelude to the construction
of China's University city, then Songjiang University City in Shanghai, Changping university city in
Beijing and other University cities have sprung up. Up to now, there are more than 55 University
cities in the country.
This kind of university cities are generally built on the edge of the big city, which can not only fully
rely on the material and cultural foundation and public service facilities, but also have the abundant,
cheap development land and the expansion space.
With the development of the universities, there gradually formed a complete function of living
places, such as farms, restaurants, and schools and medical, postal and other facilities, which is for the
convenience of the staff and students living on campus. Although people have bid farewell to the era
of welfare housing, and new teachers will no longer live in campus housing area. But there are still a
large number of teachers living in the campus, most of who have entered the elderly.
On the other hand, there are some villages near the university town. Because these villages are not
completely surrounded by urban built-up areas, which have a big difference from the typical villages
in the city, some scholars use the "City side village" to address them.These "villagers" and some of the
low income floating population constitute a unique urban fringe community, which is a unique
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
13
phenomenon in the process of urbanization in China. Under the influence of specific policies,
economic and social factors, there is a very intense game between the villagees, the low-income
groups, businessmen, community committees (the original village committee) due to the economic
interests.
Although the pension mode in China gradually improve, institutional care and community care
pension mode provides diversification("9073" policy), but there are still 90% of the elderly need to
home-based care in old age. Elderly residents in villages surrounding university city are also the
case.The improvement of the life of these old teachers and villagers is directly related to the stability
of the University.
As the "baby boom" generation aging in the future, the elderly population will grow rapidly with
facilities for the elderly facing serious deficiencies. At the same time, the emergence of the "declining
birthrate" problem will make the youth facilities appear free.
Then, can the university city and the surrounding villages be integrated into one organism to help
to solve the problems of home care for the elderly?
The challenge of the old age community lies in how to satisfy the needs of the elderly to the
greatest extent. In other words, one of the core competitiveness of the pension community is the
supporting services and systems, which both allow the elderly to start their own lives and take care of
the needs of the elderly for the rich and colorful living environment. College endowment will help
the elderly to take care of themselves, to delay aging. It includes campus life service system and
nursing care for the elderly and the elderly education system. We can create or share community
hospitals, nursing homes, community clinics, home run apartments, community school relying on the
university and its surrounding community.
2. Basic situation
In public service facilities, the design of the appropriate old design can be summarized as the
following four categories: 1) specifically for the elderly public service facilities: old age home, the old
cadre activity center, the old activity center, the old gym and recreation room, the old activity area, the
old people's activity gym and fitness facilities; 2) public service facilities used by people of all ages:
community activity center, aged children's activity center, community hospital (clinic); 3) Pension
institutions: nursing homes, nursing homes, etc.; 4) Barrier free design: Obstacles in the residential
area, residential settings ramp handrail, etc.
In considering the old fitness design of the residential area, seting up specifically for the elderly
public service facilities (such as the elderly activity center) is the usual choice, and considering set up
public service facilities used by all ages (such as the elderly and children's activity center) in the
residential area is very rare. No university city and its surrounding village construct pension space in
the inside or around, and only a handful of university considering the accessibility of universal design
in their teaching area.
On the whole, the old people in Colleges and village are basically satisfied with the outdoor
environment of the campus residential area. Outdoor environment in the limited space meet the needs
of the old as far as possible. First of all, because it is adjacent to the campus environment, the space
have the high rate of green, and the outdoor environment is suitable for living. Secondly, in the
residential area also arranged some cultural and recreational facilities, which nrich the spiritual life of
the old. The use of these facilities is very high, which are very popular with the elderly. The
environment around the active site has a better green environment, thus forming a centralized place
for the elderly. However, not all aspects of performance are satisfactory, are suitable for the elderly
life.
They mainly show several aspects: 1) in the residential area of the car mixed problem is more
prominent. Tthe vehicle are controlled in the teaching area, but the residential area is no measure.The
internal roads in the residential area are limited by the planning, whose width is not large, which is
14
more aggravated the degree of congestion of the road. This is undoubtedly a potential security risks to
the old.2the outdoor space is less. A certain size of the outdoor space for the elderly to bring more
convenient life. Teaching area has become the main place for the daily activities of the elderly.
Because of the old people's physical changes, they can not do too intense exercise and walking is the
main exercise for the elderly. The campus housing area is short of enough outdoor space for the old
people to use, they can only choose to carry out activities in the teaching area. Because of the increase
of motor vehicles, there is not enough parking space, which leading to motor vehicle parking
everywhere. This phenomenon has reduced the activity space for the elderly.
Through the community, Public service basically meet the needs of the elderly. The public
facilities in the campus residential area can basically meet the requirements. Because of the
physiological characteristics of the elderly, the basic medical services are particularly important for
them. In the investigation of the several colleges and universities, because the school itself has the
school hospital, there is a great convenience for the elderly to see a doctor. Some of the old disease
can be better control and rescue. Purchase of daily necessities and food products are also in the near
range to solve. University canteen also solve some of the old people's eating problems. As for public
services, the elderly want the community to provide more comprehensive and detailed services, such
as providing on-site service, to complete some of the daily housework, to take care of the elderly daily
life, to reduce the burden of housework and so on.
3. Suggestion
With the gradual deepening of the degree of aging, the elderly will become the most important use of
space environment and public service facilities in University cities areas. Under the aging society, the
planning of the areas should grasp the following principles:
(1) Put the actual needs of the elderly as the starting point
At present, due to the lack of practical experience can be used for reference many projects in the
planning often caught in a simple way to implement the standard indicators. And because the standard
specification itself is not perfect, there will be a lot of problems in the actual construction. Truly
effective guidance to the living area of the old planning method should be a full investigation and
analysis of the real needs of the elderly living in. This includes the need to understand the living
patterns of the elderly, the characteristics of daily travel activities of the elderly, the requirements of
community services, etc..
(2) Consider the dynamic factors in the long-term development of residential areas
The living area is people living places, and residential and public service facilities to allow for the
change in the future 10 years or decades of development in the building. At present, China's early
construction of the residential area has been exposed to a lot of old problems. Because these
residential areas in the early planning did not fully pr sentenced to these changes, leading to the need
to transform a lot of work. And the transformation of residential land is difficult to carry out. Aging
will become the social development of the new normal, which should be considered from a long-term
perspective of the needs of the elderly living area planning, and we have to fully estimate the
population structure, the changing trend of the family structure.
(3) Strengthen the public service facilities allocation of short distance and close range
The elderly should be closely related to public service facilities of the daily life in the near range
because of the limited capacity of the elderly. These facilities include older persons holding station,
the canteen service point, the elderly activity stations, community care services and facilities, and
convenience stores, community health station and so on. By dispersing these facilities in a suitable
residential area with a more homogeneous manner, it can guarantee the availability of elderly people
to arrive. In this way, the spatial distribution density of the facilities which are closely related to the
daily life of the elderly is increased in the near home, thus form a short distance, flat, network layout.
This will be more in line with the needs of the elderly and their travel characteristics.
15
(4) Compound community endowment service
From the point of view of planning and layout requirements, these facilities are to ensure the
convenience of the elderly to reach and use, so it is easy to show the trend of optimal site selection.
Therefore, in the planning, we should focus on the establishment of these facilities in one place that
becomes a community service core". From an operational point of view, the function of the complex
type of community service core will put different facilities to gather together, which makes the
content of diversification of services more. As older people are concentrated in the community service
core to carried out activities, it can improve staff service efficiency and space usage, so as to reduce
the difficulty of operation.
4. Summary
In real life, university city construction climax has passed nearly ten years, it seems that the villages
have already been incorporated into the category of city community, but in fact they maintain complex
attributesis as village in city" or "city village" with the establishment of city community in form. We
believe that this kind of edge community is an important part of the city's vivid pattern, and the life
there is full of life breath, which is one of the basic way of life of the common people. In a sense, it is
necessary to retain the community, for the city's characteristics completing; the development with the
basic framework of this is sustainable development.
Then, can the indigenous people or even low-income migrant population has been living in
communities surrounding university city continue to develop? How can the original living in these
villages breath with the city and the development of the University of the nearby? This series of
problems in the process of urban development is of great value.
European and American developed countries has entered the aging society earlier than China, so
their experience in the construction of residential facilities for the aged are more abundant compared
with us, such as Sun City Center in the United States, the United States elderly community Anglican
Bishop Gaitston retired, the Oxford community Knowles, British Lara, Germany Bremen mountain
community elderly care type residential. The cases have great significance in our residential public
service facilitiese reform that suitable for the elderly.
Based on the common problems and personality of public service facilities in residential areas in
Wuhan city in different age, the transformation strategy can be divided into two categories: general
strategy and specific strategy. The general strategy is applicable to the villages surrounding University
City in each time, and according to the actual situation of the community, the corresponding measures
are formulated.
1) Generic Strategies
The proportion of the village which has no barrier design is only 0.3%, and the lack of barrier free
design is a common problem in the design of the community in each age. It is recommended that
improve all the related villages barrier free design: for example, in height is arranged at the ramp, to
the area of the public toilet to increase barrier free design, railings and handrails in the public walkway.
Specifically according to the "barrier free design specifications GB 50763-2012" to guide the
transformation of villages without obstacles.
2) Corresponding Solutions
The villages built in 1980s. The characteristics of this type of village are: the aging population are
more than the major (relatively small young people); supporting facilities aims to meet the material
needs of people but is lack of cultural and recreational facilities; buildings are very old.
Recommended to sort out the integration of the village facilities, after the selective renewal, made
specifically for the elderly cultural and recreational facilities, to meet the needs of the elderly people
in the village of multi-level and multi species spiritual and cultural needs
The villages formed after 1990s. The characteristics of the residential area is: the proportion of the
elderly population is low (relatively young people); the village has a certain cultural and recreational
16
facilities; buildings are new; the largest proportion of buiding are residential and retail buildings. The
transformation of the old community facilities.have to consider the different needs of different age
groups. Suggested that carry out barrier free transformation of the existing cultural and recreational
facilities in residential areas, dividing the old man's exclusive activity space in the facility, which
should conform to the physiological and psychological characteristics of the elderly. At the same time,
also divide the place of the common use of all ages. It will lead to the interaction between the elderly
and other age groups..
5. Acknowledgement
This research is supported partially by the following two projects: Humanities and Social Sciences
Research Project of Education Department of Hubei Province (serial number: 16Q051); National
College Students Innovation and Entrepreneurship Training Program (serial number:
201610488002).
References
[1] GAO Yan, TANG Ke-yue, and BAO Yu-qing, Building Science Vol. 25(2009), pp. 48-51.
[2] Milton Meckler: Retrofitting of Buildings for Energy Conservation, (Fairmont Press,
Georgia1994).
[3] K. Kamaleswaran ; S. Prabhakaran ; P. Harinath ; M. Damini ; V. Kirubakaran, Capacity
Building On Energy Conservation In Rural Industries: A Case Study IEEE, 16154443, Mar.
2016, DOI: 10.1109/ICEES.2016.7510659.
[4] Information on http://ec.europa.eu/environment/.
[5] Information on http://www.pikeresearch.com/.
17
Study on SM22 Promoter Cioning and Its CArG Box Function Domain
Point Mutation
Mengmeng Qiang
Tianjin Bohai Vocational Technical College, Tianjin, 300402, China
Keywords: SM22; SRF; CArG box; Vascular smooth muscle
Abstract. Vascular smooth muscle cells (VSMC) phenotype is atherosclerosis high blood
pressure and restenosis after angioplasty common disease pathogenes of vascular remodeling.SM22
is a differentiation marker of VSMC, which is found in recent years.It is a marker genes associated
with VSMC differentiation and de-differentiation. Some researches found that in the promoter of
differentiation marker genes have a serum response factor(SRF) binding consequence named CArG
CC(A/T)6GGbox. The interaction between SRF and the CArG box is very important for
transcription in smooth muscle marker genes. Myocardin related transcription factor (Myocardin
related transcription factors) is a kind of protein factor specificity found in regulating the expression
of cardiac muscle and smooth muscle gene. Myocardin is a cofactor of serum response factor (SRF),
form a Myocardin/SRF complex binding to CArG box site in the promoter of smooth muscle cell
marker genes, and promote SMC differentiation.
In this paper, designing SM22 promoter primers, extraction of vascular smooth muscle cells
genomic, PCR amplification of the promoter ,construction of SM22 promoter luciferase reporter
gene expression plasmid and identificating the plasmid (PCR, double restriction enzyme
identification, DNA sequencing identification). Design CArG box point mutation primers, PCR
amplification of mutant SM22 promoter, construct mutant SM22 promoter luciferase reporter gene
expression plasmid. And study on a preliminary comparative of wild-type and mutant-type SM22
promoter function.
In this study, the preliminary test results show that with the full-length SM22 promoter, the
plasmid CArG box point mutation after the transfer contingent effect is reduced, CArG point
mutation of box promoter lost the ability to regulate downstream gene combined with SRF.
These results elucidate that Myocardin-SRF and SM22 promoter interaction of new molecules,
reveal new vascular smooth muscle cell differentiation mechanism has great inspiration and help to
reveal the pathophysiological molecular mechanism of atherosclerosis new, provides the reliable
theoretical foundation for the prevention of atherosclerosis or cardiovascular drug development in
the prevention and treatment of atherosclerosis.
1. Introduction
Arterial vascular smooth muscle cell (VSMCs) is a kind of multi functional mesenchymal cells, and
smooth muscle cells in atherosclerotic lesions are mainly derived from the [1]. Vascular smooth
muscle cells (VSMCs) is a multifunctional mesenchymal cells as well as one of the major cellular
components of coronary atherosclerosis and restenosis, which balances the expression and function
of the coordination of cell physiological and pathological conditions. Previous studies have showed
that smooth muscle cells in the differentiation type can inhibit atherosclerosis.
SM22 is a vascular smooth muscle cell differentiation markers found in recent years, with the
expression of smooth muscle tissue specificity and cell phenotype specific, which is a type of
differentiation of vascular smooth muscle cells (VSMC) molecular markers, encoding the size of
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
18
22kDa contraction protein. SM22 promoter is responsible for the regulation of its transcription and
expression
Myocardin is a transcription factor related to serum response factor (SRF) transcription
dependent manner transactivate several smooth muscle cell specific regulatory elements, and the
transcription factor SRF (Serum Reaction Factor, serum response factor) interaction with target
gene highly conserved cis regulatory element CC (A/T) 6GG (CArG box) sequence specific binding
and transcriptional regulation of target genes in 160. The interaction between SRF and box [2] plays
an important role in the regulation of the transcription and expression of smooth muscle marker
genes CArG.
In this paper extrac vascular smooth muscle cells in mouse genome, and cloning SM22 promoter
successfully, at the same time, making point mutation of CArG box, DNA sequence analysis
showed that SM22 was successfully constructed and so as a total length of CArG box promoter
point mutation, comparing with NCBI consensus sequence reported in the literature. Luciferase
gene analysis showed that compared with SM22 full-length promoter, CArG box promoter mutation
has a disability to bind SRF, which can not regulate downstream genes[3]
2. Experiment material and method

2.1 SM22 promoter primer design [4]
According to the found in the UCSC genome database of SM22 promoter sequences, design
primers sequence: upstream primer (P1): GCGAGCTCGTGAGTGTGTGAGACATAGCAC3, 5 ";
(P2) primer: 5" GCAAGCTTGGCTTGGTCGTTTGTGGACTG "3 fragments of 1067bp.
2.2 Double enzyme digestion reaction
Restriction endonuclease (restriction endonu clease): a double stranded DNA endonuclease
sequence of an organism that is capable of identifying and cutting the specific. It can cut off the
DNA of the enzyme, which is able to restrict the invasion of alien DNA and make it lose its vitality,
but it has no damage to their DNA so that the original genetic information can be protected.
2.3 PCR validation [5]
We used the plasmid as template in 1067bp with the double enzyme digestion. And SM22 promoter
gene primer was used for PCR.
2.4 CArG box point mutation
In this experiment, we use mutant primers to amplify PCR. After PCR, we will use the DPN1 to
digest PCR products through the verification of product.
2.5 Luciferase activity assay (luciferase) [6]
Experiment should be based on SM22 and mutant plasmid influence differentiation of smooth
muscle cell function, using constructed recombinant plasmid Myocardin, SM22-luc, SM22Mutation,
PCDNA3.1, transfection in 24 well plates COS-7, with 3 parallel experiments.
3. Experimental results
3.1 Identification of recombinant plasmids
Discussion: contains more than a single restriction endonuclease in plasmid vector genome in
restriction sites of exogenous gene inserted into two restriction sites, using two restriction
endonuclease gene restriction sites at both ends of the cut, the two linear DNA fragment of the
small section containing a foreign gene DNA and another for plasmid DNA. The gel electrophoresis
analysis was carried out, and two DNA bands were observed under the ultraviolet lamp.
19
vehicle
SM22 promoter
1067bp
SM22 promoter
1067bp
Fig. 1.Electrophoresis of constructed Fig. 2.Electrophoresis of PCR

vectordigested with endonuclease
3.2 Sequencing comparison of mutation plasmid and plasmids
Fig. 3.Sequence comparison of SM22 and SM22 Mutation

Discussion: from the graph, the mutation gene sequence was compared with the original sequence,
the GG mutation was TT, which showed that the point mutation was successful.
3.3 Cell culture and transfection
The recovered COS-7 cell line which is donated by Medical University Of Tianjin add to
10%DMEM to join the full training based on 37 degrees C, 5%CO2 incubator culture.
In 24 hours after transfection, the expression of green fluorescent protein was observed. And the
green fluorescent protein (GFP) was transfected with liposome. At last, the transfection efficiency
was observed under microscope.
Fig. 4. Transfection of PGEFP into cos-7 cells illustrated the high-transfection efciency.
3.4 Luciferase activity assay (luciferase) [7]
In order to explore the difference of SM22 and mutant plasmid affect the differentiation of smooth
muscle cells, the experiment first began in function. The cell model was COS-7. Using the
20
constructed recombinant plasmid Myocardin and SM22-luc, SM22Mutation, transfection in 24 well
plates in COS-7 cells from one day before transfection with 5 * 104 cells , which were inoculated to
2 cell growth to 24 Orifice plate, 60%~70% fusion, transfection experiments. The experiment was
performed 3 times in parallel. Transfection and dosage (NG) as shown in table 1:
Tab. 1. The planning of plasmid transfection
Number Myocardin PCDNA3.1 SM22-luc SM22mutation-luc
1 300 0 100 0
2 300 0 0 100
3 0 300 100 0
4 0 300 0 100
According to the fluorescence value and the average fluorescence value, we draw a column chart.
Fig. 4. The effect of Myocardin, SM22 and SM22mutation on Luciferase Assay

Discussion: 1 we can see from the figure that the transfection of Myocardin does enhance the
activity of luciferase as reported in the literature.
2 however, when transferred to Myocardin and SM22mutation, the fluorescent value decreased
significantly, indicating that CArG needs to be played by box Myocardin.
4. Summary
In this study, the preliminary result shows that comparing with the full-length SM22 promoter, the
CArG box point mutation after the transfer effect is reduced, CArG box point mutation of the
promoter lost the ability to regulate downstream gene combined with SRF.
These ndings indicated the molecular mechanisms of the interaction between Myocardin-SRF
and SM22 promoter, and help to declare the new mechanisms for the differentiation of the vascular
smooth muscle cells. Revealing new pathophysiological molecular mechanism of atherosclerosis,
provides a reliable theoretical basis for the prevention of atherosclerosis and the development of
cardiovascular drugs to prevent and cure atherosclerosis.
References
[1] Duguid JThrombosis as a factor in the pathogenesis of coronary atherosclerosis[J]. J Path
1995, 4(8).
[2] Wang D, Chang PS, Wang Z, et al. Activation of cardiac gene expression by myocardin, a
transcriptional cofactor for serum response factor.Cell 2001, 105:851-862.
[3] Loots GrVISTA 2.0: evolutionary analysis of transcription factor binding sites[J]. Nucleic
21
Acids Res, 2004,17(8): 22-30.
[4] Sambrook, Russell. Guide to molecular cloning experimentsBeijing:Science Press, 2002.
[5] Ausubel FM. Short Protocols in Molecular Biology Guide (third edition) [M]. Beijing:
Science Press, 1999:120.
[6] Jian-Wu Liu, Cheng-hua, Liu Ning. Luciferase and its application. Biology Bulletin. 200434
(2):15-16.
[7] Baldwin TOChristopher JARaushel FMet laStructure of Bacterial Luciferase[J]. Curr Opin
Struct Biol.1995, 56:798-809.
22
The Change and Development of Cloud Computing Data Center Network

Xia Yang, Kai Wang
Tianjin Bohai Vocational Technology College, Tianjin, China
Keywords: Cloud; Data center; Network; Virtualization
Abstract. With the development of cloud computing and big data applications, the traditional data
center network architecture is difficult to meet the needs of the development of the cloud computing
technology in the future. In this paper, the development of cloud computing with the status of data
center network structure as the background of the research and development of 10G data center
Ethernet, network topology, network transmission protocol, network virtualization, network and
other energy-saving direction are introduced.
1. Introduction
In recent years, Internet driven economic development has become more dependent on the network
and the data of our life, the amount of data currently produced annually by more than 7.9ZB, is
expected to increase to an annual 40ZB in the future. Huge data storage and data computing
requires a higher challenge to the data center, which is the core of cloud computing technology. The
problem of multiple tree structure network in traditional data centers used in data transmission
bandwidth and data fault tolerance has been difficult to adapt to the needs of the future development
of cloud computing, data center network structure in the future need to be improved and technical
breakthroughs in many aspects.
2. The application of 10G Ethernet

As the backbone communication link data center network, network construction, 1000Base-T
1000Base-LX, 1000Base-SX standard Gigabit Ethernet is applied to the traditional data center
based on a lot, there are still a lot of data center in the use of this standard network, the mainstream
network equipment in the network interface standard as standard. When large scale distributed
computing and distributed storage appear, Gigabit Ethernet is difficult to meet the needs of data
transmission between nodes of cloud computing resources.
In order to optimize laser 50m multimode fiber (OM3) and six kinds of enhanced copper as the
transmission medium of 10G Gigabit Ethernet is becoming the current construction standard data
center backbone network. The application of Gigabit Ethernet provides a higher transmission
bandwidth and a more stable data channel for all kinds of resource nodes in the data center. It also
makes the design of internal network structure more flexible.
In the application of Gigabit Ethernet in OM3 multimode fiber channel choice reflects the
tremendous performance advantages, although do not have a price advantage, but better than in the
effective bandwidth, transmission distance, signal attenuation, energy consumption, etc. six kinds of
copper wiring density performance. The same transmission distance on the fiber provides a stronger
load capacity, the power consumption of each port 15W with respect to the 10GBase-T, the port
energy consumption of the fiber channel is only 0.5W. When the data center equipment density at a
higher level, the copper will not only take up too much space, and in order to support more switch
ports, requires additional energy consumption, energy consumption generated by radiating cable for
the environmental control system of data center layout more requirements.
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
23
3. Network topology structure of data center
The tree topology structure of traditional data center network used in the case of large, will lead to
the core network of the load is too large, single point of failure in the network exists, it is difficult
for each access equipment to provide higher bandwidth, so in the cloud data center, distributed
computing and distributed storage services put forward higher requirements for the network
structure.
Currently in the development of new data center network topology, including the switch as the
core and the server as the core of the two development direction. The switch is the core of the
topology including: VL2, Helios, Fat-tree, c-Through, OSA and other typical programs. The main
idea is to improve the performance of the network by using more switches in the traditional
topology and improving the network performance. For example: in the three layer topology Fat-tree
scheme, the core layer is arranged in the core switch enough, in order to ensure to provide 1:1
network oversubscription rate, while the convergence layer and access layer are placed enough
redundant switches are interconnected, communication leads to a single point of failure in order to
prevent the exchange of machine failure. Network for each access server provides multiple access
to the core switch link, to achieve the server without blocking communication.
In the topology of the server as the core, the method of direct access to multiple network is
adopted. Use the server configuration of multiple network interfaces, the interconnection and
routing functions on the server, the switch only to provide the server between the vertical and
horizontal (crossbar) switching function. In this kind of topology, the low layer network which is
composed of a number of servers and a switch is connected with other similar nodes to form a more
complex advanced network. The topology of the scheme is DCell, FiConn, BCube, MDCube and so
on.
A comprehensive solution to the existing switch, as the core of the network is still not get rid of
the limitation existing in the performance of the tree structure, the number of switch level switch
and core limited more the expansion of network scale is limited, to support cloud computing ability
is not adequate, it is difficult to meet the one to many and many to network communication services
many model. Server centric network architecture improves the cost of server procurement and
network construction, but it opens up a new way for the construction of the data center. This kind of
architecture has good expansibility and fault tolerance, which can support one to many and many to
many communication modes.
4. Data center network transmission protocol

Support the development of the Internet Protocol TCP/IP system at present, much difference exists
in the design of its main application scenarios and data center network environment at present, the
TCP protocol which point to point, in the application of data center under the special environment
will encounter some unexpected circumstances resulting from the sharp decline in transmission
performance. Single path transmission characteristics of the TCP protocol cannot link resource rich
data center to good use, according to the special structure of network data center and the special
needs of the application should also be used to adapt the transmission protocol.
The current transmission requirements for data center is taking some corresponding solutions to
improve the TCP protocol, by reducing the RTO value and the design of new congestion control
algorithm to solve the TCP Incast problem, the introduction of multi path MPTCP, between the
source and destination at the same time, a plurality of transmission paths, in order to make full use
of resources to improve the network link throughput. Development of the corresponding
transmission protocol for the special application of cloud computing.
24
5. Network flat and integration of data center
Traditional data center based on the task requires the existence of three relatively independent
network, which is used for Internet applications, storage and computing clusters, different networks
using different communication media and communication protocols. In addition, the hierarchical
design of the traditional network structure makes the data center network structure is too complex,
the resources between different networks are difficult to effectively integrate, cannot achieve a
unified scheduling and management. Faced with the problem of effective solutions is the three
network integration through the integration of the network structure, enhanced Ethernet fusion
(Converged Enhanced Ethernet) was selected as the exchange network technology integration
compatible with three aspects of storage, computing and network application.
Including the traditional tree network structure of the core layer, convergence layer and access
layer, layer over the network expansion more difficult, in the core of the exchange equipment layer
and pool layer configuration requirements of high performance, redundant equipment in order to
improve the overall performance of the system need to add a large amount at every level. In order to
improve the traditional architecture of the existing data center network flat and simplified,
traditional architecture consists of three layers reduced to two layer switching matrix with high
elasticity and ultimately establish a monolayer, ensure that there is a high rate and low latency
network links between any node resources. Transforming the entire data center into a seamless pool
of resources, to achieve a unified scheduling and management.
6. Network virtualization of data centers

The data center computing resources and storage resources are administered in a virtual way, for
distribution and use by the virtual pool of resources, users of the cloud computing resources and
storage resources in the use of these resources cannot consider the physical structure and position,
no need to worry about data backup and security. The virtual management mode so that users can
use on-demand data center resources.
Data center network virtualization is established between different cloud computing users,
including a virtual network of a user to use a number of virtualized resources. In many cases, users
need to use a lot of resources, these resources are existed in the way of a virtual machine, so when
the user has multiple virtual machines on the need to realize the information interaction between
virtual machines and a corresponding virtual network. Because the virtual machine in physics are
on the same physical network, virtual network and the need for independence and very strong
security, virtual network isolation, virtual machine migration, bandwidth sharing for network
virtualization brought no small trouble. In the proposed scheme, the scheme is more effective to IP
Ethernet packet encapsulation user virtual machine on the third floor of the physical network,
through the virtual network encapsulation in physical network and multi-tenant support, the scheme
can realize network virtualization in the network core equipment upgrade the case.
7. Cloud computing data center network energy saving

In order to meet the requirements of large-scale computing and storage, data centers tend to focus
on a large scale of hardware equipment, so the rapid expansion of the network size significantly
increased the level of energy consumption of the data center. The main factors leading to a rapid
increase in energy consumption, in order to solve the traditional tree topology structure of data
center network generated by the performance limitations and the "rich connection topology, in order
to ensure the performance of network transmission in the peak network traffic conditions and
improve the reliability of complex networks, the use of more network interconnection equipment,
and increased a lot of redundant lines. However, the data center network traffic in most cases is at a
low level, due to the peak hours of work is very little, so the data center network energy
consumption efficiency is not high. Taking into account the cost of data center operation, and the
25
burden of too much energy to the air-conditioning system, the need to find ways to control energy
consumption from two aspects of hardware equipment and network operation mechanism.
The main method in the network energy is currently dormant and adjust the rate of equipment,
equipment solutions dormancy is the main object network interface for the network equipment
energy consumption and put forward, for no idle flow through the network interface dynamic
adjustment of the operating mode, in the new data packet arrives in front of the equipment interface
let dormant work mode. And then wake up the port in the data packet arrival equipment. Based on
the same principle, the adjustment of the network device interface speed can also achieve the
purpose of controlling the network power consumption. According to the load change of link
transmission data, the speed of the link is reduced or adjusted, so that the energy consumption of the
link can be effectively reduced.
8. The trend and Prospect

With big data applications to cloud based increasing, data storage and computing tasks more
large-scale data center development is the fundamental driving force to promote to a higher level of
technology, the process of development to a higher level of technology in the data center, the
development of network architecture and related technology is an important part of the inevitable.
The development of cloud computing also depends on the results of related network technology
research in a certain degree. The future data center will be a lot of progress in many ways.
With the development of network communication technology, multi-channel parallel
transmission mode based on OM3/OM4, using MTP and QSFP multimode fiber, 40G interface and
100G speed Ethernet, will become the preferred solution for future data center backbone network. A
new generation of application of enhanced Ethernet will greatly promote the integration of the flat
data center exchange network development, will be used for the three kinds of network storage
service, cluster computing and Internet application integration, the establishment of the unified
management of the integrated data exchange network. In view of the virtual network, software
defined network, data center network transmission protocol, network energy saving and other
direction of research in the future will have an important impact on the development of the next
generation data center.
References
[1] Yan Li, Wenxin Li, Honghui Chen, Deke Guo, Tian Zhang, Ting Qu. Congestionfree routing
strategy in software defined data center networks[J]. Concurrency Computat: Pract. Exper.
2015 (18).
[2] Shieh A Kandula S Greenberg A. Sharing the data center network [A]. 2011.
[3] Bari M Boutaba R Esteves R. Data center network virtualization: a survey [J]. 2012, (02).
[4] Yu Wen Wu, Wei Zhang. OpenFlow-Based Global Load Balancing in Fat-Tree Networks [J].
Advanced Materials Research. 2014 (989).
[5] Xiao Chen, Longjun Zhang, Jiayong Chen. The Design and Implementation of Disaster
Recovery in Dual-active Cloud Center [A]. Proceedings of International Conference on
Information Sciences,Machinery,Materials and EnergyICISMME 2015[C]. 2015.
26
A Case Study on Qiqiao in"The Golden Cangue" from the Perspective of

Gender Alienation Theory in Marxist Feminism
Dan Lua, Lin Lib,*
School of Foreign Languages, Wuhan Polytechnic University, Wuhan, Hubei, China
a
1254028556@qq.com, b99502779@qq.com
*Lin Li, Corresponding author
Keywords: Marxist feminism; Gender alienation theory; The golden cangue
Abstract. "The Golden Cangue" was written in 1943 which describes the psychological changes of
Qiqiao who was born in a business family. All positive fantasies for her youth, love and life have
been ruthlessly broken and killed due to the patriarchal society and deformity of economy, marriage
and family. Marxist feminism is one of the most important schools of feminism. Gender alienation
theory is an important theory. Marxist feminists believe that women are in common with the
oppression of the working class. So they integrated the alienation of women in life into the labor
alienation theory, bringing forth gender alienation theory, analyzing women's oppression in the
process, and further deepening the concept of alienation on Marx doctrine. This paper attempts to
analyze "The Golden Cangue" from the perspective of gender alienation theory in Marxist
feminism.
1. Introduction
In "The Golden Cangue", in the patriarchal family, womens status has never changed, owing to the
oppression and abuse .The novel is full of despair due to struggle. Under the heavy oppression of
feudal economy, feudal patriarch system and feudal ethics, Qiqiao became a woman of a sick and
twisted mind. Finally, she destroyed her son and daughter's happiness with the shackles of money
and mind, making her children always accompany her before she died. Qiqiao, the artistic image in
The Golden Cangue" is analyzed from the perspective of gender alienation theory, hoping to
provide an inspiration to solve the plight of contemporary women, and calling on people to build a
harmonious society and gender equality between men and women.
2. The origin of gender alienation theory of Marxist feminism

2.1 Alienation theory
Alienation, a word from Latin, refers to detachment, transfer, alien force rule, others control and so
on. Later many different thinkers endowed it with different connotations. And Marx's theory of
labor alienation is to fully absorb the positive factors of their alienation, and transcend them, so as
to construct their own scientific materialism alienation theory.
2.2 Marx's theory of estranged labor
Marx believes that alienation is the alienation of labor, is a phenomenon in the process of capitalist
mode of production. Only through the proletarian revolution to overthrow the capitalist system, can
the communism be achieved. Marx believes that in the capitalist society, the object of labor for the
production of products and labor, being an alien or the strength independent of producers, is
opposite to the labor.
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
27
2.3 Gender alienation theory
Feminism in different stages has developed different views and formed a number of feminist
schools, such as Liberal feminism, Radical feminism, Socialist-feminism, Eco-feminism, Marxist
feminism and so on. The Marxist feminism appeared in early 1970s, a product of feminism and
Marx's combination, adheres to historical materialism and Marx's theory of women's liberation. It
believes that women's Liberation and socialism have the same goals. The gender division of labor
or the labor division of gender is the focus of feminist discussion of Marx. As early as in Engels's
"family, private ownership and the origin of the state" and Bebels "women and socialism", they
believe that the liberal feminism holds that the fight for women's equality is unreliable. Inequality
between men and women is a result of economic inequality. If the economic problem is solved, the
problem of male and female can be solved. Therefore, Marxist feminism is the most important
schools of feminists. It focuses on the limitations of liberal feminisms interpretation of oppressed
position and liberation of women, and refers to Marx's historical materialism, class and alienation to
analyze the ways to liberate women and their oppressed status. Marx believe that man is a kind of
existence. Freedom is the essence of human beings. The consciousness of life in the process of the
objects transformation has achieved the essence of human nature. However, according to estranged
labor, people can not enjoy their own physical and mental freedom, but have physical torture,
mental suffering. As a result, workers feel at ease only when they are out of work or not at home.
The oppression of women and the oppression of the workers have a lot in common, so Marxist
feminists, in the premise of Marx theory, combine the theory of feminism and gender alienation
theory to find the root of women's oppression and ways to realize the liberation of women. The
gender alienation theory of Marxist feminism is applied to analyze unequal situation of gender
division of labor and gender ideology in men and women, by revealing the gender relations in the
system and the weak position of women in relationships, as well as pointing out the way to
womens liberation. In short, gender alienation theory of Marxist feminism is an important theory
which Marxist feminism concerns, followed by the guidance to analyze and solve gender issues.
The theory also further deepens, enriches and expands Marx's alienation theory. It also has the
practical significance of making human gender harmony and building a harmonious society.
3. Analysis of the image of Qiqiao in "The Golden Cangue" from the perspective of gender
alienation theory
3.1 Motherhood alienation
Women alienate themselves from different products of their own labor in the process of
reproduction. On the one hand, in the female fertility process, women cannot decide to have
children, but their parents and husband, on the other hand, because of social needs, some women are
forced to provide more labor. More children are born for the shortage of labor. And in the
developed capitalist society, because of the economic burden, women are forced to abort or sterilize.
Therefore, raising their children does not make them have the joy of motherhood, instead regard
their children as an object and often feel guilty for less or too much care. These make women drift
away from children themselves, essentially the relationship between mother and child. In "The
Golden Cangue", as the holders of power, Qiqiao became crazy to vent her pain and began to take
revenge on others, while the victim was her children. It was the abnormal psychology that makes
Qiqiao envied her son and daughter. Due to the long suffering of lust, Qiqiao rested all her emotion
on her son, beyond the normal love. But when emotions were tied by blood, she got crazy.
Changbais marriage did not make Qiqiao feel comfort and happy, but hate daughter-in-law Zhi
Shou. At the two consecutive night, she let him help her smoke on the couch. She also seduced or
forced her son to talk private affairs with abnormal psychological mentality. She was jealous and
made the marital privacy public for lack of chances to enjoy the normal sexual intercourse. In the
end, all these made great mental stress on her daughter-in-law and caused her death. At the same
time, due to the envy of her daughter, she took a variety of means to ruin her daughters happiness.
28
Qiqiao no longer played a mother role, but the perpetrator. Children were her object to vent pain
and desire. There is no hint of the maternity and traditional image of mother .When children
encountered difficulties, she did not provide warm harbor. Consequently, Qiqiao is not the person
they looked forward, but the person who tormented and rebuked them madly. She is no longer her
childrens spiritual home, but the feudal authority spokesman, personally ruining her children's
happiness.
3.2 The alienation of female self-awareness
In patriarchal society, women are forced to be labeled as"Womanliness"---gentleness, cleverness
and kindness. The label is largely to meet the aesthetic needs of men. In feudal society, women
must be dependent on men to survive.A woman said losing weight, body sculpting and making up
was to please herself, but in fact it was to please a man to get life insurance. Females are brought up
to learn "daughters" and conform to" the three obediences and fourvirtues", never against the
authority of male. They are dominated by men frombody to spirit, lose their independent personality,
and imperceptibly becomes male slaves. In "The Golden Cangue", Qiqiao, young and beautiful,
obeyed her brothers order and married ill husband, without any resistance. Maybe the feudal
thought deeply ingrained in her mind, she took it for granted. Although finally she got a little
property and could pursue her own life and love, she made the feudal males demands into her life
standard. In the past because of feudal ethics, she performed a role, which is accord with males
need, hiding her love and relying on money to make up for her emptiness and pain. Now, in the face
of the old lover Ze, she picked up memories and even faltered to pursue her own happiness. But
abiding by the old idea that the money rather than men is more reliable ", she no longer believed in
love and men, and even obstructed her daughter's marriage. Maybe this is becauseof feudal ethics
that she was enslaved and completely lost her personality and female self-consciousness. All of
these made her depressed and even have distorted eyes on money, leading to her tragic life.
3.3 Psychological alienation
Qiqiao desired sex life apart from the normal fertility, but her husband suffered from "Bone
tuberculosis", could not meet her physical needs. Qiqiao once said: "I don't know how this child is
born! The more I think, the more I fail to understand!" At the same time as a woman, she was also
eager to love, hoping to find a person she likes. However, it was her fate to marry a young
paralyzed man in bed, who subsisted on taking opium. In this marriage, she could not find any love.
In a loveless and repressed marriage, brother-in-law Jiang Jize saved her soul love, but her love was
ruined by the feudal family. In addition to thirsting for the affection and love, she was also eager to
find a sincere friend. Then, she took an initiative to talk to the new Lan, but because of her family
position, Lan did not talk to her. Qiqiao, as a woman from lower feudal society, simply can not
control her own destiny. In order to get money, her brother forced her to get married. The infighting
cage of essence of marriage and feudal family ruined her emotional life, causing her have
psychological metamorphosis. And finally she became the slave of money. This abnormal
psychology makes her think that people should not get what she could not own. Therefore, she
nosed about her sons private affairs, forced daughter-in-law to die, and destroyed her daughters
love, ruining all her children's happiness.
4. The inspiration to solve the dilemma of contemporary women

4.1 The plight of contemporary women
With the reform and opening up, the new thought is popular around China. Society is evolving and
women's sense of independence is also growing. Nowadays, women can participate in social life as
men. However, because of the long-term accumulation of the traditional ideology, there is still
discrimination against women in society, which is not conducive to the development of women.
Contemporary women not only have to play a role of a good wife and a good mother, but also to
29
have a great career. Women's initial employment will be subject to discrimination. For example,
they were asked whether to have children recently and other issues related to privacy. Many
business units only recruit men or married women. Therefore, for working women, they not only
need to take social responsibility in the workplace, but also to bear more domestic responsibility.
However, it is difficult to maintain a balance between work and family, so there are many family
conflicts.
4.2 The Enlightenment of gender alienation theory
Under the premise of Marx's theory, the Marxist feminists consider the problem of feminism and
put forward the theory of gender alienation. Gender alienation theory of Marxist feminism has
given full attention to womens problems. The alienation of female in the field of all aspects of the
family, is shown in front of people, it promotes people to correctly understand relations between the
sexes, raises women's independent awareness and builds up harmonious society. Gender alienation
theory plays an important role in contemporary China, which provides a solution to the problem of
Chinese women.
First, in the ideological field, we should enhance women's self-awareness. Women's liberation is
the consciousness of women. Although the social development provides a prerequisite for women's
liberation, but there are still some old social thought hindering the development of human beings.
To achieve womens liberation, we should liberate self-consciousness, if you don't keep the pace
with times, accept new knowledge and ideas, in some extent, you will lose independent personality
and dignity. In contemporary society, the phenomenon of inequality of men and women can be
found everywhere, women must have self-esteem and self-reliance. They should continuously learn
knowledge, constantly improve themselves, and actively participate in social activities to prove
their strength.
Second, optimize the social and economic environment and realize the independence of women's
economy. Economic independence is the prerequisite for women to gain dignity and freedom. Men
are taught to be strong, responsible, and independent, so they will be strong, unyielding and
independent of economy. On the contrary, women in childhood is regarded as the weak side, young
parents educated them to be gentle, quiet and dignified, which people think women should be.
Because of this, women are regarded as men's accessories, relying on men to survive. Therefore,
women should be separate themselves from the males control. It is necessary for them to have
economic independence and take an initiative to participate in social activities.
Third, achieve the liberation of women - the liberation of all mankind in full development .
Women's liberation is an inevitable stage of human liberation, making themselves become free men.
There is no denying that there are physiological differences between men and women. Only to
eliminate gender discrimination, can women obtain social status, women's liberation and equality.
However, it is not to destroy the feminine temperament, but to bring femininity into full play to
obtain real freedom, to achieve comprehensive human development and to create gender
harmonious society.
5. Summary
The overall performance of "The Golden Cangue" in feudal patriarchal society, women can not
control their own destiny, having no freedom or status. They are males accessories. The infighting
cage of immaterial marriage and feudal family ruined all her emotional life, resulting in abnormal
mentality. Based on the gender alienation theory of Marxist feminism, we hope to make an
inspiration to solve the plight of contemporary women, to call on people to build a harmonious
society and gender equality between men and women.
30
References
[1] August Bebel, Woman and Socialism[M], Beijing, Central Compilation & Translation Press,
1995:48.
[2] Dujie, Western Marxist Feminism[J],Women Study,1998.
[3] Li Yinhe ,Women; The longest revolution[M], ChineseWomen's Publishing House, 2007.
[4] Eileen Chang, The Golden Cangue[M], Harbin Publishing House, 2005.
[5] Marx, Economic and Philosophical Manuscripts of 1844.
[6] Simone de Beauvoir, The Second Sex [M], Shanghai Publishing House, 2001.
[7] Wang Hong, The alienation of female consciousness, enslavement and Transcendence [J],
Social Sciences Research, 2004
31
The Analysis of the Parking Problem and Its Solutions of Beijing City
Mingxin Shi a, Peihong Chen b
School of Economics and Management, Beijing Jiaotong University, Beijing, China
a
15120526@bjtu.edu.cn, bphchen@bjtu.edu.cn
Keywords: Difficulty in parking; Contradiction between supply and demand; Motor vehicle
ownership.
Abstract. The purpose of this paper is to solve the parking problem in Beijing which is complex
and comprehensive. First, this paper analyzes the present situation of parking in Beijing. Then, we
find that the deep level reasons which affecting the problem of parking difficulty through the
existing data. In the last part of this paper, in view of these reasons, we put forward relevant policies
and suggestions to solve the problem of parking difficulty.
1. Introduction
In recent years, the growth speed of cars is more and more quickly. The number of motor vehicle
ownership is in a state of swelling, especially in Beijing. The constant growth of the number of
motor vehicles caused urban traffic congestion and parking difficult problems, which has brought
huge pressure for Beijing. The pressure is not only on the road traffic congestion, but also on the
parking of the vehicles, which resulting in the awkward situation that people have money to buy a
car, but nowhere to park.
In this paper, through the research of the present situation of motor vehicle parking problems in
Beijing, we are committed to discussing the deep reasons for the parking problems in Beijing, then,
to solve these reasons, we will put forward the corresponding solutions.
From a domestic perspective, the domestic scholars` research is mainly from the perspective of
the specific situation of Beijing. The relevant research is mainly from the following three aspects:
(1) Contradiction between supply and demand: Sun Zhuangzhi (2008) found that it`s imbalance
between supply and demand of Beijing parking facilities, he suggest that according to the parking
demand predict reasonable parking supply scale.
(2) Charging mechanism: Yin Yuanfei (2006) found that the charging mechanism of Beijing`s
parking facilities is not reasonable. And the author suggests that the research should focus more on
price formulation.
(3) Parking management: Wang Wei and He Xingdong (2014) considered that Beijing`s parking
facilities management mechanism is not sound, what`s more, our government should strengthen the
management of the parking lot .and improve the existing parking industry laws and regulations.
2. The present situation of parking in Beijing

By the end of 2015, the number of motor vehicles of Beijing is 5.619 million, 28000 more than the
end of 2014. As the carry out of the control measures on cars` total number in Beijing, the growth
speed of the number of motor vehicles has slowed. However, this still cannot able to resist the
citizen's desire to have their own cars, so the number of private cars is still growing every year.
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016

32
Tab.1. The change trend of the motor vehicles` number in Beijing
Unit: thousands of vehicles
Number of The growth rate of Number of Small The growth rate of small
Years
motor vehicle motor vehicle private vehicles private vehicles
2007 312.8 192.8
2008 350.4 12.02% 228.9 18.72%
2009 401.9 14.70% 281.8 23.11%
2010 480.9 19.66% 356.6 26.54%
2011 498.3 3.62% 371.7 4.23%
2012 520 4.35% 389.7 4.84%
2013 543.7 4.56% 409.3 5.03%
2014 559.1 2.83% 419.7 2.54%
2015 561.9 0.50% 424.3 1.10%
According to the 2015 Beijing traffic analysis report which issue by the Beijing traffic
committee, the 2015 total trip volumes on working days among the city center is 27.29 million
times (excluding walking),which fell 3.5% compared with last year. Commuter trips volumes are
18.1 million times (excluding walking). The proportion of the commuter`s travel by car is 31.9%,
which accounts for a big proportion.
From the supply and demand situation of parking facilities, relevant data shows that by the end
of 2015, the number of motor vehicles of Beijing is 5.619 million, And by the end of 2014, the
number of the registered parking lot in Beijing is 6448, and the number of the parking space is
1757718. The gap of the parking space is about 3.86 million. The proportion between the number of
motor vehicles and the parking space is 3:1. According to international experience, the number of
parking space should be 1.1 times-1.2 times of the number of motor vehicle. If calculating
according to the number of 5.619 million, Beijing should have parking garages for the number of
6.181 million- 6.743 million, which are far more than now.
Through the above analysis, the mismatch between the number of parking garages and the
number of motor vehicles directly cause the phenomenon that parking is difficultly and disorderly.
Beijing`s supply of parking garages cannot meet the demand of the reality. The contradiction
between supply and demand of parking facilities is very outstanding, and lacking of parking
management leads to parking out of order. Solving the problem in parking difficult of Beijing,
especially among the city center area has become an urgent problem. Beijing, as the city which has
the largest number of automobile, should accelerate the standardization of the parking industry
development to promote the development of automobile industry, which can help to solve urban
traffic problems.
3. The analysis of the reasons for parking problems in Beijing

In addition to the insufficient supply of parking spaces, parking difficulty is caused by a series of
problems of multiple levels. Therefore, solving the problem of parking difficulty will be a
comprehensive social systematic project. To fundamentally solve the problem, we must adjust
measures to local conditions, analyze deeply of the reasons that cause the parking chaos in Beijing,
and put forward corresponding solving measures as quickly as possible.
There are many reasons leading to the present situation of parking in Beijing.
(1) The planning and construction lag behind the development of demand.
Since the late 1990s, the rapid development of urban economy and society is beyond the
imagination of overall planning, which makes the planning and construction of urban infrastructure
lag behind the development.
(2) The parking facilities are lack of sharing thought.
33
The open degree of Beijing`s parking facilities is poor, especially in public buildings` parking
garages and company`s own parking space. Most of the companies have the stipulation that outside
vehicles are not permitted to enter.
(3) The level of parking charge is lower than other developed countries, and the fee structure is
not reasonable.
Fig..2. the average parking fee in big cities of the world (euro/ per hour)
Compared the above data about parking fee standards in China to the data in other developed
countries and regions, we can figure that Beijing's current motor vehicle parking fee is far lower
than others, and the price system is not reasonable. This reduces the cost recovery speed for the
large parking garages.
4. The solutions of the parking problem in Beijing

Parking difficulty and parking chaos" are essentially the comprehensive reflection on a variety
of parking problem. To solve this problem, we need the joint efforts of the whole society.
We should gradually adopt comprehensive governance countermeasures from different aspects,
such as the management system and mechanism, the parking planning, the parking price, the
development of the parking industrialization and the informatization introduction, etc. According to
the above discussed reasons for the parking problem in Beijing, this paper will put forward the
following suggestions:
(1) To attach great importance to the parking management system and mechanism
Beijing's parking facilities planning, the construction standards, the setting up of parking fee, and
the parking guidance and so on all need effective management means to achieve the ultimate goal.
(2) To strengthen the parking planning
Parking lot planning is the important basis of urban parking facilities construction, Therefore, we
need according to the Beijing's development situation and the situation of the increase of motor
vehicle ownership to update the present planning and indicators in time, which for make them
match the parking demand.
(3) To adjust the parking price
Through the parking price adjustment, Beijing can increase the utilization rate of existing
parking facilities, also can guide the benign development of parking industry; at the same time, by
adjusting the parking price system and level, Beijing can indirectly curb rapid growth of motor
vehicle amount.
(4) To strengthen the management of the parking order
As the same time as constructing the parking space, the parking order need to be regulated in
Beijing, especially the parking order around hutongs and residential areas. Through the parking
34
order management, we try to make the motor vehicle parking and parking management to
standardization and normalization in Beijing.
(5) To promote the development of parking industrialization
Beijing needs to change the current investment and financing mode which mainly rely on the
fiscal investment from government or state-owned enterprises. The basic idea is that the
government establishes relevant industrial policies, which attract private capital to participate in the
construction of parking facilities. Then, we can promote the development of parking industry
according to the way that construction and management of the enterprise.
5. Summary
To sum up, the speed of development of the parking industry and the degree of sound of
management system, to some extent, determine the development of a city, and affect the whole
transportation system of a city. The development of parking industry of Beijing is far less than other
international metropolis at present stage.
One of the five basic characteristics that Beijing should have for becoming a world-class city is
developed, modern, and three-dimensional traffic system. Parking industry is one part of the
transportation system. We are short of appropriate laws and regulations of the existing parking
garages in Beijing. The existing parking garages can't meet people`s demand. And the modern
parking facilities are not perfect. All of these influence the development of Beijing's traffic system.
The government should increase the investment for parking industry (including capital, policy, etc.)
to promote the development of parking industry of Beijing.
6. Acknowledgement
My deepest gratitude goes first and foremost to my supervisor, vice professor Chen, for her constant
encouragement and guidance. Secondly, I would like to express my heartfelt gratitude to my
beloved family for their loving considerations and great confidence in me all through these years.
Last my thanks would to the National Natural Science Foundation of China and the Fundamental
Research Funds for Central University.
Project of Beijing Social Science Foundation Research Base: The Research on the Impact of
Beijing Municipal Government Relocation on Urban Transportation (16JDYJB009).
References
[1] Albert Gragera, Daniel Albalate. The impact of curbside parking regulation on garage
demand[J].Transport Policy,2016,47.
[2] Rong Zhang, Li chao Zhu. Curb parking pricing in a city center using a threshold[J].Transport
policy,2016,6.
[3] Yin Yuanfei, Li Yang, Yan Hai. The discussion on the price mechanism of parking fees [J].Road
traffic and safety,20064:1-4.
[4] Sun Zhuangzhi, Xu Juan, Qiu Xujian. The study about parking problems in Beijing and its
countermeasures [J]. Special attention, 2008:11-14.
[5] Wang Wei, He Xingdong. The analysis about Beijing`s parking management problem and
countermeasures [J].Journal of comprehensive transportation, 2014(6):76-79.
[6] Ye Zeng, Shen Xiaopeng, Shen Fen.The countermeasure research of Beijing parking facilities`
construction and management[C].Annual meeting and academic seminar of traffic planning
of Chinese urban,2014.
35
The Principal Risks of Public Technician Colleges in Guangzhou

Xu Fan a, Shuyan Guanb,*, Xiaohong Wei c
School of Public Administration, South China University of Technology, Guangzhou, China
a
gxufxu@sina.com, bm18814105096@163.com, cxhwei@scut.edu.cn
*Corresponding author
Keywords: Public technician college; Risk classification; Principal risk
Abstract. Technician colleges play an important role in cultivating highly skilled personnel, but
they also face various risks in running schools. Based on the investigation of six public technician
colleges and their government departments in Guangzhou, the risks existing in the public technician
colleges were systematically sorted and classified. The principal risks faced by public technician
colleges in Guangzhou are social recognition, food safety, internship safety, mental health,
enrollment competition, public opinion, faculty, and student loss risks.
1. Questions and literature review

Technical education in Guangzhou has been seated in the front row of Chinese technical education
and has created highly skilled personnel training mechanismsthe Guangzhou model.
Guangzhou technician colleges are becoming widely seen as the primary practitioners of this model.
Ever since six public technician colleges were approved as technician training institutions, they
have nurtured a large number of highly skilled, talented workers and gradually pushed the
Guangzhou model into the international scene. While the gradual improvement of educational goals,
the continuous innovation of educational models, and the further expansion of marketing,
modernization and internationalization provide new opportunities for public technician colleges of
Guangzhou City, at the same time, they force these public technician colleges of Guangzhou City to
face the challenge of complex risks. These risks not only come from uncertainties of external
environment but also from problems rooted in the internal management of colleges. Recognizing
these risks is the basis for technician colleges to carry out risk prevention and control work, and to
improve the quality of school operations.
Risk refers to multiple differences between possible consequences caused by uncertainties of
decisions and objective conditions of the future behavior of the object system and expected targets.
The greater the differences, the greater the risks and vice versa[1]. Zhou Qiong points out that the
root causes of financial risk of technical colleges lie in colleges lack of cost awareness, high
spending in procurement and insufficient logistics management [2]. Li Juan and Wang Yi believe
that technical colleges face two major problems: enrollment and the loss of students[3]. Ou
Mingchao points out that there are problems such as insufficient teachers of double teacher type
and lack of quality of teachers of double teacher type in secondary vocational schools, seriously
hindering the improvement of teaching quality in secondary vocational schools[4]. Chen Lianyong
believes that there are some problems in the process of providing internships in enterprises, such as
low counterpart rate of students majors and internship positions of enterprises, lack of scientific
and reasonable evaluation systems, and lack of tangible guarantee of students rights during
internship[5]. Liu Li points out that mental health problems of secondary vocational school students
are diverse and complex, and mental weariness, interpersonal barriers, social pressure, emotional
confusion and negative emotion have a big impact on these students[6].
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
36
All in all, scholars studied more of the risks for universities and higher vocational colleges, than
those for technician and technical colleges. While there are scholars who have carried out
single-risk research of financial risk, enrollment competition risk or student loss risk of technician
or technical colleges, there are no scholars who have systematically sorted out and classified risks
of technician or technical colleges.
The risk matrix method is a method of classifying risks into corresponding levels according to
two factorsthe severity of consequences and possibilities of risksthen forming a risk
assessment matrix in order to qualitatively measure the risks[7].
2. Empirical study design and basic situation description

There are seven technician colleges in Guangzhou, six of them being public. During 2015 and 2016,
the government office responsible for Guangzhou technician colleges, entrusted this research group
to carry out research on the prevention and control of Guangzhou technician colleges. The purpose
was to systematically investigate the risks of Guangzhou public technician colleges and explore the
source and evolution law of risks. Research methods included questionnaire surveys, in-depth
interviews and literature data collection. The recipients investigated included students, teachers,
middle-level managers and high-level managers. The group also conducted in-depth interviews with
relevant staff of the administrative department of Guangzhou technician colleges. During the
research, 1368 valid questionnaires in total were collected, including 1099 questionnaires for
students, 71 questionnaires for teachers, 132 for middle-level managers and 66 for high-level
managers. The questionnaire recovery rate was 95 percent.
3. The risk analysis of public technician colleges

3.1 Risk classification
3.1.1 Risk classification process
According to the risk matrix method, risks can be classified according to two dimensionsrisk
probability and risks degree of impact.
(1) Carding of risks
This study used literature surveys and interview surveys to sort out current risks of technician
colleges. 1)Literature survey. All risks of technician colleges and higher vocational colleges
mentioned in related documents were summarized and then possible risks of technician colleges
were refined. 2) Interview survey. Risks for Guangzhou technician colleges were identified through
questionnaire surveys and interview surveys of the principals, middle-level managers, teachers, and
students of technician colleges.
(2) Determination of the risks degree of impact
The expert scoring method (Delphy method) and fuzzy comprehensive evaluation methods were
used in this study to determine the impact of risks. First, the degree of risks was divided into five
levelssevere, serious, moderate, not serious, and very slight. Second, experts assessed the impact
degree of risks according to their knowledge and experience. Third, the impact degree of risks was
calculated according to experts ' scoring. (3) Determination of risk probability
In this study, the probability of each risk was determined by experts reasonable estimate of the
probability of risk events. Initially, the risk probability was divided into five levelsvery high, high,
moderate, low and very low. Second, experts assessed the probability of each risk according to their
academic knowledge and experience. Third, the probability of risks was calculated according to
experts ' scoring.
(4) Risk level determination
After determining the probability and the impact degree of each risk, risk rating scale (Table 1)
was established to clarify the levels.
37
Tab. 1. Risk grade control table.
Impact degree
Very slight Not serious Moderate Serious Severe
Risk probability
Very low Low Low Low Moderate Moderate
Low Low Low Moderate Moderate High
Moderate Low Low Moderate High High
High Low Moderate High High Very high
Very High Low Moderate High Very high Very high
3.2 The results of risk classification of questionnaires

3.2.1 The results of risk classification for colleges
This study visually demonstrates the distribution of levels of each risk in the form of the coordinate
diagram. Risks falling into the first quadrant are high-level ones, risks falling into the second and
fourth quadrant are mainly middle-level ones, and risks falling into the third quadrant are low-level
ones. Take A and B technician colleges as an example. A technician colleges high-level risks are
food safety risk, equipment safety risk, student group event risk, mental health risk, integrity risk,
enrollment competition risk, social recognition risk, internship safety risk and public opinion risk. B
Technician colleges high-level risks are food safety risk, mental health risk, integrity risk,
internship safety risk and public opinion risk (Figure 1).
Fig. 1. The risk distribution of A technician college and B technician college.

Tab. 2. High-level risk summary of technician colleges.
Risk A B C D E F Total
college college college college college college
Food safety risk -- -- 4
Equipment safety risk -- -- -- -- 2
Campus violence risk -- -- -- -- -- 1
Student group event risk -- -- -- -- 2
Mental health risk -- -- 4

Teaching quality risk -- -- -- -- -- 1
Integrity risk -- -- -- -- 2
Free tuition policy risk in Vocational Schools -- -- -- -- 2
The reduction of students because of the -- -- -- -- 2
decrease in the population of school age
Enrollment competition risk -- -- -- 3
Social recognition risk -- -- 4
Internship safety risk 6
Public opinion risk 6
38
The high-level risks of each college were summarized through questionnaires. The specific
results are shown in Table 2.
3.2.2 The ranking of high-level risks
From Table 2, it can be seen that risks recognized as high-level ones by at least 3 colleges are food
safety risk, mental health risk, enrollment competition risk, social recognition risk, internship safety
risk, and public opinion risk. These 6 risks are regarded as main risks of public technician colleges
of Guangzhou City. Because risk matrix method cannot be used to rank these six risks, next step
will employ an analytic hierarchy process to rank these six risks.
Step 1: Establish risk assessment structure model according to the goal (Figure 2).
Fig. 2. Risk assessment structure model
Step 2: Establish comparison judgment matrix.

(1) Judgment matrix of risk probability (Table 3).
Tab. 3. Judgment matrix of risk probability.
Public Mental Enrollment Social
Food safety Internship
opinion health risk competition recognition
risk safety risk
risk of students risk risk
Food safety risk 1.00 1.00 0.33 0.50 0.25 0.20
Public opinion risk 1.00 1.00 0.50 0.50 0.33 0.25
Internship safety risk 3.00 2.00 1.00 1.00 0.50 0.25
Mental health risk of
2.00 2.00 1.00 1.00 0.50 0.33
students
Enrollment
4.00 3.00 2.00 2.00 1.00 0.20
competition risk
Social recognition risk 5.00 4.00 4.00 3.00 5.00 1.00
W1=0.06,0.07,0.13,0.12,0.20,0.42 T is calculated according to additivity method. Next,

consistency check will be conducted.
Results calculated from the relevant formula:
=6.231, =0.046<0.1
Consistency ratio =0.037<0.1

Therefore, this matrix is consistent with the consistency test, and the weight of criterion layer on
the target layer is:
W1=0.06,0.07,0.13,0.12,0.20,0.42 T
(2) Judgment matrix of risks degree of impact (Table 4).
39
Tab. 4. Judgment matrix of risks degree of impact.
Public Mental Enrollment Social
Food safety Internship
opinion health risk competition recognition
risk safety risk
risk of students risk risk
Food safety risk 1.00 4.00 2.00 2.00 5.00 3.00
Public opinion risk 0.25 1.00 0.33 0.33 3.00 0.50
Internship safety risk 0.50 3.00 1.00 1.00 3.00 2.00
Mental health risk of
0.50 3.00 1.00 1.00 3.00 2.00
students
Enrollment
0.20 0.33 0.33 0.33 1.00 0.33
competition risk
Social recognition risk 0.33 2.00 0.50 0.50 3.00 1.00
Results calculated from the relevant formula:

=6.158,C.I.=0.032<0.1
Consistency ratio C.R.=0.026<0.1
Therefore, this matrix is consistent with the consistency test, and the weight of criterion layer on
the target layer is:
W2=0.34,0.09,0.20,0.20,0.05,0.12 T
In this study, the probability and influence degree are equally important, so their weights are
0.5,0.5 respectively.
Step 3: Clarify weight and sorting (Table 5).
Tab. 5. Calculating results of weight of six risks.
W1 W2 Risk probability Risk impact W1*f1+W2*f
f1 degreef2 2
Food safety risk 0.06 0.34 0.5 0.5 0.20
Public opinion risk 0.07 0.09 0.5 0.5 0.08
Internship safety risk 0.13 0.20 0.5 0.5 0.165
Mental health risk 0.12 0.20 0.5 0.5 0.16
Enrollment 0.5 0.5
0.20 0.05 0.125
competition risk
Social recognition risk 0.42 0.12 0.5 0.5 0.27
According to Table 5, it can be seen that social recognition risk ranks first (0.27), food safety
risk (0.20) ranks second, internship safety risk ranks third (0.165), mental health risk ranks
fourth(0.16), enrollment competition risk ranks fifth (0.125), followed by public opinion risk(0.08).
4. Analysis of the results of interviews

Apart from sorting out main risks through questionnaires, interviews with various groups of
Guangzhou citys public technician colleges were conducted in order to fully understand the main
risks facing Guangzhou citys public technician colleges. Through interview surveys, risks that they
might face or have already attacked public technician colleges were sorted out. Risks mentioned by
at least 5 colleges are integrity risk, enrollment competition risk, campus violence risk, student loss
risk, mental health risk of students, internship safety risk, and faculty risk. During the investigation,
it was discovered that colleges took the prevention and control of integrity risk very seriously, and
took a series of measures to prevent integrity risk. Therefore, the prevention and control of integrity
risk were not studied during this research. In addition, although most colleges referred to campus
violence risk during interviews, college administrators thought that the frequency of campus
violence had significantly decreased in recent years. Therefore, this research did not study the
prevention and control of campus violence risk. For enrollment competition risk and internship
safety risk, these have already been classified as principal risks in the previous questionnaire
40
investigation. Apart from these two risks, concerned faculty risk and student loss risk were also
classified as main risks.
5. Summary
Based on the questionnaire survey and interview survey, the principal risks facing public technician
colleges in Guangzhou City were sorted out, including social recognition, food safety, internship
safety, mental health, enrollment competition, public opinion, faculty, and student loss risk. Lack of
government policy design, defect of college management (service), students and other subjects
awareness of risk prevention and control, lack of social support and other factors led to the
of these risks. Therefore, a government-college-media-parent-student linkage mechanism needs to
be established to prevent and control risks for public technician colleges.
References
[1] Liu Qingxiu and Xiong Feng, Current situation analysis and countermeasures of risk
management in colleges and universities, Education and Vocation, vol.06, pp. 37-39, 2008.
[2] Zhou Qiong, Analysis of financial risk management and effective control in technical colleges,
Occupation, vol.23, pp. 190, 2014.
[3] Li Juan and Wang Yi, On countermeasures of two major problems of enrollment and the loss of
students of technical colleges, Vocational Education Research, vol.07, pp. 126-127, 2006.
[4] Ou Mingchao, Mechanism innovation research on the construction of teaching staff with
bi-expertise in secondary vocational schools, Guangdong Polytechnic Normal University, 2014.
[5] Chen Lianyong, Analysis of current situation and countermeasures of internship outside the
province of technical colleges: Taking Yunnan technician college for example, New Curriculum
Research, vol.5, pp. 97-98, 2015.
[6] Liu Li, Study on mental health problems of students in secondary vocational schools,
Chongqing Normal University, 2012.
[7] Li Shuqing, Yan Zhi, and Duan Yu, The application of the risk matrix method in the
classification of dangerous and harmful factors, China Safety Science Journal, vol.04, pp.
83-87, 2010.
41
The Plan for Urban Lifeline Systems on Coastal City under the
Background of Typhoon
Dinghua Zhanga,*, Jiali Lib, Yunru Kongc
Public Administration, South China University of Technology, Guangzhou, China
a
dhzhang@scut.edu.cn, bkali115@sina.cn, c404450719@qq.com
Keywords: Coastal city; Urban life line system; The regional disaster system theory; Triangular
Framework
Abstract. The urban lifeline system plan is a safeguard ,which is extremely important for urban
security. Because of its coupling structure, the urban lifeline system is vulnerable
to be damaged when exposed to strong typhoons. First, this paper analyzed the characteristics of
disasters within coastal cities, which were based on the theory of the regional disaster system.
Second, according to the field investigation from Zhangjiang, Shantou and Shanwei, this paper
could construct coastal urban typhoon chain reaction, and consequently discover the hazard factor
in the current urban lifeline system when a strong typhoon occurred. Third, the Rainbow event in
Zhanjiang City in 2015, can be a strong example to further explain this model. Finally, based on the
hazard factor and centered around EmergencyEmergency management- Hazard-bearing
body, this paper tried to provide some comprehensive plans or ideas for the lifeline system in the
coastal cities of Guangdong province.
1. Introduction
The city is the unity of Modernization and human civilization. With the development of
urbanization, coupling structure of coastal urban lifeline system is more and more complex, which
means the failure of the system and part of the system function will cause a cascading effect. After
suffering the consequences of a powerful typhoon, coastal urban lifeline systems will spring up a
chain reaction, derive various disasters chains, and threaten the safety of the cities. People can only
forecast the typhoon path, but not accurately predict the typhoon level or control the failure degree
of the disaster. In the face of powerful typhoons, which can't be predicted or controlled, we must
make a global, systematic, forward-lookingsecurity-oriented plan for the complex system, with
development and contact view, try to strengthen the robustness of the coastal urban lifeline system,
and reduce the risk of system function failure when disasters strike, in order to ensure safety of our
cities.
2. An analysis for coastal urban lifeline system disasters under the powerful typhoon
disasters
Disaster system theory consists of disaster-pregnant environment (E), disaster-causing factor (H)
and hazard-bearing body (S), which have function system corresponding to stability (S), risk (R)
and vulnerability (V). And all these three parts are important to the disaster system[1]
2.1 An analysis for the characteristic of disasters in the coastal cities of Guangdong province
(1)Instability and complex disaster-pregnant environment
Guangdong province is in the south of China and includes 14 prefecture-level cities which are
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
42
coastal cities. Along with the reform and opening up, population size, economic structure, industrial
structure, transportation network, population flow are deeply changing in these coastal cities. The
data from the Guangdong statistical yearbook shows that 14 coastal cities have high population
mobility as the urban resident population reached 68% by 2014, and year-end household
registration net population migration changes drastically every year. The reform improves the level
of urbanization in the coastal city, but it has also increased the instability of the coastal cities.
As the basis of the development of urbanization, industrialization has changed the layout of the
city and increased the complexity of the city. According to the Guangdong statistical yearbook, the
gross domestic product of Guangdong province accounts for 17.5% of the national total, and the
second and third industrial gross domestic products account for 11.5% and 10.8% of the national
total. The number of industries and enterprises in coastal cities are also increasing year by year from
2012 to 2014, which means increasing 95 industries and enterprises in an average year. All the
above shows the transformation and upgrading of industrial structure and the increase in the
proportion of the second and the third industry. With the interwoven natural environment and
industrial humane environment, streams of people, logistics, and information flow, urban lifeline
systems converge together to form a subsequently complex environment.
(2)A variety of high-risk disaster-causing factors
Along with the economic development and urbanization process, the intensity and the specifics
of the disaster-causing factor, that mainly can be divided into natural factor, infrastructure factor,
industrial factor and social factor, is rising in the coastal cities of Guangdong province.
Natural factor: Guangdong province is located in the Pacific Ocean and lies in the southern of
mainland China. The geographical location leads to frequent typhoons every summer, which cause
direct economic losses of billions of RMB. And even the level of typhoon has a tendency to
increase. Infrastructure factor: it mainly includes planning and the coupling structure of lifeline
systems. For example, the current power grid planning and design of the basic line is based on 50
years (30) [2], but the powerful typhoon 2015 "rainbow" has exceeded the standard. Industrial factor:
it mainly refers to the safety accidents, such as: fire, explosion, toxic chemicals leakage. Coastal
cities have invested in the construction of a lot of big industry in recent years. The destructiveness
of powerful typhoons increases the risk of industrial safety accidents. Social factor: it is mainly
embodied in the social and public security, such as mass incidents and terrorist attacks. With the
deepening of the urbanization in the coastal cities of propulsion and high population mobility, the
broken original pattern of interest distribution made the social contradictions increasingly
intensified, which will become a threat to public safety.
(3)High vulnerability of hazard-bearing body
Urban lifeline systems is quite weak. For example, the collapse of cables readily occurs in
Guangdong province because many cables are suspended on stilts and exposed to typhoon damage.
Also, the vulnerability of coastal urban lifeline systems also reflects on the coupling structure,
2.2 Analysis for powerful typhoon and the chain reaction relationship of the urban lifeline
system
The typhoon can be generated in just a few hours, that makes this disaster come on very suddenly
and strongly [3].This article adopts the method of social investigation. Using the principle of disaster
system theory, we built a chain reaction of a powerful typhoon based on the information from
Zhanjiang, Shantou, Maoming. In the analysis, a powerful typhoon is initial natural disaster event A,
urban power supply interruption is the event B, urban water supply interruption is event C,
communication interrupt is event D, traffic chaos is the event E, shortage of energy (fuel) is the
event F, industrial disaster is event G, social panic is event H.
In essence, the coastal city is not only a pregnant environment of the disaster, but also a
hazard-affected body, which means a single disaster may turn into a series of disasters and cause a
chain reaction.
43
Tab. 1: specific table about chain reaction of the emergency
emergency disaster-pregnant environment/ disaster-causing factor
hazard-bearing body
The powerful Three facing the sea, in the east of the south climate
typhoon China sea (in the western north Pacific
"rainbow" A (China sea) the typhoon area)
Urban power Distribution wire, electric pole and electric The wind resistance standard of
outage B tower, power plants, substations and other power system
electric grid system
Urban water Waterworks, pump and other water supply Electricity, power supply plan, the
outage C facilities backup power supply, water pump
operating conditions
Communication Communication base stations, machine Electricity, back-up power, base
interrupt D building, cable and other communication level
facilities
Traffic Highway, railway, airport, traffic lights, Electricity, roadblocks, traffic
interruption E daily and emergency vehicles, bridge lights, road safety, congestion
Shortage of Gas station, payment system, monitoring Electricity, back-up power,
energy (fuel) F system, daily and emergency vehicles market supply and demand
Industrial Piping, equipment (such as boiler) equipment operations demand for
disaster G electric power, backup power
supply
Social panic H Order of social life and production, The rumor, the degree of
information dissemination media information disclosure
2.3 Specific casethe basic situation of the powerful typhoon "rainbow" and the situation of
the disaster in Zhanjiang
On October 4, 2015, a powerful typhoon named rainbow" landed in potou district of Zhanjiang at
14 PM while the level of the biggest wind near the center had reached 15 grade (50 meters/seconds),
parts of wind reached grade 17 (67.2 m/s). Zhanjiang was badly damaged by the typhoon: blackouts
appeared in the city; the city's large area of water ,traffic light and communications base station
were work out and so on.
2.3.1 An analysis for emergency chain reaction
When the disaster caused by powerful typhoon "rainbow" (A) happened, disaster-causing factors,
which can lead to chain reaction between urban lifeline systems: (1) 110000 power station in
Zhanjiang tripped out first, then 500000, 220000 power station (B),the speed of the winds (50
meters/seconds) had surpassed the standard of anti wind (A);(2) 12 waterworks without power(B) in
Zhanjiang were out of service(C)due to the lack of self-provided power supply planning and single
loop power supply constraints. (3) the power interruption made three major communication
operators were out of power. More than 3000 base stations lost power (D) because of weak security
of power system;(4)There were 73 traffic lights in the city, and 63 of them were damaged (B),and
multiple roads were covered by water and garbage ,such as the 207 national highway (E);(5) more
than 120 gas station in Zhanjiang stopped functions of refueling, and the demand about enterprises,
residents of life self-help, National Day holiday and emergency vehicles self-help were making a
intense situation (F);(6) a few large industrial (G) like the Baosteel were facing risks which the
function of refrigeration went out of action due to power failure (B); (7) urban residents couldnt
work or live without power(A), water supply (B), communication interrupt (C) for a long period of
time; then if rumor bred and government didnt clarify timely, there would have been social panic
(H).
3. Safety planning of lifeline system in coastal cities based on " Triangular Framework"
Professor Fan Weicheng, from the perspective of public safety ,science and technology, put forward
the framework called " Triangular Framework" : Emergency , Hazard-bearing body and Emergency
44
management, and the three vertex called disaster element, including material, energy and
information. [4] And divided the hazard-bearing body into two forms, which were the main body
damage and the function destruction. [5]
3.1 Prevention planning based on the "emergency" and "disaster element"
In the future planning of the lifeline system, we must implement multi-sectoral, integrated concept.
And the consideration should be given to the characteristics and distribution of the lifeline systems,
hydrological climate, topography and disaster sources etc... And advertising board, iron sheet and
other illegal structures should be forbidden to build around the urban lifeline facilities. Beside urban
lifeline system must realize information sharing. Sharing the layout of some facilities and other
planning information together
3.2 Prevention planning based on the characteristic hazard-bearing body
The key link of the collapse of urban lifeline system is the interruption of power supply, so it is very
important to improve the anti disaster capability of power facilities in the coastal city. First, improve
the wind resistance standards and update the technical specifications. Secondly, increase the
investment in the security of facilities and research new reinforcement method. And in order to
reduce the function destruction caused by the damage of the main body, the operation mode
should be converted in order to improve the robustness: Adopt Parallel loop structure mode, which
can ensure the functional failure of any system could not crash the entire system. And improve
the "auxiliary" system, that is, the backup power system: configure backup security power supply,
set the external interface and maintain regularly.
3.3 Prevention planning based on "emergency management"
Emergency management covers a number of indicators and dimensions, so this paper selects the
"mechanism, the legal system, the resources ".For a super complex urban lifeline system, it is
really essential to establish a joint emergency response mechanism: the deputy mayor of the
territory has been as the commander and urban lifeline system has been as its member, and each
system set up interconnection and interworking platform in their own office spot. In addition ,the
first one who arrived at the scene has been as the scene commander, and disaster scene of each
person should be responsible for one person only. Legal system is the guarantee of the emergency
management. So government departments should formulate relevant laws including disposal
procedures and contact system, backup power allocation system and system technical standards as
well as power and responsibility system. Emergency resources are fundamental to the emergency
rescue work. First, telecommunications operators should increase the emergency communication
equipment, waterworks should set up designated cisterns and transportation system should increase
the mobility of traffic signs. Second, establish interconnected and interworking emergency
resource network database, in order to achieve the vertical and horizontal linkage in resources
between each system. Finally, pay more attention to the funding and human resources investment.
4. Summary
With the development of society and the influence of the complex disaster environment of coastal
cities, the higher risk of disaster factors and the vulnerability of hazard-bearing body, to make a
comprehensive planning to urban lifeline system is particularly important nowadays. To this end,
planning must be participated among each system; Each system should share information and make
the whole process of emergency management become legalize ; Strengthen the anti wind lifeline
system and improve the robustness of the system. It is especially important to make the
comprehensive planning.
45
5. Acknowledgement
This research was financially supported by the Science and Technology plan Research of
Guangdong province(2013B070207001),Basic Expenses of Central University(x2ggD2152410),
urban Management Research Project of Guangzhou and the Major Research Projects of Ministry of
education in 2016(16JZD026).
References
[1] Rong lili,Tan hua,Modeling Chairrreactions to Emergency Based on Disaster-pregnant
Environment ,Systems Engineering,vol.07pp.40-47, 2012.
[2] GB50545-2010.110kv~750kvTechnical Specification for Design of Overhead Transmission
Line ,2010.
[3] Ye wen,The Characteristics of Typhoon Disaster and Disaster Countermeasures in Guangdong
Province, Journal of Catastrophology,vol.09,pp.54-59. 2002.
[4] Fan weicheng,Liu yi, Analysis of urban public safety system ,Forefront of Urban Management,
vol.05,pp.38-41,2009.
[5] Fan weicheng,Liu yi,Weng wenguo,Triangular Framework and "4+1" Methodology for Public
Security Science and Technology ,Science and Technology Review,pp.01, 2009.
46
Chapter 2:
Literature, Art and Cultural Studies
A Study on the Elements and Aesthetic Value of Folk Songs of Yi People

in Yunnan
Wenpei Chen
School of Music and Dance, Qujing Normal University, Qujing, Yunnan, 655011
Keywords: Yunnan; Yi people; Folk song of Yi people; Elements; Aesthetic value
Abstract. Yunnan is the province with most ethnic minorities in China, and the folk musical culture
is rich and colorful with its own characteristics. The number of Yi people living in Chuxiong,
Honghe and Baoshan counties accounts for more than half of the total population of Yi people. Like
other ethnic minorities, it also has a unique ethnic music, dance and musical instruments. Yi ethnic
music with its unique ethnic elements enriches Chinas music, reflecting the Yi peoples life and
work, customs, etiquette, culture and thoughts. As the most important expression form of Yi music,
folk song is an significant part of traditional Chinese folk musical culture. It has both the ethnic
characteristics and the similarities with other ethnic musics. To study the Yi folk song and analyze
its representative music deeply and carefully can make us feel different music styles and aesthetic
values from the unique elements. Meanwhile, people can also enjoy the pure beauty and get internal
peace.
1. Introduction
Yi nationality originated from Southwest Yi ( Southwest minorities) recorded by the Han
history. According to Record of Southwest Yi and other books, the Yi people called themselves
(ni), and because in ancient China the pronunciation of was the same as (Yi), so in
Chinese language it was recorded as (Yi). In 1956, to abolish ethnic discrimination in the old
times, the representatives of the Yi people came to Beijing and met President Mao, who changed
(Yi) to (Yi) after understand the situation and discussion with others. The reason is that in
Chinese (Yi) refers to rude and brutal minorities with derogatory sense, while from the
pictographic meaning (Yi) stands for prosperity with (rice) and (silk) under a house.
The Yi ethnic group is the sixth largest one in China, and people mainly live in Yunnan, Guizhou
and Sichuan provinces in southwest China.Yunnan is the province with most ethnic minorities in
China, and the folk musical culture is rich and colorful with its own characteristics. The number of
Yi people living in Chuxiong, Honghe and Baoshan counties accounts for more than half of the total
population of Yi people. Like other ethnic minorities, it also has a unique ethnic music, dance and
musical instruments. Yi ethnic music with its unique ethnic elements enriches Chinas music,
reflecting the Yi peoples life and work, customs, etiquette, culture and thoughts. As the most
important expression form of Yi music, folk song is an significant part of traditional Chinese folk
musical culture. It has both the ethnic characteristics and the similarities with other ethnic musics.
To study the Yi folk song and analyze its representative music deeply and carefully can make us feel
different music styles and aesthetic values from the unique elements. Meanwhile, people can also
enjoy the pure beauty and get internal peace.
2. Narrative folk songs recording life

Yi ethnic group is one of China's ethnic minorities with a long history and ancient culture. Its own
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
49
language with six dialects belongs to the Yi-language branches of the Tibeto-Burman language
group of the Sino-Tibetan language family. Its music and songs are recording the Yi people's daily
life. The narrative folk songs are those created and sung by Yi people in life and work, and also on
the creation of world, national heroes, history and other themes. There were originally created and
spread orally, and those existing today reflect the collective wisdom and emotional experience of
different people in different periods and different regions. The lyrics involving a wide range of life
are simple and true with unique imagination to arouse our feelings. For example, the Shepherd Song
is about the shepherds work from the first month to the twelfth lunar month; the Tea-picking Song
shows people pick tea; Picking and Wearing Flower presents a wife picks a flower and wears it
when she comes back to her parents home; Luban tells us how a house is built up from the first
month to the twelfth lunar month. With the same tune, several section of lyrics are repeatedly sung,
and in every section the number of words and rhythm are roughly the same, which is a typical
sub-section song especially common in the Yi folk songs. The general structure of these folk songs
is short with narrow range and stable melody, to show the daily life and labor scene with a unique
imagination and rich ethnic life.
The Sani people of the Yi ethnic group have a famous narrative song Ashima, which celebrates
the labor, courage, freedom and rebellious spirit through the struggle between Ashima and Ahei, the
representative of feudal forces. It reflects how people of Sani are against feudal oppression and
pursue freedom and happiness. Ashima is a bright, beautiful, industrious girl of the Sani people of
the Yi ethnic group, the best of the ten million Sani girls. It is a story to some extent with the way of
singing to be interesting and attractive. The study of the cultural origins of the Yi people must be
linked with the narrative songs, from which the Yi folk customs and cultural civilization can be seen.
The narrative folk songs have left rich historical materials for the historians. Yi people love singing
with great talent, and the singing every time and everywhere is a portrayal and records of life. The
folk melodies of Yi people's narrative songs are different with various forms. The melody is
scattered and free, and rhythm is relatively casual. The contents and techniques are full of ethnic
and regional characteristics.
3. Custom songs advocating faith

Various custom songs are created for different ceremonies of Yi people good at singing and dancing,
such as Song of Wine in festivals, Weeping Marriage, and Mourning the Dead. As the saying goes,
Yi people like to drink with cheer. Whether in marrying or funeral and no matter man or woman,
they would drink together an dance in a round hand by hand from night to dawn. Yi drinking, where
the funeral, men and women drink together, hand-wound, Yi songs all night, as a music drama. A
few words clearly portray the simple, solemn, rough and frank Yi people. Due to the influence of
traditional culture, Yi people are very honest, hospital, and courtesy. At home, as long as the guests
come, they would immediately rise to let the guests seat and present tea or wine with hospitality to
respect others. They feel happy and pride when friends come, because others like to communicate
with them and everyone can chat together happily. Sometimes when they have meals happily, they
would hold the wine bowl and sing that I hope you drink more and help yourselves. The song
expresses the friendliness and hospitality of Yi people. In addition to wine songs, there are songs for
marriage and funeral customs which are the most important.
Marriage is an important part of the Yi people's custom, and Weeping Marriage is sung in the
whole process. It is the most impressive, as well as Teasing Bridegrooms Assistant when
bridegroom comes to the bride home and takes away the bride. Weeping Marriage expresses the
feelings of attachment and parents love. The main idea of lyrics is that under the Snow Mountain
foot in Wumeng there are nine daughters in a family eight of which are married. The only daughter
who is not married are waiting for the matchmaker. When the matchmaker comes, she must leave
home. Its so sad that daughters must leave home after married, unless parents only give birth to
sons. In the Teasing Bridegrooms Assistant, the assistant refers to the elder from grooms home
who must be good at singing, dancing and talking. He should be teased by the bride's sisters or
50
friends with the form of sing, mixed with trick, which is very interesting.
Yi funeral is known as the white event, and during the process with singing and dancing, the
song is called Morning the Dead. People sing around the dead, coffin and grave solemnly. The most
representative are the and in Nasudu" branch of the Yi ethnic group in northeastern
Yunnan. Indeed, they refer to the singing and dancing in the sacrifice reflecting profound ancient Yi
culture. means a group of people, means singing and means dancing. Therefore,
refers that a group of people are singing, and refers that a group people are dancing.
Morning the Dead in fact shows Yi people's spirit of loving life, with the original form of music to
express the deep and inner feeling vividly. Yi faith has a strong primitive religious colors,
worshiping many gods and mainly referring to natural worship and ancestor worship. The natural
worship is believing in gods and ghosts. Yi people also believe in nature and worship spirits,
thinking that all things have soul. The ghosts and ghosts control the weal and woe, and life and
death, so only a lot of sacrifice and pray can make them protect ourselves from disaster. The songs
with the themes of custom, rites and sacrifice are the unique elements of Yi folk songs. Through
music, they pray for the harvest of the coming year and the peace of the tribe through rituals and
customs. Such folk songs have been integrated into the Yi national spirit and culture, reflecting their
life status and attitude towards life.
4. Love song
Love is always one of the main themes of literature and art, so music is, as well as Yi folk songs as
well. Yi people sing love song to show their love, and it is rarely sung before the elders or at home,
but usually in the wild or the mountains. With diverse forms, it can be sung by a boy man and lady
or a group of men and ladies. The popular Sending My Lover to Leave, Shepherd's Song, and My
Gambler are beautiful and impressive. For example, the lyrics that at dust when the sparrow chirps
loudly, I am making up in my room happily; after midnight when the sparrow tweets sleepily, I am
dressing up in my room happily. shows a sleepless girl cant wait for the broom to engage. When
the dawn is coming, the matchmakers finally reach girls home. Therefore, this Sparrow Song
presents us that an awaiting girl slowly makes up and dresses up to wait for her engagement and at
the end happily appears before the lover. The Sending my Lover to Leave describes carefully that
the girl reluctantly sends her lover, a young wrangler, to leave away, puts some money in the case
for him, and then tells him not to love others. Daughters Room shows the unique custom of Yi
people in Chuxiong of Yunnan. When a girl is over 16, her parents would build a small thatch
building for her to sleep. Then the young men over 20 may blow beautiful melody with a certain
leaf an sing songs with the girl there, and date with each other. The most representative Yi songs are
four tunes in Yi region of Honghe of Yunnan, which are yam tune, seaweed tune, five mountain tune
and Hui tune. The young men and women of the Yi nationality would sing love songs with each
other through this kind of love songs. It can be said that in the Yi folk songs, the love songs are the
richest ones with easy lyrics and no gorgeous rhetoric and lyricism, but a sincere feeling. From the
aesthetic point of view, the cheerful or sympathetic Yi songs has high aesthetic value with sincere
feelings and beautiful melodies. The beauty of songs is expressed through the singers own feelings
to affect every audience and make them intoxicated in the story.
5. Colorful folk songs and children songs

Folk songs refer to songs sung in the mountains and the wildness field. Yi folk songs are spread
orally. Like a long poem, they record the life and change of Yi people in different times, who
express their inner feelings and emotions of happiness and sadness. The folk songs are like a story
for the listeners. Listen to the song folk songs, is to listen to a complete story. The changing melody
stands for feelings of excitements, happiness or calmness, and description of the real sense in
different moments. There are numerous folk songs to express missing through the moon. For
51
example, the song Enjoy Flowers to Midnight presents a story that a girl is waiting her lover eagerly
from the moon appearing to disappearing, which also shows a kind of black humor that it is not
good to be a nights lover. While the other song Mountain to Mountain and Cliff to Cliff is different,
the beautiful moonlight in it symbolizes the pure love.
The beginning of the folk songs is long from the true sound, then suddenly jump to the treble
with falsetto singing, and at the end prolongs without jump. The rhythm is free, and melody jumps
frequently, with roughness, changing and originality, deserving appreciation. The folk songs are rich
in content and tunes are varied by region, mainly including labor folk songs such as farming songs,
the widely spread bitter love songs, and ballad that shows sense of seasonal changes, missing their
loved ones and feelings of sadness.
Because Yi children learn to dance and sing after birth, they are influence and enlightened by the
elders, so as a result a lot of wonderful children's songs appear. Yi children's song is a kind of verbal
short song created by the Yi people in the long-term work and life according to children's
understanding, psychological characteristics and interests. There are three kinds of Yi children's
songs. The first is enlightenment songs, to sing the general knowledge of enlightenment. The
second is children's song, which takes the sun, moon and birds and beasts as enlightenment
knowledge, with "Ah-ho", "ah yi" and other functional words at the beginning. The tune is fixed
and music section is regular, with the short lyrics easy to be sung. music catchy. The third is to coax
kids with enlightening real word, but there are the functional words in the whole song. Yi children's
songs is very interesting and funny with simple content, vivid language, lively and concise tunes,
and bright rhythm, full of taste of mountain plateau.
Art comes from life, and aesthetics is the experience of life. Music is the art of life sublimation,
and its composition comes from the elements of daily life, impacted by the living environment. A
nation's music culture is bound to integrate into their living environment, and reflects all aspects of
work and life. Yi ethnic music with its unique ethnic features enriches the elements of music and
forms its own music art. Music is peoples emotional expression, and for the Yi people it is their
artistic mean to record life, advocate faith, and pray for a happy life with great national appeal and
artistic appeal, so that we can experience a special beauty and inner affection from the unique
characteristics of the Yi folk songs.
References
[1] Baidu baike -Yi Ethnic Group. http://baike.baidu.com/
[2] Website of Chuxiong in Yunnan. http://www.chuxiong.cn/mzwhpd/mzgw/
[3] Shucai, Li. An Analysis of the Features of Yi Folk Songs in Luoping County [J]. National Music,
2014.
[4] Zhang Xingrong. The Original National Music of Yunnan Province [M]. Central Conservatory
of Music Press, 2006.
[5] Li Biao. An Introduction of Music and Dance Drama of Yi People in Chuxiong [M].Yunnan
People's Publishing House, 2011.
[6] The Editorial Office of Yunnan Folk Literature. The Folk Songs Collective of the Yi People [M].
The Nationalities Publishing House of Yunnan, 1986.
[7] Cultural Bureau of Yi Autonomous Prefecture in Yunnan Chuxiong. National Folk Music in
Yunnan Chuxiong [M]. Yunnan People's Publishing House, 1982.
52
Changes and Transformation of Musical Culture of Tang and Song

Dynasties in Chinese Musical History
Wenpei Chen
School of Music and Dance, Qujing Normal University, Qujing, Yunnan, 655011
Keywords: Music of Tang; Yan music; Ya music; Music of Song; Hu music
Abstract. Chinese traditional national musics are divided into folk music, court music and religious
music according to Chinese music history. With the constant change of the times, China's national
music continues to absorb the music of all ethnic minorities, which is particularly evident in the
Tang and Song dynasties. In historical materials, about the music culture transformation of Tang
and Song Dynasties, the gradual music mechanism and style at that time are explored, besides
absorbing foreign music. And national music changes from the court to the folk, which is the most
obvious music transformation during the Tang and Song. This change and transformation make our
national music as a unique musical culture. To analyze the music culture of Tang and Song, we can
understand the basic elements and connotation of Chinese music history to a great extent.
1. Changes of traditional music

In the five thousand years of Chinese culture, music is of great significance. Whether it is the
traditional Six Classics which are Odes, Records, Rites, Changes, Spring and Autumn Annals,
and Music, or the Six Skills of Rites of Zhou, which are etiquette, music, archery, equestrianism,
calligraphy and arithmetic, music is considered as one of the most important and indispensable
parts , to which each dynasty has attached much importance.
Chinese traditional national musics are divided into folk music, court music and religious music
according to Chinese music historiography. These traditional folk music are rooted in the lives of
the masses. In ancient times, music is composed of folk songs produced in people's lives. As the
time changes, music as a culture becomes rulers entertainment. In the Western Zhou Dynasty, the
court set up a special music institution responsible for collecting folk music. First, public opinion
can be investigated through folk music; second, folk music can be as a kind of court entertainment.
China's earliest poetry collection "Book of Odes" includes a large number of folk music.
In ancient court, music is not only for entertainment, but also to worship ancestors. This music
sounds more solemn than folk music with lyrics memorizing and praise ancestors. From the
Western Zhou Dynasty, China's feudal dynasty had set the corresponding music institution, which
reached the peak in the Tang Dynasty. The court set up music institutions mainly for the court
service, and before the Tang Dynasty, song and dance are main entertainment from the court to the
folk. At the same time, music is also the way to cultivate the sentiment of the literati. Along with the
prevalence of Buddhism, Chinese religious musics are divided into native Taoist music and foreign
Buddhist music. And music is main part of religious activities. Therefore, although different
dynasties set different officials, there was rites department, which was responsible for ceremonies
and sacrifices that were about music management. With the development of society, music changes
from the court into folk music, forming a unique musical culture in China's national musics.
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016

53
2. Musical culture of tang dynasty
In Chinese history and culture, combination of poetry and music rhythm is common, and the
"singing poetry" is unique in the Tang Dynasty. Lvshi (a regulated verse with 8 lines) and Jueju (a
regulated verse with 4 lines) are typical poetry culture formed in the Tang Dynasty, in which the
music elements are integrated. The changing tone and harmonious rhyme endow the Tang Dynasty
poetry a unique musical beauty, and the poets mostly created following the music score, making the
poem a beautiful music. The rhyme of Tang poetry is more strict than the ancient poem with the
rhyme of every sentence to the end, to bring harmony. Singing is to strengthen the poetic contrast
and the iambic change of voice and combine the tone of language and beautiful melody to create a
unique charm and musical beauty. A good singing work is an excellent song. Singing poetry in Tang
poetry is the unique art of music with our national long musical culture background.
In Tang Dynasty the music culture was paid great attention to the extreme. Music is for the sage
to cultivate his taste. Humankind has his own personality and emotions that can be expressed
through poetry. The emperor adjusted it with tune and eulogized it with poetry combining with bell
drum and string tube, to rebuild ones spirit and scrape ones sadness. If it is applied to the country,
the court is orderly; if to the world, the gods come; if to the politicians, the emperor and ministers
coordinate well; if to the battle, the warriors would be brave. Based on this, the ruling class at all
times of the Tang Dynasty attached great importance to music in the cultural life. During the period
of Wude, Gaozu let Xiaosun revise Ya music, and performed it in June in the second year of
Zhenguan time. At that time, Du Yan, the official who monitored other officials, said that the former
dynasty died because of music entertainment. For example, Charming Flower in the Garden
symbolizes fall of Chen Dynasty and Song of Lovers stands for fall of Qi Dynasty. Therefore, if all
people feel sad and cried due to one music, it is called music leading to a falling dynasty. The
emperor Tang Taizong said that he didnt agree with Du because music can bring different feeling to
people. For the happy, the music is happy; for the sad, the music is sad. People in falling countries
must suffer from misery, so they feel sad when listening to the music. But for the happy, they cannot
feel sad when listening to the same one. Now if the Flower and Lover were played for Du, he must
be not sad as those people. The minister Wei Zheng also said in ancient time rites was not only to
give present and music not only referred to drum, so the essence of music is to bring harmony
among people. In Tang Dynasty, music was widely used in the court's internal and external affairs,
with different music and performance in different occasions, and affairs.
Tang Dynasty not only is a dynasty of poetry, but also has unprecedented music. In the emperor
Tang Taizong era, there was the imperial Ten Kinds of Musics, which reflects music and dance of
the Tang Dynasty. In the emperor Tang Minghuang era, he modified Zuobu performance and Libu
performance in the 10 musics, which are two kinds of court musics. For the music institutions, he
added the training center from one to five. There were different functions between Taichangsi (a
government department to manage rites) and the training center, with the former responsible for Ya
music, etiquette and worship and the latter responsible for folk music to entertain. He also set up a
new institutionpear garden, specialized in training musicians responsible for the court's music,
dance and drama performances.
The development of Tang music culture can be attributed to the two emperors who like music.
Emperor Tang Taizong not only liked music, but also could compose music and dance, and the great
Yan music about Qin Wang Victory is directed by him; Emperor Tang Minghuang according to the
Brahman Song created the dance of Beautiful Attire of Colorful Feathers, becoming a classic song
by his favorite concubine Yang Guifei. The popular Hu music is another feature of Tang Dynasty
music. The so-called Hu music refers to the surrounding minority music. In the ten musics in Tang
Dynasty, only performances of Yanyue, Qingshang and Xiliang are traditional Chinese Yan Music,
while Indian, Korean, Qiuci, Anguo, Gaochang, Shule, and Kangguo are from abroad. The clothing
of dancers and musicians were also from abroad when performing in the court, which means that
when performing Indian or Korean, they dressed like Indian or Korean. A variety of Hu musics, like
Hu Xuan dance and Green Waist dance were widely popular in the Tang court, and even Hu clothes
54
and make-up were also popular. This mainly related to the Tang's national strength, so that the
neighboring countries had come to worship, as well as their own music; Tang Dynasty is also a
political enlightened dynasty, with a flourishing mind, to absorb the surrounding culture. Another
important feature of the Tang music is the court music as mainstream, with Ya music and Yan music
belonging to the court music, that is, aristocratic music culture. It can be seen from the Bai Juyis
Lute in which the women playing lute in Changan for the aristocratic class, and even beside
Xunyang River the persons who could appreciate it are the officials such as Bai Juyi. To the middle
and later periods of Tang Dynasty, the folk music began to appear gradually.
3. Musical culture of song dynasty

The Song Dynasty was the period when the folk culture flourished in the feudal times. Especially, a
large number of minority cultures were introduced in Tang Dynasty, great influencing music in the
Central Plains. It is clear that the cultural exchange between the inside and the outside played an
important role in promoting the development of music, which made great music of the Song
Dynasty. Before the Song Dynasty court music was common in the history of Chinese music, but
after the Song Dynasty the folk music was developing fast. Folk music had gradually become the
main form of music in this period, and kinds of music appeared, entertainment places changed from
the court to "Washe" or "Goulan" which refer to brothel. Song Ci that is kind of verse in Song
dynasty is very popular, and this is a new form of folk music. Social music life is very rich, with
folk music, song and dance music, rap music, national instrumental music, and opera music that is
as its highest form. The rap and opera in folk music were formed. This is an active period in
Chinese traditional music history.
Compared with the Tang Dynasty, the Song Dynasty performed well politically, but not as strong
as the Tang Dynasty. From the Northern Song Dynasty, the surrounding Liao, Xixia cast greedy
eyes on the Central Plains, making the Northern Song government wary of being invaded by other
countries. The Tang Dynasty emphasized music to harmonize people, and Ya music should be
magnificent to highlight the country's power and political harmony, so music is to adjust the mood.
The Song Dynasty 's music is subtle, introverted, dignified, and secular - oriented, emphasizing the
function of music rationality and nationalism. Tang Dynasty music is to absorb the surrounding
ethnic music, while the Song Dynasty is mainly based on conservation, combining with the
traditional Confucianism, to reflect the relationship between the monarch and his people.
Tang Dynasty music is aristocratic music, and Song music changes from the court to the folk,
divided into two major categoriesfolk music and literati music. The mainstream of Song folk
music is the public music, while Tang's Ten Kinds of Musics, Qin Wang Victory, and Beautiful
Attire of Colorful Feathers are performed in the court, so that the general public is difficult to
appreciate them. But in the Song Dynasty, there are numerous whorehouse in the capital of
Bianliang, where every day music and dance, theater performances, and rap art are performed for
ordinary people. The literati music is mainly presented as the form of Ci which is a kind of lyrics
for singing. The same Cipai has the same melody, and Ci is created according to corresponding
Cipai to be sung. The famous Green Waist is to entertain nobles in Tang Dynasty, but the famous
poetry Liu Yongs Ci can be enjoyed by all people in Song Dynasty. It can be seen How popular the
folk music is at that time. This shows that folk songs in the Song Dynasty not only continues the
trend of the Tang Dynasty, but also has its own unique charm.
4. Changes and transformation of musical culture of tang and song dynasties

The Tang and Song dynasties play great role in our history, especially with their cultures. The
poems of the Tang Dynasty and Ci poems of the Song Dynasty are milestones in the history of
Chinese civilization, and the birth of these two cultures is inseparable with the development of
country and music at that time. Tang Dynasty music is grand and good at absorbing the surrounding
ethnic music, with the court music as mainstream, while the Song Dynasty is implicit and dignified
55
combining with the traditional Confucianism, with the folk music as mainstream. This change is
related to the respective social environment. The powerful Tang Dynasty attracted foreign music
and absorbed them. Meanwhile, the opening of the Tang Dynasty made the surrounding small
countries continue to send ambassadors, and the grand Yan music is suitable to show Tangs
strength when the foreign ambassadors came.
Tang dynasty was stronger than the Song dynasty, but the latters did well politically, so that with
high economic growth, industry and commerce had been developed and the people could live a
good life. Therefore, the civilian with high consumption promoted folk music development. In Song
Dynasty, except folk music, even the court sports of Tang, Cuju, also went to the public. Movable
type printing made publishing develop fast, and literati music could be enjoyed by the masses, to
promote the development of folk music.
Tang court music was the cultural center, and the strong centralization and national strength
made the court music achieve the highest station. Because musical culture worked for the court,
literati music and folk music did not become the mainstream music, and in the music pattern Yan
music developed positively. The music and cultural center in Song Dynasty was the city, and
compared with the court music recession, folk music had become the mainstream of society as the
rise of the public class. The public's aesthetic orientation determined the weakness and
transformation of large-scale singing and dancing music, and then the small folk art with the story
had gradually become the aesthetic trend of the people. Thus there is the difference between the two
ages. Tang Dynasty in the history of Chinese culture put court music, especially the Yan music and
music and dance performance to the extreme. The Song music is a kind of transformation for the
Tang Dynasty, because it absorbed the music expression popular in the Tang Dynasty and integrated
it into the new music to make its folk music develop rapidly. made a leaping development. Its music
and the Tang court music is equally important historically. As the two blooming times in our feudal
society, the change and transformation of the musical culture make our national music culture
unique and creative.
References
[1] Bai Hongxiu. A Study of the Court Music in the Tang Dynasty [D]. Yangzhou University, 2004.
[2] Zheng Yueping. The Decline of Song Court Music and Rise of Folk Music [J]. Chinese Culture,
2004(03).
[3] Xu Xiaoming. The Transition of Chinese Music Art in Song Dynasty [J]. People's Music,
2004(06).
[4] Cao Xiaoxia. Thoughts on the Musical Cultural Differences between the Tang and the Song
Dynasties [J]. Time Education, 2010(08).
[5] Niu Nana. The Main Features of Music in Tang and Song Dynasties [J]. Journal of Zhengzhou
Institute of Aeronautical Industry Management, 2008.
56
Analysis of Music Theory and SolfeggioIntegrating Teaching Function

in the Major of Musicology in Normal Universities
Wenpei Chen
School of Music and Dance, Qujing Normal University Qujing Yunnan, 655011
Keywords: Musicology in Normal universities; Teaching function; Music theory; Solfeggio;

Integration; Permeability; Guidance
Abstract. in the professional course structure of musicology in normal universities, the basic theory
of music has occupied an important position in the teaching. And as two separate courses, the
Basic Music Theory and Solfeggio have been mutually dependent. In recent years, after
repeated research, the Ministry of Education has planned outlines and programs, integrating the
Basic Music Theory and Solfeggio into one course - Music Theory and Solfeggio. The study
of this course, to a large extent, has a direct impact on the students' basic musical qualities and
comprehensive aesthetic ability. As far as its teaching function is concerned, on one hand,Music
Theory and Solfeggiois to systematically study basic theoretical knowledge of music, and to train
students basic ability of music; on the other hand, the infiltration and guidance of course learning
of other professional courses has far-reaching significance in cultivating and expanding the
students comprehensive qualities.
In the professional course structure of musicology in normal universities, the basic theory of music
has occupied an important position in the teaching. And as two separate courses, the Basic Music
Theory and Solfeggio have been mutually dependent. As the most important professional basic
courses of music education in normal universities, they are the basic requirements which need to be
met by all music learners. For students in the major of music, their importance is self-evident. They
are mutually dependent, and inherently connected. The ntegration of Basic Music Theory and
Solfeggio into one course is to optimize them through the integration of course structure, so as to
construct new teaching methods. It emphasizes the learning of basic music theory and strengthening
the training of solfeggio as well. It masters, uses and consolidates the music knowledge in the
perceptual experience, and the learning of basic music theory is driven by solfeggio. Only in this
way can Basic Music Theory and Solfeggio promote each other, and become an organic whole.
Since 2003, the Ministry of Education has organized the experts for the preparation and research,
and formally introduced the "Undergraduate Professional Guidance Programs and Outlines in
National Higher Education Musicology (Teacher Education)" in 2006. The "Programs and the
Outline" redefined and integrated the course nature ofMusic Theory and Solfeggio. The
"Programs and the Outline" further clarified the training objectives and talents specifications of
musicology (Teacher Education) in normal universities, which is of great guiding significance for
the construction of professional curriculum system and the implementation of main courses[1] . Base
on the above, The "Programs and the Outline" integrated "Music Theory and Solfeggio "to be an
important part of the music theory course of undergraduates' musicology (Teacher Education),
which occupies an important position in the teaching of music theory. Taking the basic skills of
solfeggio as the starting point, based on the feeling for music sound, it penetrated basic knowledge
of music into it, sounds it, and reproduced their various types of audio content with acoustics. It
interpreted and expressed the basic concepts, content, categories, characteristics through playing,
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
57
singing, reading, listening, and writing, and guided students to obtain the most comprehensive
music basic knowledge only with mouth. It also improved the basic quality and comprehensive
ability of music, laying the foundation for further studying music theory, vocal music, musical
instrument, composition, command[1]. These are the basic teaching functions of music theory, and it
can be further analyzed from the following two aspects by combining with the course.
Firstly
As a compulsory course of undergraduate majors in normal universities, the teaching function value
of Music Theory and Solfeggiohas the organic combination characteristics of the basic theoretical
knowledge (music theory) and the basic skills training (solfeggio). It also has the function of
systematically learning the basic theoretical knowledge of music, training music perception and
memory, enhancing the appreciation of music and expanding the students basic music ability.
Music Theory and Solfeggioorganically integrated teaching and consolidating music vocabulary,
the learning and training of music performance elements, and strengthened the combination of the
related subjects with music such as music appreciation, vocal music, instrumental music, and other
cultures, therefore, better expanding lateral thinking of students, promoting the potential of music
and comprehensive thinking ability, and thus achieving the goal of education as well.
In the context of the pilot work of the Ministry of Education, in order to implement the spirit of
the "Program and the Outline", it is necessary to revise the talent training program. Under the
guidance of the "Program and the Outline" of the Ministry of Education, in recent years, the School
of Music and Dance of Qujing Normal University has integrated the "Basic Music Theory" and
"Solfeggio" into a comprehensive course of "Music Theory and Solfeggio". Through the teaching,
it is found that the integrated course is more conducive to students mastery and understanding of
basic knowledge and basic skills.
Problems existing in the practice teaching process are as follow: (a) the Music Theory belongs
to the theoretical course in the traditional teaching, it mainly studies the basic theoretical knowledge
of music. It is found in teaching the integrated "Music Theory and Solfeggio" that the teaching
content and time arrangement, the traditional knowledge structure have been adjusted, such
adjustment resulted in puzzle among students of the local colleges and universities, most of them
have some cognition about music in the training phase for college entrance examination, they felt
boring in learning the basic theoretical knowledge over and over again after entering universities.
As a result, the effect of classroom teaching is not ideal; as for solfeggio, due to the differences in
content and degree of students pre-exam training, for the students of musicology major in general
local universities, the teacher should not only teach them the pitch and rhythm, but also should
explain the knowledge of the music theory for students mastery. It is most likely that the
improvement of students comprehensive quality as a whole is not obvious, there is a certain
distance away from our teaching goal. (b) our university is located in the west of China which is an
underdeveloped area, students foundation is uneven, part of students recruited in our university
didnt take part in the test of music theory and solfeggio in the college entrance exam, so the
students have poor foundation, leading to some students not keeping up with teaching progress. In
addition, influenced by social phenomenon and culture, some students tend to "go overboard on one
or some subjects", they spend much time in studying the skills of vocal and instrumental music, and
ignore the study of basic theory of "Music Theory and Solfeggio". Thus, they cannot improve their
own music basic ability and comprehensive ability. This phenomenon is quite obvious in the usual
test, the performances and basic skill competition for musicology undergraduates in normal
universities in recent years. Good students have a good grasp of music works in the competition,
while some students will get a poor performance in singing, playing, and music accomplishment.
Combining with teaching practice, the reason investigated is that they have a weak grasp of basic
music theories, their understanding of music works lacks perceptual and rational thinking and they
cannot accurately and effectively capture the comprehensive thinking ability of the artistic image,
resulting in their strength not matching their ambitions. Such behavior of "emphasizing the theory
58
and ignoring the skills" can not achieve "emphasizing the basic, enjoying the format, and revising
the decoration"[2]. and it will be bound to hinder the development of students' own music subject
consciousness and the improvement of comprehensive ability.
For these phenomena, the teachers who teach music basic theories, in particular, should
reasonably and effectively guide and stimulate the students to recognize music basic theory, they
should guide and strengthen "Music Theory and Solfeggio" and pay much attention to the basic
theoretical knowledge and basic skills training for students, such as to imitation singing,
composition singing, melody, and rhythm discrimination. They should instruct students with music
theory knowledge so as to enable them to distinguish the modal, tonal, the color, improve the
students basic ability, and cultivate students' interest in learning music theory and solfeggio.
"Music Theory and Solfeggio" is an important index for music theory. On the whole, music
theory is the scientific summary of the music and music culture in the practice obtained by people
in the long-term practice of music. In the form, it has formed different branch systems of the subject.
Music theory is divided into two categories, technical theory and ideology theory. For a long time,
the musicology in normal universities is defined as a compulsory theory course, it bases on the
basic technical theories, such as basic music theory and solfeggio, acoustics, song composition,
accompaniment, music works appreciation complemented with the ideological theory, such as
music historiography (home and abroad), music aesthetics, introduction to art, etc. As college
students in musicology, they should systematically and fully learn the basic theoretical knowledge,
especially the "Music Theory and Solfeggio", only after constant accumulation and consolidation,
can they improve their own music taste and expand their music analysis ability[3].
Secondly
As a very important basic theory course of musicology in normal universities, the teaching function
of the "Music Theory and Solfeggio" is expressed in the mutual penetration of other music theory
course and professional skills, it is the reappearance of music theory and professional skills in
practice."Music Theory and Solfeggio" penetrates and guides the learning of other professional skill
courses, which is of far-reaching significance tp cultivate and enhance the comprehensive quality of
students.
The permeability of this function is to apply the knowledge taught organically into other music
teachings, guides and stimulates the students to gradually convert the theoretical knowledge in the
books into practical operation ability in the study and practice, that is the teaching principles and
normal characteristics of "rationality being applied to perception". Good grasp of the function is of
far-reaching significance and importance not only in improving the students' ability of knowledge
application, but also developing the music potential, expanding a variety of music abilities. In
recent years, as the teaching reforms in national and local universities, the comprehensiveness and
rationality of musicology in normal universities has new request, it is also the inevitable trend for
the development of musicology in university music majors, which is of great importance for
teaching reforms of each course of musicology in normal universities. The society more and more
likes "composite" talents, and the cultivating the teachers who "master many skills while
specializing in one skill" and being engaged in basic music education, or higher music education
has become one part of the education and teaching reforms in musicology of normal universities.
This requires the students in musicology should grasp more comprehensive, popular music theory
knowledge and professional skills. So, in the integration of teaching process of "Music Theory and
Solfeggio", it is inevitable to strengthen mutual guidance and penetration of the rest of the music
curriculum because it is also an important part of the course teaching reforms in the musicology of
"Music Theory and Solfeggio" in universities .
Permeability teaching is a worthy of inquiry and thought-provoking teaching problem. It is
imperceptible penetration through the theoretical knowledge in the skills practice so as to promote
the formation of skills, and it is gradually converted in the forms of action or psychological
activities into music ability with a wide range of the migration role. Because the music ability is
59
formed in the process of mastering knowledge and skills, it is based on knowledge and skills, and is
expressed in knowledge and skills. And dynamic knowledge (penetration)plays a direct and long
role in the formation of the music ability.
The guidance of teaching function is connected with the knowledge structure characteristics of
"Music Theory and Solfeggio". Each unit of this course consists of "perception and performance"
and "theory and acoustic analysis". "Perception and performance" strengthens the mastery of music
basic theory knowledge and skills through cognition and expression of rhythm and melody in the
teaching link. The practice-based solfeggio teaching is summarized from the perspective of
"perception and performance"; "Theory and acoustic analysis" is summarized in the aspect of basic
music theory by the combination of auditory analysis, it internalizes and deepens the music
elements and the knowledge. It focuses on the teaching and summarizing the theoretical
knowledge-- music theory, and based on the auditory experience of theoretical basis so as to avoid
the concept teaching[of music theory teaching in the past [4]. The learning and training of "Music
Theory and Solfeggio" is involved with theoretical knowledge, such as high value, speed, rhythm,
beat, interval, chord, tune, tonality, harmony, song style at any time. By combining the conscious
penetration of theory, teachers enable students to obtain the rational guidance and enlightenment so
as to avoid arbitrariness, superficialness, and blindness of perceptual cognition, and so that the
knowledge skills of "Music Theory and Solfeggio" can form rational characteristic and
standardization, the students can establish a good music sense and thinking, thus, promoting the
formation and development of auditory, visual ability.The penetration of "Introduction to National
Music" in vocal music and musical instrument teaching can help students consciously understand
and explore the traditional culture of national music, and is conducive to the formation of national
music singing and dance, and performance style; the penetration of music style, song practices,
music aesthetics, music appreciation, music history and other knowledge will enable students to
improve their application quality and effectiveness of various skills in a wide range of music
practices, and to create the conditions for the development of musical talent[3]. Therefore, it is
needed for the teachers to strengthen their study and further study of music theory, purposefully
explore the theory-penetrated teaching methods, and implement the on purpose so as to
continuously improve the teaching effectiveness and quality of talents.
The singing and playing based on the basic music theory and the music quality will consciously
mobilize their various elements, make rational thinking and analysis of the works, accurately grasp
the theme ideas and music image such as from the times background of the works , works style,
works tone, works tonality, melody features, melody development, harmony by organically
combination. Only in this way can students be of clear thinking, well-conceived, broad vision, and
full of imagination and artistic expression. In the practice of melody and rhythm , it is needed to be
guided with knowledge such as rhythm, beat, sound value, intensity; in the various courses of
musicology such as vocal music, instrumental music, chorus and other, it is needed to be guided
with the combination of basic music theory, harmony, appreciation and even tone, polyphony.
Otherwise, the wonderful music full of beauty and emotion expressed by music will become a
phenomenon, dogmatic and even mechanized mediocre sound. As a saying goes: success comes
from independent contemplation and is abandoned in the laughter. There are many students and
teachers who divorce the theory from reality, and ignore the guiding role of the theory in the
musicology of normal universities, which is in conducive to the development and growth of
students, which is also contrary to the law of music teaching and teaching purpose.
The teaching reform of musicology and the integration of teaching materials in normal
universities are conducive to promoting the training objectives and talents specifications of music
major in normal universities. Teaching practice shows that it is difficult for students to make
achievements who have a loose basic structure of professional knowledge, lack the comprehensive
theoretical knowledge accumulation and effective guidance and penetration in the process of
learning music even after they get some skills. Obviously, for the teaching reform of musicology in
normal universities, it is urgently needed to strengthen the guidance and penetration of theoretical
60
knowledge in the theory teaching and skills teaching. The study and analysis of the course Music
Theory and Solfeggio in normal universities can better cultivate and improve the students' basic
musical ability and comprehensive quality, meanwhile, it is also very important for the teaching.
References
[1] Chen Yaxian. "Music Theory and Solfeggio"[M].Shanghai. Shanghai Music Publishing House,
2007.
[2] Edited by the Department of Psychology, Beijing Education and Administration College,
Educational Psychology Lectures [M]. Beijing. Beijing Knowledge Publishing House,
1983:67.125.
[3] Chen Wenpei, Yi Xiping. Analysis of the Teaching Function of Music Theory in Normal
Universities [J].Music Creation. 2009(2):136.137.
[4] Chen Yaxian. Theory and Method of "Music Theory and Solfeggio" Teaching Design in Normal
Universities[J]. Journal of Nanjing Institute of Arts. Music and Performance Edition. 2009(2).
61
On Anna of the Five Towns from the Perspective of Intertextuality

Chunming Li
School of Foreign Languages, Zhaoqing University, Guangdong, China
596323383@qq.com
Keywords: Anna of the Five Towns; Intertextuality; Naturalism; Social Darwinism
Abstract. Intertextuality in the broad sense represented by Kristeva encompasses the cultural,
historical, social or political discourses, codes or texts that an artist may adopt deliberately or that
implicitly exist within a work. From this angle, Anna of the Five Towns have two kinds of intertexts:
cultural intertextNaturalism and social intertextSocial Darwinism, which makes the novel both
readable and writable.
1. Introduction
Arnold Bennett was an English novelist, as well as a playwright, essayist and literary critic. He does
undoubtedly seem the major English author of his time. His serious Five Towns novels probably
stand next to Hardys novels in merit in the depiction of a specific provincial life. Anna of the Five
Towns is a powerful and absorbing novel. The plot is simple, but it contains a surprising ending.
The characters are wonderfully true to life and are described with the hand of a master. The
outstanding merit of the story is its intimate understanding of the life of the Five Towns. Not long
after the publication of the novel, many reviews have been written on the novel:
Anna of the Five Towns, by Arnold Bennett, is the work of a capable and conscientious artist,
one who has here recorded some life in the Potteries with unusual insight and fidelity to nature. [1]
The plot soon seizes the attention and holds it, and some of the phases of local life and the
local colour are admirably portrayed and neatly hit off; but the real strength of the book lies in its
study of character. [1]
2. Julia Kristevas intertextuality in its broad sense

The term intertextuality is created and introduced by French critics Julia Kristeva in her Le mot,
le dialogue, le roman published in the magazine Tel Quel in 1966. Kristeva is the most important
representative of broad intertextuality, who points out that intertextuality refers to the relationship
between any text and the total knowledge of this given text, code and signifying practice, and that
all these knowledge, code and signifying practice forms a potentially infinite network.
Kristeva insists that text should not be separated from the larger cultural or social textuality in
which they are created. Therefore, all texts consist of the ideological structures and struggles
expressed in society through discourse. She thinks there are two dimensions of the dynamic literary
word: a horizontal dimension and a vertical dimension. In the horizontal dimension the word in the
text belongs to both writing subject and addressee [2] and in the vertical dimension the word in
the text is oriented toward an anterior or synchronic literary corpus [2]. She thinks that every text
builds itself as a mosaic of quotations and every text is absorption and transformation of another
text [3]. Her semiotic approach makes effort to study the text as a textual arrangement of elements
that possesses a double meaning: the meaning in the text itself and the meaning what she calls the
historical and social text. In her Desire in Language, she actually defines the text as a permutation
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
62
of texts, an intertextuality: in the space of a given text, given utterances, taken from other texts,
intersect and neutralize one another [2]. Thus, texts are understood and evaluated as the entity
open to cultural environment and historical outside and the outside embodies in the inside of
texts.
3. Cultural intertext naturalism

Emerging first in late 19th century France, Naturalism then spreads to other European countries and
other parts of the world. A group of writers aiming to eradicate social evils through objective
observation and faithful description of human experience come into being, resulting from complex
factors including an increasing interest in scientific experimentation, widespread economic disparity
and political repression and so on. It focuses on human beings in the real environment. Its ideal is to
set up a literary situation much like an experiment set up by scientists and record accurately and
dispassionately what happens with the evolvement of the situation. The outcome of it is ideally
objective. Zola is universally recognized as the typical representative of Naturalism. Zola insists
that the experimental method should be applied to the study of nature and man. It is natural that
naturalist novel is defined as the depiction of sordid events on the basis of industrious
documentation and reflects the deterministic role of natural and environmental power in the
movement of events. Applying to literary theories of determinism, naturalistic writers are
accustomed to portray characters as helpless victim, subject to hereditary and environmental forces
beyond their control and comprehension. The most distinct cultural intertext within the text is
Naturalism.
3.1 Environmental determinism
One of Bennetts typical subjects in the text is deterministic tendency. The heroine Anna in the
novel is struggling with social environment but she cant change her fate and finally become a
helpless victim.
In Victorian age, dutiful wife and loving mother is highly praised in middle class family. Men
and women play different roles in society and shoulder different responsibilities. Women should do
all the housework and take good care of children, while men should go out to make money, which
leads to womens dependence on men in economy. Mens dominance on women is also supported
by law. In fact, women are slaves of men because they have to obey husbands all their lives. Double
standards on sexual moral are employed by men and women. The adultery of a woman is
unforgivable because this kind of behavior disrupts moral principles and violates husbands
possession of his wife. By contrast, the adultery of man is understandable because it is a weak point
of man which cant do any harm to marriage. Another main characteristicsj on spirit and belief in
Victorian age is obedient and submissive to father in family. Fathers will is superior and he has
absolute power on children and his wife. Although Bursley is one of the earliest places to develop
industry, old beliefs are still rooted in townspeoples thought. The heroine Anna lives in this small
and remote town and she also cant get rid of these old conventions. She does all the housework
including cooking, cleaning, buying necessities and caring for her little sister and performs her
duties without any complaint. She has formed a good habit of thrifty under the influence of her
miserly father for years. All these qualities are in conformity with Victorian standard for a good
woman and perhaps one of the reasons that Mynors chooses her as wife. Everything Anna does
must be permitted by her father, otherwise, he will become angry and keep silent for several days.
Anna never feels paternal love from her dominant father but often suffers from his surly and
terrorizing ferocity for her father has never been happy at home. Such treatment of his daughters to
him is just like eating. Tellwright never considers his attitude towards the women of his family is
abnormal. In his opinion the women of a household are the natural victims of their master who has
an unquestionable right over the happiness and the peace of defenseless souls under him. He
belongs to the powerful class of house tyrants, the backbone of British nation. Anna herself knows
63
clearly that her fathers position is always impregnable to her and no moral force, no consciousness
of right can overthrow the authorities, which she has to absolutely submit to all her life.
Henry Mynors is the most superior man in the town who can do everything well from arranging
and modernizing his factory to organizing a revival. He woos Anna publicly, able to command her
boundless admiration and waken the hunger or illusion of love but Anna does really feel for simple
and sheepish Willie Price satisfying love which she perceives only when she bids him farewell to
Australia. She has saved him from disaster by the boldest act of her life, an act of opposition to her
tyrannous father, and she feels for him something of a mothers love. A womans real love for a
man has always in it a touch of the mother, for her heart vibrates on a whole. As their eyes met in
an intense and painful gaze to her, at least, it was revealed that they were lovers. [4] Though the
small town develops its industry very early, the traditional value and thought is deeply rooted and
continues to function in the society. Living in such environment, Anna has no alternative but to
perform her dutyto be a good wife of Henry Mynors, even if she clearly knows in her mind the
marriage is lacking in love. She has to do what she aught to, not what she wants to because she has
no enough courage to fight against the society in which she was born and brought up. The tragedy
of Annas fate is determined by the environment.
3.2 Objective narrative technique
The naturalistic novel is simply an inquiry into nature, beings and things. Novelists give facts and
details through documentary method. The novelist doesnt intervene in depicting reality because it
is sufficient to present facts without modification or pruning. The task of novelists is simply taking
the life study of a person or a group of persons, whose actions are faithfully portrayed. The
conclusion is nothing more than a natural and inevitable consequence. The work becomes a report
and it has but the merit of exact observation, of more or less profound penetration and analysis is of
the logical connection of facts. These writing principles are strictly observed by Arnold Bennett
when creating Anna of the Five Towns. It is a record of what may be perceived without much
comment. He unfolds a truthful local picture before readers. The most special objective narrative
technique adopted by Bennett in the novel is changing points of view instead of a single persons
point of view with the purpose of seeing life impassively, neither praising or blaming, just showing
what happens. Of all English novelists, Bennett comes the nearest to sheer objectivity.
In Anna of the Five Towns, Bennett uses different points of view including Annas point of view,
Agnes point of view, Tellwrights point of view, townspeoples point of view and narrators point
of view to weaken the voice of author-narrator, thereby, enhance the objectivity and truthfulness of
the novel. The adoption of this kind of technique is compatible with the non-subjective principle of
the naturalism which Bennett follows. The purpose of Bennett is to refuse to take responsibility for
the thoughts, feelings, words and behaviors of the characters, producing an effect that all characters
in the novel are true to life and they are not controlled by him.
William Price first appears in the novel from Agnes point of view, His eyes, so kind and
sincere, and that mysterious, delicious, inexpressible something which dwelt behind his eyes; these
constituted an ideal for her [4]. When Anna goes to the Prices works asking for rent, her feeling is
somewhat similar to Agnes, For her there was nothing in his blue eyes but simplicity and good
intentions. [4] The basic relations between Anna and William expose also from Annas point of
view, Beside him she felt old, sagacious, crafty; it seemed to her that someone ought to shield that
transparent and confiding soul from his father and the intriguing world. [4] In such way, Bennett
conveys Annas sympathy to William to readers who have an impression that Annas attitude is
nave caused by kindness. The authenticity of Williams appearance is strengthened because
Bennett takes two persons perspectives, a child, Agnes, and an adult, Anna, instead of one persons
point of view. Thus, subjectivity of the impression of William hidden in the heart of Agnes and
Anna is endowed with more objectivity. Similarly, Prices works is also unfolded from Annas
perspective. There are totally two pages describing what Anna thinks, sees and feels. Except for
several sentences providing the background information about the business relationship between
64
Ephraim Tellwright and Titus Price, all the other paragraphs are stated from Annas point of view.
Anna is the main reflector used by the author but in many circumstances, others are used as
reflector as well. At the beginning the story is dominated by the narrator and Agnes appears at
that time. Soon after, Agnes functions as reflector, and two important persons, Henry Mynors and
William Price are introduced. Then the story is narrated by the narrator again and at the same time,
Mrs. Sutton is brought in. After that, Agnes becomes the center again until Anna, the heroine, is
introduced to readers. Then she acts as reflector. Till then, Agnes has finished the task of
introducing all the important characters, except Ephraim Tellwright. The prominence of the narrator
is dramatically lowered by such means. It shows Bennett has a great power of choosing which
persons point of view because every chosen point of view must have functional value. If the person
plays an important role in one point during the development of the plot, he will enjoy prominence as
far as technique is concerned.
4. Social intertextsocial darwinism

The term Social Darwinism first appeared in an article in Popular Science by Oscar Schmidt in
1897. Until American historian Richard Hofstadter published his influential Social Darwinism in
American thought during the Second World War, the term began to be widely used in the
English-speaking world. Social Darwinism describes the idea that humans like animals and plantsv,
compete in a struggle for existence in which natural selection results in survival of the fittest. It
claims that Charles Darwins theory of evolution by natural selection or by survival of the
fittest can be employed to the evolutionary change and competition between individuals or groups
in human societies drives social evolution. One of its main ideas is that humans, especially males,
need competition in their lives so as to survive in the future, and the poor should provide for
themselves and not be given any aid, although most social Darwinists of the early twentieth century
advocate better working conditions and salaries.
The representative of Social Darwinism is Herber Spencer who adjusts Darwinian ideas to his
own ethical theories. The concept of adaptation allows him to claim that the rich and powerful are
better adapt to the social and economic climate of the time, and the concept of natural selection
allows him to argue that it is natural, normal and proper for the strong to thrive at the expense of the
weak. Survival of the fittest is not only natural, but also morally correct. Social Darwinism is a
belief popular in the late Victorian era in England which claims that the strongest or fittest should
survive and flourish in society, while the weak and unfit should be allowed to die. Social
Darwinism is also an important social intertext of Anna of the Five Towns.
4.1 Survival of the Fittestthe fittest
In the latter half of 19th century, Britain first experiences the Industrial Revolution, and as a result,
science and technology is improved by leaps and bounds and industry and commerce are booming.
The competition becomes more intense and cruel than before. Conflict among middle class
members also grows more and more fiercely. In such a fast-developing society those who can adapt
themselves to the changing situation will survive, otherwise will die.
Ephraim Tellwright belongs to the strong who successfully accommodates to the new condition.
He is niggardly, shrewd and most importantly, he knows how to deal with business and make
money. When he is young, he inherits a small fortune from his father and he makes good use of
money by investing money in property. Consequently, at the age of 30, he is worth twenty thousand
pounds. He is regarded as a good Wesleyan, however, as a matter of fact, his chief interest lies in
those fiscal scheme, not the doctrines or the spirit of Methodism. He wins respect from others and
lives a comfortable life in Hanbridge due to his supreme status and capability. In his fifties,
Tellwright gives up the religious work and leading position in the chapel of Hanbridge and moves
to Bursley where he purchases a lot of cottage property. He is totally engaged in his business
regardless of other things. Every person who has transacted business with him admires his business
capabilities and shows respect to him. Owing to his excellent investment and interest accumulating,
65
few people in Five Towns are richer than him. His indifference and cold-bloodness are also closely
related to his wealth. He demands Anna to ask for rent although he knows his tenant was in poor
condition. His ingenious scheme eventually compels Titus Price to hang himself in the works.
When Anna tells Tellwright the startling news, he feels no guilt and no pity at all. In his opinion, it
is a right thing for the fittest to exploit the others and the survival of the strong is not only natural
but also morally correct. The productivity of capital is to him the greatest achievement of social
progress and the social organism justifies its existence. Nothing can be more equitable than this
productivity, nothing more natural. Males need competition in their lives in order to survive in the
society and the weak should have to provide for themselves and not be given any aid. He believes it
is reasonable the strongest or the fittest survive and flourish in society, while the weak and unfit
should be allowed to die because they have no ability to survive. Another fittest person who lives in
Bursley is Henry Mynors, the owner of a pottery, morning superintendent of the Sunday school and
conductor of the mens Bible class. His parents die in middle ages and he inherits no money from
them. He has worked as clerk, as traveler and at last as manager. In fullness of time, he leaves and
starts in business for himself by taking a newly-erected manufactory in Bursley near the canal.
Being an expert in manufacture and markets, he is inevitably flourished. His pottery works is
acknowledged to be one of the best in the district. He believes the fittest of the survival is a
natural law which is applied to the mankinds society and the rich need not show sympathy to the
less fortunate or help them. Showing little pity to the Prices, Mynors thinks they are useless for they
make themselves trapped in a financial trouble. Henry Mynors is not only a successful businessman,
but also a superior man in Weslayan Methodist church. Being a morning superintendent of the
Sunday school and conductor of the Mens Bible class held in the lecture-hall on Sunday afternoon,
he can fulfill his functions with act, grace and dignity. He is a pious and devout principal of God
and teaches the blind and the lost how to make confession and redemption so as to approach God.
He is a spiritual leader who always keeps calm and sedate even when facing the fervent and
emotional crowds of people. Henry Mynors is a god in Annas eyes because he has the ability to
cope with everything with ease, from managing his works to organizing a revival. Even exigent
Tellwright thinks him to be a suitable son-in-law.
4.2 Survival of the Fittestthe unfit
Titus Price and William Price can be classified into the unfit or the weak in the jungle of
competition. They face constantly vindictive pursuit of their creditors and interminable succession
of the mortifying interview. They struggle to throw off the financial troubles and spare no pains to
extricate themselves from a difficult position but unfortunately, fail. They eventually step down
from the stage of history because they are unfit to live in such a cruelly competitive society.
Titus Price is a two-face man. As the superintendent of the Sunday school in Bursley, he always
arrays in fine and decent clothes on Sundays and appears sleek and happy in front of other people as
if he has no cares in the world. His appearance gives a false image to townspeople, thus, few people
know that he is living in a straitened circumstance. He is managing a tumble-down-old manufactory
which belongs to Anna and owes her one hundred and twenty five pounds. Although in such
financial crisis, he still presents at Sunday school regularly and pretends to be merry. In privacy, he
is having a hard struggle but everything is against him especially the works. Tellwright asks for
money one time after another. So Titus has no alternative but to forge and use trust money to
overcome his difficulties. Unfortunately, the London firm which he counts on has suddenly
smashed, which gives a fatal strike to Price. He has no way of reversing the situation. Afraid of
being blamed by his shameful deeds, he ends up with suicide. The matter stirs the small town, but
the elders are not as surprised as the young because such an event often happens in their experience.
William Price is another one belonging to the weak and doomed to have a tragic end as the
victim of circumstances and of his own simplicity. He is Titus Prices son and secretary of Bible
class, simple and pure. As soon as he is taken as a partner by his father in the business, he
experiences hard struggle because the old and wrecked factory is facing the danger of breaking
66
down. He works very hard to try to save it. However, laborious working doesnt get rewarded. He
and his father still cant pay for the rent in time. He is sent by his father several times to turn in
plaintive appeal to those greedy jaws of mercy and consequently, always encounters blow from
those indifferent creditors who consider it is unnecessary to show their pity to debtors. William
experiences the profound grief and restrained bitterness against the world the loss of his father.
At the same time he has to shoulder the disastrous result brought by his fathers illegal deeds.
Although with the help of Anna, William no longer worries about the imprisonment, there is no
room left for him in the town. Nobody else will give the young man a hand. He has to leave Bursley
and goes to Australia to restart his life. Unsuccessful in business, he is also a loser in love. Anna
and he love each other but fail to unite. Compared with Mynors, William is meek, timid,
self-conscious, ungainly, simple and transparent. He has no courage to make any promise to Anna
or bring her with him. The only thing he can do is remembering Anna forever. At the end of the
story, the author-narrator tells heartrendingly he dies in an abandoned pitshaft.
5. Conclusion
Bennett strives for the realization of the combination of traditional realism with French Naturalism
in Anna of the Five Towns. Bennett succeeds to a fairly large extent in following Flaubers, but it
doesnt mean he copies his style indiscriminately. He changes it for his own use. The naturalistic
elements containing in the novel are helpful to the construction of characters, themes and meanings
of the text. The text achieves a good combination of traditional realism handed down from Great
Britain novelists such as Dickens and Eliot with French Naturalism skillfully adopted by Flaubert
and other French novelists, setting a good example for English writers. The publication of the novel
proves that writers should widen their horizon and absorb new things from others when creating
literary works.
The novel is both readable and writable. The story happens in Bursley, one of the five towns in
England where many characters live including major characters: the Tellwrights, Henry Mynors, the
Prices, the Suttons and many minor characters. The plot of the story develops gradually and slowly
according to time sequence and space sequence. All these factors are the necessities of traditional
realistic novel. This novel is the rebirth of English realism inaugurated by Defoe, transposed by
Jane Austen, revived by Charlotte Bronte, over-elaborated by Charles Dickens and brought to
perfection by George Eliot. Thus, Anna of the Five Towns is readable. The figures in the novel are
all common people, and the plot is rather simple, lacking adventure and fantasy. Besides, the
detailed description of mental activity and constant changing of point of view bear the feature of
modern novels. Readers need to use their own accumulated knowledge and take actively part in the
reading process in order to analyze and understand it better and more thoroughly, so the novel is
almost do-it-yourself book which each reader can interpret according to personal feelings. In such
way, the novel can be said writable.
References
[1] Hepburn, James. Arnold Bennett.London:Routledge &Kegan Paul Ltd, pp.155-164,1981.
[2] Kristeva, Julia. Desire in Language: a semiotic approach to literature and art. New
York :Columbia University Press, pp.36-66,1980.
[3] Kristeva, Julia, Smotik:Recherches pour une Smanalyse. Paris:Editions du Seuil, p.146,
1969.
[4] Bennett, Arnold. Anna of the Five Towns.London:Methuen &CO.Ltd,pp.11-253,1902.
67
Analysis and Performance of the Piano Work Jumping Music with

Yi Minority Style in Southern Yunnan
Xianying Zhou
Qujing Normal University, Qujing, China
Keywords: Piano work with Yi minority style in Yunnan; Creative technique; Playing skill; Liu
Xiaogengs Jumping Music
Abstract. This paper is to study the musical structural characteristics, development methods of
musical material and playing skills to explore the artistic charm, with Liu Xiaogengs piano work
Jumping Music with Yi Minority Style in Southern Yunnan as main object, based on the ontological
research. Through the analysis of this piece of music, the author aims at interpreting music culture
of Yuannan minorities, so as to obtain a broader cultural interpretation.
The Yi people are versatile and good at dancing and singing. The Nisu branch of the Yi people in
Yunnan mainly lives in Sheping and Jianshui counties in the Honghe Hani and Yi Autonomous
Prefecture of Yunnan Province. Due to the special geographical environment of Yunnan, this branch
lives a dispersal life. Therefore, during the communication and integration with other Nisu people,
there have appeared branches like "Huayao", "San Daohong" and "Luoluo". They have their own
writing, language and their traditional "Four Tunes" and "Cigarette Case Dance" and so on. The
piano work Jumping Music by Liu Xiaogeng adopts the main melody of Heshi and Luomeng that
is divertimento of songs and dance of Yi music in Yunnan, including music and dance of the Yi
Sanxian dance and cigarette case dance. The unique characteristics of the original music created by
Nusu branch of Yunnan Yi minority are spread to the piano that is a widely popular Western musical
instrument, and in the second creation, the Western polyphonic writing skills and Nisu polyphony
together , so that the traditional Yi music bursts out of life rhythm in the new era through the piano
performance.
1. Music and dance elements in Jumping Music

1.1 Tonality and mode
Jumping Music takes La (Yu) as main mode, with a little Re (Shang), Sol (Jue) and Do (Gong). It
includes the pentatonic scale, constituting by la, do, re, mi, and sol. The Heshi and Luomeng that is
divertimento of songs and dance, usually composes of 13 songs and 9 sets of dance movements, to
form complete rigorous performance, and from the musical structure it can be divided into thee
parts which are beginning, development and end. With free variation, the 1-2 pieces are the first part
with the soothing melody; 3-12 are the development with bright melody; the last one is the end,
with slow and simple do mode. This work was created by Mr. Liu Xiaogeng during his college life
in the 1980s, and because learning romanticism and modern harmony writing, he was more inclined
to study the harmony skills of Western Romanticism and modern twelve tone sound system. The
A-tone writing technique is used when he selected the mode, and the whole song begins from
A-tune and ends with the A-tune, so as to reach the unity of form from the tonality and mode. The
analysis of musical structure is as follows.
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016

68
Musical Form of the First Part
a a1 a2 a3 a4 b c a5 a6 a7 a8 d
7 7 6 8 10 6 7 9 6 6 6 10
A Tune A Tune
The music begins with one a phrase as the theme, and uses sequence and variation of a phrase in
the unused parts. Meanwhile, the specific groups of music of the Yi minority are used, such as
group of do, mi, sol, and group of do, falling mi, sol. There are a number of changes and modal free,
and ultimately it returns to the A-tune, in order to obtain the rich and varied music image.
From this piece of work, we can see the author used a lot of semitone, writing techniques of
metaphone system, as is shown below.
The melody is full of jump with six degrees, seven degrees, eight degrees or even nine and ten
degrees, which shows Western composing techniques and the unique sound structure of Yunnan Yi
music from the effect of the music.
1.2 Melodic composition
Due to the horizontal composite thinking in the singing, playing or combination of music and dance
of Heshi, there are two to four parts of the polyphony. In the playing or singing, chorus, echo, free
imitation and following can be freely inserted, so that the polyphony will show a few people with
several sound parts. Mr. Liu Xiaogeng who was studying in the three parts composition in the early
1980s created this piano work Jumping Music, and he adopted the main melody of Heshi and
Luomeng that is divertimento of songs and dance of Yi people in Yunnan. The structure is still
followed the three parts of writing techniques of Bach Fugue, and integrates the modern
composition techniques to the national tunes based on the original melody. With the rotation of
three parts, the music presents the lively scene where men and women, and the young and the old,
are singing and dancing happily together. The interval relationship of three parts has been sustained
in the fourth, fifth, or octave degree. In the premise of overall unity of the national characteristics,
the creative polyphony, multi-rhythm, multi-melody, and polytonal give the meaning of the various
parts to the textures with different tones and timbre, as follows.
69
The first, fourth, and eighth sectors respectively show the melodies in E, B, and E, and the
relationship between the intervals of each topic is perfect fourth from E to B, fifth from B to E, and
eighth from E to E. Regardless of the superposition of the subject, they are maintained in the
harmony of interval structure. This free superposition of national melody not only preserves its
original folk music melody style, but also combines the Western tradition of polyphonic melody
writing techniques, which show a rich Yi music style in Yunnan and makes the work full of vitality
and infectivity.
1.3 The special scales of Yi Music
The colorful Yi folk musics have different characteristics in different regions and different branches.
The music of the Nisu branch is mainly composed of pentatonic and seven-tone scales, which
shows two basic types, one of which is characterized by "three-degree" three-tone framework and
accent variations, such as melody of Jumping Music.
The first section uses the Yi traditional three-tone frame of "do mi sol", while the second section
lower the third tone by half tone, changing the mi into falling mi, to form changeable melody. At the
same time, there are three kinds of playing methods in the score which are legato, jumping and even
jumping. Legato can represent the melody of treble flute playing. The jumping and even jumping
represent the three-string and dance steps. All of these vividly express the Yi people dancing
brightly and lively. In Heshi song and dance, false voice is usually used in the treble range, with fast
singing and jumping, to enhance the artistic expression and appeal of music. As is shown above,
from the third section there are ten-degree jumping in the rise of G to B sound, or even in the sixth
section the rise D to rise F sound, and this big jump writing techniques of melody can make music
more cheerful and attractive.
1.4 Unique Yi Dance

The earliest jumping dance of the Yi people, also known as cigarette case dance, is a traditional folk
dance of the Nisu branch, which is originated from the folklore activity eating huocao tobacco.
During the dance, there are traditional string and other mixed one, and the former is classic
representative of cigarette case dance while the later is derived from the traditional one[5]. As time
goes, jumping music has gradually become a popular Yi folk dance, also known as "big jump
music" and "Wo music". Heshi song and dance of Nisu branch in Yunnan, a kind of jumping music,
is usually composed of 13 songs and 9 sets of dance movements, with complete form and rigorous
structure. The environment of jump music decides its fervent dance atmosphere, and the rhythm is
very bright and cheerful, with 3/8 and 6/8 beats.
In the Yi music, jumping music has two meanings, one of which is a dance form that everyone
circles together to dance and the other refers to the happiness. In their daily lives, Yi people in the
various villages usually get together for dinner, baihua, sing and dance no matter the young, the old,
70
male or female in the traditional festivals. If both men and women like each other, they would sing
"hot song" and invite each other to dance together. During the jumping dance, with the beautiful
four-string instrument, coupled with the applause and footsteps, a strong rhythm is produced, so as
to glorify the dance beside the bonfire. The piano piece Jumping Music belongs to fast-tuned one,
using the 6/8 beat rhythm writing, with the performance tips of Allegretto, making the entire music
playing bright and cheerful. In the process of dancing, the leading dancer plays four strings, while
beating the panel of the instrument with the strong beat, while the other participants click the
bottom of the case when singing, or pat their hands to make crisp and sweet sounds. In addition,
although the four-stringed instrument will always occupy the core, the small three-stringed
instrument, erhu, flute and other instruments are also be used, so that various sounds accord with
dance to make more colorful art form with richer expression and appeal.
2. Analysis of playing techniques of Jumping Music

The Jumping Music is a three-part fugue, and when playing three-part music, the player should
divide the three parts, make clear the melody of each part, and practice each part respectively. In the
process of playing, the main part should be highlighted, while the other two parts need different
intensities to play. For example:
From the first to the third sector, there are only melodies of soprano and alto, and the alto should
be played steadily and strongly, while soprano that maintains the rhythm of a sixteen-note followed
by a eighth-note should be played more lightly, which indicate the Sani girls light footsteps. From
the fourth sector, the theme appears in basso, the rhythm of alto repeats the previous soprano, and
soprano transforms continuous quarter-tone and dotting quarter-tone. Here the playing part should
highlight the main theme of the basso, the alto continues to imitate with light playing, and soprano
should be player brightly and clearly with fingers to keep the time of sound, Like a Yi girls long
and beautiful singing.
From the 31st sector, the alto should be played and controlled by the left and right hand. In
addition to the right hand to control the top part of the melody with the jump, control and distribute
the link of melodies between the right hand and left hand, so that the left and right hand are
coherent more naturally and sophisticatedly, where practices of each part should be done. Practice
each part separately and then play with two hands together, through the different intensity of
contrast and different playing methods to distinguish the vocal lines, as is shown as follows.
71
Taking the third sector as an example, for soprano fall B and return B are highlighted; for alto it
should be player coherently and uniformly. Moreover, the left whispered eighth note should be
played lightly, to imitate the sound effect of plucked instrument.
Beginning in the 41st sector, the music is transferred from rotation of three parts to the sequence
of different positions of the four parts. In order to make the lines of the melody more clear, the
accent should be added to the first note of each part, as is shown as follows.
Taking the second sector as an example, the reducing C-tone of the bass part, the reducing
G-tone of tenor, D-tone of alto, and A-tone of soprano should be changed to accents, to obtain the
effect of the part line. From the 45th sector to the 51th, the beat of the 45th is changed from the
previous 6/8 beat to 9/8 followed by a return to the 6/8 beat, which belongs to the Yi style of music
in a typical rhythm of stretching. The 45th is also a link of the rhythm pattern conversion between
the 44th and 46th convergence. Before and in the 45th, the rhythm has been three beats playing
method, while from the 46th, the left-handed quarter-note continues with the three-beat rhythm and
the right-hand rhythm is converted to 2/4-beat, as shown in the play marks given by the author.
From the 6/8 beat in the third sector, the left hand keeps the continuous three beat rhythm, and
the right hand into four beat, which is a separate rhythm though it looks tuneful. With the three-beat
and four-beat at the same time it should be played separately by one hand when the player is
practicing it, to find the different rhythms and beats. At the same time, when playing the chord, the
player should sink the power through the support of palm, adding the pedal on each accent, in order
72
to obtain better sound. In short, when playing this polyphony, the player divide the music theme,
part, and harmony, and play separate sound part, with the technique of Baroque polyphony piano
works, to make clear the relationship of part and melody line finally and make better performance.
The piano work Jumping Music that was created by Mr. Liu Xiaogeng's when he was a college
student has fully embodied the author's unique polyphonic thinking and national polyphonic
harmony thinking. These early composition made foundation for his later creation of various types
of chorus and symphony. On the creation, he once said that to create music one should accumulate
much for a long time, and his more colorful and complex creation also experiences a long-term
struggle accumulation. The deeper root is that he loves music and Yunnan. Now what he has been
trying to do is to spread Yunnan musical culture to the world and become the world's music, making
more people love and understand it, to convey Yunnan people's spirit and culture.
References
[1] Zhang Xingrong. The Original National Music in Yunnan Province. Beijing: Publishing House
of Central Conservatory of Music, 2006.
[2] Jin Qiu. Folk Dance of Regional Minorities in China. Beijing: The Ethnic Publishing House,
2009.
[3] Li Mang. Analysis of Musical Composition. Chongqing: Southwest China Normal University
Press, 2007.
[4] Zeng Xi, Xiao Wei. Jumping Tone of Yi Folk Music [J]. National Music, 2013.
73
On the Artistic Features and Playing Skills of the Piano Music

Sani Fantasia
Xianying Zhou
Qujing Normal University, Qujing, China
Keywords: Piano work Sani Fantasia; Artistic characteristics; Playing skills; Liu Xiaogeng
Abstract. Liu Xiaogeng is a well-known local composer in Yunnan province. All of his works are
based on the elements of Yunnan's ethnic minorities' musical culture and art, reflecting the rich
Yunnan folk music style and revealing his own unique artistic style. His piano work Sani Fantasia
created in the early eighties is a piano variation with rich Sani style. This paper is mainly to analyze
and study the artistic characteristics and playing skills of Liu Xiaogeng's Sani Fantasia, to explore
how to inherit and protect Yunnan folk music through the creation of piano music works with
musical style of Yunnan minorities.
As a well-known composer in Yunnan province, Mr. Liu Xiaogeng has made a series of music with
minority styles in Yunnan with the elements of that music. His piano work Sani Fantasia, created in
the early eighties with the traditional music elements of Sani branch of Yunnan Yi minority, had
been designated as the repertoire of Hong Kong Piano Competition in 1997, which shows that with
time going, this work has increasingly been affirmed and praised by the community. It plays a big
role as the Chinese national piano work or appreciation case of piano musics, as one of the best
piano music with Yunnan minority style.
To recompose and recreate a solo with a certain instrument, the original style of the music should
be remained in order to reach similarity in form and content. In China, from the 1950s, a large
number of composers came to Yunnan to collect the music materials of Yunnan minority to recreate
Yunnan folk songs, such as Wang Jianzhong's Five Yunnan Folk Songs (1958), Liao Shengjings
Night of Torch Festival (1953), Shen Chuan-min's Five Yunnan Folk Songs (1982). These
recomposed piano works of Yunnan folk songs deeply affected Liu Xiaogeng, who was a college
student of Professor Zhao Kuan Ren in Yunnan Arts University. Growing up in Yunnan and loving
the piano, he is also eager to use his own composition to create a piano work with musical style of
Yunnan minorities. Moreover, he is not satisfied with re-composition of folk songs with the
traditional techniques, but to integrate more Western creative techniques. It is difficult to integrate
Chinese and Western creative techniques while playing the role the playing skills of instrument, to
improve the connotation, artistic conception and professional skills and enrich the works. However,
Liu Xiaogengs piano work Sani Fantasia fully realizes all of these. This piano work takes use of
the tone of folk song Distant Guests, Dont Leave, making the Sani folk songs fully rooted in the
idea of modern creative materials. The techniques include the use of piano sounds to imitate the
playing skills of Sani Sanxian, use of Western Ragtime Rhythm to imitate Sani drums, as well as
pure control skills of piano sound, to reflect the charming of this work style from new aspect.
Peacefully but excitedly, the music is filled with the vitality of the people of Sani with strong
expressive force, and highlights Liu Xiaogeng's unique musical language skills and aesthetic
feelings.
In Sani Fantasia, a sonata form without second tonal area, Mr. Liu Xiaogeng presents the
contrast between the two materials and mode with the traditional writing style of Western
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
74
"Fantasia". The theme of the first tonal area is taken from the tone of folk song Distant Guests,
Dont Leave, in order to make the audience know and love piano works and bring them into the
cheerful dance scene of Yunnan minority with E-tune and 2/4 beat. The theme of second tonal area
makes use of subordinate tone of the first area, while the beat is converted to 3/8 beat, and mode
and tone are transferred from fall E into fall B which is its functional mode. Thus, the music is quiet
and beautiful, full of hazy moonlight mood, and after the second area it returns back to the first area.
But the first area has adopted the music materials of exposition for variation and sequence, and
combining with the unified theme, it actively develops with a series of unstable harmony and
modulation until it ends on the B tone and returns to the homophony. The development works well,
to end of the continuation of instability, making the music character and the image more vivid.
In the recreation of Sani Fantasia, Liu Xiaogeng connect the static and dynamic of the Sani
music together, to sufficiently present the beauty of a flexible musical form. To analyze the playing
technique, there are not pedal mark and excessive playing tips, which is a common phenomenon in
modern works, indicating that Liu Xiaogeng expects more possibilities to play the work and hopes
to use different playing styles to enhance more musical charm.
At the beginning of the introduction, a sixteenth note pp is played with weak strength,
representing the characteristics of fantasy. PP must be played brightly to create a picture with
beautiful night, bright moon, and vague music of treble flute from distant place. Then it is F tone of
strong drum rhythm, to instantly narrow the distance of time and space and bring a scene, where
Sani people sing and dance around the campfire. This is like an answer to the question in the
beginning of the PP, and then it is the rhythm of flexibility. The player should pay attention to the
contrast of controlling the intensity of PP and F, forming a call between the two music exchange,
which is consistent with the aesthetic combination of static and dynamic. And then it is the 9/16
beat of drum rhythm, to constitute a changing structure. The second section is full of lively phrase
of F tone, and syncopation should be played heavily or added by a pedal, so that the music is more
rhythmic, like the music when plucking stringed instruments big Sanxian or the drums of minorities,
as the picture shows.
The strength of the piano sound expands the micro "static and dynamic" to distance of the time,
space, pitch, and rhythm, so that the whole music is static but not lagging, with flexibility and
vitality.
From section 12 began enters the subject, with the speed tag of a cheerful Allegro, representing
that the Sani people welcome friends from distant places. The left hand begins this cheerful jump
rhythm, which also represents Liu Xiaogengs common style. The characteristics of the rhythm is
75
different from the traditional one, and the remake should be slightly focused on the first sound (root)
and the last tone (the two eighth notes at the beginning and the end). This special rhythm belongs to
the Sani unique dance rhythm, representing the plucked three-stringed sound and rhythm type. And
the later sixteenths interval should be played lightly, with the skill of jumping sound that fingertips
hook a little, playing flexibly and elastically. The players can imitate the playing technique plucked
instrument, representing the rhythm of Yi people footsteps when they are singing and dancing. The
14th section is the melody of the first area and Distant Guests, Dont Leave, so that it should be
payed attention to the singing of right hand melody, the ups and downs of phrase and breath
changes, while the left always plays brightly and lightly.
In the creation of traditional Western piano works, variations are usually presented in
multi-segment structure. However, in the traditional Chinese folk music, the melody variation of the
music is usually only part of decorative tone of the melody or a small amount of melody
replacement. In the creation of Sani Fantasia, Liu Xiaogeng used the variation method of western
piano music and the piano variation technique in line with Chinese national music style. For
example, the decorative sound is added to melody of the 14th section, and the 29th section is the
main theme of the variation entering into the main theme. The right hand begins a brisk sixteenth
note running, to highlight the main melody sounds F, B, E, and G, with crisp copper ringtones,
and the first finger knuckle of left hand should be fixed, to still maintain playing jumping sounds
and touching keys briskly and quickly.
From the 40th to the 44th section, the changes of tempo have gone through 2/4, 6/8, 4/8 and 3/8.
The Chinese traditional music emphasizes the combination of rhythm and beat, from slow, medium
to fast[6]. Therefore, Liu Xiaogeng cleverly integrated syncopated rhythm of the Western modern
jazz in the recreation of Sani Fantasia, to transform the sound effects of the piano into Sani national
drumming drum sound and rhythm, which retains the original style and enhances the rhythm of the
work. From section 40 to 43, it indicates the end of the lively dance scene, and this unique hybrid
rhythm of the Yi must obtain the accuracy of rhythm, with senses of overlapping and promoting the
music rhythm. When adding pedal to each remake, take use of the support of palm. The player need
to play decisively and strongly, with strong support from fingers to withstand the weight of heavy
pounds, to get brilliant and vigorous sound.
From 44 section it enters to the second tonal area, and the whole tune transforms from the bright
and cheerful E tone to the soft quiet tranquil B tone. The accompaniment of the left hand from the
rhythm also changes from the pulsing rhythm into a uniform flow of 3/8 beat, while the left hand
use accompaniment playing method with the wrist rotation, as playing a quiet berceuse. Note the
key control of the fingers, with pulp to play, and the speed should be loose and even, not too fast.
76
Then the pedal can be used once every section until the 75th, similar to the performance of national
musical instruments. The right hand should make changes in decorative sound sweet and beautiful,
to achieve the stirring overtone effect of Chinese ethnic instruments, and a small jump and modest
decorative tone present Sani boys show their love to beautiful the girl sincerely and shyly in the
bright moonlight.
The 75th section to the 133rd is the development of the music, with the music material of the first
tonal area for variation and sequence. The idea of music shows the joy and lively folk dance of the
Sani people - jumping on the moon, with excited and intense emotion and simple and clear rhythm.
When Sani people are jumping on the moon, men and women are usually making even teams, with
men playing Sanxian bamboo flute and women clapping hands in various forms [1]. The instruments
of jumping on the moon include the earliest flute, small three-stringed, and the later treble flute,
bass flute, big three-stringed, small Sanxian, Yue Qin, and erhu. The jumping on the moon grows
with folklore and customs, as a channel for people to express their feelings and make friend. After
Transition of three sections, music enters into the recapitulation of omission of the second tonal area,
with music material of the first area as the melody. The left and right accompaniment pattern is
converted to the flow of the sixteenth note of the running, and the musical style becomes more
lively and vivid comparing with the first tonal area though with the same music material. The tone
and mode transform from fall B-la to B-do and then to C-do, and the soft music melody is also
gradually transformed into cheerful and bright dance rhythm, with the music material mainly from
the main melody variation. The player should carefully deal with the convergence of the gradually
slow of the 74 section and fast pace in 75 section, and left hand accompaniment changes from non
legato into a flexible and lightweight jumping sound. With sensitive fingertips distinctive and
flexible rhythm characteristic is expressed. In addition to highlighting the keynote, the right hand
should use the accompaniment, making the melody light and coherent running and echoing with the
left hand.
From section 103 to 107, the melody of left and right hand is question and answer of the theme a
melody, like antiphonal. The right hand imitates female crisp and bright voice, with delicate and
delicate playing, showing the characteristics of feminine, while left hand imitates male strong and
heavy footsteps, with low and heavy playing, showing roughness and passion.
77
Section 136 is the sequence of octave chromatic scale by left and right hands and the climax of
the music. The first and second meters are an infinite free repetition, to present the scene that Sani
people are dancing around the bonfire. When playing eight degrees, the player need to relax the
wrist, with the first knuckle to support, making several important parts of the body relaxed, such as
the back, shoulders, arms, and wrist. The weight is at the fingertips with all the power of the body,
having high emotion, exciting, and full of passion. In the sound effect, he only uses the pedal to get
resonate, making the sound like bright torch against the night sky, so as to achieve the desired
artistic effect.
From section 137, it is recapitulation of the music that returns to the main theme, with
accompaniment changing into the decomposition and 16 notes of chord flow. Here the author gives
the expression of Grazioso, beautiful compact allegro, like a graceful ink painting, with quiet
playing. The right hand should play to control the sound, showing a sweet and tender atmosphere,
like the Sani girl tender songs under the beautiful night sky. In contrast to the vibrant first area, the
accompaniment of the left hand is lighter, requiring evenly coherent playing, like the quiet flowing
river. Here the pedal can be used to avoid the turbidity of sound through two pedals for each beat or
one-half of the pedal for each beat.
78
The end of the 180th section is the climax of the hot octave, and in the chromatic running with a
pedal get one go, as is shown in the following figure.
When playing eight degrees, the player should pay attention to the acoustic resonance to the end
with the arm, in order to foil the lively Sani festival with dancing people and bright torch. The mood
of the music should be warm and generous, with the light final ending to contrast with the previous
sound, just as a bright torch disappears in the night sky, with infinite fantasy.
Sani Fantasia was created by Liu Xiaogeng when he was young, but today it still sounds fresh,
because his long-term growth in Yunnan and study abroad shape his unique musical style, to
integrate the unique music of Yunnan minorities with Western modern composition techniques to
create a number of music works with his dream and aesthetic feelings. This piece of work shows his
unique music language and schema, with the traditional national writing techniques or modern
composition techniques. Its creative techniques have also been reflected in his future creation of
chorus, dance, or songs. He once said that it is very important for a composer to keep the distinction
of his works and preserve the unique style if he does not want to be outdated. From Liu Xiaogengs
works, people can feel that he has worked diligently in the creation of music, and has been trying to
sublimate the most unfashionable music of ethnic minorities in Yunnan to the highest point, and to
make it popular to the public.
References
[1] Li Shaoming, Feng Min. The Yi Minority. Beijing: the Ethnic Publishing House, 1993.
[2] Jia Anlin. The Dance Culture of the Ethnic Minority. Shanghai: Shanghai Music Publishing
House, 2012.
[3] Zhou Weimin. A Multidimensional Study of Piano Art. Beijing: Peoples Publishing House,
2011.
79
Study on Achievements and Difficulties of the Post-80s Singers of

Zhuang Minority Taking Wulong Town in Shizong County as an
Example
Gengsheng Zhang
Qujing Normal University, Yunnan, China
Keywords: Cultural integration; Native; Creative
Abstract. Regional differences give birth to different cultural patterns. From the aspects of
geographical features, cultural environment and economic development, the author analyzes Yu
Xiaoyans inheritance and innovation in singing and dancing, who is head of the dance team of
Zhuang minority in Wulong town of Shizong county of Yunnan Province, and popular there because
she adds new cultural elements to the Zhuang national culture. However, Wulong Town is also
facing the dilemma of national cultural decline with economic and social development. The external
cultural invasion, the outflow of the population, the lack of funds and other factors have restricted
the further development of Zhuang ethnic dance, thus the author hopes to find a suitable
development path through analyzing the whole ecological background.
Shizong County of Yunnan is a multi-ethnic area, with people of Han, Zhuang, Yi, Yao, Miao and
others living there. Among them, Wulong town with Zhuang minority is located in the southeastern
Shizong county and the connection of three provinces of Yunnan, Guizhou and Guangxi, and five
places, bordering with Luoping county in the east,next to Gaoliang Township across the river in the
south, adjacent to Longqing township in the west, and connected with Danfeng in the north, Yunnan,
Guizhou and Guangxi provinces is a combination of five continents unit. It is located in 104
10'-104 25 'of east longitude and 24 10'-24 48' of north latitude. The government is 59 km
away from Shizong county. For the township terrain, northwest is high, and southeast low, to form
ladder-type dimensional climate, where the highest elevation is 2408 meters, and the lowest 737
meter, so that there is a saying that a mountain has four seasons, and climate is different from the
area ten kms away. There are superior location and convenient traffic with Nanning-Kunming
Railway going through and State Road 324 and provincial roads linked to other places. It is one of
the 60 tourist towns planning and constructing by Yunnan government. With the Zhuang as main
minority, minorities population accounts for 38% of the total population. It is the only national
cultural tourist township with ethnic customs, tourism landscape, and hot area scenery. Superior
geographical environment and humanistic background provide the existence and exchange
opportunity for the survival and development of the local Zhuang minority.
Wulong Zhuang In the community of Zhuang minority in Wulong,such a group of people have
their own song and dance team of Zhuang minority. During their ethnic holidays or national
holidays, they will perform the rural folk song and dance, including the Zhuang tunes, toast songs,
and a variety of customs and rituals. Here, the author aims at revealing problems of cultural heritage
and development direction of minority music and so on, through analyzing the head of the song and
dance team, to provide some theoretical support for the survival space and development of the local
minority music culture.
The head of this song and dance team is Yu Xiaoyan, a Zhuang female born in October 1981,
who got bachelor's degree of dance and graduated from the Yunnan Arts University. Now she words
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
80
in Zhuang rural center school of Wulong, Shizong county, as the Youth League members, director
of the women committee, secretary of league branch, general counselor of Young Pioneers, and
deputy secretary of Wulong Zhuang Township. In the past twelve years work, perhaps due to her
love of the national music culture and persistence, she has been focusing on the collection and
development of the folk culture, as well as her profound exploration of the Zhuang folk arts. During
the holidays, when there is no performance, she would collect the village folk songs and some
resources of the older artists, to innovation and develop them combining with the actual life. During
the work, she has repeatedly led the Zhuang song and dance team and students team to participate in
performances and competitions in the county or city, which have been unanimously praised by all
sectors of society.
Yu Xiaoyan
Lunar March 3 is the annual busiest day in Wulong Town, when each family should do the color
glutinous rice and stain colored eggs. In addition to a variety of rituals, the most lively scene is the
sing and dance in the rural square. Its main content is sing and dance performances, followed by
some entertainment programs, such as fighting eggs, throwing hydrangea, guessing and so on. The
Zhuang sing and dance team headed by Yu Xiaoyan show their national self-confidence and joy in
this day . In the "Song of Zhuang minority" and "Bamboo pole Dance", the dance team takes the
Zhuang local elements as the basis and integrates the gestures action of local Yao dance, coupled
with the adapted Zhuang music, making the performance popular among the vast majority of the
local people. According to Yu Xiaoyan, at first their dance is almost in a "native" state, so that none
of the post-80s singers like them is willing to learn and see. Thus, she gradually realized that the
traditional native Zhuang dance can not be satisfied with the younger generations aesthetic pursuit.
And she decided to adapt the traditional song and dance performances, and after the continuous
practice and exploration of the team, they gradually realized the desire to bring forth the new based
on "creative" thinking. According to Yu Xiaoyan, in order to meet the aesthetic needs of the younger
generation, they also try to add modern pop musical elements to their own tunes. And she had spent
a long time to research, which is simply a painful suffering, because it is also involved her in a
relatively unfamiliar cultural fields. The continuous integration of different national cultures makes
Yu Xiaoyan improve herself further, while learning new knowledge and capture new inspiration.
The clever and smart lady finally lives up to expectations, with her innovative dance works to the
next year's song and dance performances in March 3, winning the local people's praise. Government
and the masses appreciation of her works made her excited and inspired, and she created and
adapted a series of songs of Zhuang minority, such as "love song", "Couple Song", and "Capturing
song", which have often been sung by the local people.
81
Folk Festival performance
Girls of the performance team

In order to guide rural cultural undertakings in the direction of healthy development, Zhuang
people like Yu Xiaoyan who has theoretical knowledge and practical experience have the duty to
carry out a variety of cultural activities, develop folk and ethnic art and culture, especially the
Zhuang culture. The CPC Central Committee formulated the Decision on Deepening the Cultural
System Reform to Promote the Development and Prosperity of Socialist Culture, the Cultural
Reform and Development Plan for the 12th Five-Year Plan of the Ministry of Culture, the
Regulations on the Protection of Ethnic and Folk Traditional Cultures in Yunnan Province and
National Economic and Social Development of "Twelfth Five-Year Plan" Outline in Shizong
County. Under the instructions of these important documents, Yu Xiaoyan in October 2012
submitted to the higher authorities the report of cultural basement of Wulong Zhuang ethnic in
Shizong County. The national cultural display base contains food, clothing, song and dance, leisure,
sightseeing, and rafting, making the tourists to enjoy the scenes and the unique song and dance
performances of Zhuang minority in Wulong. According to Yu Xiaoyan, the purpose of national
cultural display base is to protect excellent national traditional culture and ecological environment
through the local inheritance with local peoples independent and active participation[1]. She also
thought that to protect national culture, it is not only necessary to attach importance to cultural
excavation, collation and inheritance, but also continues to absorb the outside world and the
modernization of outstanding culture, to combine the two together. It is also important to pay
attention to cultural and ecological protection and local economic development[2]. The report states
the favorable situation, policy support, favorable location suitable for display, good resource to
explore and favorable atmosphere easy to integrate. It focuses on the folk culture of Wulong Zhuang
82
minority and the Zhuang folk song and dance performances and hand-made arts in the traditional
festivals with the local characteristics. The practical report provides field and material support for
the local Zhuang music culture heritage and development, and is supported by the local authorities
positively affirmed.
With the globalization, Wulong Township also can not avoid the invasion of foreign cultures,
which has gradually influenced peoples spirit from material. Suits, jeans, and leather shoes have
gradually replaced the traditional dress and become peoples first choice. TV, computer, and mobile
phone are all the time promoting the values of the mainstream society and lifestyle, which are
slowly changing thinking and behavior of the younger generation of Zhuang people. Slowly, people
no longer sing their own songs and perform their own dance, and even the language would be
forgotten, replaced by the so-called popular songs and the Han language, which is an indisputable
fact and a common phenomenon. Yu Xiaoyan noted this phenomenon, and she felt that if there is no
change, a few years later maybe no Zhuang people speak Zhuang language and sing Zhuang tunes.
Thus as a worker, secretary of league branch, and counselor of young pioneers in Wulong Zhuang
Central School, she took this advantage and set up a Zhuang students performance team in 2012.
The team members are voluntary students from first to fifth grade in the school, with main task to
learn Zhuang language, songs and dances in spare time. In the annual Children's Day and some
local festivals, the team would participate in the performance and it has been loved by parents and
social people from its establishment. The team can inherit and develop local Zhuang ethnic music
culture. It can be seen that Yu Xiaoyan has played a great role in the heritage and protection of local
music culture.
With the success, she also had to face a lot of difficulties. The first is the lack of talent in Wulong
region. Most of the Zhuang vocational college students or above find job in other places, few of
them willing to return home to work, which makes no group of the high educated persons there.
Thus it not only restricts improvement of the local culture and the spiritual life, but also makes Yu
Xiaoyan difficult to inherit and carry forward the music culture of the Zhuang minority. No fresh
talents affects Yu Xiaoyans ability to a certain extent. The second is the lack of funds. As a typical
agricultural township, Wulong Township's economic development is still in the lower level with
poor overall economic strength, though it has made great progress in the past two years. Thus, local
governments have limited investment in national culture and tourism development, leading to the
stagnation of cultural construction in the region in recent years. These factors will not only make
difficult to construct Wulong Township cultural display base, but also make her Zhuang song and
dance team lack of material support. Finally, if the Wulong town wants to take Zhuang rural song
and dance and tourism as the driving force to promote regional development, it should get the
attention and publicity of the higher authorities. Only with support from the authorities, the local
people and the scholars from all aspects of society, this region may get long-term sustainable
development.
The cultural achievements of Zhuang minority in Wulong township are attribute to Zhuang
peoples efforts like Yu Xiaoyan. Due to their love of the national music culture, they continue to
introduce new music to the Zhuang culture, and thus they also enrich their own understanding of the
national music and culture. It is believed that in the future Yu Xiaoyan will soon become the
representative that understand and develop the Zhuang music, and it is also hoped that she can seize
the opportunity to overcome the difficulties, leading the Zhuang people to get a more substantial
spiritual life.
References
[1] Li Xiaojuan. Reflection and Reconstruction of Culture - Thinking on Cultural Philosophy
Across the Century [M]. Heilongjiang: Heilongjiang People's Publishing House, 2000. 465.
[2] Wei Huang. Cultural Reflection on Multicultural Music Education [J]. Music Research, 2002 (1),
10.
83
Research on Cuju Cultural Creative Development on Linzi Qi Capital

International Cultural Tourism Festival
Zhenhong Lia,*, Mengmeng Gaob, Lin Li c

Sports and Science College, Jishou University, Renmin South Road 120, Jishou City, Hunan
Province, China
a
316225603@qq.com, b448716587@qq.com, c2862923557@qq.com
* Zhenghong Li
Keywords: Cuzu; Cultural creativity; Cultural tourism festival
Abstract. Qi culture festival is a festival , which carries out in Zibo city of Shandong province, which
is to improve Linzis reputation, to carry forward the inheritance of Qi culture, to enhance urban
culture connotation, to promote sound and rapid economic and social development in the section.
This study, using the research methods such as literature, field survey and so on, studied its culture
creativity development. The study found out that by a series of creative activities launched such as
Cuju performance, Cuzu celebration, Cuju contest, inviting the international friends address, holding
Cuju culture seminar, building the sculpture The source of the sacred football and iconic monument,
holding Cuju summer camp, one thousand players keepie-up challenging Guinness world records
activity, the construction of Cuju museum, the plait of films and songs have spread the brand Qis
onetime capital, Culture Linziand make it become an effective carrier that constructs the advanced
culture, expands foreign exchanges, promotes the comprehensive development. At the same time, the
paper puts forward some suggestions for the future development about Cuju Cultural creative
development on Linzi Qi Capital International Cultural Tourism Festival.
1. Introduction
Linzi Qi capital international Qi culture festival is a festival , which carries out in Zibo city of
Shandong province, which is to improve Linzis reputation, to carry forward the inheritance of Qi
culture, to enhance urban culture connotation, to promote sound and rapid economic and social
development in the section. Among them, Cuju culture is the centerpiece of the cultural festival. On
October 23, 2015, chairman Xi jinping's visited Britain. The gift that chairman Xi sent England
football museum is the ancient Chinese Cuju, which show the world the great charm of Chinese
traditional culture. Thus, Cuju has gained the very good publicity.
2. State-level non-material cultural heritage- cuju

Cuju originated in spring and autumn and warring stage period, as a kind of folk popular sports and
entertainment. Biographies of historical recordsLegendary shu qin: " Linzi was very rich, all its
people were fond of Yu, lyre and Cuju." Cu means kick by foot. Ju means a ball made of leather.
Cuju means playing ball with their feet This is the earliest recorded about the word Cuju. Qis
capital Linz, as in the spring and autumn period and the warring states period of the country's largest
economic developed cultural prosperity with members of the industrial and commercial city, for the
production and development of Cuju provided the material base and social cultural atmosphere.
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016

84
According to historical records, Cuju activities appeared in the royal family and army training in Han
dynasty [1] ."Cuju, articles25 " is a professional books about Cuju in Han dynasty, The book records
in detain the competition system and the technical and tactical system about Cuju in the period[2]
From Han stone pictures unearthed from Henan, we can see the pattern of women's Cuju dance [3]
[4]. Tang and song dynasty were the most prosperous period of Cuju culture[5]. Cuju had the
functions such as body-building, military and entertainment, which deeply rooted in people's life[6].
Many poetries, prose and music of Tang dynasty had described it. Poet Wang wei of Tang dynasty saw
the scene of Cuju and wrote: "Cuju flies repeatedly across a bird in the sky, swing fly out of the
poplars ." [7] Until Yuan dynasty, Mongols replace Hans unite and ruled the central plains . Their
customs were different from Han people. The activities of Mongolian were mainly about horse riding,
archery, wrestling and so on. Therefore, Cuju could not get good development in Yuan dynasty. The
scene of singing and dancing in the previous society had gone. So, Cuju that had been once very
popular among Han nationality was declining step by step. Later, it was boycott by people slowly and
slowly. The development of Cuju became more difficult in the Ming dynasty. Ming dynasty paid more
attention on culture than martial arts. Qing dynasty adopted a policy of weaken people. Ruler ordered
"If who plays Cuju, whose feet will be cut off." So that in the middle and later periods of the Ming and
qing dynasties, Cuju who had been inherited for thousands of years gradually disappeared in people's
life. In the 20th century, football was popular all over the world, and Cuju has gained more and more
attention. [8] In 2004 FIFA ceremony for one hundred, FIFA President Blatter formally announced:
"Football originated in China, originated in Linzi Zibo." In May 2006, Cuju was listed by the state
council in the first batch list of state-level non-material cultural heritage. Chairman Xi jinping
stressed: "Good inheritance can be good at innovation." In the age of cultural soft strength increasing
today,the inheritance and innovation of Cuju culture is the responsibility that history gives us.
3. The present development situation of Linzi Qi capital international cultural tourism festival
cuju culture creativity
3.1 Cuju performance and cuju celebration
On September 16, 2004, First International Qi Culture Tourism festival held the celebration football
originated in Linzi. At the opening ceremony, Cuju performances and other activities was held.
During the tourism festival, Chinese football association set up the first Cuju club Linzi Cuju club.
The club has performed for general secretary JiangZemin and other important national leaders and
gained enough affirmation from the leaders at all levels. On April 2, 2005, at the opening ceremony of
China football super league , the antique Cuju performance from Linzi team of China gained the
attention of the audience. Many countries and areas rebroadcasted the grand occasion. At the same
time, the antique Cuju performance from Linzi team of China on behalf of zibo also took part took
part in such following large-scale activities as provincial minority games, provincial workers sports
meeting and provincial travelling train promotion and other, and won the gold award, receiving
consistent high praise from the leaders and the general audience. On July 21, 2007, the part of the
team members of Cuju were invited to play football with world soccer prodigy Messi . The exciting
scenes fascinated the fans deeply. At the opening ceremony of the 7th international Qi culture tourism
festival, the singing and dancing "Linzi Cuju spreads all over the world" Han Cuju performances,
Cuju contest of Tang and Song dynasty, children Cuju dance, shuttlecocks Cuju performances and
other activities were held. The Cuju culture performance was displayed during the activity. In
addition, also made Cuju clothing of Han dynasty and Cuju door of Han dynasty. Wonderful programs
and innovative Cuju shows attracted tens of thousands of people and watched it. Linzi 10th
international Qi culture tourism festival will further expand the influence of two big brands Seeking
roots and worshiping ancestors, the origin of world soccer. And carried out Cuju performance of
Han dynasty. Linzi Cuju performance showed in the Olympic Games in 2008, and world expo in
2010.
85
3.2 Holding Cuju contests
The second international JiWenHua tourism festival to "meet qi old capital, feel open culture,
carrying forward the culture of football, promoting common development" as the theme, content rich
and colorful. As the world's football origin, tourism festival will be held during the contest of Cuju
linzi district elementary and middle schools. The fourth international Qi culture tourism festival held
Asian football future plan the first city football league final and juvenile football league match; The
6th international Qi culture tourism festival held Cuju game of primary and middle school students,
etc. The 12th Qi culture festival carried out "Football birthplace cup " KT National Football League
finals; Who is the king of football - folk football championship. The 13th qi culture festival held "The
origin cup" international youth football tournament; The world robot football game, International
youth football tournament.
3.3 Inviting the international friends address
The 3rd international Qi culture tourism festival, on the basis of the successful experience of the
previous two festival, focuses on innovation and development. The internationalization of Cuju and
the participation of the masses are the great subject of cultural activities. As the birthplace of world
football, the president of Asian Football Confederation Braden addressed at the opening ceremony:
"Three thousand four hundred and fifteen years ago, a great man Jiang Taigong was born here. His
people created football and brought happiness for all over the world." He also said: "Linzi is the place
the people who love football yearn for. Because of Cuju, Linzi, people all over the world give
attention to it; Because of Cuju, Linzi will be better tomorrow.
3.4 To Build sculpture the origin of the sacred football and iconic monument
The fourth international Qi culture tourism festival held the ceremony of The Origin of the Sacred
Football and the ceremony The light of Cuju. Zibo The door of China Cuju appeared FIFA in
Germany. In 2007, The iconic monument of the origin of football The Source of the Sacred ball
settled on the FIFA headquarters building. The large-scale sculpture "The light of Cuju" appeared the
millennium monument in Beijing. In 2008, 2010, designed the derivative products related football
such as Cuju boy and so on.
3.5 Holding cuju culture seminar
The fifth Qi culture international tourism festival paid attention to two big brands characteristics
"root-searching and ancestor worship" and "football origin" . And pay more attention to opening up
and innovation, the formation of cultural products, industrial and intellectual property protection.
Sports culture development center of State sports general administration delivered the plaque to Cuju
culture research base, that is the JieCai ceremony of the first international Cuju culture seminar. The
9th international Qi culture tourism festival held Asian regional intangible cultural heritage - Cuju
culture theme seminar. The 11th qi culture festival, Fu Yannong , the dean of historical culture of
Ludong university, expert of sports history research in China give a lecture< The Speculation on
Football Origin Proof>. The 13th qi culture festival, China and England held "world football culture
peak BBS" . In 2008, in 2010, published a number of academic achievements such as "Qi capital
Cuju" and so on. On August 27, 2015, Zibo satellite conference of the 22nd international history
science congress held in Linzi. Zibo satellite meetings took "Cuju and Qi culture" as the theme,
around Cuju and football and so on held the three special academic symposium. The 65 experts and
scholars from Britain, South Korea, Japan and other countries and mainland China and Taiwan took
part in it [9].
3.6 Holding Cuju summer camp and one thousand players keepie-up challenging guinness
world records activity
86
The eighth international Qi culture tourism festival held the first international youth Cuju camp
activities, bounce the ball challenge the guinness world record for the one thousand summer camp
activities and one thousand players keepie-up challenging guinness world records activity. The 9th
international Qi culture tourism festival held the second international youth Cuju summer camp
activities.
3.7 The construction of Cuju museum
The 6th international Qi culture tourism festival inaugurated football museum. The 12th Qi culture
festival held the opening ceremony of the national football museum opening activities and the
opening ceremony for taking-ball table. Linzi football museum systematically and comprehensively
displayed the origin and development history of football. Recovered more than 20 scene and
displayed more than 300 both chinese and foreign ; ancient and modern history pictures and 150
precious cultural relics, which is A characteristic topic museum that displays football development all
over the world and China Cuju culture. It is a carrier of city brand that is about Cuju culture and the
origin of world football , and is the centre of spread and study of China football culture and world
football culture. It provides a basic guarantee for us to study Cuju culture latter and is window show
Cuju culture to world.
3.8 Creating films and songs
The 12th qi culture festival opening ceremony held <Cuju baby legend> shooting ceremony. The 6th
international Qi culture tourism festival, the songs such as "Linzi Cuju Spreads the world" and so on
sing the praises of the open of Linzi and meet the guests at home and abroad with broad mind. The
12th Qi culture festival collected "Cuju" micro movie script. Seen from above, since 2004, Linzi was
identified as the origin of world football, Linzi district committee government and district
government, according to the related policies and regulations of the state, combining own actual
situation, strengthens the plan of Cuju culture of Linzi Qi capital international culture tourism festival,
and set up and implement a series of policies and measures speeding up Cuju culture development of
Linz Qidu international culture tourism festival, which created good environment and conditions for
the development of Cuju culture of Linzi Qi capital international culture tourism festival. That
Vigorously implement the strategy that Linzi Qi capital international cultural tourism festival Cuju
culture brand drive, make Cuju culture of Linzi Qi capital international culture tourism festival as the
main measures to improve the level and technology of culture industry and successfully created a
number of high standard, high grade, the high grade brand of Linzi Qi capital international cultural
tourism festival Cuju culture. To let Lizi go into the world, to make the card Cuju culture and the
origin of world football got deeper and wider propaganda. "The origin of football " has become Zibo
city a beautiful card.
4. The creative development and prospects of Linzi Qi capital international cultural tourism
festival cuju culture
4.1 To further strengthen the development and the research on cuji series products or
souvenirs
The depicting Cuju series products development and Cuju culture, background, and given
characteristic process to whip culture connotation, meet to combine the Cuju series products
development with Cuju culture, and endow the special local products culture connotation to meet the
consumption demand from different levels and different group.
4.2 To strengthen the construction "creative linzi qi capital international cultural tourism
festival and cuju culture"
87
Around the city's economic structure adjustment, implement the construction of creative Linzi Qi
capital international cultural tourism festival and Cuju culture". Actively develop comprehensive
range of design activities such as cultural tourism, ceramics, clothing, building and so on. To extend
Linzi Qi capital international cultural tourism festival Cuju creative activities to the first and second
industry and modern service industry. To strive to launch a large number of creative works with high
technological contents and added value.
4.3 To pay special attention to the construction of cultural carrier and construct the
development platform of linzi qi capital international cultural tourism festival cuju
cultural industry
Take the construction of cultural carrier as an important gripper, focus and the main position to
promote the development of cultural industry. Make full use of advanced technology and modern
production methods, transform and upgrade traditional cultural industry, cultivate the culture
creativity groups such as website, advertising creative, galleries, animation games, newspaper, radio,
film and television, digital publishing, planning design, information, and so on. Support and develop
Linzi Qi capital international cultural tourism festival Cuju culture creative key enterprises that can
become investor in R&D, investor in technology innovation and investor in the application of
innovative achievements. Let more people know and contact Linzi Qi capital international cultural
tourism festival.
5. Acknowledgement
This research was financially supported by 2015Western philosophy and Social science Fund project
of Hunan province15YBX037; State General Administration of Sport Open-end Funds Key
Research Base of National Sports Topics(16jdzb004); 2014 Core Curriculum group Construction
Projects of General Class of Jishou University(jdtshxkc201404).
References
[1] Song Xiu-ping, Shuai Pei-ye, Textual Research on "City of Cuju" in Han Dynasty, Journal of
Chengdu Sport University, Vol.36,No.7, pp.37-51, 2010.
[2] Weng Shixun, Is Han dynasty Cuju football with martial arts style?, Sports Culture Guide, Vol.6,
pp.67-68, 2005.
[3] Tong Xigang, Wang Shuqin, An Investigation on Cu Ju in the Han Dynasty, Journal of Shandong
Normal University( Humanities and and Social Sciences), Vol.53, No.2, pp.104-107, 2008.
[4] LIU Pu, A study on ancient football(tsuh- jyur)observed in Han painting sculptures, Journal of
Shandong Institute of Physical Education and Sports, Vol.25,No.8, pp.38-42.
[5] MEN Li, Cultural and Time Characteristics of Chuju in Song Dynasty, Journal of Shenyang
Physical Education Institute, Vol.1, pp.28-29, 2005.
[6] Yang Yuquan, On the Development and Influences of Cuju in Tang Dynasty in China,
Vol.3,pp.29-31, 2003.
[7] Li Na, On Cuju in the Poetry of Tang Dynasty, Sports Culture Guide, Vol.12, pp.67-68, 2006.
[8] QIAN Wen-jun, Exploitations on cultural reasons for Chinese Cujus failure to become modern
football, Journal of Wuhan Institute of Physical EducationVol.12, pp.17-20, 2005.
[9] Mi Jifeng, Cuju appearance in England win "wave of the world", Zibo Daily, Version 1,7.5,2016.
[10] To carry forward the cultural spirit and Build the Modern Culture of Zibo, Journal of Literature
and Art, Version.8, 11.26,2012.
88
Research on Natural Inheritance and Protection of Miao Peoples

Strand-towels Dance in Xiangxi from the Perspective of Intangible
Cultural Heritage Cultural Heritage Protection
Zhenghong Lia,*, Lin Lib, Lei Zhangc

Sports and Science College, Jishou University, Renmin South Road 120, Jishou City Hunan
Province, China
a c b
316225603@qq.com, 2862923557@qq.com, 448716587@qq.com
* Zhenghong Li
Keywords: Miao People; Intangible cultural heritage; Authenticity
Abstract. Strand-towels dance is a kind of dance which is used to put down the evil, wipe out the
disaster, thank gods, redeem a vow to a god and so on and is popular in Miao people in Xiangxi. It has
a long history and distinct national characteristics. This paper, using such research methods as the
literature material method, field survey method, logic method and so on, from the perspective of
Authenticity heritage and protection researched the strand-towels dance. On the one hand, it presents
the evolution history of Xiangxi Miao Peoples strand-towels dance; on the other hand, it explores the
natural inheritance and protection of Xiangxi Miao peoples dance. It makes every effort to present a
vivid cases to show the methods of Non-material Cultural Heritage Protection and inheritance of
strand-towels dance in Xiangxi. But "Authenticity" is a dynamic, diverse and complex problems, we
must understand it from the interactive and dynamic perspective.
1. Introduction
Intangible cultural heritage refers to the various manifestations of traditional culture, folk activities,
performing arts, traditional knowledge and skills, as well as the related instruments, physical, cultural
and natural [1] which are inherited by people generation after generation and is closely related to
peoples life.[2]Miao Peoples strand-towels dance in Xiangxi, acting as immaterial carrier that
reflects its national characteristics and style, is the living component of the national folk cultural
ecology. Miao had undergone multiple migration in history, and also had undergone repression many
times. In order to get rid of the hard fate, Miao people needs strong cohesion to inspire morale and
confidence during the struggle against foreign invasion and oppression of the imperial court. Miao
peoples strand-towels dance tied their hearts tightly together. Miao people migrated to the backwater.
The condition was very backward. When they couldnt explain the plague and evil, they had to turn to
the gods and hoped they could eliminate the disaster and prayed for happiness and progeny. In
Xiangxi area, Lijin is regarded as a sacred utensils by Miao people, which deeply rooted in Miao
People's daily life and economic production, shows their religious faith and respect for the old culture.
The continuously flowing ribbons reveal their spirit of striving and reflect their brave and
hardworking quality and national passion.
2. The origin of Miao Peoples strand-towels dance in Xiangxi

Strand-towels dance is Miao peoples worship dance, whose name comes from the musical
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
89
instruments used by Wizards. It is popular in such Miao peoples area as Huanyuan, Fenghuang,
Jishou and so on. strand-towels dance originated in ancient times, from the fairy tales that the young
man called Zhang Zhaoer learned magic and matched magical powers. It is said that when Zhang
Zhaoer was twenty years old, he had learned magic from Taoist for three years. After he had
completed his education, Taoist gave him a knife, a strand of towels. After he came back from the
mountain, Zhang Zhaoer shook his knife, danced the strand towels dance to cast spells and redeemed
a wish for Miao people.[2] He worshiped Nuo god and goddess in internal sacrifice and worshiped the
high mountains and Seventy-two bodhisattvas in the external sacrifice. From then on, wizards have
inherited Zhang Zhaoers altar. When they are conducting a religious rite to dispel misfortune, they
are shaking a knife, dancing strand-towel dance. After liberation, through the improvement of folk
artists year after year, the unique strand towels dance has come into being[3]. According to the current
responsible knowledge and information, it is inferred that Miao strand-towel dance probably began in
the pre-qin period. Wang Yi wrote in his "Chu Ci Chapters": "The area between Yuan river and Xiang
river, the people advocate the ghosts and sacrifice. When they are offering sacrifices to gods or
ancestors, they must sing and dance to amuse the gods." In the early 20th century, Liu Shipei wrote in
his articleDance and magic derived from offering sacrifices to gods or ancestors. Because Miao
people advocate magic. Wizards are good at singing and dancing. They can achieve the purpose of
communion with gods through song and dance. They can bring good life to people with the power of
gods. These may be the reason that Miao peoples strand-towel dance is popular in Miao people. The
contents of strand-towel dance are to care away evil spirits and takes Miao peoples beliefs as the
cores. So, It can be concluded that strand- towel dance is a kind of sacrificial dance. Why is
strand-towel dance popular in Miao people of Xiangxi? The reason is the traffic here is very block.
Miao people maintain relatively intact traditional customs. And through the long life, labor, and
constantly creation processing, it merges itself with Xiangxi Miao people's religious beliefs. And
eventually, it has formed the form today.
3. The forms and characteristics of Xiangxi Miao Peoples strand-towel dance

When dancing strand-towel dance, Miao peoples wizards are wearing a red robe and a black hat with
a row of pig hair on the top of the hat and, a rockhopper in the front of the hat. His left hand grasp the
strand towels and right hand hold grasp a knife. The basic movements are: "three worship",
"worshiping five clouds generals", "spreading plum blossom", "flying towels", "dust", "holding plum
blossom on the open palm, "draping plum blossom over the shoulders ", "sweeping dust", "raising a
dust", " twining towel round " , putting on handkerchief, and so on.Strand -towel dance is mainly
divided into two forms: one kind is solo dance of Miaos wizard, also known as "Faman", meaning the
spirit of amusing god; the other kind is wizard leads, followed by a number of people holding strand
towel and a knife, forming the "" glyph and "" glyph. The dance is solemn and powerful. There is
strength as well as grace in it. When dancing , the dancers are singing accompanying with the music.
The strand towel in the hands of wizards and other people are called flying towels and scarf, each of
them is about 45 cm long, and the colour is gorgeous. In the process of singing and dancing, strand
towel plays a conducting and guarding role. In Fenghuang and Huayuan of Xiangxi, the strand towel
is made up with ten satin stripes stitched on the stick, and the stick is wrapped with embroidered
towel and with skeins of silk drooping. When dancing, the scarf and flying towels have the
implication of exorcism and striking gang and evil. When dancing, people often accompany it on the
drums, and the rhythm is very distinctive. The drumbeat of strand towel dance is sometimes fast and
sometimes low. The performance forms of strand towel dance differ because of regional differences.
Miao people in Huyuan, Jiwei, Dongmaku and so on, kill cattle for their meat, no matter rich or poor,
men and women, gather together happily when encountered major activity or harvest threshing. The
activity is mainly hosted by Miao "wizard", dancing strand towel dance is a way of expressing
emotions. Part of their actions is to imitate the usual production, life, another part is to imitate the
90
ghosts and gods of. Rural flavour is very strong. When Miao people in Fenghuang, La Ershan, Dong
Maku and so on offer sacrifices to gods or ancestors, in order to to ward off evil, wizards lift up
incense and bow down to their ancestors and gods, and beg the gods to give them grant auspiciousness
and happiness. Then, all people dance strand- towel dance. Strand-towel dance, as a sacrificial
religious dance, the routines of movement are cultured. These actions objectively reflect the Miao
people's normal working life and religious beliefs, but also profoundly reveal the feudal ethical code
of Miao people.
4. The changes of Xiangxi Miao People Strand-towels dance

Strand-towels dance is a kind of dance which is used to put down the evil, wipe out the disaster, thank
gods, redeem a vow to a god and so on and appear in the ritual activities such as vertebral cattle,
solitaire, redeem a wish to Nuo. The form that taking towel in the hand has been established. Since the
1980 s, strand-towel dance, as the essence of local art of Miao people in Xiangxi, perform for the
domestic and foreign tourists and scholars many times in the city and state as a representative of the
excellent national culture. Miao peoples wizards, through the basic movements such as "sweeping,
supporting from under, wrapping around, pushing, rushing, reeling and so on, express Miao people
wishes to thank gods, pray for peace, suppress the evil. But it can yet be regarded as the entertainment
form of Miao culture. In order to pray for good weather for the crops, the people dance strand -towel
dance to beg gods and thanks gods. Such, strand-towel dance become social entertainment activities
of Miao people generation to generation. Strand-towel dance, changing into cultural products that is
available for others to watch from traditional folk art, has given birth to a group of outstanding strand
towel dancers, and eliminated the inherent sanctity and private recessive. Therefore, it is to shorten
the distance with the public. After the tourism developmentXiangxi takes the advantage of the
market demand for national culture, and makes strand -towel dance as a brand onto the stage and to
the market, which makes strand-towel dance become a commodity and is presented to consumers. At
the same time, it attracts more tourists. Now strand-towel dance, as part of the national fitness of local
people, brings the benefits to ordinary people.
5. Authenticity heritage and protection of Xiangxi Miao Peoples strand-towel dance

The core ideas of authenticity mainly manifest in the following aspects: firstly, to respect the
heritage body and to the principal position of inheritance person, and to respect the intangible active
creation for intangible cultural heritage; Secondly, based on the dynamic characteristics of intangible
cultural heritage, to let the intangible cultural heritage be inherited in the context of life[4]. Thirdly,
based on the creative characteristics, the protection and inheritance of intangible cultural heritage can
draw the viewing experience from the audience, and become the foundation of innovation culture
content. Xiangxi strand-towel dance reflects this authenticity essence in the specific protection
practice.
5.1 To play the dominant role of inheritance people
The inheritance of protection of any non-material cultural heritage depend on the subjective choice of
inheritance people. [5] As a intangible cultural heritage, the generation, transmission, storage,
innovation of strand-towel dance are not carried out within the closed framework, but to face the test
of system, market, culture and other complex context, and intangible cultural heritage is inherited by
inheritance people[6]. Inheritance person's personality, skills, talents, family, interest and the
expression of cultural heritage have impressed the trace of the individual. Therefore, in the process of
protection and inheritance of Xiangxi strand-towel, the government should not substitute for
inheritance people for inheriting Xiangxi Miao peoples strand-towel dance, and should respect the
dominant role of inheritance person, give play to the dominant function of inheritance person[7] .
Breaking away from the learning and propaganda of authenticity, the inheritance and protection of
91
Xiangxi Miao strand-towel dance are counterproductive. As the change of environment and era,
Xiangxi Miao strand-towel dance in real life may gradually lose their function and be put aside. Or
changes, even be replaced under the impact of the foreign culture. After a long time, only the older
generation can remember these national culture. Shi Sandong, as the inheritance people of the second
batch of provincial intangible cultural heritage of Hunan province, is regarded as the most
representative, authoritative and influential inheritance people. But he is very aged, the protection of
authenticity is imperative.
5.2 To respect the living change regularity of Xiangxi strand-towel dance
Xiangxi Miao strand-towel dance has its variability. But its protection is by no means protected at a
certain time or space. But to put the culture into the current environment, to respect its authenticity
inheritance and protection of living transitional regularity and the way of inheritance of the true. So,
Xiangxi Miao peoples strand-towel dance can be inherited in the healthy way [8].
5.3 To form the text with teaching meaning
The lack of text records makes Xiangxi Miao strand-towel dance lack the guidance in education and
inheritance, which is easy to cause the learners cannot understand Miao culture and understand the
connotation of Miao strand-towel dance and only imitate it for ever and can never grasp its
authenticity. It needs scholars to play their promoting role and form the text with teaching meaning as
the auxiliary materials Xiangxi Miao peoples strand-towel dance living inheritance [9].
5.4 To build aboriginal products based on native villages
Relying on the native ethnic villages of strand-towel dance develop better and cultivating ecological
culture carrier can have the effective protection and inheritance of the folk cultural characteristics
"authenticity". During the period of the festival, the original local people dance together, which
present the original favor of strand-towel dance and guide the audience's understanding and
acceptation and deepen the perception and identity for Miao peoples image and, help the audience
grasp and perceive Miao peoples strand-towel culture on the whole[10].
5.5 To establish the perfect organization and management system
The authenticity of Xiangxi Miao strand-towel dance is not pure original form. It embodies a
continuous construction. Protection is not to close it on the space-time point in a previous history, but
an integral part of the systems engineering of culture construction. Government should play a leading
role in the protection of Miao peoples strand-towel dance. It should provide more resources to protect
strand-towel dance. And establish a perfect system of organization and management. To cultural
inheritance people's responsibility and right on the system and give them policy protection and legal
protection. To give full support in the capital, system, policy, legislation and funding and so on to
protect Xiangxi Miao strand-towel dance.
6. Summary
Under the background of market economy, Xiangxi state takes advantage of the the existing tourism
resources and realize the development of the tourism industry. What is more important is that national
culture has obtained the excavation and protection during this period. Xiangxi strand-towel dance was
originally scattered in Miao villages of Xiangxi and was unknown and mysterious for out-of-town
people. The census for Xiangxi strand-towel dance that state implements has laid a solid foundation
for the protection and inheritance of strand-towel dance. Let masses contact Xiangxi Miao
strand-towel dance, also let strand-towel dance is inherited in living condition. But " authenticity " is
a dynamic, diverse and complex problems. We must understand the inheritance and protection of
strand-towel dance from the interactive and dynamic perspective.
92
7. Acknowledgement
This research was financially supported by2015Western philosophy and Social science Fund project
of Hunan province(15YBX037); 2015Philosophy and Social Science Fund Project of Hunan province
(15YBA318); 2015Scientific Research Key project of Hunan Province Department of Education
(15A154); 2014 Core Curriculum group Construction Projects of General Class of Jishou
University(jdtshxkc201404) .
References
[1] Liu Kuili, From the Essence of Human to Intangible Cultural Heritage, Jiangxi Social Sciences,
Vol.1, pp.95-101, 2005.
[2] Wu Jihuai, Miao Peoples strand-towels dance in Xiangxi, National Forum, Vol.5, pp.61, 2014.
[3] Xiong Xionghui, On Miao Peoples strand-towels dance in Xiangxi, Union Newspaper, 003
edition, 11.30.2003.
[4] Liu Kui-li, On the Characteristics of the Authenticity and Sharing of Intangible Cultural Heritage
and the Cultural Diversity of Mankind, Journal of Xuzhou Institute of Technology(Social
Sciences Edition), Vol.2, pp.64-67, 2010.
[5] Gao Bingzhong, On the Shaping of Intangible Cultural Heritage as the Concept of Integrated
Academic, Henan Social Sciences, vol,15No.2, pp.15-17, 2007.
[6] Hu Tao, On Protection Main Body of Non-material Cultural HeritageHenan Social Sciences,
Vol.1, pp. 109-117, 2014.
[7] Liu Xiao-chun, Who is the original? Why is this true, Analysis of the Original Ecological
Phenomenon under the Context of Intangible Cultural Heritage, Academic Research, Vol.2,
pp.153-158, 2008.
[8] Huang Sheng- jin, On the Conception and Value of Intangible Heritage fromCultural Heritage
to Cultural Capital, Nationalities Research in Qinghai(social sciences), Vol.17,pp.10-12,2006.
[9] Deng Xiao- yan, On Tourism Exploitation of Intangible Cultural Heritage Resource: from the
Theory of Perspective of Constructivism Authenticity Guizhou Ethnic
Studies,Vol.31,pp.90-94,2010.
[10] Hu Tang, On the Positioning Errors and Correction about the role of government in Intangible
Cultural Heritage Protection Work, Cultural Her itage, Vol.3, pp.8-14, 2013.
93
Research on Three Great Drum Living Inheritance of Laifeng County of

Hubei Province
Zhenghong Li 1,a,*, Lin Li1,b , Lei Zhang1,c, Benzheng Xiao2,d

1
Province, China
2
Lai feng County Culture and Sports Bureau, Laifeng County Ethnic Religious Bureau, China
a
316225603@qq.com, b2862923557@qq.com, c448716587@qq.com, d 3575093520@qq.com
* Zhenghong Li
Keywords: Three Great Drum; Living inheritance; Laifeng County; Folk arts
Abstract. Laifeng three great drum, combining folk talking and singing with acrobatic arts, is one
wonderful work of arts in the gardens of Chinese nation. This paper, using the research methods such
as literature material method, field survey method and so on, discussed its origin, form, the
development situation and so on. Especially, its living inheritance was focused on to be researched.
Study found out that since the 1980 s, with the development of market economy and the impact of the
mass cultural diversity, although three great drum in LaiFeng and surrounding areas has remained
strong trend, it has still been facing the crisis and the confusion of the inheritance. Therefore,
understanding the present situation of the three great drum tradition and mode, analyzing the reason of
its success or failure, exploring effective protection strategies and measures, are undoubtedly of
significance to strengthen its living inheritance.
1. Introduction
Laifeng three great drum is also called flower-drum, which is very popular in Laifeng of Hubei
province, Longshan of Hunan province, Youyang of Chongqing. Especially, in Jiusi village, Dahe
village of Laifeng county, it is more popular and more representative. Three great drum , combining
folk talking and singing with acrobatic arts , thrill of danger, is one wonderful work of arts in the
gardens of Chinese nation. [1]In 2008, three great drum with its unique arts and humanities value was
included in the state and provincial intangible cultural heritage list, get broad attention and
recognition of government and society. since the 1980 s, with the development of market economy
and the impact of the mass cultural diversity, although three great drum in LaiFeng and surrounding
areas has remained strong trend, it has still been facing the crisis and the confusion of the inheritance.
Therefore, understanding the present situation of the three great drum tradition and mode, analyzing
the reason of its success or failure, exploring effective protection strategies and measures, are
undoubtedly of significance to strengthen its living inheritance.
2. The origin of Laifeng Three Great Drum

According to the historical records and old actors legend, three great drum began in Tang dynasty,
and spread to Tianmen, Mianyang of Hubei province in Ming dynasty. According to <The Memoir of
Mianyang>: "Ms( Chen Youliangs wife) is beautiful and is good at singing and dancing, ....is good at
sword. She can use three knives at the same time.[2] The knives goes and comes back just like flying
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
94
back and forth. Chen Youliang organized troupe of ballad singers, performances in his army. The folk
admired her exquisite craft, so imitated her. But it was too difficult to learn. Through continuous
exploration and improvement, they uesd three rural sickles used for wheat harvest. They cut the long
handles into the small handle. They tossed the handles into the sky with double hands in turn. So, it
quickly became a kind of folk performing arts forms. Due to the flood, people, in order to get rice for
making a living, only could cut the sickles off and remained three sticks, which became "Three Great
Drum". <Mianyang memoir> said:" In the middle of Qing dynasty, three great drum was popular. " So
can see, Three great drum was popular throughout the villages and towns in the middle of Qing
dynasty. it throughout the paper manufactory, township. However, the evolution formula of "three
great drum" is basically: martial arts-entertainment-juggling-making a living. This is the source of
"Three Great Drum".[3]
3. The manifestation forms of Laifeng Three Great Drum

The performing form of three great drum is similar with acrobatic performances. Props are mainly
drum and sticks. Someone also uses a knife and steel fork. Typically, artists are women. Commonly
3-5 women make up a art team. When they perform, one person plays drum and sing, one person plays
gong and drum, and one person plays flower sticks. [4]Flower sticks have three, one foot long. The
player take one stick in each hand and another one is thrown into the sky. The player hits the stick in
the sky with his sticks in his hand. He tries his best not to let the stick in the sky touch the ground. His
rhythm must in keeping with the beats of drums. Someone can play 5 steel knives instead of three
sticks. Steel knives fly around in the air just like shuttles. The player with high skills suddenly throws
the knife high into the sky.[5] Then he makes a flying kick and then turns his body outside, continues
to toss up his knife, which makes people dazzling, and people cant help praising. In general, the
knives they use are sickle, kitchen knife and kill pig knife and so on. Playing three great drum need to
be highly concentrated. The strength that tosses the sticks should be moderate. The action should be
agile and accurate. If being slightly negligent, not only performance will fail, also knives will cut or
hurt others. Thus, the three great drum performance is actually the combination of a force and skill.
4. The development situation of Laifeng County Three Great Drum

After Han peoples three great drum spread into the border region of Hubei, Hunan, Sichuan and
Guizhou, Tujia people, who is a national singing and dancing, remould and processed it. So it formed
a kind of unique art form with Tujia ethnic characteristics. After the liberation, the township
government has been using three great drum this simple propaganda tool to carry out the policy for a
long time. Such as fighting the local tyrants, parting fields, scientific farming, census, public security
management, etc., have become the contents of the three great drum performances. Even during the
"cultural revolution", the three great drum was still chartered to be performed by the local government.
It can be said that this period was the most prosperous period of three great drum. From the 1980 s to
now, the overall inheritance situation of three great drum has been still good. In the folk, at festivals,
weddings and new house completion, celebrating the birthday, rest interval the farming, enjoying the
cool summer nights, people all play three great drum. County cultural centers and stands hold flower
drum competition 1 to 3 times every yea. [6]The winners are given the spirit and material reward. And
carry out outstanding folk artists selection activities. Now, LaiFeng two flower drum artist was
awarded the title of "Enshi National Folk Art Master". After 2003, under the vigorous promotion of
the county cultural departments, three great drum went out of mountain. Three great drum
successively took part in the Central China National Tourism Expo, Zhang JIagang National Folk
Arts Festival, Wuhan Spring Festival Folk Tourism Arts Performance and so on. These were popular
with the audience. Flower drum artist Xiang Qianhe from Lvshui town innovated the performance
skills of flower drum. He himself beats drum, sings and tosses the sticks into the sky. He participate
into Hunan province satellite TV "who is the hero" competition and won the second prize. He also
95
was invited by Shenzhen ethnic village and Shenlongxi scenic spot to performance .[7] His stunt
amazes audience and is honoured as " Tu People Fly-cutter". As a result, Tujia peoples three great
drum got more popularity, and gradually formed art brand. However. However, we also found in the
survey, since the reform and opening up, three great drum is also faced with crisis of inheritance and
confusion: Firstly, the scope of inheritance becomes more and more narrow. In the past, three great
drum had circulated in wuling mountain area, such as LaiFeng, Xuanen, Xianfeng, Hefeng, Longshan,
Uyang, Xiushan, Qianjiang, Wanxian, Songtao and so on. Now, its spread scope is limited Laifeng
and several adjacent villages, such as Longshan, Xuanen, Xianfeng and so on. The rest has gradually
disappeared. Secondly, Fault-layer- phenomenon occurres. Now, the actors who play flower drum are
mostly 50 to 70 years old, 20 to 40. The people aged 20-40 mostly go out to make money, rarely work
on the performing arts."
5. The inheritance pattern of Laifeng Three Great Drum

Firstly, the general mass are all out of love and self-study comprehension. Their inheritance is
according to the form of family and the village relationship without strict mentoring relationship. But,
they have the representative figures and group of inheritance. There are 87 flower drum teams in
Laifeng. In them, there are couple flower drum team, father and son flower drum team, brothers
flower drum tea, four generations under one roof flower drum team. Laifeng county is known as the
"flower drum nest". Each of the people here learn to sing. Three great drum is handed down from
generation to generation. Secondly, professional artists learnt from his masters when they were young.
After they have made a name for themselves, they continue to pass their technique to their disciples.
Such as old actor Tian Zhiqing, Li Fenggui, Tian Yanjiang, Xiang Qianhe and so on. When they learn
three great drum from their master, they practiced very hard. So they acquired masterly skill through
intensive training. Later, they perform all corners of the country for making a living. Thirdly, three
great drum goes into the field of education, which is an effective way to promote the art inheritance.
We are surprised to find that in the investigation that middle school teacher Peng Wenqian from Dahe
town Laifeng adapted 56 Classical Chinese of 1 to 6 volumes of the junior middle school language
into flower drum Quyi collected works < Arts Sea and Archaic Chinese Rhyme>, which was
published and used into teaching practice and is very useful to cultivate students' interest, enhance
memory, deepen understanding. Fourthly, the support and attention from the governments and the
ethnic and cultural departments are the most powerful guarantee to inherit three great drum. Since the
foundation of new China, the local party committee and government have taken three great drum as an
important propaganda tool for a long time. They carry out folk arts master selection activities at the
same time. [8]These not only save the local performance market of three great drum, but also has set
up a broad platform of talent show for the artists, which make them gain the economic benefit and the
increasing popularity. Thus stimulated the enthusiasm of three great drum artists performance and
inheritance.
6. The reasons of Laifeng Three Great Drum thriving

Firstly, three great drum is simple and unadorned. This style of art form is easy to be accepted by the
mountain people. Three great drum came from the plains, known as "beggars utensil ". It is a kind of
oral folk performing arts. Its performance is concise with popular language, natural and plain style,
which is suitable for Tujia peoples pursuit of concise aesthetic orientation and simple and honest
personality characteristics. So, it was quickly accepted and modified by Tujia Artists.[9]
Secondly, Tujia Peoples Unique Folk Custom Provides the Space of Survival and Development
for Three Great Drum. Tujia people are enthusiastic and candid. Especially, they are fond of carnival
party. Tujia peoples festival include Han peoples festivals and their nation's traditional festivals.
Three great drum absolutely performs in them. Tujia people pay attach more importance to personal
and familys festival celebrate. Inviting actors to play three great drum is indispensable. And the
96
actors of three great drum often change their performance contents according to different occasions.
So, Tujia peoples unique folk customs not only provide the survival and development space for three
great drum, but also the festival diversity characteristics endow three great drum with rich contents
and a variety of functions.
Thirdly, The relatively closed geographical environment in Tujia area slows down the death rate of
three great drum. Laifeng county is located in the hinterland of Wuling mountain, and is relatively
isolated from Han areas. So, the loss degree of local culture is very slow. These are main reasons that
LaiFeng three great drum can maintain its characteristic and circulate for a long time.
Fourthly, The flexible adaptive function of three great drum is its survival principle to protect its
longevity. First of all, it roots into the folk and close to people's lives. It meets the needs of people's
emotional life in the flexible form. It becomes the folk art and the art folk. Then, it actively cooperates
with the mainstream ideology of government. So, it gains the recognition and protection, even if
during the "cultural revolution", it was not blocked. [10]However, it appears in front of the world with
strong attitude. Today, in the face of pluralistic culture shock, for survival, it changes its attitude and
tries its best to dissolve itself into the mass culture. So, it appears in the busy city, tourist resorts on the
television and so on. It not only gains the vitality, increases its profits, but also opens a new
inheritance market and promotes its art taste.
7. The problems of Laifeng Three Great Drum inheritance

Firstly, since nearly 20 years, with the development of economy, and the introduction of new type of
mass media such as television, Internet, change the life way of Tujia people and their spiritual needs.
The television and the Internet gradually go into the mountainous area. The multicultural kind of
leisure entertainment ways will certainly cause the diversion of audience, which is a natural trend.
Furthermore, the progress of the economic transformation, technology updates and media means
accelerates the change of the social fashion, also bring significant changes in people's aesthetic
standard. The survival folk environment of three great drum and peoples aesthetic temperament and
interest will meet unprecedented impact.
Secondly, because Tujia nationalitys settlements are located in the old, less, edge, remote areas.
Economic development lags behind. Now, villagers going out of the villages for making money has
become the main road. Most young people go out to work to make money, the young go to school. The
people that stay at home are the old and the young. Young people are easy to accept new culture, who
lacks the interest in the traditional folk art. They don't like watching three great drum or dont want to
learn it either. So, the fault phenomenon of three great drum is self-evident.
Thirdly, the research is weak. Professional researchers are few. There is a fault phenomenon. The
business personnel in cultural centers and stations are nearly all retired. New staffs are mostly
non-professionals, young people lack the interest in the folk arts. And cultural management
departments lack the management approach and the rewards and punishment mechanism about
business research, personnel training, achievement awards and so on. These problems should cause
the improvement and attention of the departments in charge of the business.
8. The inheritance and protection strategies of Laifeng Three Great Drum

Firstly, to draw up the protection plan, study out the segmented target. The protection of three great
drum and other folk culture is a systematic project. Planning is fundamental. Its contents include
inheritance thinking, overall objectives, stage plan, safeguard measures and contents, and evaluation
of study results, etc, and approved by the government. Then implemented step-by-step. At present, we
need to do combination of national culture and ecological tourism plan, further develop the
performance market of three great drum, promote the effective inheritance of national folk art.
Secondly, To List the Folk Ecology and Cultural Ecology of Tujia Three Great Drum as the Core of
Protection Mechanism. Set up the key reserves of three great drum. Actively carry out the activity of
97
selection "three great drum township (village)". Respect ethnic customs, pay attention to the
development of folk consciousness and national sentiments. Establish the folk culture subject of three
great drum and so on and bring them into the local teaching courses. To strengthen the protection of
inheritance people, establish inheritance pedigree files. To carry out the activities of annual selection
of outstanding inheritance people. To found "Three Great Drum ChuanXiSuo" at the location of the
folk arts master. To hold three great drum contest regularly every year, and give the winners mental
and material rewards.
Thirdly, County cultural departments set up specialized research institutions, allocate personnel
and related equipment configuration. Draw up the research programs, research topic and quantitative
management objectives. Implement the appraisal reward mechanism of research achievements.
Promote the scientization and specialization of three great drum and Tujia folk cultural work.
9. Summary
All in all, three great drums and other local Tujia folk culture are facing the crisis of inheritance and
confusion. The party and the governments only intensify protection of inheritance, reasonably and
scientifically develop and utilize them in the strategic deployment building Tujia culture integration
region, can they reach the purpose of sustainable development so as to make greater contributions to
strong culture county construction.
10. Acknowledgement
of Hunan province15YBX037; 2015Philosophy and Social Science Fund Project of Hunan
province (15YBA318); 2015Scientific Research Key project of Hunan Province Department of
Education (15A154); 2014 Core Curriculum group Construction Projects of General Class of Jishou
University(jdtshxkc201404).
References
[1] Xiang Daiyuan, The Sing Collection of Hubei Laifeng Tujia Traditional Three Great Drum,
Beijing, China Literary Federation Press, 2004.
[2] Hubei LaiFeng County Annals Compilation Committee, LaiFeng County Annals, Wuhan, Hubei
People's Publishing House, 1990.
[3] Yang Changxin. Tujia Customs Records, Beijing, Central Nationalities College Press, 1990.
[4] Tian Jinggui, China Tujia Customs, Beijing, Chinese Literature Publishing House, 1990.
[5] Chen Tingliang, Chen Aolin. Folk Culture Characteristics of Tujia Dance, Journal of China Three
Gorges University (Humanities & Social Science), Vol.33, No.4, pp. 16-29, 2011.
[6] Tian Can, The Origin and the Aesthetic Characteristics of Three great drum, Literature Education,
Vol.3, pp.148-150, 2008.
[7] Xiong Xiaohui, The Artistry of Three Drum of Tujia MinorityJournal of Chongqing Three
Gorges University,Vol.29 No.144, pp 11-15, 2013. Hu Man, Hubei Three Great Drum, Vol.4, pp.
34, 1983.
[8] Dong Weijian, Zhong Jianbo, China 100 kinds Folk Traditional Opera and Songs and Dance,
Guangxi Peoples Publishing House, 1999.
[9] Duan Chao, Tujia Cultural History, Beijin, Nationalities Publishing House, 2000.
98
Investigation and Research on Living Inheritance of Rolling Dragon Lian

Xiang Dancing at Lijia River Village, Xuan En County in Hubei Province
Zhenghong Li1,a,*, Lin Li1,b , Lei Zhang1,c, Wanxin Sun 2,d

1
Province, China
2
Xuanen County Ethnic and Religious Bureau, LIjia River Town Cultural and Sports Center, China
a
316225603@qq.com,b2862923557@qq.com, c448716587@qq.com, d3538329691@qq.com
* Zhenghong Li
Keywords: Publisher; Designing; Lowercase letters
Abstract. Rolling dragon Lian Xiang is a folk dance which is popular in Lijia River Town, Xuanen
county, Hubei province and loved by local people. .In order to master the first-hand data of living
inheritance of Rolling Dragon Lian Xiang Dancing and explore its inheritance mode and measures,
summarize its experience, find its existing problems, the paper, using the research methods such as
literature material method, field survey method and so on, researched its origin, present situation of
living inheritance, inheritance experience and problems and so on. And put forward that the
inheritance should seek the valid ways of popularization and elevation, draw up and carry out the
relevant incentive policy, development planning and work measures. So, the excellent traditional
culture can get the inheritance and continuity, and carry forward.
1. Introduction
Rolling dragon Lianxiang dancing at Lijia River village, Xuan En county in Hebei Province is very
famous, and is loved by local people. In order to master the first-hand data of living inheritance of
Rolling Dragon Lian Xiang Dancing and explore its inheritance mode and measures, summarize its
experience, find its existing problems, the author specially made in-depth investigation and research.
2. The origin of Rolling Dragon Lian Xiang Dancing

Lianxiang is called Bawangbian, which is circulated in the west of Hubei Province, in the west of
Hunan province and in the northeast of Guizhou. It is a traditional folk dance and is loved by delighted
by local people to hear and see. [1] Its movements are flexible and changeable. The tone is relaxed and
lively. The lyrics are simple. Folk artists Zhou Shuting, on the basis of Lian Xiang, processed into
Rolling Dragon Lian Xiang.When Zhou Shuting was young, he learnt Ba Wang Bian and Lian Hua
Lao from Yang Yunqing, who was from Huayuan county of Hunan province. He combined Ba Wang
Bian and Lian Hua Lao into on. [2]And Beg for living by selling his art. After the liberation, the
people celebrated the liberation in a variety of cultural and artistic forms. At that time, Zhou Shuting
got the inspiration from Xuan En saying Rolling expresses happiness. So, he used the movement of
rolling to play Lian Xiang so as to celebrate the liberation. [3] And in 1952, Zhou Shuting creatively
merged some fighting skills of the acrobats and Southern opera and made singing, fighting, jumping
and rolling of Liang Xiang and Lian Hua Lao into one. In the end, he created a new Lian Xiang
performance. That the waving of the props cooperates with jumping and rolling movements was not
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
99
only rhythmically in harmony, but also like a huge dragon, which makes people dazzling [4]. Later, he
accepted the suggestion from Tang Jingxiu who came from Hubei province song and dance team and
canceled the lyrics and adapted for Rolling Dragon Lian Xiang. It contained 18basic movements such
as three sticks, shuttle step, beauty combing hair and so on, and 6 six difficult moves such as one step
three nods, double heads embracing pillar and so on[5]. So far, rolling dragon Lian Xiang finalized
basically the design. It becomes unique folk consummate art of Xuan En county[6].
3. The present situation of Rolling Dragon Lian Xiang living inheritance

Rolling Dragon Lian Xiang has experienced more than half a century. Its forms of living inheritance
are various and effective, which mainly embodies in the following three aspects.
3.1 The inheritance between teachers and disciples
When Zhou Shuting was alive(Zhou died in February, 2012), he taught many disciples. Hou Anxing
is one of the excellent disciples. He is over70 years old. In 2007, Hou Anxing named the first batch
excellent folk artists by Xuanen county. From then on, Hou Anxing had this birthright and the power,
and become the leading figures of wondrous performances and living inheritance of rolling dragon
Lian Xiang of Xuanen county. In 2010, he was by the identified as provincial intangible cultural
heritage inheritance people by provincial cultural office. In 2011, was appointed as the folk dance
guest coach by Wuhan music institute. In the middle of may, 2012, province national song and dance
troupe hired master hou to teach the troupe entertainers rolling dragon Lianxiang [7]. At the same
time, Hou Anxing is the technology coach and main actors of Xiaonian eldly art troupe of rolling
dragon Lian Xiang of Lijia river town. He has made an important contribution to living inheritance of
rolling dragon Lian Xiang.
3.2 Through the inheritance of cultural and artistic performance team
In 2003, Lijia river town established Rolling Dragon Lian Xiang elderly art troupe. There are 23
members, average age over 62 years old. Female members are more. Because of the common hobbies
for folk literature and Lian Xiang, they come together. They learn from Zhou Shuting. After years of
practice, they have learnt the skill that combines Da Lian Xiang and Lian Hua Lao into one. At present,
in the folk amateur art team only the troupe actors can master the skill that play Lian Xiang with the
right hand and Play Lian Hua Lao with left hand. The troupe, with the love for folk art and rolling
dragon Lian Xiang, actively carry out a series of fruitful performance, competition and training
activities. In 2004, Hubei TV, "Wuling Tujia" camera crew took the troupes rolling dragon Lian
Xiang as the important material, and interviewed and recorded on-site many times. In 2005, the troupe
participated in Zhangjiajie China Hunan Zhangjiajie sino-foreign middle-aged national folk culture
and arts exchange, performed rolling dragon Lianxiang and won gold prize "Huang Shizhai Cup". In
2007, the troupe participated in Hubei province first "Jinfeng award (amateur) dance competition,
won the second prize. In November, 2007, the troupe won the award of best ideas in National old
literature and art competition "in Shenzhen [8]. In 2010, rolling dragon Lian Xiang participated in the
folk art performance of Shanghai world expo and won the praise. Since 2011, the troupe, invited by
Lijie river town Party committee and sports cultural service center, has taught more than 200 people
from national primary and secondary schools Da Lian Xiang and Lian Hua lao irregularly and now
achieved initial results. Through these productive activities, Rolling Dragon Lian Xiang elderly art
troupe has become the famous performance team in the township and the surrounding areas. They
make a contribution to the living inheritance and the spread of Rolling Dragon Lian Xiang[9].
3.3 Inheritance through all kinds of sports activities platform
Since the reform and opening entering the 21st century, Enshi county has put forward the construction
of culture states. It attaches great importance to the construction and development of national culture.
Xuan En county uses and grasps the platform of national folk cultural and sports activities
100
performance to inherit Rolling Dragon Lian Xiang and create and develop Rolling Dragon Lian Xiang.
And takes Rolling Dragon Lian Xiang as county professional troupe show and merge rolling dragon
Lian Xiang into traditional sports performances, etc. Such the competition as 2005 countys folk
songs, folk dance, folk music, folk songs, Li Jia rivers rolling dragon Lian Xiang won the best
performance award. In 2007, in the first batch of outstanding folk artists and folk wondrous
performance activities, rolling dragon Lian Xiang show caused a sensation. In 2010, rolling dragon
Lian Xiang was invited to participate in the county-wide non-material cultural heritage and folk
wondrous performances, the pictures of rolling dragon Lian Xiang were reported on Hubei daily news.
In 2009, Xuanen delegations program <Joyful Tujia People>, which took rolling dragon Lian Xiang
as the material, won the first prize in non-competitive events of Hubei province 7th National Games.
In 2011, Xuan En county took part in large-scale original song and dance <Colorful Xuan En> of First
Hubei province minority cultural and art performance. Rolling dragon Lian Xiang dance was
recomposed into important program of it. Since in 2007, folk arts performance of three towns of
South Xuanen every two years has made Rolling Dragon Lian Xiang hand down[10].
3.4 Actively go out of mountain gate and spread
Since Li Jia River Rolling Dragon Lian Xiang elderly art troupe was founded in 2003, it not only
actively take part in performance and competition, but also goes out of mountain gate boldly. It takes
part in kinds of national eldly people amateur art contest, and wins the reputation and respect, expands
the influence of Rolling Dragon Lian Xiang.
3.5 Carrying out three into Activities of into Schools, into the Government Units, into the
Countryside
Rolling Dragon Lian Xiang is well-known folk dance of Lijia river town. In recent years, Lijia river
town party committee and town government list the inheritance and development of Rolling Dragon
Lian Xiang as an important content of local cultural construction. Order township culture and sports
service center to draw up development plan and specific adjust measures. According to the local
conditions, carry out the activities such as Rolling Dragon Lian Xiang into school, Rolling Dragon
Lian Xiang into government unit, Rolling Dragon Lian Xiang into the countryside and so on. Invite
the staffs of elderly art troupe to teach the teachers and the students from the national primary and
secondary schools the basic skills of Lian Xiang. At present, there are more than 200 teachers and
students who master the basic movements such as Jian San Bang, Sha Pa Zi, Shuo Bu and so
on. They go into the government units and teach the staff rehearsal rolling dragon lian xiang program.
They go into the countryside and carry out the performance combined with counseling activities for
new rural pilot sites. These pragmatic and efficient countermeasures promote the living inheritance of
rolling dragon lian xiang. It changes the monotonous situation that only the elderly people practice
rolling dragon lian Xiang and cause the good influences on the primary and middle school students
and young people[11].
3.6 Being invited into the campus
The raising of rolling dragon lian xiang reputation caused the social attention. Hou Anxing is
successively invited by Wuhan music institute, Hubei ethnic song and dance troupe and Xuan En
cultural troupe to teach the students of art department and professional troupe actors rolling dragon
lian xiang. Seen from the surface, this is Hou Anxings monomer behavior. But from the other side,
this reflects that the inheritance of rolling dragon Lian Xiang is going into higher level and a larger
platform. And this kind of living inheritance is an important form for the folk consummate art.
101
4. The experience and problems of Rolling Dragon Lian Xiang living inheritance
4.1 Success and experience

Firstly: Lijia River town, as the founding of rolling dragon lian xiang, attracts and motivates a group
of enthusiasts for rolling dragon lian xiang. After the reform and opening up, especially since the 21st
century, the social demand for culture, local governments carrying out the multiple forms of cultural
activities, Chinas non-material cultural heritage list declaration engineering and so on make the
inheritance and inheritance people keep and maintain an enthusiasm and motivation.
Secondly: Local party committees and government pay attention to it and give support and funding
to carry out it. The countys cultural and sports departments give it love, help, guidance and services.
The ethnic and religious department and cultural and sports department of county and state give
perennial support, etc. These make rolling dragon Lian Xiang appear on the stage, serve the society go
out of the mountain. The elderly art troupe of Lijia river has participated in folk art performance and
communication events in other provinces and cities many times. The local party committee and
government and the cultural and sports department give such support as the capital and operational
guidance, personnel services and so on.
Thirdly: These folk cultural and sports performance and competition activities at all levels provide
display platform for rolling dragon Lian Xiang. The kind of living inheritance should be the important
means and forms that are worth being positive and carried forward.
4.2 The existing problems
Firstly: The inheritance of rolling dragon Lian Xiang mainly depends on old people of Lijia river town.
They cherish the simple passion and love to carry out such activities as practice, performance,
teaching and so on. Its spread is very limited. It hasnt set up scientific planning and work objectives
and tasks, which will directly affect the sustainability and long-term of the inheritance.
Secondly: Rolling dragon lian xiang has 18 kinds of basic moves and six kinds of difficult moves.
Technically, Lijia river town and Xuanen county haven't systematical authoritative teaching materials
about rolling dragon lian xiang. The people who master the 6 kinds of difficult moves are only Hou
Anxing and other few people. Hou Anxing is over 70 years old, and he can not perform the difficult
moves. It has the possibility of lost and disappear. There is no specific support materials for its living
inheritance, it will not do more scientific and effective development.
Thirdly: The inheritance of rolling dragon lian xiang lacks relative financial support, such as
performing props, audio, power and other basic equipments. Without these conditions, the inheritance
and popularization are difficult to carry out. Therefore, these limitations and spending pressure block
the inheritance of rolling dragon lian xiang. If to carry out widely spread and inheritance activities of
rolling dragon lian xiang, there is certainly the Funds safeguard. This is the important factors of
inheritance and popularization.
5. Summary
Rolling dragon lian xiang is a form of folk literature and art, which is popular in the southwest of
Hubei and the surrounding area. It has the exuberant vitality. So, Xuan En county has the current
situation of living inheritance. However, through the deep rational analysis, the ways, means and
sustainability of rolling dragon lian xiang inheritance need to be explored according to the following
aspects. Firstly, rolling dragon lian xiang is popular, who has long history, and mass love it.Its
inheritance is relatively easy. Secondly, rolling dragon lian xiang combines Da Lian Xiang with Da
Lianhua Lao. The skill is very hard. If no one teaches it or without hard practice, it is difficult to reach
a certain performance level. Thirdly, rolling dragon lian xiang needs good skills and dancing body. It
needs double peoples cooperation, and the level of skill is relatively consistent. Thus, people can
fully show and performance. So, its popularization and enhancement are very difficult. The real living
102
inheritance of rolling dragon lian xiang is not to see how many people play it. Of course, rolling
dragon lian xiangs wide spread and popularization is the foundation. As governments cultural and
sports departments and ethnic and religious need to think about how to find out the methods of
inheritance, seek the valid ways of popularization, draw up and carry out the relevant incentive policy,
avoid rolling dragon lian xiangs lost and disappearance because of old artists death or own job miss,
so as to make the excellent traditional culture get inheritance and continuity, and carry forward , it has
a long way for us to go.
6. Acknowledgement
of Hunan province(15YBX037); 2015Philosophy and Social Science Fund Project of Hunan province
(15YBA318); 2015Scientific Research Key project of Hunan Province Department of Education
(15A154); 2014 Core Curriculum group Construction Projects of General Class of Jishou
University(jdtshxkc201404).
References
[1] China Music Institute, Music Census Report of Hunan. Changsha: Hunan People's Publishing
House, pp.274, 2011.
[2] Jiang kun, Ni Zhongzhi, Chinese Quyi History. Beijing: People's Literature Publishing House, pp.
536,2005.
[3] Zhou Li, Hubei Folk Dance and Music Appreciation, Wuhan: Huazhong University of Science
and Technology Press,
[4] Zhong Gaozheng, Research on tourism industry of Xiang, E, Yu and Qian, Chengdu: university
of Electronic Science and Ttechnology Press, PP.176, 2009.
[5] Zhang You-ping, Tu Jia Peoples Sports Dance Lian Xiang, Sports Culture Guide, Vol.5, pp.77,
2003.
[6] [6]Xuanen compilation committee compiled. Xuanen. Wuhan: wuhan university of technology
press, 1995:386.
[7] Xuanen Compilation Committee, Xuanen County Annals, Wuhan: Wuhan University of
Technology Press, pp.386, 1995.
[10] Wu Hui, The Living Inheritance and Protection of Gun Long Lian Xiang, Golden Field, Vol.317,
pp.136, 2014.
[11] Ji YingTao, Artistic Feature Analysis of Chinese Han Nationality Folk Dance " Da Lian Xiang,
Journal of Chifeng University, Vol. 31, No. 6, pp. 95-96, 2010.
103
The Recluse World of Tao Yuanming and W. B. Yeats
Lei Guoa, Jixing Lib

School of Foreign Languages, North China Electric Power University, NO. 689 Road, North District,
Baoding 071003, Hebei, China
a
gl_guolei@qq.com, b854923847@qq.com
* Lei Guo
Keywords: The Lake Isle of Innisfree; Back to country life I; Recluse world; Similarities and
differences; Causes
Abstract. The Lake Isle of Innisfree written by Irish poet William Butler Yeats and Back to
country life I written by a well-known Chinese poet Tao Yuanming both depicted recluse life in the
lines. The paper is to compare the two poems, discuss what they have in common, including the
imagery and rhetorical devices, especially metaphor used in the poems to express their feelings; in
addition, it will explore their discrepancies and causes behind them on cultural level and political
level, expecting to enable readers to appreciate the poems more deeply, learn poets skills to express
their innermost feelings, meanwhile, provide a new perspective for the study and appreciation of
classical poetry.
1. Introduction
W. B. Yeats was a distinguished figure in English poetry in the early 20th century; he expressed his
dream to go back to nature in The Lake Isle of Innisfree. He enjoyed the village scenery and liked
talking with the farmers and fishermen and hearing their folk tales and songs, which fostered in him a
lifelong love for old Irish legends and ancient Celtic myths [1]. And the central themes of his poetry
are Irish history, folklore, and contemporary politics [2]. Undoubtedly, Yeats was deeply charmed by
the mysticism of the Irish countryside. Thus, Yeats created numerous works concerning Ireland to
express his deep affection to Irish culture and his aspiration to Irish independence. In the late 19th
century, aestheticism prevailed in Europe. Under the influence of aestheticism, Yeats created many
works, apart from showing the Irish culture; he felt sorrowful at the turn of the century and expressed
the tendency to escape from the real world. His best-loved poem The Lake Isle of Innisfree is a good
exemplar of getting away from real world and going to the lake isle, like the fairyland in the folklore,
for recluse life. While Tao Yuanming, one of the greatest poets in Chinese history, being tired of
secular society and the ugly nature of human, withdrew from political position and went back to
countryside, and was famous for his poetry series of Back to country life, in which he portrayed
pastoral beauty and leisure rural life, expressing much inner peace of the recluse life.
When describing their free life, both the poets made full use of imagery as well as metaphor. At the
same time, the recluse life in their mind is different from each other because of personal experiences
and social situation. Its obvious that Yeats wanted to escape from the real life and pursued a fairyland
where he might be free from troubles; however, Tao Yuanming would like to get away from political
career of which he despised, and he made it come true to become an ordinary person and to live a
harmonious country life in a village. Undoubtedly, the two poems share some similarities through the
imagery and metaphor used, while they differed from each other in essence from the perspective of
their motivation and other aspects.
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
104
2. Literature review
To study The Lake Isle of Innisfree and Back to country life I, a brief review of the precious study
is necessary. As the case stands, there are many researches on the each poem. Lets examine The
Lake Isle of Innisfree first. The Chinese researcher Duan Qingyan claimed that the poem consisted of
initial conceptions of modernism, and that the main idea of this poem and the poetic techniques used
by Yeats both illustrate the initial attempt of modernism[3]. And she further analyzed some features
of modernism in this poem to prove her claim. However, some researchers study the poem from the
theme perspective, for instance, Although Yeats writing styles are very different at different stages
of life, his poetry has been full of unique Irish Charm [4]. Specifically speaking, Yeats aestheticism
in early times, Irish nationalist movement in the mid times and Imagism in later times, his poetry has
been full of enthusiasm to eulogize the Irish nationalist and Irish culture. His work really reflects
peoples love and fear towards the revolution and his thoughts about the future of Ireland. Different
from others, the poem was interpreted intensely from its text by using interdisciplinary approach. For
example, from painting perspective, readers can easily have an insight on the wonderful world Yeats
pursued in the poem [5]. Shen Xia paid her attention to the imagery Yeats used in the poem. Images
are to make poetry concrete rather than abstract, Yeats was good at using different images to express
personal feelings [6]. In the poem The Lake Isle of Innisfree, Yeats hermitage thoughts were well
conveyed by the concrete manifestation of the image.
As for the poem Back to country life I, people usually focused on its country life and the main
spirits expressed in the poem. For instance, TaoYuanming was the first person to write the pastoral
life into poetry, his personal experiences made it more vivid and concrete, to some extent, he opened
up a whole new world for Chinese poetry [7]. Moreover, Zhang Ningfang contented that
TaoYuanming valued self-respect and didnt bow to the powerful; his pastoral poetry was indeed an
important part of Chinese culture [8]. In the same year, Zhang Zhiguo also praised Tao Yuanming
from spiritual ecology perspective [9]. Different from former learners, Luo Yili maintained that there
were full of imagery and metaphors in the poem, and she analyzed it from the perspective of cognitive
linguistics, aiming at revealing the cognitive mechanisms behind poets creative process [10].
Based on the precious researches, it is easy to perceive that the two poems share much in common,
they not only depict the ideal world the poets dreamed by the use of large number of imagey and
metaphors, but also conveyed the same meaning--the poets wanted to be free from real life. However,
the researchers have little analyzed the causes of such situation. In this state, the paper is to analyze
their similarities and differences at length, expecting to help people to comprehend poets innermost
feelings more deeply, meanwhile, to provide a new perspective for the study and appreciation of
classical poetry.
3. The similarities between the poems

As the poems about recluse life, they have much in common. When portraying their ideal world, both
the poets make the best of imagery and the rhetorical devices, such as metaphor to make the world
more vivid, thus make their voice heard.
3.1 In terms of the imagery
Imagery may be defined as the representation through language of sense experience and poetry
indirectly appears to our senses through imagery, the representation to the imagination of sense
experiences [11]. An image is what presents an intellectual and emotional complex in an instant of
time [12]. And image perhaps often suggests a mental picture, something can be seen in the minds
eye is called visual imagery, and something represents a sound is called auditory imagery. Therefore,
its wise to analyze the poems through the imagery used. Although The Lake Isle of Innisfree and
Back to country life I were created in different times, they made the most of imagery, especially
visual imagery and auditory imagery, to show the colorful life pursued.
105
As the case stands, each poem contains some images, some appeal to the senses. In Yeats The
Lake Isle of Innisfree, there exist small cabin, bean-rows, hive, honey-bee in the first stanza;
cricket and linnets wings in the second stanza; and lake water, shore, roadway and
pavements in the last stanza. And in Back to country life I, Tao Yuanming used hills and
mountains, Birds in the cage, Fish in the pond, land, farm, cottage, rooms elm and
willow, peach and plum, village, smoke from chimneys, mulberry trees, country lanes,
dog and cocks, all the images appeal to our senses of sight that convey not only shape but also
motion. In the meantime, the bee-loud, cricket sings and lake water low sound in The Lake
Isle of Innisfree and dog barks and cocks crow all appeal to the sense of hearing. Static and
dynamic binding shows harmonious surroundings. Since imagery is a peculiar effective way of
evoking vivid experience, and since it may be used to convey emotion and suggest ideas as well as to
cause a mental reproduction of sensations, its an invaluable source to the poet [13]. In this sense, both
poets specialized in describing the recluse life vividly in terms of sense impressions that readers
virtually see and hear what the poets saw and heard to share their excitement at that time.
3.2 In terms of metaphor
Metaphor is an important type of meaning transference in literature [14]. The poets do it because they
want to say more vividly and forcefully by metaphor than they can by saying it directly. And metaphor
may be take one of four forms, depending on whether the literal and figurative terms are respectively
named or implied [15]. Both Yeats and Tao Yuanming took full advantage of metaphors to express
their feelings. In The Lake Isle of Innisfree, Yeats wrote that: And I shall have peace there, for
peace comes dropping slow, Dropping from the veil of the mourning to where the cricket sings there
are two metaphors. One is the peace, the literal term is named, and the figurative term is implied,
the poet regarded inner peace as rain dropping slowly, and the other is the veil of mourning
(morning), the figurative term is named but the literal term is implied. In fact, the poet described mist
as the veil of morning, which really presented the light and thin characteristics of mist. The metaphors
showed the poet really had pleasant time in the lake isle, and enjoyed the peaceful moment there.
The same point applies to Back to country life I, Tao Yuanming wrote that Birds in the cage
would long for wooded hills; Fish in the pond would yearn for following rills. The sentence has two
metaphors, being an official; the poet regarded himself as the bird in the cage that lacked freedom and
fish in pond that missed the old living environment. Though the metaphors, the poet presented his
eagerness to escape from bureaucratic life and gain freedom to live a harmonious life.
4. The differences between the poems

Although recluse worlds were both characterized in details in poems, they were created differently
first in terms of geographical environment. Yeats chose the Lake Isle as his recluse world in his poem,
while Tao Yuanming had country life in the village because of the different geographical environment,
that is, China was an agricultural country at that time, people valued the land, which can supply their
life, but in the United Kingdom and Ireland, there are numerous islands around them, therefore, its
reasonable that Yeats wanted to build a recluse world in the Lake.
And as for the world itself, Yeats considered the lake isle of Innisfree as a fairy land, and the poem
hymned an ode to nature in the Romantic fashion, furthermore, the word will occurred three times
and shall, used as subjunctive mood, in the Lake Isle of Innisfree expressed his aspiration to get
away from the real world as well as showed the impossibility of doing so. Therefore, the recluse life is
mere a dream, which Yeats never realized. Compared with the former, Tao Yuanming, really
withdrew from the official career, spent most of his time living in the countryside, and his recluse life
became the subject of Back to country life I.
106
5. The causes of differences
5.1 The causes on cultural background level

To explore the reasons for the two types of recluse worlds, both cultural background and political
situations of their times should be taken into account. Under the influence of John OLeary, an Irish
ultra-nationalist, W. B. Yeats used poetry as a therapeutic tool for Irish culture and for every member
of modern society, uneasy about the fragmentation of belief. He sought communal healing for Ireland
and his psychological explorations via poetry writing become healing, life-affirming aesthetic
experiences for his readers [16]. Yeats considered it significant to create a highly aesthetic national
culture which would unite the nation in turn. And as one of the most important leaders in this Literary
Renaissance, Yeats had strong Irish identity and insisted on finding heroes in ancient Irish folklore,
aiming at discovering a literary that drives people to struggle for their independence. At the same time,
as an Irish, Yeats considered the lake isle of Innisfree fairyland, where people can keep their identities
as they like; the isolated world is constructed by aesthetic and national spirits.
As is known to people, Jin dynasty was unrest in ancient China and after numerous wars which
brought about a considerable number of calamities, people longed to enjoy life. People can analyze
Tao Yuamings choice from the perspective of Confucianism and Taoism. With particular emphasis
on the significance of the family and social harmony, rather than on an otherworldly soteriology, the
core of Confucianism is humanistic [17]. Confucianism considers the ordinary activities of peoples
life and human relationships sacred, and it values the social responsibility, self-cultivation and
self-creation. Taoism is a philosophical, ethical and religious tradition of Chinese origin whose
emphasis is harmonious relationship with the Dao, which refers to path, way or principle;
however, it advocates something that is the source of everything that exists, as well as the force
behind them, in other words, it is inclined to emphasize wu-wei, which means action through
non-action, that is naturalness, simplicity and spontaneity [18].
Influenced by two theories, Tao Yuanming, first of all, as many typical ancient Chinese literati,
was one of sincere followers of Confucianism which emphasizes personal responsibilities; therefore
he actively chose his political career, expecting to make great contributions to his country. However,
much to his disappointment, what he encountered in his official position was opposed to
Confucianism, human relationships were not sacred any longer because of personal interests, the
world was turbulent and people suffered a lot. He saw the ugliness of human nature. Unsatisfied with
secular society and unwilling to compromise, he withdrew from his political position to embrace
country life, that is, he turned to Taoism, contacted with his neighbors and engaged himself in farming,
enjoying his recluse life in the countryside without worrying about fame and fortune.
5.2 The causes on political situation level
England was in charge of Ireland for centuries. The continuous conflicts between two countries
resulted in many political movements [19]. During this period, Maud Gonne, a beautiful Irish
revolutionary, Yeats pursued for his whole life, was the source of inspiration for much of his early
works. Her revolutionary enthusiasm drove him to participate in Irish nationalist movement. However,
Maud Gonne was a radical nationalist, and she stuck to getting the liberation of motherland via
violence, Yeats advocated a mild and rational way that is using literature as a weapon to arouse the
peoples patriotic passion. In this sense, the conclusion to some extent may be made that it was
because of both political environment and the gap between his lover, which made Yeats miserable
that he longed for a peaceful fairyland, like the lake of Innisfree, where he could gain true peace and
Irish people could acquire independence and freedom.
It should be emphasized that Jin dynasty TaoYuanming lived in was one of the most complicated
times in Chinese history. All authorities urged to extend their land and to gain more power in turn;
therefore, wars and slaughters among them were commonplace at that period. When wars broke out
the society is unstable, it was often the common people who suffered the most, the wars brutally made
107
them homeless and miserable. Some intellectuals would seek opportunity to earn promising future,
however, some only to find that they were unable to get accustomed to the political career, because
they were unwilling to give way to the powerful. Therefore, intellectuals choose a recluse life for
freedom. Tao Yuanming was such a person who at first threw himself into the political career,
expecting to make achievements and accomplish the values of life. However, he was truly unhappy to
be an official; he despised peoples tricks to pursue personal interests. Abandoning the promising
career and accompanied by land, farm, cottage, rooms , elm and willow as well as local
people, Tao worked on the land with heart and soul, and fully enjoyed country life.
6. Conclusion
Despite written in different times by different poets, The Lake Isle of Innisfree and Back to country
life I share the sameness and differences. The recluse world truly existed for Tao Yuanming, the core
of his recluse is to keep inner peace regardless of the secular society, whereas the ideal world Yeats
craved was merely a dream, which only expressed his aspiration to escape from true world and
represented his struggle for nations identity via literature. Different cultural backgrounds and
political situation led the discrepancy of recluse world. The two poems, created in different social
backgrounds reflected the different personal and social values, which render readers to continue to
explore, to question and to explain.
References
[1] B. S. Liu, History and Anthology of English Literature, Henan Peoples Publishing House, pp.
396, 2011.
[2] Z. Y. Huang, Selected Readings In English and American Poetry, Higher Education Press, pp.
395, 2014.
[3] Q. Y. Duan. Analyzing Yeats Initiation of Modernism in The Lake Isle of Innisfree, Overseas
English, pp. 298, 2011.
[4] G. Zhao, IrelandA constant theme of Yeats poetry, Anhui Literature, vol.9, pp. 45, 2012.
[5] M. R. Wang, The soul of poetry in PaintingsAn analysis of The Lake Isle of Innisfree from the
perspective of painting, Bulletin of Chinese Language Teaching, Vol.838, pp. 70, 2015.
[6] X. Shen, The Analysis of Imagery in The Lake Isle of Innisfree, Journal of Taiyuan Normal
University, vol.14, pp. 96, 2015.
[7] H. X. Wu, The Pastoral Complex in Tao Yuanmings Poems, Literary Education, pp. 30, 2011.
[8] N. F. Zhang, The Interpretation of TaoYuanmings Back to country life I, Literary Education, pp.
84, 2011.
[9] Z. G. Zhang, The spiritual ecology of Tao Yuanming, Journal of South-Central University for
Nationalities, vol.31, pp.145, 2011.
[10] Y. L. Luo, and X. G. Qin, The Interpretation of Cognitive mechanism in TaoYuanmings Back to
country life I, Journal of Baohai University, pp. 81, 2014.
[11] T. R. Arp, Perrines Sound and Sense: An Introduction to Poetry, Wadsworth Publishing
Company, pp. 57, 1988.
[12] Z. Y. Huang, Selected Readings In English and American Poetry, Higher Education Press, pp.
396, 2014.
108
[14] S. Y. Wang, Essentials of English Stylistics, Shandong University Press, pp. 66, 2011.
[16] R. Merritt, W.B. Yeats: Poet as healer, Journal of poetry therapy, vol. 22, pp. 235, 2009.
[17] H. Fingarette, Confucius: The Secular as Sacred, Philosophy East and West, vol. 26, pp. 463-477,
1976.
[18] Net.1.Taoism. https://en.wikipedia.org/wiki/Taoism, December 31, 2015
[19] Y. X. Long, and X. J. Zhao, A Study of Political Causes for Two Recluse Worlds, Journal of
Language and Literature, pp. 50, 2012.
109
Analysis on the Present Situation and Integration of Tourism Industry in

Xianning, Yueyang and Jiujiang
Min Zhang, Juncheng Zhu*, Guosong He
School of Resources Environmental and Engineering, Institute of Modern Urban and Regional
Development, Hubei University of Science and Technology, Xianning, Hubei, 437100
hbzhuu@126.com
* Corresponding Author: Juncheng Zhu
Keywords: Small triangle area of Xianning; Yueyang and Jiujiang; Tourism resources; Industrial
integration
Abstract. Integration of Tourism industry is an important part of regional development. Taking

Xianning, Yueyang and Jiujiang as example, this paper applied Super Map and other software to
study tourism industry development. The results show that tourism traffic accessibility in Xianning
is higher than that of Yueyang and Jiujiang, and that tourism industry development in Jiujiang is
better than Yueyang and Xianning. This paper puts forward three ideas for integration of tourist
attractions, integration of the service of travel agency and tourism transportation, and integration of
multi-domain cooperation between government and enterprise.
1. Introduction
In the context of economic globalization, cooperation of regional tourism industry is an inevitable
trend. There are earlier theories on industrial integration abroad. The research on the early industrial
theory is mostly based on the real economy and the commodity economy, with the enterprise and
the market as the main body, while the research on the tourism industry integration is relatively
scare. In the 1980s, the research on industrial integration between tourism enterprises began to
develop gradually. Din K H and Fagerce M argued in 1982 that tourism-related firms must
collaborate on tourism resources to achieve win-win outcomes, and jointly promote the
development of tourism [1]. Ronkainen I and Raig-Smith S argued in 1983 that the sustainable
development of the regional tourism industry must involve the integration of all the tourism
resources. Inkeep, Gunn, and Stewens proposed the concept of consultation and cooperation from
the perspective of regional tourism planning and decision-making of the development route [3].
Alberto Sessa in 1988 analyzed in detail the method of resource allocation and division of labor
between different parts of tourism in regional tourism by quantitative and qualitative analysis, as
well as the combination of tourism development and environment based on the theory of human and
nature [4]. After the 1990s, the empirical research on tourism industry integration appeared and
developed. Weaver in 1998 analyzed the tourism regional integration of the Bojda islands and the
Caribbean Sea by the core-periphery theory [5]. Craig-Smith explored the tourism cooperation
between East Asia and the Pacific region from a large regional perspective, and proposed regional
tourism cooperation methods and countermeasures [6]. As the early scholar studying the tourism
resources, Bao Jigang pointed out that the study of regional tourism resources should take the
location of the study area and economic background as the premise [7].
From the macro background, Xianning, Jiujiang and Yueyang are the gateway cities of the three
provinces. Under the background of the regional cooperation of the middle reaches of the Yangtze
River, the regional tourism industry of Xianning, Yueyang and Jiujiang is facing the pressure of
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
110
simultaneous development with the other cities in the middle reaches of Yangtze River. Based on
this, this paper takes Xianning, Yueyang, Jiujiang as the research object, analyzes and evaluates the
present situation of tourism industry, and puts forward the integration thought, to provide the theory
basis for tourism cooperation in the three cities.
2. Research methods and data sources

2.1 Research methods
The methods adopted in this study mainly include comparative analysis and mathematical statistics,
to classify and analyze the regional tourism resources and industry with software such as Super
Map, so as to put forward the idea of integration.
2.2 Data sources
The data of this study mainly comes from the statistical bulletins of national economic and social
development and the statistical yearbook of Xianning, Yueyang and Jiujiang from 2002 to 2015.
The national tourism resources statistics are from the relevant data in the official website of
municipal tourism departments, and the coordinates of main attractions are from bigmap.
3. Analysis and evaluation of tourism industry

The distribution of tourism resources in the three cities are shown in table 1.
Tab. 1 the state-level tourism resources in Xianning, Yueyang, and Jiujiang
Cities Scenic spots of 3A Excellent tourism National National historical National important
level and above cities in China forest park and cultural city cultural relic
protection institutes
Xianning 13 0 1 0 8
Yueyang 16 1 1 1 17
Jiujiang 24 1 8 1 16
Total 53 2 10 2 41
(Data sources: the relevant data in the official websites of the three municipal tourism departments)
Among the three cities, Yueyang and Jiujiang are excellent tourism cities and national historical
and cultural cities; there are 10 national forest parks, 53 3A level tourism attractions, and 41
national important cultural relics protection institutes, most of which are in Yueyang, followed by
Jiujiang and Xianning.
3.1 Analysis of traffic network accessibility
Accessibility index is used to measure the accessibility of a single tourist node to external travel
traffic[8], with the average path length to calculate the indicator which is generally expressed in the
formula:
n
Aj Dij V (1)
i 1
In this formula, Aj is the accessibility index of node j, Dij is the shortest distance from node i to
node j, and V is the number of nodes. The smaller the accessibility index is, the better the
accessibility is, and vice versa. Here we replace the shortest distance with the shortest time in order
to make easy understanding of accessibility for the public.
In this paper, seven representative nodes of different tourism regions in three cities are selected,
which is based on the number and popularity of tourism resources in the cities. Here we first use
supermap to find the shortest path between the two counties and cities through the provincial
highway and highway, and then divide it by the speed of corresponding sections to calculate the
111
shortest average time interval. To study effectively, take the national highway and the highest speed
as the standards that are the provincial highway 70km / h and high-speed 120km / h, and the
calculated results are shown in table 2.
Tab. 2 The shortest time interval between the connection points of the three cities (Unit: h)
Xianning Tongshan Chibi Yueyang Huarong Jiujiang Lushan
city county city city county city mountain area
Xianning city 0 0.9 1.1 2.4 3.5 3 2.8
area
Tongshan 0.9 0 1.5 2.1 3.3 2.5 2.3
county
Chibi city 1.1 1.5 0 1.7 2.8 3.6 3.4
Yueyang city 2.4 2.1 1.7 0 1.2 4.5 4.4
area
Huarong 3.5 3.3 2.8 1.2 0 4.7 5.6
county
Jiujiang city 3 2.5 3.6 4.5 4.7 0 0.2
area
Lushan 2.8 2.3 3.4 4.4 5.6 0.2 0
mountain area
(Note: The shortest time interval is calculated by dividing the shortest route between two points by the speed of the
corresponding path, which are selected from the provincial and high-speed routes.)
Then put the data into the formula (1) to calculate the traffic accessibility of the seven points in
table 3.
Tab. 3 the traffic accessibility of points in the three cities
points Xianning city Tongshan Chibi city Yueyang Huarong Jiujiang Lushan
area county area city area county city area mountain
area
Traffic 1.96 1.8 2.01 2.33 3.01 2.64 2.67
accessibility
index
From Table 3 we can see that Tongshan County has the highest traffic accessibility, followed by
Xianning and Chibi city, and the accessibility is close in Yueyang, Jiujiang and Lushan, while
Huarong county has the lowest accessibility.
3.2 Economic proportion of tourism industry
By collecting and sorting the tourism economic data in the Xianning, Yueyang, and Jiujiang in 2015,
the results are shown in Table 4.
Tab. 4 Regional distribution of the tourism industry and the proportion in the economy in 2015
Regions Added value of Economic GDP Economic Added The The
tourism income proportion proportion Value of proportion proportion of
(100 million yuan) (%) (100 (%) tertiary of tourism the tourism
million industry industry in industry in the
yuan) (100 GDP (%) tertiary
million industry (%)
yuan)
The whole 1461.05 100 5819.03 100 2487.89 20.4 58.7
area
Xianning 206 14.1 1030.07 17.7 351.01 17.8 58.7
Yueyang 332.68 22.8 2886.28 49.6 1122.29 11.5 29.6
Jiujiang 922.37 63.1 1902.68 32.7 1014.59 48.5 90.9
(Source: the statistics bulletin on the national economic and social development of the three cities in 2015 )
As can be seen from Table 4, the proportion of added value of tourism income in Xianning,
112
Yueyang, and Jiujiang is not average, with 63.1% in Jiujiang and 14.1% in Xianning. Then the
ratios of tertiary industry in economy are also very different, and in Jiujiang the tourism industry
output value accounted for 90% of the tertiary industry output value, while only 30% in Yueyang.
3.3 Summary
From the analysis of tourism traffic accessibility, we can see that the accessibility of Xianning City
is higher than that of Yueyang City and Jiujiang City, which has a great relationship with the
distribution of Xiantong Expressway and Beijing-Hong Kong-Macau Expressway. Although the
time intervals between the various counties and cities are generally 2 to 3 hours and the tourists
spend a shorter time, the direct access lines and transportation systems are not perfect for the tourist
attractions in the three cities. Some management departments of A-level scenic spots even do not set
up the through vehicle, and tourists need to travel by self-drive or renting vehicle. In addition,
traffic signs in some areas are not clear, along with unclear tourist routes.
From the tourism economic data, Jiujiang has the best tourism industry base, with fastest speed
of development, which has a great relationship with its own huge tourism industry Lushan mountain.
Lushan mountain was developed early with great reputation at home and abroad, and it has
excellent tourism value. Compared with other industries, the tourism industry value in Yueyang
accounted for little in its GDP. But its tourism resources are excellent, which shows it has large
potential to develop the tourism industry, so that Yueyang should seize the opportunities, to
vigorously develop innovative tourism industry. Among the three cities, Xiannings GDP and
tourism income are ranked at the end, with lowest GDP and tourism added value. The tourism
industry accounts for large part in the tertiary industry, indicating that Xianning focuses on the
development of the tourism industry, but due to poor industrial base, the tourism industry is difficult
to integrate with other industries cluster. Therefore, Xianning should increase the construction of
tourism industry infrastructure, and plan and implement good tourism policies.
4. Integration ideas of tourism industry

Based on the above analysis, the integration ideas of tourism industry in Xianning, Yueyang, and
Jiujiang are as follows.
4.1 Integration of tourism attractions
With rich mountains and rivers resources and cultural connection, there has been a very good
integration basis in Xianning, Yueyang and Jiujiang. Moreover the tourist attractions of 3A level
and above clusters in this area, which make the integration possible and necessary.
A. The Integration of Natural Geographical Attractions
The characteristic natural scenic tourism zone is created, which includes Junshan mountain,
Jiugong mountain, and Lushan mountain. Junshan mountain of Yueyang and Jiugong mountain of
Xianning are national 4A scenic spots, and Lushan mountain of Jiujiang City is 5A scenic spot.
They have similar natural characteristics, and a variety of individual tourism attractions can be
combined together organically, to reach the integration. them in the region organic combination,
the integration of tourism routes integration. Due to the small area, Junshan mountain can be listed
as a single tourist attraction in the integration. The specific integration of line is as follows: Junshan
mountain- Yunzhong Lake resort - Linhai resort - Longtan Exploration Tour - Guling Town -
Shimenjian - Hanpankou - Wulaofeng mountains - Mianxiu Valley - Lulin Lake - Sandiequan.
B. Cultural Tourism Belt
There are rich cultural attractions in the three cities, which can play the role of cluster, so as to
improve core competitiveness of regional tourism market through cooperation to integrate cultural
attractions with different qualities into a single line. The specific integrated lines is as follows:
Yueyang Tower - Junshan Island - Xiao Qiao Tomb - Quzi Cultural Park - Zhang Guying Village -
Xianning Hot Spring Valley - Chibi Yanglou Cave - Chibi Ancient Battlefield - Lushan Museum -
Lushan Celebrity Residence - Bai Juyi Cottage - Tao Yuanming Tomb - White Deer Hole Academy.
113
4.2 Travel agency service and its integration with tourism transportation
Travel agency is an important part of the tourism industry, and as a tourism enterprise to provide
services for tourist, its advantages are strong market competitiveness and wide range of industries.
Integration of travel agency and tourism transportation will accelerate the overall economic growth
of tourism in the three cities, and constantly balance the tourism industrial economy in the regions.
4.3 Integration of multi-domain cooperation between government and enterprises
In general, the regional tourism resources are developed and managed by the local government, and
enterprises are difficult to participate. However, tourism enterprises is an indispensable part of the
tourism industry, and its value for the local tourism economy can not be ignored. Therefore, for the
efficient development of the tourism industry, the functional integration between government and
private enterprises must be carried out.
5. Acknowledgement
Project information: Hubei Technological Innovation Research Project (Soft Science Research:
2016ADC031);Innovation Team of Urban and Regional Sustainable Development of
HBUST([2016]27) ; Humanities and Social Sciences Research Project of Hubei Provincial
Department of Education (2009q146);Hubei Provincial Education Department Science Research
Project (D20122801); Humanities and Social Sciences Project of Hubei Provincial Education
Department (13g392).
References
[1] DinK H. Tourism in MalaysiaCompeting Needs in Plural Society[J]. Annals of Tourism
Research, 1982, 9(3):453-480.
[2] Ronkainen I. The Conference on Secyrity and Cooperation in Europe.Its Impacton Travel and
Tourism [J]. Annals of TourismResearh,1983,10(3):415-426.
[3] Michael Fagence. Regional tourism cooperation[J]. Annals of Tourism research, 1995, 22(3):
221-223.
[4] Alberto Sessa. Thescience of system for tourism development[J]. Annals of Tourism reseach,
1988, 15(6):219-235.
[5] Weave. Tourism in Tobogo and Barbuda Annals of Tourism Research[J]. Peripheries of the
periphe, 1998 ,25(2):522-523.
[6] Craig-Smith, Proceedings of the Australian National Tourism Research and Education
Conferences[J],1995.
[7] Bao Jigang, Yin Shoubing, Liang Zengxian. Results and Future of Tourism Geography in China,
2011 (12): 1506-1512.
114
The Female Protagonists Journey to Construct their Subjectivity in the

Work of the Woman Warrior
Haixia Zheng
School of Foreign languages, North China University of Water Conservancy and Hydroelectric
Power, Zhengzhou 450011, Peoples Republic of China
freshair1978@163.com
Haixia Zheng
Keywords: Female protagonists; Subjectivity; Different Stages
Abstract. Since the publication, The Woman Warrior has received considerable attention from the
readers and critics. The rich meanings it contains have been interpreted from different perspectives.
This paper is meant to explore the different phrases in which the female protagonists seek to search
for their identity and the long journey they have taken to construct their subjectivity in the
unfavorable situations though based on that feminist approach, but on the macro scope.
1. Introduction
The Woman Warrior written by Chinese American writer---Maxine Hong Kingston turns out be a
masterpiece which brought her a permanent fame in American literary world. And this work marks
the rise of Chinese American literature in the colorful and creative American literary world. Due to
her contributions, Kingston has been granted the National Book Award for Nonfiction in 1981 and
1997 National Humanities Medal. The previous American President Bill Clinton spoke highly of
her: Great writers reveal a world weve never seen but instantly recognize as authentic. Maxine
Hong Kingston is such a writer. In her groundbreaking work, The Woman Warrior: Memoir of a
Girlhood among Ghosts, she brought the Asian-American experience to life for millions of readers
and inspired a new generation of writers to make their own unique voices and experiences heard [1].
Upon its publication, this work has received considerable attention from the literary critics all over
the world. Later it was selected among the text lists read and taught in American high schools and
colleges. Thanks to its rich meanings and implications, the critics have attempted to interpret it from
different perspectives such as postcolonial narrative angle, cross-cultural angle, Orientalistic angle
and so on. This paper is meant to explore the difficult journey the female protagonists have taken to
construct their subjectivity and different paths they have taken to find out their true-selves out of
their marginalized and oppressed situations based on the feminist criticism.
2. Losing of female protagonists subjectivity

In the long history, Chinese women as a particular independent gender group generally has gone
through the following three phases: losing, wakening and expanding of their subjectivity. The
Woman Warrior, actually an autobiography about Kingstons family, consists of five chapters: No
Name Woman, White Tigers, Shaman, At the western palace and A Song for a Barbarian
Reed Pipe. As the title suggests, the first chapter tells a story about my no-name aunt who was
forced to jump into the family well because she could not have been pregnant with her husband
having been absent for years. In the second chapter, inspired by mothers stories of swordswomen,
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
115
Fa Mu Lan, the writer in the first person, I was guided under fantasy by a bird looking like the
ideograph for human into the mountains where I met an old man and an old woman who would
train me to a warrior woman like Fa Mu Lan. The third chapter tells a story about my mother, Brave
Orchid who studied medicine at Hackett Medical College for women at Canton and later migrated
to America to have a reunion with father where they started a laundry for a living. The fourth
chapter is involved with my aunt, Moon Orchid, my mothers sisters story in which she finally
came to America to have a reunion with her sister, daughter and husband after thirty years living in
Hong Kong, but neglected by her husband and unfortunately died in a California state mental
asylum. The fifth chapter tells a story about me who has a long way to go from being silenced in
American society to restore her voices. From the naming and ranking of the female protagonists, we
can detect the writers unique arrangement of the text and their long journey to find the true selves.
In the first chapter No Name Woman, my aunt departed with her husband who went to
America for gold rush shortly after getting married, but to find she was pregnant a couple of years
later. In the traditional patriarchal society, her act undoubtedly violated the social morality and
would bring a massive disgrace to the family. On the night the baby was to be born the villagers
raided her maternal family. At first they threw mud and rocks at the house. Then they threw eggs
and began slaughtering the stock. My aunt had to hide in the pigsty and gave birth in it that night.
The next morning, she and her baby was found to be plugging up the family well. My no name aunt
is the typical representative of being oppressed in the Chinas patriarchal society. Her tragedy
reflects a destined miserable life waiting for all the derailed women. They had to play their
supposed roles such as the filial daughters and virtuous wives, they had to be absolutely
subordinated and obedient to men, accordingly they were deprived of any chance to obtain their
subjectivity and inevitably became the Other called by the feminist critics. The Other concept was
first put forward by Beauvoir in her masterpiece The Second Sex. As de Beauvoir analyzed it,
French society- and Western society generally- is a patriarchy that consistently denies freedom and
personhood to women. Women, for men, are the Other, not seen or observed as they are, but rather
projected out of male needs and defined in subordinate relation to male norms [2]. Beauvoir also
pointed out that humanity is male and man defines woman not in herself but as relatively to him;
she is not regarded as an autonomous being... she is defined and differentiated with reference to
man and not with reference to her; she is incidental, the inessential as opposed to the essential[3]. In
such a patriarchal society, women were in the position subordinated to men. When my no name
aunts adultery was made known to public, she kept the mans name to herself throughout her labor
and dying, she did not accuse him that he be punished with her, because she knew that all the
village were kinsmen, the titles shouted in loud country voices never let kinship be forgotten. She
finally chose death, the permanent silence. Her bitter death didnt get the forgiveness from her
family but rather a deliberate forgetting. The real punishment was not the raid swiftly inflicted by
the villagers, but the familys deliberately forgetting her. Her betrayal so maddened them, they saw
to it that she would suffer forever, ever after death. [4] Her name was omitted from the family tree
and forbidden to be mentioned forever.
The fourth chapter At the Western Palace also tells a miserable story about my aunt, my
mothers sister, Moon Orchid. She was small, fragile and mild-natured. She got married to her
husband by obeying the arranged marriage by her parents. After months of marriage, her husband
went afar to engage in the golden rush. There after years of struggle, he became a famous surgeon,
and got remarried again to a young beautiful nurse and abandoned her and her little daughter. But
she didnt harbor any bitterness against him, instead she was grateful for the money he remitted to
send her daughter through school and college, waiting hopelessly for his return back. What is more
miserable is that when her sister, my mother, Brave Orchid managed to help her to come to
America legally with great strength, she was unwilling to meet her husband for fear that she would
be blamed by her husband for not getting his permission. Under fantasy, she would like to be his
servant to take care of him and his new family if he would like. Although her sister encouraged her
to fight for her rights, to regain her position in her family, however when she finally met her
116
husband due to Brave Orchids careful planning, she shrank from his stare like the savages did,
which silenced her crying. She felt ashamed, covered her face with one hand and motioned no with
the other, feeling like she came into a world of ghosts, bumped around by losing the directions. She
had misplaced herself, her spirit scattered all over the world, each day she slipped further away,
eventually she totally collapsed mentally and was sent to a California state mental asylum where
she died a tragic death. Moon Orchids tragedy also represents the doomed destiny for the women
attached to men in the feudal patriarchal society where the significance of their existence was
defined and denied by men. Therefore, in the traditional Chinese culture, women existed in the
context of social groups rather than individuals, never knowing they were independent beings.
Moon Orchid lost her soul means she lost her subjectivity or her true self as an individual.
3. Awakening of female protagonists subjectivity

My above mentioned no name aunt and Moon Orchid are the typical traditional women characters
in the subordinated and marginalized social positions, serving as the sacrificial lambs of feudal
society. My mother, Brave Orchid, however, was shaped out of my real mother on whom the third
chapter Shaman centers. Unlike my two aunts, she became a heroic protagonist whose subjective
consciousness was awakened and developed by herself. At that time, it was known that my mother
had to bear the oppression from the patriarchal society as well as the tortures of long departing from
my father inflicted by American Exclusion of Chinese. Facing up to these sufferings, she didnt
yield to the doomed destiny like my two aunts, but rather gathered herself up to fight against them.
To get the eligibility to reunite with her husband in America, she studied medicine. To own a room
of her own, she struggled to read in the room haunted by ghosts. On a clear night, the so-called
ghost appeared, it breathed airlessly, pressing my mother, sapping her. She thought it was A Sitting
Ghost. She pushed against the creature to lever herself out from underneath it, but it absorbed this
energy and got heavier. This encouraged her to fight further and stronger. She shouted I do not
give in. There is no pain you can inflict that I cannot endure. Youre wrong if you think Im afraid
of you. Youre no mystery to me. Ive heard of you Sitting Ghosts before. Yes, people have lived to
tell about you. You kill babies, you cowards. You have no power over a strong woman. You are no
more dangerous than a nesting cat[5]. She was endowed with more power by constantly speaking
and eventually defeated the Sitting Ghost.
The Sitting Ghost doesnt assume an interesting shape, merely looking like a boulder. This
suggests that it has some uncertain identities. These uncertainties provide the readers with a huge
space for imagination. For instance, the ghost can symbolize the dual oppression Chinese American
women had to bear from the traditional Chinese patriarchal society and the American racism or
Exclusion of Chinese. The weapons Brave Orchid used to overcome the Sitting Ghost is not the
medical knowledge she had mastered but rather the continuous speaking, which implies the
importance of gaining the discourse rights, because to have the discourse rights equals to have the
rights to speak up for oneself and claim ones identity. After finishing the medical school, my
mother became an outstanding country doctor. Years later, she left China, arrived in New York
Harbor and reunited with my father there. She became an American citizen and enjoyed the rights
to maintain her maiden name, because professional women had the rights to use their maiden names
if they liked, even when they emigrated, they could keep their maiden names, adding no American
name nor holding one in reserve for American emergencies. It is obvious that if women want to
break through the restrictions inflicted on them such as their attachment to the men and fight against
the gender unfairness to regain a new self, they should first get the economic independence as
pointed out by Beauvoir, to be economically independent is the prerequisite to undo their alienated
and oppressed situation. By doing so, they get their transcendence and avoid becoming the second
sex or the Other. Seen from the above, the women as the other is not a natural product, but a
product shaped by the social environment including economy, culture and etc.
117
4. Expanding of female protagonists subjectivity
My mother, Brave Orchid is regarded as a heroine to go beyond the oppressed situation for women,
but as one of the first generation of immigrants to America, she had attempted to keep the family
bond with the affection and the traditional culture. As her daughter,I, or the writer in the sense of
autobiography belong to the descendents of the first generation immigrants. My cultural identity is
quite different from my mothers, I feel alienated from Chinese culture instead of being identified
with it. I want to get the social recognition of American main stream, get integrated with
Americans, but only to encounter huge discrimination, which makes it difficult for me to find my
own position in American society. Being squeezed between two different cultures has made me to
record the livings of Chinese American women and rethink about the gender and racial problems in
a unique way. My thoughts and ideals about how the Chinese American women construct their
singular identity and their true selves are vividly conveyed by my wonderful characterization in the
context.
In the second chapter White Tigers, Kingston adopts the Chinese mythic tales in a creative
way. For instance, she integrates the widely-told story about Fa Mu Lan with another household
story about the mothers tattooing on Yueh Feis back to create a brand new Chinese American
heroine up to times, conveying her ideal of the gender relations between males and females. The
writer or the narrator in the first person,I inspired by my mother stories imagined myself to be the
heroine, Fa Mu Lan. Guided by a mysterious bird looking like the ideograph for human I went
into a depth of mountains, there I learnt the martial arts under the supervision of a fairy old couple
whose family offered me comfort and warmth. This family was filled with harmony instead of the
sexual discriminations and patriarchy, as suggested I saw two people made of gold dancing the
earths dances. They turned so perfectly that together they were the axis of the earths turning. They
were light; they were molten And I understand how working and hoeing are dancing; how
peasant clothes are golden, as kings clothes are golden; how one of the dancers is always a man
and the other a woman[6]. This fantastic picture symbolizes the writers denial of the patriarchal
system and gender antagonism and reflects her new desired compatible, complementary, and
interactive gender relationship. This desired relationship has already been stated in Virginia
Woolfs essay, A Room of Ones Own In each of us two powers preside, one male, one female; and
in the mans brain the man predominates over the woman, and in the womans brain the woman
predominates over the man. The normal and comfortable state of being is the two living in harmony
together, spiritually cooperating. It is when this fusion takes place that the mind is fully fertilized
and uses all its faculties. Perhaps a mind that is purely masculine cannot create, any more than a
mind that is purely feminine [7]. Eventually, I became a warrior woman and led the army against
the enemies including the evil powerful landlords and was welcome back by the villagers as a great
heroine. This marks women can not only become independent selves but also can have the capacity
of becoming great if they are willing to expand their subjectivity.
As a Chinese American writer, having lived in America, Kingston has keenly experienced the
dual oppression from the Chinese patriarchal system and American racism. She has struggled
against this marginalized situation and presented her vision for the settlement of racial and cultural
problems. In the fifth chapter A Song for a Barbarian Reed Pipe, Kingston narrates her childhood
experiences in the first person. The emphasis is mainly put on my painful struggles against the
exclusion from the American main stream as a minority member. When I went to kindergarten, I
became more silent because I was able to speak quite little English, out of which I was rejected
and ignored by the teachers and classmates. Later on, as I grew up, my mother was meant to
nurture me to be good housewife, but I decided to study hard to be an independent individual
instead of having to be subordinated to men economically or socially. Although I stood out
among my classmates, I was also discriminated, as suggested I studied hard, got straight As, but
nobody seemed to see that I was smart and had nothing in common with this monster, this birth
defect. At school there was dating and dances, but not for good Chinese girls[8]. Therefore, the two
words that troubled me most are I and here, which expresses the writers confusion about her
118
cultural identity as a minority member. Who am I and Where do I belong have become the issue
she always interrogates, which foregrounds the difficulties for Chinese American women to find
their selves and to construct a new type of identity. But her marginalized situation can also provide
her with a best perspective to examine and reflect on the Chinese and American cultures free from
being influenced by either of them. At end of this novel, the writer reuses Tsai Yens story in
which Tsai Yen, a poetess born in A. D. 175 who was captured by a chieftain during a raid by the
Southern Hsiung-nu. This poetess was actually unable to adjust to the life of foreign land, but with
the writers recreation, she is able to get accustomed to a foreign life and sing her own song loudly
and clearly in Chinese that the barbarians can understand. This recreation undoubtedly embodies the
writers ideal of rethinking about the cultural and racial problem. Tsai Yen here becomes an ideal
person who can eliminate the cultural barriers and live in harmony with the barbarians, as suggested
Eventually her children sang along when she left her tent to sit by the campfires, ringed by
barbarians[9]. This figure conveys the writers wishes: people with different cultural backgrounds
can live peacefully, interact and exchange freely with each other. In the meantime, this figure
represents the Chinese American women who can find their selves, expand their subjectivity and
construct a new type of cross-cultural identity.
5. Conclusion
The protagonists created in The Woman Warrior have long attracted the readers and critics
attention. Confronted with the unfair fate, they took different approaches. My no name aunt and my
another aunt, Moon Orchid yielded to the massive oppression from the patriarchal system. They had
no courage to struggle against the established social order. Therefore, they lost themselves without
any subjectivity, they did not know who they are, what they can become, completely reduced to the
victims of patriarchal ideology. My mother, however, unlike my two aunts, managed to fight
against the unfavorable conditions by violating Three Obediences and Four Virtues. She finally
became a famous country doctor, winning respect from all people in and around her village, years
later moved to America to reunite with her husband where she supported a large family by working
midnight. Her economic independence set her free from the subordinated position to men. So her
endeavors symbolize the awakening of womens consciousness or subjectivity, though she was
internalized with some traditional Chinese cultures to some extent. The writer in the autobiographic
sense, I as an ethnic woman in America has to bear the double oppressions imposed from the
gender and racial discriminations, but I do not surrender to the destined fate for the ethnic women.
By reusing the stories of Fa Mu Lan and Tsai Yen, I make it clear that the ethnic women can not
only become heroines but also can build a cross-cultural bridge between different cultures. This
indicates womens self-transcendence of searching for identity and subjectivity. In a word, these
impressive women characters represent the different phrases in which they search for their identity
and subjectivity.
References
[1] Clinton, Bill. Remarks at the Arts and Humanities Medal Awards dinner.Weekly Compilation of
Presidential Documents, Vol.33 Issue40, p1458, 1997.
[2] Richter, David H. Eds. The Critical Tradition: Classic Texts and Contemporary Trends. Boston:
Bedford Books, p1065,1989.
[3] Beauvoir, S. D. Ed. The Second Sex. New York: Vintage Book, p26, 1974.
[4] Kingston, Maxine Hong. The Woman Warrior: Memories of a Girlhood Among Ghosts. New
York: Vintage Books, p18, 1989.
[5] Ibid, pp82-83.
119
[6] Ibid, p32.
[7] Woolf, Virginia. A Room of Ones Own. New York: Harcourt, p73, 1929.
[8]Kingston, Maxine Hong. The Woman Warrior: Memories of a Girlhood Among Ghosts. New
York: Vintage Books, p228, 1989.
[9] Ibid, p243.
120
Study on the Artistic Expression of Chinese Character Design in Modern

Packaging
Bing Liua, Fan Wangb,*

Academy of Fine Arts, Northeast Normal University, Changchun130024, China
a
ice8515@163.com, bwangfa06@163.com
Keywords: Packaging design; Chinese character; Artistic expression; Traditional culture
Abstract. Analyze and discuss the artistic expression of Chinese characters in traditional packaging
design, research on embodiment of Chinese character elements in modern packaging design, research
focuses on the application of visual expression and creative thinking. The results show that Chinese
characters are important design elements of modern packaging, combining the visual performance
and rich connotation of Chinese elements, make full use of its application methods and design skills,
can make the emotional characteristics of Chinese elements, in modern packaging design with a
broader and more reasonable design performance.
1. Introduction
The development of Chinese characters has a long history; Chinese character itself has the image of
beauty, and reached the highest level of art. Chinese characters can not only convey commodity
information, play packaging promotion function, and the most direct and effective visual
communication factor in packaging design. The originality of Chinese character font design is to
change the "reading symbol" into "visual language", in the packaging design assume the transmission
of information, the role of communication vision, this is a summary of the previous experience of
expression, and create new performance symbols of thinking activities, is an unconscious process of
font design [1-3].
From the perspective of modern packaging design, Chinese characters as the most simple design
elements, rich and complex design means, each era created fonts are branded era imprinted, from the
line changes show rich philosophy and personality. The overall visualization of the packaging design
is to explain the meaning of the text, with the performance of commodity content features, make the
font can be used as identification tool, and form a picture, accurately convey the distinctive and
unique commodity information [4, 5].
2. Analysis of modern packaging design

Modern packaging design is the design of commodity packaging, structure and decoration. The use of
advanced technology to achieve protection of products, reduce consumption, facilitate transport, easy
to use purposes, and as a propaganda commodity, establish brand and communication culture of
powerful media [6,7]. Therefore, packaging design can be considered through the selection of suitable
packaging materials, the use of clever means of technology, in order to pack the goods and carry on
the container structure modeling and the beautification commodity decoration design.
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016

121
2.1 Development trend of modern packaging design
With the development of science and technology, packaging design features more perfect. The
original function of packaging design is to protect the goods, convenient transportation. Modern
packaging design and more new requirements, such as: aesthetic and emotional, psychological
consumption and emotional experience, human design and interactive packaging. Green packaging
design focusing on health, attention to ecological materials, recycling technology has also been a large
number of promotions; dynamic packaging is also widely used by designers, mainly the dynamic
design between products and packaging, dynamic design between packaging and packaging, dynamic
design of products and consumers.
The style of packaging design, more tend to Chinese national characteristics, a good packaging
design, not only fully reflects the cultural connotation of the works want to express, but also with the
brand, packaging design with traditional culture can leave a deep impression on people. The
traditional culture elements applied to packaging design, give full play to the influence of traditional
culture, and combined with modern packaging technology to create a diversified design trends, in the
forest of nations of the world, seek the traditional elements belonging to our Chinese nation, create the
packaging brand belonging to our own nation.
2.2 The significance of Chinese font design to packaging design
In the modern packaging design, Chinese character design with Chinese national and cultural
characteristics, more and more attention by designers and consumers. The design of Chinese
characters plays a key role in the style of nationalization packaging design, Chinese character itself is
a symbol of nationalization, its shape is different, change myriad. Chinese character is the main
component of visual elements in packaging design, packaging design to the international market, has
a huge role in promoting. Designers should continue to tap the potential of the Chinese characters, to
enrich its form, then let the ancient Chinese characters, as the vitality of visual elements, in the field of
packaging design great splendor.
Modern packaging design has been widely used in social life, as a form of commodity culture,
packaging design exists independently, packaging design cannot abandon its traditional cultural
foundation and national characteristics, and this fully embodies the culture and temperament of a
nation. Chinese character font design as decorative elements, applied in packaging design, meet the
development trend of packaging design. Nowadays, people's life is not only comfortable, And
gradually shift from material life to spiritual life, this is fully reflected in the packaging design, people
now not only pay attention to the inner embodiment of packaging, pay more attention to the external
form of packaging, therefore, the use of Chinese characters this ancient design elements, can make the
nationalization of packaging design has greater room for development.
3. The embodiment of Chinese character design in packaging design

The design method of Chinese character font in modern packaging design is mainly, analyze how
different fonts are applied reasonably in modern packaging design, in the realization of information
dissemination at the same time, enhance the visual effect of the product, to achieve the purpose of
marketing propaganda.
3.1 Deconstruction forms of Chinese characters in the packaging design
The design of deconstruction in Chinese characters: refine the specific font form elements, in
accordance with the intended purpose of communication and the pursuit of visual effects, after the
deformation treatment, with other elements, and integrated into the design work, So that the overall
natural form, design symbols show structural relevance between, to achieve the artistic effect of
emotions.
122
In the modern packaging design, deconstruction Chinese characters pay more attention to the
planning and performance of strokes; especially, the font distortion, tilt, dislocation, illusion,
overprint processing, the structure of Chinese characters greatly highlights the visual beauty and order,
for the viewer to bring endless associations and imagination. The application of deconstruction
Chinese characters design, provides a new design thought and method for modern packaging design,
showing the visual beauty and order, and provides a new way for the internationalization of Chinese
traditional packaging design.
3.2 Abstract and graphic of Chinese characters in the packaging design
In the modern packaging design, we often abstract and graphical processing of Chinese character
design, weaken the function of Chinese character recognition and information transfer, as a graphic
element, and other packaging design elements to form a good match and coordination. To some extent,
abstract, graphic design after the Chinese character has a strong appeal and expressiveness; especially
to enhance the entire packaging works personalized style.
The advantage of graphics is that it improves cognition and memory of information, text can
quickly understand its meaning. Combined with text and graphics, able to strengthen key information,
better to achieve the purpose of cognition. Text graphics in packaging design of the most prominent
feature is easy to identify, and fully embodies the product information, visualization, art and other
visual language features.
3.3 Forms on calligraphy of Chinese characters in the packaging design
Calligraphy is the carrier of Chinese characters, represents the essence of Chinese art and culture, it
has the times of the aesthetic and artistic features, is an art form based on Chinese characters. From
the emotional expression of creation, calligraphy design can change through rich lines, with the
pursuit of culture, the beauty of form, rational induction to convey the emotions of characters, to bring
spiritual demands to the viewer.
In the modern packaging design, designers can directly with a special connotation and emotional
charm of calligraphy fonts, applied to the design work; designers can also according to the
characteristics of different products and the need for information expression, innovative design of
various calligraphy characters, made the packaging design, more artistic charm and good visual
perception.
3.4 The strokes of Chinese ink-wash on Chinese characters in the packaging design.
Ink Chinese characters have special modeling features and are widely used in packaging design; in a
sense, it is a form of artistic expression, greatly highlights China's traditional art Chinese characters
free and easy, simple and free, especially between ink Chinese characters strokes cadence, order of
priority, highly varied flavor characteristics, showing a distinct sense of rhythm and weight sense,
greatly increased the performance of packaging design works, which gives the viewer a wonderful
visual enjoyment.
Mr. Jin Daiqiang, the famous designer, according to the traditional Chinese ink strokes created
many excellent works; this proves the perfect combination of Chinese traditional culture and Western
design concept, with feasibility and breakthrough. Such packaging design, the use of ink painting
composition "white when black" blank form, to achieve the unity of the overall picture structure,
creating a harmonious picture effect.
4. Summary
Study on the manifestation of different fonts in Chinese font design, the results show that the Chinese
character font design is rich in line changes and the structural characteristics of calligraphy and
painting, to convey information content of implication deep and emotional rich. In packaging design,
the deep understanding of the emotional characteristics of different font differentiation, and their
123
reasonable application in product packaging, is conducive to consumer identification and
interpretation, so as to achieve the intended purpose of the dissemination of packaging design
information. Packaging design is constantly impacted by various social cultural phenomena and
concepts, which adds new cultural connotation to traditional consciousness and social function.
Packaging design, as a cultural form exists, fully embodies the culture and temperament of a nation.
The cultural beauty of the nation is more and more prominent in the packaging design, the
representative cultural elements are reorganized and analyzed, not only for the modern design to
provide a wealth of visual language, but also allows the public to understand the information, so that
packaging more commercial value.
5. Corresponding author
Wang Fan, Professor, Northeast Normal University, CHINA, wangfa06@163.com.
6. Acknowledgement
The author gratefully thanks the financial support by Research Project in National Social Science
Foundation Art Project (14BG085) and Jilin Social Science Fund Project (2013BS14).
References
[1] Xinghai Chen, Huan Yang and Haijin Liao, Thinking of the future attribute of Chinese characters
under the condition of new media technology, 2009 IEEE 10th International Conference on
Computer-Aided Industrial Design & Conceptual Design, pp. 1914 - 1917, 2009.
[2] Dan Zhang, A Cross-Cultural Exploration of Children's Preferences of Package Design: The U.S.
and China, Journal of International Consumer Marketing, vol.25, pp. 391-404, 2014.
[3] Shouhui Zhao, Chinese Character Modernization in the Digital Era: A Historical Perspective,
Current Issues in Language Planning, vol.27, pp. 315-378, 2009.
[4] LEI Zhongmin, REN Jun, Origin and Artistic Charm of the Application of the Chinese Character
in Packaging Design, Packaging Engineering, vol.28 (8), pp. 152-154, 2007. (In Chinese)
[5] ZH Zhao, Discussion on the Path of Character Design in Commodity Packaging, Journal of Jilin
Teachers Institute of Engineering and Technology, vol.29 (9), pp. 73-75, 2013. (In Chinese)
[6] WEI Zhengqing, Discussion of Character Design in the Modern Package Design, Art and Design,
vol.6, pp. 63-65, 2010. (In Chinese)
[7] S MukaiG MiyazakiFactorial Invariance in Evaluation of Impressions Between Fonts and
Package Designs Using Structural Equation Modeling, Bulletin of Jssd, vol.61, pp. 107-110,
2014.
124
The Research for Cultural Connotation of Marine Dragon Boat Racing in

Zhanjiang of China
Yongfeng Zhao1,a, Lei Shi2,b, Jianqun An1,c
1
Physical Science College, Lingnan Normal University, Zhanjiang, Guangdong, China
2
Gansu Commmunications Institute of Technology, Lanzhou, China
a
635733121@qq.com,b707651312@qq.com,c643520850@qq.com
Keywords: Dragon boat; Zhanjiang; Culture
Abstract. The history of marine dragon boat racing of Zhanjiang is as long as the history of human
being in Zhanjiang. That is a gradually developing process, and an essential ingredient for the
whole Zhanjiang history and culture. With features from totem culture, marine culture, folk culture,
and military culture, it has combined with local folk custom and festivals, becoming an
indispensable part for peoples entertainment at leisure. Actually, that has become an unique culture
phenomenon and a precious cultural inheritance. Putting more efforts on study of Dragon Boat
Racing is of great significant of local culture in Zhanjiang.
1. Preface
The time-honored dragon boat race is a traditional sporting event widely loved by the Chinese
people. Apart from national, artistic, technical, competitive, collective, and fund natures [1], it is also
helpful in improving fitness, leading to positive influence on participants' cardio-pulmonary
function, anaerobic power, and recovery capability [2]. Dragon boat race is often mentioned to
memorize the great patriotic poet in ancient China - Qu Yuan [3]. As for this, it also cultivates
people's courage, aggressiveness, and patriotism. Just as other sports culture forms, Marine Dragon
Boat culture reflects the characteristics of an era, a area, or nationality, regularizing people's sports
behavior, and affecting people's value and concept.Protection, inheritance, and promotion of dragon
boat race in Zhanjiang are practical needs of local people. This is quite significant in constructing a
happy Zhanjiang.
2. Dragon boat culture and Zhanjiang marine dragon boat culture

2.1 Dragon culture and dragon boat culture
China is the country of dragon, and the Chinese people are descendants of the dragon. However,
dragon does not exist in natural environment. Instead, it is a spiritual material, as well as a
supernatural and artistic creation [4]. The image of dragon has a long history in traditional Chinese
culture. It combines the dream, the wish, the intelligence, and the power of ancestors of the Chinese
nation, with a deep and solid root, as well as profound connotation. As for this, dragon has almost
become "the badge of the Chinese nation" [5]. Seeing from existing information and archaeological
discovery, the origin and development of dragon is basically consistent to the origin and
development of civilization of ancient China. Dragon is the God of Water, and it is dragon's duty to
rain and to administrate water. In modern society, dragon gradually transforms from a divine
element into a mascot. As a mascot, dragon means fly, inspiration, exploitation, improvement, etc.
The life and vitality of dragon rest on water. Dragon lives on water to control the forces of nature,
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
125
and to move freely. Or else, without water, a dragon is not alive. As a focal point of primordial
religious spiritual concept, the core reflection of China's dragon boat culture is dragon totem. In
Chinese, Zhou means boat. "Ancient Chinese prefer the name of Zhou, while the people of Han
nationality prefer the name of Chuan". The historical and cultural development of dragon boat
reflects the unique dragon culture in China. In the development process of dragon boat, Chinese
dragon culture could be seen almost everywhere. The historical culture of dragon boat is also one of
the carriers and heirs of Chinese dragon culture. Dragon symbolizes China, the Chinese nation, and
Chinese culture. In thousands of years' history, dragon has permeated into every aspect of the
Chinese society, becoming a cultural cohesion and sedimentation. From the historical and cultural
development of dragon boat, we may be able to understand the development of Chinese dragon
culture and the Chinese nation, and to see the development of Chinese dragon culture, which
provides necessary foundation for researches on Chinese dragon culture.
2.2 The Ancient Marine Dragon Boat Racing in Zhanjiang
In late Neolithic Age, ethnic groups in southeastern and southern China were called by a joint name
- Baiyue. In Chinese, "Bai" means plenty of castes and branches. There were more than forty names
of Baiyue recorded in "Lushi". General History of Guangdong recorded that, people living on
Leizhou Peninsula of that period were actually the Luoyue nationality in Baiyue. In history, there
were plenty of potteries with ripple, wave scroll, and checkered fishing net pattern, as well as
ceramic chips found in Leizhou Peninsula. Worthy of mentioning, ripple pottery jar with cover from
the Warring States Period and excavated in Songhuangxiang of Naozhou Island was famous across
the world for its well-designed structure and fine texture. This reflects local people's attachment to
water and adoration to nature. So far, there is no historical record about dragon boat found in
Leizhou Peninsula. However, in the city of Chongzuo, 300 kilometers west of Leizhou Peninsula,
there is dragon boat race in cliff painting of Zuo River created by people of Luoyue[6]. On the other
hand, archaeological circles have found "canoe" and "wooden paddle" in coastal area of Lingnan,
with 3000 to 7000 years' history up to now. The living habit of Luoyue nationality was to "take boat
as carriage, and paddle as horse". Thus, it may be said that, ancestors of Zhanjiang had already
started boat races in that period. According to Volume 10 of Chronicles of Leizhou Government by
Ouyang Bao, Surveying Official of Ankang, the earliest written record about dragon boat race
derives from Wanli 43th Year of the Ming Dynasty (A.D.1615). Based on the record, written
records of dragon boat race in Zhanjiang have at least 400 years' history. In Kangxi Period of the
Qing Dynasty, Zhanjiang established 10 trade ports along its coastal line, including Haian, Chikan,
Anpu, Meilu, etc. For this reason, marine transportation and commercial trade were developed fast,
bringing about prosperous economy. In the flourishing age, a lot of folk festivals and entertainment
activities appeared. Dragon boat race also entered its full bloom period. Between the 11st year and
the 51st year of Kangxi period (1672-1712), Chronicles of Leizhou Government, as well as other
county annals were successively compiled in Zhanjiang, Haikang, Wuchuan, Suixi, Xuwen,
Shicheng (Lianjiang), and other places of the region. What's more, records concerning the grand
occasion of dragon boat race on Dragon Boat Festival could always be found in Custom Volume of
these local annals. At that time, dragon boat race held yearly, from preparation to ending, would
often last for more than 10 days. Dragon boat had exquisite outer appearance, mighty nose, and
colorful decoration. Costume of scullers, as well as quants were of the same color with dragon boat,
creating a magnificent atmosphere.
2.3 The modern marine dragon boat racing in Zhanjiang
On June 19, 2007, the 1st China Zhanjiang International Dragon Boat Invitational Tournament was
grandly held in the sea area of Long Corridor in Jinsha Bay.In the 4th race held in 2010, there were
totally 51 teams overseas and domestic participated. These teams came from Australia, America,
Europe, and other places across the world. The number of foreign players reached up to 420.From
the 37 competing teams at the beginning to the 51 teams in the 4th and 5th session, and until the 38
teams in the 8th session of 2014, people experienced the continual development of Zhanjiang
126
Marine Dragon Boat Invitational Race, as well as the improvement and reorientation of the race.
The full name of the first dragon boat race was "China Zhanjiang International Dragon Boat
Invitational Race". After that and until 2012, in order to conform to the governmental call of
practicing economy, the race no longer invited foreign terms, and the name of the event was also
changed to "Zhanjiang Marine Dragon Boat Invitational Race". As for this, standard, scale, team,
and influence of the race were significantly reduced. Without rostrum, opening ceremony, firework
show, and leader presence, people might feel the least of perfection. However, the race truly became
a folk feast to all local people of Zhanjiang. For example, in the first competition of 2007, only lion
dance, dragon dance, and other similar folk cultural performances were put on before the race. In
2013, citizens might enjoy delicious foods, fly kites, visit book fair, watch sailing boats, and
appreciate dragon boat models. In 2014, apart from sailing boat and kite shows before the
competition, there were also a series of new activities organized, such as "Poly Dreamy Magic
Show", "Haigang New City Concert", "ICBC Happy Water-Sprinkling Festival", "Happy Bear
Street", "Street Show", "Energetic Beach Performance", etc. These activities enabled every citizens
and tourists at the site to fully experience and feel the cultural charm of Zhanjiang. From "Duanwu
Festival" to "Dragon Boat Festival", dragon boat race of Zhanjiang realized a transformation from
tradition to modernism, presenting new vitality and orientation.
3. Cultural connotation of marine dragon boat race in Zhanjiang

3.1 Totem culture characteristics
The so-called totem culture is various cultural phenomena deriving from totem concepts, i.e.
cultural phenomena created by people after they took totem as their relatives, ancestors or
protection angle, so as to express their adoration to the totem. Totem culture is one of the oldest and
most spectacle cultural phenomena in human history. Primitive ancestors of Zhanjiang mainly lived
on fishing and hunting. For the purpose of living and reproduction, they had to fight for food with
snakes, crocodiles, and boas. Moreover, they were often threatened by animals in water. In fishing
and hunting, they found that, snakes were able to go freely and mysteriously in water, which were
quite arrogant and domineering. Out of the wish for existence, they came out of the adoration to
snakes, hoping to imitate the shape of snakes. As for this, "snake adoration" and "snake totem" were
invented. The people of Yue took snake as their totem faith, which was reflected by many
archaeological discoveries. In many geometrical patterns with period from late primitive society to
the Western Han Dynasty, there were snakes included. Recorded by Wu Yue Chun Qiu, "in order to
defeat Chu State, Wu State established Chu Defeating Gate, and in order to annex Yue State, it set a
wooden snake at the south gate" . Here, "snake totem" and "dragon totem" are actually of the same
thing [7]. In aspect of shape, the basic outline of dragon is snake, and dragon is quite similar to snake.
In Zhanjiang area, there were many Dan people who lived on the sea, and they were descendants of
ancient people of Yue. The people of Dan recorded that: "painting snakes on palace for sacrifice
offering, and considering themselves as the descendants of dragon", "green snake was regarded as
green dragon, and was respected as divinity ...... while a ceremony was set to welcome the green
dragon". In the Spring and Autumn and Warring-states Period, China entered a stage of great
nationality combination. The First Emperor of Qin unified China, and Emperor Wu conquered
South Yue. As for this, the ancient Yue amalgamated with the Chinese nationality soon. As for this,
totem of ancient Yue also integrated with the God of Dragon in the Chinese nationality, jointly
evolving into the dragon adored by the Han nationality. For this reason, totem gradually withdrew
from the historical arena when tribes were extinct.As a basic cultural force in human culture, totem
culture strongly affects human's life and social development since the primitive tribal clan period.
The invention of boat derived from primitive ancestors' production, life, and labor creation. The
development from boat to dragon boat carried primitive people's faith on and pursuit for good life.
Dragon boat culture of Zhanjiang is a combination of diversified culture formed by totem evolution
of ancestors on Leizhou Peninsula, as well as national fusion. Apart from versatile intrinsic nature,
127
it also contained the nature-conquering resolution and courage of people on Leizhou Peninsula.
3.2 Marine culture characteristics
From birth to present, dragon boat race of Zhanjiang inevitably contains obvious marine culture
characteristics. This should be attributed to the special geographical location and natural
environment of Zhanjiang. Zhanjiang has a coastline of more than 1556km, approximately
accounting for 2/5 of Guangdong Province, and 1/10 of the nation. Leizhou Peninsula covers an
area of 8000 square kilometers, and is one of the three largest peninsulas in China. Thick red soil
runs through the area from north to south, as if a red dragon flying above the sea. What's more, the
peninsula has lots of natural disasters, drought, thunder strike, typhoon, storm, flood, rainstorm, sea
tide, and tsunami happened occasionally. Adding up with pirate, war, and other man-made disasters,
people living here suffered a lot. These typical natural environment and social environment forced
the fiery, hardihood, generous, and complicated character of peninsula people, and also endowed
dragon boat race here with unique marine culture characteristics. First of all, the marine culture
characteristics of dragon boat race in Zhanjiang are reflected by its racing location - the sea.
Compared with lakes and rivers, marine race is more difficult, which may be able to better reflect
local people's doughty and perseverance. This fully proved that, in tradition, dragon dominates the
sea, "the world of dragon is the sea, and the home of dragon is island" [8]. Secondly, the marine
culture characteristics of dragon boat race are reflected by racing equipment and number of players.
The total length of international standard dragon boat is 18.40m, with 24 players. Dragon boat of
Zhanjiang has sharp nose to break sea waves. The hull is luxury, elegant, nimble, and dexterous.
The total length of boat is 22m, with 36 players, including separately 1 helmsman, flag-bearer,
drummer, and gong beater, as well as 32 boatmen. By contrast, small dragon boat is unable to cope
with large sea waves. In tradition, people of Zhanjiang lived on fishing and shipping. Xuwen of
Zhanjiang used to be the starting point of Maritime Silk Road in ancient China. "Miwei Boat made
in Naozhou was 20m in length and 5m in width, which is capable to carry 50 tons of fish", and was
ranked as the largest Miwei Boat, as well as the largest fishing boat in China. Fishing boat of
Zhanjiang often gathered in crowds and groups to fishing ground of Xisha and Nansha Islands. The
quantity and size of boats, as well as the range of navigation were rare across the nation. As for this,
dragon boat race of Zhanjiang is closely related with such marine production and life. Thirdly,
marine culture characteristics are also reflected by sporting patterns. Apart from adoration and
veneration to the God of Dragon in ocean, dragon boat race also demonstrated the collective power
of human, and the struggle against nature. Race on the sea has to face large sea waves, leading to
high risks. As for this, participants are obliged to have collective consciousness to achieve close
cooperation and teamwork. The race is to be carried out upon the efforts of many people. This is the
most complicated expressing form of dragon boat of Zhanjiang, as well as an important reason for
the existence and development of dragon boat race of Zhanjiang in tough coastal area. Moreover, it
reflects the resolution and faith of people by the seaside when facing disasters.
3.3 Folk culture characteristics
Folk custom is also interpreted as "Feng Su" in folk. Normally, in Chinese, elements formed by
natural conditions are referred to as "Feng", and elements triggered by social environment are
named as "Su". "Feng Su" is a combined product of the two. In tropical and coastal environment,
native people of Liliao and people of Han nationality in Zhanjiang successively became the main
part of local residents. Based on existing social and economic life, folk culture of Leizhou was
formed. Apart from retaining Liliao culture, culture of Han nationality and overseas is integrated as
well, forming strong regional characteristics. These characteristics were fully reflected in aspects of
festival, marriage, funeral, diet, and entertainment. Folk culture of Leizhou Peninsula is cultural
mode formed in the long history with primitive cultural image as the core, and based on the cultural
consciousness of residents on Leizhou Peninsula. Dragon boat race is one of the enduring folk
culture forms on Leizhou Peninsula. The race was held yearly on Dragon Boat Festival: i.e. May 5
of lunar calendar. In folk, people regarded the festival as a date for "exorcism". Hereby, the festival
128
is also referred to as "Water Ghost Festival" or "Water Spirit Festival". Since the first day of May,
people would plug mugwort stick to door header for the purpose of "exorcism". On the 5th day of
May, children hung fragrant amulet (triangular or animal-shaped amulet made from fragrance
wrapped by colored cloth) on their chest to "drive away evil spirits". In cities, since the first day of
the month, mugwort and herb were sold everywhere in streets and alleys. Citizens plugged mugwort
and herb on their doors, and boiled water with mugwort and herb for bathing. The time for bathing
was normally set at 12 o'clock. It was said that bathing with mugmort water helped to drive away
evil influence and skin disease. On May 5th, people around the place ate zongzi (traditional Chinese
rice-pudding), and held grand dragon boat race. Having experienced a long history, the activity is
still popular. Between the 11st year and the 51st year of Kangxi period (A.D.1672-1712),
Chronicles of Leizhou Government, as well as other county annals were successively compiled in
Zhanjiang, Haikang, Wuchuan, Suixi, Xuwen, Shicheng (Lianjiang), and other places of the region.
What's more, records concerning the grand occasion of dragon boat race on Dragon Boat Festival
could always be found in Custom Volume of these local annals. The day of dragon boat race
gathered huge crowds of people, with deafening sound of gongs and drums, and firecrackers
volleying in the sky. As yell incessantly lingering on, the occasion was really bustling. According to
local custom, apart from silver award, the winner got a roasted pig, the runner-up got two roasted
gooses, and third winner got plenty of fruits. After the race, people dined together, eating zongzi
and drinking Changpu Wine as celebration.Dragon boat race reflects the primitive god worship of
people in Leizhou, including the wish of "forever blessing" from gods, as well as the primitive
thought of harmoniousness between the heaven and human, conquering the nature, and identity
recognition. Later on, sport was even closely combined with folk custom, becoming a way of life to
entertain and to relieve. This in return reflected folk culture. It has features of universality,
inheritance, variability, etc.
3.4 Military culture characteristics
Military culture, briefly speaking, is the summation of all spiritual achievements created in humans'
military practice and activity. In history, military culture reflects the special achievement and
national property of a country and a nation when utilizing nature, exploiting nature, and conquering
nature in a broad field. War is the main channel for military culture propagation. Military culture
characteristics of dragon boat race in Zhanjiang are related with the special social background of the
region: frequent wars and disasters. Besides, it is also affected by rampageous pirates in the area in
the period of late Ming Dynasty and early Qing Dynasty. Boundless seatakes in hundreds of rivers.
The broad breast of ocean is just a paradise for fishes. As for this, Leizhou Peninsula has highly
developed marine fishery, and is one of the largest fishery bases in China. Drawing support from the
advantageous geographical environment, apart from fishing, people on the peninsula also lived on
shipping, salt making, pearl collecting, and other oceanic economies. Being faced with wars, pirates,
and other man-made disasters, people had no choice but to escape in their boats as fast as possible.
Both sides at war also took quick movement of boats as the key to victory. For this reason, the birth
and development of marine dragon boat race inevitably contained military culture elements.On one
hand, dragon boat race is helpful in body building, protecting homes and defending the country. On
the other hand, it stimulates people's aggressiveness, increases people's willpower, and making
people fearless. This is also the reason for the doughty character of people on Leizhou Peninsula.
Thus, marine dragon boat race of Zhanjiang contains obvious military culture characteristics.
4. Conclusion
Suffering more than a century's impact from western sports culture, traditional Chinese sports
culture is faced with cultural crisis. Nowadays, with the strength of the country improves, the
opportunity to revitalize traditional sports culture of the Chinese nation has come. Dragon boat
culture is an indispensable constituent part to traditional Chinese culture, which includes patriotic,
vigorous and promising spirit that is necessary to present society. Relying on rich regional culture
129
and long history, dragon boat race of Zhanjiang has deeply blended in the blood of people in
Zhanjiang. Its significance is far more than entertainment, leisure, and competition. Instead, with
the development and fusion of social economy, it forms multi-layered and diversified combinations,
as well as unique cultural phenomenon. It is actually a rich cultural heritage.
5. Acknowledgement
This research was financially supported by the Zhanjiang City Science and Technology Research
Project of China (Grant NO. 2011C3106018) and the Social Sciences Research Project for Lingnan
Normal University(Grant NO. YW1508).
References
[1] Liu Yacong. Preliminary Exploration on the Combination of Dragon Boat Spirit and
Ideological Political Education for University Students of Sports Major[J]. Heilongjiang
Science, 2014, 5 (12): 147-155.
[2] Zhang Zhicheng, Chi Jian, Li Bing. Building of Physical Function Evaluation Model for
Excellent Male Dragon Boat Athletes in China [J]. Journal of Beijing University of Physical
Education, 2014, 37 (3): 128-132.
[3] Yi Cuixia, Yang Tao, Chen Yan. A Preliminary Exploration on Dragon Boat Culture of Miluo in
Hunan [J]. Sports Culture Guide 2013, (12): 105-108.
[4] Liu Hongyu. Modern Interpretation of Dragon Boat Race in China [J]. Journal of Shanghai
University of Sport, 2011, 35 (6): 70-73.
[5] Wu Guangjin, Qin Dezeng. Connotation and Modern Value of Dragon Boat Culture [J].
Heilongjiang National Series, 2010, 119 (6): 141-144.
[6] Wei Xiaokang. Origin of Dragon Boat Race [J]. Sports Culture Guide, 2002 (1): 45-46.
[7] Qin Wei. Dragon Boat Race [M]. Beijing: China Society Press, 2010: 4-6.
[8] An Jianqun, Fan Huamei. Research on Cultural Inheritance of Folk Sports "Dragon Dance"
from the Dimensionality of Intangible Cultural Heritage Protection [J]. Journal of Xi'an
Institute of Physical Education, 2011, 28 (1): 71.
130
Variation and Social Value of Marine Dragon Boat Racing in Zhanjiang of

China
Jianqun An1,a, Yang Bing2,b

1
Physical Science College, Lingnan Normal University, Zhanjiang, Guangdong, China
2
Sports School, Chikan District, Zhanjiang, Guangdong, China
a
643520850@qq.com, b252128155@qq.com
Keywords: Dragon boat; Zhanjiang; History; Social value
Abstract. Originating from productive labor, being catalyzed by totem adoration, and upon
generations of development and improvement, marine dragon boat race in Zhanjiang of China has a
long history and rich regional characteristics. Extensive development of dragon boat race in
Zhanjiang leads to a series of values, such as cultural inheritance, fitness, entertainment, patriotic
education, development of regional economy, etc. Protection, inheritance, and promotion of dragon
boat race in Zhanjiang are practical needs of local people, as well as the demand to promote red-soil
culture of Zhanjiang. This is quite significant in establishing the coastal and tourism image of
Zhanjiang, improving the city's cultural taste, and constructing a happy Zhanjiang.
1. Preface
China has 56 ethnic groups, while more than 30 of them have dragon boat custom. Marine dragon
boat race in Zhanjiang of China is world famous for its profound mysterious color, and special custom
style.At present, dragon boat race has been included in competitive sports in Asia. As a traditional
sporting event of the Chinese nation, dragon boat race will inevitably absorb modern competitive
element, endowing itself with new cultural connotation. Now, dragon boat race is faced with a key
transitional period from tradition to modernism. Zhanjiang is one of the birthplaces for dragon boat in
China. For this reason, it is realistic and necessary to discover dragon boat cultural connotation of the
region.
2. Origin and evolution of dragon boat race in Zhanjiang
2.1 Seeds of dragon boat race in Zhanjiang

Zhanjiang is located on Leizhou Peninsula, at the southernmost point of China mainland, with 8000
years' history of civilization[1]. Huafengling of Xuwen, Liyudun of Suixi, Yinglouling of Leizhou, as
well as other several historic sites are relics on this land left by human beings in the Neolithic Age. In
aspect of geographical location, it is surrounded by sea in three directions, and is situated on land
partitioned by water. As for this, streams and lakes are widely distributed in the region, with plenty of
rivers. Natural environment here is severe, forming an uncivilized region[2]. Aborigines of Zhanjiang
lived in this the water resort for a long history. Consequently, boats became important tools in their
production and life. Book of the Later Han - Biography of Yanzhu also mentioned that, the people of
Yue "are habituated to water and adept at boat". This should be attributed to their living environment.
Volume Eight of Book of Yue State: ancient people of Yue "take boat as carriage, and oar as horse,
coming and going freely". Volume Thirty-three of Book of the Later Han: in the Eastern Han Dynasty,
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016

131
"in ancient China, all articles of tribute from Vietnam are transferred via Dongye by sea". In the year
of 1983, a batch of animal bones were explored from tomb of the Nanyue King, including cyprinoid,
tortoise, soft-shelled turtle, as well as marine clam, spiral shell, etc. This may reflect traditional
dietary habit of local people. According to archaeological records, sailing and fishing were quite
important to residents of Leizhou Peninsula. Professor Chen Xujing, famous sociologist in China,
once said: "Culture is nothing more than the consequence of human's adapting to and trying to make
use of various natural phenomena or natural environment [3]." There is regional, national, cultural, and
cognitive difference in the origin of dragon boat race. Moreover, various origins are closely related
with local ancestors' sacrifice, labor, faith, etc. The creation can never go without specific natural and
economic foundation. As for this, apart from labor, aborigines of Zhanjiang also play dragon boat
race, so as to improve their viability. For this reason, present marine dragon boat race of Zhanjiang
finally came into being.
2.2 Origin of dragon boat race in Zhanjiang
Stone adze is production tool of the Neolithic Age, belonging to the category of polished stone
implements. Adze is of rectangle shape with single sharp edge. There was also stone adze with
"stepped section" (grinded) at the upper end, being referred to as "stepped adze". If being installed to
a wood handle, stone adze may be used in cutting and digging. Stone adze is important tool to make a
wooden boat. Such stone relics were found in many historic sites (Huafengling, Yinglouling
Shangang, Yingdian North Slope, Lanyuanling, and Shitouyan Shangang) of the Neolithic Age in
Zhanjiang, with shoulder, trapezoid, and other shapes. In the meanwhile, zax, celt, stone net pendant,
stone chopping tools were also discovered[4]. This, from another dimensionality, demonstrated the
important status of boat in the life of residents of Leizhou Peninsula. Huainanzi - Spirit Volume
mentioned that, "the people of Yue take snake as delicious food." The people of Yue loved fish,
soft-shelled turtle, snake, mussel, and clam. This was no doubt related with local special natural
environment. Being often benefited from water, and also harmed by water, they hereby believed that,
there was such God of Water that controlled people - the Dragon. Dragon can fly through the clouds,
swim in the deep ocean, and control the forces of nature. Thus, it is an ideal God of Water in people's
mind [5]. As for this, people sailed boats to offer sacrifice to dragon, so as to exorcise evils, to pray for
peace and good harvest. Later on, with the introduction of Central Plain Culture, the content of
memorizing Qu Yuan was added. Hereby, the day of Qu Yuan's death was chosen as Dragon Boat
Festival. In literatures, there were plenty of records concerning ancient people's worship on dragon.
According to Garden of Anecdotes - Volume of Fengshi, "the people of Yue cut hair, and keep tattoos
to imitate the Son of Dragon,as well as to elude the God of Water". This paragraph of text means,
local people used to work in water, so they cut their hair short. Moreover, their bodies were covered
by shapes of dragon, with the purpose to elude harms in water. Mr. Wen Yiduo held that, "the people
of Yue cut their hair and have tattoos to imitate the Son of Dragon, for dragon is their totem. [6]"
Huainanzi - Custom of Qi recorded that: "the people of Hu are good at horse riding, while the people
of Yue are good at boat sailing." This proves that, ancestors of ancient Zhanjiang region were adept in
making boats and sailing boats. Folklorists held that, in folklorists' view, the so-called dragon boat
was actually such kind of boat sailed by the people of Yue when offering sacrifice to the God of Water
(Ling Chunsheng Nanyang Aborigines and Baiyue Nationalities in Ancient China). Origins of
Objects quoted from History of Yue that, "the race originates from Gou Jian Monarch of the Kingdom
of Yue, i.e. today's dragon boat race." There used to be legend spread in Wuchuan of Zhanjiang that, a
golden dragon was seen at the sea. Volume Seven Hundred and Sixty-nine of Taiping Imperial
Encyclopedia quoted from History of Jiaozhou that, "there was copper ship of the King of Yue in
Anding county, and was seen when the tide fell. The copper ship appeared at the sea twenty
kilometers from Hepu." In the year of 1982, an undersea archaeological activity performed in
Wuchuan discovered a copper sheet shipwreck from Tang Dynasty. The ship was 40 meters in length,
with copper handrails and nails. Bottom and deck of the ship were wrapped by copper sheet, and were
quite spectacular [7]. Records about dragon boat of Zhanjiang could be seen in many historical
132
literatures. However, when exactly the race originated was never clearly demonstrated in historical
literatures. As for this, it may be considered that, dragon boat of Zhanjiang originated from
productive labor of ancestors. Being catalyzed by totem adoration and upon generations of
improvement, marine dragon boat race was eventually developed and formed.
2.3 Evolution of dragon boat race in Zhanjiang
Dragon boat race was also referred to as "dragon boat competition", "dragon boat rowing", "dragon
boat climbing", "competing for the championship", etc. In Zhanjiang, people used to call the event as
"Rowing Dragon Boat". There was the tradition of rowing dragon boat on Dragon Boat Festival every
year in Haikang of Zhanjiang. In the 12rd year of Yongzheng Period of the Qing Dynasty (1734), a
dragon boat sank in Caiyuan Bay, and dragon boat race was banned by the government. Later on,
merchants and residents around Chengnanguan and Xiajiang used sailing ships in artistic
performance activities [8]. At present, the most traditional dragon boat race is handed down by Wushi
Town of Haikang, and is held yearly at Wushi Port. Dragon boat race of Lianjiang area in Zhanjiang is
of the similar period. People in Lianjiang attach great importance to dragon boat race. There was folk
saying going like this: "People of Lianjiang would rather neglect a whole year's farmland than lose a
dragon boat race." Shown by related information, as early as in Qianlong Period of the Qing Dynasty,
boatmen in the lower reaches of Jiuzhou River of Lianjiang would race their boats for fun during the
slack season. In the Republic of China era, dragon boat race was widely held in Lianjiang, and the
spending was raised publicly. The custom was carried on for more than 10 years after the founding of
the nation. During the "Cultural Revolution" period, when China was destroying the old and
establishing the new, dragon boat race was abandoned. However, it was again recovered when the
opening up and reform policy was promulgated, and was even revitalized. It was not until the Qing
Dynasty that dragon boat race in Wuzhuan area of Zhanjiang eventually had its historical records. By
the period of the Republic of China, dragon boat race in Wuchuan faced an unprecedentedly grand
occasion. In the three large scale competitions held in 1923, 1936, and 1944, the number of boats
attended the race was up to 21. In recent years, many towns of Wuchuan held dragon boat races, while
Huangpo and Meilu were two most famous places. In history, residents on Tiaoshun Island of
Zhanjiang also had the custom of dragon boat race. Dragon race here could be traced back to early
Qing Dynasty and became popular in late Qing Dynasty and early Republic of China period. On May
5 every year, fishermen on Tiaoshun Island would voluntarily organize marine dragon boat race.
Approximately 3 to 4 dragon boats participate in the race, making the race a quite fervent event.
There has already been the tradition of dragon boat rowing in Suixi area of Zhanjiang before the
founding of the nation. The event was mainly held in coastal area, and was stopped later on for plenty
of reasons. In the year of 1984, Jianghong Town of Suixi took the lead in resuming the activity. After
that, dragon boat race was regularly held on Dragon Boat Festival every year. Neighboring counties
and towns were also invited to the race. In recent two years, the people of Suixi took dragon boat race
as an important measure to excavate, develop, and improve folk culture, and to promote localization
of art. As for this, "Dragon Boat Culture and Art Festival" was launched. Apart from dragon boat race,
there were also Painting and Calligraphy Exhibition, Photography Competition, Lion Dance, Cultural
Show, and other activates organized, making local May into a grand session of dragon culture.
2.4 Marine dragon boat invitational tournament of Zhanjiang
Most dragon boat races in China were held on rivers and lakes. However, in Zhanjiang, from
beginning until now, dragon boat race has always been held on the sea. Especially, on June 19, 2007,
along with the implementation of nationwide fitness campaign and the preparation of Olympic
Games, the 1st China Zhanjiang International Dragon Boat Invitational Tournament was grandly held
in the sea area of Long Corridor for Seeing Sea in Jinsha Bay. This event promoted local dragon boat
sport up to a new level. As an expert in folklore, Ye Chunsheng, Professor of Zhongshan University,
pointed that, "if the number of invited countries and regions is less than 5, and the number of overseas
teams is less than 10, such race shall never be referred to as an 'International dragon boat Race'". In
this sense, Zhanjiang held a genuine international dragon boat invitational race. It has several
133
distinctive characteristics: I. the only domestic dragon boat race held on the sea, with obvious marine
nature; reflecting that local people's "maritime consciousness" and "maritime right concept" are
improving all the time. II. The sea area for dragon boat race is deep and wide, leading to huge stormy
waves, which are great challenges and impacts to players. These elements fully demonstrate the
perseverance and self-improvement nature of the Chinese nation. On the other hand, it also contains
deeper level spiritual meanings of the Chinese people, such as dragon leads the world, fallen leaves
return to the roots, etc. III. Wide influence and huge scale: for example, in the 4th race held in 2010,
there were totally 51 teams overseas and domestic participated. These teams came from Australia,
America, Europe, and other places across the world. The number of foreign players reached up to 420.
IV. Solid mass base and strong support from local government: in previous dragon boat races, more
than 100 thousand tourists domestic and overseas were attracted to the site to watch the competition
under the hot sun. Moreover, local party leaders, as well as experts and scholars domestic and
overseas also presented at the scene. Many media in and out of the province gave interactive report on
the splendid event.
3. Social value of marine dragon boat race in Zhanjiang
3.1 Cultural inheritance

In the year of 2010, China's Ministry of Culture released the theme of "protection of intangible
cultural heritage needs the participation of everyone", which required all places of the country to
launch diversified activities, leading the whole society to pay attention to and participate in cultural
heritage protection [9]. Dragon Boat Festival is one of the legal holidays in China, and has been ranked
as intangible cultural heritage of the world. Eating zongzi and dragon boat race are fixed contents of
Dragon Boat Festival of Zhanjiang. During the period of Dragon Boat Festival, all places of Leizhou
Peninsula would launch a series of dragon boat races. Especially, Zhanjiang Marine Dragon Boat
International Invitational Race held since 2007 has become a cultural feast for local people, with
widespread influence. Marine dragon boat race culture on Dragon Boat Festival carries the best
wishes of people on Leizhou Peninsula, which also symbolizes courage, aggressiveness, unification,
and cooperation. It effectively promotes and guarantees social harmoniousness and healthy
development, establishing a good platform to improve people's happiness index. When traditional
culture is impacted by western culture, inheritance and development of traditional Chinese sports
culture becomes an important problem [10]. Marine dragon boat race of Zhanjiang is inheritance and
development to traditional Chinese culture. Its wide implementation protects local cultural resources.
At the meantime of inheriting cultural characteristics, it also enriches the connotation of culture,
improves the taste of culture, and finding a perfect combination point for traditional culture and
modern culture. As one of the most popular events on Dragon Boat Festival, marine dragon boat race
of Zhanjiang is full of passion. With the element of courageously contending for first place, the event
has obvious cultural inheritance value.
3.2 Fitness and entertainment value
Marine dragon boat race may motivate more participants, stimulating and cultivating their subjective
initiative to actively, consciously, and positively participate in physical exercise. On the other hand,
dragon boat race is helpful in body building, cultivating participants' spirit of fierce competition,
active creation, and courageous exploitation. At the meantime of comprehensively promoting
national fitness plan of China, Zhanjiang also widely promotes dragon boat race and other sports
events to every social aspects of Leizhou Peninsula. It is an important channel to improve fitness, as
well as one of the effective methods to cultivate people's competitiveness spirit. Dragon boat race is a
strength, speed, and stamina sports event, as well as a competition of cooperation, coordination, and
collective intelligence. In dragon boat race, players have to follow drumbeats to paddle boat, and to
make concerted effort to complete the race. People saw a dragon boat race may have such experience:
when the sound of drum and gong started, an excited feel would be triggered. Accordingly, a kind of
134
physical or mental coordination would be aroused along with the rhythm of drumbeat. Both players
and audiences may feel the joyousness of emotional decompression and relief. Tacit cooperation is
the key to victory in dragon boat race. Repeated practice is the basis of tacit cooperation. Dragon boat
race helps participants form rigorous habit. Moreover, it plays an important role in cultivating
individuals respecting justice and abiding by laws, valuing teamwork, and respecting others.
3.3 Patriotism education
Dragon symbolizes the Chinese nation, with transcendental cohesion. The spirit of dragon is the soul
of traditional Chinese culture. Dragon boat race is a collective self-education and self-entertainment
cultural activity with huge educational potential on the public. It has positive role in moral education,
aesthetic education, physical education, and intelligence development. Worthy of mentioning, it has
unconscious influence on cultivation of identity sense and national spirit of people under the same
cultural background with them same ethical concept and value view, helping people form strong
national pride and confidence. For example, in the Opening Ceremony of the 5th Zhanjiang Marine
Dragon Boat Race, "Dragon and Eulogium" was taken as the theme, including three chapters: Hidden
Dragon - Ancient Island, Flying Dragon - Zhanjiang, and Rising Dragon - The World. Drawing
support from the historical folk art of Zhanjiang, present elegant demeanor of Zhanjiang was
combined to demonstrate the profound cultural deposits of Zhanjiang, showing to citizens the charm
of Chinese dragon culture, and realizing patriotic education. Leizhou Peninsula is an area with
multiple ethnic groups. Diversified nationalities created diversified local culture [11]. Owing to the
inclusive and united nature of dragon culture, apart from inheriting dragon boat culture and carrying
forward dragon boat spirit, dragon boat race may as well strengthen the identity sense and cohesion of
people on the peninsula, and is an important channel to construct harmonious society.
3.4 Development of local economy
Marine dragon boat race brings Zhanjiang area with considerable economic benefits. As important
resource, sport has gradually produced industrial values. Marine dragon boat invitation race of
Zhanjiang is no longer an economic activity attended by players and judges. Moreover, it integrates
audiences, media, sponsors, organizers, and many other entities, turning the event into a
comprehensive grand gathering with competition, commerce, entertainment, culture and other
elements. People's coming to watch the race and performance will inevitably form large scale crowds.
Places with people always have business opportunity. Large amounts of audiences and tourists, as
well as their attention and consumption transform dragon boat race into a huge market. For instance,
during the dragon boat race every year, many travel agencies would put advertisement on media of
surrounding cities, such as Maoming, Yulin, etc. The purpose is to attract tourists from these places.
When the dragon boat race begins, occupancy rate of hotels and booking rate of restaurants in
Zhanjiang would be largely improved. Customer flow in major malls of Zhanjiang would increase by
thirty or even forty percent than ordinary times, while most of them are from beyond the region. At
present, the win-win ideology of "developing economy on the platform of dragon boat" has become a
common sense of all sectors. It is accepted that dragon boat race may bring the area with huge
economic and social benefit. High level dragon boat race is organically combined with local economy,
trade, tourism, culture, entertainment, and international exchange of Zhanjiang, forming grand
celebration activity and economic trade activity, which efficiently motivates local economy,
commerce, trade, and media, improving the image of the city. "Taking dragon boat as the media, and
promoting commerce with culture" reveals the commodity culture and value of dragon boat race.
4. Conclusion
To protect, inherit, and promote dragon boat culture of Zhanjiang is sports and folk workers'
responsibility, people's actual demand, as well as the necessity of promoting red soil culture of
Zhanjiang. Dragon boat race is a festival shared by multiple nationalities, including cross-border
custom. As for this, it has important value to researches on cultural exchange, international
135
communication, traditional sports competition, diet culture, etc. Developing dragon boat sports with
great strength helps to better inherit self-improvement, unity, aggressiveness, and other excellent
qualities of the Chinese nation. Exploring local dragon boat race of Zhanjiang has very significant
meaning in establishing costal tourism image of Zhanjiang, improving the cultural taste of the city,
and constructing happy Zhanjiang.
5. Acknowledgement
This research was financially supported by the Zhanjiang City Science and Technology Research
Project of China (Grant NO. 2011C3106018) and the Social Sciences Research Project for Lingnan
Normal University(Grant NO. YW1508).
References
[1] Deng Biquan, Wu Maoxin. Culture of Leizhou [M]. Guangzhou: Lingnan Art Publishing House,
2013: 2-3.
[2] Deng Biquan, Zhang Xuesong. Culture of Migration [M]. Guangzhou: Lingnan Art Publishing
House, 2013: 10.
[3] Chen Xujing. A General Survey on Culture Science [M]. Beijing: China Renmin University Press,
2005: 2.
[4] Mu Ye. Overview of History and Culture of Leizhou [M]. Guangzhou: Huacheng Publishing
House, 2006: 76-82.
[5] Zhang Yilong, Zhang Zisha. Research on the Development of Dragon Boat Culture and Dragon
Boat Race [J]. Journal of Yunmeng, 2014, 35 (3): 64-67.
[6] Wen Yiduo. Collection of Wen Yiduo. Volume I [M]. Shanghai: Kaiming Bookstore, 1948: 29.
[7] Fang Zhiqin, Jiang Zuyuan. General History of Guangdong [M]. Guangzhou: Guangdong Higher
Education Press, 1996: 210-211.
[8] Lin Tao. Pictorial Interpretation of Leizhou Culture [M]. Guangzhou: Nanfang Publishing House,
2006: 42.
[9] Xu Yanlin. Traditional Intangible Culture of Guangdong [M]. Guangzhou: Jinan University Press,
2012: 223-224.
[10] Bai Jixiang. Inheritance and Development of Traditional Chinese Sports Culture in the Global
Background [J]. Journal of Nanjing Sport Institute, 2011, 25 (3): 34-37.
[11] Lin Chun, Yang Yaoming, Chen Xiaobo. Exploration of Leizhou Culture and its Moral
Education [J]. Journal of Zhanjiang Normal College, 2014, 35 (2): 156-161.
136
Analysis of Architectural Decoration and Function Expression
Tiejun Wang*
Academy of Fine Arts, Northeast Normal University, Changchun130024, China
wangtj2226@163.com
Keywords: Architecture; Decoration; Modern architecture; Function
Abstract. This paper analyzes the value and function of architectural decoration; the historical status,
cultural significance and development process of architectural decoration art are studied. The results
shows: the decoration of architectural has practical function, and is closely related to its construction
means and structure logic, as a special form of plastic arts, and architecture together writing the
long-standing history and culture; architectural decoration because of its specific material and
spiritual functions, participating in the creation of material space and spiritual space of architecture, it
is the product of culture, and the concentrated expression of human art will.
1. Introduction
Architecture originated in ancient times, the original purpose was to fight against nature, to shelter
from the wind and rain, cold and heat, sheltered spaces for safe habitation and activity, this is the
survival instinct needs, with direct utilitarian and practical purpose. People in exploring the structure
of the building solid and practical process, from the internal space of attention, develop to pay
attention to the symmetrical and proportional balance of external form, began to have aesthetic
attributes on a practical basis.
At this point, the function of the building is "for human use"; this is its practical value and aesthetic
characteristics. Architecture is the unity of practicality and art, the form and decoration in the building
have a unique practical function, and associated with the means of construction and structural logic,
these functions do not constitute form constraints, functional changes and regression, and as a
decorative language in the structure of the building to be preserved and carry forward.
2. The 19th-Century Architecture: purpose of class social service

Slavery era, architecture in Egypt, Greece and Rome are called classical architecture, at this time of
architectural decoration, pay attention to the proportion of harmony, take the proportion beauty of
human body as template, have concise and magnificent Doric order, the slender graceful Ionic order,
and the beautifully carved Corinthian order. Temple is an important type of architecture in ancient
Greece, reflect people's emphasis on self, the ideal of harmonious nature and democratic spirit; Rome
architecture to create the arch and dome, built up so large number of squares, temples, triumphal arch,
columns, theatres, public places, arenas, etc., these buildings record the lofty status of ancient Rome,
its main function is to serve on the slave owner decadent life and military empire aggression.
On behalf of the European medieval architecture is the Byzantine architecture and Gothic
architecture. Byzantine architecture created the central layout of the vault church, large areas of
indoor marble and mosaic and other decorative, to create the most outstanding art works of mosaic;
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016

137
Gothic architecture emphasizes the lofty spirit of art, the use of the pointed arch, buttress and flying
buttresses, with stained glass windows, to strengthen the Christian decoration, guide people to
abandon the worldly life and look forward to heaven, a manifestation of an upward sublimation, the
mysterious illusion of heaven.
Late renaissance, Baroque style architecture pay attention to gorgeous style, to flow vortex and
curve become the main component of decoration, to obtain a strong dynamic change and more
magnificent effect, mysterious state full of illusion, seeking sensual pleasure and showing off wealth.
Rococo style architecture, the basic characteristics are delicate, charming, gorgeous, numerous and
trivial, this reflects the upper nobility over the pursuit of luxury taste, also in line with the Catholic
church's desire to show off wealth and pursue mystery.
Architecture before the end of the 19th Century, not only for the exploitation of the parasitic life of
the class, but also directly serve their political rule, building itself emphasizes spirit, emphasizing
formal beauty, its decorative function also reflects the social class situation at that time.
3. The Architecture in 20th-Century: focus on practical functions

With the rapid development of capitalist economy, Industrialized building materials and new
structures have changed, and the way of building production has changed dramatically. In Chicago, a
large number of high-rise buildings, resulting in the "Chicago school", the new structure, materials
and art treatment techniques came into being, modeling tends to be concise and unique, on the
historical architecture of the sham was a profound attack.
After World War I, New building movement to climax, architects pay attention to the function of
architecture, pay attention to the characteristics of materials and structures, advocating new
architectural style, against imitation of historical style, which the essence of architecture lies in the
rationality and logic of building treatment.
Famous architect Ludwig Mies Van der Rohe put forward the "doctrine of reducing the principle",
advocated that "less is more"; architectural master Le Corbusier also pay attention to the function of
the building, eclectic ornamentation, abandon the retro trend, make the building become the abstract
combination of geometrical shape modeling, at the same time, with a simple, bright, light external
features.
Before World War II, The Bauhaus building is the most important modernist building, the building
scattered high and low, with asymmetric structure, all prefabricated pieces assembled, glass curtain
wall structure, In the design language, emphasizing the principle of functionalism, Advocate
"Function determines form, less is more, useless decoration is evil", the whole building without any
decoration, embodies the modernist design at the time of the highest achievement.
4. Modern architecture: diversified development

Modernism focuses on expressing concrete rough heavy effects and construction traces, the use of
traditional aesthetic principles to make modern materials and structures produce regular, dignified
and elegant sense of dignity. After 60s, people want to break the "modern architecture" indifference,
the pursuit of novel feeling. After the World War II, the development of modern architecture presents
a diversified development trend, wild and popular, closely connected with history and culture, and it
emphasizes to historical context, re understanding the role of decoration. Skyscrapers, apartments,
museums, government offices, private homes in today's American cities, these buildings are fully
showing a new interest in "decoration".
Post modernism is the pursuit of decoration and the history of the eclectic style, attach importance
to historical context and interest, and break the strict doctrine and indifference in modernism design.
The decoration embodied in post modernism architecture, with its pursuit of historical context and
interest linked, they use historical decorative styles, including ancient Rome style and other styles in
138
history. These traditional decorative styles are not only historical and symbolic, but also contain a
specific era of history and human feelings.
5. Neoteric Architecture: The contention of a hundred schools of thought

With the development of society, it is necessary to have rich and varied buildings to meet various
needs. From 19th-Century to the beginning of the 20th-Century, the continuous development of
cultural exchanges, people began to understand and master the architectural features of various times
and regions. Under such background, the world has emerged colorful architectural situation, high
rising buildings stand in great numbers, innovation and development is the main melody of
architectural creation in the 20th-Century, should also be human beings should grasp and learn from
the architectural classic.
Architecture is the combination of science and art, it often reflects the strong characteristics of the
times and artistic quality. Concrete, steel, glass and other materials are widely used, is a classic
nostalgia, is decorative ideology inheritance of consciousness, the emergence of modern architecture
is not without decoration, its functionality and identity with architecture are worth exploring. Chinese
traditional building beam column, eaves ridge, bucket and other components of the decoration, give
us more tips. Ink garden of Suzhou Museum, cobblestone court of Xiangshan Hotel, Yuming Bei, the
famous architect using traditional Chinese watercolor painting techniques, the white wall as the
background, use pebbles performance of pines, bamboo and stone etc., this kind of reference and
space change, is not only the inheritance of traditional context, but also the best understanding of
architectural decoration.
6. Summary
Architectural decoration is the product of culture, is the embodiment of human artistic will, any
decoration will be injected into the designer's will and emotion. Architectural and decoration in the
long-term development of the process of mutual influence and mutual promotion, common create the
number of classic architectural works of art. The functional decoration of traditional architecture is
the symbol of religion and status; the return and revival of contemporary architectural decoration art,
is built on the basis of contemporary architectural culture and technology, it is not a replica of the
classical decorative art, also different from the constitution of modernism, but the perfect
combination of modern technology and design art.
Architectural decoration is aimed at functional and reasonable artistic processing and
beautification, is the appreciation of architectural value and spiritual release, each kind of decorative
building history passed down, there are certain historical meaning, choose a decoration, it means
choosing this historical and cultural theme. The meaning of architectural decoration is complex and
deep, it is a reflection of philosophy of life, and coincides with the rules of the development of art,
which shows the eternal beauty of art, it is in this environment that we experience the richness and
infinity of the world.
7. Acknowledgement
This research was financially supported by the Research Project in Humanities and Social Sciences by
the Ministry of Education of China (12YJA760068).
References
[1] Anne Hultzsch, Architectural history from eye-level: Nikolaus Pevsner's Treasure Hunts in the
Architectural Review, 1942, Journal of Architecture, vol. 19(3), pp. 382-401, 2014.
139
[2] Oriel Prizeman, Function and Decoration, Tradition and Invention: Carnegie Libraries and their
Architectural Messages, Library & Information History, vol. 29(4), pp. 239-257, 2013.
[3] Alfred Neumeyer, The Indian Contribution to Architectural Decoration in Spanish Colonial
America, The Art Bulletin, vol. 30(2), pp. 104-121, 1948.
[4] Warwick Rodwell, Appearances can be Deceptive: Building and Decorating Anglo-Saxon
Churches, Journal Of The British Archaeological Association, vol. 165(1), pp. 22-60, 2012.
[5] Anuradha Chatterjee, Tectonic into Textile: John Ruskin and His Obsession with the
Architectural Surface, Textile the Journal of Cloth & Culture, vol. 7(1), pp. 68-97, 2009.
[6] Valeria Carullo, Image makers of British modernism: Dell & Wainwright at The Architectural
Review, The Journal Of Architecture, vol.9, pp. 1012-1032, 2016.
[7] Molly Bourne, Francesco II Gonzaga and maps as palace decoration in renaissance Mantua,
Imago Mundi, vol. 51(1), pp. 51-82, 1999.
[8] Andrzej Piotrowski, The Spectacle of Architectural Discourses, Architectural Theory Review,
vol. 13(2), pp. 130-144, 2008.
[9] Tobit Curteis, The Entrance Hall of the Fitzwilliam Museum, Cambridge: A Conservation
Approach to Nineteenth-Century Architectural Polychromy, Journal of Architectural
Conservation, vol. 8(2), pp. 7-22, 2002.
[10] Pattabi Raman, Richard Coyne, The Production of Architectural Criticism, Architectural Theory
Review, vol. 16(1), pp. 83-102, 2000.
140
Herman Melvilles Sources of Ecological Awareness

Na Wang
North China Electric Power University, Baoding, Hebei province, China
annable211@163.com
* Na Wang
Keywords: Ecocriticism; Sources; Transcendentalism
Abstract: Melville is one of the greatest American writers in the nineteenth Century. He is not a
ecological writer traditionally, but with the development of ecocriticism, ecological awareness
contained in his early sea novels has attracted people's attention. This paper analyzes and explores
the origin of Melvilles ecological awareness from the perspectives of personal experience, social
background and transcendentalism, and intends to make human understand the ecological confusion,
restore ecological harmony.
1. Introduction
Since twentieth Century, deterioration of the ecological environment has become a global problem.
The rise of the ecological criticism in the last century is a product in the specific historical
conditions. Ecocriticism examines the relationship between literature and environment with the
aims to arouse people's ecological consciousness of reflection and criticism, explore historical and
cultural reasons for the human impact on the natural environment, and call on people to protect the
earth. With the progress of ecocriticism, review and rereading of traditional literature works has
become a main task of ecological criticism. The classical rereading is to reveal the ecological
consciousness neglected in the traditional literary works, reconstruct the literary classics, and
promote people to establish the ecological literary view and ecological aesthetic view. Herman
Melville is one of the greatest writers of the nineteenth Century. Although he is not an ecological
writer in the traditional sense, the rich ecological consciousness contained in his works has aroused
more and more critics' attention.
Melville's lived in nineteenth Century, when the ecological crisis was not very serious, but there
had been. Melville deeply was aware of the severe hazard that the industrial civilization had on
nature. The more scientific and technological developed, the greater of human destruction to nature.
The wild plundering of nature will break the harmonious relationship between man and nature. In
such a historical and cultural background, Melville and his sea novels were found again. People
from his works have gradually realized: treat our earth in a friendly way; do not pretend to be the
dominator of the ecosystem. Possessed with opposition and hostility to nature, human would
certainly taste the bitter fruit of destruction. Melville's ecological consciousness reflects the human
concern of the ecological crisis and profound meditation on peace between nature and humans in
the modern industrial civilization.
2. Personal life experience

Melville was born of a wealthy family in New York in 1819, his two grandfathers are the heroes of
the American War of independence with a great reputation. His father was not a very successful
importer whose business was severely damaged by the scarcity of foreign exchange during
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
141
Americans first postwar depression. In the years immediately after his fathers bankruptcy,
especially his death in 1832 when Melville was twelve years old, his family could hardly make a
living. Melville had to drop out school and worked all kinds of low-paid jobs. His life became more
and more difficult in the hard times following the Panic of 1837, and eventually became a
green-hand sailor in 1839 after fruitless attempts at find work. The attraction which the sea held for
him induced him to make a trial voyage to Liverpool as a merchant sailor which was the beginning
of his sea journey. Melville has deep relationship with the sea, and the sea is the birthplace of the
great writer. British writer Laurence once pointed out, for Melville going to sea is like going home.
In nineteenth Century the United States entered the industrial age. People with rational power and
technology challenge the nature. Large-scale mechanized production not only enslaved, but human
beings have become slaves of machines. Ocean is usually used to represent the unpolluted world, so
going to sea becomes peoples spiritual eagerness. In many works, Melville describes the mood of
the protagonist who is eager to leave the land to go to sea. As in the opening of the Moby Dick, the
protagonist Ishmael is so depressed and desperate that he would commit suicide. For him going to
sea is the substitute of gun and bullet. He even despised those cowards who lived on land. In the
materialistic era, oceans have become the human spirits the last earthly consolation, a sacred place,
but a place where people realize their dream of paradise. Melville believes that ocean is the home of
the human spirit. Boundless sea brings infinite poetic imagination and spiritual comfort for mankind.
Many literary works at all times and in all countries often compared the ocean to the mother that
people are in awe of. Ocean is not only the birthplace of human civilization, but has broad mind to
tolerate human arrogance. Melville writes in Moby Dick how he admires the sea the sea which is
kind and generous. And he even admits sea is his Yale and Harvard. Melville also mentions that
ocean contains the highest truth, like God who is too profound to be understood. With his powerful
pen, he portrayed the ocean with beauty and complex. From his first novel Typee to his last Billy
Bud, he wrote altogether eight ocean themed novels. Melville realized the ecological disaster the
modern industrial civilization brought to mankind, in those whaling days, Melville witnessed
various misfortune and suffering caused by the greed of human beings. Mankind for their own
interests, plunder and conquest insanely nature, but eventually their efforts are futile, and will be
mercilessly revenged by nature. No matter how naive human beings boast about his science and
technology, no matter how advanced the science and technology will be, nature will not be
conquered by humans totally. Melville is filled with the feeling of worship and awe to ocean and
nature. Melville, son of the sea, expressed the important ecological consciousness that critics highly
advocated.
2.1 Social background
Melville lived in an age of reason. In this era science and technology experienced rapid
development. Serious and objective scientific idea has been popular. Darwin's biological evolution
and other technical breakthroughs make people realize that the world and people are able to be
understood, and nature is able to be conquered and used by humans. Man began to plunder nature
wantonly, and as a result the harmony between man and nature was destroyed by human greed.
Therefore, with the development of industry and science and technology, some insightful people
began to realize that although vast universe is recognizable, it can never be denied that how small
human beings are, how powerless their destiny is in front of the revenge of nature.
When Melville's created Moby Dick, Americas demand for oil was increasing; American
whaling industry has exceeded the total amount of any previous time. The whaling ship America
owned was three times the total number of European countries. A total of more than and 700 ships
and 20,000 people were engaged in the whaling industry with an annual increase of seven million
dollars in revenue for the United States. Therefore, the whaling industry in the United States at that
time occupied a pivotal position. Whaling is a profession that often brings men to the destruction.
Only those who cornered would be willing to risk their lives to engage in this occupation. In the
difficult conditions at that time, the majority of the whalers had to battle with nature. These poor
142
people not only rely on their own whaling skills to hunt fierce whales, but rely on luck to survive. In
addition, each whaling voyage takes about three years. The whalers ate inferior food, drank the salty
seawater and lived in shabby whaling boat. They not only had to endure the tropics climate, but also
to endure all kinds of terrible ocean storms. The poor living conditions of these poor whalers are
unbearable. More unfortunately, they still could possibly end up in the boat crash. But in order to
survive, whalers had no choice. As Melville, as an ordinary whaler in a vast ocean, was wandering,
the ecological awareness of the potential has been deeply rooted in Melville's mind, and he later
became the powerful motivation of his literary creation.
In this social cultural background, Melville generated strong motivation of writing Moby Dick.
Through the novel Moby Dick, Melville tells us that human beings are not only dominated by the
internal factors like desire, emotion, genetics, but also controlled by some external forces. These
external forces can not be completely controlled by human beings, thus becoming a huge threat to
human survival. Although mankind has made great achievements in the process of conquering
nature, we still unavoidably can be punished by the ruthless nature. Only through that humans stop
plundering of nature, build harmony between nature and humans, human beings can be completely
set from the cruel revenge of nature, so as to obtain a poetic dwelling.
2.2 Transcendentalism
The idea of returning to nature by Rousseau, a romantic pioneer, has become an important resource
for constructing ecological criticism theory. From eighteen to nineteenth Century, the progress of
Science and technology revolution in the West made peoples collective desires rapidly expand. The
blind worship to reason put humans on the position of attitude of predator, and nature became the
object of plundering. Rousseau saw prospectively unlimited desires bring natural and spiritual
disaster. He first criticized the idea of man's conquest of nature and control of nature, pointing out
that man should obey the laws of nature and not attempt to conquer nature. Secondly, he criticized
human desire. He pointed out that if the desire unlimitedly expands, it will not only annex ate the
whole nature, but also put us into slavery, and by this enslave us through corrosion. Rousseau's
ideas contain a wealth of ecological ideas, so he was the first green thinker. The core idea of
romantic nature view is to explore the concept of wholeness or relevance and to emphasize the
natural worlds interdependence and association, advocating the restoration of positions of humans
and nature.
With the influence of European Romantic movement, Transcendentalism indicates that nature is
the incarnation of God, universe is spirit or the oversoul; it perceives nature as the symbolic of God
and nature is the garment of God whose revelation can be perceive through intuition from nature.
So Transcendentalism advocates people entering nature, feeling nature, making the soul of man
sublimated in the exchange with nature. Transcendentalism has a profound influence on American
naturalism writing. Like all other writers influenced by Transcendentalism, Melville also called on
the people to return to nature, he said a trip to nature is like rebirth. He criticized human evils of the
wanton destruction and conquest to nature. In his works, he pointed out that the real power will not
destroy the beauty or harmony, but endow it with beauty. This view implies the contemporary
ecological theories. Although Melville is not the traditional ecological writer and the ecocriticism
did not come up in the era of his life, ecological ideas were expressed through his portray of the fear
of the sea, the worship of whale and criticism of expansion of personal desires. At the end of the
Moby Dick, Melville depicts such a picture for us: all the crazy hunting seamen sank to the bottom
of the ocean with whaling ship together, but only Ishmael survived. in three years of whaling
journey, the Ishmael gradually formed ecological and ethical peace between human and nature
presented by the white whale. So when he sat on a coffin floating in the sea, it seems he was resting
in a world of peace and harmony. The survival of Ishmael symbolizes the redemption and rebirth
from a Christianity sense, it is the ecological warning to humans issued by Melville: respect for
nature and reverence for all life are the ultimate salvation of human destiny.
143
3. Conclusion
Melville is a writer with rich ecological awareness, and his ecological consciousness is the result of
many factors. It is not only a product of the specific historical conditions of his time, but a
combination of many writers literary achievements. Melvilles ecological awareness contains his
accusation of anthropocentrism and ultimate concern for human destiny and the pursuit of the lost
home. In the sea novels like Typee, Omoo and Moby Dick, Melvilles endless pursuit and
exploration to poetic home is not only the pursuit of essence of truth but also the desire for the lost
homeland. From this perspective, the Melvilles ecological awareness based on the combination of
nature and civilization is undoubtedly significant to current ecological criticism, and it reflects the
unique charm of his sea novels.
4. Acknowledgement
This research was financially supported by the Fundamental Research Funds for the Central
Universities (Grant NO. 2016MS138).
References
[1] Jingcai Yang, Herman Melville and Imperialism. Nanjing: Najing University Publishing House,
2001.
[2] D. H. Lawrence, Studies in Classic American Literature. London and New York: Penguin,
1977.
[3] Miller, James E. Jr. A Readers Guide to Herman Melville, New York: Farrar, Straus and
Cudahy, 1962.
[4] Charles R. Anderson, Melville in the South Seas. New York: Columbia University Press, 1939.
[5] Parker, Hershel, ed. The Recognition of Herman Melville: Selected Criticism since 1846, Ann
Arbor: University of Michigan Press, 1967.
[6] Spiller, Robert E. The Circle of American Literature, New York: New American Liberty, 1959.
[7] Rowe, John Carlos. "Melville's Typee: U.S. Imperialism at Home and Abroad." In Donald E.
Pease, ed. National Identities and Post-Americanist Narratives. Durham: Duke University Press,
1994.
[8] Woodcock, George. Introduction to Typee. Ed. George Woodcock. Harmondworth: Penguin
Books, 1972.
[9] Kirby, David. Herman Melville. New York: Continuum, 1993.
144
Chapter 3:
Economics, Finance and Management
Study on the Applicability of the Scale of Social Financing as the

Intermediate Target of China's Monetary Policy
Xiaodong Liu
Southwest University for Nationalities, Chengdu, China
smelllman@qq.com
Keywords: The intermediate target; Social financing; Monetary policy; The real economic
Abstract. This paper aims to analyze the effect of social financing scale as the goal of China's
Monetary Agency, so as to provide empirical some evidence for the study of economic
development. This paper is divided into the part of introduction and two chapters. The introduction
part mainly expounds the research background, purpose, significance of this paper. Besides, the first
chapter explains the theories and concepts. In the second chapter, this paper makes empirical
measurement based on the monthly data from 2002 to 2014.The methods of Correlation test, ADF,
Granger causality test are used to analysis the correlative of social financing scale with the final real
economic as the intermediate target of monetary policy. The last chapter is the conclusion and
policy suggestion. The empirical results show that the effect of social financing scale on economy is
better than that of broad money supply (M2). At the same time, it shows that the scale of social
financing can have an important impact on the real economy.
1. Introduction
For a long time, broad money supply (M2) was used as the intermediate target of monetary policy
for financial market supervision. However, with the rapid expansion of the scale of social financing,
especially the diversification of P2P and other social financing channels, the bank credit scale from
official channels have received significant interference, the effect of broad money supply (M2) as
the intermediary target is gradually weakened. Monetary policy intermediate target is the financial
indicator used by The central bank to achieve the final economic goals. Which Can be measured,
controlled and has relation with economic. There is not unified model in the choose of Monetary
policy intermediate target. The choose is mainly based on the current economic and final economic
goals in different countries. M2 has used as the Monetary policy intermediate target since 1996 in
our country and had made great effect in monetary policy. The economy has a great development in
recent years. As a result, more supporting from finance is needed. However, there are many
problems in the financial system such as insufficient resource allocation, imbalances of direct
financing and indirect financing, lack of a variety of specification financing channels and so on. The
contradiction between capital supply and demand gives great help to the development of financial
innovation. The amount of direct financing develops quickly and the proportion in all financing
expands quickly.
The real relation between financial system and real economy cant be reflected by the traditional
indicators. The conduction and effect of monetary policy maybe lead to unexpected deviation for
that these traditional indicators may be miscalculate the economic situation and the Monetary
conditions. The social financing scale is an important innovation in the process of economic
development in our country, that the indicator has close correlation with the development of real
economy and has a truly reflect of the economy make it an important reference index in the future.
In summary, although the scale of social financing has its own limitations, but with the rapid
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
147
advancing status of China's social financing scale in the financial system, using the scale of social
financing as China's monetary policy intermediary target is the trend of the times. Therefore, it is
necessary to explore the feasibility of the scale of social financing as an intermediary goal.
2. Empirical analysis
2.1 Variable selection and model building
In order to research and analyze, firstly, the scale of social financing is assumed as a controllable
intermediate target of monetary policy, the PBC can adjust monetary policy to influence the size of
the total social financing. Select the base currency of the investment amount to reflect the monetary
policy related indicators, namely GDP and CPI as a measure of selected indicators; select the size of
the total social financing as financing social statistics, namely monthly data SHRZ.
In practice, since the data is influenced by the seasons, so we use CensusX11 methods for data
processing, and Eviews 7.0 is used for empirical analysis.
2.2 Correlation analysis
This paper makes empirical measurement based on the monthly data from 2002 to 2014. Article
utilize scale of social financing and M2, respectively, and the total retail sales of social consumer
goods, CPI, GDP, do correlation analysis, the results shown in Table 1.
Tab. 1 Correlation Analysis
Correlation SHRZ M2
GDP 0.668529 0.547663
CONSUME 0.701218 0.491912
CPI 0.079572 0.082073
As shown in Table 1, the correlation of China Total Social Financing and main economic
indicators of the country is very high. For the intermediate target of monetary policy, the total scale
of social financing is more relevant than M2.To further illustrate the size of the total social
financing as intermediate target of monetary policy, next we use ADF stability test.
2.3 ADF stability test
From recent economic indicators, time series data does not have the smooth characteristics. In order
to prevent spurious regression analysis of the unstable data, this paper use ADF stability test
method for smooth test of related data indicators. Relevant test results shown in Table 2,
Tab. 2 unit root test results of time series
Variable T-Statistic 5% level Prob.* Result
LNSHRZ -2.068445 -2.880463 0.2578 unstable
LNM2 -1.799289 -2.880853 0.3798 unstable
LNGDP -1.674023 -2.880211 0.4424 unstable
LNCONSUME -0.377632 -2.881830 0.9087 unstable
LNCPI -2.285895 -3.439267 0.4387 unstable
DLNSHRZ -11.59748 -2.880463 0.0000 stable
DLNM2 -9.846207 -2.880853 0.0000 stable
DLNGDP -13.11315 -2.880211 0.0000 stable
DLNCONSUME -5.639581 -2.881830 0.0000 stable
DLNCPI -9.784835 -3.439267 0.0000 stable
As can be seen by Table 2, all indicators are unstable, but after the first-order difference of the
data, the overall trend is stable, and the confidence level can meet the stability test, the variable can
be placed VAR model analysis.
148
2.4 Granger causality test
In order to quantitatively analyze the causal relationship between these indicators, we performed
Granger causality test. As shown in Table 3.
Tab. 3 Granger causality results
Null Hypothesis: Obs F-Statistic Prob Result
LNGDP does not Granger Cause LNSHRZ 155 60.8796 9.E-13 refuse
LNSHRZ does not Granger Cause LNGDP 155 7.45641 0.0071 refuse
LNGDP does not Granger Cause LNM2 155 64.5612 2.E-13 refuse
LNM2 does not Granger Cause LNGDP 155 1.14498 0.2863 accept
LNCPI does not Granger Cause LNSHRZ 155 0.02698 0.8697 accept
LNSHRZ does not Granger Cause LNCPI 155 0.44632 0.5051 accept
LNCPI does not Granger Cause LNM2 155 1.18703 0.2777 accept
LNM2 does not Granger Cause LNCPI 155 1.13593 0.2882 accept
LNCONSUME does not Granger Cause LNSHRZ 155 68.4219 6.E-14 refuse
LNSHRZ does not Granger Cause LNCONSUME 155 3.62452 0.0588 accept
LNCONSUME does not Granger Cause LNM2 155 69.8130 4.E-14 refuse
LNM2 does not Granger Cause LNCONSUME 155 1.24461 0.2663 accept
Granger causality test shows that the scale of social financing obvious effect on GDP, playing a
positive role in promoting GDP, but no significant effect on the CPI and CONSUME. GDP,
CONSUME can contribute to the increase of the scale of social financing, CPI has no significant
effect on the scale of social financing. Meanwhile, M2 had no significant impact on GDP, CPI and
consume, but the GDP, CONSUME have a significant impact on the M2. This shows that China is
still in a stage that GDP growth is the goal, by observing changes in GDP to adjust M2.
3. Summary
As can be seen from the above empirical results, the scale of social financing and the real economy
has a high correlation, by the scale of social financing to regulate the economy, the effect is better
than M2. This paper argues that the scale of social financing can be used as an intermediate
monetary policy target, through its monitoring and control, economic growth can be more healthy
and more balanced.
4. Acknowledgement
This research was financially supported by the Fundamental Research Funds for the Central
Universities of Southwest University for Nationalities (Grant NO.2015SZYQN101). Here, I would
like to express my deep gratitude.
References
[1] The results show that the economic regulation of the scale of social financing is better than M2.
At the same time, impulse Jamal A M M, Hing Y. Test of the Taylor Rule and Policy
Implications[J]. Atlantic Economic Journal, 2007, 35(1):121-122.
[2] Hoshi, Takeo, Kashyap, Anil and Scharfstein, David. Corporate Structure, Liquidity and
Investment: Evidence from Japanese Industrial Groups[J]. Quarterly Journal of Economics,
1991, 106: 33-60.
[3] Khadraoui N. Capital Movements and EconomicGrowth Fluctuations: The Threshold Effect of
FinancialDevelopment[J]. InternationalFinance, 2012.
149
[4] Bond S, Elston J A, Mairesse J, et al. Financial Factors and Investment in Belgium, France,
Germany, and the United Kingdom: A Comparison Using Company Panel Data[J]. The Review
of Economics and Statistics. 2003, 85(1): 153-165.
[5] Von Furstenberg G M, Lovell M C, Tobin J. Corporate investment: Does market valuation
matter in the aggregate [J]. Brookings Papers on Economic Activity. 1977: 347-408.
[6] Hayashi F. Tobins Marginal Q and Average Q:A Neoclassical Interpretation[J]. Econometrica.
1982, 50(1): 213-224.
[7] Hansen B E. Threshold effects in non-dynamic panels: Estimation, testing, and inference[J].
Journal of Econometrics. 1999, 93(2): 345-368.
[8] John.G.Gurley, Edward.S.Shaw. Money in a theory of finance[M]. 1. Brookings Institution,
1960.
150
Forecasting Capital Requirements Based on Revised Percentage of

Sales Method
Weiliu Yang*
Department of Economics and Management, Zaozhuang University, Zaozhuang 277160, China
26820701@qq.com
Keywords: Percentage of sales method; Capital requirements; Financing
Abstract. Financing activity is an important activity of the enterprise lifeline. The sale percentage
method is one of the most important methods to forecast the demand of enterprise's capital. But the
traditional percentage of sales method ignores the time value and the cost of capital and so on, and the
forecasting of capital requirements is not accurate. This paper modifies traditional percentage of sales
method, combining with the specific case analysis of the revised percentage of sales in capital
requirements forecasting. This paper could provide the reference for the more accurate prediction of
enterprise capital requirements.
1. The basic idea of the percentage of sales method

The percentage of sales method is very important to forecast capital requirements, which is mainly
determined by the relationship between the growth of assets and sales revenue [1-2]. Percentage of
sales method could reflect the close relationship between the asset and sales factors, that is, with the
expansion of sales, in addition to increasing the current assets, which may also need to increase the
long-term assets. Financing has become an inevitable requirement to meet the expansion of sales. A
portion of financing can be derived from retained earnings, but it is not sufficient to rely solely on
retained earnings, and external financing is needed to meet the growing demand for sale. In order to
prevent the shortage of capital, first of all, enterprises should predict capital requirements.
The percentage of sales method has its own space and scope of application. Firstly it assumes that
there is a stable proportion of assets, liabilities and sales revenue, Forecast assets, liabilities and
owner's equity according to the proportion relationship among assets, liabilities and sales revenue.
Secondly predict the external capital demand requirements. Its basic steps are as follows:
Assets and liabilities are distinguished between sensitive and non-sensitive items in the balance
sheet. Assets and liabilities with significant changes in sales revenue are sensitive assets and sensitive
liabilities, and calculate the percentage of sensitive assets and sensitive liabilities to sales revenue.
Calculate the number of each sensitive item, and forecast the increase of the capital.
Calculate external capital requirements.
The formula for percentage of sales method:
Increased Assets = Percentage of Sensitive Assets Items Incremental Revenue
Increased Liabilities = Percentage of Sensitive Liabilities Incremental Revenue
Increased Retained Earnings = Forecasted Sales Revenue Net profit margin retention ratio
A B
S S P E S '
External capital requirements = S S
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
151
Note: A is the base-period sensitive assets, S is base-period sales revenue, B is the base-period
sensitive liabilities, S is incremental revenue, P is Net profit margin, and E is retention ratio.
2. The problems of traditional percentage of sales method
2.1 Ignore the volatility of the percentage of sales

The percentage of sales is a simple and easy way to predict the demand for funds. In reality, the
enterprise capital management process is complex and changeable, and the sales percentage method
has a prerequisite for the application in reality. The premise is that there is a steady positive proportion
between sensitive assets and sensitive liabilities items and sales. Sensitive projects are determined by
subjective judgment and historical experience, and may not change with the sale change in the future.
Due to the influence of economies of scale and bulk purchase and sales in real economic conditions,
there is not necessarily a proportional relationship between assets, liabilities and sales, even if there is
a proportion of a relationship. This relationship is not necessarily stable. Therefore, this hypothesis
has a lot of limitations, affecting the accuracy of the prediction of capital demand.
2.2 Ignore the impact of the time value of money
The time value of money has an important influence on the demand for working capital, especially,
when the demand for working capital is large. When the time is long and the uncertainty factor
increases, the effect of time value of money will be highlighted. In the traditional sales percentage
method, the percentage is calculated from the base period data, without considering the influence of
the value of time. It will make increasing calculation error, and the calculation is not accurate,
affecting the enterprise financing decision. In reality, it should that compute total value using the
sensitive project and the final value of sales in recent years. According to the final value the averaged
value of sensitive items and sales are calculated, and then calculating the percentage of sales with the
averaged values can reduce the error, improve the credibility of the demand forecast. This is more in
line with the concept of financial management.
2.3 Ignore the cost of capital
Equity financing and debt financing are two different ways of financing, and the capital costs of two
methods are different. Although there is no cost of raising funds, the retained earning of capital cost is
not low. Therefore, the choice of equity financing or debt financing is related to the level of the cost of
capital. If the expected return of the enterprise is more optimistic, the expected rate of return is higher
than the debt interest rate, and the enterprise which pursuits of higher financial leverage, will choose
all through external financing to meet the needs of business investment. In this case, the traditional
percentage of sales forecast is not accurate.
3. Application of revised percentage of sales method in forecasting capital requirements
3.1 Regression analysis method

The traditional sales percentage method assumes that sensitive assets, liabilities and sales maintain a
stable proportion of the relationship. Now, we extend this assumption that there is a linear
relationship about the sensitive assets, liabilities, and salesy=Ax+B. The independent variable x
represents the sales volume, the coefficient A represents the unit change capital, and B represents the
fixed capital demand. Firstly we calculate the correlation coefficient R. According to R distinguish
sensitive items and non-sensitive items, and then calculate the coefficients A, B and determine the
linear equation. The flow chart is shown in Fig. 1.
152
Fig. 1. Regression analysis.
3.2 Considering the time value of money

The financial activities of enterprises reflect the dynamic process of production and operation at
different time. The amount of capital required by the enterprise is different, Therefore, the future
demand for funds is changing, when the business need is large. Companies must take into account the
impact of time value and risk factors, and the value must be related to the time value of treatment.
After considering the time value of money, we propose the following amendments to the traditional
percentage of sales method. The flow chart is described in Fig. 2.
Fig. 2. Revision of the monetary time value.
3.3 Wuhan Iron and Steel (Group) Corporation as an example

3.3.1 Case and data
Tab. 1. Wuhan Iron and Steel (Group) Corporation Data from 2009 to 2011(Unit: million).
Items 2009 2010 2011
Sales revenue 5371.4 7559.6 10105.8
Monetary fund 297.4 225.1 178.1
Accounts receivable 89.1 36.3 34.7
Inventory 571.1 1167 1657.5
Fixed assets 4189.1 5073.3 6071.1
Total operating assets 5146.7 6501.7 7941.4
Accounts payable 1471 1281.4 1235.4
Long-term payables 0 0 4
Total operating liabilities 1471 1281.4 1239.4
Total owners' equity 3675.7 5220.3 6706
153
Table 1 lists Wuhan Iron and Steel (Group) Corporation Data from 2009 to 2011. We estimate the
demand for 2012 by using the revised percentage of sales method, with sales revenue 20 billion, net
profit margin of 3%, etention ratio of 40% and interest rate of 5%.
3.3.2 Calculation of correlation coefficient and regression equation
We use the CORREL function in Excel to calculate the correlation coefficient of each item, use the
SLOPE function to find the coefficient A in the linear regression equation, and use the INTERCPT
function to obtain the coefficient B. The concrete result is shown in Table 2.
Tab. 2. Regression Equation and Correlation Coefficient of Sensitive items.
Correlation regression
Items 2009 2010 2011
coefficient R equation
Monetary fund 297.4 225.1 178.1 -0.986 y=-0.025x+425.63
Accounts receivable 89.1 36.3 34.7 -0.856 y=-0.011x+139.343
Inventory 571.1 1167 1657.5 0.995 y=0.228x-622.56
Fixed assets 4189.1 5073.3 6071.1 0.999 y=0.397x+2059.38
Accounts payable 1471 1281.4 1235.4 -0.927 y=-0.048x+1704.81
Long-term payables 0 0 4 0.887 Y=0.0008x-5.305
Table 2 shows that the currency funds, the absolute value of correlation coefficient of accounts
receivable, inventory, fixed assets, accounts payable and long-term payables are more than 0.8 and
close to 1, indicating a strong linear relationship between the above items and sales, which are
identified as sensitive items. While the traditional percentage of sales method makes fixed assets and
other long-term payables as non-sensitive items. Through the regression analysis method determining
the sensitivity of the project can reduce the error of the budget and improve the credibility of the
results.
3.3.3 Calculation of the average final value and percentage of sales for each sensitive item
Tab. 3. Forecast of sensitive items in 2012 (Unit: million)
Final value of the
Percentage of
Items average number of sensitive items in 2012
sensitive items sales
sensitive items
Sales revenue 14178.7 20000
Monetary fund 525.7 3.7% 741.5
Accounts receivable 130 0.9% 183.3
Inventory 1950 13.7% 2750.6
Fixed assets 9892.5 69.7% 13954
Total operating assets 12498.2 88.1% 17629.5
Accounts payable 2833.2 19.9% 3996.4
Long-term payables 1.3 0.0009% 1.8
Total operating liabilities 2834.5 19.9% 3997.9
Total owners' equity 9665. 68.1% 13633.1
3.3.4 Calculation of the external financing demand
Demand for external capital requirements under the revised percentage of sales:
A0
S0 B0 S0 P E S
External capital requirements= 0 S S0
12498.2 2834.5

20000 - 14178.7-
20000 - 14178.7- 20000 3% 40%
= 14178.7 14178.7
=3727.59 million
Demand for external capital requirements under traditional percentage of sales method
A B
S S P E S '
External capital requirements= S S
154
7941.4 1239.4
20000 - 10105.8- 20000 - 10105.8- 20000 3% 40%
= 10105.8 10105.8
=6321.7million
Through the above comparison, it can be seen that the revised calculation result is very different
from the traditional method, which shows that the revised sales percentage method has obvious
correction effect. The Revised percentage of sales method determines the sensitivity by the
correlation coefficient between the project and sales revenue and overcomes the shortcomings of
traditional sales percentage method. On the other hand, the modified percentage of sales method takes
into account the time value of money, which combines the time value with the risk value. The
forecasting results are more accurate and consistent with the concept of financial management.
4. Conclusions
The revised percentage of sales method uses regression analysis to determine the sensitive items and
non-sensitive items, changing the traditional methods of relying on historical experience and
subjective judgments, so that the determining basis of sensitive projects is more scientific and greatly
improve the accuracy of the forecast results. In addition, the revised percentage of sales method
considers the value of time value of money impacting on demand for funds, takes into account risk
factors, reduces environmental changes and other uncertainties, and improves the credibility of the
forecast results for business decision-making services.
References
[1] L. Si, How to Make the Forecast of Capital Requirement, Accountant, vol.9, pp. 78-79, 2009
[2] J. J. Li, Analysis and application of percentage of sales method, Business accounting, vol. 11, pp.
53-53, 2011.
155
Problems and Countermeasures of Internal Control in Electric Power

Enterprises
Yi An
Hebei Geological University, Yuhua District of Shijiazhuang City, Hebei Provice, China
a
497380917@qq.com
*Yi An
Keywords: Internal control; The electric power enterprise; Benefits
Abstract. This paper introduces the related concepts and basic theory of internal control, combined
with a large number of relevant domestic and foreign literatures. By collecting a large amount of
data, it reveals the present situation and problems of the power enterprise's internal control. It
deeply analyzes the causes of these problems. And to solve these problems and reasons, this paper
puts forward some reasonable suggestions to strengthen the internal control of electric power
enterprises.
1. Introduction
The electric power enterprise has been growing as the leading industry of the national economy and
the basic industry of the people's livelihood. With the development of the national economy and the
deepening of the reform of the electric power system, the challenges that the power enterprises face
are more and more competitive. There are many problems in the power enterprise, including the
imperfect internal control system, the negative effects of internal control, and the increasing cost of
internal control and so on. The lack of internal control has been led to a serious loss of power
enterprises in China. It is necessary to establish a modern enterprise system and improve the
internal control system, if the power enterprises want to make steady progress in the fierce
competition. Enterprises should strengthen the supervision of internal control system, to ensure the
implementation of the system. Only in this way can it lay a solid foundation for improving the
efficiency of enterprises.
2. The concept of internal control in electric power enterprises

2.1 The definition of internal control
The definition of internal control varies from country to country. On the whole, it emphasizes the
importance of ensuring the security of assets, accurately recording accounts, and promoting
enterprise management. In China, there is no uniform notion about internal control. It is generally
believed that the internal control is the system of self - supervision and self - adjustment. It is based
on the internal check, created by the management personnel in the management, and summarized by
auditors.
2.2 Elements of internal control
Since the definition of the basic elements of internal control in the COSO report is widely used
throughout the world, this paper has been draws on the definition. The basic elements of internal
control are defined as: control environment, risk assessment control activities, information and
communication, monitoring.
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
156
3. The current situation and problems of internal control in electric power enterprises
3.1 Weak perception of internal control
At this stage, the management of electric power enterprises is generally lack of internal control
concept, which formed an invisible obstacle to the establishment and implementation of the internal
control system. According to the data, nearly forty percent of the domestic power enterprises have
not established the internal control system. In addition, it is difficult to establish an effective
internal control system to solve the existing problems for the management of some power
enterprises. The staff of power enterprises has a bias towards the understanding of internal control.
They think that the internal control is the job of the finance and the auditing department, has
nothing to do with themselves.
3.2 Defective internal control mechanism
At present, most of the power enterprises establish the internal control mechanism to meet the
country's policies and regulations. They did not really take maximizing profits as the goals. Most of
the power enterprises do not really pay attention to the establishment of internal control, and the
independence is very poor. Moreover, the internal control mechanism of the power enterprise is
relatively fixed. As long as there are uncontrollable factors in the internal control, the problem will
not be treated in a timely manner.
3.3 Inadequate enforcement of internal control
The internal control system of some power enterprises in China is only to cope with the
examination of the superior departments, and not implemented in accordance with the provisions of
the state. Although some power enterprises began to pay attention to the construction of internal
control, they used the common internal control system, which is not authoritative and not standard,
unlike the COSO report. They have not built the internal control system according to the actual
situation of their own enterprises.
3.4 Insufficient sharing of internal control information communication
Because of the restriction of the management system and technology level of the electric power
industry, the information system has been seriously divided and the information flow is not fluent.
There are many problems in the electric power industry, including the unclear responsibility, the
monopoly power and so on, which have already affected the operation efficiency of the electric
power enterprise.
4. Causes of internal control problems in electric power enterprises

4.1 The lack of a sound risk management system
Most of the electric power enterprises risk consciousness is weak, because they see themselves as
monopoly industry. The electric power enterprises think that the relationship between enterprise
development and enterprise income is weak, but more is to rely on national policy. With the
development of market economy, they have received the impact of uncertainty factors from the
market. Because of risk management system is not consummate. Managers often make wrong
judgments and then take improper means. Due to the lack of a sound risk management mechanism,
they may not be able to effectively manage and control the risk effectively, which may affect the
development of enterprises and even endanger the survival of enterprises.
4.2 Defective internal control system
Because of the different levels of normalization, most of the units are not in accordance with the
requirements of the internal control system of the group company. In the actual operation, the
internal control system does not affect the various business processes. Its control effect is not good
for the critical control point and the key process. The internal control system of grass-roots power
157
enterprises is not matched with the existing management standards system, which leads to the lack
of internal control implementation.
4.3 The weakness of supervision mechanism
The supervision mechanism of electric power enterprises is composed of internal and external
supervision. At present, a minority of the electric power enterprises which set up establish internal
audit department are very few. At present, in our country, the establishment of internal audit
supervision department of the power enterprises. Even if the internal audit supervision department
was established, its function was seriously weakened and the monitoring effect is also not
satisfactory. Generally speaking, the status of the internal audit department of power enterprises is
not on the high level.
The external supervision system of electric power enterprises is dominated by the government,
and the supervision of the community is supplemented. Because each department has promulgated
the internal control regulations, the external supervision system has not formed the powerful force.
4.4 The deficiency of human resources policy
Human resource allocation is not intensive, and employment of staff and setting the position
arranging is not reasonable. Enterprises should be based on the requirements of each position
arrange the people who has the corresponding ability to do the job. But in fact, the professional
quality of staff is uneven. Grassroots employees can not meet the requirements of the job in the
short term, even they are possible to resist the internal control system. This hinders the authenticity
of the internal control information.
4.5 The lack of legal person structure
The power enterprises of our country have established the corporate governance structure by
referring to the modern enterprise system of foreign countries. But the development background and
process of the electric power enterprise in our country is different from which that is in the foreign
company. In fact, it did not play a important role in the operation and management. The general
manager also serves as a director, and the right has not been effectively supervised. And the board
of directors is short of necessary permanent institutions.
5. The Countermeasures to perfect the internal control of electric power enterprises

5.1 Establishment of a sound risk management system
First of all, leaders at all levels should establish a strong sense of risk, to give sufficient attention
and strong support to internal control. It should establish a clear job responsibility system for
management. It also should establish a clear job responsibility system.
Secondly, enterprises should establish risk assessment and management system and also improve
the risk assessment procedures. Enterprises should set up the risk management organization and the
perfect risk system should be set up. At the same time, through the risk management organizations,
causes of the risk and the stage of the risk, and the measures to prevent risks can be effectively put
forward.
5.2 Improvement of the internal control system
Firstly, Enterprises should formulate relevant system, and strengthen the control of business
activities. Grass roots power enterprises should revise and improve the business management
system. In combination with the actual situation of enterprises, enterprises should revise the
relevant system of internal control which is suitable for various departments and links.
Secondly, Enterprises should strengthen internal control of internal supervision. Internal audit is
the key to the internal control. In view of the problem of poor independence of the internal audit
department, the enterprise should separate the internal auditor from the financial sector, so that it is
158
directly responsible for the board of directors or the board of supervisors. Superior departments
should check the implementation of internal control system.
5.3 Intensifying the implementation of internal control
Enterprises should clearly define the responsibilities of the position and department. They can make
internal control regulations to meet the actual work. Enterprises can develop normative documents
in order to ensure the implementation of internal control responsibilities to the posts and personnel.
In addition, Enterprises should establish a scientific authorization system, and strengthen the
assessment of employees. Enterprises should make the work responsibilities of the management and
consistent regulations. The internal control execution results should be directly related to the
manager's annual assessment and promotion.
5.4 Strengthening the training of staff
First of all, enterprises should strengthen the training of enterprise employees and management.
They should regularly carry out training on internal control, to strengthen the internal control
awareness of all employees. Enterprises should enhance the professional ability of enterprise
employees, especially the comprehensive quality of accounting personnel.
Secondly, Enterprises should establish a scientific employment system, and strengthen the
management system of wages. They should establish a standardized performance appraisal system.
Enterprises should be clearly defined assessment methods, the content of the assessment and the
normal of reward and punishment. They should be the results of the examination and enterprise
employees closely linked to the bonus, and the results of the assessment will be publicized.
5.5 Perfecting corporate governance structure
First, enterprises should clearly divide the rights and responsibilities of their owners. They should
strengthen the reform of property rights, break the monopoly, and fully participate in market
competition. They should enhance the control of the use of rights in the management, and make
sure that the decisions are scientific and normative, so that the board of directors and managements
can be responsible for their own.
Second, the enterprise should make clear the supervisory responsibility of supervisory board. In
accordance with the systemit should supervise the board of directors, managers and the company's
financial position, in accordance with the system. The board of supervisors shall reasonably obtain
the company's supervisory authority, decision-making power and executive power.
6. Summary
Internal control is an important means for enterprises to improve the management level, against the
prevent risk and improve efficiency. The internal control system is an important part of the modern
enterprise system. Management and employees of electric power enterprises should fully
understand the importance of internal control, and give full play to the role of internal control. Only
in this way can the electric power enterprises improve the competitiveness and develop better.
References
[1] Griggs LLAudits of Internal Control over Financial Reporting: What Do They Mean,
Insights, Vol.18, pp.2-11, 2004.
[2] Julie Harrer, Internal Control Strategies: A Mid to Small Business Guide, John Wiley &
Sons, Vol.18, pp.52-66, 2008.
[3] Heather M Hermanson, An Analysis of the Demand for Reporting on Internal Contro
l, Accounting Horizons, Vol.14, pp.225-330, 2000.
159
[4] Smith A K, The Relationship of Internal Control Evaluation and Audit Sample Size,
Accounting Review, Vol.47, pp.259-266, 1972.
[5] Cushing E B, A Mathematical Approach to the Analysis and Design of Internal Control
Systems, Accounting Review, Vol.49, pp.25-52, 1974.
160
The Robust Optimization Applied in Supply Chain

Chunnian Weia, Chenlu Lib,*
School of Management, Shanghai University, Shanghai, China
b
250840276@qq.com
Keywords: Supply chain; Robust optimization; Demand forecasting uncertainty; Fast Fourier
transform approach
Abstract. In order to lowering the uncertainty lying in demand forecasting, we bring in robust
optimization. Unlike the classical methods in demand forecasting, it doesnt request us to know the
accurate demand distribution. Instead, it gives an uncertainty set. In terms of the calculation, we
also put forward the fast Fourier transform approach which greatly reduces computational
complexity. At last, some values are given to these variables to further exhibit the process of robust
optimization and improved algorithm.
1. Introduction
Demand forecasting is the basis for the expansion of revenue and enhancing the competitiveness. In
other words, it is a key to supply chain management. Not only reducing the decision-making errors,
it can also increase revenue.
Generally, demand forecasting in supply chain is not so accurate. Researchers have pointed out
its disadvantages. Jukka Hallikas et. Al (2002) regarded the demand forecasting uncertainty as a
type of risk. In his word, the inaccurate forecast will increase the difficulty of material control, and
even affect the long-term production planning and capacity investment decision. Huang Xiaoyuan
and Yan Nin a (2007) thought the deviation in demand forecasting as a kind of supply chain
uncertainty, which stems from customer uncertainty. It will cause information asymmetry between
enterprises in supply chain, thus affect the stability of the whole supply chain.
The significance of accurate demand forecasting has been stressed by many scholars. In order to
get more accurate demand data, scholars have focused on improving the methods of demand
forecasting. Thomas R. Willemain et. Al (2004) has addressed the irregular demand prediction
problem in supply chain. The paper shows that compared with the exponential smoothing and
Croston method, bootstrapping method can obtain more accurate demand distribution based on the
fixed lead time. Considering various demand forecasting methods all have advantages and
disadvantages, Luis Aburto, Richard Weber (2007) put forward the hybrid system which combines
various techniques to integrate the advantages of all methods. In this way, the accuracy of demand
forecasting in supply chain has increased greatly. While Fang, F., Wong, T. N. (2010) constructed a
Bayesian model in the paper and the results showed the model effectively reduces the cost. They
think accurate and fast prediction information can help manufacturers make optimal decisions.
Meanwhile, Song Huamin et. Al (2011) use the Bayes method to correct the demand. The prediction
error was regarded as a log linear function of time in the information update mode. They established
an optimal decision modal which balanced between the gains and the cost produced by updating the
demand forecasting. Moreover Kou Yukun et. al(2015) established the collaboration demand model
of supply chain to improve the prediction accuracy for the perspective of Petri and Agent.
Meanwhile, some researchers begin to introduce the robust optimization method into supply
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
161
chain. It aims to reduce the uncertainty of demand and improve the prediction accuracy too.Cheng-
Liang Chen, Wen-Cheng Lee(2004)modeled the uncertain market demand situation by using the
discrete multiple known probability and use fuzzy set to reflect the compatibility of price preference
between the sellers and buyers. It shows that the robustness measures as part into the objective
function can greatly reduce the fluctuation of the value of the objective function. D. Bertsimas et. Al
(2006) mainly concerned optimally controlling a supply chain with stochastic demand. Considering
the discrete demand is not evenly distributed over time, the author adopted robust optimization and
constructed the equivalent model to fix demand sequence. This method is better than dynamic
programming. Not only the calculation of large scale supply chain, it can also solve the dimension
problem when using dynamic programming for network supply chain. At the same time, Perakis G,
Sood A(2006)explored the multi-period oligopoly market and used the robust optimization to solve
dynamic pricing for a single perishable product with a fixed inventory. Realizing the fact that
historical data can only help obtain the demand interval, Yan Nina et. al(2008) used a variety of
robust optimization methods to study the problem of competition between multiple retailers under
uncertain demand environment from different perspectives.Considering the operation management
of the closed loop supply chain, the corresponding robust model was constructed by Xu
Jiawang(2008) based on the uncertainty of customer demand. While, Feng Pan, Rakesh Nagi(2010)
thought the design of supply chain in the emerging market can not accurately predict the customer's
demand, so the authors used the robust optimization method to solve the problem of uncertain
demand in the supply chain.
Based on above literature, we introduce robust optimization to construct a new model of
centralized supply chain. Moreover, the improved algorithm is used to reduce computation. In
section 4 we give some numerical simulation and section 5 is a concluding section.
2. Basic assumptions and notation

Suppose there is one supplier and multiple retailers in the market, and the retailer is independent of
each other. We use D j to denote the real demand the retailer j (j=1,2,m)faces with and Q to denote
the total quantity the supplier can offer. The demand faced by the retailer is a random variable and
belongs to the Poisson distribution. Moreover, the retailer j orders a quantity Q j from the supplier
and sells at the price Prj . We also choose v to represent unit salvage value contained by the surplus
products and c to represent the unit product cost. Meanwhile, we assume that Prj is bigger than c,
while v has the smallest value compared with c and Prj .
Assuming that the cost isnt concerned, we can figure out the revenue each retailer get as
following:
Q Pr min Q , D v Q D

rj
j j j j j j
The supplier's residual value:

m
v Q Qj
j 1
Then, we can have the revenue function in centralized supply chain:

c Q j v Q Q j Prj min Q j , D j v Q j D j cQ
m m

j 1 j 1
v c Q Prj v min Q j , D j
m
j 1
2.1 Models
If Q is fixed, the model is formulated as follows:
162
max c Q j v c Q Prj v min Q j , D j
m
Qj
j 1
m
(1)
s.t. Qj Q
j 1

Qj
We use Q*j as the optimal solution.As we all know ,the key to have the maximal expected revenue
max c Q j is to calculate max Pr v min Q , D firstly. It is a standard separable problem and
m
j j j
j 1
can be solved by dynamic programming. As the computational complexity of this dynamic
programming approach is of the order of O(m Q 2 ), its necessary to reduce the calculation.
Obviously, to apply this approach we need an efficient algorithm to compute the function values
min Q j , D j . The improved algorithm is called fast Fourier transform(FFT). See
references[14,15].
2.1.1 An improved algorithm
As said above, we need an improved algorithm to compute the function values min Q j , D j

The first step is to introduce the function given by:
Fj :
Fj Q j min Q j , D j

Qj
For given , that
F j n D j t (2)
n
t 1
Clearly, Fj n Fj n 1 is non-increasing in n. So, Fj is a discrete concave function.Thus, solving

problem(1) equals solving the following model:
m
max Prj v Fj Q j
j 1
m
(3)
s.t. Q j 1
j Q
Q j
Obviously, Q j Q , now introduce for 1hQ, the values

jh =Fj h Fj h 1 p jk
k h
p jk = D j =k
Where
Therefore, Prj v jh
gives the marginal value of increasing Q j from h-1 to h.The core of this
mQ marginal revenue matrix.
improved algorithm is to introduce a
Pr1 v 11 Pr1 v 12 Pr1 v 1Q

Pr2 v 21 Pr2 v 22 Pr2 v 2Q

Prm v m1 Prm v m 2 Prm v mQ
The optimal value of function (3) can be found by sorting j jh values and adding up the
Pr v
first Q terms. Meanwhile the number of times index j appears among these Q terms give the optimal
*
F
solution Q j . As j is discrete concave, the marginal value in each row j are in descending order, ie:
163
Pr
j v j1 Prj v j 2 Prj v jQ
. Thus, every time we have to do is to compare those values
on the left side which havent been selected for comparison last time. In this way, we just need to
the computational complexity of the proposed
compare total m values each time. Consequently,
approach reduces to the order of O(mQ).
2.1.2 A robust optimization approach
In the process of modeling, we also need to know the probability distribution of demand. Such
probabilities are always estimated by analyzing the historical data, and hence they are prone to
inaccuracies. In order to reduce the impact of inaccurate demand estimation, we propose the robust
optimization approach. References[16,17,18]
Assume the random variable D j , representing the actual demand faced by the retailer j, is

concentrated on
0, , K p j p j0 , , p jK
, and this demand has an estimated probability vector .

p jk
Each is assumed to be positive. To compensate for possible estimation errors, we consider

j
1jm the probability vector pj
belonging to the uncertain set given by:
K 1

j pj pj p j j , p j e 1

Where

2

b jk 2
j b j b j 0 ,
K

, b jK K 1

k 0
j

p jk
0,1
with j
Clearly, the demand depends on its distribution probability p j , hence we can denote this
random variable by j j . Now we have the robust counterpa
D p rt of problem (1):
max min c Q j v c Q Prj v min Q j , D j p j

m
Qj p j j
j 1

m (4)
s.t. Q
j 1
j Q

Qj

Same as the chapter 3.1, we introduce G j : given by
G j n min min n, D j p j
p j j (5)
pj j
For every , the function

n min n, D j p j

is discrete concave on .

s
The problem (4) can be rewritten a
max Prj v G j (Q j )
m
j 1
m
(6)
s.t. Q j 1
j Q

Qj
,
For given p j j
164
Q j 1

min Q j , D j p j kp jk Q j p jk c Q j p j
K

k 0 k Q j
Where
c Q j c0 Q , c Q , , cK Q

j 1 j j
0,1, , Q j 1, Q j , Q j , ,Q j
By relation (5), we have

G j Q j min c Q j p j p j j

(7)

c Q j p j min c Q j b j b j j , b j e 0

Using standard nonlinear programming techniques(references17-18), its easy to show

min c y y Ay 2 , e y 0
(8)
e A1c
2
c A1c
e A1e
Where A is symmetric and positive definite. It shows that the last term in relation(7) has an
analytic expression.
Using c0 Q j 0 , we have
2
K 2
2
k 1 p jk ck Q j

G j Q j c Q j p j j p jk ck2 Q j ( Qj Q )
K
K
2
k 1
k 0 jkp
Same as the chapter 3.1, we introduce jh ,for 1hQ ,

jh G j h G j h 1
At the same time, we can get a mQ marginal value matrix

Pr1 v 11 Pr1 v 12 Pr1 v 1Q

Pr2 v 21 Pr2 v 22 Pr2 v 2Q

Prm v m1 Prm v m 2 Prm v mQ
Certainly, we can also use FFT to get the optimal objective function value.
2.2 Numerical simulation
2.2.1 Classical model
Firstly, we give a certain value of some variables.
We set Pr1 30 , Pr2 20 , Pr3 25 , Pr3 35 ,v=3,c=10. We also suppose that there exist four retailers
in the market and the quantity the supplier can offer is ten. It means m=4, Q=10. At the same time,
we assume 1 =2.9, 2 =3.2, 3 =3.0, 4 =3.5
Because the demand variable belongs to Poisson distribution, we use Excel to randomly generate
a 410 matrix about jh (j=1,2,3,4h=1,2,,10):
11 12 13 14 15 16 17 18 19 110
22 23 24 25 26 27 28 29 210
21
31 32 33 34 35 36 37 38 39 310

41 42 43 44 45 46 47 48 49 410
165
0.945 0.785 0.554 0.330 0.168 0.074 0.028 0.010 0.003 0.001
0.950 0.801 0.577 0.352 0.184 0.084 0.033 0.012 0.004 0.001

0.959 0.828 0.620 0.397 0.219 0.105 0.044 0.016 0.005 0.001

0.969 0.863 0.678 0.462 0.274 0.141 0.064 0.026 0.009 0.002
Then a 410 marginal value matrix can be obtained:

25.508 21.200 14.953 4.536 1.997 0.769 0.261 0.077 0.017
8.914
16.149 13.610 9.801 3.136 1.422 0.565 0.197 0.060 0.014
5.992

21.092 18.223 13.631 8.734 4.816 2.308 0.971 0.359 0.115 0.028

31.001 27.619 21.700 14.795 8.753 4.524 2.057 0.823 0.283 0.073
Now we can apply FFT :

(1) Find the first maximum. In the first column, 31.001>25.508>21.092>16.149, easily we know
the value of first maximum is 31.001;
(2) Find the second maximum. Because 27.619>25.508>21.092>16.149, the value of second
maximum is 27.619;
(3) Find the third maximum. As 25.508>21.700>21.092>16.149, we can get the value of third
maximum is 25.508;
(10) Find the tenth maximum. 14.795>13.631>13.610>8.914, so the value of ninth maximum is
14.795.
For now, we have found the first ten maximum values as follows:
31.001,27.619,25.508,21.700,21.200,21.092,18.233,16.149,14.953,14.795
Q1* =3, Q2* =1, Q3* =2, Q4* =4, max c Q1 , Q2 , Q3 , Q4 142.250
Q1 ,Q2 ,Q3 ,Q4
It means, the quantity the first retailer ordered is three; the quantity the second retailer ordered is
one; the quantity the third retailer ordered is two; the quantity the fourth retailer ordered is four. And
the maximum revenue the whole supply chain can get is 142.250.
2.2.2 Robust model
Set K=10, 1 =0.2, 2 =0.4, 3 =0.6, 4 =0.8
p1 0.055,0.160,0.231,0.224,0.162,0.094,0.045,0.019,0.007,0.002.0.001

p 2 0.050,0.149,0.224,0.224,0.168,0.101,0.050,0.022,0.008,0.003,0.001

p 3 0.041,0.130,0.209,0.223,0.178,0.114,0.061,0.028,0.011,0.004,0.001

p 4 0.030,0.106,0.185,0.216,0.189,0.132,0.077,0.039,0.017,0.007,0.002

Then we can get a 410 matrix about jh (j=1,2,3,4h=1,2,,10):

0.864 0.717 0.511 0.312 0.163 0.073 0.028 0.010 0.003 0.001
0.789 0.662 0.487 0.312 0.171 0.081 0.033 0.012 0.004 0.001

0.720 0.615 0.472 0.323 0.193 0.098 0.043 0.016 0.005 0.001

0.657 0.574 0.459 0.338 0.222 0.126 0.061 0.025 0.009 0.002
Thus the marginal value matrix can be obtained:

23.324 19.349 13.804 8.421 4.388 1.964 0.764 0.260 0.077 0.017
13.414 11.246 8.274 5.301 2.915 1.370 0.556 0.196 0.060 0.014

15.849 13.539 10.380 7.112 4.237 2.156 0.941 0.355 0.114 0.028

21.023 18.370 14.685 10.820 7.106 4.017 1.938 0.801 0.280 0.073
Same as the chapter 4.1, the first ten maximum values can be found by using FFT:
166
23.324,21.023,19.349,18.370,15.849,14.685,13.804,13.539,13.414,11.246
Q1* =3, Q2* =2, Q3* =2, Q4* =3, max c Q1 , Q2 , Q3 , Q4 =94.603
Q1 ,Q2 ,Q3 ,Q4
It means, the quantity the first retailer ordered is three; the quantity the second retailer ordered is
two; the quantity the third retailer ordered is two; the quantity the fourth retailer ordered is three.
And the maximum revenue the whole supply chain can get is 94.603.
3. Conclusion
This paper mainly focus on the problem of inaccuracy demand forecasting in supply chain. We
construct a robust model with one supplier and multiple retailers. Robust optimization is used to
reduce the uncertainty of demand forecasting. Furthermore, numerical simulations show the method
is applicable and can be implemented. As to the improved algorithm, we can see its convenience
and efficiency. For solving the discrete problem, it reflects its unique advantages in terms of
reducing computational complexity.
References
[1]Hallikas J, Virolainen V M, Tuominen M. Risk analysis and assessment in network environments:
A dyadic case study. International Journal of Production Economics, vol.78, pp. 45-55,2002.
[2]Huang Xiaoyuan, Yan Nina. Research Progress on Supply Chain Robustness. Chinese Journal of
Management, vol.4, pp. 521-528,2007.
[3]Willemain T R, Smart C N, Schwarz H F. A new approach to forecasting intermittent demand for
service parts inventories. International Journal of forecasting, vol.20, pp. 375-387,2004.
[4]Aburto L, Weber R. Improved supply chain management based on hybrid demand forecasts.
Applied Soft Computing, vol.7, pp. 136-144,2007.
[5]Fang F, Wong T N. Applying hybrid case-based reasoning in agent-based negotiations for supply
chain management. Expert Systems with Applications, vol.37, pp. 8322-8332,2010.
[6]Song Huamin, Yang Hui, Luo Jianqiang. Research on supply chain cooperation strategy based on
Bayes demand forecast updating. Journal of Management Engineering, vol.25, pp. 220-
227,2011.
[7]Kou Yukun, Huang Mengxing, Chen Hongyu. Predicting Model of Supply Chain Demand Based
on Petri Net and Agent System. Computer Engineering and Design, vol.39, 2015.
[8]Chen C L, Lee W C. Multi-objective optimization of multi-echelon supply chain networks with
uncertain product demands and prices. Computers & Chemical Engineering, vol.28, pp. 1131-
1144,2004.
[9]Bertsimas D, Thiele A. A robust optimization approach to inventory theory. Operations Research,
vol.54, pp. 150-168,2006.
[10]Perakis G, Sood A. Competitive multi-period pricing for perishable products: A robust
optimization approach. Mathematical Programming, vol.107, pp. 295-335,2006.
[11]Yan Nina, Huang Xiaoyuan, Ma Longlong. Research on Robust Stochastic Optimization of
Multi-Retailers Competition under Demand Uncertainty. Chinese Journal of Management
Science, vol.16, pp. 50-54,2008.
[12]Xu Jiawang, Huang Xiaoyuan, Guo Haifeng. Robust Optimization Model for Operating of
Closed-loop Supply Chain with Uncertain Demands. Systems Engineering and Electronics,
vol.30, pp. 283-287,2008.
167
[13]Pan F, Nagi R. Robust supply chain design under uncertain demand in agile manufacturing.
Computers & Operations Research, vol.37, pp. 668-683,2010.
[14]Golub G H, Van Loan C F. Matrix computations. 1996[J]. Johns Hopkins University, Press,
Baltimore, MD, USA, 1996: 374-426.
[15]Bertsekas D P. Nonlinear programming[J]. 1999.
[16]Birbil S I, Frenk J B G, Gromicho J A S, et al. The role of robust optimization in single-leg
airline revenue management. Management Science, vol.55, pp. 148-163,2009.
[17]Ben-Tal A, Nemirovski A. Robust convex optimization. Mathematics of Operations Research,
vol.23, pp. 769-805,1998.
[18]Bertsimas D, Sim M. Robust discrete optimization and network flows. Mathematical
programming, vol.98, pp. 49-71,2003.
168
Evaluation of the Regional Innovation at the Provincial Level
Lixin Daia, Ying Chenb,*, Ruifen Zhaoc

Department of Economics&Management, North China Electric Power University, Baoding city,
Hebei Province,China
a
dlx1966@163.com, b987078379@qq.com, czhrf001@126.com
*Ying Chen
Keywords: Regional development; The innovation ability; Comprehensive evaluation method
Abstract. Regional innovation ability is an important factor to promote balanced development among
regions. Accurate measure of regional innovation ability although very difficult, but it is as necessary.
In this paper, by using the method of comprehensive evaluation, to empowerment of performance
index of regional innovation ability, construct evaluation system.
1. Introduction
Provincial regional innovation ability is an important factor affecting regional development.
Especially in the current collaborative development environment, regional innovation ability of high
and low will be important impact on the region's economic development. Provincial region to develop
practical and feasible development plan, must be based on innovation, through innovation drive to
build the new bright spot of economic development. Promote regional innovation ability, must first
understand the province's regional innovation environment, and grasp the innovation ability of
innovation main body to the province. This needs an effective measuring of the "tool" of regional
innovation activities, regional innovation index. Regional innovation index reflects the changes in the
status quo and development of regional innovation ability; by observing the index changes, we can
understand the main factors affecting the development of regional innovation ability, dynamic
development and monitor all areas of the high and new technology industrial structure changes,
provide effective basis for scientific decision-making.
Based on the background of the regional coordinated development, constructs the reflection of
provincial regional innovation ability index system and evaluation method, to measure index of
regional innovation, so as to realize the provincial regional innovation ability and the development
status of statistical monitoring and evaluation, in order to provide a reference for relevant departments
to formulate regional innovation development policy
2. The provincial construction of regional innovation ability evaluation index system
2.1 Provincial regional innovation ability evaluation index system of the principle of building
Currently, some new area and some other places have been programmed in regional innovation index
so as to promote innovation and development. Based on the research of provincial regional innovation
ability evaluation index system, should refer to the above the actual case, at the same time also should
follow the following three principles.
2.1.1 Should focus on technical innovation and non-technical innovation at the same time
A focus at present innovation in other areas of the index is relatively narrow, focus on technological
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
169
innovation. And, in fact, provincial regional innovation ability are not limited to technology
innovation, there are many other reflect social life aspects of the technical innovation activities should
also be incorporated into consideration.
2.1.2 Attaches great importance to the cultivation and innovation results at the same time
In the process of provincial regional continuous development, the evaluation of innovation ability
should also consider its innovation cultivation conditions and results. Innovation results can show the
current provincial areas, cultivating can reflect the regional innovation ability and innovation of the
development of the future, cultivating innovation ability including the situation of the innovation
environment, etc. Cultivating innovation ability of regional innovation capability and regional
economy sustainable development has very important influence. Both should be also included into the
evaluation system of innovation ability.
2.1.3 Should pay attention to regional social and ecological benefit indexes, etc
Existing regional innovation evaluation index tend to ignore the improvement of human survival
environment, only pay attention to the positive impact on innovation, and ignore its negative effects.
Ecological civilization construction is the important foundation to promote the development of
provincial area. Provincial regional innovation should be to achieve economic benefit, social benefit
and ecological benefit of organic combination as the goal.
2.1.4 Should attach importance to the region, and the synergistic effect of the region and the
surrounding
Focuses on the current innovation ability index system considering the input and patent number
indexes, but rarely involves the interaction between the subjects of evaluation. The interactions
between organizations can produce synergistic effect, can promote the circulation of resources,
information sharing, it is also the important factors that affect the future of provincial regional
innovation ability, take a consideration.
2.2 Build the index system
Domestic and foreign scholars from different Angle of view of regional innovation ability are defined.
Hailing woos (2003) is the ability of creative integration of factors of production. Liu Lin (2003)
argue that, regional innovation ability is within a region by the abilities of knowledge creation,
knowledge flow, enterprise technology innovation ability, innovation environment and innovation
output elements convert knowledge into new products, new technology, new service ability. Also
have some scholars from the perspective of network paradigm to explore innovation problem, the
responses of the regional innovation ability in the regional innovation network composed of the main
body interaction. Freeman (1991) puts forward the concept of innovation network: "innovation
network is for the sake of innovation and form the system arrangement, market and organization in
the form of mutual infiltration and connection mechanism is the innovation of enterprise cooperation
relationship". Zhang Yinchuan (2010) argues that regional innovation system is the area of relatively
concentrated and division of labor and the associated enterprises, colleges and universities, research
institutions, government departments and agencies, around the regional development strategic target,
through extensive formal or informal areas inside and outside the exchanges and cooperation,
promote innovation of network system. This paper defines regional innovation ability as: regional
innovation ability is in the area between organizations and interacts with area outside the organization
form of innovation network, the constant discovery, creation of new resources, and effectively
combines with social conditions, into the ability of production, consumption and services.
In this paper, the results from innovation, foster innovation and regional network interactive three
Angle index system design, the composition of the concrete index system is shown in table 1.
170
Tab. 1 at the provincial level evaluation index system of regional innovation capability
Level indicators The secondary indicators Level 3 indicators
Environment pollution investment as a share of GDP
Education spending accounts for the proportion of GDP
Number of research and development institutions
Number of professional and technical personnel ten
Innovation results
thousand people
R&D spending as a share of GDP
Enterprise research and development spending accounts
for the proportion of main business income
Regional innovation The government's management ability
ability at the provincial The protection of intellectual property rights
level (C) Innovation cultivation The preferential tax level of high and new technology
All kinds of cultural institutions
Information of social life
Number of cooperation projects enterprises with colleges
and universities, scientific research institutions
The government orientation and the parties
Area network interactive
responsibilities defined degree of detail
Complementary resources docking coordination degree
Synergy degree across administrative region
2.3 Superiority analysis

Other regional innovation focuses index narrow, focus on technological innovation. Most innovation
index is designed to measure efficiency of scientific and technological innovation, to the service,
social and management of non-technical innovation not enough, and this should be precisely evaluate
provincial regional innovation ability to focus. This paper builds the evaluation index system of
regional innovation ability at the provincial level at the same time focus on the technical innovation
and non-technical factors can be more comprehensive and more scientific evaluation of provincial
regional innovation ability.
Other regional innovation index ignores the social and ecological benefit indexes. Existing
regional innovation evaluation index tend to ignore the improvement of human survival environment,
only pay attention to the positive impact on innovation and ignore its negative effects. Ecological
civilization construction is the important foundation to promote the development of provincial area.
Gradually increase the ecological space and improving environmental quality should be as the
constraints to economic construction and social development. Provincial regional innovation should
be to achieve economic benefit, social benefit and ecological benefit of organic combination as the
goal.
This paper builds the provincial regional innovation evaluation system considers the body interior,
synergistic effect of interaction between subject and other subjects. Regional innovation ability
produced in regional innovation networks of interaction between the compositions of the main body,
the relationship between the subjects and determines the innovation ability and the ability of resource
integration system to cope with risks, etc. Existing regional innovation ability evaluation system lacks
specific index of the interactive relationship between quantitative subjects.
3. Method
For each evaluation index weights of indicators should be relatively important degree of a kind of
subjective and objective measurement. Depending on the source of the calculation when the original
data, determine the weight of methods can be roughly classified into two kinds: one kind is subjective
values. The method, including comprehensive index method and AHP method, the original data is
mainly composed of experts based on experience judgment. This article selects the entropy method to
determine the weights of evaluation indexes, minimize subjective randomness bias. According to the
171
theory of information theory, entropy is for the measurement of the system disorder, said comes higher
entropy can obtain the less amount of information, the disordered degree is higher, and the
understanding of the system is more difficult. If use k to represent the entropy value, expressed in beta
= 1 - k information utility, beta value range is 0 or less beta 1 or less, beta, the greater the value, the
higher its importance, the corresponding weights. Using entropy method to determine index weight
mainly has the following four steps:
(1) Basic data matrix normalized processing. Assume that select m years, n evaluation index, x as
the year the first j I indicators values (I = 1, 2, m; j = 1, 2, n), depending on the above, the established
evaluation index system for data collecting and organizing, basic data matrix can be
obtained: X ' x'ij mn
x'11 x'12 ... x'1n

x' x'22 ... x'2 n
X ' = 21

x'm1 x 'm 2 ... x'mn
Because each index of the unit of measurement and measurement standard is different, can't
compare directly, so need to standardize processing, according to the formula 3.1 standardized
processing to the original data matrix, standardized data are obtained.
x'ij min j x'ij
xij
max j x' ij min j x'ij
x11 x12 ... x1n

x x22 ... x2 n
X 21 j =1, 2, 3, n (3.1)

xm1 xm 2 ... xmn
(2) According to the formula for calculating the first j a 3.2 evaluation index of entropy.
m
k j h f ij ln f ij
i 1
yij
h (ln m) 1 f ij m
and if f ij 0 f ij ln f ij 0 j =1,2,3,....n (3.2)
y
i 1
ij
(3) calculate the weight of each index, the weights are the first j a can calculate according to the
formula 3.3.
j
wj n

j 1
j
n
0 w j 1 w j 1 j =1,2,3,....n (3.3)
j 1
172
Regional innovation ability of high and low, there is no exact boundaries are a relative concept.
Fuzzy comprehensive evaluation based on fuzzy mathematics, the application of the principle of
fuzzy synthesis, from multiple factors on "connotation clear, the extension is not clear" characteristics
considered things membership grade is a method of comprehensive evaluation, the evaluation result is
not absolutely yes or no, but is represented as a fuzzy set, so the introduction of fuzzy comprehensive
evaluation to calculate the relative membership degree of each index, comprehensive evaluation
index, a calculation to the provincial regional innovation ability is described and evaluated.
(1)Determine the evaluation objects, evaluation set. If the regional innovation ability as the
evaluation object set; Using the identified in table 3 evaluation index system, and corresponding
evaluation index evaluation sets V = {high, low}, namely provincial regional innovation ability has a
"high" and "low" two grades, the other is the intermediate state between the two levels.
(2)To calculate the relative membership degree of each index, evaluation index of relative
membership degree matrix. In fuzzy set theory of relative membership degree is for limited field
collection of objects (evaluation) in the different decision-making merits compared, has nothing to do
with the decision of outside, can reduce or even eliminate the defects of subjective arbitrariness. First
R
of all, each index are calculated separately, and the relative membership degree g and relative
R Rb 1
membership degree Rb g .
Positive indicators relative to the "good" membership
1 x j x j max
x x
degree Rg x j min x j x j max
j j min
x j max x j min x j x j min

0
Negative indicators relative to the "good" membership

1 x j x j min
x j x j
degree Rg max
x j min x j x j max
x j max x j min x j x j max
0
Relative membership degree value between 0 and 1, 1 represents a year of a relative to the other
years the same indicators of good status, 0 means from one year of a poor relative to the other years
the same indicators of the state. Relative to the interval [0, 1] said 1 or 0 that is relative to the
subordinate degree of the state of the good or bad.
(3) Comprehensive evaluation index. Finally according to the weight of each index matrix and the
relative membership degree matrix, the formula of specific
Se see formula: 3.1. According to the formula
to calculate the annual regional innovation ability evaluation matrix, can get provincial regional
innovation index, then the longitudinal comparison.
4. Summary
When choosing evaluation index, this paper not only consider the man, money and material input
indicators, outcome indicators, and the management of government, market, society support index
and environmental index of regional innovation, and considering the provincial area for nurturing
innovation situation, ensure the comprehensive, scientific selection of indicators. Provincial regional
innovation index is a complex systems engineering, and based on many factors, this paper also only
on its innovation ability index system is built and the choice of evaluation methods discussed some, in
view of the relationship between the data collection and time, the lack of empirical part of the study,
these problems will be improved in the later research.
173
5. Acknowledgement
This research was financially supported by the science and technology project of Hebei Province
Research on Regional Innovation Index of Hebei Province Based on Regional Integration of
Beijing-Tianjin-Hebei (Grant NO. 16457636D)
References
[1] Chen S Y, Talking about the relative membership degree. The Exploration of the Nature, 1993, 12
(44): 25 to 27.
[2] Cooke P. The new wave of Regional Innovation Networks: Analysis, Characteristics and Strategy
[J]. Small Business Economics, 1996, 8(2):159-171.
[3] Freeman C. Networks of Innovators: Synthesis of search Issues [J].Research Policy, 1991,
20(5): 499M. Y. Jaber and S. K. Goyal, Coordinating a three-level supply chain with multiple
suppliers, a vendor and multiple buyers, Int. J. Production Economics, vol. 116, pp. 95-103, 2008
174
Analysis of the Behavior of Buying Fake Product on Purpose

Hongchao Ning, Fangzhong Shi
Graduate school of Harbin University of Commerce, Harbin, China
649517597@qq.com
Keywords: Buy fake product on purpose; Claims disputes; Living consumers; Protection of legal
system
Abstract. In recent years, with the continuous development of China's market economy, various
interests of the social market players are becoming increasingly complex. In the recent period in
China, there has been a special phenomenon in the socialist market, namely the market phenomenon
of the game between the seller and the counterfeiter in the market. In a market economy, a portion
of fake sellers of the market participates obtain the huge interests through the purchase of fake
goods or services, while another part of the consumers buy fake product on purpose, they also
obtain huge interests by resorting to legal means through the behavior of buying the fake products.
Whether such behavior of buying fake product on purpose should be fairly protected by the legal?
Therefore, the discussion on the behavior of buying fake product on purpose has become the focus
of this paper.
1. Introduction
The author will divide this paper into three parts to conduct the relevant discussion on the behavior
of buying fake product on purpose. In the first part, the author will briefly introduce what is about
the behavior of buying fake product on purpose. In the second part, the author will mainly discuss
the related controversy on the behavior of buying fake product on purpose. For the third part, in
order to better understand the behavior of such kind of buying fake product on purpose, the author
will analyze how to better face and solve this kind of buying fake product on purpose from Chinas
legal system.
2. Simple analysis of buying fake product on purpose

"Buy fake product on purpose" refers to the phenomenon that consumers in the main body of the
market still buy the goods or services that are known with the false sales in the process of buying
related goods or services. Simply put, buy fake product on purpose is that consumers still buy the
fake products when they know those products are fake products. Regarding to buying fake product
on purpose, there are generally two different understandings. The first viewpoint is that the behavior
of buying fake product on purpose is that consumers buy fake product on purpose in order to covet
cheap price of fake products, in this understanding, the consumers buy fake products simply want to
get low price of fake products to achieve the purpose of maintaining their own price benefits. The
second viewpoint is that behavior of buy fake product on purpose refers to that the consumers
behavior of buying fake product on purpose is intended to use the sellers punitive compensation for
selling the fake products as provided in the law to buy the fake products, thus to achieve the
purpose of claim for huge amount of compensation from the sellers, such kind of buying fake
behavior is not just a simple behavior of buying fake products, but to buy the fake products "on
purpose".
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
175
3. Debate on the behavior of buying fake product on purpose
In China's current academic community today, theres the different attitudes to the behavior of
buying fake product on purpose, on the whole, theres more voices against the behavior of buying
fake product on purpose, but there are certainly a lot of supporters of the behavior of buying fake
product on purpose, and the reasons for both parties to support their viewpoints with respect to the
purpose of buying the fake product on purpose are also worthy of thinking. Whether in the end the
status of the behavior of buying fake product on purpose in the legal environment in China today,
whether its behavior is with legitimate legitimacy, all is worth us to discuss.
3.1 Relevant theories of supporters of the behavior of buying fake product on purpose
The relevant theories of supporting the behavior of buying fake product on purpose is that whether
the motivation for actors to buy fake product on purpose is for simple acquisition of low-cost
interests or to claim for the compensation, in essence, the purchased goods or services are for their
final consumption of living, so the law can completely define the actors buy fake product on
purpose are the consumers in the legal sense, theres no dispute for this. Since the actors buy fake
product on purpose is consumers in the legal sense, they should be fairly protected by the law.
Supporters of supporting the behavior of buying fake product on purpose also argue that China's
Consumer Protection Act explicitly protects the consumers' interests. Regardless of the motivation
of the actors in the process of buying fake product on purpose, as long as they buy the fake goods or
services, they should offer the punitive compensation to sellers as provided by law accordingly.
Even from the aspects of maintenance of legal authority and practical practice in China, the actors
buy the fake product should also be supported by the society.
While the behavior of buying fake product on purpose is in line with legal protection as provided
on the legal level, such behavior should also confirm to the traditional morality of fairness and
justice in social morality. In current market economy, as long as the fake product purchasers buy the
fake goods or services, from a moral level, they should be offered the appropriate compensation, if
the sellers are free from punishment because of purchasers buying fake product on purpose, this
also is not in line with the traditional moral understanding of the fair trade.
3.2 Relevant theories of opponents of the behavior of buying fake product on purpose
Opponent theory of the behavior of buying fake product on purpose holds that China's Consumer
Protection Act clearly provides for the protection of the interests of consumers. According to the
provisions of Article 2 of the Act, consumers are clearly defined as three: (1) to buy goods; (2) to
use goods; (3) to accept the services. Among the consumers as stipulated by the Act, theres a clear
premise that the actors must have the perpetrator of the purpose of living consumption. Conversely,
the actors buy fake product on purpose do not buy simply for the purpose of living consumption,
but they have some other purposes and motivation, such as to buy fake products in order to obtain
the punitive compensation from the sellers, so the actors buy fake product on purpose should not
constitute the consumers in the legal sense, naturally they should not be protected by the relevant
law.
The actors against buy fake product on purpose also argue that the legislative intent of Consumer
Rights Protection Act is to protect the rights and interests of consumers who are disadvantaged in
social market activities, thus to compensate consumers for their losses and protect the market order
of fair trade. In the process of actors buy fake product on purpose, they often get great benefits
through the legal means. In essence, they do not suffer the real losses, and this is not in line with the
ultimate purpose of protecting the losses of consumers, and also does not really safeguard the
market order of fair trade that should be reached by law. So opponents do not think that actors buy
fake product on purpose should be subject to relevant legal protection.
Finally, the opponents also put forward that the behavior of buying fake product on purpose to a
certain extent has contributed to unearned atmosphere in the society, as long as the actors buy fake
product on purpose to buy fake products or services, they may obtain the huge economic benefits,
176
which in the traditional moral do not meet the value pursuit of China. The continuous appearance of
the phenomenon of buying fake product on purpose has tended to cause certain accumulation of
judiciary resources in China, the judicial authority has to do a lot of preparations in order to deal
fairly with the behavior of buying fake product on purpose, which is not conducive to efficient
working environment of the judicial authority in China.
4. Legal response methods against the behavior of buying fake product on purpose
In today's academic circles of China, there is no clear definition of the behavior of buying fake
product on purpose. In order to better guide the market economy behavior, the author believes that
it is necessary to correctly regulate such behavior of buying fake product on purpose. If theres no
correct and favorable guidance for the behavior of buying fake product on purpose, the market order
may be affected certainly. But to have a good standard for such behavior of buying fake product on
purpose, the author thinks its necessary to guide from the two aspects of legislation and the
judicature. Only China's legal system is continuously improved from the legislative and judicial
aspects can China's market order be under healthy and favorable development.
4.1 Legislation perfection of behavior of buying fake product on purpose
For the sale of fake goods on the market, China's protection means for the consumers is mainly
China's Consumer Protection Act. According to the Act the consumer is defined as: natural persons
buy goods or services for personal consumption. But the Act does not further clarify whether the
individuals in the behavior of buying fake product on purpose are real consumers, the author
believes that from the perspective of protecting the market order of fair trade, it is necessary to
clearly identify the consumer status of actors buy fake product on purpose in Consumer Protection
Act, which is conducive to the social public better fight against the market selling behavior. In
addition, regarding to the sellers behavior of selling fake goods, it is necessary to strictly improve
and increase the penalties for the behavior of consumers from the legislation.
4.2 Judicial perfection of the behavior of buying fake product on purpose
The behavior of buying fake product on purpose in the market has hit the sellers of selling fake
product to a certain extent. In order to better lead the healthy order of market in China, it is
necessary for the judicial organs at all levels to make a definite guidance on the behavior of buying
fake product on purpose. The people's courts shall make certain relatively fair and directive
jurisprudence on the behavior of buying fake product on purpose in the market and publicize it in
the public information platform of the court for people to inquire and guide such a purchase fake
product on purpose.
In the judicial proceedings of China, in order to better protect interests of consumers, for the trial
of behavior of buying fake product on purpose, and the corresponding proceedings can be
simplified accordingly, the appropriate reference to the foreign advanced legal system, correct and
efficient identification of the nature of such behavior of buying fake product on purpose, reducing
the consumer concerns about litigation, thus to ensure that China has correct good market order.
5. Conclusion
China's market economy is now in a critical stage of rapid development, a variety of market
phenomena appear one after another. In Chinas market, the behavior of buying fake product on
purpose is derived from such kind of the market background, which requires all parties in China's
market economy to treat and understand this kind of buy fake product on purpose. In order to better
protect the healthy development of our market order, governments at all levels and the judiciary
need to correctly regulate and guide the behavior of buying fake product on purpose. Consumers in
the market should also correctly understand and treat the behavior of buying fake product on
purpose. By correctly handling the social effects of the behavior of buying fake product on purpose,
177
it is propitious for us to effectively implement the strategy of governing the country according to
law and guarantee smooth progress of the socialist market economy in China.
References
[1] Sun Hong, editor: Consumer Protection Act, Beijing: Tsinghua University Press, 2011 edition.
[2] Zhang Yanfang: Research on Consumer Protection Act, Beijing: Law Press, 2010 edition.
[3] Simon James editor: Economic Law, London: Peking University Press, 2014 edition.
[4] Wang Changmin: "On actors buy fake product on purpose is consumers", Consumer Guide,
2008
[5] Mi Jian: "Buy fake product on purpose should not be protected", Legal Daily, July 1, 2004.
[6] Will Cooper: "Legal exploration of phenomenon of buying fake product on purpose", Law
World, 2001 March.
178
China Pakistan Economic Corridor: Socio-cultural Cooperation and its

Impact on Pakistan
Muhammad Ibrara*, Jianining Mib, Muhammad Rafiqc

School of Management, Harbin Institute of Technology, Harbin 150001, P.R China.
a
ibrarshabjani@yahoo.com, bmijianing@126.com, crafiq109@yahoo.com
*Muhammad Ibrar
Keywords: China Pakistan economic corridor; Socio-cultural cooperation; Impact on Pakistan
Abstract. The China Pakistan Economic Corridor can play important role in the mutual cooperation
between two neighboring countries. Socio-cultural cooperation occupies a relatively significance
place in regional cooperation. Based on the notion of win-win situation, the meaning of
Pakistan-China Economic Corridor needs to be review from socio-cultural point of view.
Socio-cultural cooperation could provide an opportunity for self-reflection and deep understanding of
each other. Economic Corridor is the most important agreement signed between Pakistan and China
till now. This article discuss that this corridor will improve linkages between China and Pakistan and
its impact on the living standard of Pakistani people as well as it will create more job opportunities
and with improvement of communication channels the agriculture sector of Pakistan will boost. This
study is based on the evaluation of the socio-cultural cooperation and its impact on the local
development of the country especially related to the development of the Pakistani society.
1. Introduction
The ChinaPakistan Economic Corridor, frequently stated through the abbreviation CPEC, is a group
of plans presently still in the phases of construction which have an accumulated budget of around $51
billion, envisioned to quickly increase and enlarge the infrastructure of Pakistan in addition to
deepening and broadening the economic relations among the People's Republic of China and Pakistan
[1]. The passage is reflected to be an addition of China's determined single route enterprise, and the
significance to China of China Pakistan Economic Corridor (CPEC) is revealed by its addition as
portion of China's 13th five-year growth plan. Under the sponsorship of this cooperation the
infrastructure projects will span across all corners of Pakistan, and will ultimately connect to China's
northwestern independent area of Xinjiang to the city of Gwadar in Pakistan through a massive link of
railways and highways [2]. Planned development and infrastructure plans are valued roughly around
$11 billion, and these projects will be bankrolled by deeply sponsored by concessionary loans that
will be distributed by the China Development Bank, the Industrial and Commercial Bank of China
and Exim Bank of China to the Government of Pakistan. As part of the comprehensive bundle of
infrastructure and development projects under CPEC, the Karakoram Highway amongst Rawalpindi
and the Chinese border will be totally rebuilt and repaired, and a 1,100 kilometer extended motorway
will be built between the cities of Lahore and Karachi. The main railway line between Karachi and
Peshawar will also be repaired and upgraded so trains can be allowed to travel at the speed of up to
160 kilometers per hour hopefully by the December of 2019 [2].
In fact, it was Pakistan that gave the proposal of this mega project way back in the 1960s. The idea
of this project is as old as the idea of Gwadar Port itself. The idea was actually conceived in 1964 but
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
179
due to a number of constraints, it was not implemented [3]. Again the idea to establish an economic
corridor began in the 2000s, but gained momentum with the initiation of assertive Chinese
leadership under Xi Jinping. It has since become a central theme of discussion in Sino-Pakistani
high-level collaboration. In February 2013, state-owned China Overseas Ports Holding Limited took
administrative control of the Gwadar Port. During Premier Li Keqiangs visit to Pakistan in May
2013, the two sides signed agreements on the blueprint for the China Pakistan Economic Corridor
(CPEC) [4]. Finally the mega project came into shape during visit of president xi Jingping to Pakistan
in April 2015 [3].
In short, the China Pakistan Economic Corridor (CPEC) is a mega project benefiting whole of
Pakistan with smaller provinces being given top importance. China is more than willing to shape this
project, addressing China trade and marketable necessities from the Arabian Sea through Pakistan.
The China Pakistan Economic Corridor will be game and fate-changer of Pakistan and the region. It is
a welcome and optimistic project started to bring socio-cultural and economic development in
Pakistan [5].
The purpose of this research study is to review the significance of China Pakistan Economic
Corridor regarding social and cultural point of view. Further, China Pakistan Economic Corridor
(CPEC) is also a renewed and upgraded approach of linking two societies i.e. China and Pakistan.
2. Socio-cultural Cooperation
Socio-cultural cooperation occupies a relatively significance place in regional cooperation. Social is
the outcome of relationships in society while the most common type of relationship is cooperation.
Culture is the way of life in society which includes knowledge, ideas, beliefs, customs, traditions,
languages, buildings, and technology etc. shared by almost everyone in a particular society. Although,
culture and social are interlinked and closely related concepts that can never be wholly separated.
Furthermore, cultural change is very broad term it include all the human phenomena in a society
which leads to social change and brought development. It can be said that for sustained relationship
between China and Pakistan requires a mutual understanding of each other cultures, traditions and
language, which can take place only through socio-cultural ties.
The China-Pakistan Economic Corridor (CPEC), is heralded as a game changer for Pakistans
social and cultural development [6]. A Pak-China Friendship Centre was inaugurated in Islamabad
during former Chinese Premier Wen Jiabaos visit in December 2010. There are four Pakistan Study
Centers and 8,000 Pakistani students studying various disciplines in China [7]. In September 2011,
the provincial government of Sindh overzealously announced starting teaching of Chinese language
as a compulsory subject from 6th grade onward from 2013[8]. Provincial education department of the
Sindh government allocated Rs. 625 million for Chinese language teaching in 2012. Pakistan and
China signed a memorandum of understanding (MOU) for establishing a permanent campus of the
Pakistan-China University of Engineering, Science and Technology in August 2008. Although the
university has not been inaugurated yet, an independent Pakistani think-tank dedicated to research on
China, the Pak-China Institute, was established on 1st October 2009. Pak-China socio-cultural
cooperation has thus been progressing very smoothly over the past few years. It is also being
contemplated celebrating 2015 as the Year of Friendly Exchanges. While a Confucius Institute was
established at the National University of Modern Languages in Islamabad in 2005, during Chinese
Premier Li Keqiangs visit in May 2013, an agreement was signed for opening another one at the
Karachi University [9].
Pakistan and China have a very close strategic and political relationship; China Pakistan Economic
Corridor (CPEC) is one of them, so it is mandatory to make relations better among people to people
via provide some platform to exchange their experiences. This leads to implementation of various
mini projects so economy can improve. As every nations power is their youth, the youngster of both
countries should come and take part and will open ways for their upcoming generation. Pak-China
180
relations as a model of friendly exchanges and cooperation to countries of different civilizations. An
establishment of Chinese Cultural Centre is welcomed by Pakistan as announced by the China in
order to promote friendly Exchanges. The two sides will also actively encourage and support their
publishing organizations to participate in each others book fairs and to translate and circulate
high-quality publications of each other. China and Pakistan should continue to send 100-member
youth groups to visit each other's country and encourage more contacts and exchanges between young
Chinese and Pakistanis. In the next five years, China will provide 2,000 training opportunities for
Pakistan and train 1,000 Chinese language teachers for Pakistan. Research Scholars from both sides
and think tanks can do research on the different topics for the advancement of China Pakistan
Economic Corridor (CPEC) i.e. planning, and management, infrastructure, and transportation
development including roads, railway lines, airports, ports, Information Communications Technology;
social, cultural and political challenges; skills and future jobs creation; agriculture, food security and
climate change; economic stability and prosperity, while growing international investment and trade
through knowledge inputs, water and energy security. Following are some packages announced in
China Pakistan Economic Corridor (CPEC) to launch projects like CCTV English News Channel and
International Documentary Channel, the establishment of the FM98 Pakistan-China Friendship
Radio studio by the China Radio International and the Pakistan-China Small-sized Hydro Power
Technology, National Joint Research Center in Pakistan [10].
3. Impact on Pakistan
In developing economies, road networks improve means of transportation which enhances
socio-cultural and economic status such as community access to basic facilities like education, health,
employment, and economic opportunity [11]. Sothy, and Horn (2007) argue that road improvements
would enhance access to education, health care, markets, and other public service facilities in the
surrounding areas of economic corridors [13]. In this regard with development of China Pakistan
Economic Corridor (CPEC) Pakistani student will have better education opportunities in the
universities of China and this factor is directly associated with improving and enhancing the literacy
rate of the population of Pakistan. Furthermore, the level of poverty will also be decreased
significantly with the new and modern job opportunities [15]. According the available data and
previous studies conducted on the similar projects, it can be said that China Pakistan Economic
Corridor is directly associated with improving the job opportunities for the population. Also, it will
also help in providing the opportunities for better life style and education for the population of
Pakistan [2]. The level of poverty is higher in Pakistan as compared to other countries of the world
and this issue poses a serious threat to the socio-economic development of the country [16]. China
Pakistan Economic Corridor can be regarded as an important and essential step in the development of
the community and population of Pakistan. The route for the export of fruit will also be open with the
development of China Paksitan Economic Corridor and this will help the farmers to improve the
quality of their produce and contribute in the economic welfare. CPEC can also be regarded as a step
toward the modernization of the agriculture system of Pakistan as the technological advancement in
this field will be adopted by the locals [3]. The production and profit of the agricultural produce will
be enhanced significantly by the development, initiation, and completion of this project [15].
Aside from social trade, the general population to individuals contact can be an awesome hotspot
for crossing over any barrier of errors between the general population of Baluchistan and different
parts of Pakistan. Subsequently, the China Pakistan Economic Corridor (CPEC) can be an awesome
project in advancing national trustworthiness. People in Baluchistan who are included in criminal or
aggressor exercises are generally the ones who are jobless, uneducated and scarcely locate their
living[14].
The route of the trade and export will become convenient and cheaper as compared to the current
methods of trade and farmers, traders, exporters, and government will the benefit of this advantage. It
181
can also be said that the local will flourish with the completion of China Pakistan Economic Corridor
(CPEC) and they are happy to have a chance to improve the rate of their profit due to the help of
Chinese government [16]. It can also be said that the population of Pakistan about the chance of
economic and social growth of the country. They are striving for a batter picture of Pakistan and China
Pakistan Economic Corridor (CPEC) provided that opportunity to them. The cooperation, if gets
emerged, can give better opportunities to engagement of these individuals in different projects in
Gwader, subsequently, decreasing the odds of getting required in criminal and additionally aggressor
exercises. There are territories where there is no administration writ, unemployment is at its pinnacle,
and education rate is low; subsequently, without whatever other positive movement, inside clashes
are inescapable to happen [12]. So if the general population are included in this projects, this segment
of society can be developed into careful citizens and the will be left with no purpose behind clashes
and aggressor exercises [17]. The project of China Pakistan Economic Corridor (CPEC) is also linked
with the improvement of the social picture of both nations and it will help in decreasing the poverty
level.
The economy of Pakistan can be easily affected by manufacturing of goods, improving the field of
agriculture, and improving the current situation of communication and information. The landscape of
communication and information will be improved with the completion of China Pakistan Economic
Corridor (CPEC) project. Currently India holds an advantage over Pakistan in term of information and
communication modernization due to its population. With the help of this corridor, Pakistan will able
to correspond with the neighboring countries in an effective manner [2]. This opportunity will
ultimately lead to the development of strong relations with other countries and boost the process of
business and export. The current route of agriculture export is through Dubai which increases the cost
of the trade. The Chinese appetite for fruits and vegetables can be regarded as insatiable and with the
help of CPEC this demand will be fulfilled through local transporters and exporters of Pakistan [17].
The water and irrigation system of Pakistan will be improved with the help of advanced technologies
and machines designed by the Chinese researchers and it can help the local community especially
farmers of Pakistan [16]. The manufacturing of different product will also be improved as the supply
and availability of advanced technology and it can help the Pakistani population to improve and
enhance their economic growth. In short, it can be said that China Pakistan Economic Corridor
(CPEC) is one of the most crucial step for the development and enhancement of the economy of
Pakistan [14]. It is evident from the available data that the economy of Pakistan is the target of
persistent ups and down throughout its history and China Pakistan Economic Corridor (CPEC) is
providing a chance to change the situation in a positive and effective manner. The economy of the
country is directly associated with the growth, welfare, and job opportunities of its population and
these factors will be positively influenced by the completion of this project.
Pakistans Socio-cultural and Economic environment will be positively and constrictively
enhanced by the development of China Pakistan Economic Corridor (CPEC). Populations of both
countries will bond on the trade of the goods and they will promote the culture of each other in their
specific area. It can be regarded as a positive impact of China Pakistan Economic Corridor (CPEC).
4. Summary
It can be state that CPEC is an important development step taken by the Chinese and Pakistani
government. It is directly associated with the progress of the community and will help in stabilizing
the interaction and communication among the population of both countries. It will help in improving
the economy and ultimately affect the overall economy of the region positively. This project will also
help the Pakistani community to understand and appreciate the importance of education and its impact
on the welfare of the community. The cultural aspect of the China Pakistan Economic Corridor
(CPEC) is also associated with improving the culture of the country and helps the population of both
countries to establish secure terms with each other. The Baluchistan province of Pakistan will flourish
182
and the scope of jobs and education will also be enhanced with the development and completion of
China Pakistan Economic Corridor (CPEC). Pakistan and China share an uncommon bond and the
populations of both nations have warm feeling for each other. This project will likewise help in
enhancing the comprehension and communication of the population of both nations. Pakistani
understudy will have better training openings in the colleges of China and this component is
straightforwardly connected with enhancing and improving the literacy rate of the population of
Pakistan. Moreover, the level of neediness will likewise be diminished altogether with the new and
advanced openings for work.
The paper summarized the idea on the basis of facts that the importance of China Pakistan
Economic Corridor (CPEC) project cannot be denied. It can be regarded as an advanced step toward
the path of glory, establishment, and social welfare. The population of Pakistan will be positively
affected by this development and the cultural history of the region will also be improved. This
cooperation will also provide a chance of better education and improve the living standard of the
people of Pakistan. It can also be regarded as one of the most crucial development step as it is directly
associated with improving the economy of the country. The economy of Pakistan can be easily
affected by manufacturing of goods, improving the field of agriculture, and improving the current
situation of communication and information. The landscape of communication and information will
be improved with the completion of this mega project.
5. Acknowledgement
This research was financially supported by the National Natural Science Foundation of China (Grant
NO. 71673068).
References
[1] S. D. Ali, Impact of CPEC on Regional International Relations, Internet: http:www.ia-forum.org/
Content/ViewInternalDocument.cfm?ContentID=8596, Oct. 2016 [Nov. 21, 2016].
[2] M. Aqeel, Impact of China Pakistan Economic Corridor (CPEC), BBA, Dept. Bus. Manage.
Analytics., Arcada Univ. Appl. Sci. Univ. Helsinki, Finland, 2016.
[3] W. Ali, L. Gang, and M. Raza, China-Pakistan Economic Corridor: Current Developments And
Future Prospect for Regional Integration, International Journal of Research (IJR), vol. 3, pp.
210-222, 2016.
[4] G. Ali, China and Pakistan prepare to establish economic corridor, in Central Asia-Caucasus
Analyst vol. 17, pp. 03-05. 2015.
[5] A. R. Malik, A Corridor of success " Internet:
http://www.pakistantoday.com.pk/2015/06/05/comment/a-corridor-of-success/, June. 2015 [Nov.
21, 2016].
[6] M. Ibrar, J. Mi, M. Rafiq, and A. L. Karn, The China-Pakistan Economic Corridor: Security
Challenges, Proc. Asia-Pacific Manage. Eng. Conf., Shanghai, China, 2016.
[7] M. Khalid, Pakistan-China Relations: An exemplary friendship, Daily Times, 2013.
[8] Z. Mustafa, Chinese in Sindh, Internet:
http://www.zubeidamustafa.com/chinese-in-sindh-schools , Sep, 2011 [Nov. 2016].
[9] A. U. Khan, Pak-China Economic Corridor: The Hopes and Reality, Regional Studies, vol. 33, pp.
45-63, 2014.
183
[10] R. Khalid, China-Pakistan Economic Corridor (CPEC) should be supported by people to people
contacts, Institute of strategic studies, 2015.
[11] S. O. Wolf, An unequal equation?: CPEC development and Pakistan's political mindset,
IndraStra Global, vol. 9, 2016.
[12] R. Zhang and G. Shi, Social impacts assessment for China-Pakistan Economic Corridor
investment activities, Annu. Conf. Int. Assoc. Impact Assessment, Nagoya, Japan, 2016,
[13] S. K. Phyrum, V. Sothy, and K. S. Horn, Social and economic impacts of GMS Southern
Economic Corridor on Cambodia, Research and Learning Resource Center of the Mekong
Institute, 2007.
[14] M. S. Irshad, One Belt and One Road: Dose China-Pakistan Economic Corridor Benefit for
Pakistan's Economy?, Journal of Economics and Sustainable Development, vol. 6, pp. 200-207,
2015.
[15] D. Bhattacharjee, China-Pakistan economic corridor (CPEC), Indian council of world affairs,
Issue brief No. 13, India, 2015.
[16] K. Mumtaz, The Middle East in a Flux: How Should Pakistan Respond?," Institute of Strategic
Studies Islamabad, vol. 18, pp. 136-156, 2015.
[17] S. O. Wolf, The China-Pakistan Economic Corridor: An Assessment of its Feasibility and Impact
on Regional Cooperation, Brussels, Belgium, 2016.
184
The Correlation Analysis of Financial Performance and Goodwill of the

Listed Companies
Zehong Lia, Huarui Sunb,*

Huadian Road No.689 Baoding, Hebei Province, China
a
1043204896@qq.com, b1143326192@qq.com
*
Corresponding author
Keywords: Goodwil; Financial Performance; Market Concentration Rate
Abstract. This paper studies the effect of the goodwill on the long-term financial performance of the
listed companies, and further analyzes the influence of the market concentration on the relationship
between the goodwill and corporate financial performance. Based on the data of mergers and
acquisitions financial reporting data of A-share non-financial listed companies from 2007 to 2015, the
study found that: goodwill of listed companies reduces the company's long-term financial
performance; The higher the degree of market concentration in the industry, the better the goodwill of
listed companies to enhance the company's long-term financial performance. The conclusion of this
paper supplements and expands the research on the economic consequences of the implementation of
accounting standards, and also provides the basis and reference for the norm-setting department, the
supervising organization and the enterprises undertaking M & A activities.
1. Introduction
Goodwill were put forward in the first, it refers to can bring excess profits for business during the
period of the future potential economic value, namely that the goodwill and corporate financial
performance has a certain relationship of business[1]. However, the recognition and measurement of
goodwill in the new accounting standards implemented in 2006 are only defined as the difference
between the merger costs paid by the M & A and the fair value of the acquired assets. Whether it is
consistent with the concept of the initial goodwill, can represent the economic value of the future
excess return of the enterprise, and the relevance of the financial performance of the enterprise?
Assuming that the goodwill recognized by the firm has a certain correlation with the financial
performance, what are the factors that affect the performance of goodwill?
Based on the above reasons, this paper will obtain the relevant data from 2007 to 2015 to study the
relationship between the goodwill of listed companies and the overall financial performance
indicators, And then consider the different factors affecting the nature of the industry, and at last, the
financial performance of the evaluation indicators are broken down, respectively, to study the
relationship between mergers and acquisitions goodwill, So we can analyze the specific process of
goodwill's influence on financial performance in a more comprehensive and detailed way to reflect
the connotation of goodwill recognized by listed companies in our country and correctly understand
and utilize the accounting information that it can transmit.
2. Theoretical analysis and research hypothesis

The term "synergy" was first proposed by the German physicist Hermann Haken in 1971, which
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
185
published in the same year on the theory of "synergetic", in this article the relevant synergy theory was
systematically expounded. Simple said that the synergy theory is the effect of"1 + 1 > 2"[2,3]. The
theory of synergies applied to the merger and reorganization, refers to the overall performance or
value of the two companies after M & A activities will be greater than the merger before the merger of
the two companies the performance or performance of the combined effect. With the gradual
improvement of China's securities market, more and more listed companies join in the ranks of M &
A activities. For the purpose of the merger, acquisition and reorganization activities of listed
companies mainly in order to obtain the synergies, to improve the company's financial performance
and market competitiveness[4].
Therefore, this paper puts forward the first Hypothesis : Goodwill is correlated with the current and
future financial performance, but the correlation with the future financial performance has more
significant.
In the capital market which not fully effective, monopolistic enterprises have the ability to use its
advantages in resources, especially after the formation of the market monopoly of the merger to
achieve excess profit. Therefore, some companies are willing to pay the cost of goodwill, improve
company performance[5]. Through mergers and acquisitions, the advantages of the two companies
can be complementary, so as to realize economies of scale or scope economy, and improve the
company's performance. The transaction costs of different industrial chains or enterprises of different
production stages in the same industry chain are eliminated due to the new enterprises after the M & A
activities. At the same time, the reduction of transaction costs has effectively improved the
performance of new enterprises after M & A activities. As an important way of corporate financing,
the cost of goodwill has also become the necessary transaction cost to save the future financing and
investment cost, while the M & A activity can significantly reduce the future transaction cost of the
enterprise.
In view of the above analysis, this paper proposes the second Hypothesis: in the industry with
higher market concentration, the correlation between goodwill and financial performance is more
significant.
3. The design of the empirical research
3.1 Sample selection and source of data

This paper takes the listed non-financial listed companies of Shanghai Stock Exchange and Shenzhen
Stock Exchange from 2007 to 2015 as the case study. In order to ensure the comparability of the
acquired data and the impact of the changes in accounting standards, the data obtained in this paper
are the latest updated company disclosure data under the new accounting standards. In this paper,
2609 empirical samples were selected after eliminating ST and * ST special treatment listed
companies and data missing listed companies.
The data in this paper are from the CSMAR database and the RESSET database, respectively.
Return On Total Asset and other data missing samples, through the manual to find information on the
huge influx of listed companies to provide annual reports to be added. Market concentration of the
data obtained by hand calculation.
3.2 The definition of each variable
186
Tab. 1. Explanations of the various study variables in the model
The type of the
The name of the variable The definition of each variable
variable
Return On Total Assets
Net profit/total assets
ROA
Explained variable Net Profit Margin (ROS) Net profit / prime operating revenue
Total Assets Turnover
prime operating revenue / total assets
RAT
Standardization of
Goodwill increase value / total assets
Goodwill (GWA)
Herfindahl-Hirschman Index
Explanatory
HHI xi / X xi
2
variables Market Concentration , represents the amount of
Rate (HHI) revenue for company i in an industry,XA represents the
sum of the square of the revenue of all firms in the
industry
Market Concentration The added value of operating revenue/Operating income
Rate (SGR) last year
Ownership
The proportion of the shareholders holding the largest
concentration1
proportion
(OwnCon1)
Ownership
The sum of Shareholding percentage of the company to
concentration5
hold the proportion of second to fifth
(OwnCon5)
The size of the company The natural logarithm of the total assets of the company
(CSIZE) at the end of the period
Total liabilities at the end of the period/ Total assets at
Control variables asset-liability ratio (LEV)
the end of the period
The proportion of
Number of independent directors/ The total number of
independent directors
directors
(IndDir)
State-owned
Number of state - owned shares / Total number of shares
shareholdingStateShr
Annual Variables
Annual dummy variable
(YEAR)
In accordance with the industry classification standards
Industry variables
in 2012, the industry is divided into 16 categories ,not
(INDT)
including the financial and insurance industry.
3.3 Model selection

In this paper, we use the multiple linear regression model to conduct an empirical study on the
correlation between the goodwill of listed A-share non-financial insurers and financial
performance[6]. This paper establishes three regression models from three aspects: the relationship
between goodwill and long-term financial performance, the influence of market concentration on the
relationship between goodwill and financial performance, and the influence of goodwill on financial
performance.
The first model: Goodwill and current and future financial results
ROAt i 0 1GWAt 2 SGRt 3OwnCon1t 4 OwnCon5t 5CSIZEt 6 LEVt
7 IndDirt 8 StateShrt YEAR INDT (1)
The second model: The Impact of market concentration on the relationship between goodwill and
financial performance.
187
ROAt i 0 1GWAt 2 HHIt 3GWAt HHIt 4 SGRt 5OwnCon1t 6 LEVt
7 OwnCon5t 8CSIZEt 9 IndDirt 10 StateShrt YEAR (2)
The third model: the impact of goodwill on financial performance.

ROEt i 0 1GWAt 2 SGRt 3OwnCon1t 4 OwnCon5t 5CSIZEt 6 LEVt
7 IndDirt 8 StateShrt YEAR INDT (3)
4. Empirical results
4.1 Descriptive statistics results

In this paper, a sample of non-financial A-share listed companies from 2007 to 2015 was selected as
the sample, and the data were processed to obtain a total of 2609 samples. Descriptive statistics of the
main variables in the regression model are shown in Table 2.
Tab. 2. Descriptive statistics of the main variables
Variables Minimum Maximum Average Standard deviation
GWA 0.00021 0.68850 0.03324 0.04267
ROA -0.39801 0.51720 0.06128 0.05743
HHI 0.00969 0.60274 0.07108 0.13567
CSIZE 18.95000 27.38745 22.06507 1.12828
SGR -0.98434 8.49593 0.24416 0.51149
LEV 0.01780 0.95642 0.46224 0.15885
OwnCon1 0.00207 0.85232 0.18032 0.18659
OwnCon5 0.00280 0.69810 0.09768 0.08756
StateShr 0.00000 0.86276 0.14479 0.19948
IndDir 0.09090 0.83330 0.36146 0.09459
It can be seen from the results that the standard deviation of the total assets return (ROA) of the
explanatory variable is 0.057, indicating a small difference in the total return on assets of the observed
sample. The maximum value of the standardized goodwill (GWA) is 0.6885, the minimum value is
close to 0, the average value is 0.0332, which indicates that there is a big difference between the cost
of goodwill paid by listed companies. The maximum concentration of market concentration (HHI) is
0.6027, the minimum value is 0.0096, and the average value is 0.0710, which indicates that there is a
big difference in the market concentration degree of the observed samples. Ownership of the first
largest shareholder (OwnCon1) is 18.0%, and the average of the second to fifth largest shareholders
(OwnCon5) is 8.8%, which indicates that the ownership concentration of the observed sample is high.
The average debt-to-asset ratio (LEV) is 46.2%, indicating that the average debt level of the sample is
moderate.
4.2 Analysis of regression results
4.2.1 The impact of goodwill on corporate financial performance
Table 3 shows that there is a significant positive correlation between the goodwill of the listed
company and the current financial performance, which means that the goodwill recognized in the
current period can enhance the current financial performance of the listed company; Goodwill of
listed companies and the first year of future financial performance has a significant negative
correlation, which means that the cost of goodwill to pay a certain amount of listed companies will
reduce the lag of a financial performance; The goodwill of the listed company has a significant
negative correlation with the financial performance in the second year, and there is no correlation with
the financial performance in the third year.
188
Tab. 3. The Regression results of Goodwill and Financial Performance
ROAt ROAt+1 ROAt+2 ROAt+3
Variable
B T B T B T B T
Constant 0.058** 2.372 0.079** 2.781 0.1** 3.151 0.094** 2.809
GWA 0.07** 1.208 -0.062** -1.259 -0.01* -0.23 0.075 2.507
** **
CSIZE 0.006 1.168 0.011 0.767 0.012** 1.61 0.012** 1.542
SGR 0.09** 4.365 0.017* 2.569 0.004* 1.392 0.011 0.403
LEV -0.175** -15.588 -0.081** -5.765 -0.029** -5.086 -0.012** -2.206
OwnCon1 0.051** 3.578 0.059** 3.53 0.054** 2.81 0.089** 3.239
** * *
OwnCon5 0.025 0.672 0.014 0.507 0.01 0.025 0.016* 1.295
StateShr -0.027** -1.14 0.01** 1.298 0.014* 1.598 0.019* 2.098
IndDir 0.001 0.087 -0.001* -0.079 0.01 0.602 0.003 0.169
Notes*** respectively in 5% and 10% level has significant correlation.
The reason may be that: after the merger and reorganization of listed companies, the merged
enterprise's net profit share will be included in the financial statements, the net profit after the merger
value of the blind increase, on the surface, the financial performance of listed companies has
improved; However, with the actual operation of the enterprise after the merger difficult to meet the
actual needs of the company, goodwill on the company's financial performance due to short-term
effects, In addition, it is possible that the high cost of goodwill in the M & A activity may have the
motivation to enhance the financial performance of the current company. It has certain blindness. It
can not evaluate the long-term financial performance of the company.
4.2.2 How goodwill affects the financial performance of the listed companies
Tab. 4. The regression results of Goodwill and sales net profit margin, total asset turnover ratio
Non - normalized coefficient
Variable
ROSt RATt ROSt+1 RATt+1 ROSt+2 RATt+2 ROSt+3 RATt+3
Constant -0.069 0.68** -0.429** 0.377 -0.135* 0.326** 0.006* 0.131
GWA 0.12** -0.064** 0.246* -0.645** 0.107 -0.657* 0.267 0.719
** ** ** *
CSIZE 0.01 -0.003 0.024 -0.013 0.011 -0.018 0.004* 0.027*
SGR 0.022** 0.048** -0.006* 0.013** 0.008 -0.023 0.032 -0.028
LEV -0.127** 0.355** -0.072** 0.269** -0.071** 0.212** -0.051** 0.211**
OwnCon1 0.108** 0.015** 0.091** 0.06 0.076** 0.039 -0.077* 0.058
OwnCon5 0.042** 0.135* 0.311** 0.062 0.22* -0.088 0.123 0.154
StateShr 0.022** 0.084** 0.021** 0.042* 0.025** -0.003* 0.038* 0.095
IndDir -0.032 -0.047 -0.018 -0.09 -0.061 -0.116 0.02 -0.202
Table 4 shows that there is a significant positive correlation between the goodwill of the listed
company and the current sales net profit rate, and there is no significant negative correlation with the
current total assets turnover rate. Therefore, it can be seen that the financial performance of the listed
company is improved by increasing the current sales net Interest rates to achieve. Goodwill and the
next year's sales of the net profit margin has no significant positive correlation, and has significantly
negative correlation with the next year's total asset turnover, it can be seen goodwill to reduce the
financial performance of the next year is mainly by reducing the Total asset turnover of the next year
Goodwill has significantly correlated with the sales net profit rate of the second year,has no
significant negative correlation with the total asset turnover rate of the second year, which means
goodwill reduced the second-year financial performance mainly by reducing the total assets Turnover.
There is no correlation between the goodwill and the third-year sales net profit rate and the total asset
turnover rate. There is no correlation between the goodwill and the lagged financial performance.
189
The reasons for this may be: 1) the increase in the net profit margin of the current period due to the
excess returns from the goodwill of the continued operation of the acquired enterprise, but this effect
is transient; 2) Synergy effect, which takes up most of the assets and reduces the efficiency of asset
operations in the future, thereby reducing the total asset turnover.
4.2.3 The influence of market concentration on the relationship between goodwill and corporate
financial performance
Table 5 shows that there is a significant positive correlation between the market concentration and the
cross-term of goodwill and the financial performance of the current, first and second years. It can be
seen that in the industries with low market concentration, especially the perfectly competitive market,
the goodwill formed by the excessively high merger cost of listed companies has very limited impact
on the long-term financial performance of listed companies. In the market with high market
concentration, especially in the oligopoly market or the monopoly industry market, the goodwill
formed by the listed company's overpaying merger cost will help to improve the long-term financial
performance of the listed company.
Tab. 5. The regression results of market concentration, goodwill and financial performance
ROAt ROAt+1 ROAt+2 ROAt+3

Variable
B T B T B T B T
Constant 0.057** 2.366 0.078** 2.76 0.049** 6.565 0.043** 5.445
GWA 0.035* 1.876 -0.015** -0.158 -0.036* -0.723 0.155 2.391
** ** ** *
GdandHHI 0.008 0.784 0.216 1.71 0.106 0.587 0.149 0.658
HHI 0.12 1.411 0.011 0.941 0.028* 2.103 0.012 0.836
SGR 0.01** 4.322 0.007** 2.596 0.004** 1.423 0.001 0.381
LEV -0.074** -15.556 -0.031** -5.772 -0.032** -5.878 -0.014** -2.685
OwnCon1 0.05** 3.509 0.058** 3.467 0.051** 2.676 0.089** 3.24
** ** *
OwnCon5 0.006 0.776 0.003 0.364 0.013 0.312 0.021* 1.722
StateShr 0.017** 1.132 0.009** 1.235 0.013 1.492 0.018 2.009
IndDir 0.001 0.076 -0.001 -0.087 0.009 0.541 0.002 0.109
5. Summary
In this paper, from 2007 to 2015, China's A-share non-financial listed companies as a sample, studied
the relationship between goodwill according with China's accounting standards recognized
measurement with long-term financial performance of, and further analysis the market concentration
of listed companies in the industry on the relationship between goodwill and financial performance. It
is found that the goodwill of the listed company improves the current financial performance mainly by
increasing the sales net profit rate, reducing the financial performance of the first and the second year
mainly by reducing the total asset turnover rate, Performance is not relevant. In the industry with
higher market concentration, the goodwill of the listed companies will improve the financial
performance of the current and the first and the second year, and there is no significant positive
correlation with the financial performance of the third year.
References
[1] Jiashu Ge, Several Issues in Current Financial Accounting - Derivative Financial Instruments,
Creating Goodwill and Uncertainty[J]. Accounting Research1996 (1):3-8.
[2] Zining Li,Pervin K.Shroff,Ramgopal Venkataraman,Ivy Xiying Zhang.Causes and consequences
of goodwill impairment losses[J].Published online Springer Science+Business Media, 2011,6.
190
[3] Comiskey E E, J E Clarke, C W Mulford. Is negative goodwill valued by investors? [J].
Accounting Horizons, 2010.9:333-353.
[4] He Wen, Stephen R.Moehrle. Accounting for goodwill: An academic literature review and
analysis to inform the debate[J].ResearchinAccountingRegulation,2016,281:.
[5] Xiaojing Huang. Empirical Study on Performance of American Bank Industry
Mergers&Acquisitions[D]. Xiamen University, 2 014.
[6] Fukai Luo. The Capital Synergy Effect Research on M&As of Enterprises[D]. Ocean University
of China, 2014.
191
An Empirical Study on the Factors Influencing the Cash Dividend Payout

of Electric Power Listed Companies after the Reform of Non - tradable
Shares
Shuliang Liu a, Ang Lib,*
Department of Economics and Management, North China Electric Power University, Baoding City,
China
a
123lsl@163.com, b1074528904@qq.com
Keywords: Reform of non-tradable shares; Electric Power Listed Companies; Cash Dividend
Payment; Influence factors; Empirical research
Abstract. The dividend policy of power listed companies present new characteristics after the
reform of the shareholder structure. Although foreign scholars have done some research for the
company's dividend policy, the results are not completely applicable to the actual situation of the
electric power industry in our country. To study on the influence factors of cash dividend payment
of power listed companies in our country in the new period, this paper makes assumptions from five
aspects of the equity structure, profit ability, growth ability, asset size and debt paying ability, and
then selects Chinese electric power listed companies as samples to make multiple linear regression
analysis. It obtains main factors on the cash dividend distribution of power listed companies and
related relations between them, which has a realistic significance for electric power listed
company's dividend distribution policy.
1. Introduction
As one of the three core contents of financial management of listed companies, dividend policy has
always been the hot research issue of experts and scholars. What kind of dividend policy is the best
dividend policy has not yet come to an agreement.. Due to its industry particularity, the power
industry has the important status in the national economy, and the dividend distribution of electric
power listed companies naturally receives widely concern and attention.
According to the survey of the previous scholars research, some characteristics of power
distribution policy of listed companies in China. Before the reform of non-tradable shares, it is
a common phenomenon that listed companies do not allocate dividend incomes and dividend
distribution has the volatility. Dividend policy lacks continuity and stability, and there is a serious
problem of abnormal cash dividend. After the reform of non-tradable shares, some changes appear
in the power listed company dividend policy, such as the common dividends distribution, high
dividends of new listed companies after the share reform, the decrease of abnormally high
distribution, etc. It is noteworthy that power listed companies have been more inclined to the cash
dividend policy. Why are electric listed companies tend to distribute cash dividends? After the
reform of non-tradable shares, what factors influence the level of electric power listed company
cash dividend payment? What effect it makes? Western scholars had do a lot of research on the
effect factors of the allocation policy of the company, and formed a certain influential theory,
however, because of the Chinese particularity of the transforming process into the market economy,
and the particularity of electric power industry, when the theory applied to the practice in our
country, its assumptions may not able to meet. The application of the theory is restrictive. Therefore,
this paper selects Chinese electric power listed companies as samples, and conducts an empirical
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
192
study on influence factors of the cash dividends of power listed companies after equity division
reform, objectively revealing the existing problems.
2. Hypothesis
Hypothesis 1: The proportion of the largest shareholder is positively related to the cash dividend
payout.
Hypothesis 2: The proportion of outstanding shares is positively related to cash dividend payout.
Hypothesis 3: Profitability is positively related to dividend payout
Hypothesis 4: Growth capacity is negatively correlated with dividend payout
Hypothesis 5: asset size and payment levels are positively correlated
Hypothesis 6: The debt risk level is negatively correlated with the cash dividend payout level
3. Model design
DPS=+1CR1+2LTG+3EPS+4ROE+5RGR+6NPGR+7SIZE+8FLV+9DA+ (1)
Among them, DPS is the explanatory variable, representing the cash dividend per share, is a
constant, 1 ..., 9 is the coefficient of each explanatory variable, is a random variable.
3.1 Variable definition
3.2 Dependent variable
In this paper, the cash dividend per share (DPS) is on behalf of the level of dividend payments as
an explanatory variable to reflect the company's current cash dividend payments.
3.3 Independent variable
A. Ownership structure attributes: respectively, with the concentration of ownership and equity
attributes to that, of which equity concentration index is the largest shareholder of the proportion
(CR1), the formula is:
CR1 = number of shares held by the largest shareholder / total number of share capital (2)
Equity attributable is the proportion of outstanding shares (LTG), the formula is:
LTG = unrestricted tradable shares / total share capital of the company (3)
B. Profitability indicators: Earnings per share (EPS) and return on equity (ROE) are used to
reflect the profitability of listed companies. The formula is:
EPS = net profit / total number of shares (4)
ROE = net profit / owner's equity (5)
C. Growth Capability Indicators: The growth ability of listed companies is measured by the
growth rate of business income (RGR) and net profit growth rate (NPGR), which reflects the
development potential and development prospect of the company. The formula is:
RGR = (This year operating income - last year operating income) / this year operating income (6)
NPGR = (net profit this year - net profit the previous year) / profit this year (7)
D. Asset size index: As the scale of assets of listed companies varies widely, this paper uses the
natural logarithm of the total assets of listed companies to measure (SIZE), the formula is:
SIZE = ln (total assets) (8)
E. Debt Level Indicators: The short-term and long-term debt pressures of listed companies are
measured by the ratio of current assets (FLV) and asset-liability ratio (DA), the formula is:
193
FLV = current assets / current liabilities (9)
DA = Total Liabilities / Total Assets (10)
4. Sample selection
The sample data of this paper comes from wind database, and the data collation, analysis, test and
model building are done by Excel and SPSS19.
A. This paper selects 51 electric power listed companies on the Shanghai and Shenzhen markets
from 2013 to 2015 as samples.
B. The samples are excluded ST and PT listed companies, because such companies do not
normally distribute dividends. Even if the distribution of dividends is not normal, they are not
suitable for the study. At the same time, According to the Company Law of China, the companies
with negative net profit and negative return on net assets are excluded.
C. The sample of this paper only includes A-share listed companies.
D. This paper excludes sample companies that do not distribute cash dividends.
Eventually, there are 99 sample data, including 30 in 2013, 34 in 2014 and 35 in 2015.
5. Regression analysis
5.1 Regression analysis of samples
Using SPSS19 to carry on the regression analysis to the sample data, it obtains the result as follows.
Tab.1 Move in / out variables b
Model Move in variables Move out variables Method
1 DPS, CR1, EPS, RGR, NPGR, FLV, . Move in
LTG, SIZE, ROE
a. All requested variables have been entered.
b. Dependent variable: DPS
Table 1 gives information on the entry model and the eliminated variables. From the table, we
can see that all four variables go into the model, indicating that our explanatory variables are
significant and explanatory.
Tab. 2 Model Summary
Standard Changed statistics

error Changed
Model R R2 Ra 2 estimate Changed R 2 F df1 df2 Changed Sig. F DW
1 .716a .513 .463 .06878 .513 10.197 9 87 .000 2.030
a. Predictors: (constants), DA,CR1,EPS, RGR,NPGR,FLV,LTG,SIZE,ROE.
Table 2 gives an overview of the overall fitness of the model, with R being 0.716 and R being
0.513. The model's goodness of fit is not particularly high, but reflects a significant linearity
between the dependent and independent variables relationship. DW value is 2.030, between 2 and 4,
indicating that the model variables without sequence correlation.
Tab. 3 Anovab
Model sum of square df Mean variance F Sig.
1 Regression .434 9 .048 10.197 .000a
Residual .412 87 .005
Total .846 96
a. Predictors: (constants), DA,CR1,EPS, RGR,NPGR,FLV,LTG,SIZE,ROE.
194
Table 3 shows the variance analysis. It can be seen that the value of the F statistic is 10.197 and
the P level of the significant level is almost zero, so the model passes the set test, that is, the linear
relationship between the dependent variable and the dependent variable was significant.
Tab. 4 coefficient a
Normalized
Non - normalized coefficient coefficient Collinearity statistics
Standard
Model B deviation trial version t Sig. Tolerance VIF
1 (constant) -.327 .090 -3.630 .000
CR1 3.957E-7 .000 .000 .001 .999 .572 1.750
LTG 4.919E-5 .000 .014 .165 .870 .750 1.333
EPS .126 .040 .364 3.158 .002 .420 2.379
ROE .002 .002 .160 1.385 .170 .421 2.377
RGR .001 .000 .207 2.500 .014 .819 1.221
PNGR -8.901E-5 .000 -.174 -2.074 .041 .791 1.265
SIZE .027 .007 .439 4.095 .000 .487 2.052
FLV .027 .018 .129 1.513 .134 .769 1.300
DA .000 .001 -.055 -.528 .599 .518 1.931
Table 4 shows the T-values of the regression coefficient table and the significance test of the
variables. It can be found that the T-value of the CR1, LTG and DA is too small to be significant, so
these three variables should be removed. From the VIF value, it can be seen that the model of
multiple collinearity is not serious.
5.2 Regression analysis after elimination of variables
After removing CR1, LTG and DA, the multiple regression analysis was conducted again and the results are as
follows.
Tab.5 Model Summary b
Standard Changed statistics

Adjusted estimation Changed Changed Changed
Model R R2 R2 error R2 F df1 df2 Sig. F DW
1 .715a .512 .479 .06775 .512 15.711 6 90 .000 2.066
a. Predictors: (constants),FLV, RGR, , ROE NPGR , LTG,SIZE,. ,EPS
Tab. 6 Anovab
Model sum of square df Mean variance F Sig.

1 Regression .433 6 .072 15.711 .000a
Residual .413 90 .005
Total .846 96
a. Predictors: (constants),FLV, RGR, , ROE NPGR , LTG,SIZE,. ,EPS
195
Tab.7 coefficienta
Non - normalized Standard
coefficient coefficient Collinearity statistics
Standard
Model B deviation trial version t Sig. Tolerance VIF
1 (constant) -.323 .080 -4.054 .000
EPS .134 .037 .385 3.578 .001 .469 2.132
ROE .002 .002 .141 1.309 .194 .466 2.146
RGR .001 .000 .195 2.485 .015 .880 1.136
NPGR -9.314E-5 .000 -.183 -2.310 .023 .869 1.151
SIZE .026 .005 .415 4.835 .000 .738 1.355
FLV .029 .018 .136 1.651 .102 .797 1.255
After eliminating the three variables, it passed the goodness of fit test and equation significance
test, and the remaining variables have passed the T test. The resulting economic model is as
follows:
DPS=-0.323+0.134EPS+0.002ROE+0.001RGR- (9.314E-5) NPGR+0.026SIZE+0.029FLV (11)
6. Results
Firstly, CR1 and LTG did not pass the significant test, indicating that the ownership structure has
little effect on the cash dividend distribution, probably because, after the reform of split share
structure, the largest shareholder of the proportion declines and its influence on dividend policy is
weakened.
Secondly, DA has not passed the significance test, according to the descriptive analysis results:
from2013 to2015, average asset-liability ratio of the power listed companies is 59.6595%, close to
60%, while long-term debt constraints has mot be considered as the main factor for distribution of
cash dividends, probably due to the stable capital sources and the low risk of long-term debt of the
power industry.
Thirdly, EPS, ROE, RGR, SIZE and FLV are proportional to DPS. The positive correlation of
EPS is 13.4%, which shows that profitability is an important factor to influence cash dividend
distribution.
Then, NPGR is negatively correlated with DPS. The effect of RGR on DPS is only 0.1%,
probably because the companies with strong growth ability keep more funds for their own
development, unwilling to pay too much cash dividends.
Lastly, SIZE is proportional to DPS, and the relevant degree is 2.6%, indicating the size of the
company is the factors influencing cash dividend distribution level of power listed companies.
7. Summary
In this paper, the data of power listed companies from 2013 to 2015 are selected as samples, and the
multiple regression analysis is made by SPSS. The main factors affecting the cash dividend
distribution of electric power listed companies are profitability, liquidity ratio and asset size.
However, the reform of the non-tradable share reform began in 2005, and the sample selected in this
paper is only from 2013 to 2015. Insufficient quantity may make the analysis result have some
limitations and can not represent the overall stage characteristics after the reform of non-tradable
shares.
References
[1]Yubi Tu, Research on the Relationship between Ownership Structure and Cash Dividend
Distribution Policy of Listed Companies, Economic Review, 2011(02).
196
[2]Guoliu Hu, Jinggui Huang, Shuncai Jiang, Weiming Li, Split Share Structure, Corporate
Governance Structure and Cash Dividend Distribution, Journal of Business Economics,
2010(06).
[3]Zheng Wang,An Empirical Study on Cash Dividend Distribution and Influencing Factors of
China 's Listed Companies, China Journal of Commerce, 2015(13).
[4]Litai Chen, Xinfeng Yang, Chuan Lin. A Study on the Characteristics and Influence Factors of
Cash Dividend Distribution of Listed Companies in China, Technology Economics, 2011(01).
[5]Lei Gao, A Study on the Influencing Factors of Cash Dividend Policy - Based on the Empirical
Analysis of Listed Company Data, Shanxi University of Finance and Economics ,2008.
[6]Kaifang Zheng, Qian Bi, An Empirical Study on the Determinants of Dividend Distribution
Policy in Listed Companies, Communication of Finance and Accounting, 2012(24).
[7]Gang Hou. An Analysis of the Influential Factors of Dividend Policy in China - An Empirical
Analysis Based on the Impact of Equity Structure on Cash Dividend, Southwest University of
Finance and Economics, 2012.
[8]Ling Li, An Empirical Study on Cash Dividend Policy of Electric Power Listed Companies,
North China Electric Power University (Beijing), 2008.
197
Study on the Mode of Logistics Collaboration between Xian Land Port

and Air Port 1
Weixia Yang
School of business, Xian International University, Xian, China
wxyang741117@163.com
Keywords: Xian Land Port; Air Port; Logistics collaboration
Abstract. In spite of vastness in territory, China has long suffered from the imbalanced development
of economy, with the Midwest lagging behind the East. That problem can be mainly attributed to the
underdevelopment of the hub function of Xi an. As the biggest land port of China, Xi an is supposed
to play a significant modeling role for the booming of the Midwest. Based on the function orientation
of Xian land port,in this paper we present an analysis of the necessity and feasibility of Logistics
Collaboration between Xian Land Port and Air Port. Strategies for development and suggestions for
Logistics Collaboration between Xian Land Port and Air Port are given.
1. Introduction
Xi 'an land port is newly built the interchange of railway and highway in xi 'an based on the xi 'an
railway container terminal, and it is the treaty port opening to the outside world in accordance with the
relevant laws and regulations, treaties of international transport and conventions, and it is regional
ports and modern logistics operation platform of the coastal ports in xi 'an, it is the core project of xi
'an international port area. So it has been provided convenient and quick international port services for
Xi'an and Guanzhong - Tianshui economic zone to develop international and domestic trade.
With the strategic of "Silk Road Economic belt " concepting, The work report of the government of
Shaanxi province in 2014 points out that "xi 'an international port district should do co-construction
and sharing and the air-ground linkage mechanism with airport new town". The work report of Xi 'an
government also explicitly proposed that "we should actively build comprehensive transportation
system and international transshipment hub port as the center of Xi'an". The linkage of the xi 'an land
port and airport new town is very significant and irreplaceable to build a new starting point of the silk
road economic belt in Shaanxi province, and it marks Xi 'an to build a hub of the silk road economic
belt further speed up the pace.
2. The current situation of the development of Xi 'an land port
2.1 Development model of Xi 'an land port

We may carry on the thorough analysis the development model of Xi 'an international land port from
the core carrier, main functions and core competence, the path of development.
2.1.1 Core carrier
In the process of construction, Xi 'an international port district formed a innovative platform in the
inland with the service function of the international land port and become the core carrier of the park
1
The Scientific Research Project of Education Department In Shaanxi Province of China (Grant NO. 16JK2167)
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
198
comprehensive service functions relying on the three support project include of the xi 'an railway
container terminal.
It becomes the core of the pattern of Xi 'an international land port that Xi 'an railway container
terminal, xi 'an comprehensive free trade zone and port of xi 'an road superpose their function through
modern information technology means. It relies on the port functions and comprehensive service
ability of Xi 'an land port international, forms the overall efficient service function, improves the
regional industry supporting function, reduces the logistics cost, build enterprise direct docking
channels with the international market, and builds environment of the region undertaking industry
shifting. It undertakes a significant role in promoting the international competitiveness of regional
industries.
2.1.2 Main function
(1)The multiplier of industry shift in area
Industry transfer is the irreversible development trend with the world economic integration, beause
the comparative advantage in the western region to undertake industry shift will gradually appear with
the labor costs, land costs of eastern region rising and industry accomodation having been saturated.
So undertaking industrial transfer is one of the major task of further implementing the western
development. Xian international land port make the western region to undertake industrial transfer
ability to a higher level relying on the port of complete function, convenient logistics capability of
multimodal transport and more comprehensive industry service level. It is advantageous to the
western region to introduce, to undertake a high starting point, high level of export processing,
equipment manufacturing, spin industry chain, and it is effective to promote the openness of the
western region at home and abroad.
(2) The multiplier of regional industry structure adjustment and upgrade
There is necessities capital, abundant natural resources and labor in the western region, so it is still in
the early stage of industrial, and is on the development path of predominantly resource development
and labour intensive processing industry. At present, because of the volatility international financial
market and the rising of labor price which can lead to the development of western resources
endowment as the advantages of traditional path be challenged. In this case, the construction of xi 'an
international port district becomes the key to promote the adjustment of regional structure. Xi 'an
international port district not only make up for the short plate of modern areas logistics and
international business, improve the system of regional industry, but also creat the aggregation and
growth environment for the development of the regional producer services.
2.1.3 The core competitiveness
Xi 'an international port district core competitiveness lies in its distinctive industrial system, it
implement "1234 project" and build the mode of industry of "a nuclear" (production service industry)
" two characteristic" (modern logistics, international trade), "three expand" (bonded processing,
service outsourcing and strategic emerging industries), "four gather" (modern logistics industry,
international trade, modern service industry gathered, strategic emerging industries gathered), in
accordance with the ideas of "industrial chain building, clustering development". So it can extent
leading industry chains, expand the supporting industrial chain, strengthen the comprehensive
function, strengthen the industry cluster level, improving the professionalism of the service, variety
and convenience.
2.1.4 Path selection
Xi 'an international port will build China's largest land port international relying its advantage of
district location, transportation, industry, policy, will together "four flows" such as people flow,
logistics, cash flow, and information flow to build an innovative development zone through the
extension of industry chain and the improvement of the service function. The "port - area - city" is the
innovation and development path of Xi 'an international land port, it is have the model function of the
first try to inland development.
199
2.2 Problems existing in the development process of Xi 'an land port
The construction of Xi 'an international land port is still in its infancy, Its investment was more,
regional restrictions is obvious, the following main problems still exist in the process of development:
2.2.1 Hardware conditions is absent
Facilities construction of Xi 'an land port has developed rapidly, but the yard failed to give full play to
its nature of the hub because of its smaller scale and single function.
2.2.2 Regional logistics level was low
Xi 'an land port have no logistics connection with various county, and inter-city logistics distribution
is not related. And baoji, inter-city logistics distribution is not perfect to Weinan and Tianshui area. If
the enterprise want to carry out customs clearance in Xi 'an land port, it must transport goods to Xi 'an
by oneself. It illustates that Xi 'an international port district failed to exert forming inland
transshipment port and drive the radiation regional economy.
2.2.3 Informatization level is not high
Xi 'an land port is an important link of the chain of international trade and business activities in the
northwest and the foundation platform of modern logistics. The integration of logistics enterprises
and land port through electronic business platform is slowly, such as port, road transport, financial
insurance, logistics enterprises. The function of inland port is not complete, the cooperation between
the customs and land port still need to be strengthened.
2.2.4 Management mechanism is not perfect
The construction and operation of land port need coordinate customs, port authorities, and shipping
companies with the owner of the goods. But due to the intense competition between ports, as well as
local enterprise pursuit short-term interests, These factors limite the cooperation of land port.
3. The significance of linkage land port and air port

Port linkage development refers that within the scope of the certain region the ports build a
relationship of competition and cooperation breaking the divisions of administrative, according to the
internal relation and geographic proximity. The purpose is to form integration advantages and jointly
participate in the competition through the market and resources sharing, port service differentiation.
So it may form overall attractiveness and competitiveness of regional port to realize the coordinated
development and continued to win more.
3.1 To improve competitiveness of land port
Cooperation between the ports is good for all parties cooperating in the participation. The linkage land
port and air port is advantageous to expand economic hinterland, improve investment yield of port,
and realize economies of scale. The port cooperation can also promote the joint development of new
technology, to speed up the popularization and application, to improve production efficiency of each
port and the whole competitiveness. In addition, the system design and implementation, the energy
conservation and emissions reduction and personnel training, and so on which is benefit to the port in
the same group.
3.2 Promote the development of regional export-oriented economy
Linkage land port and air port in xian, can give full play the operation mechanism of the international
port and convenient operation system, reduce the transit link of import and export goods in radiative
zone, to speed up customs clearance and improve the efficiency of logistics, reduce logistics cost,
increase radiative zone, especially the Guanzhong--Tianshui economic zone to undertake
international and eastern coastal industrial transfer capability. It is help radiate area to participate in a
broader and more wide field and higher level of international division of labor and cooperation.
Airport with the aid of international land port, overcome the logistics bottleneck restriction, through
international trade channel, introduce large-scale foreign capital, undertake the global industrial
200
relocation, convertthe regional resources superiority, the scientific research and talent advantages of
ed to competitive advantage of participating in global economic cooperation, promote the Guanzhong
-Tianshui economic zone and radiative inland to formate export-oriented economic zone.
3.3 Give full play to their role as the support platform of new asia-europe continental bridge
With the continuous improvement of China's trade openness and transparency of policy, and growing
cancel China's non-tariff barriers and other trade protection measures, China's economic and trade
cooperation with all countries in the world is in the deepening, import and export trade will be rapid
development. The linkage Xi 'an land port and air port has important strategic significance to promote
international trade between China and central Asia, Russia, the European countries, expand the space
of foreign trade in our country at the same time, expand the market of energy and raw materials supply
for China's economic and the sales market of competitive products, and establish a stable and
harmonious international environment around.
4. Linkage development mode of land port and airport
4.1 Linkage of function

The main function of land port in the logistics system is to focus on the goods in advance, construct
positively the regional logistics network so as to develop into a regional logistics center, to form the
safe and fast transportation system. It can create favorable conditions for joining transportation and
shortening the distance of the inland city and the international market, so it can attract the perimeter of
the import and export goods in land port.
For the owner, if regarding "Land port" as neighbors, they not only can enjoy closer service, but
also save a lot of time, energy, and the logistics cost, and can focus on their own core competitiveness.
Logistics enterprise can optimize their logistics chain, provide cross-regional, cross-border services,
to clients worldwide with high efficiency, low cost services by land port. At the same time, the
function of linkage can promote the improvement of the land port operation and management system.
4.2 Planning linkage
The construction of land port is a system engineering, It need government and port authorities, railway
departments and other departments work together. Government departments coordinate construction
strategic layout of airport and land port, carefully plan linkage operation process, the standard system
and support system around the national economic structure adjustment policy and economic
development strategy, in order to realize the benign interaction and collaborative development
between the logistics chain each link, to avoid the problem of insufficient development of air port.
In the process of freight yard planning, port authorities, establish efficient logistics channels with
airport as far as possible to improve customs clearance speed of land port cargo. They will construct
"door to door" supporting facilities between the railway station and air port, form fast and reliable air
transport channels, to quickly get the bill of lading, higher conversion rate, and improve trade
turnover of funds.
4.3 Information linkage
If the land port want to realize its rapid development, it must interface the business with the airport.
The linkage of the information can provide information support for l customs clearance of land port
and regional. We may built public data center and exchange of information system of cross-sectoral,
cross-regional, cross-industry based on a national public telecommunications, and realize the
integration of the international trade and logistics through the logistics information platform.
We can centralize store electronic data such as information flow ,goods flow and cash flow of
import and export enterprise. So that may provide electronic data interchange and verification
services to the customs, outer tube, commerce, industry and commerce, taxation, but also provide
201
real-time online services such as online declaration, inspection declaration, foreign exchange, tax
rebates to the enterprise.
So we can set up the modern comprehensive logistics system by regarding port as the center,
improve the inland economy development, promote the development of land port, and build
technology intensive "smart".
4.4 Operating linkage
In order to achieve carrying out import and export business convenient, efficient, economy, we
should strengthen cooperation about custom between land port and airport. So inland cargo may
realize deal with the formalities of customs declaration, tax for all on the enterprise belongs, realize
transportation mode of the import and export cargo, that is high effect, and can shorten the
development period of freight, reduce logistics costs. Government decision-making body can use
comprehensive logistics information system to achieve the scientific allocation of transport resources,
to make decisions and to master large amounts of data information as its scientific development plan
for reference, to enhance the foresight, realize the harmonious development.
Transport enterprises may realize the scientific allocation of implementation capacity and expand
service network by sharing information with the help of mastering source distribution. We make
Goods be shipped to the port of shipment in the completion of quarantine inspection, no restricted by
minimum tonnage of shipment.
5. Summary
Modern port is developing towards a link of the supply chain, the competition between ports is
turning into the competition between supply chains participated by port. Linkage between land port
and airport is directly related to the circulation of the entire supply chain smoothly. As a component
part of supply chain the port is expanded, the supply of goods is increased, which affects the function
of coastal ports and competition ability. The construction of Xi 'an land port is still in its infancy, and
its function remains to be further improved. It not only needs to have a lot of investment in the
hardware facilities, the perfection of the management system and operation mode is also very
important, especially the design of the airport linkage model is the key to the development of land
port.
6. Acknowledgement
This research was financially supported by the Scientific Research Project of Education Department
In Shaanxi Province of China (Grant NO. 16JK2167).
References
[1] Stephen Hoadle, Yangjian. ChinaS Cross-Regional FTA Initiatives: Towards omprehensive
National Power[J]. Pacific Affairs, 2007, 80(2): 327-348.
[2] Peter L. Watson. Export Processing Zones: Has Africa Missed the Boat. Africa Region Working
Paperseries No.17, Africa Region, the World Bank, 2001.
[3] Hiroshi Oikawa. TNCs in Perplexity over How to Meet Local SuppliersThe Case of Philippine
Export Processing Zone. IDE Discussion Papers of Institute of Developing Economics NO.167.
2006.
[4] Lueas.R.: On the mechanics of economic development[J].Journal of Monetary Economics .
2016, 22:3-42.
202
[5] Barro.R.J.:Governments spending in a simple model of endogenous growth [J]. Journal of
Political Economy.1990,98(5),407-443.
[6] Barro.R.J.,Sala-i-Martin.X.: Technological diffusion, convergence and growth [J]. Journal of
Economy Growth.1997,2:l-26.
203
Research on the Practice and Innovation Development of E-Commerce

Platform in the Era of Big Data
Yao Liu, Junqiang Liu
The Engineering Technical College of Chengdu University of Technology, Leshan, Sichuan, China,
614007
Abstract. Under the influence of the era of big data, people's sensitivity to data and processing
ability, accurate data information services for people to bring a convenient way of life. The
combination of data information and smart phone, so that people no matter when and where they
can go online shopping, but also to promote the establishment and development of e-commerce
platform. E-commerce platform under the era of big data has the characteristics of independent
commodity purchase consumer interface, selected commodities, goods through the network fast
payment settlement, but the electronic commerce platform of its own logistics and distribution
system in a short period of time for consumers door-to-door. One-stop shopping process, simple and
efficient, it can be said that the stable and healthy development of the television business platform
for human life has a vital impact. The development of things is tortuous, e-commerce platform in
the process of its development is also facing many problems, because e-commerce platform
business scale is less, and the average survival period is not high phenomenon; in the consumer
process, the existence of consumer privacy abuses, will seriously hinder the development of
e-commerce platform and how to effectively carry out the practice and innovation of e-commerce
platform, quickly solve related problems, provide a reliable environment for the development of
e-commerce platform is the key content of this paper.
1. Concept and characteristics of the age of big data

1.1 Concept
At this stage, the core of social development is to receive and process information, and to transform
it into a tool to promote economic development, to provide the necessary information for enterprise
development. Big data plays an important role in human life and work, which is not meekly
reflected in the economic aspect. In the social development, the effective use of big data can push
the development trend of events, to achieve a certain constructive marketing effect. Overall, the
fundamental significance of the existence of large data is to build a new service model for human
beings, to promote the development of human society intelligently. At present, the development
trend of big data is still accelerating, more companies will be involved into the economic
development of data information and business management, and to win economic benefits for the
enterprises has played a key role. The current data forms are mainly reflected as: image, audio, text
and other unstructured form. A variety show that with the form which is easy to collect and to use,
objectively, work efficiency of people is improved, and the development of human life is promoted
into the direction of diversification.
1.2 Characteristic
Big data features are mainly reflected in the following four aspects: extremely huge data size,
dynamic data information, diversified data types and a variety of data value. The characteristics of
big data era to cater to the direction of development, become the mainstream products to promote
the development of society, the huge data system will generated from many aspects of human life
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
204
together, and which will build perfect network system, show the mode of information superiority.
users of data, is the dynamic data producers, people will produce dynamic data containing a lot of
information from the online shopping, or micro-blog use; data information in various forms appear
in people's life, for people to choose and investigation; in the process of use and dissemination of
data, a large amount of data information from the various aspects involved, including weather
forecast, publishing, film and television industry. Huge benefits produce various kinds of data types,
through to the information collection, into theoretical knowledge, to guide people's decisions and
actions.
2. Development of e-commerce platform in the era of big data

The development of electronic commerce platform has provided a strong support for the
development of the country, while it has won great economic benefits for itself. With the use of big
data and Internet technology, in a short period of time e-commerce rapidly to build a new economic
and trade framework, fast network trading platform, to promote the development of national
industry, to enhance the national strength, and to improve the level of competition.
2.1 Convenient and efficient trading process
The data support cannot be separated from the development of e-commerce platform , while the
impact of the data has its own unique development, as an online transaction, and the traditional line
trading there is a fundamental difference. Traditional line platform, the establishment of the process
by many checks and reviews, and the e-commerce platform is based on Internet technology, it can
accommodate all kinds of personnel involved. E-commerce platform for a wide range of
transactions, all walks of life are able to quickly integrate into the platform, the commodity
marketing, relying on network traffic and consumers to achieve, all the times, and anywhere trading
activities occur.
2.2 System management of laws and regulations
For the healthy and orderly development of e-commerce, the state to develop relevant laws and
regulations of the transaction appears in the transaction information and manual operation of
standardized management, to provide consumers with a guaranteed trading platform.
2.3 To achieve mutual coordination between the various departments
The huge trading system, need to process a good coordination among the relevant departments, to
avoid trading errors, through the mutual coordination between the companies and the customers,
companies and suppliers, the company and the government, e-commerce platform to create clear,
accurate, and convenient service processes.
3. Problems in the development of TV business platform in the era of big data

The formation and development of big data provides an opportunity for the development of
e-commerce platform, but also brings challenges to the electronic commerce platform, only to solve
a series of problems, the development of e-commerce platform in the future to solid.
3.1 The security problem of electronic commerce data
Big data in the formation of the development process, there are a series of natural security issues;
e-commerce platform of the application is not to avoid data security vulnerabilities. As a result, the
development of electronic commerce platform has a series of problems in data management, which
is not enough to control the safety of data information. In the use of data, the data carried by the
malware and virus code is difficult to be found, the virus software can long-term attack e-commerce
platform, the e-commerce transactions in jeopardy. The network is open, the data show as not
hidden, open development environment to become a hacker attack in the effective combination
205
between the data, the data system is becoming more and more powerful, once attacked, the loss is
huge.
3.2 The monopoly of electronic commerce data
Relies on the development of e-commerce platform is the effective information support platform,
and after the establishment of the obtained information in minimal maintenance and is more of its
own data to the information processing ability of the data. A short period of time allows maintain
the e-commerce platform to share data maintenance work, but in the long term, it will be easy to
cause the strong stronger, the weak weaker situation, once the illegal data, data theft, will cause a
huge loss of e-commerce platform, the consequences could be disastrous.
3.3 Privacy issues in electronic commerce data
Consumers in the process of consumption will reveal their basic information to the business
platform, for example, preferences, consumer preference types of goods etc... At the same time,
through the quick payment method, the important information will be spread out. The consumption
of fast payment is registered by the consumer's real full name, mobile phone number, ID number
and bank card number, these information are in the process of consumption by the electricity
supplier master, if the information being stolen by hackers engaged in illegal behavior, will
seriously affect the interests of consumers, and therefore the trust relationship between consumers
and providers is destroyed, and it will break the user trust in business.
3.4 Relevant policies and regulations are not perfect
Perfect management system and policy is a powerful guarantee for the healthy development of
e-commerce platform, although the state has adopted certain laws and regulations on the
supervision and management of e-commerce platform, but there are still many problems in the
actual process of implementation and trading. And at this stage of China's e-commerce platform
related laws and regulations are not sound, the standard is not uniform and so on, is not conducive
to the relevant supervision and management of e-commerce platform for the development of
effective supervision and guidance.
4. Development strategy of e-commerce platform in the era of big data

4.1 Develop a reliable storage security policy
In the process of the development of the electronic commerce platform, storage management and
reliable to the data involved in information, ensure consumer privacy rights, e-commerce platform
can be managed by means of encryption on data information, make e-commerce in adding
encryption function of data management, enhance consumer trust in e-commerce platform. In order
to further strengthen the encryption function, at the time of encryption, it also can be the key
password management and data isolation management; or through real-time monitoring of data
information, using the filter monitor, once the data is stolen, it will immediately stop data
transmission, to avoid data loss.
4.2 Build a sound management system
Electronic commerce platform has a huge information system; the industry involved a wide range of
transactions, the need to develop unified regulatory standards for supervision and management. This
can be achieved by establishing cross-regions. Coordination of inter departmental integrated
agencies to ensure the safety and reliability of the development of e-commerce platform. By
restricting the electronic commerce platform in the transaction process of the use of data and
application scope, standardize the e-commerce platform trading process; build a sound trading
platform for consumers to create a trusted consumer environment.
206
4.3 Innovative e-commerce marketing channels
In order to carry out effective innovation and development of e-commerce platform, it should be
done in advance marketing strategy to understand the market, to meet the needs of the market to
make appropriate adjustments. Through the collection of market data information, analysis of
market demand, found opportunities in that market. And the relevant consumer groups for effective
classification, understanding of different consumer groups of consumer preferences and
consumption characteristics, the use of practical and feasible means to attract consumers to buy
goods. And continue to pay attention to the product cost, product sales, commodity prices and other
basic issues, and constantly make adjustments to achieve the maximization of enterprise benefits.
4.4 Building a new service model
The e-commerce platform in the development process, the use of data analysis of consumer
information and effective preference for goods and use value, develop appropriate service mode, is
useful information for the development of e-commerce platform to provide. Electric business
background can be used for rapid analysis of massive data information, in a short period of time for
the user to recommend a stage of need and suitable products, to meet consumer preferences,
increase product sales. Electricity suppliers can also be through the budget and interpretation of the
data of the product packaging and marketing to the needs of small and medium enterprises, improve
product sales of disposable business amount, increase the profit value. Either way, the electricity
suppliers are required to effectively grasp and fully analyze the data, to form a perfect service
model, to provide consumers with a valuable service platform.
5. Concluding remarks
The arrival of the era of data, to provide a wide range of e-commerce platform for the development
of the world, the data has become the main source of interest in e-commerce platform, and to
become the core competitiveness of the competition between the platforms. In the face of big data
challenges and opportunities brought by e-commerce platform only solve the current problem, make
limited innovation and practice, abide by the relevant laws and regulations. Consciously form the
safety and health of the marketing environment, to develop long-term effective, win the
corresponding profit. Along with the data to the electronic commerce platform's seepage and the
influence, the electronic commerce platform's development needs to operate smoothly, using the
data information to carry on the practice and the innovation, carries on the healthy development.
References
[1] Ming Jejune. Opportunities and Challenges of Electronic Commerce in the Situation of Big Data
Security [J]. Information security research, 2016, 02:186-190.
[2]Liu Men GU Wangling. Discussion on the development of electronic commerce in the era of big
data [J]. Prices Monthly,2016,04:51-54.
[3]Liu Jing. Research on the practice and development of e-commerce platform in the era of big
dataTake Taboo network as an example [J]. Reform and strategy, 2016,05:122-126.
[4] Duane Xiao hen. Research on China's e-commerce marketing strategy in the era of big data [J].
Journal of Xi'an Petroleum University (SOCIAL SCIENCE EDITION), 2016, 04:48-53.
[5] Jiang Xuehui. Information development and innovation of electronic commerce in the era of big
data [J]. Business economic research, 2015, 07:78-79.
[6] Liu Zhuhai, Chen Yong, Yao Chili. Electronic business service model innovation in the era of
big data [J]. Research on science and technology management, 2014, 01:31-34.
207
Discussion on the Development of the Third Party E-Commerce Platform

in the Internet Era
Yao Liu, Junqiang Liu
The Engineering Technical College of Chengdu University of Technology, Leshan, Sichuan, China,
614007
Keywords: Internet era; Third party e-commerce platform; Development
Abstract. With the advent of the Internet era, the third party e-commerce platform in China began
rapid development, which has become a new way for many enterprises to sell items, new means and
modern consumers often choose consumption, but the third party e-commerce platform in our
country there are still some problems, so how to effectively improve these problems make the
enterprise and consumers can make better use of this platform to enhance economic efficiency, and
lay a solid foundation for the development of electronic commerce in China.
1. Introduction
The third party e-commerce platform, generally refers to businesses and consumers in the service
platform, in accordance with established trading and service standards, to provide services for
buyers and sellers, its content can include: enterprise information publishing and consumer search.
The two sides established trading, payment, goods logistics; but there is no restriction for these
contents 1 .

2. The concept of the third party e-commerce platform in the Internet Era
2.1 Characteristics of the third party e-commerce platform in the Internet Era
2.1.1 Uniqueness
Third party e-commerce platform does not belong to the scope of the buyer, and the seller does not
belong to the category, the main choice is the use of the platform as a transaction, and the reality of
the market is similar, which makes it a unique.
2.1.2 Mainly rely on the network
Third party e-commerce platform, which is mainly due to the development of electronic commerce,
which makes it necessary to rely on the network to the normal use of electronic commerce.
2.1.3 Specialist
Third party e-commerce platform, main role is to provide a service platform, which requires more
professional skills, mainly includes: the order management, payment security protection, provides a
variety of services such as logistics management makes its better protection of both safety and has a
convenient.
1.2 Classification of the third party e-commerce platform in the Internet Era
Third party e-commerce platform in general in accordance with the industry, geographical and
functional classification of different,
1.2.1 According to the industry is divided into
1)Specialist:Requires third party e-commerce platform is mainly single and a certain industry and
industry related to the industry.
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
208
2) Comprehensiveness:Requirements of the third party e-commerce platform associated with a
wide range of industries, making the industry and a certain industry.
1.2.2 Divided by region
Local character: Requires third party e-commerce platform is only in a country, region or smaller
region as a range, at this stage to the provinces as the majority. In the province as the scope of the
third party e-commerce platform, generally with the government as the leading, mainly to provide
some demand or supply of special industry platform.
Globalist: This is mainly with the former, respectively, for the third party e-commerce platform
involves many countries or regions as the range, the main is to provide some design language
translation, declaration of international service and complete global freight platform.
1.2.3 According to the function is divided into
Full electronic commerce platform. It is mainly involved in all aspects of enterprise economic
behavior of the process, generally in the collection of information to the delivery of goods, has been
to the final payment of funds, which makes the business to carry out the business to get better help.
Partially electronic commerce platform. It is mainly involved in the business behavior of the
enterprise itself, only to provide business activities in some business.
2. The development status of the third party e-commerce platform in the Internet Era
The rapid development of the third party e-commerce platform, driven by China's industrial
structure, which also enhance our national economy. And for the electronic commerce has a very
important network platform, the Chinese government also has a high attention and concern. In
collaboration with relevant government departments, greatly improve the electronic commerce the
platform running environment, given the hardware and software of a lot of data support.
In China at the end of twentieth Century, e-commerce platform began to sprout and rapid
development, bring in traditional industries under the pressure of China's e-commerce has
experienced difficulties, until the beginning of the twenty-first Century, e-commerce platform in
China began to have a certain scale and profit. But with the development of the international trend,
China's e-commerce platform began to increase rapidly, the domestic enterprises to enhance their
own development through the third party platform, which not only makes the enterprise obtains the
promotion, the third party e-commerce platform also began to grow. However, due to the emergence
of a number of issues, leading to the problem of e-commerce to enterprises and consumers are
gradually highlighted2.
3. The important significance of the third party e-commerce platform in the Internet Era
3.1 Forcing the transformation and upgrading of traditional enterprises
With the advent of the Internet era, the Internet technology in the rapid ascension, which makes
traditional enterprises to face new opportunities, meanwhile, also a new challenge, which makes
some traditional enterprises, were forced to face in the transition and adjustment. Third party
e-commerce platform development, not only requires the traditional enterprises in the technical
need to upgrade, but also in the sales model and methods have changed. Many large home appliance
manufacturers are open to make use of the Internet for sales, but also through the delivery service,
so that consumers get more convenient.
3.2 To promote the rapid development of small and medium sized enterprises
With the rapid development of China's economy, China's small and medium-sized enterprises have
been developed, but still has a number of features, the industry wide and historical time is too short,
which makes the development of electronic commerce, facing the dual constraints of capital and
talent. But the third party e-commerce platform will greatly reduce these restrictions, not only
reduces costs and provides professional electronic business service, it also enables the small and
209
medium-sized enterprise can enhance its efficiency, and make its faster development.
3.3 Provide new employment opportunities
The rapid development of the third party e-commerce platform makes a large number of
professional talents to obtain certain employment opportunities. Because the basis of the technical
work is relatively simple, all of its professional requirements are in low levels, which makes the
professional talent can find some favorite work. And, the third party e-commerce platform needs
talent there is a lower threshold, investment cost is lower, but higher gain characteristics, which
makes part of the group began to conduct business on the third party e-commerce platform, which
makes more people get employment opportunities3.
4 The problems faced by the development of the third party e-commerce platform in the
Internet Era
4.1 Development cannot be balanced
There are many kinds of third party e-commerce platform involved, which makes the range covered
in a variety of industries on the platform of comprehensive type of broad, the customer resources
are more abundant species; and the depth of a wide platform for the industry, the industry also has a
fine division of labor; regional type of platform has a fixed customer base, and with the
characteristics of goods and services. In practical use, in addition to a few of the larger third party
e-commerce platform, the pace of other platforms has a slower development, which causes that the
development of the third party e-commerce platform is not balanced.
4.2 Service cannot be promoted
With years of development of e-commerce platform for the third party in our country, the
transformation of the information service platform into a simple trading platform compound, but the
professional skills of the platform and the logistics service level corresponding to the still failed to
get promoted. In actual use, first of all, part of the platform or not to provide for consumers and
businesses is linked to communication tools software, which makes consumers in commodities on
the question cannot be normal communication with the enterprise, or even misunderstanding
because consumers buy the wrong goods; secondly, part of the platform or not to provide for the
logistics. Led to the enterprise in order to achieve the trading volume of its own, some cannot
complete the commitment to consumers, and even delay consumer use of items.
4.3Sincerity cannot be guaranteed
As China's Internet era, e-commerce platform in China has increased rapidly, but because of starting
late, the relevant legal system has not been perfect, coupled with our related network services has
not been perfect, which will be part of the enterprise produce bad behavior in the aspect of
operation. Although in order to solve this situation, the third party e-commerce platform will also
take some solutions, but on the platform of enterprises more and more, the scope is more and more
widely, which makes the third party e-commerce platform, to protect the interests of consumers
cannot be performed without legal support, will lead consumers to third party e-commerce platform
has a certain skepticism.
4.4 Security cannot be protected
With the rapid development of China's Internet, China's third party e-commerce platform has also
been rapid growth, but in the growth, there will be security vulnerability. In actual use, first of all,
part of the third party e-commerce platform appeared to reveal consumer's name, email, password
and other related information to the consumer, which brought some trouble and even losses;
secondly, some third party e-commerce platform tampering with information, resulting in the lack
of performance of enterprise goods information true and complete. The enterprise management also
210
has a bad effect4.
5. Scheme for the development of the third party e-commerce platform in the Internet Era
5.1 Enhance its balanced development
The main reason for the development of the third party electronic commerce platform is the main
reason for the development of the electronic commerce platform is its management mode. In the
electronic commerce of the founding of the enterprise is the consumer, the importance of its open
platform also determines the consumer participation. Although the larger third party e-commerce
platform has attracted the majority of consumers in the past, but its way of operation will also be
other platforms to different extent. But in order to reduce the price war due to the same way, other
platforms should operate independently of the innovation, the advantages of their own to the full
play, making it more attractive to consumers.
5.2 Improve its service level
The service level of the third party e-commerce platform mainly displays in the following two
aspects:
5.2.1 Technical service level
Third party e-commerce platform mainly uses the network technology to support, improve its
various computer functions, and the use of related technologies to enhance the level of technical
service platform.
5.2.2 Application service level
Third party e-commerce platform can be used to sign the contract, combined with some of the
logistics company, logistics distribution service convenient for the enterprise platform, which not
only can save the cost of the enterprise also guarantee the quality of service, so the application can
improve the comprehensive service level.
5.3 Build its integrity system
Credibility is the key factor to ensure the development of its platform, with the development of
China's third party e-commerce platform, China's Ministry of Commerce began to publish its
relevant regulations and rules and regulations. But with the development of electronic commerce in
China soon, the integrity of the system of the platform makes more and more complex, which
makes, not the integrity of the system construction of the third party e-commerce platform only in
accordance with the laws of the countries also need to supervise third party and the government, the
enterprise and the consumer with each other, the establishment of a network the national credit
system, the credit system can not only maintain the electronic market order, but also promote the
development of third party electronic commerce platform.
5.4 Ensure its safety environment
The security environment of the third party e-commerce platform should proceed from the
following three aspects: first, in order to protect the consumers' information will not be leaked, need
to upgrade the technology of information encryption; second, in order to protect the business items
of information is not tampered with, relevant to the needs of technology to enhance the firewall;
third, in order to improve the security platform trading environment, national we should introduce
some relevant laws and policies, punish criminals on the platform5.
The use of these measures can ensure the development of the Internet era third party e-commerce
platform, so that China's e-commerce can be better to upgrade.
6. Concluding remarks
This paper mainly expounds the important meaning from the development status and the concept of
211
the Internet, the Internet era third party e-commerce platform of the Internet era the era of third
party e-commerce platform of third party electronic commerce platform, showing the age of the
Internet third party e-commerce platform problems, explore the Internet era third party e-commerce
platform, want to be taken development plan.
References
[1] Zhang Xian. Research on the development of the third party e-commerce platform in the
"Internet plus" era [J]. Information and computer (Theory), 2015, 08(23):165-166.
[2] Deng Xinxiang, He Leaching. Reflections on "legal orientation of e-commerce platform in
China Internet plus" era [J]. Journal of Chongqing University of Posts and Telecommunications
(SOCIAL SCIENCE EDITION), 2016, 01(1):131-137.
[3] Mao Hanson. Research on the "Secondary Liability" of the trademark infringement of the third
party e-commerce platform [J]. East China University of politics and law, 2015, 09(18):
256-266.
[4] Sun Man. Thinking and analysis of the development of the third party e-commerce platform [J].
China management informationizati, 2014, 07(11):183-184.
[5] Ago Yang. Research on the efficacy evaluation of the third party e-commerce platform [J].
Hashing Normal University, 2015, 08(16):115-117.
212
Analysis of Factors Restricting Rural Credit System Construction
Jing Chen
Business Department, Suzhou Vocational University, China
chenjing1@jssvc.edu.cn
Keywords: Constraints; Credit system; Factors; Value
Abstract. The stability of rural areas is essential to the whole society in China. While to ensure the
stability of rural areas, a sound credit system is the key point. The construction of rural credit system is
an indispensable part of countermeasures to solve the current rural problems. With the country's
emphasis on credit construction, rural credit management has been significantly improved, the credit
file has been initially established, the credit environment and the rural economy have been greatly
enhanced. However, extensive rural areas in China lead to large regional differences, a large number
of farmers and other social factors involving government departments, financial institutions, farm
families, rural economic organizations, therefore, rural credit management fails to form a system.
This paper aims to analyze the factors that restrict the rural credit system in all aspects and put forward
countermeasures.
1. Introduction
Rural economy has always been a hot topic as agriculture is the primary industry as well as the pillar
industry of economic development. Improving the rural economy and building a healthy agriculture -
related industrial clusters is an essential part of the construction of a new socialist countryside.
Therefore, how to make agriculture-related industrial clusters move towards the healthy development,
so as to continuously improve the rural economy. To construct rural credit system is an effective
means to solve the problem.
Credit system is a systematic management project, which includes all the elements to improve the
agricultural economy, including: financial institutions, farmers, enterprises, intermediaries,
government, people, etc. These elements in the credit system are inter-constraint and promote each
other, thus regulating the operation and improving the rural economy. Therefore, it is very important
to correctly understand and deal with all the factors in the credit system and find out the factors that
restrict its construction.
2. Reasons to analyze the constraints of the rural credit system construction

These factors restrict the construction of rural credit management system as well as the rural
economic construction and socialist modernization. Therefore, it is of great value to analyze the
restrictive factors.
2.1 To promote rural credit system
The rapid economic development has brought the lack of social credit, and there have been a lot of
credit missing events in rural areas. For example, in order to obtain state funding, planting content and
quantity are fabricated; the fruit and vegetable pesticide use exceeded; evade bank debt and so on. The
occurrence of such incidents is mainly due to the imperfect rural credit management. However, the
reasons why the rural credit management has not achieved good results are that there are some
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
213
constraints in the rural environment. Only by dealing with the restrictive factors, can the rural credit
system construction be carried out smoothly.
3. To improve the rural economy

Constructing and implementing rural credit system is an effective means to improve the rural
economy and it could benefit all the elements. As the rural credit system is not perfect,
non-performing loans often occur, resulting in financial institutions to give up the rural market, which
hinders the development of agriculture-related enterprises, reduce the financial institutions profit and
lead to the slow development of rural economy. In addition, due to the credit deficiency of famers and
agriculture-related enterprises, the product transactions in the context also undermine the local
trading environment which is not conducive to attracting investment, expanding the scope of the
transaction, thus leading to rural economic lags. Therefore, the negative awareness public may also
pose a negative impact on the development of rural economy. Rural economic management is an
important part of agricultural and rural work, so it is necessary for us to analyze the constraints and put
forward countermeasures.
4. To achieve the socialist modernization

The socialist modernization refers to not just urban modernization but the all-round modernization.
Only the high urban modernization cannot guarantee the modernization of the whole society as the
rural areas are still in a state of low productivity. Therefore, rural areas should be rooted in their own
characteristics and geographical conditions to establish the industrial chain. Correspondingly, a credit
management system is required to improve productivity and achieve rural modernization. The
analysis of the rural credit management system constraints is of great significance for the
development of China's rural areas.
5. Analysis of factors restricting rural credit system construction

The establishment of rural credit system requires comprehensive power in the credit system and the
overall planning of the main function. Then build information platform on this basis to achieve the
management and sharing of above content. The construction of credit management system in rural
areas has always been a concern of scholars and governments; however, it has not been implemented
smoothly which is mainly due to the following constraints.
5.1 Farmers
According to the survey by the research group, most farmers in China are less educated and they do
not understand the credit management. So the majority of them hen carrying out farm, the majority of
farmers do not cooperate in information collection and even extreme that this is against the privacy of
individuals. In addition, with the further development of urbanization, the number of migrant workers
increased dramatically and in many families in rural areas, only the senior and children are left home,
which also restricts the construction of rural credit management system as well as the development of
the new countryside.
Generally, farmers have a sense of self-sufficiency, completing field cultivation through their own
means of production and labor resources to solve the problem of food and clothing. The rural credit
behavior that farmers can have is limited to small-scale agricultural and sideline products transaction,
small cash borrowing, human relations and other activities. They have weak credit management
consciousness and are less constrained by their credit. This attitude has caused great obstacles on the
development of rural credit management.
214
5.2 Agriculture-related enterprises
Most of the agribusinesses adopt the family management mode where the management is not sound
and lack internal control mechanism, so the dishonesty in order to earn immediate benefits often
occurs. The survey indicates that many companies are unaware of their dishonest behaviors. The
unreal propaganda of products, exaggerated product efficacy and delta debt has become a common
problem in rural enterprises. Enterprises are the core of credit management project, only their honesty
could solve the problem and promote the local economy towards a healthy direction, so for
agriculture-related enterprises, great efforts should be made enhance their sense of credit.
5.3 Financial institutions
At present, many financial institutions have abandoned the rural market for they believe that the high
rate of non-performing loan market in rural areas increases the financial risk. This status quo is bound
to be a fatal blow for the rural economic development. The economic development promotes the
development of enterprises. The expansion of enterprises needs funds and the benign capital could
promote their healthy development. However, many agriculture-related enterprises choose private
institutions and the pressure in the high interest rates results in many companies to discard the
principle of integrity and honesty. If the credit management system is established and implemented,
the above problems can be solved. In the system, there is a lot of corporate credit information and
financial institutions can conduct assessment according to records to determine the amount of loans,
thus achieving a win-win situation.
5.4 Government
At present, some government leaders ignore the credit construction for personal gain which has
become the biggest obstacle in the credit management construction process. As an important factor
that decide the successful implementation of the rural credit system, government plays a leading role
in the operation of the whole society and has a strong appeal, which will determine the development
of affairs.
5.5 The public
Nowadays, many people are not concerned about the social disharmony, which makes it difficult to
suppress dishonest behaviors in enterprises. Lack of supervision makes them choose to take the
shortcut which is often based on the premise of the loss of good faith.
6. Countermeasures to improve the rural credit system
6.1 Governments should improve the credit consciousness of farmers and enterprises
The government is a powerful guarantee for the construction of agricultural credit system, and the
rural grass-roots governments play an especially vital role. Therefore, it is necessary for the
governments to increase the intensity of construction, improve the relevant systems, and carry out
regular publicity and explanation of credit management to improve the credit consciousness of
farmers and enterprises.
6.2 Farmer and enterprises should be self-disciplined
Farmers and small and medium-sized enterprises in rural areas are the main subjects of credit granting,
so they play a vital role in the construction of rural credit system. Farmers and enterprises should be
aware of the credit management, coupled with the constraints of the government, and they will be
honest in the initial stage of the construction of the credit system. Then with the continuous
improvement of the system, they will certainly benefit from it and have an increasingly profound
understanding of the importance of credit management, thus achieving self-discipline.
215
6.3 The financial institutions should make rational use of the credit system
Financial institutions are the financial support of enterprises and the credit management system
construction must ensure that all the main information is symmetry. The financial institutions join the
agricultural credit management system and use the agricultural credit management platform to
improve the efficiency of financial institutions loans, reduce the cost of credit and solve the financing
difficulty for agriculture enterprises.
6.4 The public advocates credit
The power of the public is enormous. If the public can advocate credit, ensuring their own integrity
and supervising others, the credit is bound to be implemented smoothly.
The construction of rural credit management system is a long-term research content. The timely
adjustment based on the development of rural economy could improve the implementation effect.
Factor analysis is like to analyze the internal parts of the system, only fully understanding the part
structure, can we apply them flexibly in the subsequent system construction.
References
[1] Zhang Jun. Strengthen the Corporate Credit Management Construction in Jiangsu Province
Based on the Concept of Benefit [J]. Business Economics, 2015 (03).
[2] Bu Xuhui. Research on the Rural Credit System Construction [D]. Northwest A & F University,
2010.
216
Simulation Research on Cooperation Game between Bank, Government

and Enterprise under Risk Compensation Mechanism
Huafeng Chen1,2,3,a, Mu Zhang1,b, *
1
School of Finance, Guizhou University of Finance and Economics, Guiyang Guizhou 550025, China
2
Guizhou Institute for Urban Economics and Development, Guizhou University of Finance and
Economics, Guiyang Guizhou 550025, China
3
Guizhou Institution for Technology Innovation & Entrepreneurship Investment, Guizhou University
of Finance and Economics, Guiyang Guizhou 550025, China
a
2272364739@qq.com, brim_007@163.com
Keywords: Cooperative game; Risk compensation mechanism; Shapley value method; Simulationl;
Technology-based SMEs.
Abstract. In this paper, cooperative game theory is used to construct a cooperative game model
between technology-based SMEs, government and banks under the risk compensation mechanism.
This paper discusses the distribution of cooperative achievement by using the shapley value method,
and makes simulation through Matlab, which makes the distribution of the results as reasonable as
possible, and promotes the long-term cooperation between the technology-based SMEs, government
and banks.
1. Introduction
With the rapid development of science and technology and the acceleration of global economic
integration, the technology-based SMEs play an increasingly important role, as an important source to
enhance the comprehensive national strength and national competitive advantage. The development
of technology-based SMEs will impact the country's economic future. Compared with the general
technology-based SMEs, the biggest difference is that it is mainly engaged in high-tech products
research and development, production and sales. It has strong innovation ability and strong
development potential. China's government has been actively exploring how to play a role of
government macro-control through policy guidance to enhance China's independent innovation
capability, so that technological innovation has become a new impetus to China's economic growth.
Therefore, to promote the rapid development of technology-based SMEs will enhance China's
scientific and technological innovation capability and promote the rapid development of China's
economy.
Scholars at home and abroad in the field of cooperative game theory have been rich in research
results. Nash (1951) firstly defined the cooperative game and non-cooperative game of the two
concepts [1]. Cooperative game is a game in which people can exchange information and have a
mandatory agreement, while non cooperative game is a game in which the central government can
neither exchange information nor enforce a force agreement. Rubinstein's (1982) based on
alternat-ing offers model studies the cooperative game equilibrium solution [2]. Zhao Hong (2007) on
the basis of reasonable definition of stakeholders, uses cooperative game mathematical model to
prove the uniqueness of the sub game refined Nash equilibrium solution of stakeholder game [3]. Zhou
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
217
Lai(2009) discusses the allocation of internal authority in cooperative game framework[4]. Feng
Genfu, Zhao Juehang (2012) from the perspective of cooperative game perspective, based on the
asymmetric Nash bargaining model, an endogenous Nash bargaining model is constructed. This
model is used to systematically analyze the relationship between managerial salary, equity incentive
and on job consumption [5]. Sun Hongxia, Zhang Qiang (2013) studied the problem of revenue
distribution in the form of preferential constraint in the form of priority constraints by introducing a
lattice structure [6]. Li Cui, Xue Yu (2014) , in order to make up for the deficiency of the core as a
possible empty set of game solutions, the negotiation set in classical cooperative game is extended to
fuzzy cooperative game [7].
In summary, the cooperative game theory has been a wealth of research results, but based on the
risk compensation mechanism of cooperative game research less. In this paper, cooperative game
theory is used to construct a cooperative game model between technology-based SMEs, government
and banks under the risk compensation mechanism. This paper discusses the distribution of
cooperative achievement by using the shapley value method, and makes simulation through Matlab,
which makes the distribution of the results as reasonable as possible, and promotes the long-term
cooperation between the technology-based SMEs, governments and banks.
2. Cooperative game model

The difference between cooperative game and non cooperative game lies in whether there exists some
external force to guarantee the participant's execution strategy to form an alliance. It is generally
accepted that a cooperative game is a game in which if the agreement, promise or threat is fully
binding and enforceable. The benefit of cooperation is greater than the internal members of the
individual operating income, and for the consortium should exist within the Pareto improved nature
of the distribution rules. In this paper, we will establish a cooperative game model based on
government, banks and technology-based SMEs, and apply Shapley value method to discuss the
distribution of income.
2.1 Model hypothesiss
The coalition consists of government, banking and technology-based SMEs. Government as a whole
alliance to maintain stability, because the existence of the government alliance will not default, fraud
and so on. Suppose that the government's compensation coefficient for new loans to banks is , and
has the risk compensation fund I1 . The purpose of the government is to allow enterprises to create the
greatest social benefits. We set the technological innovation of enterprises to the social contribution
of the coefficient of effect . Bank as the main lender, its new loans is I 2 , the deposit interest rate is r0 ,
the loan interest rate is r1 . The loan period is assumed to be 1 unit cycle. Tech SMEs as their own
recipients and benefits of the generator, its own funds are I 3 , technological innovation and production
activities, labor input are L . Suppose that the production function of technology-based SMEs is the
Cobb-Douglas production function with constant returns to scale. is the elastic coefficient of capital
output. is the elastic coefficient of labor output. A is an integrated technical level. Y is the total
output. Therefore, the production function of technology-based SMEs is
Y AI3 L
(1)
2.2 Model establishment
In the model, governments, banks and technology-based SMEs acquire output in the form of
cooperation. After the outputs are obtained, the distribution of benefits will become a problem, and
the contribution of different sectors will vary and the benefits to be gained will vary. Shapley value
method is a relatively reasonable benefit allocation method.
218
According to the assumptions, v (1) means that the league only has government, and its not
implements loan risk compensation mechanism, which is not involved in cooperation. Assuming that
this part of the risk compensation funds can receive the income is stored in the bank's interest income,
that is v(1) I1r0 .
v (2) means that the league only has bank, so there is no investment object and no government risk
compensation. So the funds idle only access to the banking industry average income, that is
v(2) I 2 r0
.
v (3) means that the league only has scientific and technological SMEs. It can not obtain bank loans,

can only use their own funds and labor into production activities, that is v(3)=AI 3 L I 3r0 LP .
v (1, 2) indicates that the participants in the alliance are government and banks, but because there is
no SMEs , so the government and banks cannot reach cooperation. Can only receive the interest
v(1, 2) I r I r
income of funds, that is 10 2 0.
v (1, 3) indicates that the participants in the alliance are government and science and technology
SMEs, assuming that the Government will risk compensation fund into the production of enterprises,

that is v(1, 3) A( I1 +I 3 ) L -I 3r0 -LP [ A( I1 +I 3 ) L ] I1r0 .
v (2, 3) indicates that the participants in the alliance are banks and technology-based SMEs. The
bank will own loans to enterprises and receive a certain interest, that is

v(2, 3) A( I 2 +I 3 ) L I 3r0 LP I 2 r0
.
indicates that the government, banks and technology-based SMEs are involved in the
v(1, 2, 3)
alliance. The alliance is stable, and the output of technology-based SMEs is also determined, that is to
say there is no risk of default and investment failure. The government has put in the funds for SME
loan risk compensation to guide the banks to increase the SME loans, and the SMEs will invest their
own funds and new loans and labor into the production activities, that is

v(1, 2, 3) (1 ) A((1+ )I 2 +I 3 ) L I 3r0 LP (1 ) I 2 r0
.
And then based on the above characteristic function , we can get shapley value,
1 1 1 1
1 v(1) [v(1, 2) v(2)] [v(1,3) v(3)] [v(1, 2,3) v(2,3)]
3 6 6 3
1 1
r0 ( I1 I 2 ) AL (( 1)( I1 I 3 ) I 3 2( 1)((1 ) I 2 I 3 ) 2( I 2 I 3 ))
3 6
1 1 1 1
2 v(2) [v(1, 2) v(1)] [v(2,3) v(3)] [v(1, 2,3) v(1,3)]
3 6 6 3
1 1
r0 (3I1 I 2 ) AL [( I 2 I 3 ) I 3 2( 1)((1 ) I 2 I 3 ) 2( 1)( I1 I 3 ) ]

3 6
1 1 1 1
3 v(3) [v(1,3) v(1)] [v(2,3) v(2)] [v(1, 2,3) v(1, 2)]
3 6 6 3
1 2
AL (2 I 3 (1 )( I1 I 3 ) ( I 2 I 3 ) 2( 1)((1 ) I 2 I 3 ) ) r0 ( I1 (1 ) I 2 I 3 ) LP

6 3 3
Finally, the Shapley value is normalized,
The proportion of revenue to total revenue should be received by government is
1
1
1 2 3
The proportion of revenue to total revenue should be received by bank is
219
2
2
1 2 3 .
The proportion of revenue to total revenue should be received by bank is

3
3
1 2 3 .
2.3 Simulation and analysis of model

Table.1.Assumed parameter
I1 I2 r1 r0 I3 L A P
variable
We simulate the alliance
parameter 80 0.of 3 government,
100 banks
0. 0475 0. and
015 technology-based
50 20 0. 7SMEs.
0. 3The parameters
2 2 such as
table 1, values from 0% to 50%, 0.1% per interval to take a value, the simulation picture be get in
Figure 1. In the case of a change in the risk compensation coefficient of the government, we observe
the ratio of the three benefits to the total return. Based on the Shapley Value Method, we find that with
the increase of the risk compensation coefficient, the proportion of revenue to total revenue of the
government and the technology-based SMEs will increase gradually, and the ratio of the bank's
proportion of revenue to total revenue will decrease. And the bank should obtain the minimum
proportion of total revenue, the government should obtain the largest proportion of the total revenue.
In this model, the bank contribution to the alliance is relatively small, so the proportion of income
should be obtained on the lower proportion of total revenue. The government's contribution is
relatively large, so it accounts for the proportion of the total revenue gains should be high. has the
least impact on the SME of science and technology. changes from 0% to 50%. The change of
science and technology SMEs income ratio has about only 1%. has the greatest impact on the
government. changes from 0% to 50%. the change of government income ratio has about 3%. This
shows that the greater the value of , the greater government contribution to the total income, and the
greater the proportion of income should be received by government.
0.404
0.402
0.4
0.398
SME
0.396
0.394
0.392
0.39
0.12
0.115
0.11 0.525
0.105 0.52
0.1 0.515
0.095 0.51
0.505
0.09 0.5
0.085 0.495
0.08 0.49
Bank
Government
Fig.1.The proportion of revenue to total revenue of the government, bank and SME
3. Summary
This paper expounds the basic meaning of cooperative game, and applies it to the bank and the
government on the SME loan risk compensation mechanism. Through the establishment of
cooperative game model, and citing the Shapley solution to the overall income distribution of the
220
cooperative alliance. We concluded that the proportion of government and bank income in the union
basically conforms to the actual situation. Through the establishment of loan risk compensation
mechanism, cooperation with banks, to reach a cooperative alliance, so that the welfare of the whole
society has been improved. Therefore, according to the income distribution situation of the
government and cooperative banks, the risk sharing proportion under the loan risk compensation
mechanism can be quantitatively defined to ensure the stability of the union.
4. Acknowledgement
This work was financially supported by National Natural Science Foundation of China (71263011).
References
[1] Mcmillan. Game theory in international economics [M]. Beijing: Peking University press, 2004.
[2] Rubinstein, A. Perfect equilibrium in a bargaining model[J]. Econometrica: Journal of the
Econometric Society. 1982, 50:97-109.
[3] Zhao Hong. Cooperative game and equilibrium among enterprise stakeholders [J]. financial
theory and practice, 2007, 28 (4): 74-77.
[4] Lu Zhoula. Distribution of Internal Power in Cooperative Game [J]. Economic Research, 2009
(12): 106-118.
[5] Feng Genfu, Zhao Wei. Executive compensation, on job consumption and corporate
performance: an analysis perspective based on Cooperative Games [J]. China industrial economy,
2012 (6): 147-158.
[6] Sun Hongxia, Zhang Qiang. Limit value of restricted cooperative games with alliance structure
[J]. system engineering theory and practice, 2013, 33 (4): 981-987.
[7] Li Cui, Xue Yu. The income distribution of the set of fuzzy cooperative game negotiation scheme
based on [J]. control and decision, 2014 (11): 2101-2107.
221
On the QMS Operational Performance of Manufacturing Industry in the

View of Quality Manufacturing
Zhongmin Ma
Management School, Xu Zhou Institute of Technology, Xuzhou, Jiang Su Province, China, 221008
Keywords: QMS; Life cycle; Optimal design; Process increment; Process performance
Abstract. Based on the theory of product life cycle and the ISO9001 process method, this paper
puts forward the QMS operating life cycle theory. On the basis of the analysis of the performance
characteristics of QMS life cycle, the process increment P and process performance E are
introduced. The research indicates that the performance depends on P and E. Only when they are
in a relatively high value, QMS could maintain high performance, thereby promoting the change
from "Chinese manufacturing" to "quality manufacturing".
1. Introduction
The importance of quality has now been generally recognized by the government, business and the
public. The 13th Five-Year Plan clearly put forward the strategies of "speeding up the construction
of quality power" and Chinas manufacturing 2025 and five basic principles of innovation,
quality first, green development, structure optimization, talent oriented. The core objective is to
promote the development of industrial structure, upgrading from Chinese manufacturing to
high-quality manufacturing. Enterprise operation and management practice show that the vitality of
QMS fundamentally determines the enterprise's product quality which is an important factor
affecting business performance. Therefore, how to improve and maintain QMS operating
performance and promote "quality manufacturing" has important practical and long-term
significance.
2. Basic theory
2.1 Product life cycle theory
Product life cycle was first proposed by Professor Raymond Vernon from Harvard University in
1966 [1], also known as product economic life cycle. It means the period of from product
development, to marketing and elimination. The theory indicates that for any product, its social
needs are not fixed. With the passage of time, it will ultimately be eliminated by users. The life
cycle of a typical product consists of four phases: introduction, growth, maturation and recession.
The evaluation point of product life cycle is the customer's needs which means the product is
introduced and goes into the recession period all because of customer demand. Therefore, the
company should continuously improve their products and make them meet customer demand
changes, enhance their satisfaction in order to extend the products life and remain competitive. The
product life cycle theory has a profound inspiration for enterprise management.
2.2 Manufacturing QMS performance
The quality management system (QMS) means to complete the quality management activities and
organize and coordinate these activities. IS09001 standard clearly puts forward that using the
quality management system and improving its performance is a strategic decision of the
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
222
organization to promote sustainable development. The specific operation methods require a
combination of PDCA (plan, do, check, action) cycles and risk-based thinking and customer focus.
Use the process approach to enable organizations to plan its process and the interactions, aiming to
achieve breakthroughs, innovations and reorganization as well as the increment of the process and
ensure the effective process performance [2] - [3]. The so-called process approach refers to the process
of systematically identification and management of the application of the organization, especially
the interaction between these processes. Make use of the process approach to understand and
manage interrelated processes as a system, which is conducive for the organization to achieving its
expected results efficiently and effectively. This approach not only ensures the efficiency of
cross-functional activities, but also reflects the principle of prevention, emphasizing the risk
management, knowledge management and continuous innovation.
Therefore, the quality of manufacturing products has life cycle characteristics, so the establishment
and operation of manufacturing QMS should follow the life cycle theory. The high-quality
manufacturing must rely on its QMS performance improvement. The implementation of
customer-oriented method, the effectiveness of process control, the process increment and the
process vitality determine the QMS performance. Figure 1 indicates the establishment and operation
life cycle of manufacturing QMS.
Fig. 1 The establishment of QMS in manufacturing industry and its operation life cycle
3. The improvement strategy of operation performance of QMS in manufacturing industry

from the perspective of quality manufacture
3.1 The urgency of achieving high-quality manufacturing in China
Over the past 30 years of reform and opening-up, China's manufacturing has developed rapidly and
has become the world's largest manufacturing country. However, compared with the developed
countries, there is a problem existing in China's manufacturing industry, that is, large scale but less
advanced technology. Actually, Chinas manufacturing industry has the three high and three low
characteristics [4]. China has released the "China manufacturing 2025" strategy to cope with the US
advanced manufacturing partner strategy, the German industry 4.0 strategy, and established a
quality-oriented basic policy and seized the short-board of manufacturing in China. Besides,
quality is the key for the manufacturing industry to break the bottleneck [5]. Inadequate domestic
demand leads to the excess capacity, but there are a large number of oversea purchase events,
such as toilet cover, milk powder, health care products, rice cookers, and so on. In the year of 2015,
the amount of overseas consumption of the Chinese people exceeded 100 billion US dollars. 6.
The status quo promotes us to contemplate the development of manufacturing industry, so it is
urgent to achieve high-quality manufacturing.
3.2 The operating performance characteristics of each cycle of the manufacturing QMS
In order to improve quality management, many domestic manufacturing enterprises have introduced
ISO9001QMS and implemented QMS certification. The operating performance characteristics of
different life cycles of the manufacturing QMS are listed in table 1. As can be seen from the table,
the QMS performance in the introduction period is inefficient, which belongs to the run-in stage
with the low target recognition and general process increment. In the growth period, the operating
performance is effective, which means it has run through run-in stage and moved to the initial
223
integration, so it has low target recognition and the best process value addition. In the mature period,
the operating performance is efficient or highly efficient (relative to the other stages), reaching the
integration state, so it has high and fixed target recognition and the increment of the process tends to
be stable, and the operation begins to become rigid. In the recession stage, the performance is
invalid or ineffective and the target is recognized but fails to achieve the requirements from the
outside world, the process increment is low, and the operation is rigid. If P refers to the
increment of each QMS process, t represents the time increment, P / t QMS can be used to
express the increment rate of each life cycle of QMS, known as the process performance. The
comparison results of the process performance E are shown as follows: E growing period> E maturing period>
E introduction period> E recession period
E=P/t (Equation 1)
It can be seen from the equation 1 that for the process vitality is the best in the growth period,
followed by the maturing period. Therefore, as the operation and management of the manufacturing
QMS, the operating state of QMS should be adjusted continuously, thus promoting the transition
from the introduction period to the growth period, extending the QMS operation of the growth
period and maturing period, eliminating the recession period.
Tab. 1 QMS operating characteristics of different life cycles of manufacturing industry
Cycle stage Characterization Performance
Introduction period Identify process, form document information and begin running-in. inefficient
The system is not complete. Build the target, the quality and
credibility are low and the process increment is general.
Growth period Through continuous running-in, the process began to become efficient
smooth and the awareness of cooperation has been enhanced. There
is a preliminary integration and the system is more complete and
appropriate with clear objectives, high quality and good process
increment.
Mature period The process and cooperation are smooth. The system is complete Efficient and
and suitable with good integrity. The target recognition is high but highly efficient
fixed and the process increment tends to be stable, coupled with
high-quality. The operation tends to rigid.
Recession period The environment has changed, the system does not change or change Invalid
less, the sector is struggling to cope. The target is recognized but
fails to achieve the requirements from the outside world, the process
increment is low, and the operation is rigid.
3.3 Strategies to improve QMS performance of manufacturing industry under the view of
high quality manufacturing
The manufacturing industry should determine the QMS operation situation according to the QMS
operating characteristics of different life cycles and adopt the strategy to improve QMS
performance based on the characteristics of different periods:
(1) In the introduction period, leaders should take personal supervision. The introduction period
is the basis for future growth; therefore, the top management should personally participate in it,
including determining the target, defining the departmental responsibilities and ensuring the
resources, rather than just break down the quality objectives. For the manufacturing industry, it is
necessary to combine with the implementation of enterprises in the information process when
preparing documents. Therefore, in the introduction period, it is not appropriate to copy the
standards or documents of other enterprises when establishing QMS in the introduction period.
(2) In the growth period, fully realize the process increment. IS09001 requires the use of process
model to establish QMS, including 6 main processes P, leadership, planning, support, operation,
performance evaluation and continuous improvement. Their process increment is respectively
represented by P1, P2, P3, P4, P5, P6 and then the total process increment of QMS is
224
P=P1+P2+P3+P4+P5+P6 (Equation 2)
The main process P also contains n subdivided sub-processes p, then:
P=P1+P2+P3+P4+P5+P6=p1+p2+p3++pn (Equation 3)
And it can be introduced by the formula 1 that the QMS process performance is
E=P/t=(P1+P2+P3+P4+P5+P6)/t
= (p1+p2+p3++pn)/t (Equation 4)
Therefore, whether the QMS is efficient and the efficiency is high or low, the key lies in: any
process Pi0 in operation and there is no negative process, so it is necessary to continuously
eliminate the non-value-added links. Clear boundary of each process and division of labor,
coupled with the big data, Internet and other technological means could break boundaries and
achieve integration, thus achieving better operational performance. Emphasize the process and
ensure results. Therefore, the process requires the training of all employees, so that employees
could implement the established procedures strictly and breaks boundaries as soon as possible, thus
improving the overall performance and achieving high-quality manufacturing.
(3) In the maturing period, find the key links that influence the process increment, thus
maximizing the operational performance of QMS. As the running time increases, the process runs
smoothly, but the process increment tends to be stable and the operation becomes rigid and
dogmatic. To maximize QMS performance and achieve continuous quality manufacturing, the big
data, Internet and other scientific and technological means can be used to achieve meticulous
management and statistical analysis of customer needs, thus overcoming the soft rib of operation,
improving the quality function and finding the key factors affecting the process, emphasizing the
process and ensuring results. According to Equation (3) and (4), we can evaluate the importance of
each process on QMS operation, operation and other factors. By evaluating the sub-process p,
introduce the weight .
P =1P1+2P2+3P3+4P4+5P5+6P6
=1p1+2p2+3p3+4p4++npn (Equation 5)
E=P/t=(1P1+2P2+3P3+4P4+5P5+6P6) /t
=(1p1+2p2+3p3+4p4++npn) /t (Equation 6)
0i1,1+2+3++n=1
Therefore, it is necessary to use internal audit, management review and periodic external
supervision to evaluate each process and determine the best corrective and preventive measures.
The continuous improvement of PDCA cycle can effectively prevent QMS from becoming rigid and
dogmatic.
(4) The fundamental for prevention in the recession period lies in correction and integration of
each process. The design of the process should be optimized according to the changing external
environment and the internal operation, in which measures aimed at risk and opportunity are being
take to fit the quality with the potential demand. With the help of large-scale data, Internet + and
other scientific and technological means, we can analyze the change of external environment and
the internal operation condition, judge whether the QMS operation can reflect the change timely
and accurately while scrutinizing the added-value of each process. correction factor can be
introduced to conduct a comprehensive revision of the process. It can be drawn based on formula 3
and 4:
225
P =1P1+2P2+3P3+4P4+5P5+6P6
=1p1+2p2+3p3+4p4++npn (Equation 7)
E=P/t=(1P1+2P2+3P3+4P4+5P5+6P6) /t
=(1p1+2p2+3p3+4p4++npn) /t (Equation 8)
Among them0i1
When =0, it means that the process has no added-value over time, which will be fully integrated
into the corresponding processes. = 1 indicates that the process still has high value after the
assessment and will be all reserved. Manufacturing industry should introduce effective reference
standard into planning process, and constantly achieves the effectiveness of the process [7].
Consequently, each process of QMS has continuous increment and big data, Internet and other
technological means are used to optimize the QMS design. Besides, drive the operational
performance by the increment audit of the external cycle and customer satisfaction and grasp the
key factor to conduct correction for the invalid or inefficient process, thus continuously
improving the performance of QMS and extend the life cycle effectively. This is also the weak link
of improving QMS and promoting high-quality manufacturing emphasized by ISO 9001: 2015.
Figure 2 is the QMS performance improvement path in the context of high-quality manufacturing.
Fig. 2 QMS performance improvement path in the context of high-quality manufacturing
4. Conclusion
Then grasp the key factor to conduct correction for the invalid or inefficient process, thus
promoting the change from "Chinese manufacturing" to "quality manufacturing". The 13th
Five-Year Plan clearly put forward the strategies of "speeding up the construction of quality power"
and Chinas manufacturing 2025 and determined the quality first principle. Manufacturing
enterprises should clearly recognize that the QMS operation has obvious life cycle characteristics.
To extend the life cycle and improve the performance, great attention should be paid to the
increment P and the increment performance E. Only when they are in a relatively high value,
QMS could maintain high performance. Thereby, the manufacturing industry use big data, Internet
and other scientific and technological means to continuously optimize the QMS design, and drive
the operational performance by the increment audit of the external cycle and customer satisfaction.
Then grasp the key factor to conduct correction for the invalid or inefficient process, thus
promoting the change from "Chinese manufacturing" to "quality manufacturing".
5. Acknowledgements
This paper is supported by National Social Science Fund Project 15BGL144, Jiangsu Province
Social Science Applied Research Quality Engineering 16 SYC-016, and Jiangsu Province
University Philosophy Social Science Fund Project 2016SJD790029, 2016SJD630086.
226
References
[1] R.Vernon. International investment and international tradein the product cycle [ J ]. Quarterly
Journal of Economics.1966(8):190-207.
[2]International Organization for Standardization, Brussels. ISO9001-2015Quality management
systems Requirements [S].
[3] General Administration of Quality Supervision, Inspection and Quarantine of the People's
Republic of China, Standardization Administration of the People's Republic of China. GB / T
19001-2008, Quality management system requirements [S].
[4] Wang Dexian, Wang Yuesheng. Operating Mechanism of the Development Strategy of the
Advanced Manufacturing Industry in America and Germany and Its Enlightenment[J],
Academic Journal of Zhongzhou, 2016, (02): 33-37.
[5]National Manufacturing Strategy Advisory Committee, the Chinese Academy of Engineering
Strategic Advisory Center ed. Quality Manufacturing[M] Beijing: China Public Information
Publishing Group, 2016, (5): 163-165.
[6] Zhou Lin. Chinese People Spent 1.2 Trillion in Purchasing 46% of the World's Luxury Goods
Last Year [EB / OL]. [2016-02-14]. Http://mt.sohu.com/ 20160214 / n437297564.shtml .
[7] (US) S Thomas Foster. Quality Management, An Integration Approach [M] (second edition).
Translated by Ke Zheng. Beijing: China People's Publishing House, 2006: 67-68.
227
Governance: Origin, Connotation and Application

Jiandang Liu1,a, Jie Tang1,b, Dong Wang1,c, Senlin Zhu2,d
1
Harbin Institute of Technology, Shenzhen Graduate School, China
2
Anhui Agricultural University, College of Economics & Management, China
a
239661842@qq.com, bjietang@sz.gov.cn, cclayton_wang@163.com, dRedForest_1994@163.com
*Wang Dong1,c
Keywords: Governance; Supervising power; Balancing power; Bureaucracy; Government's ability;

Government performance; Check of power
Abstract. The word "Governance", derived from classical Latin and ancient Greek, has been
gradually spreading across the world with the help of English culture, the World Bank, European
urban practice and academic journals. The connotation of governance has been changing along with
the change of research perspectives that mainly include five perspectives: supervising power,
balancing power, bureaucracy, government's ability, government performance. Originally,
governance was only popular in the field of law. Later, it was used in economics, sociology,
political science and other fields, becoming a bridge of interdisciplinary research.
1. Introduction
The word "Governance" in English could date back to "steering" in classical Latin and ancient
Greek, mainly referring to control, guidance and manipulation(Bob Jessop, 1999; Keping Yu, 1999).
Some scholars have traced the word back to the 16th century, more to the 18th century. At that time,
enlightening philosophy combined the liberal government with the respect for citizens, one element
of the philosophy once was "gouvernance" in French which was translated as "governance" in
English and was used in various contexts later(Jean-Pierre Gaudin, 1999). With the help of English
culture, the term "governance" has been widely used around the world and popular among the major
languages in Europe and other places(Keping Yu, 1999; Jean-Pierre Gaudin, 1999).
In 1989, the World Bank used the term "Crisis in Governance" for the first time in the report
"SUB-SAHARAN AFRICA: FROM CRISIS TO SUSTAINABLE DEVELOPMENT". Thereafter,
"Governance" was used to describe the political situation in post-colonial and developing
countries(Xue Lan, Zhang Fan, Wu Muyao, 2015; Keping Yu, 1999). Till the 90's, Belgium and
other European countries were faced with lots of challenges, such as: the fragile urban space, lack
of public houses, etc. Hence Brussels and other cities introduced new tools and mechanisms for
urban governance, such as community contracts, and strived to improve the functions of community,
to promote urban renewal and to increase urban attractiveness, which promote governance
practices(Katarzyna.M.Romanczyk, 2015).
In March 1998, facing with the rapid development and various practice of "governance" around
the world, the International Social Science Journal published a special with the theme of
"governance" for the first time, which was the iconic response from academic circles. From then on,
"Governance" has been a part of the global political science research, and has constantly
been developing(Xue Lan, Zhang Fan, Wu Muyao, 2015).
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016

228
2. Connotation of governance
A clear definition of governance connotation is the starting point for the study of governance.
According to the existing literatures, however, the connotation of governance has been changing
along with the change of different research perspectives. Thus, theres no uniform understanding of
the connotation of "governance" so far. Following the changing trajectory of the research
perspective, this paper reviews the typical definition proposed by well-known scholars and
authoritative experts, which is helpful to deepen our understanding of the connotation of
governance.
2.1 The first perspective: supervising power
Douglas North proposed a basic concept of governance---limited government that protects private
property from being grabbed by state(Daniel Kaufmann, Aart Kraay, and Massimo Mastruzzi, 2007),
which was used in the early mainstream literatures. The definition is relevant to mainstream
perspectives at that time, because political science researchers are interested in studying political
institutions that limit or check power, such as: democratic accountability and rule of law(Fukuyama
Francis, 2013). Most rational choice institutionalists agree with the assumption that states are
predatory(Mansell Olson, 1995), and the chief goal of political development is the creation of
institutions like rule of law and accountability that limit the states discretion. Among the
perspective of "supervising power", the government and the state hold and use power, while citizens,
enterprises and other non-governmental organizations supervise power, therefore, supervising
power is the primary form of "check of power".
2.2 The second perspective: balancing power
In his classical articles such as "governance without government" and "governance in the 21st
century", Rosinau(1992), one of the principal founders of the governance theory, defined
governance as: a range of management mechanisms which do not have formal authorization, but
could effectively play a role; a kind of activities supported by a common goal, the main body of
these activities may not be the government, and do not have to rely on the national force to achieve;
it includes both government and non-government mechanism. Kuhnman and Van Fleet argued that
the structure or order created by governance could not be imposed externally, but could play a role
only with the help of the interaction of various actors. Although, Rosinau, Kuyeman and others have
some differences in the specific definition of governance, they are adhering to the core
idea---balancing power---accepted by mainstream, that is, besides supervising power, governance
emphasizes balanced federal system between national and local government through
decentralization, providing opening access to encourage the development of non-governmental
organizations and citizen participation(Jean-Paul Faguet, 2013). Hence, compared with the
supervising power, balancing power emphasizes on decentralization which is the senior form of
"check of power".
2.3 The third perspective: bureaucracy
As the two perspectives above pay little attention to the institution that accumulates and uses power,
the state, Max Weber defined the ideal type of modern bureaucracy with ten aspects for the first
time, and proposed the famous "Weberian bureaucracy" in Economy and Society, that is, the
appointment and promotion based on personal merits and achievements, functional organization
structure, focusing on skill assessment, etc, which become the most classic definition of governance
in terms of procedures. Max Weber describes the ten core characteristics of the modern
bureaucracy(Fukuyama Francis, 2013): individuals are free and obey authority only within a
defined area, they are organized into a clearly defined hierarchy of offices, etc. The weaknesses of
Weberian bureaucracy include(Fukuyama Francis, 2013): firstly, fixed salaries is not compatible
with the incentives proposed by New Public Management; secondly, bureaucrats are simply robotic
agents whose only purpose is to do the bidding of principals, which means the idea of bureaucratic
229
autonomy is not possible.
2.4 The fourth perspective: government's ability
The definition above analyses state or government under system, Marcus J. Kurtz & Andrew
Schrank(2007) studied state under capacity, and defined governance as the ability of the state to
formulate and implement its goals. While Fukuyama Francis(2013) defined governance as a
governments ability to make and enforce rules, and to deliver services, regardless of whether that
government is democratic or not. Francis Fukuyama accepts Michael Mann's point that state power
is infrastructural rather than despotic, which excludes democratic responsibility from the definition
of governance. Obviously, unlike supervising power perspective that simply emphasizes the
restriction on state's discretionary power, and balancing power perspective that encourages power
decentralization, Francis Fukuyama focuses on the institution that uses power, and emphasizes on
state capacity and strong government, which is fully reflected in his new book---Political Order and
Political Decay.
2.5 The fifth perspective: government performance
Along with the maturity of the civil society in the west, the development of modern IT, and the
"top-down" bureaucracy out of date, "bottom-up", which focuses on responding to citizens
demands effectively, has become popular gradually, so governance begins to emphasize government
performance. Robert I. Rotberg(2014), an expert in political science and governance, pointed out
that good procedures and strong capacity were inputs, but not ends in themselves, governance
should emphasize outputs. Thus he defines governance as the public service supplied by
government, which stresses the orientation of result, not only a summary of citizens' needs, desires,
expectations, but also a "bottom-up" approach to define governance. Obviously, similar to Francis
Fukuyama, Robert I. Rotberg's definition also focuses on government agencies and is applicable to
different regimes. The difference is that the former focuses on government's ability---input; the
latter focuses on government performance---output(Robert I. Rotberg, 2014).
To sum up, the existing literatures have differences in the connotation of governance along with
the changing of research perspectives. Among them, both supervising power and balancing power
focus on power, and belong to check of power. The other three perspectives focus on the institution
that uses power, bureaucracy is based on system, government's ability is based on capacity,
government performance is based on output. Thus, the definitions of governance form a
complementary relationship with each other.
3. Discussion and conclusion

Originally, governance emerged as a substitute for government, and described the implementation
of the Constitution relating to "state affair", or referred to manage various defined institutions or
industries with different stake(Bob Jessop, 1999; Xue Lan, Zhang Fan, Wu Muyao, 2015). Since the
1990s, western political scientists and economists have given a new meaning to governance which
is far from government, and have extensively applied it in the field of social economy(Keping Yu,
1999).
At present, governance is still a continuous developing concept, and has been applied to
economics, sociology, political science, law and other fields, and governance itself has been
described as a bridge in cross-disciplinary research(Schuppert G F, 2007). In addition, governance
has also been used to examine the management of public affairs on different levels, which has
become a common trend in academic research, resulting in lots of concept, such as: global
governance, national governance, urban governance and rural governance.
The evolutionary history of the connotation of governance suggests that the definition of
governance is designed to describe specific practices, which is similar to Roots' point that the key to
any definition of governance is its contribution to understanding the reality(R. Rhodes, 1999).
230
Therefore, the definition of governance will be changing along with the abundance of governance
practice in the future.
References
[1] Bob Jessop, The rise of governance and the risk of its failure: economic development as an
example, International Social Science Journal(Chinese Edition), (1), pp. 31-48, 1999.
[2] Keping Yu, An introduction to governance and good governance, Marxism & Reality, (5), pp.
37-41, 1999.
[3] Jean-Pierre Gaudin, Modern Governance, Yesterday and Today: A Few Points to Know from
the French Government's Policy, International Social Science Journal(Chinese Edition), (1), pp.
49-58, 1999.
[4] Xue Lan, Zhang Fan, Wu Muyao, Research on Governance System and Management Ability:
Reviews and Prospects, Journal of Public Management, vol. 12(3), pp. 1-12, 2015.
[5] Katarzyna M. Romanczyk, Towards urban governance: Twenty years of neighbourhood
contracts in the Brussels-Capital Region, Cities, (44), pp. 1-8, 2015.
[6] Daniel Kaufmann, Aart Kraay, and Massimo Mastruzzi, Growth and Governance: A Reply,
Journal of Politics, (4), pp. 1-21, 2007.
[7] Fukuyama Francis, What Is Governance?, Governance: An International Journal of Policy,
Administration, and Institutions, vol. 26(3), pp. 347368, 2013.
[8] Mancur Olson, Trans. Chen Yu et al, The Logic of Collective Action. Shanghai People's
Publishing House, Shanghai, pp. 70-71, 1995.
[9] J. N. Rosenau, Governance without government: Order and Change in World Politics.
Cambridge University Press, Cambridge, pp. 5-6, 1992.
[10] Jean-Paul Faguet, Decentralization and Governance, World development, (53), pp. 2-13, 2014.
[11] Marcus J. Kurtz & Andrew Schrank, Growth and Governance Models, Measures, and
Mechanisms, Journal of politics, vol. 69(2), pp. 538-554, 2007.
[12] Robert I. Rotberg, Good Governance Means Performance and Results, Governance: An
International Journal of Policy, Administration, and Institutions, vol. 27(3), pp. 8-19, 2014.
[13] Schuppert G F, Governance Reflected in Political Science and Jurisprudence[C] //Dorothea J.
New Forms of Governance in Research Organizations. Springer, Speyer, pp. 3-29, 2007.
[14] R. Rhodes. Trans. Mu Yi, New Governance, Marxism and Reality, (5), pp. 42-48, 1999.
231
A Review of Researches on the Influencing Factors of Entrepreneurship

Meixia Wang
Faculty of Economics and Management, Xi'an University of Technology, Xi'an, Shaan Xi, China
389008722@qq.com
Keywords: Entrepreneurship; Economic Environment; Institutional environment
Abstract. Entrepreneurship is an important driving force to promote economic growth. Researches

on entrepreneurship are attracting more and more attention of scholars. By combing the existing
research literature, this paper mainly discusses the concept of entrepreneurship, measurement
indicators at different angles, and further from the individual characteristics and social environment
aspects of the factors affecting entrepreneurship, with a view to the field of entrepreneurship
entrepreneurs and entrepreneurial entrepreneurs with more enlightenment.
1. Introduction
There are three important schools of thought on entrepreneurship: Schumpeter, Baumol's German
School, Kirzner, Von Mises, Menger's Austrian School, and Schultz, Knight, Marshall's
Neo-classical School. Schumpeter's entrepreneurial theory emphasizes the creative destruction of
entrepreneurs, and believes that entrepreneurship is a kind of economic pioneering spirit that "new
production mix is continuously introduced", including five kinds of innovation - product innovation,
production method innovation, new market expansion, new supply of raw materials and new forms
of organization. The Austrian School of thought is that entrepreneurship is the ability to first
discover new opportunities and to grasp, the ability of entrepreneurs to use the intrinsic opportunity
to make the market back to balance. Neo-classical School of thought emphasizes the entrepreneur
as a leader, through entrepreneurial behavior to promote market equilibrium, including the "wit,
cautious, firm, decisive" and other qualities of a psychological characteristics. Among them,
Schumpeter entrepreneur theory has the greatest impact on later research. For a long time, the
nature of entrepreneurship and its mechanism of action did not really understand, many factors
involved in understanding the factors of influence of entrepreneurship, this paper studies the
influence factors of the entrepreneurship to offer reviews and comments from the individual
characteristics and social environment.
2. The influential factors of entrepreneurship

2.1 Individual characteristics
Factors affecting the individual characteristics of entrepreneurship include psychological factors
and non-psychological factors. In terms of psychological factors, successful demand, risk
preference, and vitality are the important factors that motivate entrepreneurial motivation. For
individuals, the ability to withstand risks and failures is the premise and key of individuals to
choose to become entrepreneurs. Entrepreneurs create new businesses that require some special
qualities, which plays a decisive role to succeed, such as entrepreneurial orientation, adaptive
adjustment, and access to resources, while taking risks, leadership, management skills, etc., is the
secondary quality. Entrepreneurs have a greater, more adventurous and risk-tolerant, greedy and
self-confident outlook for success than the average person, and have a better insight into the
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
232
institutional environment. Different cultural background and economic development stage,
entrepreneurs have different psychological characteristics.
Although the psychological characteristics of entrepreneurs is the key to determine the success of
entrepreneurial activities, but "psychological characteristics theory" has been a serious theoretical
and empirical challenges. Some scholars have pointed out that the difference between the
psychological characteristics of entrepreneurs is actually much larger than the difference between
entrepreneurs and non-entrepreneurs, there is no typical entrepreneurial psychological
characteristics, but no need to waste energy to looking for the so-called entrepreneurial decision
will affect entrepreneurship psychological characteristics of variables. Therefore, the
non-psychological factors have attracted more and more scholars' attention. The study shows that
entrepreneurial motivation is affected by non-psychological factors such as wealth, educational
background, occupational background, management experience, social status and age. As the initial
entrepreneurial capacity and wealth of individuals are heterogeneous, then the stronger
entrepreneurial capacity, the higher the initial wealth endowment, the ability to perceive and seize
the profit opportunities, the easier the entrepreneurial success. Personal career choice depends on
the level of management and labor skills, if the management capacity is strong, it may become
entrepreneurs, if relatively high labor skills, it may become experts or professional workers.
According to the theory of human capital, the increase of educational level will increase the
employment level of men and women and improve the profits of enterprises. Entrepreneurs with
higher knowledge level are more likely to seize the opportunity and gain higher profits in the
market competition. Of course, the importance of personal family background can not be ignored,
compared with the children of ordinary families, entrepreneurs' children usually have more
resources, higher personal ability and initial wealth, more likely to become entrepreneurs.
2.2 The social environment
Compared with the factors of individual characteristics, the factors that affect the social
environment of entrepreneurship development are much more complex, mainly related to the
economic environment, institutional environment, cultural background, population factors,
infrastructure, and so on.
The impact of economic environment on entrepreneurship is mainly embodied in economic
freedom, financial support, taxation, income level and so on. Economic freedom usually includes
government size, differential taxation and labor market freedom, etc. The promotion of economic
freedom will promote the development of entrepreneurship. Entrepreneurs need start-up capital and
management support at the beginning of entrepreneurial ventures. The entrepreneur's understanding
of the available financial support and the tolerance to risks have influenced the real
entrepreneurship. If the entrepreneur has a better financing channel, the enterprise can get more
financial support, then the new enterprise entry rate will be significantly improved, on the contrary,
restrictive financial policies will have a negative impact on entrepreneurial behavior. With regard to
taxation and entrepreneurial behavior, it is generally believed that a higher tax rate reduces the
expected return of entrepreneurial behavior, thereby reducing the entrepreneurial activity of
potential entrepreneurs. The growth of income level will increase the level of household savings,
increase the financial supply of financial institutions, entrepreneurs to provide financial support for
the activities. Expansion of fiscal expenditure will increase investment, stimulate consumer demand,
encourage entrepreneurs to engage in entrepreneurial activities.
The institutional environment is widely considered in the study of entrepreneurship, and it is also
considered as the key factor influencing entrepreneurship. Different systems can lead to different
entrepreneurial behaviors, such as productive, unproductive, and disruptive entrepreneurial behavior.
For example, property rights are the basis for maintaining the market economy, and only when the
rights and interests of entrepreneurs are protected, he will believe that their time, effort and
investment to get the appropriate returns, thus stimulating more entrepreneurial activities;
Unprotected, it will undermine the entrepreneur's enthusiasm, and even encourage entrepreneurs to
233
use their talents more for non-productive activities, resulting in more rent-seeking behavior.
Therefore, a sound system of property rights can provide enough incentives for entrepreneurial
behavior. The complexity of administrative licensing and formalities required to set up an enterprise
increases the cost of doing business and is likely to delay the fleeting market opportunity for firms
to negatively impact entrepreneurial behavior. The relaxation of government regulation has a
significant effect on the development of entrepreneurship. For example, China has made remarkable
achievements in the past 30 years. The most important factor is that the reform and opening-up
activates the Chinese entrepreneurial spirit, so that potential entrepreneurs become real wealth
creator.
As the mainstream values and beliefs, cultural background is an important factor to determine
entrepreneurship in the social environment. Scholars usually from the following aspects to study the
impact of culture on entrepreneurship: individualism, honesty, self-control, uncertainty avoidance
and so on. Hofstede's five cultural dimensions are considered to be an effective framework for
measuring cultural differences and value orientations in different countries. There is a significant
correlation between this index and the national innovation rate. In the underdeveloped countries,
individualism is negatively correlated with entrepreneurship, while in developed countries,
individualism is positively related to entrepreneurship. In addition, social beliefs and values, such as
caste system, religion, family structure and family support, are also key to the success of
entrepreneurial entrepreneurship. In short, the power of culture has been quietly integrated into all
areas of the economic, and social life, it is the birth of the invisible cohesion, centripetal force can
promote the entrepreneurial spirit, aggregation and development, and then promote economic
creativity and innovation. Although the development of entrepreneurship in China has something in
common with the United States and Europe, the influence of China's unique "relationship" culture
on entrepreneurship is something that other countries do not have.
In addition, there are some important factors that affect the development of entrepreneurship,
such as population factors, infrastructure and so on. For a region, the greater the population density,
the faster the spread of knowledge and technology, the wider the scope, the more people will benefit,
which is conducive to the creation of new businesses. Age structure is usually related to the market
capacity of a region, consumption structure, labor supply and so on, and so closely related to the
region's new business entry rate. The higher the populationeducation level, the faster and wider the
dissemination of knowledge and technology, which is conducive to the emergence and development
of entrepreneurship. For example, in the knowledge-intensive and technology-intensive industries,
the average level of education of entrepreneurs and employees is significantly higher than that of
other industries, and enterprises with more high-quality personnel are more innovative and better
able to obtain and use commercial Information, easier to identify business opportunities. Good
infrastructure is conducive to reducing barriers between regions, promote regional and
inter-industry exchanges and cooperation, with the collision of ideas and knowledge, but also to
stimulate the spark of creativity. Internet, e-mail the use of these new media than telephones, letters
and other traditional means of information dissemination can stimulate business innovation.
3. Conclusion
In summary, on the one hand, the intrinsic mental quality and external characteristics of an
individual are important factors of entrepreneurship, including the pursuit of profit of the
entrepreneurial spirit, the full allocation of resources to obtain excess profits of the innovative spirit,
the courage to take decision-making risks, the spirit of adventure, the spirit of cooperation in the
process of integrating resources, and the sensitivity to market opportunities. On the other hand, a
series of social environment will affect the formation and growth of entrepreneurship.
Entrepreneurs also use specific activities to choose the environment. The choice of environment is a
representation of the social forces of the entrepreneur group, showing the regional, cultural,
institutional and other characteristics.
234
4. Acknowledgments
This study was supported by the National Natural Science Foundation of China (Grant NO.
71603202) and the Doctoral Research Foundation of Xi'an University of Technology(Grant NO.
105-256081503).
References
[1] M. Ben-Daya, M. Darwis, and K. Ertogral, The joint economic lot sizing problem: Review and
extensions, European Journal of Operational Research, vol. 185, pp. 726-742, 2008.
[2] D. B. Audretsch, D. Heger, and T. Veith, Infrastructure and entrepreneurship, Small Business
Economics, vol. 44, pp.219-230, 2014.
[3] N. Ghio, M. Guerini, E. E. Lehmann, and C. Rossi-Lamastra, The emergence of the knowledge
spillover theory of entrepreneurship, Small Business Economics, vol.44,pp.1-18, 2015.
[4] M. Lofstrom, T. Bates, and S. C. Parker, Why are some people more likely to become
small-businesses owners than others: Entrepreneurship entry and industry-specific barriers,
Journal of Business Venturing, vol.29,pp.232-251, 2014.
[5] J. Su, Q. Zhai, and H. Landstrm, Entrepreneurship research in three regions-the USA, Europe
and China, International Entrepreneurship & Management Journal, vol.11,pp.861-890, 2014.
[6] K. Wennberg, S. Pathak, and E. Autio, How culture moulds the effects of self-efficacy and fear
of failure on entrepreneurship, Entrepreneurship & Regional Development, vol.25, pp.756-780,
2013.
[7] B. Werner, F. Oliver, and H. Stephan, The impact of regional age structure on entrepreneurship,
Economic Geography, vol.85,pp.269-287, 2009.
235
Chapter 4:
Education Science, Teaching, and Linguistics
The Application of Modern Teaching Theory in Physical Education

Zhikang Qiua, Hao Wangb,*
Physical Education Department, Qinzhou University, Qinzhou, Guangxi, China
a
185471519@qq.com,b328356299@qq.com
*Correspondence author
Keywords: Modern educational theories; Physical education; Student-centered
Abstract. The development of physical education is the basic requirement of the improvement of
the quality of the people. Our country has studied physical education for many years. In the process
of the current social reform, the theory of modern education has come into being, which has played
a positive role in the development of education. The traditional education is teacher-centered
teaching, while the modern educational theories focus on the students role, which changes the past
spoon feeding teaching to the heuristic teaching to cultivate students' personality and take the
development of students as the core. This paper mainly analyzes the influence of the modern
educational theories in the physical education teaching, and thinks that physical education should be
combined with the modern teaching theory to achieve a better and faster development.
1. Introduction
With the social economic development and the promotion of science and technology, people's
pursuit of life is also getting higher and higher, so that health has become an important part of
people's quality of life, and sports is an important way to maintain healthy. Decision on Deepening
Education Reform and Promoting Quality Education by the CPC Central Committee and the State
Council has clearly pointed out that health is the basic premise for young people to serve the
motherland and the people, reflecting the vitality of the Chinese nation. The school education
should establish the guiding ideology with health first, strengthen the school physical education
work, and on the basis of the above regulations, we must develop the physical education with
unique features. And the application of the modern teaching theories become the basic requirement.
2. Connotation of modern teaching theory

2.1 Health as center
With a long time development in our country, physical education in the past often took skills
training as the center, while ignoring the fundamental purpose. Yet, the teaching theories of modern
education believe students should establish the guiding ideology of "health first" before accepting
physical education. To make physical education combine with students' physical, psychological and
social abilities, it can not be realized by skills simply, but needs health, environment, and social
security to be concluded, which can really pay attention to students' health and guide students to
form a good health consciousness. The modern educational teaching theories think that students
should form good psychological demands in physical exercise, and only with mental and physical
health at the same time, they can better adapt to social development, which is also a prerequisite for
students to learn basic life skills.
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016

239
2.2 Student personality as center
Traditional physical education often has a more scientific system, with effective skill training, to
provide a good training for competitive sports. But this systematic, professional and standardized
teaching mode has the effect only for individual athletes, but unreasonable for most students.
Therefore, such training often stifle students' initiative in the learning process, and although
students can master some skills, but can not form a good psychological preparation, which means
they still have problem in the field of psychological acceptance. Such teaching contents do not take
into account the development of students. The theories of modern education support "all for
students, for all students, for students of all", that is to say, the students' learning content is not
teacher provisions, but the teachers provide what students want to learn, to promote students' active
learning. This kind of teaching way does not aim at the competitive sports, but provides sports
learning conditions for most groups. Meanwhile, students' personality can be fully displayed in
physical exercises. For example, some students with strong explosive force can choose basketball,
some with good endurance can choose football, and some reacting best are suitable for table tennis.
2.3 Construction of evaluating system
The traditional sports classroom has the fixed principle. After the skill practice, the test is to
evaluate the student, but the evaluating mechanism under the modern education teaching theories
should be more scientific and reasonable. It takes into account the students individual differences,
health and psychological conditions. The evaluating standards in the teaching of physical education
should be greatly widened, mainly for the development of students' personality evaluation. With the
National Physical Training Standards as the basis, the past single evaluation system emphasizing
too much about students' physical quality should be abandoned, and students' classroom
performance should be appropriately increased. With the successful experience of other subjects,
teacher comments should be added to the quality evaluation table, to effectively evaluate each
student's learning with encouraging language.
2.4 Cultivation of innovation and practice
The core content of modern teaching theory is students innovation ability and practical ability. In
order to realize that, it is necessary to follow the modern educational theory strictly. In the overall
teaching, all aspects of physical education should be coordinated with innovative teaching methods,
and teachers with a strong personality should guide the students and provide good conditions for the
development of students' personality. The main feature of physical activity is the practice, and the
focus of sports curriculum should be physical activity to improve students sports consciousness
and ability in the continuous physical activity and develop the habit of exercise. In the practice of
classroom teaching, teachers should pay attention to inspire and guide students to combine the
learning of sports knowledge and skills, to raise questions, to understand and solve the problems.
The traditional teaching content is programmed so that students are often through repeated practice
to achieve the purpose of learning, while modern teaching theories focus on the development of
students' personality so that students find their target and establish practical and reasonable
direction with active measures, to maintain students dominant position and inspire their enthusiasm.
Piaget, the famous educator and psychologist, once said that force is the worst teaching method and
education should let students themselves to remaster and reestablish and find the truth. Students'
innovation ability and practical ability is inspired and obtained in the real pursuit, but not forced.
Teachers should establish physical class with national atmosphere and creative thinking to ensure
that students can create and practice in the physical education classroom.
2.5 Valuing relation of subjects
Modern educational theories conclude the link of subjects comprehensively. The teaching of
physical education should concern cognitive factor, putting physical education to the normal life,
especially the construction of campus culture. The school extracurricular activities should be
240
enriched, various sports activities should be carried out, and the enthusiasm of students to
participate in physical exercise should be enhanced, which means that student's learning is not
limited to the physical education class, but everywhere in the campus culture. These sports can
better motivate students enthusiasm for the sports study, and students through the competition have
a sense of honor, and have a good understanding for physical exercise. In these activities, students
can also exercise their ability to adapt to society.
3. Reform of physical education under modern educational theory

3.1 Change of Teaching Values
First, the school should make clear the fundamental value of sports teaching, making students
highlight health and establish healthy value of sports learning.
Second, teachers should be separated from the previous teaching values. The students' health
should be as the core of teaching theory, to create a good teaching environment and take the
responsibility of maintaining students health.
Third, in the process of teaching, innovation should be based on the traditional teaching method
for all students, rather than individual students. We should have technical promotion and
development of personality, insisting the basic principle of "health first".
3.2 Curriculum transformation under modern teaching theory
First, the traditional, old, and backward education theory should be abandoned, as well as the
evaluation methods valuing sports performance. Teachers should actively broaden the evaluation
mode, making students select the teaching content. Meanwhile, teachers concept should be
changed to enhance students' innovative spirit and practical ability.
Second, the new curriculum should be innovated actively with student-centered teaching mode,
for the differences between students. More comprehensive teaching mode should be provided, and
in the process of innovation, the scope of physical education should be continuously extended,
involving the fields of operations, cognition, emotion and behavior, and integrating
multidisciplinary knowledge and skills. The new curriculum reform should fully mobilize students
enthusiasm, making them actively participate in activities. Students' interest in sports should be
cultivated, to set up the concept of lifelong sports. Students' quality should also be cultivated, to
improve their social adaptability.
3.3 Transition from valuing teaching methods to valuing learning methods
Like other subjects, the traditional teaching of physical education is teacher-centered, largely
ignoring students initiative, so that students are passively learning, which means that the passive
digestion has become a habit and students machinery exercise is not able to develop their
innovation ability. The modern teaching theory and lifelong learning theory pointed out that the
most important thing about teaching is to enable students to obtain the learning ability. Similarly,
physical education is not only about simple teaching skills, but to allow students to learn sports
methods, so as to promote their health through physical exercise. Therefore, the current sports class
should handle the relation between skill teaching and students personality, and teachers should
guide students to learn and create a suitable environment for the student's learning.
3.4 The diversification of the teaching methods
Traditional physical education often has a fixed program, without too much innovative teaching
methods, so that it is stereotyped and lagging. The modern education theory pointed out that
physical education should innovate the teaching methods, and actively innovate teaching methods
with various measures, to create good conditions for students' learning, enhance the quality of
physical education teaching continuously, and provide a new direction for the development of
sports teaching activities.
241
4. Conclusion
In the current educational environment, the theory of modern education has been deeply affected
school physical education. In the course of physical education, value of health first provides a good
guarantee for students health, and all kinds of sports activities on campus also provide a good
opportunity for students and link subjects closely. In addition, students' innovation ability and
practice ability in sports are also emphasized, which is of significance for students' all-round
development and is fundamental self-development. It is believed under the guidance of modern
education teaching theory, the physical education in China will be improved, to achieve leapfrog
development.
References
[1] Xing Dengjiang, Liu Guoqing. Sports Management Course [M]. Beijing: Beihang University
Press, 2004.
[2] Haihong, Pei. Curriculum Theory of Physical Education [M]. Beijing: People's Medical
Publishing House, 2001 .
[3] Peng Jie, Sun Daming, Xiang Limin. Theoretical Course of University Physical Education [M].
Xuzhou: China University of Mining and Technology press, 2002
242
Focus on Experience, Enhance Communication, Explore the New Model

of Medical Humanities Education
Can Geng 1,2,a , Guozheng Wen1,b,*

1
Inner Mongolia Medical University, China
2
Inner Mongolia University, China
a
gengcan@hotmail.com, bwgz86210@163.com
*Guozheng Wen
Keywords: Humanistic education; Humanistic spirit; Excellent physician; Teaching
Abstract. In modern society, a qualified medical student, the soft skills is as important as the
professional achievement. During the cultivation of excellent physicians, it is urgent to develop a
suitable model of medical education for medical students to face the new challenges in society. The
author believes that we should change the concept, enhance the understanding as an opportunity, from
the perspective of the human spirit to interpret new issues. Meanwhile, pay attention to the humanities
curriculum experience, make students feel empathy, to the humanistic spirit as the core to explore a
new model of medical humanities teaching.
1. Introduction
In recent years, the conflict between doctors and patients has occurred, the doctor-patient
contradiction is grim. The country more than a series of vicious injury case occurred, so that the
relationship between doctors and patients is not harmonious enough worse. As a medical college, in
addition to teaching students professional medical knowledge, how to make students more clearly and
objectively understand the doctor-patient contradiction in the real world has become an essential
research topic in the teaching of medical colleges and universities. The author, as a teacher of
humanistic education course in medical colleges and universities, starts from the teaching practice for
many years, and belives that the cultivation of humanistic spirit should be closely combined with the
new problems in the present society, and then explore the new model of medical humanities
education.
2. Organization of the text
2.1 Change the concept, enhance understanding, from the perspective of the human spirit to
interpret new issues
To enhance the cultivation of humanistic spirit and to improve the quality of medical students is a
necessary requirement for medical colleges to cultivate complex medical and health care personnel in
the new century. [1] As a modern medical student, in addition to rich professional knowledge, in the
face of new social contradictions and new problems, good professional ethics, high-quality human
accomplishment in the real world has become increasingly important. In the humanistic quality
education of excellent physicians, students can understand the relationship between doctors and
patients and social contradictions in an objective, rational and tolerant attitude is the first step to
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
243
enhance their own literacy, but also our prerequisite for exploring the new mode of humanistic
education for outstanding doctors.
However, the students' understanding of social contradictions is not achieved overnight, we need
to run through the various stages of humanistic quality education courses. In the humanities education,
the first thing that should be clear is the humanistic connotation of medicine itself. Medicine, is
undoubtedly a professional science, but it is a person to learn. Objectively speaking, as a science of
medicine itself is very young, the former scientific era of medicine is dominated by humanism. We
need to be consistent with this humanistic tradition. In the teaching of humanities education, to enable
students to realize that medical learning is also a humanistic spirit of learning, a humanistic
understanding of life and deep concern for a humanitarian practice of morality.
Based on this understanding, we can further require students to a humanistic vision of an objective
understanding and understanding of real social problems, understanding of the doctor-patient
relationship itself. Doctor-patient relationship is becoming increasingly tense, the doctor-patient
disputes continue to be one of the real contradictions can not be avoided. Doctor-patient relationship
itself should be based on a mutual trust on the basis of the doctor, the patient should face the common
enemy disease, rather than the other side. However, from the overall social environment, the
expansion of modern material desire, the relative lack of human care, the relationship between people
cold defense is a widespread social problems. [2] The implementation of civic and moral construction
also pointed out: "There are still many problems in the construction of civic morality in our country,
some areas of society and some local moral anomie, right and wrong, good and evil, beauty and
ugliness boundary confusion. Academician Zhong Nanshan also said that the root cause of the current
tension between doctors and patients lies in the lack of medical education of humanistic spirit, "do not
improve the quality of the humanities, can not solve the doctor-patient relationship." [3] In such a big
background, as the medical students themselves, to uphold their own human qualities will be
particularly important.
The reality of the humanities education situation is concering. In the past teaching experiences,
there was a widespread derailment of humanistic spirit education and practical problems. The
curriculum of humanistic quality of medical students is similar to the quality education courses
offered by general colleges and universities, and can not be interpreted from the perspective of the
medical science profession itself and the contradiction between doctors and patients in reality.
Therefore, in the course of exploring the model of medical humanities education, we should start from
the medical itself, in the humanities education curriculum of medical colleges and universities, to
guide students to experience the way of experiencing the contradiction between doctors and patients.
In the process of teaching experience, advocate reverence for life, respect for life, care for life, life, so
as to enhance students' meaning of life and the value of life in-depth thinking.
2.2 Focus on experience, to the human spirit as the core to explore new models
The humanistic education of medicine is a long-term and complex systematic project. In the current
curriculum of humanities education, most of the teaching mode adopted by the school is a large-scale
knowledge system which is centered on teachers.In the teaching, only the "humanistic care",
"humanistic spirit", "humanistic quality" and other core content as a knowledge, conceptual teaching.
The focus of teaching also stays in the ideological education, the completion of the task of teaching
indicators.However, the humanistic spirit of education, in essence, should be the real "human"
emotional experience for the subjectivity of learning. This idea should run through the entire medical
students in the process of humanistic education. Specifically, the author believes that the humanistic
spirit as the core to explore new teaching model can start from the following aspects.
2.2.1 Theme-oriented, guide students to explore the humanities spirit
To begin with, according to the different curriculum, humanities teaching content can be extracted for
different themes, such as life, care, love, communication, as a basis to guide students to explore. At
the same time, we can break the limitation of discipline, from the medical history, medical ethics,
244
basic knowledge of medicine and other aspects of research.In the course of the discussion, on the one
hand, we need to integrate the medical ethics education of traditional Chinese medicine, Bian Que,
Hua Tuo, Sun Simiao, Li Shizhen and so on. As a new era of medical students, it is of course
necessary to inherit and carry forward the legacy of their ancestors left behind. [4] Advocate students
to self-exploration and reflection on the theme. On the other hand, combined with the reality in the
context of globalization, we can introduce the content of humanistic care in western civilization and
guide the students to access information, form opinions, express their opinions freely.
2.2.2 Problem-oriented, guide students to understand the reality of the human spirit
Problem-oriented, to guide students to find problems in the course of solving problems, enhance
self-quality. Medical students of professional learning in the final analysis, or to face the
patient-oriented society. Therefore, in the course of humanities education should be implanted in the
real social problems, students thinking, problem-solving ability. The implantation of such social
problems should not only stay in the textbook level, but should be more, as soon as possible so that
medical students themselves to discover and experience.
For those practical problems, teachers can guide students to present in a variety of ways, such as to
the hospital in a documentary manner to shoot mobile video clips, the use of new media to find a
typical case of contradiction between doctors and patients. In the course of humanistic education, it
should be the practice of the part of the most realistic problem of doctors and patients presented, and
guide students from the perspective of humanistic culture. In particular, it is required to change the
role to experience, change perspective to think. In the course of discussing countermeasures, we can
combine the "care, respect, understanding and conscientiousness" of the humanistic spirit with the
medical discipline itself, so that students can realize that good medical ethics, good communication
skills and superb medical skills are equally important. [5]
2.2.3 Communication-oriented, enhance changing awareness, recognize the humanistic spirit during
practice
Doctor's career ethics is save life, but the face of life every day, the pain of the disease, is difficult in
no doubt. This hard work also makes many physicians appear numb in the face of the patient. Medical
care is a special kind of service. In the reality of the serious asymmetry of doctor-patient relationship,
in advocating the return of humanistic spirit, we should clearly understand that only by virtue of
human knowledge to explain and teach students to a rigid requirements and can not achieve the
desired Effect. This teaching model to the end is often a mere formality of indoctrination.
For patients to understand and appreciate, we should have a variety of forms to explore. For
example, periodic social surveys, hospital visits, the students went to the middle of the field survey of
patients, through direct questionnaires or a way to conduct a practical exploration of the problem. In
the process of investigation, students in the learning stage and patients can have direct communication
and dialogue to solve the difficult problem of communication.The second class is set up to guide the
students to rehearse the real mental state of the patient and to stimulate the corresponding humanist
spirit to reflect on the real case of doctor-patient relationship, rehearsing small drama and
psychological drama.In short, through the exploration of new teaching mode, to enhance the initiative
of students in the humanities classroom, to mobilize the enthusiasm of students to explore, so that the
humanistic spirit of education into a real experience.
2.3 To broaden the channels for the humanistic spirit of education into vitality
2.3.1 From the curriculum set up, open up the humanistic spirit of learning space
As the humanistic spirit in medical education has become increasingly prominent, we also more
deeply aware of: Medicine is not only intellectual science, but also an anthropological sense of culture,
has a profound and obvious cultural markers. Medicine is not only a comprehensive system of
knowledge, technique and skill combined with knowledge and technology, which is always based on
a certain philosophy and methodology, and is constantly absorbed by other scientific achievements.
245
Medicine is not only a kind of knowledge and scientific ideology, but also a social organization. The
essential characteristics of medicine, laid the foundation of its humanities and social sciences. "[6]
Therefore, as a medical school in order to enhance the quality of their own humanistic
accomplishment, we should further adjust the professional curriculum, strengthen the proportion of
the humanities curriculum, pay attention to the combination of scientific and feasibility.Such as
university Chinese, philosophy, medical history, Chinese traditional culture, speech and eloquence,
psychology, ethics, aesthetics, interpersonal communication, rituals, law and other humanities
courses, to ensure that the humanities core courses in the rational and appropriate elective courses, So
as to broaden the channels for medical students to experience the human spirit, to provide students
with more choices and opportunities.
2.3.2 From the characteristics of medical education, humanistic education will be carried through
Medical education and other undergraduate education is obviously different, it has its own clinical
education stage. This stage is the medical students to finish the school's basic, theoretical knowledge
of medical knowledge, access to hospitals and society, the face of the patient's run-in stage. Due to the
great difference and change of the environment, from the single learning type to facing the realistic
environment, the medical students not only face the challenge of professional knowledge, but also the
psychological challenge in the clinical stage. At present, the medical education for medical students
only stay in the early stage of school education, to the clinical stage. When students face the social
contradictions, the humanistic spirit of the education fault. Medical education for medical students,
should always run through medical education. Students entering the clinical stage, facing new
problems, we should also have regular courses or exchange activities to help students face new
problems, new environment, humanistic and humanistic interpretation of social issues.
References
[1] Li Xinfu, Difficult to see a doctor, see a doctor expensive - about medical care reform and seek
the end, repeatedly changed the heavy thinking, Int. J. Journal of Chengdu University of
TechnologyPhilosophy and Social Sciences Editionvol.4, pp. 62, 2012.
[2] Li Wenting, Zhao Bang, Reflection on the Return of Medical Humanistic Spirit, Int. J. Health soft
science, vol.10, pp. 632, 2013.
[3] Zhang Na, The Elimination and Return of the Humanistic Spirit - Reflections on the Construction
of the Socialist Core Value System, Fudan University Academic Papers, 2010.
[4] Zhu Wanyu, Study on the Lack of Humanistic Quality Education for Medical Students, Int. J.
Quality Education Forum, vol.2, pp. 16, 2008.
[5] Fan Yanhong, Dong Hui, Wang Haichang, On the Quality Education of Contemporary Medical
Students from the Perspective of Doctor - patient Relationship, Int. J. Chinese medical ethics,
vol.21, pp. 20, 2008.
[6] Du Zhizheng, The Rise of Humanities and Social Medicine and Its Historical Mission, Int. J.
Medicine and Philosophy, vol.18, pp. 508-513, 1997.
246
Research on Engineering Practice Teaching System of Civil Engineering

and Architectural Specialties Based on Interactive Network
Bailing Zhoua*, Donghua Liub, Entian Qiec
School of Urban Construction, Wuhan University of Science and Technology, Wuhan, China
a
cps.zhou@gmail.com, bliudonghua@wust.edu.cn, cqieentian@wust.edu.cn
*Bailing Zhou
Keywords: Practice teaching system; Interactive network; Civil engineering; Architectural.
Abstract. This topic makes full use of the convenience, real-time and terminal features of interactive
network system (Internet and mobile phones, tablet PCs and other mobile intelligent terminal) and the
personalization features of terminals, networks, content and applications, so as to constructing the
engineering practice teaching system of civil engineering and architectural specialty under the
background of credit system.
1. Introduction
Engineering practice teaching of Civil Engineering and Architectural specialties is an important link
in cultivating high quality engineering talents with innovative consciousness, which mainly consists
of cognitive practice, production practice and graduation practice. The shortage of teaching resources
in Colleges and universities became more and more serious after college enrollment expansion in
1999, so that the engineering practice teaching in Colleges and universities began to adopt
decentralized mode. The research on engineering practice teaching in Colleges and universities has
been paid more and more attention by the educational circles, which focus on the comparative
analysis of decentralized practice and centralized practice (Liu Ying, 1995; Xin Zhanli, spring 2000;
Ji Chunyi, 2004).
With the change of time and space, the talent training in Colleges and universities in our country
pays more attention to individuation and diversification. College personnel training model gradually
changed from academic year system to credit system, which lead to practical teaching flexibility and
dispersion in time and space became so clear. Our research focus shifted to practical teaching quality
monitoring. In recent years, we focus on the construction and application of network practice
teaching management platform (Li Nan, 2010; Tong Shaojuan, 2012; Xu Jin, 2014). The overall trend
of the study attaches equal importance on systematic research and special research. The former
focuses on domestic different types of institutions (undergraduate and higher vocational education,
the subordinates and the local colleges and universities etc.), the latter focuses on specific problems of
different types of professional (such as medical, normal, civil class, etc.).
This topic makes full use of the convenience, real-time and terminal features of interactive
network system (Internet and mobile phones, tablet PCs and other mobile intelligent terminal) and the
personalization features of terminals, networks, content and applications, so as to constructing the
engineering practice teaching system of civil engineering and architectural specialty under the
background of credit system. This study involves teaching design, organization, implementation and
management, assessment and other aspects. We find that there is more research on a single angle. and
combining credit system, interactive network, engineering practice training to explore the
reconstruction of teaching system is relatively rare from the existing literature.
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016

247
2. The role and significance of this research project in promoting teaching work and
improving teaching quality
1) Based on the Internet and mobile intelligent terminal (mobile phone, tablet computer, etc.), this
paper constructs the integrated engineering practice teaching system. We can effectively solve
contradiction between the construction/design internship enterprises scattered, specific
circumstances and limited number of teachers. We can effectively change the current situation that
teachers, students and field technicians are difficult to interact in real time. We can effectively solve
the problem of single assessment methods. Through these means, we can effectively improve the
efficiency of practice, ensure the quality of teaching.
2) The research results provide basis for the evaluation of practice teaching based on big data.
3) The research results will further promote the integration, networking and standardization of
practice teaching process management, providing a new perspective and reference for the design and
implementation of network distance education system.
4) The research results will promote the reform of engineering practice teaching and strengthen the
innovation ability training of students. The research results provide the basis for the development of
the professional training plan of civil engineering and architectural specialty, which to meet the needs
of local social and economic development. And provide basis for the construction of high level
engineering practice teachers.
3. Project implementation plan

The practical teaching of civil engineering and architecture majors includes curriculum practice,
engineering practice, professional quality training and professional skills training and so on. Their
engineering practice mainly consists of three parts: cognitive practice, production practice and
graduation practice. Civil engineering and architectural majors enrollment continues to expand since
2004 with the leapfrog development of the construction industry. College teaching resources (such as
teachers, internship site scale, number of internship bases and internship funding) are seriously
inadequate, which lead that there are many difficulties in centralized internship arrangement.
Therefore, colleges and universities generally use decentralized practice.
The current three stage model (mobilization / internship / summary) regards engineering practice
as a teaching process rather than a single teaching process, which part solves the problems of
short-time practice that becomes mere formality. But still fail to make full use of the advantages of the
network in supporting interpersonal communication and resource sharing. This leads that resource
management is relatively backward, it is difficult to further improve practical teaching quality, and
assessment form is relatively simple.
(1) Personalized customization of engineering practice teaching plan based on interactive network
platform.
We use interactive network teaching resources to introduce the general situation of the domestic
and foreign construction engineering design, construction, equipment installation, site management,
post operation etc. through a variety of ways of playing picture and video. So we can guide students to
combine individual wishes and industry trends to select internship enterprises and develop
individualized and diversified internship programs and internship programs.
(2) Simulation practice under interactive network platform
We can construct virtual practice platform with Combining with virtual reality technology and
computer simulation technology, introducing or developing the virtual practice software. And the
virtual practice platform was constructed on the basis of "urban and rural construction and
environmental development practice teaching center", which we use as a leading preparation for off
campus internship.
(3) The whole process management of engineering practice teaching based on interactive network
platform
248
In recent years, with the development of network technology and popularization of mobile Internet,
application and network technology in the actual production and life is more extensive: most of the
internship sites are equipped with computer and network access(most of them have broadband
networks, while companies in remote areas take dial-up internet access). Most students who can
basically achieve mobile internet carry laptops or smart phones with one. It seems that we have basic
conditions for the application of network technology in decentralized practice teaching.
Since students scattered in various internship sites, teachers are difficult to guide one by one
on-site. And the specific situation of each site is different: for example, some sites do concrete works,
some do steel structure, some are under construction, some are ongoing superstructure construction.
Students can promptly feedback the scene, upload the site drawings, photos and construction
technology by using network technology. Teachers for each student to establish an internship file
without the need to be able to guide the internship site. Interactive feedback between teachers and
students can be in real time quickly, which achieving "one to many" teaching.
In addition, network technology can not only achieve real-time interaction between teachers and
students, but also achieve interaction between students and students. Some students participate the
same kind of project in different internship site, so they can exchange learning experience and grow
together through the network. We observed that the interaction between students and students was
more active than communication between students and teachers. Students' initiative in learning is
stronger, which can greatly improve the effect of practice teaching.
Distributed internship time is generally longer (3 months or more), and construction practice site
and university classroom is different. These caused the original teaching program can not be
implemented, due to a variety of subjective and objective reasons. For example, some of the
construction sites can not start due to climate reason. These conditions cannot be predicted before the
internship,. We can't afford to have more hands than needed, more equipment that kept on idling.
Some students encounter this situation at a loss, some students have negative coping, idling during
the internship and wasting precious time for study. We can't afford to have more hands than needed,
more equipment that kept on idling. Teachers will be able to understand the changes in the scene, and
timely communication with the construction site personnel so as to adjust teaching program through
the network. In short time of abnormal circumstances, teachers can guide students to see drawings,
collate information; if encounter a long time without work to do, teachers can help students to contact
other construction site.
(4) Diversified process assessment method of engineering practice teaching based on interactive
network platform
We ask students to upload internship logs and photos in real time to build a "practice teaching
electronic archive" containing text, pictures and videos. Teachers generally require students to hand
written daily practice log in traditional decentralized practice teaching process. Students summarize
practice report according to practice after the end of the internship. "Internship log" and "internship
report" are important basis for assessing student internship results. Students usually handed in
"internship log" and "internship report" to the teacher to check in the 1-2 weeks after the end of
practice. Some students do the work daily, but write memoirs after back to universities. These cause
the lack of content, even some students copying the previous "practice log". With network
technology, the teacher can ask students upload internship log every day o every two days.
"Internship log" is not only a written record, should also include internship photos and even video.
Teachers can check the students daily internship log to master student internship. The electronic
version of the practice log can be archived directly after the internship, so we will establish teaching
practice electronic files contain text, pictures and video. Teachers will take these records as the most
important basis for practice evaluation, and effectively avoids the fraud practice log.
4. Summary
Practice shows that the application of network technology is more and more important for ensuring
the realization of teaching purpose of the practice teaching of civil engineering and architecture
249
specialty and ensuring the effect of practice. We introduce modern network technology into
engineering practice teaching, which can realize the instruction of one to many and solve the
contradiction between the large number of students, the scattered site and the limited number of
teachers. Teachers can also communicate with students in real time to achieve real-time supervision
and guidance. We establish electronic teaching archives, improve the objectivity and impartiality of
practice performance evaluation through the interactive network technology. With the development
and popularization of interactive network, the network will play a more and more important role in
the engineering practice teaching of modern civil engineering and architecture specialties.
5. Acknowledgement
This research was financially supported by Year 2011 the "Twelfth Five Year Plan" of Educational
Science in Hubei Province (2011B446) and Higher Education Teaching Research Project in Hubei
Province: Research on Practice Teaching Quality Control of Civil Engineering Specialty Based on
Web-App (serial number: 2015225); Research on Engineering Practice Teaching System of Civil
Engineering and Architecture Specialties Based on Interactive Network (serial number: 2016241).
References
[1] ZANGKan, Research on the application of network in decentralized practice teaching Journal
of Higher Education Vol. 13(2015), pp. 150-151.
[2] ZHANG Yongjun, Multi subject practice teaching process management and its information
platform construction Software Guide Vol. 7(2013), pp. 51-52.
[3] K. Kamaleswaran; S. Prabhakaran; P. Harinath; M. Damini; V. Kirubakaran, Capacity Building
On Energy Conservation In Rural Industries: A Case Study IEEE, 16154443, Mar. 2016, DOI:
10.1109/ICEES.2016.7510659.
[4] Information on https://en.wikipedia.org.
[5] Information on https://www.pikeresearch.com/.
250
Researching on the Reform of Physical Education Course in University

of Applied Technology
Wenbiao Ma
Tianjin Chinese and German Applied Technology University, 300000, Tianjin, China
Lyz20141011@126.com
Keywords: Applied technology university; Physical education curriculum; Reform research
Abstract. Physical education is the traditional teaching subjects, which occupies a very important
position in the education system structure. The quality of the curriculum development is directly
related to the formation of students' physical quality. The paper takes the application of Technical
University as an example, discussion and Analysis on the subject of the reform of physical education
curriculum, and according to the new education development situation, proposing the development
direction of physical education,In order to provide readers with reference, and strive to
comprehensively improve the quality of physical education in the University of applied technology.
1. Introduction
Applied technical university is different from the academic, research and technical universities, the
requirements of the practical application ability is very high, compared to the other comprehensive
local university, applied technology university to focus on the implementation of training in the
application of technical talents, its peculiar properties and characteristics of the decision in the
development of physical education curriculum, not only to improve the physical quality of the
students, more should focus on the occupation the characteristics of teaching, so as to provide the
corresponding service to students' occupation career. In view of this, in the current education reform
background, perspective of application technology university educators should be related to the
development of the times, based on the development needs of the current students, from teaching
methods, teaching objects and other aspects, seeking a breakthrough in physical education curriculum
reform, in order to give full play to the sports curriculum teaching in improving students' physical
quality, occupation ability the role of sustainable development, to meet the requirements of talent
cultivation of Applied Technology University.
2. Investigation and analysis on the present situation of physical education curriculum in

University of Applied Technology
Applied Technology University to the application oriented, technology oriented research oriented to
the work of the main, multi coordinated development.This school characteristics and talent training
orientation also decided to attend the university students need to have good physical quality, in order
to meet the needs of their own employment development. As the traditional basic courses of physical
education curriculum, through participation in sports training, can not only strengthen the body,
enhance the physical fitness of students, can also exercise their minds and make their physical and
mental health.And students only through physical exercise, enhance physical fitness and function, in
order to better further study, in order to better qualified for the job.
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016

251
Based on this, this thesis designs a questionnaire survey activity on the basis of the sports scientific
research methods, and makes a survey about the school's physical education curriculum development,
and based on this, further deepen the construction of sports education.This survey mainly for students
and physical education teachers group, the average age of teachers in the 45 years of age, a total of 20
teachers (special part-time) participated in the survey, the teacher education are undergraduate
education and above; Application technology university students about 13000 people, a total of 1000
questionnaires were issued to the students, the form of questionnaires were distributed in the field, the
field recycling, the questionnaires were issued with the number of recycling, can be used as an
effective questionnaire.
Table 1 :Survey on the contents of physical education courses in the University of Applied Technology
Course content Open or not
football
Tennis
Athletics
Aerobics
basketball
Volleyball
Table Tennis
badminton
martial art
Yoga
swim
pulley
Tai Ji
Notes: Table V said have been opened, Said not to open

From the data in Table 1 can be seen, the current set of Applied Technology University Physical
Education Curriculum is the basic project of sports, the traditional occupation ability of students is
relatively concentrated, professional sports is not in the curriculum teaching goal has been well
presented, which is obviously not conducive to student occupation development in the future.
Table 2:Survey on the teaching of physical education theory course in the University of Applied Technology
content of courses Open or not
Sports health knowledge, health knowledge
Special sports technology, competition rules
Principles of fitness and exercise
Knowledge of health care and health care
Physical fitness evaluation method
sports culture
Physical mental health
other
Notes: Table V said have been opened, Said not to open
From table 2 shows that the application of technical college sports theory teaching mainly focus on
sports special action techniques, contest rules and sports knowledge, basic knowledge of sports
teaching in the basic theory, teaching content very limitations involved, almost no open and applied
technology university running characteristics related the theory of curriculum.
252
Table 3:Survey on the academic setting of the physical education curriculum in the University of Applied Technology
classification Academic year Term / year (a) Class hours / term Credits per
(year) (hours) semester (points)
Specialty 2 2 20 1
Undergraduate 2 2 32 2
Table 3 survey data show that the application of technical college class every year 2 semesters,
each semester 20 hours, credits each semester for 1; undergraduate classes per year 2 semesters, each
semester 32 hours, credits each semester for 2 points. As a basic course of sports course, at the same
time by the special effects in the basic courses by nature, the effect will be the common professional
class, class is compressed. Therefore, we need to re-examine the relevant documents of the state set
applied technology university physical education curriculum, the all-round development of students
with occupation, now the number of teaching hours, the need to increase.
3. Approaches to the reform of physical education curriculum in University of Applied

Technology
3.1. Set up scientific curriculum system
3.1.1 Physical education curriculum development diversification
In order to meet the needs of the development of new education, university education should focus on
the full range of comprehensive personnel training. And for the application of technical college sports
courses, to meet the requirements of this development, it is necessary to start from the course
construction, to achieve a diversified, personalized development. Of course, due to the existence of
certain professional development differences between the application of technical universities and
regular universities, it is necessary to take into account the professional development of students in
the curriculum of physical education.Therefore, in the school sports curriculum, in order to ensure the
comprehensive development of college students, not only set up to enhance the physical quality of
students of physical education curriculum, to set up more about students' psychological and exercise
the will of course, to meet the needs of the development of students' personality.
3.1.2 Special subject of physical education course
In order to meet the development needs of students of different professional employment, application
of university physical education curriculum but also to topics presented to students of different majors,
their aptitude, to ensure the objectivity of university sports in the light of its general trend,
comprehensive teaching. First, students can according to their own professional development and
personal hobbies with their special physical education curriculum, to make their own self
breakthrough in special physical education curriculum, the realization of self value, so as to enhance
physical fitness, exercise will purpose. Second, due to part of the students' physical quality, they are
some difficulties in sports training. For this part of the students, schools can give them care and set up
separate sports curriculum of mental health class, so that they can get rid of physical and mental
problems, to achieve a breakthrough.
3.2. Forming characteristic of physical education teaching mode
On the current situation of the development of higher education in China, the reform of physical
education curriculum has gradually become one of the important contents of the strategy of
developing the country through science and education. Therefore, in order to comply with the
development trend of the strategy of rejuvenating the country of our country, the application of
technology in the process of university sports curriculum reform, according to the guiding document
of the development of creative education, from the shackles of the traditional teaching concept, in the
implementation of teaching activities to establish "student centered" and "student-centered" the
253
teaching idea, form their own characteristics of teaching mode.First of all, teachers need to intensify
efforts to mobilize students' autonomous participation in the initiative, the basic theory about
knowledge on physical education curriculum, to carry out effective teaching activities, to ensure that
students can master the basic in the learning activities of physical exercise skills, to highlight the
importance of physical education curriculum in the exercise of the will of the students. Secondly,
teachers should according to different levels the level of the students, the design of classroom
activities, provide corresponding learning platform for different levels of students can benefit from
learning in sports. For example, teachers can often organize the students to carry out some simple
games, and provided generous incentives to encourage students to actively participate in, In order to
active classroom atmosphere, enhance students' interest, improve students' classroom participation. In
addition, teachers can also in the process of teaching, as a form of physical training situation, to enable
students to receive training in the experience of the story. The students generally afraid of endurance
running, I often turn to endurance running game, fun, make the students happy the game activities,
wandering in the interesting story, complete the teaching goal.
3.3. Constructing a reasonable course evaluation system
Physical education is not a simple practical course, it is related to the development of students'
physical quality, especially in the application of Technical University of physical education, it is to
serve the development of College Students' professional ability.To this end, the school should realize
the diversity of teaching evaluation, comprehensive development, focus on the students'
comprehensive ability of sports test.First of all, from the school to bound the traditional evaluation
mode of curriculum implementation, evaluation of student learning results to the development
process of student evaluation transformation; transformation evaluation theory knowledge and skills
of simple to the comprehensive evaluation of students sports ability; from passive acceptance of
students assessment to students active participation in the evaluation process of transformation. In
addition, the school should build a dynamic the evaluation model of comprehensive students sports
specific performance, health score, physical quality scores and grades, realize the evaluation model,
the evaluation index system of diversification, the era of development.
4. Conclusion
In summary, the higher education system gradually adjust and improve the environment background,
the sports course teaching of Applied Technology University can keep up with the times of the train,
promote the reform and innovation of the curriculum, has become an important issue facing the
educators. Meet the demand for the development of innovative education guidance documents of
application technology in college students the teaching staff should, according to the development of
the school, to build a new education system, higher technology applied talents with the development
and cultivation of sports literacy cohesion.
References
[1] Wu hui-Chao, Innovation of physical education teaching mode based on physical ability and
professional double demand, Contemporary sports science and technology, vol.11, 2015
[2] Xia chun-Feng, Reform and practice of the project oriented teaching of physical education course,
Contemporary sports science and technology, vol.31, 2014.
[3] Wang Ying, Construction and Countermeasures of physical education teaching content of
different vocational positions in science and Engineering Colleges--Take the mechanical
engineering major as an example, Fight (Sports Forum), vol.7, 2014.
254
Risks Evaluation of Occupational Health and Safety in Accordance with

OHSAS 18001:2007 in Educational Domain
Adela-Eliza Dumitrascu1,a,*,Dorin-Ion Dumitrascu2,b

1
Transilvania University of Brasov, Department of Manufacturing Engineering, 5 Mihai Viteazul
Street, 500174 Brasov, Romania
2
Transilvania University of Brasov, Department of Automotive and Transport Engineering, 29 Eroilor
Street, 500068 Brasov, Romania
a b
dumitrascu_a@unitbv.ro, d.dumitrascu@unitbv.ro
Keywords: Occupational health and safety; Risk factor; Education; Evaluation matrix; OHSAS
18001:2007
Abstract. In this paper are presented the methodology of the risks assessment on occupational health
and safety at educational workplace. The case study refers to the evaluation the severity of identified
risks factors at workplaces and their consequences based on risk matrix. Also, it was identified a
hierarchical order of the main risks factors. The results of evaluation indicate the level of security for
analyzed workplace. In this respect, there are implemented the proposed corrective measures for the
factors to which the risk exceeds the level of acceptability.
1. Introduction
Risk management is activity directed towards the identification, assessing, mitigating to an acceptable
level, monitoring and control of risks. In some cases the acceptable risk may be near zero. Risks can
come from accidents, natural causes and disasters as well as deliberate attacks from an adversary [1],
[2].
Occupational Health and Safety Management System is a simple and effective way for companies
to manage health and safety.
The management representative is responsible for ensuring that the quality policy is understood at
all levels at the company. The quality policy is reviewed when:
The effectiveness of the management system being reviewed at management review meetings;
Development of activities;
New goals and objectives are being set.
Health & Safety law requires employers to look after the health, safety and welfare of their
employees. They must also consider others who could be affected by their work, for example clients,
contractors and visitors to their premises.
OHSAS 18001:2007 was designed to be compatible with ISO 9001 and ISO 14001:2004. This will
be helpful if we want to design, implement and operate an integrated quality, environmental and
occupational Health and Safety Management System.
The effectiveness of OHSAS 18001:2007 implementation depends on many factors, including: the
size of organization, the location and the nature of organization, the complexity of activities and
processes, the training, skills and abilities of human resources, the occupational health and safety risk
factor of the organization, etc.
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
255
Assessing the level of security is a systematic examination of all aspects of work undertaken to
determine the sources that may cause bodily harm, constituting the basis for substantiation of
preventive measures and control risks. Also, assessment should be structured so as to cover all
relevant hazards and risks at the workplace regarding occupational health and safety.
2. Methodology of risk evaluation of accidents and occupational health

The methodology of risks evaluation consists of process identification of all risk factors examined at
the workplace, evaluation, monitoring and control of identified risks in order to minimize their effect
in terms of severity and likelihood of predictable consequences.
The method includes the following steps presented in figure 1.
Fig. 1. The assessment of risks factors

The result of evaluated risk factors regarding accidents and occupational health are classified in
seven security level for a workplace and it is inversely proportional to the level of risk.
There are several variations on this matrix that can be found in the literature [3].
The scale of risk assessment (risk matrix) combination of severity of consequences and probability
of occurrence is presented in figure 2. The identified risks factors for the workplace are analyzed
based on the following risk matrix.
Steps necessary to assess the safety work in a system described above is performed using the
following work tools [4]:
- List of identification of risk factors;
- List of possible consequences of the risk factors on the human body;
- Scale quotation seriousness and potential consequences;
256
- The scale of risk assessment;
- Scale of employment levels of risk and levels of security;
- List of proposed measures.
Fig. 2. The risk matrix
3. Case study
The risks assessment consists of evaluation of accidents and occupational health at the laboratory
from our university. The overall level of risks calculated for workplace is 3.4 (see figure 3):
35
ri Ri 1(7 7) 1(5 5) 4(4 x 4) 24(3x3) 5(2 x 2) 374
Nrg 5 i 1
3.40 (1)
35 1x7 1x5 4 x 4 24x3 5 x 2 110
ri
i 1
Fig. 3. Overall level of risk
257
This value falls within the category of jobs with low level of risk to the environment. The result is
specified by Assessment sheet, which is observed that the total of 35 risk factors identified, only 6
above, as part of the risk, the value of 3, one falling into the category of factors maximum likelihood,
one falling into the category of high risk factors and 4 others falling into the category of medium risk
factors.
The 6 risk factors that are unacceptable are:
- F12 (the partial risk - level 7) by the direct shock: the unlinking cables, achieve accidental
elements remaining under tension, the accidental breaking of conductors LEA on the same route, to
manoeuvre the station and wrong positions;
- F13 (partial risk - level 5) electric current: the electric shock by indirect, emergence voltage
step;
- F17 (the partial risk - level 4) lower air temperature in cold season;
- F24 (the partial risk - level 4) dynamic effort: work manual digging, clearing, handling and
manual cable positions and forced to work in the vicious landfill;
- F31 (the partial risk - level 4) travel, stops in dangerous areas: the ways of auto access; the task
of lifting;
- F35 (partial risk - level 4) of non-protective equipment in laboratory (personal protective
equipment).
To reduce or eliminate the 6 risk factors (which are unacceptable in the field), are necessary
measures presented in the generic sheet of proposed measures to workplace. As regards the
distribution of risk factors generating sources, the situation is as follows:
- 42.86% factors for devices;
- 20.00%, environmental factors of own workplace;
- 8.57% factors for own workplace;
- 28.57% factors for own worker.
4. Summary
Implementing an OHSAS 18001 management system will benefit in:
- reducing risks factors of accidents and occupational health;
- a safety workplace;
- compliance with legal requirements;
- improving performance of employers.
The advantages of the OHSAS certification for an organization are:
- Achieving the occupational health and safety by eliminating and/or by reducing the potential
causes of professional accidents and sickness.
- Ensuring the organizations control over the dangers, accidents and risks of the employees at
work.
- Fulfillment of potential auction criteria.
- Reducing the work incidents and accidents that involve the organizations legal liability.
- Improvement of employees labor conditions.
- Effective planning of the activities at the place of work.
- Increasing the employees awareness regarding the importance of safety at work and of their
own physical and mental health.
- Increasing employees motivation and communication by participating within the process
constant improvement and of reducing the risks at the place of work.
- Improvement of the relations with industry and regulatory bodies.
- Improvement of business image, marketing and competitiveness by means of a management
system acknowledged through certification.
258
5. Acknowledgement
We are grateful to Transilvania University of Brasov for financial support.
References
[1] A Practical Guide to Risk Management. The NASA ASIC Guide: Assuring ASICS for Space, Jet
Propulsion Laboratory, California Institute of Technology and National Aeronautics and Space
Administration, 1993.
[2] N. Brsan-Pipu, I. Popescu, Risk Management. Concepts. Methods. Applications. Transilvania
University Publishing House, Brasov, 2003.
[3] C. Alexander, E. Sheedy, The Professional Risk Managers' Handbook: A Comprehensive Guide
to Current Theory and Best Practices. PRMIA Publications. ISBN 0-9766097-0-3, 2005.
[4] A. Nedelcu, A.-E. Dumitracu, L. Cristea, The Importance to Evaluate Risks of Occupational
Health and Safety. International Conference on Instrumentation, Measurement, Circuits and
Systems (IMCAS09), pp. 79-82, May 20-22, Hangzhou, China, 2009.
[5] SR OHSAS 18001:2008, Occupational health and safety management systems.
Requirements, ASRO & Bleu Project Software, Bucharest, 2008.
259
Analysis of Situation of China's National Defence Education
Ming Xu1, Xingyong Luo1, Yuanyuan Wang1, Guoyu Xu2,a,*, Mei Ye3,b
1
Air Force Logistics College of PLA, Xuzhou, 221000, People's Republic of China
2
Kewen College, Jiangsu Normal University, Xuzhou, 221000, People's Republic of China
3
JiuLiShan experimental school, Xuzhou, 221000, People's Republic of China
a
KJHQXM@126.com, b565885848@qq.com
Keywords: Defense education; Defense research; Defense system
Abstract. The peculiar character of a country and the policies being followed decide the type of
national defense. This article mainly analyzes the domestic situation which our country faces, the
defense education organization structure, explore how to reform of the national defense education, the
integration of national defence education system with Chinese characteristics and to build a powerful
people's army for future tasks.
1. Introduction
China need to improve the capacity of the national defence education in our country.The China is
faceing domestic environment faced by china's national defence development. At the same time, the
concept of national defense education system with Chinese characteristics, it does not instigate any
arms race. To meet the challenges of modern era is the hallmark of national defence education. It lays
a good foundation for recruitment in armed forces. In order to build a strong national defence army,
the national defence education system must be scientifically and comprehensively developed.
2. Domestic environment faced by china's national defence development

To do a good job in national defence education, we need to consider not only the international
environment but also the domestic environment. Analysis of the domestic environment, especially
since the cold war, reveals that China's national defence development must be considered holistically.
2.1 The state attaches great importance to the building of national defence
Since new China has been founded for more than half a century. The communist party of China has
devised objective laws for economic development and national defence development. So we have
accumulated the rich practical experience, and achieved fruitful theoretical results. Our country was
facing two important tasks. One is to speed up the development of production, the national economy
to recover from the rubble of war, and the other is to strengthen the national defence development,
safeguard the socialist state power. Comrade Mao Zedong policies pursued development of China in
both directions.
The Chairman Hu Jintao pointed out the relationship between the national defence development
and economic development. He emphasised coordinated development of national defence building
and economic development.
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016

260
The Eighteenth National Congress is a very important meeting of our party. It helps in building a
well-off society and accelerates the transformation of economic development patterns. It is also a
major event in the political life of the whole party and people of all nationalities. For our party to unite
and lead the Chinese people of all ethnic groups to build a well-off society, speeding up socialist
modernization, creating a new situation in the cause of socialism with Chinese mask has great and
far-reaching significance.
The chairman Xi Jinping pointed out that China should pursues a national policy that is defensive
in nature. Our endeavours to strengthen national defence aim to safeguard China's sovereignty,
security and territorial integrity and ensure its peaceful development. China's armed forces have
always been a staunch force upholding world peace and will continue to increase cooperation and
mutual trust with the armed forces of other countries and play an active role in international political
and security fields.
2.2 National economic actual strength is abundant, comprehensive national strength has been
enhanced, the solid foundation for national defence development
After 30 years of reform and opening, China has experienced a sustained and rapid economic
development. There is considerable improvement in the quality of life of common people. In 2012
annual gross domestic product (GDP) was 24.662 trillion, an increase of 7.8% over the previous year.
In 2013 Gross domestic product (GDP) was 26.067 trillion, with GDP growth of 7.9%.
In general, the economic development of our country shows good trends. After a long period of
investment and development, China's national defence strength have experienced a big jump. People's
liberation army (PLA) with its land, sea, air, and the second artillery forces and equipped with a
number of advanced weapons and equipment, has a high degree of political consciousness and
absolute loyalty to the country.
2.3 The current domestic environment is not completely harmonious
China's domestic environment is a cacophony of factors. There are many problems demanding prompt
solutions. Taiwan issue and Tibet issue illustrates that domestic separatist forces are growing. In 2008,
314 violent crimes happened in Tibet, undermining the country's sovereignty and territorial integrity.
Due to US-Japan military alliance, Taiwan is continuously making progress to face China. This is
a serious threat to peace environment. To prevent separation of Taiwan is one of the most important
tasks facing China.
Peace and development remain the themes of our era. Peace, cooperation and development are the
common aspirations of people of all countries. However, today's world is a complicated and ever
changing. Unstable and uncertain factors still exist. Traditional and non-traditional security issues are
intertwined, and a serious threat to world peace, regional issues, and intricate local conflicts are
existing and fluctuating. The current international situation is somewhat peaceful but local conflicts
do exist. Therefore, our country's national defence development is facing two characteristics of
international environment. To do a good job in national defence education, we need to consider not
only the international environment but also the domestic environment. Analysis of the domestic
environment, especially since the cold war, reveals that China's national defence development must
be considered holistically.In current domestic environment, there are some inharmonious factors that
need to be solved while ensuring that country maintain steady economic development.
3. The necessity to build a national defense education system

The national defense education is an important part of national defense development. Under the new
situation, building the system of national defense education with Chinese characteristics, is a big
challenge.
261
3.1 Set up a system of national defense education is a requirement of the international situation
Since the 21st century, peace and development remain the themes of our era. To seek peace and
development is the common pursuit of people all over the world. However, hegemonism and power
politics still exist. The United States began to return to the asia-pacific, adjust military deployment,
encircling and suppressing the rise of China. On the one hand, US is bringing in Japan, to strengthen
the military alliance with Japan and to stir up the islands problem between China and Japan. Also
bringing in India in an attempt to encircle China and so on.
3.2 Development of national defense education system and need of laws and regulations
The national defense education act, the national defense, military service law and other laws and
regulations specify the legal obligation and social responsibility. Along with the development of The
Times, the progress of science and technology, great changes have taken place in the national defense
education work content also, such as the rapid development of the enrollment expansion of colleges
and universities and network, etc. these changes require must reform and innovation of traditional
forms of national defense education, explore new suited to the current actual situation of the national
defense education system.
3.3 Set up a system of national defense education is the objective need of implementing quality
education in colleges and universities reform
The National Defense Education Law clearly stipulates:colleges and universities should combine
classroom teaching with military training, and national defense education to students. The training of
talented people will depend on the quality of education.
3.4 Development of national defense education system is to adapt to the new characteristics of
college students
After 30 years of the reform and opening and the development of the modernization building, our
traditional national defense education in content and form has been far from adequate to meet today's
college and university students in need, the education is compromised. According to the new era of
college students new characteristics and new requirements and must be adapted innovative university
national defense education content and form.
Therefore, to effectively respond to multiple security threats and accomplish a diverse array of
military tasks, to further strengthen its own system, this is we have to make a choice.
4. Conclusions
The national defence education system in China must adapt to the national development strategy and
security strategy of new requirements, focus on the overall performance of the military historical
missions at this new stage in the new century, implement the military strategic principle of active
defence in the new period, and advancing with The Times to strengthen military strategic guidance,
pays great attention to ocean, space, cyber security, actively plotting peacetime use of military force,
continue to expand and deepen the military struggle preparation, improve their ability to win local
wars under the conditions of informatization for the core ability to accomplish a diverse array of
military tasks.
References
[1] National Defence Education Act, 6 Dec 2013.
[2] Jinping Xi, Firmly March On The Path Of Socialism With Chinese Characteristics And Strive To
Complete The Building Of A Moderately Prosperous Society In All Respects, Report to the Eig
hteenth National Congress of the Communist Party of China on 8 Nov, 2012.
262
[3] Hou Jing, Zeng Yi, Wang Zefeng, Career Guide of National Defence Students, University of Sci
ence and Technology of National Defence of China, Changsha, Hunan, 2012.
[4] National defence Education Should be Strengthened in General Higher Education, http://d.wanf
angdata.com.cn/Periodical_zgdxsjy201214002.aspx, 29 Sept 2012.
[5] Strengthening the development of the national defence reserve force system, http://jjys.cn/userli
st/hongse/newshow-1251.html.
[6] Chinas national defence development problems, http://www.szbf.net/Article_Show.asp?ArticleI
D=1676.
[7] Improve the national defence education system, http://renfang.bjyq.gov.cn/jsbl/xdzz/524.html.
[8] Status Chinese defence development, http://www.szbf.net/Article_Show.asp?ArticleID=1676, 5
Feb 2011.
263
Translation Teaching in an Era of Technical University in China
Gan He
Institute of Foreign Languages, Wuhan Donghu University
Wuhan, Hubei Province
543977811@qq.com, hegan6@hotmail.com
Keywords: Translation majors; Skilled personnel; Technical university
Abstract. Since 2014, the State Council guided a group of non-research universities to transform into
technical universities. Then, how to adjust teaching to the new demand becomes the task and
challenge facing every educator on the campus. This study will explore the model of training skilled
technical personnel basing on classroom teaching for English translation majors and analyze
problems and difficulties teachers confronted and advance solutions.
1. The advent of an era of technical universities in China

On February 26, 2014, Chinese Premier li Keqiang chaired an executive meeting of State Council,
examined and passed The Personnel Management Regulations for Public Institutions (draft),
demanding "a batch of universities to be transformed into technical universities." (Reporter Li Chun:
xinhuanet. Beijing, February 26)
In the morning of March 22, 2014, at China Development Forum, vice Minister of Education Lu
Xin unveiled, there are now nearly 2500 colleges and universities in China. After the reform, over
1600 to 1700 colleges and universities will focus on vocational and technical education. At the same
time, their training mode would dilute disciplines while strengthen the specialty, cultivating technical
and skilled personnel.
2. Challenges and missions

In most universities, the Teaching Program has been used for many years without change. Teaching
practice usually follows the previous experience, emphasizing more on scores than education. Little
classroom practice and few experimental classes are arranged, resulting in problems such as low
comprehensive quality, separation of theory with practice, poor skills, what students learnt in
university being not able to meet the demand of enterprises, and lacking the ability to interpret the
trade development trends today. So how to change the status quo become the main challenges and
missions facing the universities under transformation. (Chen Jiang: 2015)
Someone suggested that the link between universities and enterprises should be strengthened so as
to allow the students to familiarize with the fields they might work in the future as early as possible.
They believe that implanting appropriately the concept and training mode of enterprises into the
courses of professional and vocational quality training, as well as combining production with teaching
will broaden the horizon of the students and make the students learn both the book knowledge and the
professional skills.
In August 2014, Wuhan Donghu University was listed in the first ten universities in Hubei
province to transform into technical universities. As teachers of English translation in the university,
the question is: what will be the future working field of English-translation majors? Translation is
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
264
featured by "language + a field or industry", that is, the English language they majored in + a field or
industry they are going to service or work with, which could be all walks of life. Obviously, it is just
impossible for the translation majors to learn about every industry or familiarize themselves with
every working fields ahead of time. Therefore, what should students familiarize with or practice in the
education of translation becomes the priority of consideration and discussion.
3. Reflection on the existing translation curriculum
3.1 Teaching aim

According to the Teaching Syllabus of Translation, the course of translation is provided for the
sophomore of English-translation majors. It is a required course given at the first semester of the
second year. The textbook adopted is A Practical Course in Translation between English and Chinese
(4th edition) published by Wuhan university press in 1997, edited by Guo Zhuzhang et al. The
teaching aim is to raise the students' ability of translation, review and consolidate their English
knowledge learnt, and on the basis of it, to learn the basic knowledge and skills of English-Chinese
translation, and lay a good foundation for an ordinary translation work in the future.
To have also a preliminary understanding of the basic theory of translation, to tell the similarities
and differences between English and Chinese languages, and to master the commonly used translation
skills, eventually, being able to translate ordinary social science or current political document into
Chinese in the principle of "faithfulness, expressiveness and smoothness", or to translate ordinary
Chinese context into English, at the speed of per hour 150-200 English words or Chinese characters
3.2 Teaching method
The textbook covers a very wide range of linguistic fields, including not only a large number of
literature translations but also the translation of poetry, drama, science and technology, etc. Teaching
is given priority to classroom lecturing on literature translation skills, supplemented by some
exercises: sentence and paragraph translation. Both teaching and practice adopts the traditional
methods. Anyhow, poetry, drama and science and technology translation is comparatively briefly
introduced with no arrangement of practice.
4. Improvement done to the translation curriculum
4.1 Teaching aim

On the base of the original teaching curriculum, a section of practice was added First of all, the
decision on what to practice was made. As universities were to be transformed into technical
universities with the concept that the transformation was the need of industry upgrading as well as
employment, then the industry upgrading and employment should be examined. At present, the
industrial upgrading was still in the process of forming and nothing had taken a shape, while the
employment was what every students confronted. Therefore, it is more realistic to focus on what
being potential or suitable for employment. Therefore, the cross-border e-business and TV plays
translation were chosen for the following reasons:
4.1.1 Time of Internet +
The cross-border e-business is in line with the trend of "Internet +". Both the success of Jack Ma and
his Ali with its year after year sales miracle are worldly acknowledged. Jack Mas promise that "in the
next few years he will manage to provide one million jobs for one million people, and let each
employees earn one million" allows no ignorance. At present, the e-commerce market is domestically
dominated, while the cross-border e-commerce witnesses a sharp rise. There is a shortage of
personnel who masters a foreign language as well as e-commerce.
265
4.1.2 Government policy and flourishing TV play industry
The TV plays translation meets the development strategy of One road and one belt, being able to
promote the understanding of Chinese culture in the 56 countries involved. TV plays are widely
spread and liked by people in the world. Besides, TV play industry is flourishing in China. The huge
amount of their annual products as well as the extremely high income of those actors and actresses
shows that the industry is in its prime. To translate outstanding TV plays into foreign languages will
promote cultural understanding and no doubt the One road and one belt strategy. Whats more,
excellent translators should be able to find a lucrative job.
4.1.3 Foreign language based
Both the cross-border e-business and TV play translation conform to the spirit of "mass
entrepreneurship and innovation" encouraged by the government. While the Industrial is waiting to be
upgraded, it is imperative for individuals to relay on themselves. Starting an undertaking and
self-employment are important approaches of employment for college students. Both the cross-border
e-business and TV play translation are based on foreign languages. Therefore, they are comparatively
suitable for English majors. If one owns enough capacity and strong will, he or she might also blaze a
new path and create an industry.
4.1.4 Within the reach of sophomore
The content of the e-business was much easier than other machinery and engineering materials for
English majors and the students are familiar with e-shopping models, therefore, it is suitable for
sophomore.
4.1.5 Daily life based
Dialogues in TV plays come from real daily life. They are vivid languages, using short sentences, and
with strong personalities. They are not difficult to understand and they are good material to improve
students translation ability.
4.1.6 Fans of performing arts
Most students who were born in 1980s and 90s are the only child in their families. Most of them were
sent to various art classes and have a special liking for the performing arts. In recent years, the thriving
and prosperity of TV paly industry, as well as all kinds of TV shows, reality TV shows indicated that
there existed a large number of fans in this generation for performing arts. Interest is the best teacher,
the students interest in TV play translation will not only help them to improve the level of translation,
but also to create and produce good translation works.
4.2 Teaching method
4.2.1 The change of teaching aids
It changes from the traditional classroom teaching to lecturing in "translation lab" assisted by
computer and network. The students can not only refer to online dictionary at any time through
internet, dispensing the inconvenience of carrying a big thick dictionary, but also save the cost of
buying various dictionaries. Whats more, they can search for information needed promptly such as,
the background of the author etc. With the aid of computer, students can finish their translation in
digital form, learning as well document editing and typesetting skills. In the process of TV plays
translation, students can also download the original videos, equipping them with bilingual subtitles,
so the translated script can be perfectly displayed. The process of translation is thus full of fun,
providing a rich source of creation and innovation, allowing students obtain a sense of achievement.
4.2.2 Changes in the form of practice
Students are divided into groups to participate in practice, they are guided by the teacher in the
classroom, but after class, groups support each other in continuing discussion, exploration, reflection
and completion of the assignment.
266
5. Teaching process: the case of TV play translation
The lecture was given on the basis of action learning theory, according to which, lecture can be
divided into three steps.
Step 1: Problem-raising. Step 2: Getting the knowledge needed for solving the problem. Step 3:
Validating and consolidating the knowledge learnt through practical action, and solving the problem.
5.1 Problem-raising
First of all, the teacher unveiled the fact that the university had become one of the first ten to transform
into technical universities in Hubei province, its significance and challenges, especially the challenges
and job opportunities for the English translation majors. Reminding students the importance of
turning knowledge into ability, for the problem they were facing was whether their translation ability
could meet the market demand (so as to enhance the students' self-consciousness and the enthusiasm
of learning. Secondly, after clarifying the relationship between practice and translation ability, the
teacher told the students that a section of practice would be included in the course. The possible
practice would be: TV plays script translation. The teacher gave her reasons for her choice and asked
students to put forward their opinions. A discussion was introduced and bold comments were
encouraged. Through discussion, the students had a better understanding of the situation, and when
they reached a consensus a certain amount of learning motivation was generated as well.
5.2 Getting the knowledge needed
5.2.1 Leading-in
TV play script had a more readers than the general literature works such as, literature lovers, audience,
directors, actors, producers and so on, each reader are particular, with different purpose and demands.
Therefore, the teaching started from the perspective of the definition, types and characteristics of TV
plays. The teacher explained the definition, using the method of contrast and drawing out the
characteristics of TV plays: highly concentrated space and time, sharply contradictions, personalized
language to show ones characters and so on. All in all, through explaining the distinctive features of
TV play scrip, the students' curiosity as well as their interest in TV play scrip translation was aroused.
5.2.2 Scrip translation skills
Skills were involved in every lecture and it was the focus of teaching, as well as the specific ability to
be gradually obtained by the students. Usually, lecture started from the general concept to specific
skills, with explanations aided by examples, comparisons and etc. For example: when interpreting
"colloquialism", first the lecturer would introduce what is a colloquialism, the point of view of
various schools, etc., and then introduce through examples how to achieve the objective of colloquial
sentence, such as incomplete sentences, simple sentences, etc. Skills like this were introduced step by
step and part by part. Each part would be put into practice by students. When students finished their
translation, the teacher would point out the problems in their work and ask them to compare the
knowledge and skills taught with their practice, encouraging them to discuss, reflect and modify their
assignments so as to have a better translation.
5.3 Solving problem
5.3.1 Allocation of Tasks
When it comes to practice, we should first of all make clear what to practice or what TV plays to be
chosen? The lecturer decided to make it by voting. First, two favorite TV series should be
recommended by each class, that might be five to eight for four classes, and then choose among them
two plays that had the most votes, finally, voting for one in the two by all the students. The one with
more votes will be the TV plays for practice. Afterwards, according to the episodes of the TV series,
students would be divided into several groups, each group be responsible for the script translation and
subtitling for one episode of the TV series.
5.3.2 Translation practice
267
Classroom practice usually followed the lecture. Students would be asked to translate 150-200 words
of the script assignment, using the knowledge and skills of translation just learnt. After each new
lecture, modification and improvement to previous assignment were encouraged. The eventual
translation work would be scored as the final examination.
Classroom Practice allows the theory, knowledge and skills taught immediately put into use,
requiring no deliberate recitation but naturally went to students mind and became their ability.
Anyhow, skills are not achieved overnight. The process of turning knowledge into ability took time.
The practice should be repeated and the translated script should be corrected and re-corrected.
Translation was a job demanding a lifetime learning and continuous improvement. The more
experience accumulation, the better quality of translation. Making it clear to the students would help
them understand and adapt better to future jobs. Through constant practice, students could master the
basic translation skills required by the market and play better social roles when leaving universities.
5.3.3 Subtitling
First, making preparing: 1) download free software such as Time machine etc., 2) download the video
of TV play (or make a video for poem translation), (optional for poem translation: 3) download a
piece of music, or record their own reading), and 4) prepare a script of two languages. Usually we
started from a poem, for it was short and much easier to get prepared. When everything was ready, one
lecture would be spent on demonstrating how to making subtitles. If possible, a student in higher
grade would be invited to show the class how they made it. For the communication about internet
between the same-ages would be much more exciting. After the demonstration, students subtitle
independently using the materials they prepared. The teacher and possibly, a higher grade student
would move around the class to answer the students questions and helping them have their jobs done.
By the end of the semester, one more lecture will be given for students to review and finish subtitling,
ensuring that every team can complete the assignment.
5.3.4 Evaluation
Owing to the fact that accumulated vocabulary of sophomore was not large enough, translation errors
of one kind or another often appeared. Since each group was translating different episodes, the content
of translation was obviously different. Therefore, the evaluation focused on the knowledge and skills
taught. For example, when "personification" and related translation techniques were given, sentence
regarding the "personification" would be the focus of evaluation. The sentences translated by students
were the most vivid samples for this purpose. Those who had done a good job in their translation
would have timely affirmation and praises, those translations with mistakes and misunderstanding
would have them corrected. Through practice, the knowledge and skills that had not been well
understood or remembered during lecturing would thus be verified, understood and consolidated.
6. Summary
After one semester, the four experimental classes finished their script translation of the TV series
"Back in Time and equipped its sixteen episodes of videos with bilingual subtitles. One year later in
their third year of university, some students had part-time jobs as TV plays translators and some
prepared short advertising films with bilingual subtitles for some companies. Although the payment
they got was not as much as market price, but they had made the first step on the road to the market. At
present, effort is also made to finalizing their translated episodehoping them might be recognized
by the market.
the era of technical universities, the teaching here has striven to adapt classroom teaching to market
demand, and initial achievements has been observed which will lay a foundation for the employment
of English translation majors.
268
7. Acknowledgement
This research was supported by the Planning Project under the Twelfth Five-Year-Plan of Education
Science in 2015 in Hubei Province (Grant NO. 2015GB192).
References
[1] Ruan Quanyou. Conceptual framework of Critical Literacy Development for English Majors.
Foreign language world. No. 1, 2012. (General Serial No. 148) pp.19-26.
[2] Revans R. ABC of Action Learning: The Key Concepts.London. Lemos & Crane, 1998. pp3-7.
[3] Mason R & Rennie F. E-learning: the Key Concepts. London Routledge, 2006.
[4] Graham C R. Blended learning system: Definition, current trends, and future directions [A]. In
Bonk C J & Graham C R. (eds.). Handbook of Blended Learning: Global Perspectives, Local
Designs. San Francisco, CA: Pfeiffer Publishing, 2006.
[5] Franklin P. Developing Intercultural Competencies for Business: Principles and Practice.
University of International Business and Economics, Beijing: Pre-conference Workshop on
Intercultural Business communication, 2009
[6] Chang V & Fisher D. The validation and application of a new learning environment instrument to
evaluate online learning in higher education. In Khine M S &Fisher D (eds.). Technology-rich
learning Environments: A Future Perspective. Singapore: World Scientific, 2003. pp1-18.
[7] Stem H H. Fundamental Concepts of Language Teaching.Shanghai Foriegn language Press,
2008.
[8] Hu Wenzhong. Achievements and Deficiencies of Chinese Foreign Language Education in Sixty
Yaers. Foreign Language World. No. 5, 1999. Pp10-16.
[9] Dai Weidong, Zhang Xuemei. Reflection on Undergraduate Education of English Language
Majors.Foreign Language World. No. 4, 2009. Pp1-3.
269
Discussion on Search Algorithms in Teaching of Data Structure
Bin Yanga, Sanrong Liub,*, Caixia Liuc

School of Information Science and Engineering, Zaozhuang University,
Zaozhuang, China 277160
a b c
batsi@126.com, 14764417@qq.com, 41046457@qq.com
Keywords: Data structure; Search algorithm; Teaching method; Innovation
Abstract. Search almost could be used in every day by the people. Search algorithms is very
important component of data structure. In the teaching process, we find that students could not
understand the storage of table in the teaching process, which could lead to be more difficult to
understand pseudo code of search algorithm. In this paper we propose a novel learning flowchart of
search algorithm. Static and dynamic search could be learned in linear list and tree chapters, which
could improve the students' learning level.
1. Introduction
Data structure systematically introduced data structure such as linear lists, stacks, queues, strings,
arrays, generalized form, trees, binary tree, graph, and algorithms containing search and sort
algorithm [1]. By teaching in classroom and computer practice, the students could master logical
relationship of data, data storage (storage structure) and the basic operation of the algorithm, and lay
the foundation of software development [2]. To learn well this course could make the foundation for
study and research of subsequence courses.
Search, known as retrieval, is to find a specific data element in as large number of data elements. In
daily life, search operator almost could be used in every day by the people [3-4]. For example, a
specific image could be searched in a section of video, a piece of information could be found in a
computer network, and someone's phone number could searched in the phone book. With the wide
application of computer technology, search module has been designed in almost all of the computer
application systems to achieve a wide range of requirements [5]. In Microsoft office softwares, serach
operator also is very important.
2. Analysis
Search part includes static and dynamic search. In generally search part is put in the last two chapters
of the data structure. We introduce all data structure (linear lists, stacks, queues, strings, arrays,
generalized form, trees, binary tree, graph) and then teach this algorithm. In the process of teaching
search algorithms, we made the questionnaires according to the students learning level. The results
are listed in Table 1. From Table 1, we can see that almost students think this chapter is difficult
because of code abstraction and storage of search table.
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016

270
Tab. 1. Learning level of search algorithm.
Cases Ratio
Code abstraction 35%
How to store the search table 38%
Not familiar with programming language 20%
Have no interest in this course 7%
Sequential storage Binary search
Chapter 2 linear lists

Sequential search
Linked storage
Binary linked tree Dynamic search:

storage binary sort tree
Chapter 6 tree and
binary tree
Linked storage B+ tree

B- tree
Fig 1. The learning flowchart of search algorithms.
3. Teaching method
From the above analysis, we can see that students are not familiar with the search table, resulting in
being more difficult to understand pseudo code of search algorithm. But the storages of search table
have been mentioned in the previous chapters. Because the learning time is too long, the students have
forgotten these contents. So I do not recommend that the search algorithms should be learned in the
last chapter, and these algorithms should be learned when the corresponding storage structure of
search tables are learned. The detailed improvement flowchart of the learning search algorithms are
shown in Fig. 1. From Fig.1, we can see that learning search algorithms could be divided into two
parts.
(1) Static search table
In static search table, users could search the particular data elements and the various attributes. So
in the retrieval process, the table is not changed. Static search mainly contains sequential search and
binary search. Storage of search table is introduced in Chapter 2 in detailed. When the stroage of
linear list (sequential stroage and ordered storage) is learned, teach the static search. In this way,
students could connect the knowledge points together in order to facilitate the understanding of the
algorithm.
(2) Dynamic search table
271
In dynamic search table, users could insert and delete the particular data elements. Table structure
is dynamic in the process of generation, and the length of the table can be changed according to the
search results. The representation and implementation of dynamic search are through tree structure,
which is introduced in Chapter 6. The operators of binary sort tree (search, insert and deletion) are the
same as binary tree. So dynamic search is learned in Chapter 6.
4. Summary
I make questionnaires of students from Zaozhuang University about learning search algorithm. Based
on analysis, I find that students could not understand the storage of search table in the teaching
process, which could lead to be more difficult to understand pseudo code of search algorithm. So we
propose a novel learning flowchart of search algorithm. Learning search algorithms could be divided
into two parts, which could be learned in the previous chapters. This method could improve the
students' learning level.
5. Acknowledgement
This work was supported by the applied talents culture professional development and support
program for general undergraduate school (No. 33301), PhD research startup foundation of
Zaozhuang University (No.2014BS13), foundation of Zaozhuang University (No. 2015YY02), and
the Natural Science Foundation of Shandong Province, China (No.ZR2015PF007).
References
[1] B. Yang, W. Zhang, C. X. Liu, Discussion on Teaching of Data Structure about Spring Class in
Zaozhuang University, International Conference on Social Science, pp. 329-331, 2015.
[2] H. Shen, Z. Chen, Applications of Pictorial Method in Data Structure Teaching, The Science
Education Article Collects, vol. 259, pp. 75-76, 2013.
[3] W. Z. Dai, Design and implementation of find example demonstraion system of data structure,
Modern Computer, pp. 132-134, 2011.
[4] B. Paul, E. Faith, Optimal Bounds for the Predecessor Problem and Related Problems, Journal of
Computer and System Sciences, vol. 65, pp. 38-72, 2001.
[5] J. R. Timothy, Analytic derivation of comparisons in binary search, ACM SIGNUM Newsletter,
vol. 32, pp. 15-19, 1997.
272
The Innovation Research of University MOOC Promotion
Jing Tian
Liaoning Police Academy Vocational Education Department, Dalian, Liaoning, China
tianjing11230@126.com
Keywords: MOOC; Promotion; Innovation research
Abstract. MOOC brings a new education reform, it can solve the problems in current higher
education in a certain degree. MOOC is not only embodies the education fairness, it more promote the
excellent education resources utilization. Education experts and scholars continuously explore
MOOC teaching pattern and promotion strategy, universities MOOC promotion mode has become
the hot topic of current higher education. This document explains the innovation of MOOC
promotion, it mainly includes improving the quality of MOOC teaching; Increasing the interaction
time; perfecting the teaching management; perfecting inspection certification system; Integrating of
large data analysis technology and so on.
1. The introduction
In today's network information age, more and more students are willing to choose online learning,
MOOC online education platform offers the freedom chance to choose courses for the students. With
the development of information technology, teaching patterns and means constantly updated, more
and more colleges and universities to join the global MOOC education platform, MOOC has become
a new direction of education reform and promoted equality in the world education development
process. A lot of information shows MOOC at home and abroad have been entered into practical stage
by the theory research stage. Along with the large-scale MOOC course promotion, student's demand
for personalized is growing, it also puts forward new requirements to the university for MOOC
promotion.
2. Improve the quality of MOOC teaching
2.1 The teaching method to realize the combination of scene and entertainment
MOOC teaching should adopt different teaching methods and teaching form, as far as possible use of
network technology to achieve vivid learning situation, and to make students feel real.
Three-dimensional dynamic form of teaching can stimulate students' interest in learning, and cultivate
the students' abstract thinking. MOOC teaching such a network game set of customs clearance mode
is also a good way to improve the teaching quality. The Section MOOC class can be a micro course
about 10 minutes, the premise into the next micro lesson is successfully completed the problems of
micro class. The customs clearance problem setting has increased interest in learning, also stimulates
the students' learning motivation.
A professor of Taiwan University has launched more than competitive online games in MOOC
teaching, it is designed to inspire students' potential and passion. The 70 questions game plan
launched by research and development group raises a number of students' interests, it is finished by
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016

273
the students in just four days. The change of teaching method can make students' learning status
changed from passive to active, the teaching effect will be improved.
2.2 The knowledge architecture to realize the combination of debris and system
Each discipline knowledge structure is a whole, it has a rigorous logic system between content, so it
also puts forward very high requirements for the MOOC platform teaching. MOOC education
platform as a teaching aid has the technical advantage, the construction of knowledge system in
MOOC platform should pay attention to the interrelated with all kinds of resources, put the specific
knowledge of nodules macroscopic combing and present the complete system of knowledge structure,
what helps students to understand the knowledge framework.
MOOC curriculum reflects each chapter of the Pieces of knowledge, so it puts forward higher
requirements to teachers and students involving in the lesson for the network classroom teaching.
Students should flexible combination of the original knowledge structure in learning MOOC new
knowledge and reconstruc the creative knowledge system; Teachers need to explain the whole
process of learning contents, And actively comb knowledge architecture for the students, so that we
can help students to realize the system of knowledge, and complete the understanding of knowledge
framework, it solved the subject students fragments and the integration problem To a certain extent.
3. Increase the interaction time

MOOC teaching platform can realize the bidirectional interaction with the help of the Internet
technology, it mainly interactive online and offline communication. Online interaction is mainly
manifested in the correct students' papers, Problem solving and course materials to download.
Students will inevitably encounter difficult problems in the learning process, most MOOC teaching
platform set up related question discussion area, the students can help from teachers and classmates
by E-mailarning spaceor other ways so as to solve the problem. MOOC platform provides the
convenient communication space for students, but it cannot guarantee that students' problem can be
resolved. Students asks questions, but there is no reply in communication area, it causes loss and
reduced learning enthusiasm, and prevents the next phase of the study. Offline communication can
make up for some shortcomings of online interaction, communication with the teacher face to face is
more beneficial to the understanding of the learning content to master.
MOOC teaching is not a video recording for the teacher and a video to watch for the students,
video recording is just a starting point for MOOC class on the contrary. The teacher should add more
interaction time to organize students' interaction in a timely manner after students participating
learning. Students can discuss and answer each other who is online or offline communication
interaction, the professional teachers participating in interaction can solve the important and difficult
problem. Therefore, , teachers must increase investment in online and offline communication energy,
receive students feedback information, gather the common difficult problem, positive answer in time,
organize students to summarize knowledge and review on a regular basis. Offline communication
doesn't have to be confined in the classroom, it can be in a variety of places on a variety of forms of
interactive communication, it is not be restricted by space, such as to lead students to participate in
social practice.
4. Perfect teaching management

Most teams are organized by one teacher For MOOC teaching in universities. Teachers should focus
on course content and coordinate curriculum operation issues in the process of curriculum
implementation. The number of students are not be limited in MOOC teaching platform, the questions
needed to answer and marking homework are huge, the workload is can not be completed by one
university teacher. Therefore, universities should separate the curriculum content organization from
the teaching operation for carrying out MOOC teaching in platform, form a strong professional
274
scientific research team and teaching assistant team to ensure the overall implementation of MOOC
teaching and help teachers to complete the student's supervision and inspection work. The teacher
should share the role according to the MOOC teaching based on large data information technology for
teaching platform.
MOOC brings the new learning experience and teaching concept to the world, at the same time, it
provides the free opportunity to participate in the school curriculum for learners not leaving home and
gives learners the first-class teaching courseware and top teaching design. Besides, MOOC plays a
huge role for the global high quality education resources sharing, most of the experts and scholars
support for the promotion of desire teaching, think that MOOC can wake up the global education
reform, but as MOOC popularized in universities, the experts and scholars began to worry about
MOOC promotion strategy in the existing university. MOOC is bound to cause more education
experts and scholars to explore and think of online education.
5. Perfect examination certification system
5.1 Innovate evaluation methods

Now MOOC teaching mode most used online assessment appraisal way, Whether the answer can't
consideration for students, testing does not exclude the possibility plagiarism, cheating is difficult to
avoid, it makes online examination results of questionable and it is also the main reason for the
bottleneck period of MOOC promotion, a lot of people question the credibility of certificate for
MOOC session and the authenticity of the student credit, online assessment results is not recognized
by many education institutions or universities.
The author thinks MOOC can be from two aspects of innovation in the form of examination to
improve the awkward situation of MOOC promotion. One is to strengthen exchanges and cooperation
between universities, universities adopting MOOC teaching enables on-the-spot examination mode,
the qualified third-party evaluation institutions participates on site supervision, and Marks and
performances evaluation, it lets the student take the online examination in the field test for online. The
invigilators test can improve the credibility of evaluation. Second, in addition to relying on the field
examination evaluation scores, unsupervised online quiz assessment can be applied in the process of
technical means, such as the retina recognition, fingerprint recognition, notes tracking system and so
on, it identifies the student whether or not in order to ensure the credibility of usual evaluation and
impartiality. the fingerprint identification system of Coursera teaching platform compares the
generating keyboard for each a copy of the electronic homework, and collects involving students
fingerprint information to ensure authentic in every electronic; Uses of typing rhythm recognition
technology to test the student himself whether or not by comparing according to the records of
students at ordinary times typing rhythms, such appraisal way has more credibility and authority.
5.2 Perfect qualifications authentication system
Many universities promoted the MOOC platform, but they continue to use the original degree
certification system, the situation will be heavily restricted the reflection of MOOC advantage, and
influenced the development of its teaching mode. The author thinks that there are three aspects to
improve the existing education certification system, and reverse the Limited dilemma for MOOC
promotion. One is to increase publicity of MOOC teaching, increase the Degree of recognition by
corporate employers, unit of choose and employ persons for education certification. The job matching
programme of Udacity platform and Coursera corporate sponsorship certificate issued project is
worthy of reference, Employing unit can intuitively understand the performance of the students in
MOOC platform, this kind of form promoted the enterprise on the correct cognition of mu class
degree certification to a certain extent, so as to realize the all-round talents selection of Employing
unit.
275
6. Integrate large data analysis technology
MOOC teaching platform can excavate students' information by using large data technology, analysis
and extract the students' learning characteristic and learning record information to create the studies
information database of student, ultimately provide the personalized learning services for students.
MOOC can provide efficient data analysis and statistics, such as providing the skills of students
learning process and practice process, the data analysis results are updated in real time, these can help
teachers to understand each student's learning progress and completion, and give the corresponding
advice; these also can be made for students learning modules, and give the accuracy of
recommendation service; these Make related education organizations to understand the student's
learning effect and provide reference basis for the curriculum.
7. The conclusion
Most MOOC platforms released the single courses at present, these did not have personalized
learning system for the students. Universities should attach importance to the use of cloud computing
and large data in the MOOC teaching. The data refined by These technologies can analysis the factors
that influence the students finishing MOOC teaching process, it make MOOC teaching process more
detailed and clear and form the real MOOC intelligent teaching system. "School online platform of
Tsinghua university recorded of the students' learning process by data mining and cloud computing
technology, summed up their behavior characteristics, builded a personalized learning archives, the
teachers developed personalized learning solutions for each student through the analysis of learning
files and provided analysis report for cooperation of universities, it provided a reference for the
improvement of teaching quality eventually. These are MOOC education platform promotion trend in
the future.
References
[1] Heller and Nathan, Laptop U:Has the Future of College Moved Online?, The New Yorker, 20
May, pp. 80-91, 2013.
[2] Cathy Sandeen, Assessments Place in the New MOOC World, RE SEARCH & PRACTICE IN
ASSESSMENT, vol.8, 2013.
[3] Yvonne Belanger, Bioelectricity: A Quantita tive Approach, Duke Universitys First MOOC,
February 5, 2013.
[4] Kop, The challenges to connectivist learning on open online net works: learning experiences
during a massive open online course,The International Review of Research in Open and
Distance Learn ing, vol.3, 2011.
[5] Dorsa Sadigh, Automating Exer cise Generation: A Step towards Meeting the MOOC
Challenge forEmbedded Systems, In Proc.Workshop on Embedded Systems Edu cation(WESE),
vol.12, 2012.
[6] Xiaoxia Dong, Research on the operation mode of the MOOC, vol.7, pp. 34-39, 2014.
276
Study on Curriculum Arrangement of Foreign Secretary

Based on Career-Development-Oriented1
Na Liu
Jingchu University of Technology, Jingmen, HuBei, China
123290746@qq.com
Keywords: Ability oriented; Foreign secretary; Curriculum arrangement
Abstract. Under the premise of economic globalization, especially after China's entry into WTO,
our country's economy tends to be internationalized, which has a higher requirement for the rapid
and efficient development of economy. In order to improve the comprehensive professional ability
of foreign secretary, colleges and universities have become to pay more attention to the cultivation
of practical, commercial high-quality foreign secretary talents, focus on the comprehensive quality
of talents and professional practice ability. In this paper, it combines the characteristics of foreign
secretary education to analyze the arrangement of foreign secretary curriculum from the perspective
of career-development-oriented, thus to improve foreign secretary professional students learning
and practical ability.
1. Introduction
With the deepening of economic globalization, especially since China's accession to the WTO, the
economic development of our country gradually comes into the world economic system. It puts
forward higher requirements to the comprehensive ability of foreign personnel. As a result, many
institutions of higher learning are to the teaching reform in China, to attach importance to the
cultivation of high-quality talents of practical direction. Foreign secretarial course is required a
course for business English majors, how to use the reasonable curriculum, effectively improve the
comprehensive quality of talent cultivation and application ability. In the context of the current
higher education transformation, the foreign secretary major is also facing direction and location of
readjustment, timely analysis of the problems is still existing some problems in the teaching
secretary of concerning foreign affairs or foreign nationals, follow the principle of combining
principle with flexibility, pay attention to improve students' practical ability, clear training
objectives, set up professional and curriculum content, curriculum evaluation system of
development actively, standing in the point of view of ability as the standard scientific analysis of
the key factors of talents cultivation, targeted to improve foreign talent secretarial accomplishment,
to adapt to the continuous development and change of business and economic development is very
important in our country.
2. Basic situation of secretarial talent cultivation in universities and needing in China

It is important to pay special attention to the professional curriculum and teaching mode issues in
1. On Interlanguage Pragmatic Communication Model Based on Adaptation Theory funded by Hubei Provincial Office
of Education in 2015. (15G122)
2.A pragmatic Strategy of Interlanguage Pragmatics: An Adaptation in Spoken English Teaching funded by the
Academic Affairs Office of Jingchu University of Technology in 2015.JX-201518
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
277
the process of the secretary personnel training in colleges and universities, to fundamentally
promote the improvement of our country concerning foreign affairs secretary personnel training.
Since the reform and opening to the outside culture, secretarial concerning foreign affairs in the
form of internationalization of China's economy in our country the continuous development of
science and technology. The state, society, enterprise on the talent requirements also higher and
higher, especially the greater demands of the secretary concerning foreign affairs, social demand for
foreign secretary has not only stayed in professional writing aspects of words, also had certain
practical experience, public relations and management ability, etc., also requires the secretary of
concerning foreign affairs to master certain business knowledge and the knowledge of laws and
regulations, as well as the ability to predict the market, the need to pay attention to cultivate foreign
secretary major in higher vocational colleges is the student's comprehensive ability, so as to make
them interdisciplinary talents with comprehensive ability.
In this social environment, however, because of social actual demand people don't agree college
talents training plan, lead to the obvious contradiction between supply and demand in the foreign
secretary professional talent training and social needs. A shortage of comprehensive quality ability,
professional practical ability passes of the secretary concerning foreign affairs. In terms of foreign
secretary professional talent training in colleges and universities only pay attention to the
development of theory of knowledge, that is a big defect mode of talent cultivation of practical
ability. Therefore, it must be solved in the practical talents training in higher vocational colleges to
cultivate talents and social actual demand of differences. In talent cultivation in higher vocational
institutes for in-depth analysis of the curriculum content, building with ability as the standard
curriculum, pay attention to improve students' language ability and the actual business operation
ability, improve students' comprehensive application ability, promote the improvement of our
country concerning foreign affairs secretary personnel training.
3Status and main problems of the curriculum of foreign secretary major in universities in
China
3.1 Status Quo of the foreign secretary major curriculum in universities in China
According to the ministry of education issued by national ministry of education in 2015 to further
the reform of education teaching, comprehensive several opinions to improve the quality of talent
cultivation for deepening the reform of education teaching to detailed requirements; Pay attention to
the theory with practice in teaching, professional curriculum as the core, to cultivate innovative
talents as the key. It must adhere to the comprehensive development. In the teaching process, to
comply with the basic rule of vocational education and students' physical and mental development
characteristics. In order to teach more cultivated talents, do more practice; adhere to the integration,
production and education work-integrated learning. Higher education can be combined with the
enterprise, realize the synergy between colleges, cultivating talents. It can not only benefit between
colleges, but also variety selection created a platform for the students. Course teachers in teaching
students can strengthen international exchanges and cooperation, which can promote the teaching
reform and innovation. In order to improve the economic rapid, stable and efficient development in
our country, characteristics of training talents in colleges and universities is to course for career
development as the guidance, the mode of cultivating innovative talents is the key, professional
bridging program is the core. In the process of teaching to highlight the applicability, feasibility and
operability has the strong practice and the ability to solve the problem.
With practical ability as the standard's emphasis on cultivating talents is to cultivate students'
actual operation ability, training goal is clear, at the request of such colleges and universities must
set up reasonable curriculum system, find suitable for students' learning content, teaching method,
choose to suit his own to better develop practical professional talents. Foreign secretary curriculum
should first pay attention to post demand characteristic, pay attention to training post professional
ability, reasonable learning and application of the theory with practice, to further improve the
278
students' operating ability and professional ability, combining the concrete action ability of the
students in learning the course, and gradually improve the innovative ability of students.
3.2 Main problems in the curriculum of foreign secretary major in universities in China
Institutions of higher learning in the years of the secretary major exploration has a better
development, for the country's economic development and social progress made outstanding
contributions, but there is no denying that there are still many problems in foreign secretary major
teaching. In terms of curriculum, goal, ideological deviation, it lags behind in foreign secretary
professional content. It causes in the aspect of talent cultivation from the social reality, and affect
the overall quality of talents.
Optimization analysis was carried out on the higher vocational college curriculum. In order to
meet the social development and change of the comprehensive ability talented person's demand for
high quality develop appropriate teaching methods, we need to improve foreign secretary
professional practice ability.
4. Curriculum optimization measure of practical ability of foreign secretary major

It has presented the major problems existing in the curriculum of the comprehensive analysis and
evaluation in colleges and universities of our country. Concerning foreign affairs secretary of found
foreign secretary exist more problems in the process of the curriculum, the existence of these
problems seriously restrict the foreign secretary personnel training in our country, restricting the
talent the improvement of professional quality and comprehensive ability. In order to meet the
social development and change of the comprehensive ability talented person's demand for high
quality, we must optimize the higher vocational college curriculum analysis, formulate appropriate
teaching methods, and improve foreign secretary professional practice ability,
4.1 Pay attention to ability of professional talents of foreign secretary
After China's accession to the WTO, foreign trade and economic developed in a short time rapidly.
In order to meet the social reality, professional talent training in colleges and universities, we must
pay attention to the phenomenon of the foreign-related business talent shortage. Foreign secretary
major characteristic is the cultivation of students ability of foreign language professional business
ability, belongs to mastering many skills while specializing in talent. A foreign language in today's
society is not only a language used to communicate, at the same time is also an integral part of a
skill in business activities. According to the statistics, 85% of international telephones are through
English communication, foreign companies in China's development, Chinese enterprises also want
to do the business in foreign countries, this form of enterprise general all need foreign language
professionals. In the process of curriculum, foreign-related secretary majors should be strictly in
accordance with the demand of social security and the ministry of labor standards, formulate the
reasonable curriculum content, and hire a professional teacher to teach, determine the professional
direction of foreign secretary, to be able to promote the colleges and universities to cultivate
professional talented person's demand.
4.2 Build the practical ability for foreign secretarial majors
In the process of professional secretarial curriculum, institutions of higher learning pays attention to
the cultivation of the students' basic quality and general ability, mainly consists of students' physical
and mental quality, social ability, innovation ability and the cultivation of the political quality.
Colleges and universities concerning foreign affairs secretary professional talent training belongs to
the technology applied talents training, and technical application talented person must have a skilled
professional and technical skills and theoretical knowledge. Applied talents should not only strong
business ability in the job, and should have enough communication ability, cooperative ability and
public relations ability and strong ability of social adaptation. Foreign students enter the society
after graduation in the secretary major should first learn how to be, then pay attention to the
279
cultivation of the talents of English comprehensive ability, including English, English writing
ability as well as listening and speaking skills, colleges and universities curriculum should have
English and business English writing, English audio-visual and so on. Again, the foreign secretary
professional ability of students, it includes information processing ability, file management,
business, business processing ability, and at the same time the course has marketing, international
trade practice, documents, etc.
4.3 Improve the curriculum system
In curriculum restructuring, integration, and leaning way, promote the optimization and upgrading
of foreign secretary professional curriculum constantly updating the teaching contents, to cultivate
students with strong practical ability and the technical application ability, increase training activities
related to the professional development, actively improve the students' ability to adapt.
In the process of practical teaching in order to make the curriculum content is more scientific,
can according to students' actual needs, set up relevant courses and training courses. As a result of
the limitation of realistic condition for the development of some courses, many schools may have
certain difficulty, as far as possible in the curriculum to practice class, practice class Settings,
training students' ability to apply knowledge actively, such as foreign secretary major set in the
"public relations", "interpretation", "commonly used office software application technology" and
"calligraphy" and other elective courses and training courses, improve the students' professional
skills and comprehensive qualities.
4.4 Develop active of the construction of open innovation teaching
The curriculum reform of the foreign secretary major should pay attention to absorb high theoretical
level and practical ability. In setting process of the teachers as a secretary is the core of higher
institutions learning to build the teachers, especially should pay more attention to public relations,
modern clerical and secretarial practice faculty of teachers from the aspects such as setup, and
improve teachers' comprehensive ability the secretary major. At the same time open
university-enterprise cooperation pattern, invite famous enterprise personnel to do part-time
teachers, improve the level of students' social practice, and really improve students' practical ability.
In course setting, foreign secretary professional must pay attention to the secretary major setting
and cultivate the students' vocational ability and scientific goal. According to the actual demand of
society development of English, public relations, human resources and the comprehensive ability of
the political and economic type secretarial talents, through the system study and operational
practice to make the students grasp the public relations activities and language ability, trains the
student to have the exploration, innovation ability so that after graduation can meet the needs of
business and agency unit for talent.
4.5 Carry out the curriculum education of the theory and practice combination
In the process of teaching, theory teaching system must be analyzed from the aspects of public
theory class teaching, through the teaching of theory course must make students master the
knowledge of social life. In order to improve students' comprehensive ability to apply knowledge,
the construction of professional basic course system must make the students listen to specialized
courses to master business secretary technology application ability; Once set the professional course
teaching system of science, including commercial papers and correspondence, shorthand, and
business public relations handling, etc. Practical lessons should pay attention to students' practice in
the process of the implementation of the curriculum construction, and utilize project teaching,
teaching methods such as constructing university-enterprise cooperation practice lesson, to improve
students' practice ability. Practice curriculum system in the process of the implementation must be
arranged by teachers according to students' quarter a contact by some special skills, teaching
department, under the guidance of training class and the teacher's social time activities must be able
to adapt to the development of the students, for students to provide a good environment of practice
280
learning, encourage students to take an active part in all kinds of social practice activities, improve
the students ability to apply professional knowledge.
5. Conclusion
Information and science technology promote the social progress and change the peoples life.
According to the actual needs of society, we need to cultivate marketable talents. Therefore, in the
process of teaching foreign secretary major students, institutions of higher learning should always
keep up with the market demand. In combination with the practical situation of students, for
students' curriculum in real time and the change of teaching ideas, pay attention to the improvement
of students' practical ability and application ability. Process of the curriculum of training courses,
skills courses and professional courses setting, jobs demand of the students, the curriculum and
assessment of the positive evaluation can promote the improvement of students' practical skills and
comprehensive abilities.
References
[1] Issued by the ministry of education, the ministry of education about (on deepening the reform
of education teaching, comprehensive several opinions to improve the quality of talent training),
Bulletin of the ministry of education of the People's Republic of China. 2015.7.27
[2] Teaching by principles: An interactive approach to language pedagogy. Beijing: Foreign
Language Teaching and Research Press. 2001
[3] Liu, R.P. Introduction to secretarial education professional students' practical ability, take
secretarial education in Yunnan University as an example. Journal of Yunnan Institute of
Socialism, vol.2, pp.137-139. 2014.
[4] Liang, Y. F. Higher vocational secretary concerning foreign affairs professional integration of
the construction of practice teaching system. Journal of Education and Vocation, vol. 5, pp.
156-158. 2012.
[5] Chen, S.D. On emotional intelligence and college English learning. Journal of Xian Foreign
Languages University, vol.7 (4), pp. 58-61.1999
[6] Man C.J. Higher vocational secretary concerning foreign affairs professional ability as the
standard of the curriculum, China Adult Education vol. 22(13), pp. 156-157. 2008.
[7] Wang Z.J. English major group of "1 + X" teaching mode of the construction of the project
curriculum research and practice, Journal of Education and Vocation, vol. 17(30), pp. 123-124.
2010.
281
Research on Integration of College Art Education in Yunnan into Local

Folk Art
Ju Su
Qujing Normal University, Yunnan, China
Keywords: College art education; National folk art; Integration and development
Abstract.Yunnan is a multi-ethnic province. With the rapid development of current politics and
economy, it is necessary and feasible to integrate the college art education into the local folk art in
Yunnan. In this paper, the ways of integrating the art education into the local folk music have been
discussed from the aspects of constructing the complete curriculum system, compiling the regional
and local courses, actively participating in social activities to strengthen the national art teaching
practice, dealing with the relationship among minority folk art, Han nationality and western art so
as to improve the college art education, effectively protect and inherit the outstanding national
culture and promote the construction of national culture in Yunnan province.
Since the reform and opening up, Chinas politics and economy have been rapidly developed and
the education reform has been constantly deepened. The demands for cultural life are increasing, so
the art education has been greatly stressed by country and society and it has become a necessary
part of school education. In recent years, the strategic goal of constructing the national and cultural
powerful province in Yunnan has been put forward based on the original target of constructing the
national and cultural province. Therefore, how to promote the college art education in Yunnan
province that is closely related with the development of national culture to adapt to the development
of society has become an important topic for experts and scholars. The author believes that it is
required to pay attention to the local national art resources so as to improve the college art
education in Yunnan province. Whats more, it is also demanded to integrate the local folk art into
the education practice and further study the modes of college art education.
1. Necessity of the integration of college art education into the local folk art in Yunnan
province
Under the background of economic globalization, the political and economic exchanges around the
world have become more and more frequent, which also brings more and more cultural exchanges.
As the authority of the international music education, the international society for music education
(ISME) has proposed the pluralistic development of music education for several times in previous
years since 1960s. The relationship between the local music culture and the global economy, culture
and ecology has been fully understood and a diversified cultural heritage mode based on
localization has been advocated so as to realize the transmission of national music culture and the
communication of international music culture as well as achieve the purpose of music and cultural
ecological balance. Due to the influence of historical reasons and cultural inertia, the Chinese art
education in colleges and universities is still trapped in the western single music education mode.
Therefore, in order to occupy a space in world national culture, it is required to vigorously promote
the local folk culture. As the main platform of protection and inheritage of local folk culture----
local colleges and universities, it is particularly urgent and necessary to integrate the local folk art
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
282
into the art education.
The local folk art resource refers to the traditional art resource with Chinese characteristics that
is relative to the foreign national art and the modern art in a wider scope; in a smaller scope, it
refers to the art resource with local ethnic characteristics in minority areas.[1] Whether a nation can
be independent in the worlds outstanding national forest, establishing the national consciousness,
inspirating with national spirit and strengthening the national cohesion are indispensable. The fourth
article in the first chapter of Work Regulations of Arts Education in School published by the
Ministry of Education ha explicitly pointed out that the art education aims to enable the students to
understand the excellent national art culture traditions in out country and the outstanding foreign
artistic achievements, improve the cultural and artistic accomplishment, enhance the spirit of
patriotism and cultivate the abilities of feeling the beauty, presenting the beauty, appreciating the
beauty and creating the beauty as well as establish the correct aesthetic standards. However, for the
art education in primary and secondary schools in our country, some simple, plain and
incomprehensive art knowledge has been transmitted to students. Even in some schools, the music
courses and the art courses can not be normally conducted in accordance with the teaching program
under the pressure of entering a high school, which causes that the majority of students do not fully
understand the Chinese outstanding national arts and cultures and the artistic accomplishment of
them is low. The college students also have a poor understanding for national arts and even some
students are unfamiliar with the folk music, dance and language. Whats more, with the spread of
western and modern arts, the national identity and the subjectivity of aesthetic consciousness of
students are extremely lacked, which causes the cultural norms as well as the value pursuit are lost,
the faith crisis is appeared and the moral standards are declined.[2] Therefore, it is very necessary to
integrate the college art education into the local folk art. Through learning, the students can deeply
understand the history, the culture and the arts of the nation, appreciate the unique charms of the
nation, establish the sense of national pride, enhance the national self-confidence, strengthen the
national consciousness, identify their own nation, love their own nation and love their country.
As the important part of the intangible cultural heritage, the national art has been greatly
impacted and it is facing the dying crisis with no successor due to the transformation of the social
formation of ethnic minorities, the rapid development of economy and the popularity of new media.
How to solve this problem? Undoubtedly, the art education is an effective way. There is no culture
that is not passed down and transferred by education. As the special place for culture dissemination,
the school education affects the students through a complete system and this form is unmatched and
not replaced by any means.[3] Therefore, as the important platform of the inheritance of intangible
cultural heritage, the local colleges and universities are particularly necessary in integrating the art
education into the local folk art, highlighting the characteristics of local ethnic arts and establishing
the complete courses with national charactetisitics.
2. Feasibility of integrating the coellge art education into the local folk art in Yunnan province
In 2005, the Opinions on Strengthening the Protection of Intangible Cultural Heritage in Our
Country issued by the general office of the State Council has pointed out that it is required to
establish a scientific and effective inheritance mechanism for intangible cultural heritage and have
the successors of intangible cultural heritage through social education and school education. At the
same time, in the process of western development, the politics and the economy in Yunnan province
has been rapidly developed and the strategic target of taking great efforts to build Yunnan province
as the national cultural province with obvious characteristics has been proposed, which provides
the policy guarantee for the protection and the inheritance of local folk art and that is also an
opportunity and a challenge for college art education.
As a Chinese multi-ethnic gathering place, in addition to the Han nationality, there are 25 ethnic
minorities in which 15 ethnic minorities are endemic in Yunnan province. Therefore, there exist
more abundant art resources of ethnic minorities in Yunnan. Due to the different geographical
283
environment, different history and culture, different customs and different religious beliefs, some
colorful arts with distinctive artistic characteristics and various performance modes have been
formed, such as the Haicai Tune of Yi nationality, the Achimugua of Lisu nationality, the Bai
Opera of Bai nationality and the Fly Songs of Miao nationality, etc. For example, Zhuang
nationality in Wulong of Shizong County in Qujing has several art forms such as dance, music,
embroidery, art and folk literature; the music contains the life songs, the worship songs, the love
songs and the wedding songs. These various excellent national art resources have provided the
strong material support for the implementation of integrating the colleges art education into the
local folk art and they have also offered convenience and safeguard for the development of courses.
3. Ways of integrating the college art education into the local folk art in Yunnan province
3.1 Establishing the complete curriculum system and writing the regional local course
Art comes from life. Due to the different geographical locations, the different living habits, the
different language tones and the different ethnic characteristics, the ethnic groups have different
national artistic characteristics. In the process of integrating into the local folk art, it is required to
build a complete curriculum system and it can not be limited to have the professional courses of
national arts such as the national music in Yunnan, the national music appreciation in Yunnan and
folk music courses. It is necessary to make full use of the research results of the national science,
the anthropology, the aesthetics, the folklore and the phonetics to truly understand the essence of
folk arts in depth and grasp the characteristics of folk art through the mutual penetration and
integration. Meanwhile, it is demanded to take an objective and serious attitude to examine the
national folk art and organize the systematic local art education materials so as to provide support
for constructing the national art education system in Yunnan province.
3.2 Actively participating in social activities to strengthen the national art teaching practice
As the main gathering place of ethnic minorities, each nationality in Yunnan province has its own
festivals, such as the March Three of Zhuang nationality, the Water Splashing Festival of Dai
nationality, the Munao Song of Jingpo nationality and the Torch Festival of Yi nationality, etc.
At the same time, with the rapid development of the tourism industry in Yunnan province, there are
some festivals with local characteristics that have established across the province, such as the
Cauliflower Festival, Tourism Festival of Pearl River Source and Mango Festival, etc.
Meanwhile, the large song and dance dramas of ethnic minority in Yunnan province have achieved
market success in different degrees in recent years, such as Yunnan Impression, Lishui Jinsha,
Lijiang Impression and Yunling Teana, etc. These festivals and the art works all take the
national folk arts as the carrier to spread the brilliant national culture. Therefore, under the guidance
of teachers, the students are allowed to actively participate in some activities of ethnic groups to
conduct the ethnic art practice. Then, the theory and the practice can be perfectly integrated, which
is very useful for learning and teaching.
3.3 Dealing with the relationship among the folk art of ethnic minority, the Han nationality
and the western art
There are 56 ethnic minorities in China. In the long-term national migration, differentiation and
integration process, the Chinese nation that takes the Han minority as the main body has been
formed. The ethnic culture and the Han culture are mutually penetrated and influenced and there
exists a perplexing situation, which is more prominent in Yunnan province. Therefore, in the
process of integrating the college art education into the local folk art, it is required to take objective
and scientific attitude, avoid the extremism and timely adjust the teaching contents and teaching
methods in accordance with the specific situation so as to achieve the expected teaching goal.
At the same time, in the process of integrating the art education into the local folk art, it is
required to deal with the relationship with the western arts. As the college art education, it is
284
indispensable to transmit the new concepts, the new trends and the international advanced
professional knowledge to students. Based on this, the integration with local folk art can truly
realize foreign things are made to serve China. As the saying goes, knowing the enemy and
yourself, you can fight a hundred battles and win them all. The fusion of them can effectively
protect and inherit the excellent national cultural heritage and let the words the nation is the world
to fall into effect.
In conclusion, under the background of constructing Chinese national culture, building Yunnan
province as the national cultural province and propagating the local cultures, it is increasingly
necessary to integrate the college art education into the local folk art. At the same time, the colorful
local folk art in Yunnan has provided rich art resources and facilities for the implementation of this
integration. The integration of local folk art will play an invaluable role in the protection and the
inheritage of national culture as well as the construction of national cultural province.
References
[1] Huang Xiaoming, Huang Yueguo. Research on the Exploitation of the National Artistic
Resources in the University Artistic Education[J]. Hundred Schools in Art, 2005 (5): 147.
[2] Li Xiaojuan. Reflection and Reconstruction of Culture--- Reflections on Cultural Philosophy of
Cross Century[M]. Heilongjiang: Heilongjiang Peoples Publishing House, 2000: 465.
[3] Wei Huang. Cultural Consideration on Pluralistic Music Education[J]. Music Research, 2002
(1):10.
[4] (The United States)Written by Blocker, Gene, translated by Shen Bo and Zhang Anping.
Original Art Philosophy[M]. Shanghai Peoples Publishing House, 1991.
[5] Shi Yanping. Several Categories in Localization Process of Chinese Artisti Anthropology[M].
Theory and Criticism of Literature and Art, 2013 (06).
[6] Tian Zhongjuan. Research on Interactive Mechanism between Local College Art Education and
Local Folk Art Resources Development[J]. Journal of Yunnan Arts Institute, 2013 (04).
[7] Nan Changquan. On the Localization of National Folk Art Education in Colleges[J]. Tribune of
Education Culture, 2013 (05).
285
Research on College Students' Listening Ability in View of World

Englishes
Qibin He
Beijing Wuzi University, Tongzhou, Beijing, China
englishhqb@163.com
Keywords: Listening ability; World Englishes; Foreign language; Immersion learning.
Abstract. The phenomenon of World Englishes in the international communication has been
gradually recognized by the college English teachers and students in in the process of language
teaching and learnng in China. The globalization of ecnonmics, education and cultures has made
English an important means for people to communicate with in international exchanges. Listening
ability as the critical skill in foreign language teaching and learning is the key for college students
to improve for their future professinal career development. With aims to improve college
students ability in international communication, the paper focuses on the discussion of enhancing
college students listening ability with speakers from other variety of English in the setting of
foreign language teaching and learning.
1. Introduction
The phenomenon of World Englishes in the international communication has been gradually
recognized by the college English teachers and students in the process of language teaching and
learnng in China. With the fast development of information technology, the globalization of
ecnonmics, education and cultures has made English an important means for people to
communicate with in international exchanges. Listening ability as the critical skill in foreign
language teaching and learning is the key for college students to improve for their future professinal
career development. As most of the English teachers in China of this time have received the
education of formal English from VOA and BBC, they naturally think English should be taught and
learnt with the standard of native English from speakers of British and America. Seldom do they
think that the other variety of English should be learnt in their teaching curriculum. One reason for
this is that the teaching materials provide little or no listening materials and recordings from other
variety of English, and College English Test (CET) band 4 only play the British and America
English listening recordings in the nation-wide college test. When they communicative with
speakers from other variety of English, they could hardly get mutural understanding in
communication due to the little knowledge of World Englishes. With aims to improve college
students ability in international communication, the paper focuses on the discussion of enhancing
college students listening ability with speakers from other variety of English in the setting of
foreign language teaching and learning.
2. Theoretical basis of the paper

2.1 The concept of world Englishes
With the fast spread of English and the globalization of world economics English has gained a
dominant role in the international communication. English as a means of communication has been
defined by the linguists and scholars with the terms of English as a Native or First Language (ENL),
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
286
English as an Additional or Second Language (ESL), English as a Foreign Language (EFL), English
as an International Language (EIL) and English as Lingua Franca (ELF). Prodromou (2006) argues
that Globalization is pulling English in two very different directions: the language has splintered
into countless regional varieties (from Rubdy and Saraceni, 2006, p.51). Halliday et al. claim that
English is no longer the possession of the British, or even the British and the Americans, but an
international language which increasing numbers of people adopt for at least some of their purposes,
without thereby denying (at least in intention) the value of their own languages; and this one
language, English, exists in an increasingly large number of different varieties (from Bolton,
2003, p. 23). According to the roles English plays geographically, Kachru (1992) proposes Three
Circles of English model from the societal perspective.
2.1.1 Kachrus Three concentric Circles
The concept of Kachrus (1992) Three concentric Circles may trace back to the first two
diasporas of English with the influence of Britains colonial expansion in the 15th and 19th century
and the emergence of the American power in the 20th century. The first diasporas of English make
up the Inner Circle in which Britain, America, Canada, Australia and New Zealand are included as
the English as native language (ENL); the second diasporas of English form the Outer Circle in
which countries of Singapore, Malaysia, Philippine, Kenya, Nigeria, Zambia, Sri Lanka are named
as English as second language (ESL), the characteristics of English in the outer circle is that it is
used as an official or additional language in addition to the local language, and English in these
regions has been localized and nativised with the local culture and custom and has presented with
the characteristics of localized usage and pronunciation. The Expending Circle that defines as the
English as Foreign language (EFL) includes the countries that have never been colonized by the
British Empire, and the characteristics of the circle is that the regions where the performance
varieties of the language are used in EFL contexts (i.e., varieties that lack official status and are
typically restricted in their uses) (Kachru, 1992. p.357).
2.1.2 Kachrus six fallacies in elt
According to Kachrus Three Circles of English, English in China belongs to the Expending Circles
which is a taught subject in all the levels of educational institutions. Gupta says that In the
Expanding Circle English is predominantly a non-native language, used in very restricted domains,
and learnt in scholastics settings(Gupta, 2006, p. 95). English in China presents the characteristics
of Kachrus Six Fallacies of English on the English Language Teaching and learning in the
Expending Circle. Kachru argues that (1) in the Outer and Expending Circles, English is
essentially learned to interact with native speakers of the language; (2) English is necessarily
learned as a tool to understand and teach American or British cultural value, or what is generally
termed the Judeo Christian traditions; (3) the goal of learning and teaching English is to adopt the
native models of English; (4) the international non-native varieties of English are essentially
interlanguage striving to achieve native-like character; (5) the native speakers of English as
teachers, academic administrators and materials developers provide a series input in the global
teaching of English, in policy formation and in determining the channels for the spread of the
language; (6) the diversity and variation in English is necessarily an indicator of linguistic
decay(Kachru, 1992, pp.357-359 ).
2.1.3 The standard of English
As English has been widely used and recognized as the global language in the world, the diversity
of the world Englishes has made learners in the Expending Circle work harder to distinguish the
standard of English. Rubdy & Saraceni argues that because the range and variety of contexts in
which English is used has increased exponentially, more and more non-native speakers find
reasons to communicate with each other using the language, and many scholars are facing the
challenging questions of what the standard English is and what the varieties of English are. (Rubdy
& Saraceni 2006, p.5).
Kachru suggests that the diversity of the world Englishes makes two forms of English language,
that is, the English language standard providers and the English language standard dependent.
287
Because of the diversification of the English language, the English language providers have two
standards: the first is that of the United States, Britain, Australia and other countries taking English
as the mother tongue; the second is that of Singapore, Nigeria, Kenya and India and other outer
circle countries taking English as the second language or the official language (Kachru,1996).
"Teachers already have a hard time dealing with the differences between British and American
English. If further pluralisation of Englishes is to be accepted, would this not add to their difficulty,
particularly where English is largely learnt as a foreign language, "(Rubdy and Saraceni , 2006,
p.30).
2.2 Theoretical basis of listening skills
2.2.1 Second language acquisition
Second language acquisition is a term for which language learners acquire the language in
addition to their first language in and out of the classroom teaching and learning. Ellis argues that
For one thing, in this context, second can refer to any language that is learned subsequent to the
mother tongue. Thus it can refer to the learning of a third or fourth language. Also, second is not
intended to contrast with foreign. Whether you are learning a language naturally as a result of
living in a country where it is spoken, or learnoing it in a classroom through intruction, it is
customary to speak generically of second language acquisition. L2 acquisition, then, can be
defined as the way in which people learn a language other than their mother tongue, inside and
outside of a classroom. (Ellis, 1997, p.3).
Ellis further argues about the goals of the second language acquisition. One is the description
of L2 acquisition, and the other is the explanation which identify the external and internal factors
that account for why learners acquire an L2 in the way they do. One of the external factors is the
social milieu in which learning takes place. Social conditions influencethe opportunities that
learners have to hearand speak the language and the attitudesthat they develop towards it. Another
external factor is the input that learners receive. Language learning cannot occur without some input.
A question of considerable interest is what type of input facilitates learning (Ellis, 1997, p.4-5).
2.2.2 Krashen's English language input hypothesis
As the main language teaching skill, English listening ability to understand language input is an
important basis to encourage learners to express their spoken language. Krashen proposed the
language input hypothesis in 1982 through the important concept of the comprehensible input of
learners who take English as first language. Krashen argued that an important condition for
language acquisition is that the structure of the input language that learners understand should be
slightly higher than the current level of competence. If the learner's current level is i, the input
content should be i+1, where 1 indicates the slightly higher level than that of i. In other words, the
language learning materials presented to learners must be higher than the current level and allow
learners to understand most of the content, but it is more challenging to make learners progress. The
important principle of Krashen's language input hypothesis is that the spoken language output is not
directly or quickly learnt in the classroom. Only if the learner constructs an adequate
comprehensible language input (i+1), the expression of the language can be achieved. The best
language acquisition takes place in an environment of low emotional anxiety and no defense that is
in the context of the affective filter advocated by the Krashen (Krashen, 1981, p.100).
2.2.3 Language input and intake
Perhaps human beings have a natural tendencyto look at speaking as the major index of language
proficiency. In the decades of 1950 and 60s, language teaching methodology was preoccupied with
the spoken language of performing oral drills full of the classroom. It was not uncommon for
students to orally practice phrases they didnt even understand!(Brown,2001,p.233). Krashens
comprehensive input is significant in developing learners listening ability. And at the same time,
some other researchers stress the importance of mental processes brought to bear on learners
converting input into intake. The conversion of input into intake is absolutely crucial in considering
the role of listening in language learning. As learners could be exposed to great quantities of input,
288
but what accounts is the linguistic information learners ultimately glean from the exposur through
conscious and subconscious attention, cognitive strategies of retension, feedback and through
interaction. Therefore, in teaching listening, teachers should ask youself about what students have
taken in from perhaps from perhaps a whole array of comprehension activities (Brown,2001,
p.234).
3. English listening skills in the context of foreign language learning

3.1 English listening ability and the standard of English in the context of world Englishes
In the context of World Englishes, Standard English is notoriously hard to define (Trudgill, 1999,
from Rubdy and Saraceni, 2006, p.96). The concept of Standard English is very weak indeed in
speech. There are standard pronunciations of words, but there is no standard accent. People find it
easier to understand familiar accents than unfamiliar ones. This gives rise to problems of
intelligibility or comprehension between people from different places. The more localized the
accent, the more likely it is to present problems to hearers elsewhere (Gupta, 2006, p.96-97).
English as a foreign language in China has always been educated with the norms of British
English and American English. As the standard dependent speakers of English in the expending
circle, the diversity of English has undoubtedly added great deal of difficulties and Challenges in
learning various varieties of Englishes. Kachru (1996) suggests that we should not only recognize
the complexity and depth of world Englishes, but also understand the knowledge of various types of
English.
In teaching listening skill, teachers should consider students comprehensible ability and teach
students with the input within students knowledge ability or a little higher than their ability so that
students may have less anxiety in listening and can focus their attention on the details of the
listening materials, process the information efficiently and convert input into intake so that students
may make progress in the step by step practicing of listening comprehension.
In order to keep up with the fast advancement of society, both teachers and students should have
the awareness of World Englishes and face the challenges to get familiar with various types of
English language pronunciation, intonation and accents as many as possible, lay a solid foundation
of English knowledge, know of cultures, customs and habits of various kinds of English speaking
countries. By so doing, college students will be able to communicate with people from different
varieties of English in their future professional careers.
3.2 Modern teaching technology aided listening comprehension
With the information technology, network, multimedia widely used in college English language
teaching and learning, many language laboratories have been set up for college students to have the
listening lessons inside the class and the online self-access learning outside the class. The computer
and web-based listening training and practice may allow the learners to be immerged in the
authentic language environment with richness of video and audio resources to improve their
listening ability.
One advantage of online practicing listening is that it can help the development of individualism
in learning. As students listening comprehension is quite different in level when they are enrolled
into the university, and teachers teaching of listening comprehension might not satisfy all the
students need in one class period. By introducing the background knowledge, culture tips, difficult
words, idioms and sentence structures in the listening materials, teachers may allow students to
listen to the listening materials by themselves. With this teaching strategy, students may practice
their listening in their own pace. If a student is weak in listening, he may first listen to the material
in slow speed and listen to it over and over again until he can fully understand the text of listening
material. If students cannot identify the meaning of certain words and phrases with the
pronunciation of the words and phrases in the listening materials, he might read the transcript while
he does the listening. This kind of listening strategy may help students match the pronunciation with
289
the meaning of the words that students didnt understand by listening, distinguish the pronunciation
of unfamiliar words and understand the whole text of listening materials . With the knowledge of
the listening material, students may listening to the recording once again with no reading of the
listening materials.
The other advantage of online listening is that students may practice their English with resources
of different varieties of English from the multimedia and hypertext. The limited class hour cannot
meet all the students need with over 40 students in one classroom. Therefore, digital language
laboratory-supported foreign language listening is the best platform for students to acquire their
listening ability.
4. Conclusion
In the era of globalization in economy and education, China needs the talents who can be both
competent in professional knowledge and international communicative ability. College English
carries the responsibility of developing students language communicative competence. Listening as
the key skill in foreign language learning may have great influence on the effectiveness of
international communication. And the cultivation of professional talents need English educators and
learners at all levels to pay more attention to the trend and dynamics of the language development,
make full use of the advantage of the language soft power to promote Chinese society development.
And at the same time, the writers and publishers of English language teaching materials should
provide more language knowledge and audio and video materials about World Englishes to help
teachers and students get familiar with the English from various varieties.
Last but not least, teachers should grasp the modern teaching technology and be able to teach
students with the up-to-date technique. As students of nowadays are the aboriginal dwellers of
information and computer technology, teachers should understand students learning styles in the
era of internet of things. The future world will belong to the people who can follow the footsteps of
the times and meet with the challenges as well as opportunities.
5. Acknowledgement
The paper is financially supported by the research of Construction on Computer and Web-Based
College English Practice & Training Base established by the Educational Reformation Program
2015 in Beijing Wuzi University.
References
[1] Bolton, K. (2003). Chinese Englishes A Sociolinguistic History. Cambridge: Cambridge
University Press.
[2] Brown, H. D. (2001). Teaching by Principles: An Interactive Approach to Language Pedagogy.
Beijing: Foreign Language Teaching and Research Press.
[3] Brown, H. D. (2002). Principles of Language Learning and Teaching. Beijing: Foreign
Language Teaching and Research Press.
[4] Ellis, Rod (1997). Second Language Acquisition. Oxford Introductions to Language Study.
New York: Oxford Press.
[5] Gupta, A.F. (2006). Standard English in the World. In Rubdy & Saraceni(Eds.), English in
the World Global Rules, Global roles. London: Continuum.
[6] Krashen, S. (1981).Second Language Acquisition and Second Language Learning. Oxford:
Pergamon Press.
290
[7] Kachru, B. B. (1992). The second diaspora of English. In T. W. Machan & C. T. Scott (Eds.),
English in its social contexts: Essays in historical sociolinguistics (pp. 230-252). New York:
Oxford University Press.
[8] Kachru, B.B. (1996). http://www.jalt-publications.org/tlt/files/96/oct/englishes.html.
[9] Prodromou, L. (2006). Defining the Successful Bilingual Speaker of English. In Rubdy &
Saraceni(Eds.), English in the World Global Rules, Global roles. London: Continuum.
[10] Rubdy & Saraceni. (2006). English in the World Global Rules, Global roles. London:
Continuum.
291
Research on Pragmatic Competence in Business English

Communication
Qibin He
Beijing Wuzi University, Tongzhou, Beijing, China
englishhqb@163.com
Keywords: Globalization; Business English; Language and culture; Pragmatic competence;

Foreign language learning.
Abstract. Pragmatic use of business English has been one of the ability business students should have
in their future business careers. With the presence of global village and the phenomenon of World
Englishes, students ability to communicate with speakers from different cultures and varieties of
English has been the key to successful business activities. Pragmatics as the study of meaning in
using or in context explains how language users can overcome apparent ambiguity to recognize the
meaning of communication and reach mutual understanding. With a view to improve business
students pragmatic competence in business communication, the paper will probe into a brief
discussion on the principles of pragmatics and business students communicative competence in the
context of foreign language learning.
1. Introduction
The globalization in economics has made international trade increasingly frequent. Many large and
small multinational companies need business professionals to be competent both in professional
knowledge and cross-cultural communicative competence. English as the key working language is the
main means to carry on the introduction of new technology, the project of foreign trade and overseas
investments, transnational management and international tourism. The four skills of listening,
speaking, reading and writing are the basic foundations in international trade management. And
pragmatic competence is crucial in business negotiation, as pragmatic competence is the ability to
understand the speakers intention. In business activities whether business partners can correctly
understand each others real conversational intentions is the key to successful enterprise operation.
And a successful profession talent should have rich overseas business operational experience and a
better international communicative competence as well. Business students with a solid language
foundation, professional knowledge and a sound communicative can better meet the need of Chinas
economic development. Pragmatic competence in business activeties is one of the abilities that
business students should have in their future business careers.
2. Theories of pragmatics in language communication

Pragmatics is a branch of linguistics and a study of language meaning in using or in context in
conversations (Thomas, 2010, p.1). Pragmatics includes speech act theory, conversational implicature,
discourse and behavioral approaches of language in philosophy, sociology, linguistics and
anthropology. The significance of the research on pragmatics lies in that discourse transmitted
between speakers and listeners depends not only on such language knowledge as grammar,
vocabulary and language structures, but also on discourse context, related existing knowledge and
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
292
listeners inference on speakers intentions and other related factors. Therefore, pragmatics is to
explain how language users can overcome apparent ambiguity to recognize the meaning of
communication and reach mutual understanding. As speakers frequently mean much more than their
words actually say (Thomas, 2010, p.1), understandings of the discourse meaning ought to be
reached mostly on the methods, place and time of language being used when the discourse occurs.
2.1 Speech act theory in language communication
Speech act theory is an important theory in the pragmatic study of language. It was first proposed by
British ordinary language philosopher, John, L. Austin in 1950s. Before Austin, the school of western
linguistic and analytic philosophy focused exclusively on statements, assertions, propositions, and on
linguistic acts of having truth-value. Ordinary language philosophers led by Austin direct their
attention to observing how people apply language to communication effectively and how to do things
with words in daily life. Austin believes that language is not only the literal meaning of words and
phrases, people can not only use language to say things, but also use language to do things and
conduct things. When a speech is uttered, an act is implemented at the same time as well (Thomas,
2010, p. X).
According to speech act theory, the speaker may conduct three acts of speech simultaneously when
the speech is spoken, that is locution, illocution and perlocution. Locutionary act refers to the actual
words uttered (Thomas, 2010, p. 49). It expresses an act of literal meaning through syntax,
vocabulary and phoneme. Illocutionary act studies the force and interaction behind the words
(Thomas, 2010, p. 49). It is an act to express the speakers real intention. Perlocutionary act is the
study that reflects the effect of the illocution on the hearer (Thomas, 2010, p. 49). It is an act that the
result or variation is caused by discourse and is an act completed through saying things.
2.2 Theory of conversational implicature in language communication
Conversational implicature that is first proposed by American philosopher Grice is recognized as the
core of pragmatics. It plays a very important role in speech communication. Speech act theory
represented by Austin aims at illustrating how the speaker do things with words, while Cooperative
Principle and conversational implicature proposed by ordinary language philosopher Grice
illustrates how the listener get the implicit message beyond the literal meaning of words, that is, the
speakers implication or implicature.
Grices theory of implicature mainly includes conventional implicature and conversational
implicature. Their common properties are that both of them express the additional level of meaning
beyond the semantic meaning of the words uttered; the difference between conventional and
conversational implicature is that in the case of conventional implicature, the same implicature is
always conveyed, regardless of context, whereas in the case of conversational implicature, what is
implied varies according to the context of utterence (Thomas, 2010, p.63). In order to make the
words uttered conform to the generally accepted purpose or direction of the conversation in the
process of communication, Grice proposes four conversational maxims, which are formulated as
follows:
1) the maxim of quantity: You shouldmake your contribution as informative as is required (for
the current purpose of the exchange); do not make your contribution more informative than is
required.
2) the maxim of quality : Do not say what you believe to be false.
Do not say that for which you lack adequate evidence.
3) the maxim of relation: Be relevant.
4) the maxim of manner: Avoid obscurity of expression.
Avoid ambiguity.
Be brief (avoid unnecessary prolixity).
Be orderly.
293
(Thomas, 2010, p.63)
In order to achieve the goals in business communications, both the speakers and listeners should
abide the conversational principle to try to reach a tacit understanding so that conversations and
negotiations can be smoothly carried on.
2.3 Politeness theory in pragmatics
Politeness has long been concerned in the field of pragmatics. It becomes a hot topic in the research of
pragmatics since late 1970s, and politeness theory has almost deemed as a subdiscipline of pragmatics.
Under the heading of politeness, five separate, though related sets of phenomena of politeness are
discussed. These five kinds of politeness are:
Politeness as a real world goal;
Deference
Register
Politeness as a surface level phenomenon
Politeness as an illocutionary phenomenon.
(Thomas, 2010, p. 149)
The fifth phenomenon of politeness falls into the category of pragmatic research with its
representatives of Leech (1980, 1989), Brown and Levinson (1987 [1978]). They interprete
politeness as a or a series of strategies employed by a speaker to achieve a variety of goals such as
promoting or maintaining harmonious relations. These strstegies incluld not only the conventional
politeness strategies, but also many form of conventional and non-conventional indirectness. Leech
sees politeness as crucial in explaining why people are often so indirect in conveying what they
mean. (Thomas, 2010. p. 158).
Pragmatic principle proposed by Leech emphasizes that Minimize (all things are being ecqual)
the expressions of impolite beliefs. Maximize (all things are being ecqual ) the expression of polite
beliefs. In order to make people abide the pragmatic principle, Leech proposed six maxims of
politeness in 1980, that is, tact maxim, generosity maxim, approbation maxim, modesty maxim,
agreement maxim and sympathy maxim (Thomas, 2010. p.157-165). Leech politeness principle
helps explain why the speakers often use indirect discourse to convey communicative intentions.
Politeness theory which was put forward in 1978 and revised in 1987 by Brown and Levinson is
the most influential in pragmatics. The core of politeness theory is the face problem. The term of
face was introduced from Chinese words dioulian in 1876. And then phrases like losing face and
saving face have been widely used. The concept of face was first proposed by Goffman and
applied in the research field of politeness theory in 1967 (Thomas, 2010.p.168). Within politeness
theory, face is best understood as every individuals feeling of self-worth and self-image. As image
can be damaged, maintained or enhanced through communication and interaction with others. face
presents two aspects, one is the positive face and the other is the negative face. An individuals
positive face is reflected in his or her desire to be liked, approved of, respected and appreciated by
others. An individuals negative face is reflected in his or her desire not to be impeded or put upon, to
have the freedom to act as one choices(Thomas, 2010. p.169).
Brown and Levinson believe thatcertain illocutionary acts are liable to damage or threaten a
persons face, such acts are known as face-threatening acts (FTA). An illocutionary act has the
protential to damage the hearers positive face or hearers negative face, or an illocutionary act may
protentially damage the sprakers positive face or speakers negative face. In order to reduce the
possibility of damadage to the hearers face or the speakers own face, the speakers may adopt certain
face threatening-acts strategies by calculating the size of the FTA on the basis of the parameters of the
power, distance and rating of imposition(Thomas, 2010.p.169).
Some critics argues that no matter it is the face problem or the theory of politeness, the cases
discussed in these theories have only been concerned in the context of Western cultures. It might not
be able to apply to the cases from other cultures around the world.
294
2.4 Pragmatic meaning in the context of culture
It is commonly recognized that language and cultures are closely related. Language is the principal
means whereby we conduct our social lives. When it is used in contexts of communication, it is bound
up with culture in multiple and complex ways.
Firstly, words people uttered refer to common experience. They express facts, ideas or events that
are communicable and also reflect their authors attitudes and beliefs, their point of views and also
those of others. Therefore, language expresses cultural reality.
Secondly, members of a community or social group do not only express experience, they also
create experience through language with its verbal and non-verbal aspects. So, language embodies
cultural reality.
Finally, Language symbolizes cultural reality. Language is a system of signs that is seen as
having itself a cultural value. Speakers view their language as a symbol of their social identity. The
prohibition of its use is often perceived by its speakers as a rejection of their social group and their
culture.(Kramsch, 2000, p. 3).
Language can be viewed as verbal expression of culture and is used to convey culture. Peoples
thinking is usually influenced by the language they use, and the custom and values in the country
people grow up shape the way in which people think to a certain extent. Kramsch (2000) states that
in order to understand what was going on, it is not enough to understand and write down the
meaning of the words, one had to link their words, beliefs and mindsets to a larger context of the
culture(Kramsch, 2000, p. 26). Since language is part of culture, culture always plays an important
role in the use of language (He & Chen, 2004, p. 16). Every student of language or society should be
familiar with the essential idea of linguistics relativity, the idea that culture, through language, affects
the way we think, especially perhaps our classification of the experienced world (Kramsch, 2000, p.
89).
Pragmatic meaning is culturally realized in verbal exchanges. Meaning is created not only
through what speakers say to one another, but through what they do with words in order to respond to
the demands of their environment (Kramsch, 2000, p. 26).
3. Pragmatics in business English
3.1 The phenomenon of varieties of Englishes

English is the global language (Crystal, 2005, p.1). There has never been a language so widely
spread or spoken by so many people as English(Crystal, 2005, p.139). Prodromou (2006) argues that
globalization is pulling English in two very different directions: English has splintered into countless
regional varieties, some with a high degree of self-regulation and divergence from English as a Native
Language (ENL) (Prodromou, 2006, from Rubdy & Saraceni, 2006, p.51).
Kachrus three Concentric Circles presents the features of English with reference to the historical,
sociolinguistic and literary context. English in the Inner Circle countries as Britain, America, Canada,
Australia and New Zealand are defined as the ENG as result of the first disapora of English in the 16th
century, and English in the Outer Circles countries as India, Nigeria, Bangladesh, Pakistan, Malaysia,
Tanzania and Kenya are named as a second language (ESL) as the second disapora of English from
the 18th century. The second disapora of English is typical for the reasons that English in these
regions has been localised with the presents of new varieties, English spoken in some regions are hard
for people outside the varieties to understand, and it would not surprisingly add the degrees of
difficulty to the speakers from the Expending Circles. Rubdy and Saraceni argue that teachers
already have a hard time dealing with the differences between British and American English. If
further pluralisation of Englishes is to be accepted, would this not add to their difficulty, particularly
where English is largely learnt as a foreign language, (Rubdy & Saraceni, 2006, p. 30).
295
3.2 Business English learning in the diversity context of world English
In the context of foreign language, learners of business English in China should have met with the
challenges of communicating with speakers from Inner and Outer Circles, and with speakers among
the Expending Circles. As English in China is a foreign language with little contact of English
environment. Business English students with aims to engage in International trade mainly learn the
language in the English classes. Chinese English teachers give most of the courses in language
knowledge and business English. Only spoken English are usually taught by the teachers mostly from
speakers of the Inner Circles. With no or little knowledge of World Englishes, underegraduates of
businiess students would not quickly get mutual understandings in business activities.
Computers and internet connections, for one thing, enable business English students to learn the
Business English Practice course in the digital language laborotories. Software companies develop
and design training and practice platform for various business course. Such platforms as 3D Virtual
Business English Comprehensive Training System, 3D VR International Business English
Negociation Training System, 3D Business English Situational Spoken English Training System,
Cross-border Electricity Business Platform, and so on and so forth. These training platforms provide
students with the authentic business training practice. Business English students may learn
professional business knowledge and techniques of doing business in the VR business practice
environment. By immersion in the computer and web-based simulation training environment,
business English students may be better equipped with the business English practice techniques and
intercultural communicative competence. So, the construction of language laborotories for the
business English majors is of great importance for the future business talents who can confront with
the challenges of the fast world development both in economics and in the fast spread of English
varieties.
3.3 Pragmatic ability in business English
In the diversified world of English language, international trades in English not only carry on between
native-English and non-native English speakers, but also conduct frequently among non-native
English speakers. In pragmatic research, the model of face problem and politeness theory proposed
by Brown and Levinson is mainly proposed exclusively on the basis of Western culture with no
reference of politeness in other cultureal context, the politeness theory might not fully explain the
politeness phenomena in the context of Oriental culture and other areas in the world (Ran,2010, from
Thomas, 2010.p.xviii). Therefore, business English students, once engaging in trade activities, need
to understand the target countrys language knowledge, pronunciation rules, customs, habits, cultures
and pragmatic use of target countrys English. In addition, the business Engliosh students should
understand the differences among the business partnerscultures and the development of world
English tendency. By so doing, appropriate application to the methods and norms of pragmatic use of
English could be reached in trade and transnational business management.
4. Conclusion
With the repid acceleration of globalization in economics, business English students with the sound
professional knowledge and prgmatic use of business Englisn competence may best meet the need of
Chinas fast societal development. In the context of World Englishes, it is crucial important for the
business English students to be able to avoid the ambiguous meaning and communicate successfully
in the international trade and transnational enterprise management. Pragmatic competence in
communication is one of the important guarantee in the successful business negociation and
international business management.
296
5. Acknowledgement
The paper is financially supported by the research of Construction on Computer and Web-Based
College English Practice & Training Base established by the Educational Reformation Program
2015 in Beijing Wuzi University.
References
[1] Crystal, D. (2005), English as a Global La nguage. Cambridge: Cambridge University Press
[2] Brown, P. & Levinson, S.C. (1987 [1978]). Politeness, Some Universals in Language Usage.
Cambridge: Cambridge University Press.
[3] H,Ziran. & C,Xinren.(2004). Contemporary Pragmatics. Beijing: Foreign Language Teaching
and Research Press.
[4] Kachru, B. B. (1992). The second diaspora of English. In T. W. Machan & C. T. Scott (Eds.),
English in its social contexts: Essays in historical sociolinguistics (pp. 230-252). New York:
Oxford University Press.
[5] Kramsch, C. (2000). Language and Culture. Shanghai: Shanghai Foreign Language Education
Press.
[6] Prodromou, L (2006). Defining the Successful Bilingual Speaker of English. In Rubdy
&Saraceni (Eds.), English in the World Global Rules, Global roles. London: Continuum.
[7] Rubdy &Saraceni (2006), English in the World Global Rules, Global roles. London:
Continuum.
[8] Thomas, J. (2010). Meaning in Interaction: An Introduction to Pragmatics. Beijing: Foreign
Language Teaching and Research Press.
[9] The relationship between language and culture http://www.education.com/pdf/culture-language/.
297
Study of the Flying Geese Paradigm in the Development of Innovative

Talents in College and University
Yong Lia, Xiaohu Wangb, Liquan Hanc, Weijia Sund
College of Computer Science and Engineering, CCUT, Changchun, Jilin, P.R.China
a
21298416@qq.com, bwangxiaohu@mail.ccut.edu.cn, chanliquan@mail.ccut.edu.cn,
d
sunweijia@mail.ccut.edu.cn
* Yong Li
Keywords: Flying geese paradigm; Developmental process; Innovative talents
Abstract. The research regarding the description and analysis of the mode for the developmental
process of innovation-oriented education in the higher education system is primarily focused on the
qualitative analysis of condition development, sources of influence, the developmental environment,
and the modes of teaching while ultimately identifying that the existing development process of
innovative talents takes many forms. Therefore, the results produced cannot provide an accurate,
intuitive, or visual description of the analysis and development rules for the internal process. Based
on the actual circumstances for the development of innovative talents enrolled in college and
university, the author utilizes the rational components of the flying geese paradigm (FGP) to build a
mode and reconstruct the developmental process for innovative talents in college and university,
outlines its dynamic development process, puts forward the flying geese paradigm for the
development of innovative talent, and elaborates on its connotations, conditions of formation, and
expression forms.
1. Introduction
Wen Jiabao, while presenting to both young and middle-aged scientists during a tour of
investigation at the School of Life Sciences of Peking University, pointed out that the scientific and
technological personnel enrolled in college and university are an indispensable key force in the
development of Chinas science and technology undertakings. He stressed that making this
scientific and technological power come into role needs to take full advantage of the offerings
available in the universities of science and technology, set sights on the national goals and the
forefront of world science and technology, as well as vigorously promote both basic and high-tech
research in China. Additionally, he stressed that it needs to create a favorable environment and
positive conditions for the growth of exemplary talents, especially young scientists and technical
workers. [1] The Outline of Chinas National Plan for Medium and Long-term Education Reform
and Development also proposed that efforts should be made to select the pilot areas for the reform
of the development of high-ranking innovative talents, as well as to explore the available channels
for the development of innovative talents throughout all areas and levels of education. Innovation is
the primary driving force for social development, as well as is the soul of the national progress and
development and the main factor related to a persisting and flourishing development and prosperity
of China. The spirit and ability of university students in innovation determine, in large measure, the
competitiveness of societal life in the future. This necessitates both colleges and universities to pay
close attention to their development of innovative talents.
The implementation of an innovation-oriented education is a complex and systematic project.
The development of innovative talent must be an organized and dynamic process. According to, the
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
298
development status of innovation-oriented education in China at present, it is essential for the
reconstruction of the developmental process of innovative talents to achieve the goal of the
development of innovative talent in colleges and universities; it is necessary to create a new
development mode that can meet the actual situations and promote the talent quality based on the
people-oriented principle, with consideration to differences between individuals.
FGP, a mode of economic development proposed by a Japanese economist, mainly refers to the
industrial gradient development and economic operation mode in Asian countries, with Japan
regarded as the lead goose. [2] According to the actual circumstances of the development of
innovative talents enrolled in college and university, the rational components of the FGP
development mode can be emulated to reconstruct the process of developing innovative talents,
promote the growth of innovative talents, and promote the gradient quality found in search of
innovative talents.
2. Connotations of FGP in the development process of innovative talents in college and

university
In the traditional FGP, Japan, regarded as the lead goose, is at the forefront of science and
technology and economy. The country leads the economic growth of the region through the supply
of capital technology, market absorption, and the transfer of traditional industries. Four Asian
Tigers, referred to as the side geese and recipient, actively leverage Japans capital and
technology market to develop capital and technology-intensive industries, and transfer the
labor-intensive industries having lost market competiveness to ASEAN countries which are the
which they do not possess competiveness to hindmost geese of ASEAN countries. [3] Thus, it
completes the industrys flying geese paradigm. The author puts forward the FGP for application
to the process of developing innovative talents in college and university, by extracting the lessons
learned from the rational elements of the FGP development mode in economics and combining with
the authors years of experience in teaching and guiding his students scientific and technological
innovation and entrepreneurial teams.
Based on the traditional FGP and differences in various aspects of the innovation quality found
in innovation-oriented education systems, a corresponding flying geese paradigm will be formed
naturally during the developmental process of innovative talents in university. For example, in the
science and technology innovation and entrepreneurship teams at these universities, the project
leader embodies the role of the lead goose, encouraging the team to engage in scientific research
and organizing their development, while also serving as a fore-goer in the development process of
innovative talents. The team members, taking the role of the side geese, are the majority of the
population of geese in the mode, the research project and the recipient in the development process
of innovative talent. Other students who are outside the scientific and technological innovation team,
the hindmost geese, are those whom are late to the process of developing innovative talents. With
the growth of the innovative talent development process, the deepening of an innovation-oriented
education, as well as the continuous injection of fresh blood, the side geese, becomes lead
geese while the hindmost geese joins the side geese. Due to its cyclical nature, as well as
through sustainable development, the process ultimately promotes the overall gradient improvement
for the training quality of innovative talent.
The connotations of the FGP, in the process of developing innovative talents in college and
university, are embodied in the following two aspects:
(1) There are differences in the innovation ability found among members of the geese
Sternberg believes that the nature of creativity is made up of six parts: intellectual abilities,
knowledge, style of thinking, personality, motivation, and environment. [4] The creativity of
innovative talents is unbalanced. Likewise, the development of innovation abilities is also
unbalanced with large differences found among the talent. The FGP for the development of
innovative talents in college and university directly reflects this difference. In this process,
innovative talents differ drastically in terms of the environment, conditions, and training objectives
299
found in different stages. Therefore, the process for the development of innovative talent requires
the formulation of different standards appropriately designed for different individuals, places, and
times, as well as must leverage the different methods used to achieve the desired training objectives.
(2) In the process of developing innovative talents, the growth of talent is gradual and dynamic.
The growth of innovative talent in college and university cannot be achieved overnight.
According to the FGP for the development of innovative talents, a conclusion can be drawn:
Because the growth of innovative talents is gradual, the innovation ability is acquired in different
stages, when the innovation quality of education and the positions found among the talents are
different. As a result, the growth of the innovative talents is a ladder-type development process.
Furthermore, the growth of the innovative talents is also a process for dynamic improvement. The
development of this process is inconsistent in different stages for different trainees. The process for
the transfer of knowledge is both a fast and slow process, but generally witnesses an upward trend
regardless of speed.
3. Main conditions for the formation of the FGP for the development of creative talents
The conditions for the formation of the FGP for the process of developing innovative talents must
mirror its nature. According to the authors many years of teaching, his scientific research
experience, and the research of innovation-oriented education, the author believes that the existence
of the FGP for the development of innovative talents mainly depends on the following conditions:
(1) Comparative advantages among the members of the flock of geese
Due to the intelligence, age, knowledge learning scale, and different development of the
individual, the geese members inevitably will have comparative advantages among them with the
most rapidly developing members becoming lead geese. The lead geese assume the leadership
role while the majority of team members temporarily fall into the role of side geese. The geese
with the slowest development, or the new members, are known as the hindmost geese.
The comparative advantage is the primary cause for generating the FGP and is the driving force
behind the growth of the members of the flock of geese.
(2) Knowledge transfer among the members of the flock of geese
The comparative advantage among the members of the flock of geese is reflected in their
differences regarding their grasp of knowledge and innovation ability. This difference will
inevitably lead to the transfer of knowledge among its members [6]. This knowledge transfer is the
main purpose of the developmental process of innovative talent.
In contrast to members with comparative advantages, the remaining geese fall into two groups
comparative disadvantage and relative potential. Knowledge transfer can gradually cancel out the
comparative disadvantages of other members, tap their relative potential, promote the development
of the whole team, and enhance the gradient training quality.
(3) The geese have a vertical labor division and form the progressive development structure
According to the FGP, the vertical division of labor is adopted for certain geese due to the
comparative advantages of the members. The differences among members exist objectively and
need to be compensated by knowledge transfer. However, the FGP will exist until the potential
balance of knowledge among the members is achieved. At the same time, the flock of geese will
form a ladder-type progressive development structure because the level of knowledge among each
member (including lead geese) is transferred from strength to strength. However, this ladder-type
progressive development is uneven among members since the more rapidly developing side goose
members will form new lead geese in the flock and the members with slow development become
side geese (or remain hindmost geese) in the flock. This is the reason that the FGP will persist
for a long period of time in the development process of innovative talent.
4. Four manifestations of the FGP for the development process of innovative talent
Based on the analysis of the formation conditions of the FGP for the process of developing
300
innovative talents, there are four seen manifestations of the FGP: (1) basic type; (2) development
type I; (3) development type II; (4) development type III.

Fig. 1.Basic type of the FGP for the innovative talent development process
The basic type of the FGP for the innovative talent development process describes the inverted
V-shaped curve of the FGP for the relationship found among innovative team members (as shown
in Fig. 1). It is the dynamic and visual description of the connotations of the FGP found in the
process of developing innovative talents in college and university. As seen in the basic type, there
are few members that are placed in the lead goose position. They are pioneers in the innovative
talent development process and, as members with strong innovation ability, lead the team to engage
in scientific research and organize team development. The side geese are in the majority of geese
found and are those to engage in the training aimed towards encouraging their development to
become innovative talents. Although they are at a disadvantage in innovation ability compared to
the lead goose, they are able to narrow the gap, or even surpass the lead goose to become lead
geese themselves by way of successful training. The hindmost geese are latecomers in the
innovative talent development process. From the minority, the hindmost geese will have some
members capable of stepping up efforts towards their own innovative capacity and strive to catch up
with the superior geese.
During the process of developing innovative talents, there will be a multitude of innovation
teams within a specific discipline at a university. There will also be crossover and penetration
between differing innovation teams. Similarly, there will also be crossover and penetration found
among innovation teams in different disciplines at a particular university, as well as crossover and
penetration among innovation teams in varying colleges and universities. Based on this basic type,
coupled with the law of the development of innovative talents in college and university, the author
further proposes three development types of the FGP for the process of developing innovative
talents.

A
B

C

Fig. 2 Development type I of the FGP for the innovative talent development process
301
Figure 2 shows the development type I for the FGP for the innovative talent development
process. Development I type refers to the form which is reflected when the geese in the basic type
have improved their innovation ability after a period of training. During this stage of development,
the Original innovative team has evolved into numerous innovation teams. Due to differences found
in the developmental level, the former side geese or hindmost geese members in the flock of
geese have grown to become a lead goose in a new team. Meanwhile the hindmost geese
members have moved on to become side geese so that the development of innovative talents
maintains a virtuous cycle of the process and, ultimately, boosting the overall improvement of the
training quality.

A B C

Fig. 3 Development type II of the FGP for the innovative talent development process
As a result of the crossover and penetration of different disciplines for the innovative team, there
exists the development type II of the FGP for the innovative talent development process (as shown
in Fig. 3). Innovation, which cannot be completed singlehandedly, often requires crossover and
cooperation among multiple disciplines. Numerous breakthroughs and achievements in science and
technology are often achieved through crossover and the penetration of varying disciplines. [7]

A

B
C
Fig. 4 Development type III of FGP in the innovative talent development process
Figure 4 depicts the final form of the FGP in the innovative talent development process
development type III. The development type III indicates the imbalance in the development of
innovative talents, as well as the crossover and penetrating relationship of the disciplines found in
the process of developing innovative talents in college and university. The differences found, as
well as the crossover and penetration relationship, also exhibit the mode form of the FGP. Each
university has showcases its own comparative advantages and relative comparative disadvantages.
A school with a dominant position in a certain discipline coincides with the lead goose position in
terms of the FGP mode for the development of innovative talents in this discipline, while other
schools fall into the side geese or hindmost geese positions. In the process of training
302
innovative talent, colleges and universities can learn from each other and integrate various
applications to promote the overall quality of the talent.
5. Conclusion
From the perspective of harnessing the flying geese paradigm to guide the college teams in
scientific and technological innovation, as well as entrepreneurship projects in the development
process applied to innovative talent, the FGP proposed by the author for the development of
innovative talent is in line with the law of growth for innovative talents. Additionally, the
proposition dovetails with the law of the development of innovative talent. Finally, it has a certain
theoretical value and is of practical significance.
The 21st century is the age of the knowledge economy, defined by the opportunities and threats
that coexist, and the interests and risks that stand side by side. In this era, the competition found in
the comprehensive national strength found among varying countries are increasingly reflected in
both the quantity and quality found in the competition of innovative talents. Therefore, the
development of innovative talents should, without a doubt, become a key strategy for superiority in
the knowledge economy era. Whether the strategy can be carried out efficiently and effectively
depends on the support of the education sector and the support of the society. We will vigorously
promote and implement innovation-oriented education, develop high-caliber innovative talents best
suited for the trends of the times, and form an effective, systematic training mechanism for
innovative talent that will ultimately improve the level innovation throughout China. Only in this
way can the nation of China gain an invincible position in a comprehensive national strength
competition based on economic strength, scientific and technological strength, the strength of the
nations defense system, and a national cohesive force. [8]
References
[1] Editorial group for the Talks of Wen Jiabao on Education: Take Full Advantage of the Offerings
Found in the Universities for Science and Technology in Order to Develop Young Scientific and
Technological Personnel, and the Talks of Wen Jiabao on Education, Peoples Education Press,
October 2013.
[2] Cui Caizhou, Study of the flying Geese Paradigm in Chinas Innovative Development, in the
10th issue of Reformation & Strategy,2007.
[3] Che Weihan, Summary of the Flying Geese Paradigm Theory and Empirical Research, in
the eleventh issue of 2004 of Economic perspectives.
[4] Sternberg R.J. and Lubart T., translated by Hong Lan, Handbook of Creativity, China City Press,
pp. 5-14, 2000.
[5] Srica V. , Social Intelligence and Project Leadership, The Business Review, vol. 9, pp. 189-200,
2008.
[6] Wang Kaiming and Wan Junkang, On the Transfer and Diffusion of Knowledge, in the tenth
issue of Foreign Economies & Management, 2000.
[7] Ye Song, Zhang Lei and Jiang Guojun, Deepening Institutional Innovation to Promote the
Crossover of Disciplines, Journal of Guangdong University of Technology, vol. 5(2), pp. 14-15,
2005.
[8] Deng Xiaojun, Misunderstanding of the development of innovative talents in college and
university and restructure of the development system, in the first issue of China Management
Informationization, 2013.
303
On Cultural Introduction in College English Teaching-- A Case Study of

the Course Intensive Reading
Xiaomei Li
Jingchu University of Technology, Jingmen, HuBei, China
123290746@qq.com
Keywords: Foreign language teaching; Cultural introduction; Intensive reading
Abstract. Intensive Reading is a comprehensive course for college students. In this course, the
teacher can adopt the four- procedure frame and introduce the culture related to vocabulary, text and
communicative environment to the context. Teachers should follow the principles of adaptability,
appropriateness, systematization and compatible mother tongue culture with target language culture.
The contents of cultural introduction can improve the students intercultural competence and deepen
teachers cultural understanding to foreign language teaching.
1. Introduction
In the year 1921, American linguistic Edward Sapire put forward ideas in his book Language,
Language cannot exist without culture [1]. Human beings social behavior reflected and embodied
in language activities. Meanwhile, peoples social and cultural activities are dominated by the
language. It is true that language and culture are inseparable. Language is the carrier of culture and
it is also an essential part of culture. One of the goals in foreign language teaching is to improve the
students intercultural communicative competence, including cultural knowledge and cultural
awareness. Language acquisition, the communicative competence in the target language, is the
cultivation of cultural awareness in the target language. It is the acceptance of values, the
development of the way of thinking and the understanding of life style in another culture. The
linguistic Lado points out the idea in his book Linguistics in Language Teaching that We will not
be able to teach English well unless we have a good cultural background. Therefore, if we dont
understand cultural pattern and principles, we cant master a language. [2] Therefore, the teaching
of language should be combined with the teaching of culture. They are inseparable.
2. The characteristics and the training objectives of Intensive Reading

Intensive Reading is a basic and elementary course for English majors in universities in China. It
lasts for five semesters. The main purpose of this course is to improve the students discourse
comprehension ability, acquire basic oral and written communication skills. For the English learners
in high grades, the teachers should cultivate the students comprehensive ability to communicate in
English, their ability to study independently, and their ability of logic. Then, ultimately, the final
objective is to improve the cultural quality of the students.
Contemporary College English [3] is a set of books compiled by professor Yang Limin.
Nowadays, this set of textbooks is chosen by most English majors in universities in China as their
textbook for the course of Intensive Reading. The teaching material in this textbook covers topics in
different fields. The themes of the textbooks cover a wide range of topics including politics, war,
religion, and drug and women issues, often with fresh ideas, psychic perception. The works formed
their own language of personalities and artistic expressions. Not only does it contain the value of
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
304
language learning, but also a large number of opportunities in cultural knowledge. It covers
abundant implicit and explicit topics for cultural introduction in class. Therefore, it is a good
guarantee for cultural introduction; meanwhile, the teaching materials in the topics are positive and
active. Teachers can combine the communicative skills with cultural knowledge together. Teachers
and students respect each other, dialogue with cultural elements, students all times in an active
acceptance of cultural information immerse in activities to learn language, get in touch with cultural
information and get growth.
3. Culture and cultural introduction

Whats the definition of culture? According to Hu Wenzhong, culture can be classified into two
groups: the broad sense of culture is defined from the perspective of the distinction between society
and nature, which refers to the sum of both material and spiritual wealth created in the process of
human history. And this kind of cultural understanding is also called the Great Culture. In a narrow
sense, culture refers to the social ideology as well as the systems and organizations that adopts to,
sometimes it also refers to the spiritual wealthy in the field of education, science, literature and the
specific knowledge and facilities in politics, economies , military affairs and so on. [5]
Cultural introduction is a very important part in language teaching. It means that the teachers
introduce some cultural contents selectively. [6] This kind of introduction not only covers language
acquisition but also some cultural life related to the teaching and learning materials. Instead of
chatting with the students aimlessly, the teachers introduce some cultural information of the target
language, for instance, the national conditions of the basis of the teaching materials in the textbook.
The purpose of cultural introduction is to combine language teaching with cultural knowledge of the
target knowledge together. At last the two skills influence and penetrate each other and promote the
progress of the students. In a word, cultural introduction means the learning process that A
environment which people grow up in obtaining cultural elements in B environment.
4. The design and application process in the course of Intensive Reading

In fact, cultural introduction is an effective way to help the students to fulfill the objectives of
Intensive Reading. In language teaching, cultural introduction can be penetrated in the four
procedures of classroom teaching. The four procedures are as followed: lead-in, text-analysis, group
discussion and critical thinking, further exploration. I will adopt one text as an example to illustrate
how to adopt cultural introduction in the course of Intensive Reading.
Teaching material: Book 2 Unit 2 Text A Discovery of a Father
Teaching objectives in language:1) to help the students to grasp the main idea 2)to help the
students to get the meaning of discovery in the title 3) to help the students to understand the
effective ways to develop sentences into paragraphs 4) to help the students to appreciate the writing
styles in the text
Teaching objectives in culture:1) to let the students know Sherwood Anderson (1876-1941) 2)
to let the students know the information about Alexander Dumas and Alexander Dumasfils 4) to let
the students know the information on The Three Musketeers 5) to let the students make a
comparison with Zhu Ziqing.
Teaching preparations: 1) information done by the students (the students are divided into
several groups and are asked to gather the information mentioned above before the class)
2) Information collections given by the teacher: the materials related to the text; ppt
Teaching procedures: In classroom teaching, cultural introduction can be permeated into the
following four procedures:
305
Teaching Procedures Tasks to Fulfill in Class
1. to communicate family affection, love and friendship with the students
Lead-in
2. parents great love
1. The students are divided into 4-6 groups, after collecting the information
before the class. They are asked to do debating, presentation and
communication based on the topics.
Text- analysis and
2. Discuss all the above questions in class.
group-discussions
3. Analyze the writing skills and the structure so that the students can
understand not only the language with the help of the cultural knowledge but
also appreciate the charm of language and significance of writing skills.
Guide the students to learn from their peers, to evaluate the effective ways of
Critical thinking
learning strategies
1. Whats the discovery of the writer?
Further exploration 2. Let the students make a comparison with Zhu Ziqing A View of Fathers
Back.
From the previous example, we can see that cultural introduction can be permeated into different
procedures of classroom teaching. In the process of teaching, the content is absorbed from shallow
to deep by the students. In the whole teaching period, it covers not only the structure of the text, but
ways of thinking and values of the target language as well. In this process, it covers not only basic
background information but different kinds of activities related to the text, including some literary
works in target language and mother tongue as well, which enables the students to understand
foreign culture in the target language from different kinds of perspectives so that it makes the
students understand the text better.
4. The principles and contents of cultural introduction in the course of Intensive Reading
It is well-known that cultural knowledge plays a vital role in intercultural communication, and
intercultural knowledge is an essential and indispensible part of intercultural communication
competence (ICC) which has become one of the most important goals in foreign language teaching
(FLT). In the process of college English teaching, the culture of the target language has a positive
effect on improving the students cultural awareness and promoting the development of students
intercultural communicative competence. However, cultural introduction is a gradual process; it
could not be achieved overnight. In order to make the cultural introduction more effective, the
following principles should be followed:
4.1 Principles of cultural introduction in the course of Intensive Reading
4.1.1 Principles of adaptability
Combining the content of the teaching material and the need of cross-cultural communication itself,
the language teaching and cultural communication is closely related to the applicability of cultural
knowledge, which involves the accurate transfer of language information to the cultural knowledge,
should be the focus of the introduction. If the import of cultural knowledge and the improvement of
students ability are closely related to each other, the students learning interest will be greatly
improved.
4.1.2 Principles of appropriateness
The cultural introduction in foreign language teaching is the extension and supplement of the
traditional language teaching, which is not the whole of the foreign language teaching. The real core
of foreign language teaching is language supplemented by culture. In this sense, cultural
introduction should be appropriate, too much culture teaching cannot promote language teaching,
but become the students study burden and resistance. Therefore, the introduction of culture in
foreign language should be carried out within the framework of language teaching, which aims to
serve the language teaching and promote all-round development of the students comprehensive
abilities.
4.1.3 Mother tongue culture should be compatible with the target language culture
306
In intercultural communication, people pay more attention to the negative transfer of mother tongue
culture on the formation of language communicative activities. However, they often ignore the
positive transfer of mother tongue culture. As a tool to compare with the target language, mother
tongue culture can reveal some features of the target language more deeply and deepen the essential
characteristics of national culture. Some scholars found out in their study that the failure of
cross-cultural communication is not because of the misunderstanding of the target language but
from misunderstanding of the differences between the target language and mother tongue.
Therefore, culture teaching in foreign language education shouldnt only focus on the introduction
of the target culture, its necessary to master the essence of the culture in native language to
eliminate pragmatic failures and cultural errors.
4.1.4 Principle of systematization
It is of great importance that culture teaching should take the students demand as the center of
teaching objectives. Because in the activities of language teaching, students are the main body of
the language and culture study. Students are not only the recipients of cultural knowledge but also
the practitioners of cross-cultural communication. In this sense, cultural introduction should also
avoid being objective and aimless. Cultural introduction should be concrete and accurate, carried
out step by step, from words to discourse, from easy to difficult. Cultural introduction cant be
mechanical; it should be combined with language teaching.
Culture is dynamic and compatible; it also keeps up with the changing situation. Intensive
Reading is the main curriculum that it covers the practice of the students listening, speaking,
reading, writing and translating skills in class. In order to fulfill the objectives, it is a good idea to
give the cultural introduction about the words, discourse and environment of communication related
to the culture of the text, penetrating them into the process of the whole classroom teaching. For
different levels of English learners, the contents of cultural introduction can be carried on step by
step. Based on syllabus and teaching material, highlighting the introduction of culture, cultural
teaching is a practical approach to realize the training objectives of college English learning. The
contents of cultural introduction in class are as follows:
4.2 Contents of cultural introduction in the course of Intensive Reading
4.2.1Words related to culture
For the beginners, teachers can focus on words in cultural introduction. It contains the words as
follows: greetings, address language, euphemism, tatoos and words about deep cultures in linguistic
notations. For example, the textbook Contemporary College English, in Book 2, Unit 2, Text A
Maheegun My Brother, in paragraph 16, there are sentences like, ...He will take her for life, hunt
for her, protect her. This is the way the Creator planned life. No man can change it...In this text,
the teachers cant only explain its superficial meaning but the cultural information related to
Creator. Thus, it means God in this context whereas Creator refers to the Goddess in
Chinese culture. As in westerners mind, according to Bible, the world is created by God within
seven days. Unless the students understand this cultural information can they fully understand the
real essence of this text, which is also impossible to obtain cultural awareness in the end.
4.2.2 Discourse related to culture
For the advanced learners, not only words related to culture but discourse related to culture should
be introduced as well. Discourse related to culture covers a wide range of knowledge, including
cultural background on the writer, the theme, emotional topics, writing skills and so on. Teachers
present an opportunity to let the students experience all aspects of cultures, which helps the students
have a better understanding on the text, appreciating magnificent fascination of the language then
preceding the great empathy with the writer.
For instance, in Book Two, Unit Five, and Text A Say Yes, teachers can choose the hard
history and the long road to American blacks struggling for freedom. It is a good idea to introduce
Uncle Toms Cabin and do some group-discussions. Cultural introduction can also involve
Ku-Klux-Klan and American Civil War. The abundant cultural information not only broadens the
307
students horizon but also motivates their interest, thus, improves their learning effects. Another
example is in Book 4, Unit 2, Text A Waiting for the Police, in this text, teachers can guide the
students to make a depth analysis on mystery novels, this literary works of Alan Poe, and whats
more give a comparison between Chinese mystery novels, such as Bao Qingtian, Di Renjie with
western ones. In Book 4, Unit 1, Text A Thinking As a Hobby, for advanced learners, cultural
introduction can refer to some great thinkers, such as Confucius, Plato, Aristotle, Newton, Darwin,
Carl Marx, Kant as well as their great contributions to human society.
However, cultural introduction doesnt mean occupying a large amount of time to chat some
related materials to the text with the students but guide the students to know and understand some
cultural information systematically and logically so that the teachers can cultivate the students
cultural awareness. This process covers the whole procedure of classroom teaching. It is sure that
systematic and suitable cultural introduction does help the students to enrich their knowledge,
improve their cultural sensitivity and their ability to understand the double culture in language
learning.
4.2.3 Communicative environment related to culture
Chinese linguist Zhang Zhanyi (1990) divides cultural background in language teaching into two
groups: knowledge culture and communication culture. [7]Knowledge culture refers to some
knowledge in economy, arts, law and religious of a nation, whereas communicative culture refers to
the linguistic and non-linguistic factors that influence the accurate expression of the information in
the two different cultural backgrounds. In communications, if one cant understand communicative
culture, probably it will cause misunderstandings. Therefore, communication culture and
knowledge are equally important in classroom teaching. Communicative knowledge involves many
aspects of our daily life. In class, teachers should impart knowledge on different characteristics in
different languages, Chinese and western customs and etiquette, the association between Chinese
and English words, different cultural connotations of words and so on. For example, In Book 3, in
the text Why History Disagree, therere some words like restroom, landlord and husband,
by teaching their cultural connotations the students can have a better understanding on the target
language. Whats more, tatoos also play an important role for beginners in cross-cultural
communications. For example, in Book 1, Unit 2, Text A Going Home, teachers can teach the
students different ways of greetings in western countries, and it is not suitable to ask some personal
and private affairs in greetings.
5. Summary
Cultural quality plays a significant role in peoples foreign comprehensive capacities. In the process
of college English teaching, the effective introduction of target language culture is helpful to
cultivate students intercultural awareness and enhancing their intercultural communication
competence.The ultimate aim of learning a language is to communicate with the others. Teachers,
who acted as guides of the students, should not only teach language to the students but also import
the relevant cultural knowledge. They are equally important. The course of Intensive Reading
which is the basic and fundamental course for English majors carries on the responsiblity to
cultivate the students listening, speaking, reading and writing skills. In classroom teaching, the
appropriate and sustematic cultural introduction will definitely inspire the students interest,
develop their initiative and meanwhile deepen the teachers understanding in foreign language
teaching. The scientific method will promote the common literacy of teachers and students, and thus
help to deal with the challenges of the future world.
References
[1].Sapir, E Language: An Introduction to the Speech[M]. New York: Harcourt Brack and Company,
1921.
308
[2].Lado, D.A. Linguistics in Language Teaching[M]. Edward Ltd, 1972.
[3].Yang Limin, Contemporary College English[M].Foreign Language Teaching and Research
Press,2002.
[4].Wang Shijing. Confusion and Discussion of Cultural Introduction in Foreign Language
Teaching[C].Shanghai Foreign Language Education Press,2008.
[5].Hu Wenzhong, Culture and Communication[M].Foreign Language Teaching and Research
Press,1994.
[6].Cruickshank, D.R&Bainer, D.L&Metcalf, k.k. The Art of Teaching[M].London McGraw-Hill
College. 1999.
[7].Zhang Zhanyi, On Communicative Culture and Knowledge Culture[J].Language Teaching and
Research,1990,(2).
309
A Novel Digital Micro-teaching System
Haixia Lu
Shijiazhuang Preschool Teachers College, Shijiazhuang, China, 050228
L_xyuan@163.com
Keywords: Micro-teaching platform; Computer and information science; Web technique; B/S Model;
Novel Approach
Abstract. In order to build up a better system for micro-teaching, we implement it by adding

multimedia editing, film video production, multimedia storage, video on demand, digital broadcast
live to form a much powerful digital micro system. As a special kind of applied computer science
based application, through adding audio visual technology on traditional educational theory, the
micro-teaching method plays a unique role in modern school. In this paper, we conduct a research on
the specific usage of micro-teaching. The result shows the effectiveness and practical function of the
micro-teaching based system
1. Introduction
With the rapid development of information technology, especially in the growing popularity of
internet and digital storage which are represented by networking and digitizing, it is necessary to
produce a reform that combines Micro teaching with new video recording and storage technology,
and it is also necessary to take advantage of the existing network resources to create a digital micro
system that combines with Micro teaching, multimedia editor, film production, storage, video on
demand, digital live broadcasting. Micro teaching is an applied educational technology that combines
with audio-visual technology with education theories; it can train students' teaching skills. Effectively.
Therefore, Micro teaching can be implemented in the relevant teaching theories and psychological
theories. However, how to infiltrate Micro teaching into specific curriculum instruction is a
permanent problem. This article will focus on the verification of the practical Micro teaching from the
perspective of martial arts teaching, thus to further improve and perfect Micro teaching pattern.
2. Structure and design of our proposed system
2.1 Structure of digital micro-system

Digital Micro-System is a digital network system, which adopts advanced digital transmitting
techniques, digital storing and network applying plan. It is a collection of Micro-teaching,
multi-media editing, audio and video making, multi-media storing, video on demand, digital living,
the publishing of Micro-teaching resources, Micro-teaching experience exchanging, and
Micro-teaching evaluating [1]. They are the new Micro-teaching systems on the base of Web2.0
standard, P2P techniques, digital video collecting and processing techniques, digital image storing
and indexing techniques, and digital video on demand techniques, which make digital micro-teaching,
digital micro-teaching course learning and the releasing of Digital Micro-Teaching resources come
true through Blog, BBS, Wiki [2], RSS, video instant-publishing and NOD&MOD [3]. Multi-media
digital micro-system has many practical functions in teaching with window type and imaging Chinese
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
310
software interface. This kind of multi-media digital micro-system is easy to manipulate and often
called micro-classroom [4]. As to the structure function and movement of digital microsystem, please
refer to Figure. l.
2.2 Design idea of digital micro-system
Integrating training theory with skill practice, digital micro system is based on digital micro
equipment and computer network system, including : micro classroom teaching system, IC card
reading system, the control room monitoring system, the classification of the network broadcast,
automated micro video categorization , live web casting, Micro teaching and management system,
editor and the special effect of nonlinear systems. In terms of its functional modules, it includes the
digital micro training and inspecting subsystem, instruction subsystem number and case, the storage
subsystem of digital case or network based on the multiple evaluation subsystem of the computers. In
addition, it includes other digital connection and resource
sharing subsystem.
Fig.1 Structure Fig.2 Digital Micro Teaching Diagram
2.3 Realization method of digital micro-system

Training and storage subsystem are not only the skeletons of digital micro system, it is also the core of
the whole system and application models. At present the related digital micro's research and the
practice mainly concerns this. In fact this has already decided the operating way of digital micro
system. The Fig.2 shows the detailed information.
3. Material art teaching in the proposed model
3.1 General analysis

Martial arts mostly appear in routines and there are a lot of changeable action and transformation
routes. It is difficult for beginners, and thus high demand for use of teaching methods will be proposed.
For complex action, more difficult and high demanding of martial art teaching technique and some
abstract conception exercises, it is difficult for students to understand and master [5]. The research do
experiment and control teaching combined the above digital micro system design with realization of
the operation mode, through the mathematical statistics to prove the feasibility and teaching
effectiveness of Digital micro-teaching mode. Experimental group and Control group are set up to
compare experimental, process and analyze the statistical data to make a conclusion.
3.2 Experimental results and analysis
311
We show the result of the experiment and give a detailed explanation of the related result.
(1) A Comparison of technology total score
This paper analyzes the total result which examines the student before and after the experiment.
Respectively viewed from the horizontal and vertical standpoints, we may discover that there are
highly significant differences between the control group and experimental group (See Fig.3). It shows
that the students' technique of the two groups has improved. In view of the differential value (T=6.450,
P<O.Ol), the act technique of the experimental group is improved more significantly than the control
group, indicating that making full use of digital micro-teaching is very beneficial for the students to
enhance their overall technical skills.
(2) A Comparison of movement accuracy
Because martial arts teaching emphasizes the standards of the movement, the students' sensation
ability on spatial movement should be paid attention to in actual teaching. The principal means to
raise the sensation level is to rectifY the movement using the visual contrast by watching the video so
that students can get timely and accurate act technique. In view of the act accuracy of the two groups
(see Fig.3), there is a significant difference for the experimental group before and after the measure
(P<0.05). As to the control group, there isn't a notable difference (P>0.05), indicating that the
micro-technology can help the experimental group to understand the act accuracy better by video
feedback.
(3) A Comparison of movement range
Movement range is a very important target to weigh the martial arts skill. A diversity of physical
quality cause different understanding of the movement range in actual teaching, especially for the
flexibility quality and the strength quality. Different feeling, perception and visual affect the teaching
effect in actual teaching to certain extent, but the digital micro-teaching technology can effectively
eliminate these differences. Firstly, compare with the video material to form correct representation;
secondly, get students to understand the condition of them clearly through computer's objective
evaluation: Finally, make prompt and effective improvement.
(4) A comparison of movement dynamics
Action force is the key point of martial arts teaching, because act dynamics directly decide the
students' level. Martial arts act dynamics become the essential part in teaching and training. We can
specifically target training tools and methods on every student, to effectively improve the students
experience different action intensity, leading to raising the drilling level of the martial arts routines.
By analysis, we can see that (in Fig.3 ) there's no significant difference for the control group before
and after experiment (p>0.05). There is a significant difference for the experimental group before and
after experiment, and between the control and experimental groups. This indicates the experimental
group students have higher regulative ability in movement dynamics than the control group
obviously.
Fig.3 Experimental Result

(5) A comparison of movement mastery
Martial arts act skill refers to the memory level of martial arts movement. Because of complicated and
diversified act, strong rhythm, the students have to remember the order and speed of the movement
skillfully. Undoubtedly, this will greatly increase the difficulty for the students to learn. Martial arts
will not be mastered in one day. One will not have much gain if one works by fits and starts. To avoid
forming wrong dynamic stereotype, the students need unceasing improvement and correction. By
312
digital Micro teaching system, student can understand the act technology better and enhance the skill
of the martial arts effectively. Form Fig.3 we can see that, before and after the experimental measure
there is no significant difference for the control group (p>0.05). There is a distinguished difference for
the experimental group before and after experiment, and between the control and experimental groups
(p < 0.01). This shows that control group has not improved the proficiency obviously, but the
experimental group is at a higher level in proficiency.
(6) Movement expressive force comparison
Practicing martial arts, internally Jing, qi and shen" are refined; externally muscles, bones and skin
are strengthened. Oneness of the internal and external, integration of form and spirit. When the form
breaks, the intent connects; when the momentum stops, the "qi" links. The charm of martial arts must
be displayed through concrete body movement, which requests the students to understand the martial
arts movement deeply. The main solution is to observe, emulate and learn from outstanding students
or athletes frequently. Only the digital video technology can solve this difficult problem. It cab be
seen from Fig.3 that there is a significant disparity before and after the experiment for the
experimental group (p < 0.05). The differential value (p < 0.01) will explain the movement expressive
force in experimental group is better than the control one, which is useful for students to enhance
confidence, highlight the expressive action. Therefore, making full use of digital technology may
promote effectively the performance ability.
4. Summary and conclusion

Integrating all resources to comprehensive quality control, the digital Micro teaching system has
diverse methods of teaching and evaluation and high efficiency. The use of digital micro-system can
improve informational attainment of students, teachers and administrative staff, can optimize the
procedure of and improve the environment of educating and learning, can expand learning resource
and can form students independence and innovation. This kind of educational model contains three
systems, that is, e-learning, classroom teaching and extra-curricular activities. In sports teaching, the
application of digital micro educational model will be an important symbol of sports teaching
modernization. Applying digital micro-system is an important way of re-allocation and optimization
of teaching resources, enhancement of the information management and promotion of academic
development.
References
[1] Zhang Qijing, Liu Yadong, Wang Bo. Study on Integrated Teaching Model of Higher Vocational
English Teaching Comment Based on Micro CoursesA Case Study of Foreign Affairs Practice
Course [J]. Journal of Hubei Correspondence University. 2013 (12).
[2] Hangzhou Vocational & Technical College. The 1st College Micro Course Competition Award
Ceremony of Zhejiang Province and College Teaching Information Seminar in the Micro Era Is
Held in Hangzhou Normal University [J]. Distance Education Journal. 2013 (12).
[3] Yang Manfu, Sang Xinmin. Deep Thinking of Micro Courses in MOOCS TideAnalysis Based
on the 1st College Micro Course Competition [J]. Exploring Education Development, 2013 (11).
[4] Yang Hongye. How Can Micro Courses Attract Learners: Ponderings for Video Recordings of
Chinas 1st Colleges Micro Courses Competition [J]. China Educational Technique &
Equipment. 2013 (8).
[5] Zhang Zhengmin. Human network in the sports [O].Cheng Ou:Sichuan University, 2004.
[6] Mary Phillips Manke, Lawrence.( I 997).Classroom Power .Relations: Understanding
Student-Teacher Interaction. Erlbaum Associates.
313
Education Reform Enlightenment of the Foreign Military College for

Chinese Army Academy
Jian Du1, a,*, Tao Shi1, b, Jun Wang2, c, Jing Xia1, d

1
Department of Fundamental, Academy of Armored Forced Engineering, Beijing, 100072, China
2
Department of Training, Academy of Armored Forced Engineering, Beijing, 100072, China
a b c d
jiandu2531@163.com, taoshi@163.com, junwang@163.com, jingxia@163.com
Keywords: Military talent; Information war; Reform; Strategy
Abstract. It has become a inevitable trend and tendency of national defense education for China
military academy based on the requirement of information war. On the basis of the innovation policy
and strategy for foreign army college, this paper put forward the reform some strategies and
suggestions of the military academy as follows. To intensify general education for cultivating
compound military talents, to innovate curriculum system for teaching contents close to the
requirement of army combat, to establish an acting capacity mechanism for exchange learning
between the academy faculty and army officer, to strengthen international exchanges for new
co-sponsoring pattern. Through these reform strategies, military academy can improve the quality of
military talent and academy level.
1. Introduction
With the wide application of information technology in the field of military, information has become
the dominant factor of winning the battle, information equipment. Information command platform,
battlefield perception system and command information system have become the core military
combat system[1]. Facing the opportunities and challenges of information war, the major military
countries of the word have attached great achievement in the cultivation the high-quality new type of
military personnel, fully committed to reshape the military academy education concept and college
education reform[2]. It provides the beneficial enlightenment and reference which reform measures
and experience of foreign military colleges for China army academy education transformation in the
new period.
2. The education reform trend of foreign military college
2.1 Reform and innovation strategy

In the face of the new military theories and new challenge of technical progress, the main army
colleges in the developed countries actively carried on the education and training reform. American
military colleges walked in the forefront of the world military education reform. U.S. began to explore
the separation of the military education and ordinary higher education in 1870s, and gradually formed
the 4 military academy as the backbone in 1950s[3]. It founded the United States military general
higher education system by hundreds of universities. American academy took the Iraq War as the
latest examples in teaching material, and took the battlefield environment simulation of military
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
314
training, strengthen students training. At the same time, anti-terrorism was a compulsory course for
the students[4].
Britain is the military power country in the world, and its military education relatively long history.
The military training of junior commanding officer has a long history of more than two hundred and
sixty years history[5]. Its characteristics can be summarized as follows. All aspects of security
personnel training; comprehensive training objectives, focus on the future development trend of
military talents; the diversity of culture, supported the academy by social forces; division of military
and general academy; setting up reasonable discipline categories, strong comprehensive courses and
training goal[6].
Russian military academy often simulated combat maneuvers by the computer aided form. As a
example, Kuznetsov Marine institute, the "Ocean" computer simulation exercise system covers the
ocean information all over the world, and students can use the computer simulation system to deduce
or combat exercises for the sea battle wanting to set the battle. Russian military engineer university
with a long history is the cradle of Russian corps command officers. The talent training time of the
corps junior command is five years[7]. The graduates are granted the rank of lieutenant, and generally
assigned to the corps of engineers as a platoon leader. The training time of corps of intermediate is one
month, three months, half a year or two years. Intermediate training officers are captain, lieutenant
colonel, the major of the military, the army corps of engineers, or intermediate officers are from
security forces, border guards, civil defense forces and other units and departments. In these training
officer, the majority are army officer, also others come from the navy, air force, intermediate officers
missile forces and space forces[8]. The Russian army think the military officer experience of the
grass-roots level units is the necessary conditions for improving the quality of education. Therefore,
Russian military emphasize professional faculty must have experience as forces, engineers
professional instructors must be selected from military officers above Company, battalion, regiment.
The officer can not become a instructor if he has no experience as forces.
2.2 Review for the reform policy
From the trend view of education reform in developed countries, the major military power country
make the military academy education as an integral part of national education, most experienced the
gradually separation process between the military general education and military officer service
education, and insist on practical guidance for education teaching reform. Especially the professional
education academy presents one of the characteristics of the teaching reform which is aimed at the
future battlefield and close to actual combat teaching.
To actively cope with the challenge of the world's new military revolution and push the new
revolution in military affairs with Chinese characteristics, accelerate the new military reform of
education system with Chinese characteristics, it is the 16th meeting spirit and the core theme of all
the military academy education transformation. Under the condition of informatization, the education
reform orientation of profession academy is to make the education teaching "Close to the army, close
to the position, close to actual combat ". The Chinese military academy should absorb the advanced
beneficial ideal and draw lessons from the military academy of developed country, it is the
development trend for cultivate qualified military command.
3. Enlightenment of education innovation for Chinese military academy from foreign army
college reform
3.1 To intensify general education for cultivating compound military talents

Russian military engineer academy has the very clear talents train goal, emphasize on " Both
command and technology ", there is the unity talent of command and technology for the requirements
of modern warfare. Russian army think the commanding officer must first be a technology generalist
on the condition that modern high technology war. Engineer solider commander from platoon to
315
brigade must have a deeper understanding of each engineer solider major, not just confined to for a
professional master. Russian believes that modern war require the officer must have a high quality,
and the commanding officer must competent for any position[9]. In the modern war, what can happen.
Based on the guiding ideology, Russian military engineer university have the high profession train for
student. Junior team of students in college will be five years train, learn the engineer corps command
and various professional technology, become a professional generalist of engineers corps.
Intermediate students study content not only included command, tactical classes, but also the
professional teaching content of engineer corps for two years. Students not only become qualified
intermediate command officer of engineer corps, but also achieve military engineer technology after
student graduation, he become a technical backbone of engineer corp.
Talent training target must be traction by battlefield demand. under the information condition,
primary commanding officer have be special demanded in the ideological and political quality,
scientific culture quality, professional quality, body and the psychological quality, which requires the
military academy must exert the discipline advantage, strengthen general education, widen
professional caliber, lay a solid foundation the quality of scientific, cultural and military, increase the
cultivation proportion of humanity quality and comprehensive quality, combine the general education
and professional education. in order to adapt the talent training mode transformation, military
undergraduate can merge and adjustment from the reality view, actively push forward the
restructuring of subjects, optimize the discipline structure, set wide caliber. New students don't have
to be professional, only set a general education course first -year and second-year (at least the first
year).
To vigorously promote the talent training mode transformation, firstly, the primary job training
goal should be focused on scientific, pertinence, scientific demonstrate the component factors of first
serving ability. The military academy lay a solid knowledge base, focus on design plan to organize the
military training, lead and manage subordinate unit, do a good the ideological and political work of
officers and soldiers, as well as the physical and mental qualities and other core competence[10].
Secondly, the military academy should focused on the training objective of operability, measurable,
refinement ability training standards. In establishing the ability standard of universal military talent,
based on the special requirements for all the services and arms, further define the core ability
competence, draw a "road map" of the ability growth. Accordance with the requirements of easy to
operate, easy to assess, The military academy transform the training objectives into the talent training
standards.
3.2 To innovate curriculum system for teaching contents close to the requirement of army
combat
In order to cultivate the engineers generalists of command and technology as a unity, Russian military
engineer university have strict requirement for the curriculum content. Curriculum involves the corps
combat, command all aspects of the construction, management, and forces, including troops
command and tactics, project management, contract guarantee, the various professional of engineer
corps and mental work, highlighting corps combat command and engineer guarantee and so on.
Russian thought that the service course content must closely combine the actual requirement of forces,
solidly improve the quality of the students[11]. After the students participating all courses, they can
how to face and deal with the service works, all activities. Therefore, when after graduate from
academy they can do very well and rarely appear "hang up" and "step aside" phenomenon in the troops.
Intermediate troop curriculum and content system connect with the basic primary troop, and widen
the content on the basis of intermediate troop. For example, the two subjects of Contract Tactics and
Security Engineer, junior troop only learn division, regiment tactics and tactical security engineer, and
intermediate troop correspondingly heighten operational level, including army campaign and battle
engineer protection, etc. The whole elementary education and intermediate training course content are
made into a coherent whole. Students become a corps commander and engineer after they complete
316
the primary and secondary training curriculum. For this reason, the Russian always say their education
is the best education in the world.
To implement the teaching mode transformation, it is necessary to highlight the information
technology, outstanding joint operations command, adjust the teaching contents according to the
combat requirements. This is the inevitable choice of military academy education reform in the
information age. The military academy should reform talent programmer. In professional Settings,
The original engineer technical majors should be intermingled into "information engineering",
"command automation engineer and other professional of army requirement, to construct the
informatization knowledge framework of primary commanding officer.
To Innovate curriculum system, the military academy should offer the professional development
courses and elective courses in the areas of humanities, natural and technology. These courses can
broaden the professional caliber of students, lay a solid foundation for the overall development of
students, enhance the overall quality and development potential. With a special focus on cultivating
student's military basic physical fitness and basic skills, in the freshmen stage, the academy should
increase the proportion of military and political quality education train, exercise outdoors, implement
the whole training. The academy constantly enrich the new technology, new training methods, new
equipment, integrate teaching content, improve the teaching content applicability and pertinence.
3.3 To establish an acting capacity mechanism for exchange learning between the academy
faculty and army officer
The military teacher's quality directly affects the quality of education. It is impossible to train high
quality students if the teacher do not have comprehensive quality, superior skills, rich experience and
knowledgeable. The faculty of French Higher Defense Research Center are army commander,
government official, not even the full-time faculty[12]. The Defense Research Institute is the royal
highest institution of British, it has no full-time faculty, but according to the acquirement, it invite
army demander, government departments, local university experts and professors, lectures of military
academy to teach.
The faculty of Russian the synthesis academy must be hierarchical superior above regiment troops.
The Headquarters of the General Staff in Russian military faculty are all forces multiple experiences,
department and institutions, the vast majority have actual combat experience. The faculty are not only
academician but also military commands of former chief staff, director of operations. They can make
many abstract theory combined with practical force, so the teaching is vivid, lively and interesting,
this stimulate the learning enthusiasm of students and acquire the good teaching effect.
In order to make the students learn about the latest discipline knowledge, the academy also often
invite government minister, a professor at the university to lecture. It is shows that a mature senior
army officer need comprehensive experience of forces, institutions and departments.
To establish an acting capacity mechanism, strengthen academy faculty and army officers
exchange to learn, it is the education module transition and the faculty team development trend of
Chinese military army. The academy should contact army based on the principle of consensual,
according to the requirements, make a regular exchange mechanism in proportion. The academy
select military teaching staff from the army, and select academy young teaching staff to function in an
acting capacity of army, expand exchanges between the colleges and universities, also can improve
the teaching staff motivation.
3.4 To strengthen international exchanges for new co-sponsoring pattern
Under the background of globalization, peacekeeping operations, or the war on terror, humanitarian
relief operations are beyond the scope of a single country, it has become a joint action for more and
more countries. In the German Army Command and Staff College set the international general staff
course with a small "United Nations", this is a of open course for world, its students come from
thirty-eight countries. Weng Caim, Rear Admira said: "An important content of learning is to
317
communicate with other countries, learn each other countries military, understand the culture of other
countries." In the early 70s, The British army is emphasizes on the training of joint operations
between troops. The Coalition Command and Staff College pay attention to train joint operations
command and staff officers, and their courses included in the joint operations training for a year, in
which there are 300 students from more than 50 countries attended the joint command training for an
intermediate. In the field of higher education, European countries are now vigorously promote the
"bologna process"[13]. The goal of this programmer is to establish a unified "European higher
education area" in order to promote international education cooperation.
Data show that there were 46 European countries which signed the declaration by the end of the
first half of 2009, the military education for international cooperation provides a sample for
reference[14]. Open, cooperation and communication is becoming a education reform concept of the
Chinese and foreign military academy[15]. Any resources academy can't satisfy the requirements of
complex command training under closed condition; Any single level academy, can't meet the
requirements of commanding officer career for knowledge and ability in a phase. In a information age,
combat command officer, especially the joint operations command officer, the cultivation must be
open to other colleges, face the world, and find a way of international cooperation. In order to meet the
education transformation, at the beginning of the design the future joint operations command officer
training program should consider the international elements, to establish the commander officer
cultivation framework of international cooperation, and reach a consensus and intention similar
"bologna declaration" among the national army, set up exchange program of international officer,
exchange graduate students and instruct, explore a new co-sponsoring pattern with foreign military
academy. It is becoming a action goal of education reform for Chinese military academy.
4. Conclusion
China military academy is the cradle of cultivating military command talent. It is plays the important
for the formation of the forces fighting force, the process of revolutionary army, regularization,
modernization.How to meet the requirement of era, speed up the transformation of education,
cultivate a number of highly-qualified commanding officer, it is a difficult career. In this paper, It
made some discussion of Chinese military academy education reform based on the developed
countries reform experience. There are still many problems, such as the construction of campus
culture, evaluation mechanism, teaching staff etc. we will explore these problems in the subsequent
research.
5. Acknowledgement
In this paper, the research was sponsored by the National Social Science Foundation (Project No.
14J003-117) and Education Fund Project of Academy of Armored Forced Engineering (Project No.
JYYJ2015005).
References
[1] R. H. Chen. Junior military command personnel training characteristic of the developed countries.
Military political work theory research. Vol. 5, pp23-24, 2011.
[2] Y. J. Jiang, Y. Z. Zhu. Education development course and trend of foreign academy. Military
political work theory research. Vol. 1, pp16-18, 2010.
[3] S. H. Li, The development and characteristics of postgraduate education for German, American
and Britain, Research on basic education in China, Vol. 7, pp14-15, 2007.
[4] J. X. Yao. Analysis and countermeasure research on the training of intermediate command officers.
318
University of National Defense Science and Technology, pp20-21, 2010.
[5] R. J Xu. Some enlightenment on the military education training of American Military Academy.
Realistic. Vol. s1, pp12-14, 2011.
[6] L. T. Xu, G. M Li, Zh. J Wang, H. Y Wang. A comparative study on the cultivation the leadership
and management ability of Chinese and foreign primary command and growth officer. Journal of
higher education research. Vol. 2, pp18-19, 2010.
[7] Zh. Wen. Research on the training system of American joint professional military officer.
University of National Defense Science and Technology. pp26-28, 2011.
[8] B. H. Lang. Study on the cultivation of new primary command and growth officer. University of
PLA Information Engineering. Vol. 5, pp20-29, 2007.
[9] J. Duan. The reform of the U.S. military from Vietnam War to Gulf War. Military science press,
pp21-24, 1996.
[10] Y. Liu, H. q. Fan. Cultivate the military talent relying on the national education. Defense
education. Vol. 3, pp16-18, 2000.
[11] S. W. Pang, Zh. Y. Shao. Basic experience of foreign military training military talents . Scientific
progress and measures. Vol. 11, pp27-28. 2004.
[12] P. Zhang, X. H. Hu. Construction on military human capital and army quality in the new century.
Military science press, pp35-39, 2002.
[13] B. Chen. Research on general education in military academy of foreign countries. High
education research. Vol. 4, pp15-18, 2009.
[14] M. Zeng, Z. W. Yang, YU. F. Fan. Enlightenment of Foreign military education system structure
characteristics. University education science. Vol. 4, pp21-23,2004.
[15] Q. Shen. New military construction in the world. Information system. Vol. 12, pp28-30, 2011.
319
Research on Relationship between Bilingual Teaching and English Level

in Chinese University
Li Zhang*
Department of Information, Qilu University of Technology, Jinan, 250033, China
lizhang@qlu.edu.cn
Keywords: Bilingual education; English level; Chinese university
Abstract: Bilingual education became popular in Chinese universities considered as an important

aspect of connotative development. In this paper, we take computer programming as an example to
analyze the relationship between bilingual teaching and English level of students. We use a real
dataset including all the scores of course in two terms to compare the changes before and after the
bilingual teaching to figure out the effects of these two aspects to each other.
1. Introduction
Bilingual Teaching involves teaching academic content in two languages, one of which is the native
language, with varying amounts of each language used in accordance with the program model [1].
Bilingual teaching is not as simple as one language plus one language but to train a comprehensive
ability to use second language to understand, think and further resolve problem independently[2,3]. In
western countries, bilingual language involves English and another language which is also a Latin
such as Spanish. This is much easier to acquire. But this is total different situation in China [4, 5].
The Chinese Ministry of Education has emphasized the importance of bilingual education and
asked the universities to adopt bilingual education to undergraduates and the courses of bilingual
education should achieve 5-10% of the total courses taken for undergraduates in higher education
institutes in China. Since then, bilingual model becomes more and more popular in Chinese university
on almost all fields [6, 7].
Computer programming (often shortened to programming) is a process that leads from an original
formulation of a computing problem to executable computer programs [7, 8, 9, 10]. Also, they often
practice as bilingual education. However, these kinds of course barely reach expected effect because
of its technical feature and logistical difficulty.
As we know, teaching programming languages is very difficult to novice programmer, which is
more obvious in bilingual teaching and there are lots of researches on that. In this paper, we will list
the related works and analyze the problems in this subject and give some useful strategies
2. Computer programming course

Almost all computer science school have computer-programming course such as Java, C++. No
matter what they teach specifically, the content is similar. For every student in IT field, at least one
programming language must be mastered when they graduate. In general, they study the first
programming course on first term to open the gate of a professional world. In order to widen the
vision and get connection with other countries, this kind of significant course became the first choice
to practice bilingual education.
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
320
Bilingual teaching has advantages in computer science subjects because the computer science
began from western countries [11,12]. All the conceptions, terminologies and theories are uniform
and standard in literature. Then they are translated to Chinese. The contents in most textbooks are
similar.
3. English level and bilingual teaching

The students English language proficiency is very important to bilingual teaching and it must already
matches the need of learning to get an ideal teaching result. In some university, students are divided to
few groups according to their English level to learn language. However, none groups would set up for
bilingual teaching such as any major course. But we did notice that English language proficiency does
affect the result of bilingual teaching.
Here, we use a student test dataset which includes 79 students to observe the relationship between
English language and bilingual teaching. These students are from computer science department. They
learn basic programming in native language and learn English course in the first term. Then learn
object-oriented programming with bilingual teaching. We will compare the scores of English course
and bilingual course to observe the relationship between them. Further, for students with different
situation give diverse learn suggestions.
3.1 English level affects bilingual teaching result
We assume that high English level will be helpful to bilingual course because the strong basic
comprehension and reading ability. Here we take programming course as an example to figure out that
how the English level to promote bilingual teaching.
We plot the scores of bilingual teaching and basic programming as well as the English level in
Figure 1, where the color of circles presents English level. And two dotted lines point out the mean
score of these two courses. As it shows, the circles in first quadrant indicates the students with better
scores in both courses. We can observe that most of these students are in better English level, which
means English is not the bar to learn bilingual courses for these students. And in second quadrant,
these students have a lower score of basic programming course and a higher score in bilingual course.
These group students also are in a better English level so they gained a better score than native
teaching which they have learned last term. .
Then let us look at the third and fourth quadrants. In third quadrant, the students have a lower
native course as well as the bilingual course. The other hand, the students who have lowest English
level are all located in the quadrant. However, few students with higher English level also appear here
which shows some students are really have difficulties to learn programming course. Fourth quadrant
includes the students slipped back which shows more complicated results.
3.2 Bilingual Teaching Affects English Level
In this section, we will analysis the affection of bilingual teaching to English level. We did the similar
plot as last section which shows as Figure 2. But here the colors of circles represent the changes of
English Level before and after the bilingual teaching. The changes divide into 6 levels: A to F which
point to changes from best to worst. We can see that the most students keep the same level (color
green and color yellow). Few students that improve a lot located in third quadrant which indicates the
backward group. It seems like there is no strong relationship between these two aspects.
4. Summary
In this paper, we analyze the relationship between bilingual education and English level of computer
programming in Chinese university. Besides the difficulty of computer programming course, English
321
Fig. 1. Comparison of scores between native teaching and bilingual teaching, where the colors of circles shows the English
Level.
Fig. 2 Comparison of scores between native teaching and bilingual teaching, where the colors of circles shows changes of
the English Level before and after the bilingual teaching
makes it more complicate to understand and study. We analyzed a real data set including 79 students
scores in two terms to compare the result changes before and after bilingual teaching. Concerned the
fact of situation, we observed that the high English level did help students to understand and study
322
bilingual course then got a better result. However, bilingual teaching did not show an aspect to
improve English level.
We will work on further research of bilingual education on relationship with other courses by
including more dataset and more samples. Beside the relationship, we are more concerned about how
to help student against study difficulties since the poor English level might not change obviously. And
the other hand, for different subdivision group of students with diverse situation, making special plans
is more important to get a better result for bilingual teaching.
5. Acknowledgement
This research was financially supported by the Engineering Research Center of Digital Media
Technology of China Ministry of Education (Project No. 2015AA0004).
References
[1] Y. Ding and M. Tang, "A fuzzy approach to bilingual education assessment and analysis,"
Communication Software and Networks (ICCSN), 2011 IEEE 3rd International Conference on,
Xi'an, 2011, pp. 147-151.
[2] Y. y. Yang, "Will Chinese students applaud for bilingual education? A case study in Organic
Chemistry course," Computer Science & Education (ICCSE), 2013 8th International Conference
on, Colombo, 2013, pp. 587-591.
[3] S. Fan, J. Fan, Y. Zhang, Z. He and H. Yu, "Intelligent e-Learning System for English-Chinese
Bilingual Education," Web Information Systems and Mining, 2009. WISM 2009. International
Conference on, Shanghai, 2009, pp. 575-579.
[4] Y. Pang and D. Shi, "Notice of Retraction Multidimensional Thinking of Accounting Bilingual
Education in Chinese Institutions of Higher Learning," Education Technology and Computer
Science (ETCS), 2010 Second International Workshop on, Wuhan, 2010, pp. 531-534.
[5] C. Lv, H. y. Liu, Y. y. Li, N. Li and Y. s. Lv, "The Evaluation of Bilingual Education in Colleges
and Universities from a New Perspective," 2012 Fourth International Conference on Multimedia
Information Networking and Security, Nanjing, 2012, pp. 802-805.
[6] J. Weiwei, "Analysis of bilingual education of Computer Culture Foundation course in colleges,"
Xi'an, 2011, pp. 119-121.
[7] X. Xiaohong and W. Zhihong, "Practice of Bilingual Education in Computer Professional
Courses," Education Technology and Computer Science, 2009. ETCS '09. First International
Workshop on, Wuhan, Hubei, 2009, pp. 512-516.
[8] Xian-Min Ma, "Probe of bilingual education in computer network course for undergraduates,"
2010 2nd International Conference on Education Technology and Computer, Shanghai, 2010, pp.
V1-379-V1-382.
[9] J. Weiwei, "Research and practice of bilingual education of C language programming,"
Xi'an, 2011, pp. 129-131.
[10] Z. Tang, Q. Li, F. Cheng and X. Liang, "Application and Effectiveness of a Multimedia and
Network Technology in Engineering Thermodynamics Bilingual Education," Intelligent
Ubiquitous Computing and Education, 2009 International Symposium on, Chengdu, 2009, pp.
300-303.
323
[11] S. Fan, J. Song, Y. Zhang and Z. He, "The Use of WebQuest to Enhance English-Chinese
Bilingual Education: A Case Study in a Course in Computer Science Overview," Computational
Intelligence and Software Engineering, 2009. CiSE 2009. International Conference on, Wuhan,
2009, pp. 1-4.
[12] X. Cheng, "Application of PowerPoint in Bilingual Teaching of Managerial Classes in Chinese
Local Higher Education Institutions," 2009 International Conference on Education Technology
and Computer, Singapore, 2009, pp. 258-261.
324
Cultivate Students' Innovation Ability through the Electronic Design

Contest
Ming Sun
Foshan University , Foshan, Guangdong,P.R. China 528000
sunming_65@163.com
*Ming Sun
Keywords: Electronic design; Contest; Innovation; Ability
Abstract. It has become an important task to cultivate high quality talent with innovative spirit. At
present all kinds of electronic contest emerge in endlessly, construction through
contest,learning through contest has become one of the practice teaching mode. By organizing
students to attend National undergraduate electronic design contest ,reform of curriculum system and
teaching contents is promoted.Ultimately students learning initiative are inspired, competitive
consciousness, innovative consciousness and employment competitiveness are greatly enhanced.
1. Introduction
With the rapid development of modernization construction in China, the social demand for
application-oriented talents is growing. Some employers changes the demand for college graduates
that skilled, practical and applied talents gain popularity. [1]
In the popularization stage of higher education, the focus that people pay more attention and
widely discuss is the quality of higher education. Practice is the foundation of innovation. Practice
teaching is an important element that achieve the goal of talent cultivation. It is of great significance
to improve students' comprehensive quality and cultivate students' sense of innovation and innovation
ability.Therefore, strengthening practical teaching and improving the quality of innovative and
applied talents training is the key to enhance the employability of college students.
In the traditional experiment teaching, experimental contents and methods exist some problems
such as outdated contents,rigid form and unitary method,which has seriously constrained the
development of students' personality space.Innovation needs personality, not only is the common
training needed,but also is the cultivation of personality strengthened. There are two practice line of
the curricular and extracurricular.Curricular refers to all experiments and practical aspects includede
in cultiviting plans and teaching syllabus, extracurricular means open and independent experiment,
elective practice, competition, innovation activities etc.
Extracurricular academic work competition becomes the necessary supplementary to the first class,
which breaks through the traditional teaching mode and stimulates students ' initiative. Therefore, the
competition consciousness, innovative consciousness and innovative ability of the students have been
greatly enhanced.
2. A brief introduction to the National Undergraduate Electronic Design Contest (NUEDC)

The National Undergraduate Electronic Design Contest is a mass science and technology activity for
college students co-sponsored by the Ministry of Education and the former Ministry of Electronics
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
325
Industry in 1994. The contest aims to promote the reform of teaching contents and
curricular system,to lead teachers to cultivate students' innovation consciousness and
cooperative spirits,to strengthen students' engineering practice ability training and to promote the
formation of good learning atmosphere.
Consequently, teaching reform of higher engineering education is effectively promoted.
Not only is the quality of talents cultivation improved,but also are conditions created for
outstanding talent emerging. [2][3]
The characteristics of NUEDC is as follow: short time, heavy task, high demand and strong
comprehensiveness.Contest involves a large number of electronic information professional
courses.Among them ,theory course include low frequency circuit, high frequency circuit, digital
circuit, single chip microcomputer principle, electronic measurement, etc. Practical courses contain
electronic circuit experiment, experiment, SCM principle curriculum design, course design and
production practice, etc. The optional electronic components are discrete components, integrated
circuits, programmable logic devices(PLD), SCM, etc. Design means can use either traditional
methods or modern electronic design aided tools. It is not difficult to see that electronic design
contest questions not only reflect the advanced level of electronic technology, but also guide the
university to pay attention to cultivating students' engineering practice ability and creative design
ability in teaching reform.
3. NUEDC role in promoting teaching

The electronic design contest plays a positive role in the reform of the curriculum system and teaching
content for electronic information specialty,which is helpful to arrangement and adjustment of
university curriculum, to transformation and replacement of laboratory equipment,to update of
teachers' teaching materials and classroom teaching contents.
3.1 Reformation of curriculum system and teaching content
A scientific and reasonable practice teaching system has been constructed, whose teaching level is
gradually progressive,as shown in Figure 1.Comprehensiveness, designability and systematicness of
fundamental experimental content are highlighted. [4]
Practice Teaching
Graduate design
Platform
(graduation thesis)
Fundamental Monitoring and

Professional Integrated Application
experiment evaluation
experiment module training module innovation module
module mechanism
Course Specialty Comprehensiv Knowledge skills

Comprehensive experiment experiment e Training competition
skill training
Special skill Integrated Professional Integrated Science &

training Experiment training design technology
activities
Fundamental
skill training Curriculum Curriculum Production
design design feedback
practice School-enterpris
e cooperation mechanism
Mainbody Multi-level diversified platform
Fig.1. Diversified multi level practice teaching system
Although students have completed many theory courses and experiment courses,such as low
frequency circuit, high frequency circuit, digital circuit, electronic measurement, sensor principle,
single chip microcomputer principle, electronic circuit design, at the same time learned a part of
326
application knowledge about embedded system design and large-scale programmable logic device
application knowledge, acquiring a certain theoretical basis and practical ability, they are lack of
complete system design concept and experience because each course is relatively independent.
Therefor,compulsory course of electronic system design is offered for junior so as to provide further
training opportunities,in which all kinds of circuits design method and means are introduced.
Students' innovation ability is cultivated.
3.2 Reformation of teaching methods improving teaching level
Competition has played a role in reformation of teaching methods and improvement of teaching
quality. Contest topics are given by a group of professors and experts with a high-level after they fully
understand the latest information in electronic communication. For teachers, they can learn the latest
knowledge of electronic communications and improve their teaching level through electronic design
contest. In the process of conducting the students, the teacher should consult a lot of relevant data.In a
sense,electronic design contest examines not only the ability of students, but also comprehensive
evaluation of the teacher,and then the construction of teaching staff is facilitated.
3.3 Promotion in construction of the laboratory
In order to cultivate students' innovation ability,high standard and open laboratories are constructed
to provide good environment for practice and research.
So far there presents good development conditions of electronic design software and hardware ,with
computers, microcontroller development system, programmable logic device development system,
DSP development system, ARM development system, digital storage oscilloscope, printer, etc.
3.4 Enhancement of students' interest in learning
Various activities such as design training, works exhibition, experience exchange are held in
laboratory. It is this good learning atmosphere that affects more and more students to enter laboratory,
improve students' interest in electronic design. Thus the interest in professional learning is stimulated.
For the award-winning students, ranking is an affirmation, for the students without ranking,
participation is a driving force. To participate in electronic design contest not only make the students
eye-opening, but also makes the students confidence in their studies.
3.5 Strengthening graduates' employment competitiveness
Through this platform, students emerge as the best candidate and have more options in employment.
In the case of the expansion of enrollment over the years, the employment rate of electronic
information engineering professional student reached more than 96%. [5] In recent years, ability that
student acquire in electronic design contest is approved by the society and the enterprise, so that more
and more students participate in contest training.
Average employment quality and employment prospects that take part in electronic design contest
was better than that did not participate in.
4. Main achievements and disadvantages

Although the time to participate in the electronic design competition is relatively late, but
achievements are significant. By organizing the students to participate in the national college student
electronic design contest, students' innovation ability, cooperative spirit and comprehensive quality
have been improved greatly. Student debugged his design system for the contest.Competition
achievements for the past five years is shown in Figure 3. Obviously it has played a very significant
role in laboratory construction, teaching reform and teaching staff promotion.
327
8
7
5 the first prize

the second prize
4
the third prize
3 successful participation prize
0
2011 2012 2013 2014 2015
the first prize 0 0 1 3 2
the second prize 3 1 1 0 3
the third prize 4 7 3 0 3
successful participation 0 2 7 3 0
prize
Fig.2. debugging design system for the Fig.3.The achievements of electronic design competition in the past
contest five years
For electronic design contest requires a certain amount of material and manpower, support from
universities should be strengthened,so as to allow more students to participate in. If school has limited
ability, social forces should be made full use of.
5. Summary
Electronic design contest not only played a positive role in teaching reform, and also examined the
teaching reform achievements. Especially it has played a unique role in the aspects of
attracting more and more students to participate in and identifying excellent talents. Of course,
winning is not the end.The ultimate aim of participate in electronic design contest is to conduct
teaching reform, to cultivate students' creative ability and to stimulate the studying passion.
6. Acknowledgement
This research was financially supported by Guangdong higher education quality and teaching reform
project in 2014.
References
[1] XIAO Yingwang.The construction of practical Teaching System about Application Talents of the
Electronic informationEngineering Major.Journal of Changchun University of Science and
Technology(Social Sciences Edition).Vol.22, pp.678-679, 2009.
[2] HUANG Zhiwei.National Undergraduate Electronic Design Competition Training Course
(Revised Edition).Publishing House of Electronics Industry.2010.6.
[3] LIU Yongshun.National undergraduate electronic design contest.Physics Experimentation.
Vol.22, ,pp.42-44, 2002.
[4] SUN Ming.Three-dimensional practice teaching system construction of electrical professional in
local university .Theory and Practice of Contemporary Education ,Vol.7,No.2, pp.92-94,2015.
[5] SUN Ming. Quality Project and Employment of College Graduate. Journal of Electrical &
Electronic Education, Vol.31, pp.79-81,82,2009.
328
College English Teaching Model Prediction Based on Random Forest
Hao Wu
Hunan Radio and TV University, Changsha, China
whwendy@163.com
Keywords: College English teaching; Random Forest; Attribute model; Teaching model
Abstract. The traditional college English teaching is given priority to with teaching, learning as
the auxiliary pole. And the organic combination of college English teaching process is divided into
two separate parts. Teachers emphasis on the selection of teaching materials and descriptions, while
students emphasize the passive fillinglearning is a process of waiting for the results of pre-installed.
Reform the present college English teaching mode by random forest forecast is a very important work.
First, students are unable to acquire new relevant knowledge quickly because teachers still maintain
the original thinking and teaching environment cannot adapt to the existing big data era. Secondly, the
channel of students knowledge acquisition is not smooth enough. In addition, teaching interactive
sessions and effective teaching evaluation system are often neglected teachers and students
appeared estranged case. Finally, factors involved in college English teaching, division of the
teaching entity, definition of the relevant properties in teaching entity, corpus of information, teaching
orientation etc., which are not comprehensive enough and understanding differences exists. Therefore,
to explore a teaching model in line with college English teaching environment is a serious problem.
1. Summary of college english teaching model
1.1 Theoretical definition

Unusual problem prediction of college English teaching is based on Random Forest (RF) theory.
Random forests is built on multiple decision trees which itself has many good features such as less
training time, less complexity, faster prediction process, easy display of model, etc. For the easy
appearance of over-fitting problem in single tree, random forests can be a good fit.
1.2 Research status
In the exploring process of study college English teaching model, the researchers explored many
teaching mode, trying to improve students cognitive level and ability to innovate as much as possible
in order to make students better able to adapt to the needs of the community, but also urge teachers
and regulatory agencies to improve their overall quality, so as to better serve the teaching, to further
enhance the level of education of universities. Because in the field of education teaching mode affects
the teacher's teaching philosophy and the final way of students, domestic and foreign research
institutions have given high attention to teaching mode. So far, the constructivist model, cognitive
model, emotivism mode, assisted mode with network, multimedia teaching mode, body-oriented
teaching mode, pedagogical knowledge model, task-based teaching model, corpus teaching mode,
teaching mode of communication have been widely used and further studied.
Abroad, the reform and research of teaching model have been very intense. In Turkey, Seyda
selected 10 universities to participate in the study about the syllabus and its comparative research
through maximum differentiation strategy [1]. In this study, data analysis showed that discovery is
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
329
often associated with some factors, such as discipline subjects, face teaching, curriculum including
subjects and face teaching, elective courses, training courses, class tables, course sorting, etc. The
study gives a comparative analysis of the similarities and differences of syllabus in higher education.
Eva overcame the prejudices, discrimination and misunderstanding of people from different cultural
backgrounds in aspects of mutual understanding and intercultural communicative competence [2].
Intercultural communicative competence in English language education is in favor of mutual
understanding and communication between the language learners and target language representative.
The English Language teaching analyzed in dealing with intercultural communicative competence
has obvious advantages. Shehdeh explored the challenges of college English teaching encountered in
the Arab world countries [3], analyzed what the current challenges college English teaching are facing
with and how to deal with these challenges, discussed the problem of ill-prepared teachers, learners
lack of motivation, teacher-centered biased ,backward technical of assessment, etc. Shulman
proposed a teaching knowledge framework which was subject pedagogical knowledge PCK
(Pedagogical Content Knowledge) in 1986 for the dispute of subject knowledge and general
pedagogical knowledge [4], which integrated subject knowledge with general pedagogical knowledge
closely, emphasized that the academic knowledge should be translated into easily understood and
accepted teaching content for students. It was a specific type of knowledge of subject teacher which
was different from the academic experts and the general education scholars. Mishra et al. put forward
the concept of TPCK(Technological Pedagogical Content Knowledge)[5] on the basis of PCK, which
was the dominant knowledge of the effective teaching of the subject teachers application technology.
TPCK provides us with an analytical framework for the integration technology of the teacher
education model. Azlin established analytical framework of interview data based on model TPCK [6],
as well as studied the information on two language acquisitions and the use of communication
technology in English literature teaching. The results showed that providing a better different types of
knowledge environment is extremely important, also contributing to the further development of
TPCK model. There are task-based and content-based teaching methods which are related to the
subject teaching method. Mohammad divided thirty subjects into two groups to verify the
effectiveness of that teaching method [7].
In the process of College English teaching, the use of corpus has been highly valued by researchers.
Through the study of the key words in the corpus, Crayton revealed the relationship between the
different meaning of a word and the meaning of the word meaning, and showed its significant
difference according to this kind of collocation [8]. In addition to the use of corpus materials, teachers'
professional development is a key factor in change of professional and school cultural. Through case
studies for schools in Spain [9], Auxiliadora explained how the action research methodology to
encourage professional and school cultural towards intercultural and inclusive way direction, and
actually obtained the key factors that teachers need critical reflection, collaborative work and public
participation strategy.
In addition, communicative approach (Communicative Language Teaching, CLT) is often valued
by pragmatists. CLT first appeared in the 1970s, which was a language teaching method focus on
developing learners communicative competence. According to the framework of syllabus, Breen et
al. conducted more in-depth study on the nature of CLT theory [10]. Previous studies showed that
teachers practice may be inconsistent with cognition, especially in communicative teaching practice.
For existing cognition, observable practice and context factors, it can be observed in the using of CLT
college English language teaching method of theory and practice is very important [11]. However,
cognition and practice in real life will diverge, mainly by the impact on the understanding of the
working, also by differences between cognition and practice result from meeting different
expectations. College English Language Teaching involves a wide range of subjects. As in
management, economics and social sciences, Joy explored the subject area of different contents [12],
including linguistics, cognitive science, social cultural features of university literacy and university
literacy heritage, and described the key factors that affect teaching and further research. By studying
330
ESL teacher in 34 schools, Mari found that, in addition to communication teaching, family education,
parents support and promotion of teachers are also very helpful for student English learning [13].
However, cultural differences could affect students communication. Miguel stressed that English
teaching should consider cultural differences [14]. Learners more easily communicate with people of
different nationalities whose native language is not English. On the basis of the corpus, Miguel
discriminated students cognition and attitude by using emotional content analysis.
In China, the study of college English teaching has been more than ten years of history. Among
them, the constructivist theory has had a profound impact on college English teaching. There were
studies that had investigated the status of combination of constructivism and college English teaching
in China [15], showed that empirical research took a very small part and the constructivist theory was
not evenly distributed in application of English teaching research in China. They also found that the
research on constructivist theory of multimedia network technology took up a large proportion, and
the research lacked the spirit of critical and inheritance. As the college English teaching in our country
is entering an important historical period of transition, the main characteristics boundaries of the
transition period has been gradually blurred, and the unified teaching model is being developed to the
individualized teaching. Therefore, we should strengthen the study of the law and countermeasures of
college English teaching in the transition period, implement individualized teaching requirements and
test, transfer from basic college English teaching to special college English teaching and reform
Chinese college English teaching system[16]. With advances in statistical natural language
processing technology, legibility research of college English Teaching has been rapidly developed in
recent years. College English legibility research was explored from the perspective of the
establishment of statistical language model, which broke the limitations of traditional research
methods, went beyond measuring word length, sentence or word difficulty distribution paradigm ,and
achieved good research results. However, legibility research work remained deficiencies because of
some problems existing in the probabilistic language model. They still need to improve the quality of
research [17].
2. Random forests of college english teaching model
2.1 Random forests decision tree theory

Random forests (RF) was Breiman put forward a new combination classifier algorithm in 2001. He
used the classification and regression tree (CART) as a classifier, made of Bagging method of
manufacturing differences training sample set, and when constructing a single tree, randomly select
the feature internal nodes property division. Bagging methods and combination of CART algorithm,
together with the random selection of features property division, so that RF noise can be better
tolerated and has better classification performance. Aiming at many current problems appeared in the
process of college English teaching, how to find the problem as soon as possible, the adverse effects
that may arise in the early reverse, is the focus of this study, the use of the theory of random forests
will provide powerful data analysis capabilities to predict actual teaching effect scientific means and
the basis.
2.2 Properties of college english teaching model research
According to subject-curriculum- eaching each entity object, to explore the structure of the model
map that accurately reflects the essential characteristics of an entity so as to formal description and
reasoning entity, in which will turn the map structure into a tree model, and established in line with
the true semantics college English Teaching attribute model.
2.3 Random forests prediction unusual problems in college english teaching
The classification of machine learning algorithm is used to establish prediction model, which
involves support vector machines, decision trees, artificial neural networks, self-enhancement
331
methods etc. Random Forest is an integrated learning algorithm has good classification performance
and higher classification accuracy, and the computational efficiency of the model is high, is suitable
for the calculation of a variety of data sets. Because of the random forest method characterized in
college English teaching entity attribute selection has good robustness, and also has good
performance to high-dimensional feature vector space, has better ability in promoting and ranging of
data at the same time, so the random forest as the prediction method of abnormal problems of college
English teaching.
This article concentrates on college English teaching in the process of learning in a study of
abnormal behavior problems. Firstly, the properties model the entities constituting the object-centric,
and go through the relevant data, pre-processing, reducing and other operations to get effective feature
streamlined data; Secondly, the rule properties characteristic analysis of the acquired data, and the
establishment of a hierarchical prediction model based on similarity measure various attributes of an
entity, at the same time it took into account the configuration of the attribute weights; Finally, the
establishment of teaching mode based on hierarchical optimization model prediction model.
2.4 Classifier learning
In the design of the classifier, only be predicted by a single classifier is often imprecise and prone to
over-fitting phenomenon, training the classifiers generalization ability weak. When combining
multiple classifiers, which can enhance the overall performance of the classifier effectively. Here each
individual classifier needs to meet two conditions: the accuracy of each individual classifier should be
better than a random guess; each individual classifier should be there are differences with each other.
Through repeated sampling from the original sample set can be obtained on different training sample
subset, so as to train each individual classifier. If the sample size of the original sample set is N, each
sampling with replacement is also a subset of the sample size N, then each sample is not drawn a
probability of about ((N-1)/N)N, When N is large enough, its value approaching 37%, this feature for a
decision tree unstable splitter, can effectively improve the classification accuracy.
2.5 Random forest algorithm
Random forests is based on K decision tree {h(X, k), k=1,2...,K} as basic classifier, after classifier
learning obtained by a combination of classifiers. When the input sample is classified, random forest
classification result is outputted by the vote of a simple decision tree for each classification. Where
{k,k=1,2...,K} is a sequence of random variables, which is composed of a random thought Random
Forests decision. The training process is the essence of random forests for training each tree, and the
training of the decision tree is independent of each other, so the random forest can realize its training
through parallel processing, so as to improve the efficiency of the model.
3. Research on college english teaching model

It mainly involves 3 aspects, including the main information, course management and teaching
information. Information on the subject is mainly constituted by a student information, course
information, teacher information, course of study management mainly consists of students classroom
performance, student job performance, the student's performance constitute, teaching information
mainly by the information of teachers experience, teacher observation information, teachers
intuitive information constitute. In the course of the study, a total of 27 questionnaires were compiled,
including 3 aspects: Structured data of the main body of the study, Research on the semi structured
data of teach management, Study on teaching information of non-structured data. The process of
questionnaire survey consists of the following 3 parts.
3.1 Purpose of investigation
Through the issuance of the questionnaire, trying to objectively reflect the current situation of
students in the learning process, the achievements, the problems, According to the quantitative rules
332
designed in this study, the machine learning method combined with random forest prediction provides
guidance for our college English teaching model.
3.2 Object of investigation
From the year 2013 to 2014, four university English majors in the 400 people sample, they filled in the
questionnaires.
3.3 Effective data collection
The number of payment is 2 times, each time 200 copies issued, in 2013 and 2014, a total of 400
questionnaires, 364 valid questionnaires are the effectiveness, according to the content of the survey
scores to quantify, the random forest learning method to getting prediction rules.
3.4 Data preprocessing and analysis
Data preprocessing consists of four basic steps: data selection, data consistency, data cleaning and
data discretization. In front of three steps to solve the initial data in the presence of the surface, there
are a variety of methods and techniques; the fourth step is related to the content of the data in the
original database, which plays a decisive role in the next step. Here the discretization methods mainly
include: data cleaning, data integration, data conversion, data reduction. The establishment of random
forest mainly consists of two steps: First of all, all the training sample data are extracted by a fixed
number of sample points obtain N different sample sets; Secondly, the establishment of each decision
tree is that a certain amount of attribute is randomly selected from the total attribute as the splitting
attribute set, so that the N tree classifier is not the same, This randomly generated N decision tree is
constructed with a random forest. For each decision tree, the split attribute is the constant selection
with the Gini index to reduce the value of the largest attribute to arrange.
4. Summary
Involved in this paper from the teaching mode of college English teaching entity and attribute, based
on the theoretical definition and the theoretical prediction of random forest, the paper aims at the
property of the model of college English teaching model and students learn to predict the behavior of
effective analysis. Through the 364 survey data to verify the feasibility and effectiveness of the
program, however, the system also has the following disadvantages: 1.Whether attribute analysis is
adequate. Because the program takes into account only 27 properties, the actual determine a student's
learning behavior may be more, but also to further expand in the follow-up study to further enhance
the generalization capability of the system. 2. System of training and the time analysis lack of
effective analysis. Although a high prediction accuracy rate for the program, the training time
consuming and consuming judgment is not to be ignored, more classification trees can enhance the
ability to judge, but also an additional computational cost, this is the place where the paper to further
strengthen. 3. Attribute model of college English teaching model has made a thorough research, but
subsequent students behavior guide is a direction to explore. In summary, the proposed random
forest predict college English teaching model research have been some achievements, but above
problems to be further improved.
5. Acknowledgement
This work is financially supported by the 2012 University English Teaching Research Special Project
of The Twelfth Five-Year Plan of Hunan Education Scientific Research Institute (XJK12YYB046).
333
References
[1] Seyda Sanli. Comparison of the English language teaching (ELT) departments course curricula
in turkeys education faculties. Procedia - Social and Behavioral Sciences, 1(1):838-843, 2009.
[2] Eva Reid. Techniques Developing Intercultural Communicative Competences in English
Language Lessons. Procedia - Social and Behavioral Sciences, 186(1):939-943, 2015.
[3] Shehdeh Fareh. Challenges of teaching English in the Arab world: Why cant EFL programs
deliver as expected? Procedia - Social and Behavioral Sciences, 2(2):3600-3604, 2010.
[4] Shulman, L. S. Those who understand: Knowledge growth in teaching. Educational Researcher,
15(2):414, 1986.
[5] Mishra, P., Koehler, M. J. Technological pedagogical content knowledge: A framework for
teacher knowledge. Teachers College Record, 108(6):1017-1054, 2006.
[6] Azlin Zainal. ESL teachers use of ICT in teaching English literature: An analysis of teachers
TPCK. Procedia - Social and Behavioral Sciences, 34:234-237, 2012.
[7] Mohammad Bagher Shabani, Arad Ghasemi. The Effect of Task-based Language Teaching
(TBLT) and Content-based Language Teaching (CBLT) on the Iranian Intermediate ESP
Learners Reading Comprehension. Procedia - Social and Behavioral Sciences, 98(1):1713-1721,
2014.
[8] Crayton Walker. How a corpus-based study of the factors which influence collocation can help in
the teaching of business English. English for Specific Purposes, 30(2):101-112, 2011.
[9] Auxiliadora Sales, Joan A. Traver, Rafaela Garca. Action research as a school-based strategy in
intercultural professional development for teachers. Teaching and Teacher Education,
27(5):911-919, 2011.
[10] Breen M,Candlin C N. The Essentials of a Communicative Curriculum in Language Teaching.
Applied Linguistics, 1(2):89-112, 1980.
[11] Anne Feryok. An Armenian English language teachers practical theory of communicative
language teaching. System, 36(2):227-240, 2008.
[12] Joy Janzen. Teaching English Language Learners in the Content Areas. Review of Educational
Research, 78(4):1010-1038, 2008.
[13] Mari Haneda, Mariko Alexander. ESL teacher advocacy beyond the classroom. Teaching and
Teacher Education, 49(1): 149-158, 2015.
[14] Miguel ngel Candel-Mora. Attitudes towards intercultural communicative competence of
English for Specific Purposes students. Procedia - Social and Behavioral Sciences, 178(1): 26-31,
2015.
[15] Hui Huang, Hai Wang. Investigation and reflection of FL teaching research based on
constructivism. Foreign Languages and Their Teaching, 6:21-24, 2007.
[16] JiGang Cai. Characteristics and solutions of college English teaching in transition. Foreign
Language Teaching and Research, 39(1):19-24, 2007.
[17] FuKun Xing, DongYuan Cheng. English Text Readability Based on Statistical Models. Journal
of PLA University of Foreign Languages, 33(6):27-32, 2010.
334
A Prospect of the Five-Step Method in College EFL Classrooms

Lixin Dai1,a*, Xiaodan Lib
1
Shenyang Aerospace University Foreign Language School, No.37 Daoyi South Avenue, Daoyi
Development District, Shenyang China 110136
daisy55988@163.com
Keywords: Five-Step Method; EFL; Communicative competence
Abstract. English is considered to be the worlds most used international language. It plays an
important role in promoting the development of national and world economy, science and culture; it
is the language of the Internet and commerce. In China, English has been widely used in scientific
research, technological development, medical study, manufacturing products, education and culture
appreciation. The adoption of the Five-Step Method in English language teaching, which combines
the traditional methods, and the Communicative Language Teaching, reflects the communicative
need in English in the nations development. The Five-Step Method, which focus on
communicative competence will be various together with the changes of the students reasons for
studying English and the teachers views on English teaching.
1. Introduction
In China, English is still emphasized in the prosess of high education in response to the global
impact of English as the language of international communication. It is seen as the language of
business, technology, and science and has widely used. However, for most college students, English
is still considered as the language barrier in their pursuit of academic or social careers. The majority
of the college students will have to be trained to pass College English Tests Band 4 (CET 4), which
is also the requirement of their future jobs. In spite of the enormous efforts and time they spend,
applying English in academic studies are still challenging for the most college students. The process
of EFL teaching practice indicates the development of English. The adoption of the Five-Step
Method in English language teaching, which combines the traditional methods, and the
Communicative Language Teaching, reflects the communicative need in English in the nations
development. The Five-Step Method focusing on communicative competence will be various
together with the changes of the students reasons for studying English and the teachers views of
English teaching. However, does it necessarily mean the Five-Step Method is an effective way in
college EFL classrooms to meet students needs for developing their language abilities?
2. Review of literature
Five-step Method bases on the learning theory that activities involving real communication[1], it
combines the behaviourist theories of imitation and grammar translation techniques as appropriate
in the teaching process. The Five-Step Method combines the Grammar-Translation Method and the
Audiolingual Method and the Communicative Language Teaching.
The Grammar-Translation Method and the Audiolingual Method have dominated ELT in China
for a long time. According to Dzau, The attractions of the Grammar-Translation Method lay in its
resemblance to approaches to learning Chinese as a mother tongue [2]. Likewise, the Audiolingual
Method, which based on structural linguistics and behaviourist psychology, incorporated repetitious
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
335
learning as a strategy that was similar to the most common method of learning Chinese characters.
[2]. Today the Grammar-Translation Method and the Audiolingual Method are still used in EFL
classroom in colleges in China. However, these kinds of teaching produced structurally competent
students who were often communicatively incompetent [3], it could not meet the needs of the
nations Open Policy and the rapid development of the economy.
Consequently, new syllabus set communication as the teaching aim and Communicative
Language Teaching (CLT) approach was introduced in 1990s. CLT pays more attention to
developing students communicative competence which defined communicative competence as a
term in linguistics which refers to a language user's grammatical knowledge of syntax, morphology,
phonology and the like, as well as social knowledge about how and when to use utterances
appropriately[4]. CLT that is focused on developing communicative competences, claims contextual
materials, small size class and qualified English teachers as basic conditions to the Chinese teachers.
Because of the large population, the class size constrains the effects of CLT activities and degrades
the quality of teaching. Whats more, the teacher who adopts CLT needs to change her role into
facilitator, needs analyst, counsellor, and process manager in the classroom[1].
Later Five-step Method emerged with the guide of Prabhus theory that if the methods that we
have at present fail to account sufficiently for the diversity in teaching context, we ought to try to
develop a more general or comprehensive theory to account for more of the diversity [5].
Five-Step Method combines the Grammar-Translation Method and the Audiolingual Method and
the Communicative Language Teaching. It divides the classroom activities into five steps:
Step One --- Revision. In this stage, students usually are required to review the language points
presented in the pervious lesson, using dictation, retelling the text, making dialogues or answering
questions.
Step Two --- Presentation. In this stage, the teacher elicits and presents language input using
Grammar-Translation Method, Audiolingual Method and CLT with the use of visual aids such as
flash cards, realia, video and tapes.
Step Three --- Drilling. Students are instructed to imitate the dialogues or read through the text.
Step Four --- Practice. Students are required to practise the dialogue or text in pairs or in groups.
In Step3 and 4 the teacher engages the students in conscious learning by organizing these activities
to ensure that the language they practise will prompt its use.
Step Five --- Consolidations. Students are provided with opportunities to present communication
output with exercises constituted communication challenges for students, such as playing game,
dramas and occasionally, students are require to make sentences or do exercises connected with
grammar items.
Five-step Method is a useful method where students can benefit from various practice in
language learning, and the motivation of the students develop. It enables students to interact
effectively with others, therefore teachers should give more importance to encourage the individuals
to become more communicatively competent.
3. Five-step Method used in EFL classrooms

Five-step Method has been used widely in classrooms in the light of developing students four basic
language skills (listening, speaking, reading and writing). In the future, meaningful language
segments based on topics, situations, notions and functions, and a variety of activities and
meaningful tasks such as pair work, group work, discussions will reflect the students needs. The
focus of the classroom will emphasize on fluency rather than accuracy, because the teacher
understands that fluency is an important dimension of communication. [5] The use of the methods
in the classroom will be more flexible according to the individual student and the learning-centered
context, since different methods are best for different teaching context [6].One of the problems
that exist in current methodology in college EFL classroom is that the grammar-focused structure
still dominates the classroom. We cannot deny, there is value in classroom tasks which require
learners to focus on form [7], even in the future, grammar will still be an essential resource in
336
using language communicatively [7]. The changes of the methodology used in ELT will also be
affected by increased understanding of the distinction between differences in learning styles and
strategies, justifying the distinction between whole-class and smaller group work, and also allowing,
where feasible, for the individualization of instruction in various formats. [3]
3.1 Students beliefs
Learning how to learn would be of utmost importance in the process of language learning. Most of
the students do not have the motivation or purpose for learning English. Some of the students see
English as a required course to be passed and do not actually realize its importance as a means with
which they can communicate with others and a way to adapt themselves to new technology and the
rest of the world. For most students, learning English is something that they have to, for example, to
pass the CET 4 to meet the future job requirement. Therefore, the students' beliefs about learning
English are still focused on memorizing a list of words and a set of grammatical rules rather than
obtaining actual skills of using English.
However, with the guide of the clear purposes, students will be more active to engage in learning
English rather than passively accepting the knowledge. Students have the wills and ability to think
independently, solve the problem creatively. Their need of English will be more than basic skills of
reading and writing, communicating clearly with others is vitally important. Besides, the clear
purposes will help them to learn English more efficient, because the conceptualizing content theory
believes that language is used in a context, which determines and constrains the choices that
language users make with respect to purpose, style, register, and topic [3]. They will pay more
attention to both form and meaning of the language, showing an awareness of their own learning
style to find ways of expanding their knowledge of English; they will tend to think in English
independently from their mother tongue and are flexible in learning the language, for example, they
will not solely rely on the textbook, they will take advantage of the computers and the Internet to
learn English.
3.2 Teachers role
Five-steps Method hasnt been actually carried out in EFL classroom because teachers fear and the
associated guilt, shame or embarrassment of poor results as a consequence of their students
performance in public examinations might lead teachers to teach English for testing purposes only
[8].ELT teachers in the future will be more qualified. They will be able to accept new ideas and
adopt different methods and approaches in their teaching, such as, Nature Approach, Cooperative
Language Teaching, Task-Based Instruction or Content-Based Language Teaching and combine
them with the traditional methods adequately. In a learner-centred classroom, the teacher will view
their work as a needs analyst. She/he needs to find out what are the students need in order to
address them effectively, because different students have different needs and the information
gather through needs assessment can help a teacher make choice as to what to teach and how to
teach it [8], they will also view this needs assessment as a teaching tool that enables them to work
in partnership with their students to determine needs and ensure that the course meet those need
[8].Besides, setting goals and objective might be another change of the teachers view of their work,
since clear goals and objectives give the teacher a basis for determining which content and
activities are appropriate for her course. They also provide a framework for evaluation of the
effectiveness or worth of an activity [8].The teacher will view his/her role as a materials selector
and developer. In todays college classroom in China, the teacher is still in the position of
knowledge holder; he/she controls the direction and pace of learning and monitors and corrects the
learners performance. In the future, teachers will encourage the students to use real life language by
organizing different activities and involve themselves in the learners and activities.
3.3 Teaching materials
The material is the backbone of the course[9], Materials have the primary role of promoting
communicative language use [5] in the second language teaching. Textbooks will still be one main
337
kind of materials used in conducting Five-step Method in the future, however, relying solely on the
textbook is, perhaps, not the best strategy for teaching English communicatively. A set of
framework of the textbook can provide a firm jump off point for the creation of imaginative
supplementary teaching ideas [10] and the material in a textbook can been modified to incorporate
activities that will motive students and move them beyond the constraints of the text
[10].Therefore, the teacher will develop the material to create communicative activities and the
authentic, from-life materials such as language-based realia, magazines, and advertisements will
be more used and incorporated into activities.
Computers are seen as an important kind of material in English language teaching[10], and it is
certainly true that growth of computer use --- and of the Internet in particular--- has been
spectacular in the last few years [11]. The language most widely used in the Internet is English
[11], even though more language will be used in the Internet in the future. Learners need to be
computer literate, and since computers use language it would seem logical to take advantage of
them for language learning [10]. Presumably, there is going to be significant progress in the use of
computers and the Internet to learn English in the future in China, for example, corpora will be
widely used for ELT dictionaries and teaching materials; speech recognisers and machine
translations system might be used both in the classroom and at home.
It will be more convenient for teachers to prepare worksheets, test and select teaching materials
and the students will use it for self-study to seek their particular needs. However, as computer usage
spread, in future, automatic language translation will provide the users more convenient service for
other language speakers, such as invisible translation service and browser software transmitting
language preference information, In other words, people can search the world web sites without
knowing English [11]. To some extent, this phenomenon will reduce the need for learning English;
it will discourage the Chinese students to study English. Therefore, The growth of communication
technology indicates that the future of ELT in China will be more complex. The main obstacle for
the students is that there is no authentic environment that makes them access to the original
language. Learners must use the language and have purposes for using it. [9]. Therefore, students
will be provided with learner and learning centered contexts to learn English where the students
language skills will develop through the learners actively using and reflecting on the language
inside and outside the classroom. [12]. In other words, they will learn by doing it [1].
4. Conclusion
In the light of the literature we have reviewed and the discussion above, we see Five-step Method is
a useful ELT method. However, some problems exist while teachers employ the method in reality:
first, some of the materials are not suitable for the students, thus they cannot really meet the needs
of the learners interest. Second, basically the teachers still control the classrooms and are in the
position of knowledge holder even though some activities related to real life are organized in class.
Besides, the students still have no clearly anticipated use for the skills gained through study apart
from aiming to pass the CET 4, thus in the classroom they are still the passive learners. In addition,
all the teachers use the same method for each lesson provided in the Teachers Book. Therefore,
Five-step Method cannot really be carried out to meet the communicative needs of our Open Policy
and the development of economy. However, when we recognize the problems and take steps to
solve them in the process of teaching we can actually apply Five- steps Method successfully to
develop the students communicative skills and meet the students needs, such as, developing the
material to create communicative activities and the authentic, from-life materials will be more
used and incorporated into activities; teachers will work in partnership with their students to
determine their needs and ensure that the course meet those needs; with the guide of the clear
purposes, students will be more active to engage in learning English rather than passively accepting
it. Instead of solely relying on the textbook, students will take advantage of the computers and the
Internet to make learning English more convenient.
338
References
[1] Breet, F. The Theory and Practice of English Teaching. Sunderland: Sunderland University Press
p22, p81, p86, 2000.
[2] Dzau, F. English In China. Hong Kong: API press. p11, p64, 1990.
[3] McDonough, J and Shaw, C. Materials and Methods in ELT. Blackwell Publishing Ltd. p16,
p254, 2003.
[4] Hymes,D.H. On Communicative Competence. Philadelphia: University of Pennsylvania Press
1971.
[5] Richards, J and Rodgers, T Approaches and Methods in Language Teaching. Cambridge:
Cambridge University Press, p61, 172, 2002
[6] Prabhu, S. There is no best methodWhy? In Breet, F. (2000) The Theory and Practice of
English Teaching. Sunderland University Press pp. 161-176, 1990.
[7] Nunan, D. Designing Task for the Communicative Classroom. In Breet, F. (2000) The Theory
and Practice of English Teaching. Sunderland University Press p13, 1989.
[8] Wall,D.,&Alderson, J.C. Examining washback:Language Testing 10(1), 1993.
[9] Graves, K. Teachers as Course Developers. In Breet, F. (2000) The Theory and Practice of
English Teaching. Sunderland University Press. P12-38, 1996.
[10] Ur, P. A Course in Language Teaching. Cambridge: Cambridge University Press. p190, 193,
2002.
[11] Graddol, D. The Future of English? In Breet, F. (2000) The Theory and Practice of English
Teaching. Sunderland University Press p50-51, 1997.
[12] Nunan, D and Lamb, C The Self Directed Teacher. In Breet, F. (2000) The Theory and
Practice of English Teaching. Sunderland University Press. p8-22, 1996.
339
An Analysis of Air Traffic Controllers Needs for English Proficiency

Lixin Dai
Shenyang Aerospace University Foreign Language School
No.37 Daoyi South Avenue, Daoyi Development District, Shenyang China 110136
daisy55988@163.com
Keywords: Air traffic controller; English proficiency; Flight safety
Abstract. In aviation context, English especially aviation English is frequently used nowadays
among air traffic controllers. For student air traffic controllers in college, the need for English is not
just to get the basic language skills to communicate with others effectively but to be capable enough
to use English in the domain of aviation. The present study is to identify what factors determine the
air traffic controllers desire to acquire English and which language aspects the student air traffic
controllers prioritize. Data were collected through questionnaires and interviews. The
questionnaires and interviews were conducted by student air traffic controllers in an aerospace
university. The purpose of this study is to see the actual needs that the student air traffic controllers
demand in the aviation context and to meet the air traffic control learners requirements. The results
of the study reveal that the student air traffic controllers primary needs are improving their
listening and speaking skills, especially in respect to aviation English. Thus the study recommends
that curriculum in accordance with the learners needs should be reviewed and adjusted.
1. Introduction
English is widely used in aviation context, especially among air traffic controllers and pilots whose
English proficiency determines the flight safety. The high English proficiency will make student
traffic controllers qualified and become professional in their future career. Presently English
program has been a part in college curriculum, but most of the air traffic controllers and other
aviation employees alike still lack English proficiency in workplaces after graduation because the
current curriculum focus is not on listening and speaking which are essential for air traffic
controllers especially in air traffic management. Thus, the general aim and the syllabus design
cannot meet the learners desire for the English proficiency in the domain of aviation.
In order to bridge the gap between the current English proficiency and the proficiency required
in the workplace, a need analysis is conducted. The study is to identify the opinion of student air
traffic controllers and take their needs into account to develop a learner-centered curriculum. Data
were collected through questionnaires and interviews which were conducted by student air traffic
controllers in an aerospace university. The results reveal that the student air traffic controllers
primary needs are listening and speaking skills, especially aviation English. The study suggests that
in order to enable student air traffic controllers to be English competent enough to perform their
work in the future, current curriculum in accordance with the learners needs should be reviewed
and adjusted.
2. Review of literature
2.1 ICAO requirements on language proficiency
In aviation context, Safety experts are constantly seeking to identify means of improving safety in
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
340
order to reduce the already low accident rates [1]. Communication is one human element that is
receiving renewed attention. The purpose of ICAO language proficiency requirements is to set rules
and regulations in the use of English in aviation context to reduce the miscommunication in
radiotelephony communications to minimum and enable speakers to more readily recognize errors
and work towards the successful and safe resolution of misunderstandings [1]. In ICAO Annex 1, it
specifies that air traffic controllers need to get ICAO English language Level 4 the operational
level which is considered the safety threshold, to perform their professional work. Annex 10,
Volume 2, states that if a pilot and an air traffic controller dont speak a common language, the
default language is English.
The implication of this is that all air traffic controllers involved in international operations and
that do not share a common language have to have stated on their license their level of English
language proficiency[2]. Data obtained from the ICAO Accident/Incident Data Reporting System
(ADREP) database, United States National Transportation and Safety Board reports (ASRS), the
United Kingdom Mandatory Occurrence Reporting System (MORS) and Confidential Human
Factors Incident Reporting Programme (CHIRP) corroborate that the role of language in accidents
and incidents is significant. A number of fatal and non-fatal accidents appear in the ICAO ADREP
which cite language barrier as a factor[3]. ICAO language proficiency requirements specify that
English language should be standard, specific, explicit, and direct. [1]
2.2 Needs analysis
Needs analysis refers to procedures for gathering information about learners and about
communication tasks for use in syllabus design [4]. Needs analysis is critical when providing
curriculum and syllabus in an educational institute regarding to learners future career. Courses
should be designed to fit students rather than fitting students to courses [4].
Hutchinson and waters (1987) believe that different learners have different interest and needs,
that have an important influence on their motivation to learn and therefore on the effectiveness of
their learning. These needs support the development of the courses in which relevance to learners'
needs and interests were of great importance [5]. Mackay and Mountford (1978) states that all
language teaching should be designed for the specific learning and specific purposes of identified
groups of student [6]. Jasso-Aguilar analyzed the vocational English language needs and the
researcher found the conclusion of a wider range of voices in needs assessment [7].
In the light of the literature we have reviewed, an analysis of student air traffic controllers needs
is supposed to be a must for making English program relevant to their career.
3. Investigation and analysis

3.1 Research method
To produce a stronger and more valid information gathering process, various instruments need to be
used [8]. Thus questionnaires based on a Likert-scale on investigating the student air traffic
controller needs for English proficiency have been conducted. 90 college learners who are student
air traffic controller in college participate in the study. 30 questionnaires were conducted among
students whose majors are air traffic control in an aerospace university. The questionnaires have 2
sections, the first section containing items on needs for English proficiency is to identify the priority
that the student set among listening, speaking, reading and writing skills. The second section aims
at investigating the professional and general needs of the student air traffic controllers for Englisf
proficiency. Besides, semi-structured interviews with 15 student air traffic controllers were
conducted in an attempt to gain more information about the learners needs on English proficiency.
3.2 Findings and analysis
The analysis was based on the data collected from questionnaires and interviews. See the chart and
table below:
341
Chart percentage of Needs for Language Skills
100%
80%
60%
40%
20%
0%
listening speaking reading writing
Tab. Results from the interview

top needs for English proficiency
1. better understanding and using radiotelephony phraseology
2. providing standard English to pilot
3. work with foreign colleagues effectively in future career
4. reading original flight manuals
5.communicating with foreigners
Data from the chart shows the percentage of listening, speaking, reading and writing skills being
focused by student air traffic controllers. From the table, it can be noted that the distribution of their
needs is different where listening and speaking skills are 100%; while reading skill contributes 85%;
and 48% for writing skills.
The percentages in listening and speaking skills show student air traffic controllers are in great
need and paying more attention to speaking and listening abilities. The reason may be due to the
fact of the learners vocational features. In the domain of air traffic control, air traffic controllers are
required to use spoken English to deliver their instructions to pilots accurately and understand
pilots English responses correctly to perform their work and secure flight safety. Therefore,
listening and speaking skills play an important role in student air traffic controllers process of
learning English.
The implication of the findings is that the listening and speaking skills are beyond general
English and more associating with aviation English, which means their specific needs for the
English proficiency is based on their future career. In ICAOs previous accidents reviews, it was
found that the accidents are commonly attributing to insufficient English language proficiency on
the part of flight crew or controllers[9].According to ICAO language proficiency requirements, both
pilot and air traffic controller are required to use standardized phraseology in all situations for
which it has been specified[10], a professional air traffic controller is supposed to have the ability to
communicate with pilots successfully and be more readily recognize errors towards safe resolution
of misunderstandings. The percentage of readings skills is 85%, which indicates the need for
improving reading ability. Most of air traffic control handbooks and aviation related manuals are
written in English, therefore, reading skills are essential for student air traffic controllers to be
professions in the future careers. The chart shows writing skill is less focused by student air traffic
controllers, which implies writing ability is not that important compared with listening, speaking
and reading.
Findings in Table show the needs that the student air traffic controllers prioritize through
interviews. The results also indicate that student air traffic controllers are consistent pointing out
great needs for English in their professional field where listening, speaking and reading skills are
mostly applied. Good examples of this can be seen from better understanding and using
radiotelephony phraseology, providing standard English to pilot, working with foreign
colleagues effectively in future career, reading original flight manuals, and so on.
The findings provide strong evidence to show the learners heavy needs of the listening and
speaking skills especially in aviation professions. The implication of it is that high English
342
proficiency could add to student controllers competitive edges in their future career, thus
importance might be given to listening, speaking and reading activities in learning, and current
English language curriculum is supposed to be modified according to the needs analysis. Presently,
English programs have been necessary parts in colleges and universities associated with aviation
professions, however, the syllabus designs are not any different from any other courses, which
cause the aviation employees lack English proficiency in their working environments. The reason
behind is the English curriculum in aviation college could not meet the learners demand of English
in the workplace where listening and speaking skills are most used.
4. Conclusion
It is no doubt that English proficiency is fundamental and essential in successful communications in
the context of aviation and air traffic controllers play critical roles in air traffic management. The
results of the study reveal that student air traffic controllers primarily need for their English
proficiency is to develop speaking and listening skills. The findings indicate that air traffic
controllers spoken and listening skills determine their effectiveness of air traffic instruction and
therefore play an important role in the job careers of aviation in the future. The study implies that
both student air traffic controllers and aviation English teachers should be aware that listening,
speaking and rreading abilities, especially listening and speaking abilities are strong indicators of
language proficiency in the domain of air traffic control, it is strongly associated with the aviation
safety.
In conclusion, air traffic controllers English language proficiency greatly affects the flight safety
and aviation security. The study provides an insight on the air traffic controllers needs for English
proficiency. Based on the results, it recommends that in order to well develop the air traffic
controllers English proficiency, college curriculum and syllabus in accordance with the needs of
the student air traffic controllers should be adjusted and redesigned.
References
[1] Manual on the Implementation of ICAO Language Proficiency Requirements DOC 9835
International Civil Aviation Organization, pp.vii, 1-2, Chapter2, Chapter 3, 2010.
[2] Language Proficiency Requirements: Critical to Aviation Safety ICAO JOURNAL ISSUE 5
p64, 2013.
[3] http://www.icao.int/safety/lpr/Documents/A38.8.pdf A38-8: Proficiency in the English
language used for radiotelephony communications.
[4] Nunan, D. Second Language Teaching and Learning. Boston: Heinle&Heinle Publishers. P45,
148, 1999.
[5] Hutchinsin, T., & Waters, A.. English for Specific Purposes: A learning-centered approach.
Cambridge, United Kingdom: Cambridge University Press. 1987.
[6] Mackay, R., & Mountford, A. (Eds.). (1978). English for specific purposes. London: Longman.
[7] Jasso-Aguilar, R.. Sources, methods and triangulation in needs analysis: A critical perspective
in a case study of Waikiki Hotel maids. English for Specific Purposes, 18, 27- 46. 1999.
[8] Brown, J. D. Elements of Language Curriculum: A Systematic Approach to Program
Development. Boston: Heinle & Heinle Publishers. p52, 1995.
[9] ICAO (2010) Manual on the Implementation of ICAO Language Proficiency Requirements,
Doc 9835 Second Edition, Canada.
[10] http://www.icao.int/safety/lpr/Documents/A38.8.pdf A38-8: Proficiency in the English
language used for radiotelephony communications.
343
Research of News-listening Teaching in CET4

Xiujuan Li1, Xiangjun Xu2
1
Wuchang Shouyi University, Wuhan, 430064, China;
2
Wuhan Mechanical College, Wuhan, 430075, China
Keywords: News listening; Learning difficulties teaching strategies.
Abstract. News-listening appears in the listening part of CET4 after reform, which is a big
challenge for non-English major students who face lot difficulties during study. This paper
concludes problems existing in the News teaching and explores ways and strategies to solve those
problems.
1. Introduction
In order to adapt the change of need of college students listening ability from society in the new era and
improve the validity of listening test, CET committee adjusted partly listening question types of
CET4.Listening part adds 3 news listening which occupies 7%. Comparing to short-conversation,
news-listening is a new type with considerable difficulty, which puzzles students substantially in a short
period. And there is no big progress in news-listening ability although students persist in listening to news
broadcast. Students have no correct ways and lack correct instruction so that they are in a casual situation
and have no sufficient preparations for news listening. The author finds such problems during teaching and
attempt to find solutions and strategies.
2. Features of news and difficulties for students in studying

There is a piece of news here:
An earthquake measuring 6.7 on the Richter scale has hit northeast India, near its borders with
Myanmar and Bangladesh, killing at least nine people. The quake hit at 4:35 am local time about 29
km northwest of Imphal, the capital of Manipur state, according to the US Geological Survey.
Strong quakes have been felt across the region. The earthquake was originally reported to have
measured 6.8 on the Richter scale. India's Meteorological Department said it struck at a depth of 17
km.
The earthquake cracked walls and a newly-built six-story building in Imphal collapsed, police
said.
Other buildings were also reported to have been damaged. At least six people have been killed in
Manipur and more than 30 injured, the Press Trust of India news agency reported.
In the neighboring Bangladesh, three people were reported dead while dozens were being treated
in hospital for injuries sustained during the quake.
A 23-year-old man died when he suffered a stroke after the quake while two others died of heart
attacks, news agency AFP quoted police as saying.
A university student, who jumped from a fourth-floor balcony to escape, was among the severely
wounded, the agency added.
2.1 Features of vocabulary of news
Vocabulary used in news are stable but substantial with more than 4000 words, including a lot of
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
344
proper names such as persons names, countries, parties and some committees names. For example:
India, Myanmar, Bangladesh and the US Geological Survey. The reporters always use some
abbreviations, such as AFP in the above news to save time or make a lively image so that listeners
should react in a short time. And some new-appearing words are always used in news that is
indicators of new things, such as names or some diseases and some words about climate technology.
These vocabularies are a little far away from our life so that students have no preparations for this.
That is the first difficulty for them to understand the listening part. So, before they can handle the
whole news idea, students should reserve vocabulary about news. At the same time, students should
have preparations for background information of news.
2.2 Features of sentence structure of news
Sentences used in news are basically structured with SV and SVO and are explored based on those
structures by adding subordinate clauses, modifiers, places names and time. And sentences are long
with much information. For example, An earthquake measuring 6.7 on the Richter scale has hit
northeast India, near its borders with Myanmar and Bangladesh, killing at least nine people. In this
first sentence of the news, there is information about number, place, time and issues. Students
cannot get into a groove to grasp so much information at the beginning of the listening. Literary
language used in news with substantial information has no clues such as stress, intonation, pause
and change of speed to hint some information like spoken language.
2.3 Features of discourse of news
News reports have their own unique sequence or structure which is called the inverted pyramid
form which is frequently used nowadays. The feature of the inverted pyramid form is that it puts the
most important and the most interest and the most charming information at the beginning of the
news. The lead paragraph which contains who, what, where, when, why and how are the main
points of the news. Then the additional essential information appears. At the end of the news, less
essential details may be cropped by the editor without losing meaning. The lead which is the first
sentence of the news summarizes the most important information of the news. the following
sentences which are the main body of the news tell the details appearing according to its importance.
Students should pay more attention to the first sentence because it is the point where questions are
at. But it is also the difficulty for them because they cannot concentrate in listening at the
beginning.
3. Strategies for CET4 news listening

News listening is difficult for students in non-English majors and quietly boring for practicing so
that a lot of students will lose interests in it if they cannot obtain correct and practical strategies. In
order to enable students to encounter this problem, the author concludes some strategies about news
listening during teaching process.
3.1 Adequate preparations before listening news
Non- English major students did not have full practice in listening especially news listening in high
school. They should have mental preparation before they are required to listen to news materials
which have certain vocabulary and language style. Teachers should offer appropriate vocabulary
and related background information before requiring listening activities. Considerable quantities of
vocabulary are a big difficulty for students who only have high-school vocabularies. Teachers
should offer a good plan for students to have sufficient time and energy to adapt the practice
intensity. Teachers should offer classified vocabulary for news with different topics. For example,
there are vocabularies in news about politics such as Middle East/Mideast, Ministry of Foreign
Affairs, neutral state/neutral country and non-aligned countries. And there are vocabularies in news
about economy such as available capital, average income, balance of trade, and break. And there are
vocabularies in news about earthquake such as magnitude, aftershock, earthquake-hit region,
345
collapsed building, debris/rubble, death toll/ casualties, victim, survivor and electricity/gas power.
3.2 More practice from primary ones to high-level ones
News listening part in CET4 sets up choice questions to ask students to obtain the main ideas and
details by listening to the news only once. The requirement is much higher than the level of
sophomores of non-English majors. Teachers should choose and organize materials which are
suitable for teaching from primary level to high-level. For example, at the beginning of teaching,
teachers can choose news which students are familiar with such as conferences and wars and
terrorists and introduce background information about the news and set up some blank-filling tasks
to get the number and time in the news and allow students to listen to the materials more than once.
Then teachers can add some different tasks gradually such as filling main verbs and main elements
including persons, places and issues or ask students to answer some questions according to the
contents of the materials. After a long period of practice for primary level, students can accumulate
sufficient vocabulary and background information for high-level tasks. Teachers can choose
listening materials with more proper vocabularies and complex sentence structures to ask students
to practice through dictating or answering questions without introducing background information by
listening to the news only once. Students can adapt the difficulty and intensity of news listening and
reach the requirements of CET4.
3.3 Diverse teaching methods used in class
In news listening class, teachers should apply diverse teaching methods to arouse students learning
interests in news listening. Students cannot be interested in new listening if they cannot understand
what the news is about. Teachers should take different approaches to help students overcome the
difficulties. For example, teachers may hand out the scripts of news to let students understand the
whole one. And teachers should apply news with different topics such as politics, military, culture,
religion, science and history to make students feel fresh. And teachers should ask students to listen
to news broadcast as often as possible. At the same time, teachers may adapt diverse methods for
listening practice. For example, students can make presentation about different news topics before
class every time. They should collect the newest information about some hot news. And teachers
also take a news-speech contest with prize to attract more students to participate in. Then there is a
student on duty who broadcast everyday news for us. Teachers may plan a self-made news
presentation on special days to test students situation of learning or understanding of news. For
example, students can make up news about Christmas or Teachers day. There is a sample of news
about celebration of Christmas from students: all of teachers and students take part in a Christmas
party which is organized by the Students Union held in the school hall on December 24 That
kind of ways can vastly arouse students sense of participation.
3.4 Cooperation and competition after class
Teachers should supervise students to practice more after class. Students can cooperate with
classmates to make some groups to encourage in order to complete required assignments. Students
can make a group with roommates who have sufficient time to stay together and know each other
better. Teachers can hand out some listening materials for each dormitory with different topics and
ask them to finish the task in a given time and change the materials with other dormitories and then
finish again. Their answers will be given to teachers who will assess which dormitory can get a high
score. Students in different dormitories will try their best to complete listening task in order to
achieve distinction for their roommates. Cooperation and competition will stimulate students to
explore their potentials and arouse their interests in news listening.
3.5 Usage of Multi-media and Internet technology
Internet technology applies sufficient news materials for students to practice listening. Students can
use some Apps for study such as VOA or BBC to obtain up to date news and get a lot of suggestions
about listening and news listening and background information culture all over the world so that
346
students can accumulate solid foundation for news listening test. And teachers may set up QQ
groups for each class in order to supply a place for them to discuss and communicate their
experience and feelings about listening news. Teachers can instruct them in here after class.
3.6 Combining news-reading and news-listening
News is reported with written language which contains a large amount of information. Students
should read news reports at the first hand in order to know the literary form, sentence structure and
features of vocabulary. Then they can listen to news reports after they have preparation for it.
Intensive reading can help students accumulate useful vocabulary and know the sentence structure.
Extensive reading can help students broaden their horizon about culture background and enhance
language sense.
4. Conclusion
News listening is a new task in CET4 for non-English major students who have no sufficient
background information and vocabulary to challenge this test. They cannot adapt this test intensity
immediately so that they may lose their interests in news listening. Teachers may apply suitable and
practical strategies for them to handle the problem in class and give proper ways and methods to
help them participate in the listening after class. The paper lists the strategies used in class and
methods after class as followings: 1) giving adequate preparations before listening news, 2) supply
more practice from primary ones to high-level ones, 3) using diverse teaching methods used in class,
4) encouraging cooperation and competition after class 5) Using Multi-media and Internet
technology. These strategies and methods can light students way to news listening gradually. The
improvement of listening ability needs a long time effort.
Reference
1 OMalley, M., Chamot, A. & Kupper, L. Listening comprehension strategies in Second
Language Acquisition J. Applied Linguistics, 1989(10):418-437.
2 McGruddy, R. The effect of listening comprehension strategy training with advanced level ESL
studentsD. Unpublished PhD dissertation, Georgetown University, Washington, DC,
USA.1995.
3 Chambers, G. Listening,Why? How? J. Language Learning Journal, 1993(14): 23-27.
4 Nation L.S.P. Learning Vocabulary in Another Language M. Cambridge: Cambridge
University Press. 2001.
5 Carroll, D. W. Psychology of Language M. Beijing: Foreign Language Teaching and Research
Press.2000.
347
Significance of Research of China's National Defence Education

Contents
Ming Xu1, Xiangsheng Rong1, Chengyan Zhang1, Guoyu Xu2,a,*, Mei Ye3,b
1
Air Force Logistics College of PLA, Xuzhou, 221000,People's Republic of China
2
Kewen College, Jiangsu Normal University, Xuzhou, 221000, People's Republic of China
3
Jiulishan experimental school, Xuzhou, 221000, People's Republic of China
a
KJHQXM@126.com, b565885848@qq.com
Keywords: Defense education; Defense research; Defense awareness; Defense resource
Abstract. A strong national defense is the foundation of the national prosperity, that is the foundation
of national rejuvenation, that is the foundation of the people's health, safety and happiness. In
accordance with the China's Constitution and laws, China's armed forces are meant to resist foreign
aggression, defend the motherland and safeguard social stability internally. Building a powerful
China's army is an important component of China's modernization and is a common goal of the
Chinese people of all ethnic groups. Therefore, all countries in the world attach great importance to
strengthen the organization of national defense.
1. Introduction
Any country needs a strong national defense. In accordance with the China's constitution and laws,
the Chinese army is shouldering the responsibility to resist external aggression, defend the
motherland and maintain internal and social stability.Building a strong national defense and the army
is not only an important component of China's modernization, but also a common cause of Chinese
people of all ethnicities. Through a series of national defense education activities improve the defense
consciousness and ability of all citizens. National defense education is to enhance their awareness of
the importance of national defense and to fulfill national defense obligations for the purpose. In order
to ensure the safety, stability and development of our country and to win the future information war, it
is very important to strengthen the process of national defense development.
2. To improve and perfect the contents of subject system of national defence education
As is known to all, the national defense education is an important part of national defense
development, also is the important content of the national education.
2.1 The shift in national defense education concept
Building a strong national defense, not only to strengthen the armed forces military hardware building,
there is also the need to strengthen national defense building in the spiritual home. For this reason, the
National Defense Education leading cadres of the theoretical study and on-the-job training, and
actively organize the party and government cadres, and the army, and large national defense education
and publicity activities, such as regular for leading cadres national defense education, enhance their
interest and support to the building of national defense awareness and sense of responsibility. In
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
348
addition, raising national defense awareness of young people, young people are the contents of that
patriotism is part of national defense education.It relates to the security of the State and the future of
the country and the young people develop a national and in the needs of the people qualified
successors.
2.2 Set up the national defense education specialties
Besides the National Defense University, other universities can be according to the local historical
and cultural traditions and professional characteristics of the school, set up some rich local
characteristics of the topography, local military revolution and military thoughts of national defence
education professional, targeted the national defense education on students. Can not only improve
their national defense consciousness, as well as the national defense education in colleges and
universities create a good learning atmosphere.
2.3 To write the national defense education textbooks
We can make full use of the unified national college national defense education teaching
materials.We can also organize some defense experts and scholars, combining the practice of
historical and cultural tradition and national defense education revolution local, write some of the rich
local characteristics of books teaching defense education in Colleges and universities, strengthening
national defense education of College students.
2.4 To organize special defense education form
At present, China mainly based on economic development and the gradual improvement of overall
national strength, and improving international reputation. But hostile forces at home and abroad and
the surrounding security situation is not optimistic, such as the United States implement the policy of
hegemony and power politics. Attempts to interfere in China's internal affairs. While the Taiwan
independence forces trying to make Taiwan secede from the motherland; Japan attempts to split the
sea and the occupation of the Diaoyu Islands in China. Philippines Viet Nam and other ASEAN
countries are also illegal to use 43 reefs of the Nansha Islands, and so on. Special education in special
periods can stimulate students' patriotism, increase defenses and consciousness of middle school
students the concept of understanding in times of peace should prepare for war. In a word, through
various forms of national defense education, cultivate their suffering consciousness, improve their
awareness of the importance of national defense and make our country and people's need of qualified
successors.
3. To expand the available resources of national defence education

National defense education is a huge systematic project, only under the strong leadership of the party
and the government, the whole society to cooperate with each other, build a unified, continuity, up
and down or so of the national defense education system with Chinese characteristics, and constantly
adjust measures to local conditions to explore in practice and innovation, and constantly enhance the
effect of national defense education, finally out of a road to the national defense education with
Chinese characteristics.
3.1 With the help of media resources
We should pay attention to use various means and carrier, deepening national defense education,
relying on modern mass media such as newspapers, radio, television, network, with the form of
literature, film, television, music and other people happy, widely to carry out national defense
education, expand education coverage To open up by the national defense education column,
projects programs, web pages, and typical national defense education they publish or broadcast news
in a timely manner. The National Defense Education Day (the third Saturday in September each
year after 2001), recruitment, and other major activities planned in advance, make promotion plan,
349
centrally. Establishing typical events, major collaboration mechanism, cogent accomplish
propaganda line, at ordinary times momentum, the important time to have orgasm on propaganda,
truly the national defense education into People's Daily work and life.
3.2 Relying on the education environment edification
Should make full use of the martyrs cemetery, revolutionary site, patriotism education base and so on
education resources, organize various kinds of national defense education theme activities. Traffic
arteries in the city, the main public places and personnel center, set up national defense education
propaganda column, selectively installed a certain number of permanent national defense education
electronic screens, public welfare billboards and, electronic light boxes and other facilities, let cadres
and the masses to accept education.
3.3 The use of network platform be for education
With the internet as the core of the information revolution has brought great changes to student's study
and life, and also provides in-depth development of the national defense education in common
colleges and universities with new forms and ways. At all levels should make full use of media
advantage to open network defense education classroom. Barracks, colleges and universities can be
opened in the LAN or WAN, military defense situation documentary, national hero allusions, such as
the rise of great powers section to carry out various national defense education to the student, not only
enrich the spare life of students, and improve the national defense consciousness, strengthen the
training and the result of classroom teaching, implement the national defense education in the form of
diversification.
4. Conclusions
At present, as the global, national and our Party's conditions continue to undergo profound changes,
our development of national defence education are faced with unprecedented opportunities for
development as well as risks and challenges unknown before. The whole Party must keep in mind the
trust the people have placed in us and the great expectation they have from us. We must aim higher
and work harder and continue to pursue development in a scientific way, promote social harmony, and
improve the people's lives so as to complete the glorious and arduous tasks bestowed on us.
5. Recommendations
The national defence education system in China must adapt to the national development strategy and
security strategy of new requirements, focus on the overall performance of the military historical
missions at this new stage in the new century, implement the military strategic principle of active
defence in the new period, and advancing with The Times to strengthen military strategic guidance,
pays great attention to ocean, space, cyber security, actively plotting peacetime use of military force,
continue to expand and deepen the military struggle preparation, improve their ability to win local
wars under the conditions of informatization for the core ability to accomplish a diverse array of
military tasks.
References
[1] Jinping Xi, Firmly March On The Path Of Socialism With Chinese Characteristics And Strive To
Complete The Building Of A Moderately Prosperous Society In All Respects, Report to the Eig
hteenth National Congress of the Communist Party of China on 8 Nov, 2012.
[2] Hou Jing, Zeng Yi, Wang Zefeng, Career Guide of National Defence Students, University of Sci
ence and Technology of National Defence of China, Changsha, Hunan, 2012.
350
[4] Status Chinese defence development, http://www.szbf.net/Article_Show.asp?ArticleID=1676, 5
Feb 2011.
D=1676.
[7] Improve the national defence education system, http://renfang.bjyq.gov.cn/jsbl/xdzz/524.html.
D=1676.
351
Discuss on Statistics Professional Talent Training of Applied

Undergraduate Colleges under Big Data Era
Shan Lia, Linan Sunb,*, Fengling Wangc
Heihe University, Heihe, Heilongjing, China
a
lishan87650@163.com,bsunlinan666666@163.com,cwfl_5945@163.com
*
Corresponding author
Keywords: Big data era; Applied undergraduate colleges; Statistics professional; Talent training
Abstract. The era of big data not only provides a good opportunity and abundant information
resources, but also bring the unprecedented challenge for statistics professional talent training of
applied undergraduate colleges. This paper analyzes the quality requirements for statistical
professional talents, put forward the basic principles of statistics professional personnel training and
analyzes the characteristics of the talent training mode on statistics professional in applied
undergraduate colleges under big data era, which provides a good theoretical basis for exploring the
statistics professional training mode of applied undergraduate colleges from big data era.

a, b,*, c

a
lishan87650@163.com,bsunlinan666666@163.com,cwfl_5945@163.com
*

1.
20 80 21
1.68 DVD 2020

2020 30-40ZB
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
352
2011 6.8 2016
50.7
2.5
ODI 330

2016 6.17
2015
+
mahoutSpark SPSSSAS
2.

2.1

353

2.2
+
SPSSSASR
2.3

3.1

3.2

354

3.3

4.

4.1

4.2

355

4.3

4.3.1

4.3.2

5.

GJB1214026
356
References
[1] J.Huang, Thinking and exploration on talent training of big data, Education Teaching Forlm, no.
11, pp. 201-203, 2014.
[2] X.S.Shi, Applied talents training of local colleges under big data environment,Theoretic
Observation, no. 11, pp. 134-135, 2013.
[3] L.N.Sun, B.Tang, Building on the training mode of math class professional under collaborative
innovation of industry-university-research, Contemporary Education Research and Teaching
Practice, no.11, pp, 53, 2016.
[4] C.J.Liu, Countermeasures of statistical education in the face of challenges in big data era,
Journal of Kaili University, vol.33, pp, 29-32, 2015.
357
Application of Experiential Teaching in College Students Psychological

Health Education Curriculum
Zhenyu Chen
Wuhan University of Technology (WHUT), Wuhan, Hubei, China
chenzy@whut.edu.cn
Keywords: Experiential teaching; Instructional model; College students; Mental health education;
Mental health education courses
Abstract. With the establishment of college mental health education curriculum in colleges and
universities, researches into teaching methods, teaching models and teaching effects had been
increasing year by year. This thesis analyzes and summarizes related literature and makes a
comparison of the current situation at home and abroad. And this thesis holds that it is necessary for
college mental health education curriculum to change the concept of teaching, to improve teaching
methods, to innovate teaching models, to perfect curriculum systems, and to make evaluation
mechanism flexible. As well, according to the thesis, Experiential-Education models can be applied
to college mental health education curriculum. Based on the existing research results, it is suggested
that six procedures, which includes investigation of the students, data analysis, shaping of the theme,
curriculum design, the application of Experiential-Education models, and timely feedback, should
be applied throughout college mental health education curriculum in practice. By means of the
establishment of Experiential-Education models which contributes to the development of students
master awareness of the classroom, we hope to provide practical experiences for the current
curriculum reform of college mental health education curriculum.

chenzy@whut.edu.cn
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016

358
1

1996176176
662001
2004527[1]
2009SCL90263775Meta[2]
2001316
2002
()2011
2.

2001155
[3][4]
75.1%68.57%
75%
[2]
3.
3.1

-
expository teaching
359

[5]2012
[6]

162
3.2
20
20[5][7]
:192070
207020
20
[5]
3.3

[2][5]

4.

360

[5]
2
5058
[8]
41.1%58.3%62.0%77.9%
[8]

361
4
201595%
5%
[9]
References
[1] Yao Benxian, Lu Lu, The Present Situation and Prospects of the Research on University
Students Mental Health Education in Our Country[J], Psychological Science, vol. 30(2),
pp.485-488, 2007.
[2] Huang Yanping, Li Ling,SCL-90 as Measurement of Mental Health in College Students: a
meta-analysis[J],Chinese Mental Health Journal, vol. 23(5),pp.366-371,2009.
[3] Wu Xia,Study on Mental Health Education of College Students since the Reform and Opening
up[D].Chongqing:Southwest University,2015.
[4] Lei Ming, The Development of Psychology of Mental Health Education: Connotation,
Research Object and Discipline System[J],Journal of Sichuan University of Science
Engineering(Social Sciences Edition),vol. 29,no.3,pp.31-42,2014.
[5] Tang Jiliang ,Yao Benxian, Inspiration of Rogers Student-Centered Idea for Mental Heaching
in College[J],Journal of Chongqing University of Technology(Social Science),vol. 28(4),
pp.139-143,2014.
362
[6] Yang Jinqiao,The Research on Current Situation of the College Mental Health Education
Course of Liaoning Province[J],Journal of Liaoning Educational Administration Institute, vol.
29(3),pp.44-47,2012.
[7] Jiang Qiaoling,Constructing the System of College Network Mental Health Education[D].
Changsha:Central South University,2012.
[8] Huang Xiting, Zheng Yong, Luo Mingchun, Su Dan, Chen Benyou,Investigation and
Assessment of Chinese Colege Students-Mental Health Service Needs[J],Journal of Southwest
University Social Edition,vol. 37(3),pp.1-5,2011.
[9] Du Xuemin, Zhang Ying, Research on the Innovative Teaching Mode of Participating in and
Experiencing Mental Health Courses[J],SHANDONG HIGHER EDUCATIONV,vol. 20,
pp.56-63, 2015.
363
Study of Freshmen Entrance Education in University and College- Based

on Collaboration
Zhen Zhua, Dong Wangb, Guangfa Yangc
Foshan University, Foshan, China
a
augustjune@fosu.edu.cn, bfs.wdong@qq.com, ccocoishere@qq.com
Keywords: University freshmen; Entrance education; Collaboration; Idea; Practice
Abstract. Along with the popularization of higher education, the original model of entrance
education for university freshmen has not complied with the tendency of the times, and can not fit
the characteristics of current university students. This paper discusses the collaborative education
idea, channels and as well as forms in freshmen entrance education. And then the practice
experiences in collaborative education is introduced, including the collaborative work plan, content
system construction and career planning education. The purpose of the study is to explore a
scientific mode which can extend freshmen education time forward and backward. High quality
education resources inside and outside school may be collaborated. Online education forms and
offline education forms may be combined to reach the target of university freshman education.

a, b, c

a
augustjune@fosu.edu.cn, bfs.wdong@qq.com, ccocoishere@qq.com
1

[1]
[2]
[3]
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
364

[4]
2.1

[5]
2.2
20167CNNIC
201667.10102.9%10
1920.1%23%1.63320
QQ
365

QQ
2016
2.3
1
1
QQ

Q & A

QQQ&A
3
1971Hermann Haken
366
1976Synergetic
3.1
------
1---
3.2

[6]
1[7]
[8]
367
3.3

2016
1458
14
IT
ITIT

58

IT

IT
QQ
368

2016IT
References
[1] Yan Yin. The Necessity and Value of University Freshmen Education[J]. Journal of Henan
College of Finance & Taxation, 2011, Vol.25, No.5:48-49.
[2] Liqiang Qi. Analysis on the Beginning Education to New College of Students[J]. Journal of
Hebei Polytechnic University(Social Science Edition), 2007, Vol.7, No.7:121-124.
[3] Yujuan Shi. Exploration on the Freshmen Entrance Education in University and College[J].
Journal of Suzhou University, 2009, Vol.24, No.2:138-139, 17.
[4] Xin Liu. Research on the Present Situation and Countermeasures of University Freshmen
Education[J]. Journal of Shandong Agriculture and Engineering University, 2015, Vol.32,
No.2:85-87.
[5] Yu Zhang. Applying the Collaborative Innovation Idea into the Enrollment Education[J].
Higher Education Forum, 2013, Vol.2013, No.9:18-20.
[6] Weiqiu Huang. Construction and Practice of the Entrance Education System to University
Freshmen[J]. Higher Education in Chemical Engineering, 2005, Vol.2005, No.4:87-89.
[7] Jianxun Guo. Construction of the Entrance Education System to University Freshmen[J].
Journal of Henan Vocation-Technical Teachers College(Vocational Education Edition), 2008,
Vol.2008, No.4:18-20.
[8] Nan Zhang. An Exploration of College Students' Enrollment Education Model[J]. Journal of
Women's Academy at Shandong, 2010, Vol.2010, No.1:81-85.
369
The Application of Experiential Teaching Method in Marketing Survey

Course
Xuan Chena,*, Dinghuihong Liub
College of Economics and Management, Shanghai Ocean University, Shanghai, China
a
x-chen@shou.edu.cn, b465699268@qq.com
Keywords: Marketing survey course; Experiential teaching method; Teaching reform
Abstract. Marketing survey course is a course focusing on practical experience. The existing
teaching methods are difficult to meet the needs of society in marketing research fields. First of all,
this paper points out the existing problems in the marketing survey teaching and the necessity of the
implementation of experiential teaching methods. Then some suggestions in implementation of the
experiential teaching methods are put forward. At the same time, combined with the characteristics
of experiential teaching methods, some potential issues should be concerned by teachers during the
teaching process are covered.

a,*, b

a
x-chen@shou.edu.cn, b465699268@qq.com
*

1
1.1

978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016

370

1.2

[1]
[2]

[3]

5.4%
[4]
3.1
371
1
3.2
1

[5]
4
4.1

372

[6]
4.2

4.3

References
[1] L. Y. Hu, On the practice teaching model reform of market survey and forecast in independent
college, Modern Economic Information, vol.20, pp. 435, 2014. (in Chinese)
[2] X. J. Gu and W. S. Ge, On the teaching model reform of market survey and forecast: from the
perspective of local undergraduate universities, Journal of Huaihai Institute of Technology
(Humanities & Social Sciences Edition), vol.10, pp. 80-82, 2012. (in Chinese)
[3] G. Achenreiner, Market research in the "real" world: are we teaching students what they need to
know, Marketing Education Review, vol.11,pp. 15-25, 2001
[4] X. F. Zhao, A study on the experience teaching model of market survey and forecast, Modern
Education Science, vol.3, pp. 97-99, 2011.(in Chinese)
[5] I. Makienko and E. K. Bernard, Teaching applied value of marketing research: A questionnaire
design project, The International Journal of Management Education, vol.10, pp.139-145, 2012.
[6] D. Zhou, A study on the examination reform of market survey and forecast, Chinese & Foreign
Entrepreneurs, vol.31, pp. 207-208, 2014. (in Chinese)
373
Review of Research on the Development of Youth Campus Football

Xiaodong Zhua,*, Jing Zhongb
Guangxi College of Sport and Physical Education, Nanning, Guangxi, China
a
hero64@163.com, bzj1215@qq.com
Keywords: Teenagers; The campus football; Review
Abstract. Because of the strong endorsement of Chinese government for the development of youth
campus football, the campus football activity has been rapidly developed and expanded in China.
Through to summarize and analyse the campus football activities research of domestic and foreign
scholars, the author provided reference and advice about how to carry out campus football activity
in China.

a,* b

a
hero64@163.combzj1215@qq.com
*

1.
2013-2022
2.
1999
[1]
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
374
2010
2010-2020[2]
2009
201012
[3]

201312
[4]
20153[5]
201576[6]
2020
3.
[7]

[8]
[9]
[10]
[11]
[12]
4.

375
[13]
304050-6070-80
[14]

[15]
[16]
[17]
5.

2016
KY2016YB588
References
[1] CPC Central Committee and State Council. CPC Central CommitteeState Council decision on
deepening education reform and promoting quality education in an all-round
way[Z].1999-06-13.
[2] CPC Central Committee and State Council. National long-term education reform and
development plan(2010-2020) [Z].2010-07-29
[3] Chinese Football Association.12th Five-Year" development of Chinese youth football
(draft)[EB/OL].http://www.fa.org. cn/bulletin/other/2010-12-29/342659.html. 2010-12-29
[4] Ministry of Education. Opinions on strengthening national youth campus football work[EB/OL].
http://sports.qq.com/a/20150813/051943.htm.2015-08-13.
[5] CPC Central Committee and State Council. Notice on printing and distributing the overall plan
for the reform and development of Chinese football[Z].2015-03-08.
376
[6] Ministry of Education, National Development and Reform Commission, Ministry of Finance,
State Administration of Press, Publication, Radio, Film and Television of PRC, General
Administration of Sport of China, Central Communist Youth League. Opinions on accelerating
the development of youth campus football[Z].2015-07-22.
[7] Lu Yun-ting. Country Strategy: The depth dimension of Chinese football culture[J].Sports and
Science, 2015,36,(4):6-13
[7] Hou Xue-hua. Research on the Value of the Youth Football Program at School in China[J].
Journal of Beijing Sport University,2012,35,(12):77-83.
[9] Liu Mi-na. Soccer Dream and Chinese DreamReview of the Forum on Soccer Reform
and Social Change [J].Sports and Science, 2015,36,(4):1-13.
[10] Wang Xiao-zan; GUO Qiang;JIN Yan;LI You-qiang;WU Hong-quan;JI Liu.Theoretical Origin
and Framework Construction of Adolescent Sports and Health Promotion in China[J].Sports
and Science,2014,34,(3):3-14.
[11] Shen Jianhua. Fundamental Connotation,Key Elements and Basic Features of Integrated Sports
Development for Schools,Families and Communities[J].Journal of Shanghai Physical
Education Institute,2001,25,(3):81-85.
[12] Li Kegang.The Value Identity of Youth Campus Football Activities Empirical
ResearchBased on the Investigation of Campus Football Layout at the Provincial Level
City in Henan Province[D].Zhengzhou. Henan University,2014.
[13] Wu Jixing.A Comparative Study of the campus football mana-gement system between China
and South Korea[D].Changchun:Jilin University,2012.
[14] Wang Pengtao.Research on the Cultivation of the Reserve Forces of Japanese Football[J].
Liaoning Sport Science and Technology, 2003,25,(2):17-19.
[15] Wangping. Research the Development of Chinese and Japanese Football from the Comparison
between Chinese and Japanese Culture[J].Sports Culture Guide,2004,10:61-63.
[16] Xu Rong-kui,PAN Shao-wei. The Comparison Research about the Reserve Soccer Players
Training System between Chinese and Germany[J].Zhejiang Sport Science,2009,31,(2):34-36.
[17] PENG Guoqiang;SHU Shengfang. Rise Process and Characteristics of German
Football[J].Journal of Chengdu Sport University,2015,41,(1):92-98.
377
Short Cuts of Administrative Management in Colleges and Universities

Zhuo Jiang
School of Mechanical Engineering and Automation, Beihang University, Beijing, China,100083
jiangzhuo@buaa.edu.cn
Keywords: Colleges and Universities; Administrative management; Short Cuts
Abstract. Administrative efficiency plays an important role in colleges and universities. With the
development of education, the administrative workload increases as well. In order to adapt to the
modern education technology development needs, improving administrative efficiency and the
quality of administrative management is imminent. Office staff should be constantly thinking in
practical work, summed up the characteristics and rules of work, to seek ways to improve the
administrative quality and efficiency.

100083
jiangzhuo@buaa.edu.cn
616
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016

378
2.

PPT
34

PPT
3.

35
1
+
++
2
excel
excel3
4.

379
4.1

4.2

4.3

4.4
QQBBS
4.5

References
[1] Liu Lixia, The esearch on the Strategy of Promoting the Information Construction in order to
Improve the Administration Management of Colleges and Universities, Heilongjiang
Researches on Higher Education, vol.270, pp.71-73, 2016.
[2] Zhou Yongjun, and Liu Huiyu, Research on improving the efficiency of administrative
management in Colleges and Universities, Education Exploration , vol.245, pp. 56-58, 2011.
[3] Liu Pingping, The path of improving the efficiency of administrative management in Colleges
and Universities, Manager Journal, vol.36, pp. 289, 2015.
[4] Yang Zhiqun, A new way to improve the administrative level and work efficiency of colleges
and Universities, China Adult Education, vol.10, pp.48-49, 2013.
[5] Chen Haie, Reflection on the efficiency of administrative management in Colleges and
Universities, Education Teaching Forum, vol. 14, pp.33-34, 2013.
380
Research on Enhancing Employment Competitiveness of Higher

Vocational Students Based on Talent Development
Shihua Tonga,*, Shaoqiang Mob
College of Computer, Chongqing College of Electronic Engineering, Chongqing401331, China
a
108457135@qq.com, b2215651711@qq.com
*
Shihua Tong
Keywords: Higher vocational colleges; Talent development; Employment; Competitiveness
Abstract. In view of the difficult problem of employment of vocational college students, This paper
analyzes the employment of students in vocational colleges, To find out the problems existing in the
current higher vocational colleges in personnel training, And the ways and means to enhance the
employment competitiveness of vocational students, Enhance the employment competitiveness of
vocational students, Improve the employment rate and employment quality of higher vocational
colleges.

a,*, b
401331
a
108457135@qq.com, b2215651711@qq.com
*

[1]
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016

381
2

[2-3]

3.1

3.2

3.3

3.4

3.5

382

3.6

3.7

[4-5]
3.8

,23,
,
62
3.9

3.10

---
3.11

383

3.12

2016-GX-0682015-ZJ-033
163225
References
[1] Liu Jinxian. On the Training Ways of Vocational College Students' Employment
Competitiveness Based on Internship [J]. Guangxi Education, vol. 15,pp. 174-175,2013..
384
[2] Wang Jing. Construction of Higher Vocational Education Course System Based on
Employment Competitiveness. China Adult Education J . Business Review vol.
11,pp.126-127,2015.
[3] Zhao Xiaolan. How to Improve the Employment Competitiveness of Higher Vocational College
StudentsJ. Education and Teaching Forumvol. 21,pp. 35-36,2015.
[4] Li Yan. On the Countermeasures to Enhance the Employment Competitive Power of Local
Higher Vocational College GraduatesJ. Professional time and spacevol.11,pp. 97-100,2015.
[5] Qiu Xin. Construction and Improvement of Evaluation System of Employment
Competitiveness in Higher Vocational CollegesJ. Professional time and space, vol. 11,pp.
107-108,2015.
385
Research on the Key Problems and Countermeasures of the

Convergence between Secondary Vocational Education and Higher
Vocational Education
Shihua Tong
College of Computer, Chongqing College of Electronic Engineering, Chongqing401331, China
108457135@qq.com
Keywords: Vocational education; Convergence; Talent development; Countermeasures.
Abstract. In view of the current problems in the convergence of secondary vocational education
and higher vocational education, From the secondary vocational education stage and the stage of the
integration of personnel training objectives, personnel training program to develop an integrated
curriculum system set up integration of curriculum standards development integration of teaching
materials development, integration of assessment and evaluation, teaching and management
integration And other aspects of the study for China's secondary vocational education and higher
vocational education effective ways and means of convergence, For other professional and
institutions in the convergence of secondary vocational school to provide reference.

401331
108457135@qq.com
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016

386
1997ISCEN
2

2010-2020
2010-2020
20142014-2020
20157
[2015]6
[1-6]

1
2
3
4
5
6
7
8
9
10
11
12

3
3.1

[7]
3.2
387
20142014-202020157
[2015]6
[8]
3.3

3.4

3.5

3.6

3.7

10
12
3.8

3.9

[9]

388

2015-ZJ-0332016-GX-068
163225
References
[1] Zhang Jianxi. Analysis on the Key Problems and Countermeasures of the Connection of
Secondary and Higher Vocational Education in Engineering [J]. Survey of
Education,vol.5,pp.137-139,2016.
[2] Zhang Tiantian. Analysis of the Key Problems in the Connection of Secondary Vocational
Education and Higher Vocational Education [J]. Chinese Vocational and Technical Education,
vol. 14,pp.47-50. 2014.
[3] Zhu Xuemei. A Review of Researches on the Linkage of Secondary Vocational Education and
Higher Vocational Education [J]. Vocational and Technical Education, vol. 32,pp.24-27, 2011.
[4] LI Quan-kui .Research on the Link between Secondary Vocational Schools and Higher
Vocational Colleges[J].JOURNAL OF TIANJIN VOCATIONAL
INSTITUTES,vol. 13,pp.3-11 ,2011.
[5] Zhang Jinyin. Exploration of "Interface" and "Channel" in the Connection of Secondary and
Higher Vocational Education [J]. Chinese Vocational and Technical Education,
vol.20,pp.33-36,2011.
[6] Meng Yuanbei. Analysis of key problems in the convergence of higher vocational education
and its countermeasures [J]. China Higher Education Research, vol.4,pp.85-88, 2013.
[7] Zhou Danong . The Design and Consideration of the Curriculum Connection in Secondary and
Higher Vocational Education [J]. Vocational & Technical Education Forum,
vol.3,pp.12-15,2013.
[8] Liu Jun. The Current Situation and Countermeasures of the Curriculum System Construction of
Connecting Higher Vocational Education in China [J]. China Extracurricular Education
vol.4,pp.35-37,2016.
[9] Jin Lu. Exploration and Practice on Promoting the Connection of Secondary and Higher
Vocational Education by the Vocational Education Group - Taking the Construction of
Vocational Education Group in Zhejiang Province as an Example[J].Vocational and Technical
Education,vol. 37,pp.33-34,2016.
389
Research on the Actuality of Education and Training for Grass-root

Gymnastic Coaches in China
Yongsheng Sun1,a, Jiahui Zou 2,b
1
School of Physical Education and Coaching ScienceCUPES, Beijing, China
2
School of International Education, CUPES, Beijing, China
a
sunyongsheng@cupes.edu.cn, bzoujiahui@cupes.edu.cn
Keywords: Gymnastics; Coach; Education and training
Abstract. The declined scores of China Gymnastics Team in Rio Olympics,

has exposed the unpleasant situation of China artistic gymnastics. This article aims to further
reveal the practical problems of grass-root gymnastic coach education and training by
the investigation and analyses the causes to provide the reference for the improvement of education
and training for grass-root gymnastic coach.

1, a 2,b
1

2

a
sunyongsheng@cupes.edu.cn, bzoujiahui@cupes.edu.cn
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016

390
2
2.1

2.2
2.2.1
1947
4747100%,47,100%
2.2.2
Excel
3.

3.1
1
22
39
31
1
1
39
31
3.2
2
15
11
9
19
2
15
119
19
391
3.3
3N=47

13 27.7
20 42.6
13 27.7
1 2.0
31327.7
2042.6
1327.71
4.
1
2 ,
,,
,
References
[1] Zhu Peilan. Guidelines for Coach Training [M]. People's Sports Press. 2002.
[2] Xu He.Research on Condition and Developing Countermeasure Athletic Gymnastics Backup
talents Echelon Building in Jiangxi Province [D]. Jiangxi Normal University Master thesis,
2011.
[3] Cui Honghao. Xian Childrens Gymnastics Reserve Talents in the Combination of
Cultivation Mechanism Research [D]. Xi'an Physical Education University Master thesis,
2011.
[4] Zhao Jian. Research on Gymnastics Talent Cultivation Status and Countermeasure in Shandong
Province [D]. Shandong Normal University Master thesis, 2008.
[5] Tong Jianjun. Research on Gymnastics Talent Cultivation Status and Countermeasure in Beijing
[D]. Beijing Sport University Master thesis, 2011.
[6] Zhao Chuansheng. Analysis and Research on the Cultivation Actuality of Reserve Forces of
Jiangsu Gymnastics. [D]. Yangzhou University Master thesis, 2008.
392
The Integration and Development of Intelligent Field and School

Physical Education
Chunrong Peng, Ting Cao
College of physical education, Jiangxi Normal University, Nanchang 330022
Keywords: Intelligent Golf Course; School physical education
Abstract. Sports intelligence is the development trend of sports in the future. Intelligent golf course
is a form of the development of intelligent sports, The intelligent course has the function of
real-time monitoring and recording of the status of the sports on the court. The application of
intelligent field to school physical education is helpful to the integration of intelligent technology
and physical education, Promoting the reform and development of physical education in schools.

330022
1.

6 1
In Out
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016

393

2.

2.1

2.2

2.3

2.4

394

2.5

2.6

[3]
2.7

2.8
In Out 3D
3D 3D
[4]

3.

6 1
[5]
4.
4.1

4.2

395

5.

References
[1] Tang GuoRui, Qing HongMin, Internet plusto the extension of Physical Education[J]. Sports
science and technology ,vol.37,2016.
[2] XuDong, Feasibility analysis of the application of Internet plus in physical education[J]. Sports
front, vol.6,2016.
[3] Wu H. The "Internet Plus" Action Plan: Opportunities and Challenges[J]. Frontiers, 2015,
7(1):83-88.
[4] Cumming T M. Game Time! Justifying the Use of Wii Fit Plus in the Early Elementary Physical
Education Classroom[J]. Journal of Technology Integration in the Classroom, 2011,
48(1):55-59.
[5] Fung A, Gilman H R, Shkabatur J. Six Models for the Internet plus Politics[J]. International
Studies Review, 2013, 15(1):30-47.
396
System Modeling of Online Collaborative Learning Activities

Wenxin Deng1, Fang Lu2
1
Guangdong Polytechnic Normal University, Tianhe, Guangzhou, China
2
South China University of Technology, Tianhe, Guangzhou, China
a
dengwx@scnu.edu.cn, bflu@scut.edu.cn
*Fang Lu
Keywords: Activity theory; Collaborative learning activity; Interpretative structural modeling (ISM);
Modeling
Abstract. This paper analyzes the development trend of the research of online collaborative
learning, summarizes eight key elements of online collaborative learning activities according to the
analysis and under the guide of activity theory. The process model of online collaborative learning
activities was constructed by means of interpretation structure modeling to lay the foundation for
the design, implementation and evaluation of online collaborative learning.

12
1

2
510641
a
dengwx@scnu.edu.cn, bflu@scut.edu.cn
*
ISM
1.
1.1
Online Collaborative Learning OCL
2002 Koschmann CSCL
CSCL [1]CSCL
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016

397
OCL
OCL
OCL
1.2

OCL
OCL
2. OCL
20 Rubinshtein
1987 Engestrm
[2]
2.1
mediation[3]
[4]
Artifacts
2.2
20 30 70
2.3
20 70
80 Yrjo.Engestrom
1

3. OCL
OCL
[5]
398

1 Yrj Engestrm1987 3 OCL

2 ISM
[6]
OCL OCL
///
//
OCL OCL
2
399
4.OCL
4.1 OCL
OCL
4.2 ISM CSCL

Interpretive Structural Modeling Method ISM 1973
Warfield
ISM
3
4.3 OCL
1OCL
OCL
R-A-E [Rob.koper,2002]
OCL
1OCL
2OCL
OCL
OCL
OCL S1~ S8 S1 S2 S3
S4 S5 S6 S7
S8
2 OCL
1 OCL
S1 S2 S3 S4 S5 S6 S7 S8
S1 1 1 1 1 1
S2 1 1 1 1
S3 1 1 1 1
S4 1 1 1
S5 1 1
S6
S7 1 1 1
S8
3
A
400
4 1 1 1 1 1 1 1 1
1 1 1 1 0 0 1 1 0 1 1 1 1 1 1 1
0 1 1 1 0 0 1 1 0 0 1 1 1 1 1 1
0 0 1 1 0 1 1 1 0 1 1 1 1 1 0 1
0 0 0 1 1 1 0 1 0 1 1 1 1 1 1 1
A +I2 = 0 0 0 0 0 1 0 0
A +I = 0 1 1 0 1 0 0 0
0 0 0 0 0 1 0 0 0 1 1 0 1 1 1 1
0 0 0 0 1 1 1 1 0 0 0 0 0 0 0 1
0 0 0 0 0 0 0 1
1 1 1 1 1 1 1 1
1 1 1 1 1 1 1 1
0 1 1 1 1 1 1 1
0 1 1 1 1 1 1 1
0 1 1 1 1 1 1 1
0 1 1 1 1 1 1 1
0 1 1 1 1 1 1 1
0 1 1 1 1 1 1 1
A +I3= 0 1 1 1 1 1 1 1
4 0 1 1 1 1 1 1 1 A +I3 M
0 0 0 0 0 1 0 0 A +I =
0 0 0 0 0 1 0 0
0 1 1 1 1 1 1 1
0 1 1 1 1 1 1 1
0 0 0 0 0 0 0 1
0 0 0 0 0 0 0 1
5

a. R(Si)
Si 1
b. Q(Si)
Si 1
c. A= R(Si)Q(Si)
4-2

401
2
i R(Si) Q(Si) R(Si)Q(Si)
1 12345678 1 1
2 2345678 123457 23457

3 2345678 123457 23457
4 2345678 123457 23457
5 2345678 123457 23457
6 6 1234567 6
7 2345678 123457 23457
8 8 1234578 8

Q(Si) S1S2S3S4S5S7 M
S1S2S3S4S5S7 M
A
S1 S2 S3 S4 S5 S6 S7 S1 S2 S3 S4 S5 S7
S1 S8
1 1 1 1 1 1 1 1 S1 1 S16 S18 1 1 1 1
S2
0 1 1 1 1 1 1 1 S2 1
S3 0 1 1 1 1 1 1 1 S3 0 1 1 1 1 1 1
S4 S4
0 1 1 1 1 1 1 1 1
M= S5 M = S5
0 1 1 1 1 1 1 1 0 1 1 1 1 1 1
S6 S7
0 0 0 0 0 1 0 0 1
S7 S6
S8 0 1 1 1 1 1 1 1 0 1 1 1 1 1 1
S8
0 0 0 0 0 0 0 1
1
0 1 1 B1 1 1 1
1
M
0 1 1 1 1 1 1
I S1S2S3S4S5S7 A
1
S6S8 B A
0 0 0 0 0 0 1
B B A 0
B A 0
0 0 0 0 0 0 0

1
R(Si)Q(Si)=R(Si)i=6
i=8 S6 S8 4-2
68
402
3 68
1 123457 1 1
2 23457 123457 23457

3 23457 123457 23457
4 23457 123457 23457
5 23457 123457 23457
7 23457 123457 23457
i=23457 23457
S2S3S4S5S7 S6S8
4 23457

1 1 1 1
S1 4
B
S8 S6
A S7 S5 S4

S2 S3
S1

OCL 5
OCL Activity
CSCL OCL OCL
OCL OCL
PSLDL OCL
OCL
403
S8.
S4.
S7. S6.
S3.
S5. S2.
S1.
5 OCL
5.

OCL OCL
OCL

GDJG20141187
References
[1] GarryStahl, IntroductionFoundations for a CSCL community, Proceedings of CSCLpp.1-2,
2002.
[2] Yrj Engestrm, Learning by Expanding: An Activity -Theoritical Approach to Developmental
Research, Helsinki: Orienta-Konsultit, 1987.
[3] Vygotsky, Selected works of Vygotsky Education, People's Education Press, 1994.
[4] Vygotsky, L.S. Mind in society: The development of higher psychological processes,
Cambridge Mass, Harvard University Press, 1978.
[5] Kary.Kuuti, Activity Theory as a potential framework for Human-Computer interaction,
Context and consciousness: activity theory and human-computer interaction, The MIT Press,
1996.
[6] Yrj Engestrm, Learning by Expanding: An Activity -Theoritical Approach to Developmental
Research, Helsinki: Orienta-Konsultit, 1987
404
The Research on the Question Form in the Example Learning for the
Electrical College Student Innovations Project
Bo Hu, Zhaomin Ma
College of Electric and Information Engineering, Guangxi University of Science and Technology,
Liuzhou, Guangxi, China
443722152@qq.com
Keywords: Questions forms; Example learning; College students innovations project
Abstract. The question form is the foundation problem of the example learning, especially in the
electrical college student innovations project. The teaching demand of the question in the example
leaning for the electrical college student innovations project is first introduced. And then the
different question forms are discussion. Finally several noticeable problems for the choice of the
question forms of the example learning in the electrical college student innovations project are
proposed. It should be helpful for the improving teaching effect of the example learning in the
electrical college student innovations project.

,

443722152@qq.com
Worked example
[1]
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
405
Learning transfer[2][3]
1
2
3
4
406

MP3Upad
RGB
2016
(2016JGB272)
References
[1] Bing Hiong Ngu, Alexander Seeshing Yeung. Fostering analogical transfer: The multiple
components approach to algebra word problem solving in a chemistry context[J].
Contemporary Educational Psychology 37 (2012) 1432.
[2] Abdeslam Boularias BrahimChaib-draa. Apprenticeship learning with few examples[J].
Neurocomputing 104 (2013) 8396.
[3] J. Elizabeth Richey, Timothy J. Nokes-Malach. How much is too much? Learning and
motivation effects of adding instructional explanations to worked examples[J]. Learning and
Instruction 25 (2013) 104-124.
407
A Study on College English Mobile Learning Based on Smart Phones

Jianing Niu
Dalian Jiaotong University, Liaoning, China
joyniu1981@163.com
Keywords: Mobile learning; Smart phones; College English
Abstract. With the rapid advancement of mobile information technology and the smart phones,
mobile learning based on smart phones is bound to be the main trend of informatization of higher
education. This essay introduces the development of mobile learning and smart phones, analyzes
the feasibility of applying smart phones to college English mobile learning, explores the benefits as
well as the drawbacks, and ultimately proposes some positive and constructive suggestions in order
to promote this process more efficiently and effectively.

joyniu1981@163.com
1.

978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016

408
2.

2.1

Mobile Learning
AlexZander Dye[1]
Ipad
1994 Wire-less Andrew

3
2001
2002
Desmond Keegan 2000
40 [2]
2001 2001-2004
2006
2.2

3G 4G 2016
38 2016 6
6.56 91.9%[3]
2016
2.3

Mike Sharples
[4] APP
VOA
409

3.

3.1

3.2

APP
3.3

[5] office
Office
Word
3.4

[6]
4.

4.1
410

4.2

[7]
4.3
3G
4G
4.4

4.5
:
5.

5.1
:
411
[8]
5.2

[5]
6.

References
[1] Alexander Dye. Mobile Education a glance at the future [EB/OL]. http://www.
nettskolen.com/forsking/mobile_edueation.pdf.
[2] Xia Zengliang, Application of Smart Phones to College Mobile English Learning, Journal of
HUBEI Correspondence University, Vol.26, No. 3, 2013.
[3] http://it.people.com.cn/GB/119390/118340/406323/index.html
412
[4] Wang Jing, Perspective on Integrating smart phones into College English Teaching, Journal of
Higher Education, No.24, 2015
[5] Shao Bosheng, Zhu Ling, Exploration of Smart phones On Mobile Learning, Journal of
Educational Institute of Jilin Province, No.7, 2014
[6] Hao Kexin, On Mobile English Learning Based on Smart Mobile Phones, Journal of Jiujiang
Vocational & Technical College, No.2, 2015.
[7] Zhuo Yi, Li Yali, On Application of Smart Phone in Undergraduate Mobile Learning, Journal of
Southwest China Normal University, No.5, 2014.
[8] Hu Jing, Study on Application of Smart Phone Based on Mobile Learning to College English
Automatic-leaningJournal of Huai Hua University, No.4, 2014.
413
Perspectives on College English Flipped Classroom Based on Micro

Class
Jianing Niu
Dalian Jiaotong University, Liaoning, China
joyniu1981@163.com
Keywords: Micro class; Flipped classroom; College English
Abstract. With the rapid advancement of information technology, the flipped classroom based on
micro class has become the main trend of college English Teaching Reform. This essay introduces
the definition of flipped classroom, micro class as well as their relationship; analyzes the feasibility
of applying this new teaching mode to college English learning; explores the benefits as well as the
problems in the process of practice, taking the optimum use of this new teaching mode.

joyniu1981@163.com
1.

2010
2010-2020
2012 2011-2020
2015
90%
100%
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
414

[1]
2.

2.1
..
[2]
Brian Gonzalez
[3]

TED
2.2

[4]
415

15
15 15
2.3

1

(why) (what)
how why what
how:
why what how how why what [5]
3.

416

90
[6]
4.
,
4.1

4.2

[6]
4.3

4.4
417

[7]
4.5

[8]
5.

5.1

[9]
5.2

418
5.3

6.

"
References
[1] Outline of Chinas National Plan for Medium and Long-term Education Reform and
Development (20102020), Ministry of Education.
[2] Bergmann, J. & A. Sams. Flipping the Classroom [M]. San Bruno:Tech & Learning, 2012.
[3] Peng Min, The Research into the Flipped Classroom and Micro Class in College English
Writing, Journal of Hubei University of Economics, No.2, 2015.
[4] Chen Hua, The Application of Flipped Classroom and Micro Teaching to College English,
Journal of Higher Education, No. 12, 2016.
[5] Wang Yachen, Application of College English Flipped Classroom Based on Micro Teaching,
Journal of Huaiyin Teachers College, No.3, 2016.
[6] Wang Ping, Perspectives on Flipped Classroom in College English Teaching, Education
Modernization, No.10, 2016.
[7] Lei Wen, The Necessity of Integrating Flipped Classroom-Micro Class into College English
Teaching, Journal of Higher Education, No.15, 2015.
[8] Cui Yanhui, Wang Yi, Flipped Class Model and Its Application to College English Teaching,
China Electronic Education, No.11, 2014.
[9] Wang Chao, The Analysis into the Effectiveness of Flipped Classroom in College English
Teaching, Journal of Changji College, No.6, 2016.
419
On The Training Measures of "TWO STRONG" Applied Talents In Non-

governmental General Colleges
Weiwei Xiong
Wuhan Huaxia University of Technology, Wuhan, Hubei, China
853944938@qq.com
*Corresponding author: Weiwei Xiong
Keywords: Applied talents; Civilian run colleges and universities; CDIO Engineering education
mode
Abstract. In my school innovation and characteristics, connotation and development of the applied
talents training mode for the guidance, from the characteristics of the subject, subject characteristics
and subject strengths of three aspects of the introduction of training mode of automatic
measurement and control technology and instrument professional talents, the teaching contents and
methods. Put forward to cultivate engineering practice ability and innovative consciousness of
"TWO STRONG" (strong sense of the core professional skills, strong sense of innovation) subject
characteristics and applied talents, and gives a brief introduction of CDIO engineering education
mode, to provide reference for electrical engineering discipline is formed with the advantages of
Huaxia college characteristics.

853944938@qq.com

: CDIO
CDIO
1

978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
420

[1]
3
2007
3.1

421
DSP
EDAMATLAB
3.2

422
4

CDIO
CDIOConceiveDesign
ImplementOperata
[2]
CDIO
CDIO
[3 4]

References
[1]Weiwei Xiong, Huaiyu Wu. College practice teaching and cultivation of students' innovative
ability [J].Exploration on teaching theory and practice of Applied Talents
Training.2008,8:203-205.
[2]Huanxia Liu.CDIO interpretation of engineering education mode[J].Higher education
research.2010,6:40-43.
[3]Zhongjiang Wu,Chengliang Huang.Connotation of applied talents and cultivation of Applied
Undergraduate Talents[J].Advanced engineering education research.2014,2:66-70.
[4]Junzhi He,Guoyan Zhao. Attach great importance to laboratory safety work in private Ordinary
Universities[J].Laboratory technology and management.2013,5:206-209.
423
Discussion on the Reform of Management Course Based on

Constructivism
Li Tang
Department of management, the Engineering and Technical College of Chengdu University of
Technology, Leshan, Sichuan Province, China
scolatee21@sina.com
Keywords: Constructivism; Management; Experiment course.
Abstract. Constructivism has profound influence on the university curriculum reform. Many
teachers in college and university have reformed their course design based on the constructivism.
On the basis of the college freshmans characteristic, this paper proposed to add the training of team
into the teaching contents of the management course, because the college freshman are always lack
social experience and their experience in training course can help them to understand and master the
knowledge of the management course.

scolatee21@sina.com
: ; ;
1.
1.1

978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016

424
1.2

1.3

1.4

1.5

2.

2.1

12
425

2.2

40
1 40

1 6
2 7
3 7
4 7
5 2
6 2
7 4
8 2
37
3
40

4816
32
16
2.3
2.3.1

426
2.3.2

2

60
1 14
80

5

/
2 90

3 90
/

4 , 60
/

44
2.3.3

427
3

1 4
2 3
3 6
4 6
5 3
6 6
7 3
8 4
9 2
10 4
11 2
12 3
34 12
2
48
48
3.

References
[1] Drucker (USA). The practice of management M. Beijing: Mechanical Industry Press, 2006.
[2] Fang Liu. Teaching reform of "management science" course [J]. Cooperative economy and
science and technology, 2010, (10).
[3] Weidong Yang, Nan Jin. Constructivism theory. [J] theory guide, 2011, 5.
428
An Empirical Study on the Construction of Campus Soccer Talents

Training Base
Yi Zhang, Yong Yu
Physical Education Institute of Jiangxi Normal University, NanChang, JiangXi, China
Keywords: Colleges and universities; Campus football; Talent cultivation; Base; Construction
Abstract. Campus football plays a guiding and exemplary role in the development of campus
football. However, college football talent training is an important part of the development of
campus football in China, college football professional teachers strong, comprehensive, trained
talent is also comprehensive. Talent training needs the combination of theory and practice, while
practice is the college football teaching can not lack of part, therefore, the construction of personnel
training base is particularly important. Talent training base is a very comprehensive practice
platform, It can not only make the campus football talents in the study, and to get a better base
construction and development. Based on the investigation and analysis of the construction of
college football talent training base, this paper points out its key links and tests its importance in the
development of campus football.

,
330022
1.

978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016

429

2.
3.94
1/4 889
""2878
80

1
2016 6 5 1
2015
8 3 5
5
%
30 30 100
100 96 96
60 56 93.3
2
wordExcel
430
3.

3.1
6
5 1

12 11 2 2 5 16
2 5
2 2
( 60 60 50 55 55 50
12 11 6 4 10 16

6 4 4 6 8
200 40 40 20 22 60
150 80 60 40 65 150

2014
431

6 2 2 3 2 1
0 0 0 0 0 0
3.2

50 525
3.3

3-6 60-120

27 107 208

21 64 154

19 48 218

4 6 81

3-6 60
120 2 3
432

48 362 171
27 208 107 21
154 64
19
2015
2016 9 9
2016
3.4

References
[1] H. Zhang. Research on the Cultivation System of Schoolfootball Talents in the Layout Citis of
our Country [D].BEIJING:BEIJING SPORT UNIVERSITY2011.
[2] X.-Q. He, On cultivating mode establishment of the football reserves ofsports and education
combining styleafter 2008 [J]. Liaoning Sport Science and Technology2007.123 407-409
[3] X.-Q. He, Research on Cultivating System of Soccer Reserve Talent in our Country [PhD
thesis]. BEIJING:BEIJING SPORT UNIVERSITY2008,6
[4] B. Yu, Research on Construction and Safeguard Mechanism of Practice Base of Football
Education in College [J], Ability And Wisdom2016
433
[5] Q. Zhen, The Empirical Research on the Development of National CAMPUS FOOTBALLin
the Layout Cities of JiangXi province[D]JiangXIJiangXi NORMAL UNIVERSITY2012
[6] C.-G. Wang, Football in some universities of China current situation and development
Strategies [D], GUANGXI NORMAL UNIVERSITY2013.
[7] R. Zhang, JiangXi, Nanchang carry out primary and high school football Situation Analysis and
Research[D]JiangXI: JiangXi NORMAL UNIVERSITY5, 2010.
[8] Z.-M. DongB. GongZ.-J. Yan. Discussion of Issues on Carrying out Camous Soccer
Activities [J]. JOURNAL OF SHANGHAI UNIVERSITY OF SPORT2011,35291-94.
[9] N. Han, The Development of Campus Soccer Activities in Jinan Primary and Middle Schools
and the Construction of Long - term Mechanism [D]: []. JINANQufu Normal
University4, 2012.
[10] S.-F. Jiang, Current Situation and Developing of School Football in YangPu, ShangHai [D]
SHANGHAIShanghai University of Spor5, 2011.
[11] A. Cao, China School Football in Junior Middle School under the Background of Football
Teaching Content System Construction [D]: KAIFENG: Henan University, 5, 2012.
434
Study of the Skopos Theory in Guiding the Translation of Electric

English
Hongping Chena, Yu Hanb
NCEPU, Baoding, Hebei, China
a
physics307@163.com, b760725780@qq.com
Keywords: Skopos theory; Electric English; Translation study
Abstract. Electric English belongs to science and technology English, which has strong
professional and practical sense. By analyzing the status of electric English study, combined with
practical experience, the authors decided to adopt the skopos theory to guide the translation of
electric English. After analyzing and summarizing the collected literatures, the authors concluded
the research results, status, trend and deficiencies in the studies of non-literary translation which
adopted skopos theory as the entry point, and put forward some views on using skopos theory to
guide the translation of Electric English.

ab

a
physics307@163.com, b760725780@qq.com
.
,
1.

1skopos
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016

435

(ChristianeNord)
,
(
),
,)
3
2.
2.1

4
JKJabir5
2.2
80

2005
436
,,
7

2009
8

910

3.

4.
4.1

437
4.2

4.3

5.

References
[1] Katharina Reiss, HJ Vermeer. Groundwork for a General Theory of Translation, 1984.
[2] HJ Vermeer. Skopos and Commission in Translation Action, 1989.
[3] Christiane Nord. Scopos, Loyalty and Translational Conventions, Target, 1991.
[4] Peter Newmark, Approaches to Translation, Pergamon Press, 1980.
[5] JK Jabir, Skopos Theory: Basic Principles and Deficiencies, Journal of College of Arts, 2006.
[6] Zhou Mengzhen, Skopos Theory and Faithfulness, Expressiveness and Elegance, Academic
Forem, 2007(08).
[7] Fan Yong, Translation Errors in the Light of Skopostheorie Examples from the Web
Profiles of Some Leading Universities in China, Journal of PLA University of Foreign
Languages, 2005(28).
438
[8] Analysis on Luxuns Translation Stragety form the View of Skopos Theory, Shanhua, 2009(18).
[9] Yang Ping, Study on Skopos Theory and Teaching of Chinese-English Translation, Continue
Education Research, 2008(2).
[10] Tao Youlan, Construction of Chinese-English Translation Textbooks with the Guidance of
Skopos Theory, Foreign Language World, 2006(05).
[11] Chen Yulong, Wang Xiaoyan, Study on the Research Status of Functional Skopos Theory in
China, China Electric Power Education, 2010(24).
[12] Sun Yijing, Wang Shujing, Review of Skopos Theory, Intelligence, 2009(08).
[13] Tian Xiaoling, Study on the Translation Strategy of Scientific Papersfrom the view of
skopos theory, Journal of Northwest University, 2009(05).
[14] Peng Xiamei, The Composition and Translation of Electric English Terms, China Electric
Power Education, 2009(05).
[15] Jin Pengsun, Lu Fengfeng, Translation Study of Electric Materials from the View of
Equivalence Theory, China Electric Power Education, 2012(19).
[16] Ma Miao, Translation Study of Electric English from the View of Functional Equivalence
Theory, Kaoshi Zhoukan, 2015(92).
[17] Du Wei, Translation Study of Long Sentence in Electric English From the View of Functional
Equivalence, Success (Education), 2013(03).
[18] Wang Xian, Study of Functional Equivalence in the Translation of Scientific English, Shanghai
Scientific Translation, 1989(3).
[19] Peng Meixia, Translation Study of Long Electric English Sentence, China Electric Power
Education, 2010(24).
[20] Li Juanli, Translation Study of Electric English, Qinghai Electric Power, 2008(04).
[21] Zhao Zhang, Zhang Guowei, Logocentrism and the Translation of Electric English, Reform &
Openning, 2011(06).
[22] Yangming, Gaojun, Characteristics and Translation Skills of Electric English, Jiangsu Foreign
Language Teaching and Research, 2015(04).
[23] Wang Zhenhui, Feng Xue, Characteristics and Skills of Electric English Translation, Science &
Technology Information, 2014(34).
[24] Xie Yun, The Choose of Translation Strategyfrom the view of Reiss' text typology,
Northern Literature, 2011(09).
[25] Guo Xin, Characteristics Study of Scientific English From the View of Text Typology, Journal
of Taiyuan University, 2013(04).
[26] Ning Puyu, Lv Liangqiu, The Cultivation of MTI Talents in Electric Market, China Electric
Power Education, 2014(30).
[27] Zhang Weibo, Pan Yuchao, Cui Zhiqiang, Zhang Weidong, The Power in the Future, Rural
Power Management, 2006(07).
[28] Zhu Chengzhang, The Power in the Future and ChinaPower Market, Shanxi Energy and
Conservation, 2006(03).
[29] Ma Li, Fan Menghua, Guo Lei, Xue Song, Li Kun, The Current Trend of Foreign Power
439
Market, Automation of Electric Power Systems, 2014(13).
[30] Su Yanyan, Zhao Jinyang, Hu Jianxin, Greenhouse Gas Emmission of Chinas Power Market
from 1990 to 2050, Progressus Inquisitiones DE Mutatione Climatis, 2015(09).
440
Explore and Analyze Cultivation on Judgement Ability of Students Who

Major in Soccer----Taking students from College of Physical Education,
Jiangxi Normal University Who Specialize in Soccer for Instance
Jikun Qian, Guorong Qian
College of Physical education,Jiangxi Normal University, Nanchang, 330022
Keywords: Football majors; The referee ability; Training approaches and methods
Abstract. Soccer movement the development and popularity of the leave the moreperfect of soccer
rules and development, as a specific practitioner and a practitioner of soccer rules of football
referee's role is very important for students majoring in sports college football, football referee
ability training is imperative in this paper, by using literature method to inspect method,
questionnaire survey method, practice method, etc., all levels of football in jiangxi normal
university students majoring in team football referee ability training process tracking survey,
students majoring in sports colleges and universities to cultivate football referee ability ways and
methods of analysis.

,
330022
1986
2006
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016

441

2
2.1

2.2
2.2.1

2.2.2

2.2.3

30282480%
2.2.4
SPSS13Excel
3
3.1
3.1.1

33.33% 29.16%
1 N=24

4 3 8 2 7

16.66% 12.5% 33.33% 8.33% 29.16%
%
3.1.2

442

2 N=24

3 8 10 3

12.5% 33.3% 12.5% 12.5%
%
3.2
3.2.1

3.2.2

3.2.3

6000m7000m
3.3
3.3.1
1
234
56
3.3.2

3.3.3

3.4
3.4.1

3.4.2

443

3.4.3

3.4.4

444

References
[1] YANG Qi-cai , ZHENG Zhen-kun, An Analysis of PE Tertiary Institutes Advantages in
Training Referees, Journal of Nanjing Institute of Physical Education, Vol.17.No .2, 2003.
[2] Dongwen Wang, On the Referee 's Law Enforcement and Concrete Measures in Football Match,
Sports Word, 2008.2, 2008.
[3] Jingjian Cao, Zhilin He, Football referees must read, Beijing Sport University Publishing House,
1998.
[4] Luo Yaohua, The Cultivation of Football Referees on the Field Sense, Journal of Chengdu
Physical Education Institute, Vol .28, 2002.
[5] Xin Wang, Soccer referees the necessary psychological quality and professional ethics, Journal
of Nanjing Institute of Physical Education, Vol.16.No .6, 2002.
[6] Xiaohua Zhang, Judging ability of college football majors and establishment of evaluation
model, Journal of Wuhan Institute of Physical Education, Vol .40 No .7, 2006.
[7] Xing Zhang, Analysis on Athlete's Psychology and Regulation in Football Match, Inner
Mongolia Sports Science and Technology, Vol 4, 2006.
[8] Lige Si, Football competition referee manual, People's Sports Publishing House, 2001
[9] Gengfang Xie, The Qualities and Abilities of Soccer Referees, Journal of Zhaoqing University,
Vol.24 No.2, 2003.
[10] Jian Huang, Problems in Football Referee 's Law Enforcement, Journal of Shanghai Physical
Education Institute, Vol.S1, 1998.
445
Exploration on Training Talents in the Mode of 3+4 Connection in

Secondary Vocational Education and Undergraduate: A Case in
Mechanical Design Manufacture and Automation Major of Jiangsu
University of Science and Technology
Yongmei Zhu1,a,*, Wenxian Tang2,b and Zhimin Zhang3,c
1
School of Mechanical and Power Engineering, Jiangsu University of Science and Technology,
Zhenjiang Jiangsu, China
2
Jiangsu naval architecture & Machinery equipment advanced manufacturing laboratory, Jiangsu
University of Science and Technology, Zhenjiang Jiangsu, China
3
Zhenjiang Dali hydraulics co., LTD. Zhenjiang Jiangsu, China
a
zymtt@163.com, btanwenxian@163.com, c13511693982@139.com
Keywords: Second vocational education, Application-oriented universities, Mechanical engineering,

The talents cultivation of 3+4 connection.
Abstract. Exploring an effective mechanism to connect secondary vocational education and

application-oriented universities was the main purpose of pilot project in modern vocational
education system construction of Jiangsu province. This article analyzes the significance of training
the mechanical manufacture and automation talents with the mode of 3+4connection. Taking the
project 3+4 in the mechanical manufacture and automation Major of Jiangsu University of
Science and Technology as an example, the paper proposes implementation strategy and the
curriculum system of talents cultivation of seamless connection between secondary vocational
schools and undergraduate. From the teaching mode, the teaching staff, the practical teaching
platform, the teaching organization and quality management, etc., the paper illustrates the quality
assurance system.
3+4

1, a,*, 2,b, 3,c
1

2

3

a
zymtt@163.com, btanwenxian@163.com, c13511693982@139.com
*

978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016

446
: 3+4
.
3+4
3+4
1
20123+33+43+2
2014
3+4
3+43+4
23+4
1
201020202020
3+41+32+25+2
447
3+4
CDIO
FH
3+4

3+4
33+4

3+4

34

+
2.5+0.5+0.5+3.5
1
448
4
++
,
3+4
,
+
+
43+4
1

43+X
449

3+ X
3+X2
2 3+X
5
1

22.5+0.5+0.5+3.5
+
2.5+0.5+0.5+3.5
3
3+4
3+4
2015201559
References
[1] W.H. XUAN, Exploration on training high-level technic skilled talents in the mode of 3+4
connectionJournal of Jinling Institute of Technology, vol.29, pp.76-79, 2015.
[2] Y.M. Zhu, Research and Practice of Mechanical Practice Teaching for engineering education,
Advances in Education Research, vol.77, pp. 111-115, 2015.
450
[3] Z.H. LIU, H. X. HU, Design of Integration Course for3+4Vocational and Undergraduate,
Vocational and technical education, vol.35, pp. 29-32, 2014.
[4] S.P. ZENG, Y.M. ZHENG, Link of Mathematics Curriculum in 3+4 Model of Secondary,
Journal of Wenzhou Vocational Technical College, vol.15, pp. 83-87, 2015.
[5] S.L. Kim and D. Ha, A JIT lot-splitting model for supply chain management: Enhancing
buyersupplier linkage, Int. J. Production Economics, vol. 86, pp. 1-10, 2003.
[6] Y.M. Zhu, H. SAN, Study on Competence-oriented Engineering Teaching Reform of
Mechanical Design, Journal of Weifang university, vol. 12, pp.89-92, 2012.
451
A Review on Science and Technology Translation in China

Zhong Lin, Han Zhao
School of Foreign languages, Chongqing University of Posts and Telecommunications, Chongqing,
40065
Keywords: Science and technology translation; Status quo; Countermeasures
Abstract. As the science and technology exchange becomes more and more frequent internationally,
science and technology translation has mushroomed. This paper mainly analyses its current status
quo in terms of the objects, strategies and content of the research and the theoretical background.
Besides, the paper also proposes the problems about the current research and offers the
countermeasures to develop the science and technology translation.

a b,*

a
linz73105@126.comb1298912633@qq.com
*

1.

2.
2016
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016

452
2.1

2016 26.8%

2008
2012 1500-1600
20032011
1987
2015

(1990)
,(1995)
2003
(1987)
1989
2007
,
2.2
453

2002
,
(parallel corpus)(multilingual corpus)(comparable corpus)
2000
2015
Chen(2008)
Blum-Kulka( 1986)
( Baker1996)
1949 ,Weaver (MT)

MT
,2015
11
Guerberof,2009,2007
2011
2.3
CNKI 557
39 14 8
13 9 8 7

2016
,,
2004
2015

2005 1989
454

2008
2010
,2008
2010,
,
,
:
2013
99%
(1997)
(2003)

2011
(2005)

2016
(2004)
2.4
557
1969
2015
455

20152015

2016
2016
Sperber Wilson1986

,
,
20072015
2016
,
19852008
(2010) ,,
,
,2014
3.

,2016
:
456

,,

4.

,
,,
5.

2015 MTI
yjg153099
References
[1] Baker M. Corpus-based translation studies: The challenges that lie ahead [J]. Benjamins
Translation Library, 1996, 18: 175-186.
[2] Crystal D. Cambridge Encyclopedia of the English Language: Canadian Edition [M].
Cambridge University Press, 1995.
[3] Guerberof A. Productivity and quality in MT post-editing[C]//MT Summit XII-Workshop:
Beyond Translation Memories: New Tools for Translators MT. 2009.
[4] Newmark P. A textbook of Translation [M]. New York: Prentice hall, 1988.
[5] Nida E A. Language, Culture, and Translating [M]. Shanghai Foreign Language Education
457
Press, 1993.
[6] Wu D. Stochastic inversion transduction grammars and bilingual parsing of parallel corpora [J].
Computational linguistics, 1997, 23(3): 377-403.
[7] Yu Shan, Wuqiu Fan. A Review on Science and Technology Translation in China from 1997 to
2014 [J]. Chinese Science & Technology translators Journal, 2016, 29(1): 14-17.
[8] Mengzhi Fang.Style and Translation: English Science and Technology Text [M]. Beijing
National Defense Industry Press2011.
[9] Xiaobo Gu. Textuality and Science & Technology Translation[J]. Chinese Science &
Technology translators Journal, 2015, 28(4): 38-41.
[10] Sanyu He. Elegance in Translation: A perspective in Science and Technology Translation [J].
Shanghai Journal of Translators, 2011 (3): 29-32.
[11] Qiyi Liao. Corpus and Translation Studies [J]. Foreign Language Teaching and Research, 2000
(5): 380-384.
[12] Chunyan Liu. Translation Principle and method in Science and Technology Translation [J].
Chinese Science & Technology translators Journal, 2004, 17(3): 13-16.
[13] Zheng Liu & Feng Zhang. Review on Problems in Science and Technology Translation [J].
Chinese Science & Technology translators Journal, 2014, 2: 014.
[14] Huashu Wang & Yanxi Zhang. Translation Quality Control from the Perspective of Technology
[J]. Journal of Language and Literature Studies, 2015 (4): 1-5.
[15] Xiaofeng Wang & Chenxiang Zhang. Proceedings of Science and Technology Translation [J].
Chinese Science & Technology translators Journal, 2006, 19(4): 33-36.
[16] Lin Yang. Cohesion of Nominalization in Science and Technology Text and Translation
Strategy [J]. Chinese Science & Technology translators Journal, 2013 (1): 1-3.
[17] Fulin Yin & Yuanjiang Hu. A E-C Comparison of Cohesion Devices in Science and Technology
Text and Translation Based on Corpus [J]. Foreign Languages Research, 2010 (3): 87-92.
[18] Yifan Zhang& Mingwu Xu. A cultural Analysis on Science and Technology New Terms and
their Translation Strategies. [J]. Chinese Translators Journal, 2012, 33(5): 105-108.
458
A Review on Science and Technology Translation in the Past 40 years in

China
Feng Wang, Qiong Zhang
School of Foreign languages, Chongqing University of Posts and Telecommunications, Chongqing,
40065
Keywords: Science and technology translation; Research status; Problems
Abstract. Progress of science and technology drives a fast demand on translation of English for
science and technology text, which in turn promotes the development of translation studies. The
paper presents an analysis of the studies in the past 40 years in China issued in the CNKI database
with the focus on research status, problems and solutions. The paper is aimed to have a clear picture
of the current research status of science and technology translation with suggestions for its
development.

a , b,*

a
wangfeng367@163.com, b463429037@qq.com
*

.
CNKI
1.

80

2012
CNKI
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
459

2.

2.1
2005

2012
20122015
2015: 3
(2016)
20122012(2012)(2016)
Newmark2001

CNKI 2000~2016
200
350 //
2005200520102012

1985 Louis Trimble
1987 WMann SThompson
12 (Halliday)(Hasan) 1976
2011 20112011

2012
201320132014
20142013
2014
2015
460

2.2

2011
20112004

2011 201220132014
201620162016
2014
2016
2003
20002016

2004
2012

2010(2012)
(2014)(2010)2015
2015
2014

1987
(2015
(2015)
2016

1989 1989
20072012
2016
461

2.3

Nida :(ideal)maximal
realisticminimal2015
2014
2015
Nida Newmark

4G (2012)
2016
2011 2011
(2013)
2014
,
20162016
2016,

20112015
2016
2015

2003
,
462

2011
2013
2009
2013
2012
,2012
,
2002
2.4

90 2012 9

2013 McEnery
Richard(2010)2015
1988
2009
2012
2012
2012
, , ,
2012
,
2013
2013
2013 Wordfast
20152015

463

3.
(1)
(2)
42016
2014 27 8
5
4.
CNKI
2015 MTI
yjg153099
References
[1] Gentzler E. Contemporary Translation Theories[M]. Multilingual Matters, 2001.
[2] Halliday M A K, Hasan R. Cohesion in English [M]. Routledge, 2014.
[3] Malmkjr K. Translational stylistics: Dulckens translations of Hans Christian Andersen[J].
Language and Literature, 2004.
[4] Newmark P. A Textbook of Translation[M]. New York: Prentice hall, 1988.
[5] Nida E A. Language, Culture, and Translating[M]. Shanghai Foreign Language Education
Press, 1993.
[6] Trimble L. English for Science and Technology: A Discourse Approach[M]. Cambridge
University Press, 1985.
464
[7] Qiliang Cui. Post-edition of Machine Translation [J]. Chinese Translators Journal, 2014, 6: 016.
[8] Yu Shan, Wuqiu Fan. A Review on Science and Technology Translation in China from 1997 to
2014 [J]. Chinese Science & Technology translators Journal, 2016, 29(1): 14-17..
[9] Qiuwu Fan. Reasons for SlowProgress inScience and Technology Translation in China [J].
Shanghai Translators Journal, 2012.
[10] Mengzhi Fang& Zhixiang Zhuang. Translaion history: A Preface [J]. Shanghai Translators
Journal, 2016 (3): 1-8.
[11] Mengzhi Fang. AReview on Chinese Study on Science and Technology Translation [J].
Shanghai Science & Technology Translators Journal, 2002, 3: 000.
[12] Mengzhi Fang. Style and Translation: English Science and Technology Text [M].
Beijing National Defense Industry Press2011.
[13] Li Li. Textual Perspective on Translation Skills in Science and Technology Text [J]. Chinese
Science & Technology translators Journal, 2007, 20(4): 40-42.
[14] Yashu Li & Zhonglian Huang. Translation Studies on Science [M]. Beijing: China Translation
& Publishing Corporation 2004, 77.
[15] Lingxia Meng. Terms Translation [J]. Chinese Science & Technology translators Journal, 2011.
[16] Mengfen Wei. Terms Features in Science and Technology Texts and their TranslationMethod [J].
Chinese Science & Technology translators Journal, 2014, 1: 002.
[17] Gaofeng Yu. Translation of Complex Sentences in Science and Technology Text[J]. Chinese
Science & Technology translators Journal, 2012, 25(3).
465
Chapter 5:
Social Science
Analysis on Questionnaire of Securities Transaction Practice-- Taking

School of Economics and Management of Hei He University as an
Example1
Rong Cheng, Chunlian Zhang, Ningyi Cao
Heihe University
Keywords: Securities Transaction Practice; questionnaire; School of Economics and Management

of Hei He University
Abstract. Securities Transaction Practice is set after the theoretical course Security Investment
according to the aim of cultivating applied talents. The teachers give lecture at first and then make a
questionnaire about students employment intention, qualification tests, courses, part-time teachers
lessons, course reformation, subject selection, discussion questions, course improvement suggestion,
competition instead of exam, and learning problems. This paper is to analyze this questionnaire.

, ,

1.
2014
1
This paper is one achievement of Research on Dialogue Educational Mode of Cultivating Innovative Talents in Newly Built
Undergraduate Colleges, which is Hei Longjiang annual philosophy and social sciences research in 2015 (Grant No. 15EDE10).
2015 (:
15EDE10)
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
469
2014 115
115
10 2 8
2.
2.1
1 2014
(%)
2014 1 29 19 59
2014 2 28 23 82
2014 3 30 20 67
2014 4 28 18 64
115 80 69.6
2014 80
42 38
69.6% 2015
2.2
2 2014
(%)
2014 1 29 22 68
2014 2 28 20 71
2014 3 30 16 53
2014 4 28 18 64
115 76 66.1
2014 76
42
34
2.3
3 2014
2014 1 2014 2 2014 3 2014 4

4 3% 3 2% 5 3% 4 2%
3 2% 6 5% 5 3% 2 1%
1 1% 1 1% 5 3% 1 1%

24 19% 18 15% 15 13% 21 18%
470

2.4
4 2014
2014 1 2014 2 2014 3 2014 4

21 18% 25 21% 22 18% 23 18%

4 3% 2 1% 4 3% 2 1%

4 3% 1 1% 4 3% 1 1%

3 2% 0 0 0 0 2 1%

1+1
2.5
5 2014
2014 1 2014 2 2014 3 2014 4

3 2% 10 8% 4 3% 23 18%
8 7% 13 11% 7 6% 2 1%

6 5% 13 11% 10 8% 1 1%

15 13% 11 9% 12 10% 2 1%

31% 35%
25% 34%
2.6
471
6 2014
2014 1 2014 2 2014 3 2014 4

1 1% 5 4% 6 5% 4 3%
23 19% 22 19% 13 11% 7 6%
4 3% 11 9% 10 8% 10 8%
4 3% 5 4% 1 1% 13 11%
55%
23% 28%
19%
2.7
7 2014
2014 1 2014 2 2014 3 2014 4

11 9% 15 13% 8 7% 11 9%
4 3% 12 10% 7 6% 7 6%

7 6% 4 3% 5 4% 7 6%

10 8% 10 8% 10 8% 8 6%

38% 25%
19%
30%
2.8
8 2014
2014 1 2014 2 2014 3 2014 4

3 3% 9 5% 5 4% 0 0
5 4% 8 7% 8 7% 6 5%
13 11% 10 8% 10 8% 13 11%
10 8% 11 6% 7 6% 10 8%
38%
28%
23% 12%
2.9
472
9 2014
2014 1 2014 2 2014 3 2014 4

22 19% 16 14% 23 19% 13 11%

5 4% 10 8% 7 6% 9 7%

5 4% 2 2% 0 0 6 3%

63%
25% 9%
2.10
10 2014
2014 1 2014 2 2014 3 2014 4

1 1% 8 7% 7 5% 7 5%
21 19% 25 21% 12 10% 17 13%

4 3% 6 5% 8 7% 2 1%
6 5% 7 5% 3 2% 3 1%
63% 18%
16%
19%
3.

1+1
4.
1981-
1965-
1996- 2014 4
473
References
[1]. Jingchuan, Li. Study on Professional Ability of Securities Transaction Practice [J]. Value
Engineering, 2014, 29: 259-260.
[2]. Liu Li. Project-oriented Teaching Reform and Practice of Securities Transaction Practice in
Higher Vocational Colleges Based on Actual Securities Work [J].Finance and Economy, 2015,
16: 179-181.
[3]. Caili, Yao. Teaching Creation of Securities Transaction Practice Taking Xiamen Ocean
Vocational College as an Example [J].Journal of Changchun Finance College, 2012, 03: 55-57.
474
The Problems and Countermeasures of Construction of Ecological City

Qian Dai
Yangtze University School of Economics, Jingzhou, Hubei, China
Keywords: Ecological city; Public policy; Effect
Abstract. At present our country a lot of city environmental pollution is very serious, a lot of local
frequent waste of energy, in order to promote the ecological construction of the city, the
government must play its role, to vigorously promote the city's sustainable development policy, not
only focus on the current economic development, should have a global outlook on development.
Eco city is the ultimate goal of the development of urbanization. In this paper, we put forward some
suggestions to the government, hoping to promote the construction of ecological city and the
sustainable development of ecological city economy
1.

2.
2.1
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
475

2.2
1

2.3

2.3.1

2.3.2

476

2.3.3

4.

4.1

40%
50%
4.2

2005
102 9800 1.93
4.3

730
477
70
EEM-ESSS
References
[1] BaoJun Yang . The concept and practice of the ecological city planning [J]. The city planning,
2008.
[2] Man Li. On the role of social public policy in Ecological Innovation [J].Financial research,
2008.
[3] Deli Yao. Study on the relationship between low carbon architecture and eco city [J]. Shandong
Social Science. 2011.
[4] Zhaoyi Huang. Review on the theory of ecological city at home and abroad [J].City
planning.200.
478
Set up "Ba-Han Culture" the Ankang of"Han Water Cultural"

Linlong Zhao
Institute for Tourism Culture at Research Center for South Shaanxi Folk Culture, Ankang University,
Ankang, China
aktczll@163.com
*Corresponding author: Linlong Zhao
Keywords: Ankang; Han culture; Ba-Han culture; Construction
Abstract. Because of the history of Qinling Mountains across the barrier, the Hanjiang River Basin
Daba mountain area of Qinling Mountains - both unity of "Han water" culture, cultural
characteristics and have their regional differences, differences in the cultural connotation of the
elements of cultural origin in each region, and the culture and blend with each other, mutual
influence, promote the "Han water" culture development.Therefore, Ankang's "Han water culture"
by both the "Ba culture", but also by the upper Hanzhoung "SHUhan culture", also by the lower
reaches of Han River Xiangyang Wuhan's "Jingchu culture".Ankang "Han water culture" with
"Ba culture" as the foundation, influenced by "Jingchu culture", and the "Han culture" development,
inheritance, evolved into today's "Ankang Han water" Ba-Han culture "culture".
aktczll@163.com
*
:
. -
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016

479

1.

1970100
1976
771978
2050
1990
10100[1]

2.

10991066
316
[2]
......)
.......
[3]
480
1046
[4]611
[5]

[6]
223221
209
143
195
[7]

20
[8]

[3]
3.

3.1

481
3.2

3.3

3.4
611
4.

4.1

4.2

482

4.3

618627
1853
[9]
2010
207
[10]1700
102
2010
483

1822
7[11]2010
2010
2011
2013(13JZ003) (13XJY026)
.
References
[1] CHEN Yong, The Historical Changes of Shaanxi-Sichuan Area and Its Economic Development.
Journal of Shanghai University, vol.19(1), pp.101107, 2004.
[2] Wei Liang Guan, Wushan spring and Ba people rise and fall (down). JOURNAL OF SICHUAN
THREE-GORGES UNIVERSITY, Vol 14(4), pp.2126,1999. Zhang Lianggao, Bashibie view.
China Building Industry Press, 2006.
[3] Zheng Jianbin, the secret dies of the ancient. modern publishing house, 2008.
[4] Linlong Zhao, Yong Cultures Influence on Hanshui Culture of Ankang. ERMI 2013, Vol 45,
pp.118125, 2013.
[5] HUA Fu-gui, On the Source of Duhe River Culture in the Hanjiang River Region. Journal of
Yunyang Teachers College, vol.27(4),pp.2427,2007.
[6] YANG Hong-lin, ZHANG Ling,CommentsontheCharmofChll--HarLiteratUre. Journal of
Hubei TV University, vol.21(2),pp.4852,2004.
[7] PAN Shi-dong, The Ecology Form Characteristics of Hanjiang River Culture. Journal of
Yunyang Teachers College,vol.26(1), pp.1218,2006.
484
[8] This week day, the prince, Nuwa cultural studies. Shaanxi press.2 005.
[9] Guo Peng, the Han Dynasty in the period of the Three Kingdoms. Shaanxi Hanzhoung press,
2005.
[10] Xue Feng, Shuhe was due to water and Xing town. People.com.cn, 2004.11.3009:48.
485
A Study on the Differences between Urban and Rural Areas in the

Implementation of the One Child Policy
Xinyue Kong
North China Electric Power University, Baoding, Hebei, China
906178387@qq.com
Keywords: One child policy; Urban and rural difference; Implementation results
Abstract. In 1980, our country began to implement the policy of a couple to give birth to a child,
that is, one child policy. The implementation of the 35 years, the various drawbacks of a child
policy gradually exposed, the political, economic, social and other aspects of our country has
caused a profound impact. At the same time, the specific implementation of the policy in urban and
rural areas is different, the impact is also different. Thus, this article will be based on the perspective
of urban and rural differences, the consequences of the implementation of the "one child policy"
thinking and analysis

906178387@qq.com
.1980 , 35
1.
1973
1971 3065 1980 18.21,

, 20 80 19801982
,,
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
486

35
2.

4 5 [3]
487

3.

2015 10
References
[1]Short, Susan, Zhai Fengying, Xu Siyuan, and Yang Mingliang. Chinas One-child Policy and the
Care of Children: an Analysis ofQualitative and Quantitative Data[J]. Social Forces, 03,2001
[2]Murphy, R. Fertility and Distorted Sex Ratios in a Rural Chinese County[J]. Population and
Development Review, 04,2003
[3] Qiao Xiaochun,Historical review of the consequences of one child policy[J], Academia
Bimestrie,01,2016
488
Dian Opera Intangible Cultural Heritage Inheritance Model to Explore

Xianghong Tian
Music and Dance College of Qujing Normal University, Yunnan,China
Hxzky028@163.com
Corresponding author: Xianghong Tian
Keywords: Dian Opera; Intangible cultural heritage; Inheritance; Model
Abstract. Dian Opera is an important part in the field of opera in China, is the most representative
of Yunnan comprehensive performing arts category. In the opera is faced with the crisis of
development in the 21st century, Dian Opera was listed in the second batch of national intangible
cultural heritage. Around Dian Opera non genetic on this topic, I think to be on the basis of the
understanding in the past, found the problem as the basis, to seek the method to solve the problem
as the core to be discussed. Dian Opera performance of professional mode, music part of the
campus spread method, the fusion of Dian Opera and local cultural resources, art of the classic
reference at home and abroad, the existing folk resources protection, the use of modern
communications media, such as an exploration of channels.

Hxzky028@163.com

.
21
1.

2008
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
489

2.
2.1

[1],
2.2

[2]
[3]
[4]
20

1956
20 60
80
3.

80
490

1957
1986 2015
2008 6
4.
4.1

2012
2016
4.2

2013 9
4.3

491
90

4.4

1951

5
[6]
4.5
50 368 2005 267
8
21
2016
492

5.

2015 7 17
(201552 )[9]2016 3
[10]

A2016ZDX002
References
[1]Cong Yu.M. Drama and Chronicles a collection, Culture And Arts Press, pp.123, 2014(01).
[2] Ming Yang; Feng Gu.M. The history of Dian pera, Chinese Opera Press, pp, 26-44, 1986(6).
[3] Ming Yang; Feng Gu.M. The history of Dian pera, Chinese Opera Press, pp,55, 1986(6).
[4]Ming Yang; Feng Gu.M. The history of Dian pera, Chinese Opera Press, pp, 64-72P, 1986(6).
[5]Yaonong Zeng.M. Art and communication, Tsinghua University Press,2 007.
[6]Tao Zhou. M. Folk culture and the "seventeen years" opera adaptation, Guangxi Normal
University Press, pp12, 2012.
[7]Hengfu Zhu. M. Drama inheritance and development of research in the process of urbanization,
Shanghai people's Press, pp85-90,2013(12).
[8] Hengfu Zhu. M. Drama inheritance and development of research in the process of urbanization,
Shanghai people's Press, pp1-12, 2013(12).
[9]http://www.news.xinhuanet.com.
[10]http://www.yn.gov.cn/yn_zwlanmu/qy/wj/yzbf/201601.
493
Contemporary Football Match Typical Case Analysis and Reference

The Case of Portugal the Championship of the European Cup in
2016
Honglei Wang
School of PE, Jiangxi Normal University, Nanchang 330022, China
Keywords: European cup; Portugal; Attack; Defense
Abstract. Using video observation method, mathematical statistics and literature data analysis
seven games of the Portuguese teams in the European Cup final stage in 2016. The study shows
that: the Portuguese team in the first adverse circumstances, after the adjustment of the formation of
the coach, the state is becoming more mature. Portugal on the offensive end mainly to defensive
counterattack tactics, through the concise under the end of the mass transfer and the edge of the
main cut with the cut. On the defensive end, the Portuguese team mainly used contraction defense,
and the use of tight marking combined with regional defense to form an effective overall defense
system.
2016

330022
.2016
7
1.
2002143
16
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016

494

2.
201634
7
3.
3.1
43124424132
43121/84421/4
41324132
4312442

19
1/81/4
4
1
3.2
3.2.1
1 2016

(1:1) 1 31
(0:0) 0
1 42
50
(3:3) 2 C

3 62 C
(1:0) 1 117
(1:1) 1 33
1 50 C
(2:0)
2 53
(1:0) 1 109
711917
385.4291.2813.284.23
[1]
1971
7
495
3.2.2
19333.33%4
44.44%222.22%31
4546603
[2]

3.2.3
711917
3864173129
59
2931
[3]
3.2.4

C
C
23
3.3
3.3.1
2750.715
4
43
2
496
2 2016

(1:1) 1 50
1 19
(3:3) 2 47
3 55
(1:1) 1 2
3.3.2

3441
4.
120164424132
41-3
3-1
2
References
[1]Guskiewicz K M, Mccrea M, Marshall S W, et al. Cumulative Effects Associated With
Recurrent Concussion in Collegiate Football Players: The NCAA Concussion Study[J]. Jama
the Journal of the American Medical Association, 2003, 290(19):2549-55.
497
[2]Mccrea M, Guskiewicz K M, Marshall S W, et al. Acute effects and recovery time following
concussion in collegiate football players: the NCAA Concussion Study.[J]. Jama the Journal of
the American Medical Association, 2003,290(19): 2556-2563.
[3]Bangsbo J, Mohr M, Krustrup P. Physical and metabolic demands of training and match-play in
the elite football player.[J]. Journal of Sports Sciences200624(7):665-674.
[4]Hoffman J R, Maresh C M, Newton R U, et al. Performance, biochemical, and endocrine
changes during a competitive football game.[J]. Medicine & Science in Sports &Exercise, 2002,
34(11):1845-53.
498
How to Do the Work of Regular Rotation of Financial Personnel

YanKe Zhao
Beijing Special Vehicle Institute, Fengtai District, Beijing City, China
65151876@qq.com
*YanKe Zhao
Keywords: Financial personnel; Regular rotation
Abstract. There are disadvantages for one financial person to work on one position for a long time:
tired of always doing the same job, no motivation to improve, limited knowledge associated with
only one position. All these are disadvantageous for training people with rich knowledge and for
supervising financial personnel. This article starts with the effect of exchanging positions regularly.
As a result, some suggestions are provided on how to arrange the position exchange regularly.

65151876@qq.com
*

978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016

499

2.1

2.2

20%
1-2
3-5
2-3
2.3

2.4

500

2.5

References
[1] LiYu Chen, Job rotation of financial personnel under the condition of market economy, Market
Modernization,vol.21, pp. 344-345, 2008.
[2] QuanZheng Gai, The necessity of rotation of accounting positions in hospitals, Foreign
Investment in China, vol.16, pp. 83, 2011.
[3] Yu Wang, The value of post rotation system of financial personnel, Friends of Accounting,vol.8,
pp. 23-24, 2005.
[4] Qiang Li, On post rotation of financial personnel in Higher Vocational Colleges, The Border
Economy and Culture, vol. 7, pp. 95-96, 2012.
501
Application Techniques of Color in Black Humor Films

Ming Li
School of Media (3D Cinematic Arts), Linyi University, Linyi China 276000
Keywords: Black humor; Film; Color; Technique
Abstract. As a unique behavior art of the human being, the film has a close relationship with
literature. As an important part of the literary genre in the twentieth Century, "black humor" film
had a profound impact on the development of the film industry. Thus, a new type of film with
distinctive artistic features was also produced. This new type of film is mainly through the "black"
details and "humorous" performance techniques to win the audience's laughter, so as to leave the
audience deep impression. But the most important part of black humor in such films is its unique
use of color, which is to explain personalities characters, emotion changes and social ideology in
the film with specific colors. In this paper, take the film of "Lock, Stock and Two Smoking Barrels"
as an example, to study the application techniques and effects of the color using in black humor
film.

,3D ,,,276000
. 20
1.
20 20 20 60 70
,,
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016

502

Joel Coen

[1]
2.

[2]
2.1

2.2
[3]
503

2.2.1

[4]
2.2.2

[5]
[6]
2.2.3

[7]
3.
3.1

,,
,
,,
, [8]
,,
,,,
,
,,,
504
,
3.2

3.3

4.

4.1

4.2
50
[9]
505

4.3

[10]
4.4

10 50

[11]
506
5.

,
,,
References
[1]HAO Jian. Film and television typology[D]. Peking University, 2002 .
[2]WANG Jun_zhong. Look at the compatibility characteristics of film and literature from the
dramatic conflicts---take" crazy stoneand "Lock, Stock and Two Smoking Barrels" for
examles[J]. Journal of Xianning University, 2010,(30)7:59-60.
[3]RAN Xiao_weng. The role and performance function of the color in the animation film and
television[J]. Arts Criticism, 2007,(6):87.
[4]SONG Jie. The tone colors in the movie[M].Beijing: China Radio and TV Press, 2004
[5] GUO Meng_meng. Analyzing and evaluating color arts in films directed by ZHANG Yimou[J].
Movie Literature, 2010,(07):40-41.
[6]HU Zhi_feng. The meaning of color looking at the movie color from the Chinese film[M].
Beijing: Beijing Normal University press, 2003
[7]WANG Yu. Narrative function of the color in the animation film[J]. Movie Literature,
2011,(15):54-55.
[8]GAO Sheng. Scene language expression and cultural analysis of black humor---the art Theory of
ho-cheung pangfilms[D] Central China Normal University,2013.
[9] ZOU Dong_li. The Society and Li fe in Noir Image The Research of Film Noir .Journal of
Henan Institute of Education (Philosophy and Social Science Edition), 2004, 23(04):38-42.
[10]LIN Shao_xiong, WU Xiao_li. Theory introduction to film and television literatures, (TV
booklet)[M]. Shanghai : Shanghai University Press ,2005.
[11]HONG Xiao. Black humor gives domestic small film new life---- Analyses the similarities and
differences between the "Lock, Stock and Two Smoking Barrels" and" crazy stone [J]. Movie
Review, 2012,(12):46-48.
507
The Real-time Simulation of Smoke

Pengpeng Yua, Tao Tang, Lili Zhaob,*, Fan Xiao, Xianglei Meng
High-tech Institute, FanGong-ting South Street on the 12th, Qingzhou, Shandong, China
a
3344583@163.com, b147490292@qq.com
Keywords: Smoke; Real-time simulation; Particle system
Abstract. The real-time simulation of smoke sense of reality is a hotspot and difficulty in the
research field of computer graphics. Based on the improved particle system method has carried on
the real-time simulation to smoke, and joined the stable the role of the wind. This article with the
improved method to map the smoke of the strong sense of reality, improve the efficiency, achieved
the requirements.

a, , b,*
12
a
3344583@163.com, b147490292@qq.com
*

2
Reeves
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
508
[1]InakageOhshinmaItahashi
Nishita
ChibaFedkiw
[2]StamFiumeFosterMetaxas

[3] [4]

[5]

3
3.1

1983Reeves[1]
PeacheyFournier
N-SSimsAlex Heng
3.2

1

3.3

509
Reeves
NParts=MeanParts+Rand( )Varparts (1)

Rand( )(-1.01.0)MeanPartsfVarparts
NParts=(MeanParts+Rand( )Varparts)ScreenArea (2)

ScreenArea
3.4

Property={figure, size, color, alpha, position, velocity, acceleration, life} (3)

RGB
AppearanceProperty={figure, size, color, alpha} (4)
MovementProperty ={position, velocity, acceleration} (5)

3.5
1.

Color(i +1)=Color(i) +ColorChanget (6)

Alpha(i +1)= Alpha(i) + AlphaChanget (7)
2.

8
Velocity(i+1)=Velocity(i)+ Acceleration(i)t (8)
Velocity(i+1)i+1Velocity(i)iAcceleration(i)i
510
Position(i +1)= Position(i)+Velocity(i)t (9)
Position(i +1)i+1Position(i)iVelocity(i)i
3.
10
Life(i+1)=Life(i)-AttenuationPerframet (10)
Life(i+1) i+1 Life(i) i
AttenuationPerframe
3.6

2.7

[6]Reeves
[1]
Reeves
2.8

2
f
0 t
511

f_mid
0 t1 t2 t3 t
30t1y=axt1t2
t1
Rand( )t2
t2t3
f at 0 t t1

f f _ mid Rand ( )* t t1 t t2 (11)
f b(t t ) t 2 t t3
3
11t1t2t3abf_mid
f = atf = f _mid + Rand()*t
f =b(t3-t)
3.
Intel Core
i5-2380P CPU 3.10GHz 4.00GNVIDIA GeForce GTX 550 Ti
4
30/
(a) (b)
512
4.

GPU
References
[1] Reeves W. Particle System-A Technique Modeling a Class of Fuzzy Objects[J]. ACM
Transaction on Graphics, 1983, Vol.2(2): 359-376.
[2] Fedkiw R, Stam J, Jesen H W. Visual Simulation of Smoke[C]//Proc of SIGGRPH01, 2001:
15-22.
[3] Yang Yang,Xubo Yang. Simulation of Swirling Particle Smoke with Staggered Grid
Structures[J]. Journal of Image and Graphics, 2014, 19(5): 781-788.
[4] Shanghong Zhang, Lei Chen, Dengfeng Zhao. Real-time simulation of flow field based on
particle system [J]. Water Resources and Hydropower Engineering, 2005, 35 (9): 47-50.
[5] Xuexia Yuan, Xinfu Yin. Fast simulated smoke [J]. Computer Engineering and Design, 2008,
29 (9): 2392-2396.
[6] Qin Zhang. Research on Modeling Method Based on Particle System [J] .Computer Science,
2003, 30 (8): 144-146.
513
The Improved Design of Turbo Codes in CDMA2000 System

Jinshi Yang, Lili Zhaoa,*, Pengpeng Yu, Mingshun Ai, Peng Chen
High-tech Institute, FanGong-ting South Street on the 12th, Qingzhou, Shandong, CHINA
a
147490292@qq.com
Keywords: CDMA2000; Turbo; CTC
Abstract. In this paper, turbo codes in CDMA2000 system are analyzed and improved. Finally, the
improved performance is evaluated by simulation experiments.
CDMA2000 Turbo
a,*, , ,
12
a
147490292@qq.com
*

: CDMA2000Turbo
. CDMA2000 Turbo
1
Turbo
Turbo
CDMA2000
Turbo
CDMA2000 Turbo CDMA2000 Turbo
1 Turbo
1/2 CDMA2000 Turbo
Y0 Y1
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016

514
1 X
Y0
Y1
Nturbo

N
turbo+6/R
Nturbo1
323
Turbo
2 X
Y0
Y1
Nturbo1
323
1 Turbo
2CDMA2000 Turbo
2.1 CDMA2000 Turbo
IEEE802.16e Turbo
Turbo Turbo
2 Turbo
Turbo CRSC info
A B info A B'
00011011
515
A
CRSC1 B
Y1
W1
A

info B
Nturbo /R

A
Turbo CRSC2 B
Y1
W1'
2 Turbo
CDMA2000 Turbo
3 Turbo
2.2
CDMA2000 Turbo 1
Turbo
2
Turbo
Turbo
m
4
m (2 n 1) / n (x)
S m 1 N
S S
S m
516

D D D D
RAM
2.3
Turbo Turbo
Turbo
Turbo 5
yka,ykb Lt uk Let u k Lat uk

yky1 ,ykw1 1
+
yky2 ,ykw2

Lt uk
2 +
Lat u k

5 Turbo
5 /
y ka y kb Turbo
y ky y kw Turbo
Li (u k ) Turbo
Lei (u k ) Turbo 1 2
Lai (u k ) Turbo Lei (u k )
2.4
Turbo MAPLog-MAPMax-Log-MAP
SOVA Turbo Turbo CDMA2000
Turbo CRSC Turbo
Turbo Turbo 4
6
517
S S
k1 (s )
'
k (s )

uk
6 Turbo
Log-MAP Jacobian
Log-MAP
3
7 AWGN BPSK 1/2
1024 1000 m Turbo Turbo
Max-Log-MAP SOVA
Turbo Turbo
Turbo Turbo
SOVA Max-Log-MAP
Turbo Log-MAP
518
References
[1] C. E. Shannon. A Mathematical Theory of Communication. The Bell System Technical Journal.
1948, Vol. 27379423.
[2] Berrou, C.,Glvaieux,A.and Thitmajshima,P., Near Shannon limit error-correcting Coding and
decoding: turbo codes. IEEE International Conference Communications(ICC),may
1993,1064-70.
[3] H.Liu,C.Jego,E.Boutillon,J.P.Diguet,M.Jezequel.Scarce state transition turbo decoding based
on re-encoding combined with dummy insertion[J].Electronics Letters,2009, 45(16):846-84.
[4] J.Hokfelt,0.Edfors,T.Maseng.A turbo code interleaver design criterion based on The
Performance of interative decoding[J].Communications Letters,IEEE,2001,5(2):52-54.
[5] 3GPP2. Physical layer standard for CDMA2000 spread spec-trum systems. Release C,
C.S0002- C, Version 1.0, May28, 2002.
[6] Robertson P, Villebrun, Hoeher P. A comparison of optimal and sub- optimal MAP decoding
algorithms operating in thelog domain [A].Proc IEEE Int Conf on Commun [C].1995:
1009~1013.
[7] Youssouf Ould-Cheikh-Mouhamedou, Enhanced Max-Log-APP and enhanced Log-APP
decoding for DVD-RCS, in Proc, Int Symp., Sept. 2003, pp. 259-262.
519
Research on the Prevent and Control Mechanism of Risk Diffusion in

Supply Chain Finance Based on the Perspective of the Bank
Pinfei LIa,*, Xuejian Chub
School of Management, Shanghai University, Shanghai, China
a
1528039941@qq.com, bchuxj@shu.edu.cn
Keywords: Supply chain finance; Risk diffusion; Prevent and control mechanism
Abstract. With the development of supply chain finance (SCF), the study of risk diffusion has
attracted more and more attention in SCF. In this paper, we consider the mechanism of risk
diffusion of the SCF, which includes the element, the cause and the path in the risk diffusion.
Example for the bank, we creatively propose the prevention and control mechanism to avoid the
risk diffusion and provide guidance for it, in which the platform index system, credit collecting
system, database system, information sharing and risk warning system are fully considered.

a, *, b,

a
1528039941@qq.com, bchuxj@shu.edu.cn
2020
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
520
14.98
2
Abhijeet Ghadge[1]
Zhang Cheng[2]
Zhu You [3]

Chih-Yang Tsai[4]
Gonsalvez DJA [5]

[6]Logistic
[7]
[8]
[9]
[10]
[11]
15BP
[12]
[13]
3
3.1

521

3.2

3.2.1

3.2.2

522

3.2.3

3.3

[14]
[15]
[16]
4
4.1

4.2
523

4.3

4.4

4.5

References
[1] Abhijeet Ghadge, Samir Dani, Michael Chester and Roy Kalawsky, A systems approach for
modeling supply chain risks, Supply Chain Managementan International Journal, vol.18, pp.
523538, 2013.
[2] Zhang. C, Small and medium-sized enterprises closed-loop supply chain finance risk based on
evolutionary game theory and system dynamics, Journal of Shanghai Jiaotong University
(Science), vol.21, pp. 355-364, 2016.
524
[3] Zhu. Y , Xie. C, Sun. B, Wang. GJ and Yan. XG , Predicting china's SME credit risk in supply
chain financing by logistic regression, artificial neural network and hybird models,
Sustainability, vol.8 , 2016.
[4] Chih-Yang Tsai, On delineating supply chain cash flow under collection risk, International
Journal of Production Economics, vol. 129, pp. 186-194, 2011.
[5] Gonsalvez. DJA and Inman. RR, Supply chain shared risk self-financing for incremental sales,
Engineering Economist, vol. 61, pp. 23-43, 2016.
[6] Liu. YL and Gao. SL, The credit risk identification of small business in supply chain finance-
Based on the empirical study of credit data in Beijing, New Finance, vol. 01, pp. 45-49, 2013.
[7] Xiong. X, Ma. J, Zhao. WJ, Wang. XY and Zhang. J, Credit risk analysis of supply chain
finance, Nankai Business Review, vol. 12, pp. 92-98, 2009.
[8] Chen. CB and Sheng. X, Study on the construction of credit risk evaluation system in supply
chain finance, Journal of Fujian Normal University, vol. 02, pp. 79-86, 2013.
[9] Li. YX, Risk assessment of supply chain finance, Journal of Central University of Finance &
Economics, vol. 10, pp. 36-41, 2011.
[10] Hu. HQ, Zhang. L and Zhang. DH, Research on SMEs credit risk assessment from the
perspective of supply chain finance-A comparative study on the SVM model and BP model,
Management Review, vol. 24, pp. 70-80, 2012.
[11] Bai. SZ and LI. S, Research on the supply chain finance risk assessment based on the BP neural
network, Commercial Research, vol. 01, pp. 27-31, 2013.
[12] Yang. YZ, The risk prevention in financial supply chain of commercial banks, Finance Forum,
vol. 10, pp. 42-45, 2007.
[13] Ke. D, Zhang. Q, Zhang. ZX and Zhang. H, Analysis on finance model and risk control for
supply chain, Journal of Minzu University of China, vol. 01, pp. 36-43, 2013.
[14] Chen. L, Diffusion mechanism and application research on financial risk, Wuhan University of
Technology, vol. 01, pp. 17-22, 2009.
[15] Zheng. HM, Formation and diffusion mechanism of private enterprises financial risk, Zhejiang
University, vol. 01, pp. 77-79, 2014.
[16] Qiu. YG, Research on the supply chain risk transmission and control, Wuhan University of
Technology, vol. 01, pp. 84-96, 2010.
525
The Development of Sports for the Disabled from the

The Thirteenth Five-Year Plan
Yucong Dai, Ting Cao
College of P.E, Jiangxi Normal University, Nanchang, Jiangxi, China
Keywords: The thirteenth Five-Year Plan; Sports for the disabled; Development
Abstract. Over the past five years, the development of sports for the disabled has completed the
national targets, in the new round of five-year plan, the new planning program for the development
of sports for the disabled will have any effect. In this paper, using the methods of literature review
and inductive analysis, combined with the "The thirteenth Five-Year Plan" and the supporting
implementation plan promulgated this year, the trend and prospect of the sports development of the
disabled people in the next five years will be discussed. The research shows that the sports of the
disabled in the next five years will have in-depth development in the sports culture and industry of
the disabled, the integration of the disabled, the human resources and the professional culture level
as well as the management institution. The prospect of the future five years will be combined with
the present development situation.

330022
1.
2016 9 19
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016

526

[1]

8502 6.21% 2015

9055 80.6
3591 42148
126 1.5
225
[2]
2.

527
3.

,
[3]
,
2011 6
:,
[4]
80
2008
:
[5]
:
[6]

4.

21
528

5.

[7]
34 2019
6
4 2
6.

529

References
[1]CDPF, General Administration of Sport, MCPRC, The Implementation Plan of Cultural and
Sports Work for the Disabled in the Thirteen Five-year Plan[EB/OL],
http://www.cdpf.org.cn/hcxm /whty/201611/t20161101_572173.shtml, 2016-10-27.
[2]CDPF, Statistical Communique on the Development of the Work on Persons with Disabilities in
2015 [EB/OL], http://www.cdpf.org.cn/zcwj/zxwj/201604/t20160401_548009.shtml,2016-04-01.
[3]WU Yan-dan,HUANG Han-sheng, Influences of Beijing para-Olympics on Chinese sports for
disabled[J], Journal of Wuhan Institute of Physical Education, vol.41(7), pp.31-34,2007.
[4]XU Wu-fu, Fusion Sports: the appeal of the handicapped sports education[J], Contemporary
Sports Technology, vol.35,pp.177-178,2015.
[5](China) the NPC Standing Committee, DECREE BY THE PRESIDENT OF THE PEOPLE'S
REPUBLIC OF CHINA(Revised Edition) [M],Law Press2008.
[6]CAO Ting ,ZHANG Fan ,Xiao SI Jia ,et al, Opportunity and Challenge of Sports for Disablunder
Background of Chinas Being Strong in Sports[J], Journal of Wuhan Institute of Physic al
Education,vol.49(9),pp.20-25,2015.
530
The Analysis on the Competitiveness of Star-rated Tourist Hotel Industry

in Jilin Province Based on Principal Component Analysis
Guoxia Sun
Tourism school, Changchun University, Changchun, Jilin, China
Keywords: Star-rated tourist hotel; Principal component analysis (PCA); Competitiveness; Analysis
Abstract. With the rapid development of tourism, as one of its important pillar industries, hotel
industry has been developing rapidly, and the star-rated tourist hotel industry has been springing up,
the competitiveness of provincial star-rated tourist hotel industry has gradually become the focus of
attention. In this paper, using the method of principal component analysis (PCA), to structure the
competitiveness evaluation system of star-rated tourist hotel industry, to make quantitative analysis
on the competitive situation of star-rated tourist hotel industry in Jilin province.

,,
1.

2.
()x1
x2 x3 x4 x5 x6
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
531
x7 x8 /x9
/x10 % 10 [2]
3.
3.1
2014 SPSS14.0 31 ()
10 , 1
SPSS14.0 1
1
x1 x2 x3 x4 x5 x6 x7 x8 x9 x10
x1 1.000 0.937 0.947 0.937 0.766 0.793 0.807 -0.055 0.137 0.384
x2 0.937 1.000 0.997 0.985 0.914 0.941 0.949 0.092 0.401 0.371
x3 0.947 0.997 1.000 0.981 0.909 0.925 0.934 0.076 0.363 0.378
x4 0.937 0.985 0.981 1.000 0.903 0.933 0.938 0.064 0.366 0.388
x5 0.766 0.914 0.909 0.903 1.000 0.975 0.964 0.219 0.610 0.317
x6 0.793 0.941 0.925 0.933 0.975 1.000 0.991 0.225 0.640 0.348
x7 0.807 0.949 0.934 0.938 0.964 0.991 1.000 0.213 0.618 0.336
x8 -0.055 0.092 0.076 0.064 0.219 0.225 0.213 1.000 0.570 0.478
x9 0.137 0.401 0.363 0.366 0.610 0.640 0.618 0.570 1.000 0.241
x10 0.384 0.371 0.378 0.388 0.317 0.348 0.336 0.478 0.241 1.000
3.2
SPSS14.0
24110
3
2
% %
1 7.004 70.037 70.037
2 1.647 16.471 86.508
3 0.920 9.198 95.706
4 0.275 2.747 98.453
5 0.082 0.821 99.274
6 0.034 0.340 99.614
7 0.019 0.191 99.805
8 0.013 0.125 99.930
9 0.006 0.061 99.991
10 0.001 0.009 100.000
3
% %
1 7.004 70.037 70.037

2 1.647 16.471 86.508
3.3
SPSS14.0 4
532
4

Z1 Z2
x1 0.880 -0.356
x2 0.980 -0.169
x3 0.972 -0.194
x4 0.971 -0.192
x5 0.958 0.038
x6 0.980 0.048
x7 0.980 0.024
x8 0.223 0.895
x9 0.545 0.656
x10 0.443 0.426
Z1 70.037%
0.980 0.972
0.971 0.958
Z2 Z1 16.471%
0.895
3.4
4
[3]
z 0.332514 x 0.370299 x 0.367277 x 0.366899x 0.361987 x

1 1 2 3 4 5
0.370299 x 0.370299 x 0.084262 x 0.205932x 0.16739 x
6 7 8 9 10

z 0.2774 x 0.13169 x 0.15117 x 0.14961x 0.02961x
2 1 2 3 4 5
0.037402 x 0.018701x 0.697391x 0.5116x 0.331942x
6 7 8 9 10
3.5

1 2
Z z1 z2 2.647 z1 1.882 z2
1 2 1 2
0.358059 x1 0.732329 x2 0.687663 x3 0.689596 x4 1.013909 x5 1.050579 x6
1.015381x7 1.535637 x8 1.507182 x9 1.067848 x10

5 5
533
5 31 ()
Z1 Z2 Z
6.560514 2 0.050581 10 0.370896 4
-2.52841 29 0.151969 5 -0.00939 11
-0.20775 12 -0.23455 27 -0.29025 31
-1.26532 21 -0.02655 16 -0.14889 24
-1.94107 25 -0.03884 20 -0.15578 25
0.233448 11 -0.0774 23 -0.07873 17
-2.4171 27 0.028033 12 -0.1204 20
-2.24826 26 0.061117 9 -0.04816 14
2.485945 6 0.600056 1 0.843375 1
3.64105 4 -0.24435 28 -0.05031 15
4.982492 3 -0.38492 29 -0.13479 22
-0.65496 14 -0.04341 21 -0.07176 16
0.767865 9 -0.01021 14 0.025856 7
-1.16677 20 -0.0311 17 -0.09225 18
3.19353 5 -0.4134 30 -0.25214 30
-0.85688 18 -0.08809 25 -0.15995 27
-0.71664 15 0.007752 13 -0.02317 12
0.437287 10 0.211496 4 0.263811 5
6.881414 1 -0.52613 31 -0.2006 29
-0.72216 16 -0.07794 24 -0.12218 21
-0.98944 19 0.51575 2 0.580206 2
-1.36398 22 0.131194 7 0.049465 6
0.800663 8 -0.03116 18 0.019906 8
-1.72779 23 0.091166 8 0.004156 9
0.893402 7 -0.17941 26 -0.15872 26
-2.44518 28 0.478382 3 0.434474 3
-0.79396 17 -0.04789 22 -0.10739 19
-1.78367 24 -0.03655 19 -0.13816 23
-3.09487 30 0.146377 6 -0.0026 10
-3.3386 31 0.040234 11 -0.17876 28
-0.61479 13 -0.02218 15 -0.04775 13
4.
3 70.037%
Z1
5
-2.4171 27 5
6.881414 9 11 26 0.233448-2.24826
2.6 0.17
[4]
3 16.471%
Z2
5 0.028033 12
534
0.600056 0.6 9 0.061117 0.033
23 -0.0774 0.1
3
-0.1204, 20 0.843375 1 17
-0.07873 0.4 14 -0.04816 0.07
References
[1]Zhu Ying-gaoZhou yangZhu ZHi-weiA Study on the Competitiveness Evaluation of
Provincial Hotel Industry in ChinaSocial Scientistvol.2pp.91-95, 2009.
[2]Tian Tian-muStudy on Core ComPetitiveness in the Hotel Field In Our CountryHunan
Agricultural Universitypp.8-20, 2005.
[3]Cang Ying-meiA Study on the Competitiveness of Tourist Hotel Industry in ChinaNanjing
University Of Science And Technologypp. 40-41, 2005.
[4]Zhang Yan-chunAnalysis on Competitiveness of Hotel Industry in Shandong Province
Industrial & Science Tribunevol.8pp.90-94, 2009.
535
The Research on the Visual Measurement of Ancient Building

Appearance Size
Bo Hu, Zhaomin Ma
College of Electric and Information Engineering, Guangxi University of Science and Technology,
Liuzhou, Guangxi, China
443722152@qq.com
Keywords: Ancient building; Appearance size; Visual measurement
Abstract. The appearance size is an important parameter of ancient building, especially in the
renovation of the ancient building. It is hard to measure the appearance size of ancient building
because of the position and surrounding. The visual measurement is an effective method for ancient
building appearance size. After the step of the visual measurement method, several noticeable
points for the method are proposed. It should be helpful for the measurement of ancient building
appearance size.

,

443722152@qq.com
[1][2][3]

978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016

536

3

1

537

References
[1] Wang Mo, Three-D Laser Scanning Technology Applied in Measuring The Historical
Architectures of The Palace Museum, Palace Museum Journal, (6), pp. 143-156, 2011.
[2] Li Yueqing, Fan Jinsong, Construction of Foshan Digital Zumial Based on Virtual Reality
Technology, Journal of south China normal university(natural science edition), vol.45(3), pp.
106-109, 2013.
[3] Zhou Jiawei, Li Xin, Hu Zhentian, Huang Daoyuan, Digital Reconstruction of Pi Li Tower
Using Close-range Photogrammetry, Surveying and Mapping, vol.36(6), pp. 256-257, 270,
2013.
538
Analysis and Policy Suggestion on the Minimum Wage Law

Jin Zhang*, Shicheng Hu
Haerbin Institute Technology, Haerbin City, Heilongjiang Province, China
Keywords: Minimum wage; Labor market; Limitation; Progress
Abstract. Although the role of the minimum wage policy has been debated by economists, the
policy has been implemented in the West for 200 years. China's provinces and municipalities have
started to implement the minimum wage system for 10 years, but China's minimum wage policy
advocacy efforts and supervision are not enough. From the angle of economics, why the policy is
used by governments and why to protect workers' rights in the law of the real economy is limited
are analyzed considering the influence of "minimum wage protection law" on the employment
system. Through the analysis of different labor market, this paper puts forward the method of
determining the minimum wage in our country and the problems that should be paid attention to.
. 200
10
, ,
,
1.
1.1
200
1993 2004
2004
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016

539

35% 20%
40%
2008
4500
2000 800
960 480 580
1.2

20
(
)
2.
2.1
1978
2004 0.45 0.469
?
(2008)
540
1
1 OLBFE
AEC
Ow*ON*
N*LSOBFECLO
SOw* HECLOSBw* HEBw
ON1N1LSOBFDECLD
SOwFDECLOSBwFB
SFDEFSw*wFEHw*
SwFHw*-SHDE
SwFHw*-SHDE 0
2 1993
(2009) 1987 87% 2006 40%(

2 )
541

2.2

2.2.1
1 3 WQ
WmWoQo
WmQdQoQd
MRP
WmQoQw
abac
dac
2
43% 1991
4 88%
4 12
wo
542
1Q02Q0Q0-Q11
WmQ0 Q1
1Q0-Q12
22
SS12QnQn-Q0
W0 WnW0Wn
1Q1abQ02Q0cd
Qnabcd

2.2.2

5
MEAE
AEMEAEW0
W1Q0 Q1
543
5
MRP=MEQ0
MRPMEAEQ0W0
W1
Q1 Q0Q1
MRPME
5
W0
W1
W2 W2 ab
3.
3.1
2
15-19
3.2

544

References
[1] Mark D.Partridge, and Jamie S. Partridge. Are teen unemploymnets rates influenced by state
minimum wage laws? Growth and Change, Vol, 29(Fall 1998),pp.359-382.
[2] John Mangan, and John Johnston. Minimum wages, training wages and youth employment,
Training wages and youth employment,pp415-429,1999.
[3]R.A.Lotriet. The fairness of minimum wages in South Africa, International Journal of Social
Economics,26,7/8/9,pp900-913,1999.
[4] Yang Du,Fang Cai,and Meiyan Wang.Marketization and/or Informalization-New Trend of
Chinas Employment inTransition. Report for World Bank . 2006.
[5] Wang,Feng,Xuejin Zou."Historys Lar-gest Labor Flow:Understanding Chinas Rural Migration
in-side ChinasCities:Institution Barriers and Opportunities for Urban Migration". AEA Papers
and Proceedings . 1999.
[6]Luo,Changyuan,Zhang,Jun."Market Distor-tion,Fiscal Decentralization and FDI Penetration in
Post-Reform China:An Overview". Economic Transition with Chinese Characteristics:Thirty
Years of Reform and Opening-up . 2008.
545
The Research of Yuan Dynasty Glazed Chiwen

Wei Liu, Ke Wu, Youran Li
Shenyang Aerospace University, Shenyang, Liaoning, China
Keywords: Yuan Dynasty; Glazed Chiwen; Decorative components; Right symbol
Abstract. The Yuan Dynasty architecture is in the important stage of the transition to the Ming
Dynasty. Although the Yuan Dynasty was not long, it was an important epoch in the history of
China. Chiwen in each era has its unique meaning and symbol. Qin and Han Dynasties, the temples
and other buildings in the palace there will be a prototype of Chiwen. Since then the concept of
people and the continuous evolution of technology. To rise again in the Yuan Dynasty, and gradually
popularized in the civil. Yuan dynasty glazed chiwen in the shape, color and size are more rich than
the previous spectacular. Chiwen the shape of the basic body to determine the fish for the back of
the Ming and Qing dynasties Chiwen on behalf of the imperial level played a role in bedding. In the
process of evolution, the combination of glass chiwen and the political, cultural, and other factors of
the era shows the decorative art style with the features of this era, as well as the cultural background
and decoration of the glass chiwen Beauty.

110136
1.

978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016

546

2.
2.1.
,,,
,,
,,,,
,,
,,,,,
:,,
,,,
,,
,,;
,,,
2.2.
1:
187 124 475
700
547
2.3.
2.3.1
2
: 2-1 2-2 2-3

2-1
2-2
2-3
548
3
2.3.2.

3.

4.

References
[1]Chen Gaohua and Shi Weimin, General History of Chinese Customs, Shanghai Literature and Art
Publishing House, 2006.
[2]Tao Zongyi, Twenty-one House Network System of Nancun Countless Farmers, Beijing:
Zhonghua Book Company, 1959.
[3]Qiying Tao. Protection and Maintenance of Ancient Chinese Architecture.Beijing: Beijing
Cultural Relic Publishing House, 1986.
[4]Cai Dongfan. Yuan Dynasty History .Beijing United Publishing Company, 2014.
[5]Wu Qingzhou. Chinese ancient architectural ridge ornaments cultural origin.
[6]CaiZeJun.ShanXis glazed Beijing: Beijing Cultural Relic Publishing House, 1992.
549
Current Situation Analysis on Choice Preference of Dividend Policy

Payment Based on Banking Listed Companies in China
Bing Baia, Xiao Lib, Zhiqiong Guoc,*
Business School, Jiangsu Normal University, Xuzhou, Jiangsu, China
a
szzxbb@126.com, b541716250@qq.com, cjoan_monday@163.com
Keywords: Banking listed companies; Dividend policy; Payment; Choice preference.
Abstract. Dividend policy payment, as an important financial decision of modern companies,

directly affects the company's operating results and operating performance. The objective of this
study was to analyze the current situation on choice preference of dividend policy payment based
on banking listed companies in China. According to the empirical data of 16 banking listed
companies in China, this paper studied the choice preference of dividend policy payment. Results
show that dividend policy payment of banking listed companies in China gradually evolves from
cash dividend only to mix dividend policy. The findings of this study can help the practitioners to
better understand the choice preference of dividend policy payment of banking listed companies in
China and then adopt corresponding strategies.

a, b, c,*

a
szzxbb@126.com, b 541716250@qq.com, c joan_monday@163.com
*

: ; ; ;
16
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016

550
1

551
2

4.
4.1
20153948
2811991
16
2013
4.2
2080
1997
42.69%20122014
35%
20122014161
1 2012-201416

2012 2013 2014
15 12 13

1 3 3
1
16 16 16
2 2012-2014
2012 2013 2014

CA CA+SD CA+SD
CA CA CA
CA CA CA
552
2012 2013 2014
CA CA+SD CA
CA/CA CA/CA CA+SD/CA
CA CA+RO CA
CA CA CA
CA CA+SD CA
CA+SD CA CA+SD
CA CA CA
CA CA CA
CA CA CA
CA CA CA
CA CA CA
CA CA CA
CA CA CA

CASDRO
12201216
1593.75%
2013
75%2
20138232014
318.75%
5
16
References
[1] Deangelo, H., Deangelo, L., & Stulz, R. M. Dividend policy and the earned/contributed capital
mix: a test of the life-cycle theory. Social Science Electronic Publishing, 81(2), 227-254, 2005.
[2] Denis, D. J., & Osobov, I. Why do firms pay dividends? International evidence on the
determinants of dividend policy. Journal of Financial Economics, 89(1), 62-82, 2008.
553
[3] Naceur, S. B., Goaied, M., & Belanes, A. On the determinants and dynamics of dividend policy.
International Review of Finance, 6(1-2), 123, 2006.
[4] Chan, R. S. Y., Song, Byron Y., & Fan, L. Dividend policy and investment efficiency -- the
changes of the mandatory dividends payment. Social Science Electronic Publishing. 2016.
[5] Zhong, Y. Analysis of Dividend Policy Influence Factors of Chinas Listed Banks. Open
Journal of Social Sciences, 4(03), 272, 2016.
[6] Zhan, X. Whether Cash Dividend Policy of Chinese Listed Companies Caters to Investors
Preference. Journal of Financial Risk Management, 5(03), 161, 2016.
554
Research into Fujians Marine Silk Road Ethos Construction with a

5W1H Model
Chengxiong Chen*
School of Foreign Languages, Quanzhou Normal University, Donghai Street, Fengze District,
Quanzhou City, Fujian Province, China
a
markchenxiong@163.com
*Corresponding Author
Keywords: Marine Silk Road; Communication; Ethos; Fujian; Credibility; Discourse effects
Abstract. The construction of New Century Marine Silk Road requires supports of international
communication, where Credibility makes one key factor. This study, directed at the international
communication of Fujians Marine Silk Road construction, and based on the 5W model of Harold
Lasswell as well as a summary of the ethos theories of such figures as Aristotle, Cicero, Campbell,
Perelman, Heidegger, Burke, proposes a model of 5W1H and suggests building up ethos by means
of a meticulous investigation and classification of audience, a careful choice of speaker, media,
topos, styles to achieve deserved communication effects.
5W1H
*

a
markchenxiong@163.com
*
5W
1)2
3
4
5
1.
2013
978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016
555

2.

Corax
Tisias
[1, 2]Lysias
(thopoiea)[3]
[4]

Corts
[4]
[5]
[6]
[7]
[8]
556

[9]
[10]

[11, 12]
[11]
//
[13]
ethosEthos
dwelling place[14]
[15]
[16]

(who)( what ) (whom) ( what channel)
( what effect)[17]
how

5W1H5W1H
3.
5W5W1H
5W1H
5W1H
557

Whom5W1H
[18]
[19]
[20]
558

koucalloutside
5
What
How
[7]
[12]

[16]
559

Who
logo
What Channel
+
V
What effect
4.
21
560

FJ2015C190
JAS1504552015SK26

2016YYSK11
References
[1] W. M. Sattler, "Conceptions of ethos in ancient rhetoric," Speech Monographs, vol. 14, pp.
55-65, 1947/01/01 1947.
[2] T. S. Frobish, "An Origin of a Theory: A Comparison of Ethos in the Homeric Iliad with that
Found in Aristotle's Rhetoric," Rhetoric Review, vol. 22, pp. 16-30, 2003.
[3] T. O. Sloane, Encyclopedia of Rhetoric: Oxford University Press, 2001.
[4] T. E. Corts, "The derivation of ethos," Speech Monographs, vol. 35, pp. 201-202, 1968.
[5] C. Chengxiong, "A Contextual Interpretation Into Aristotle's Ethos," Journal of Harbin
University, vol. 32, pp. 103-106, 2011.
[6] Aristotle and G. Kennedy, On rhetoric. Oxford: Oxford University Press, 1991.
[7] Cicro, De Oratore: Books I, II vol. 1. London: William Heinemann, 1942.
[8] C. Chengxiong, "An Interpretation into Cicero's Ethos," Journal of Changchun Normal
University(Humanities and Social Sciences), vol. 30, pp. 124-126, 2011.
[9] A. Hippo, F. Sheed, and C. W. Publishing, The Confessions of Saint Augustine: Catholic Way
Publishing, 2014.
[10] J. A. Herrick, The history and theory of rhetoric: an introduction, 5th ed. Boston: Pearson
Education, Inc., 2013.
[11] L. Yameng, In Pursuit of Symbolic Power. Beijing: SDX Joint Publishing Company, 2004.
[12] G. Campbell, The Philosophy of Rhetoric. Carbondale: Southern Illinois University Press,
1988.
[13] M. Weber, The Theory Of Social And Economic Organization: Free Press, 2009.
[14] M. Heidegger, J. Stambaugh, and D. J. Schmidt, Being and time: SUNY Press, 2010.
[15] W. McNeill, Time of Life, The: Heidegger and Ethos. New York: State University of New York
Press, 2006.
[16] K. Burke, A rhetoric of motives vol. 111: Univ of California Press, 1969.
[17] H. Lasswell, "The Structure and Function of Communication in Society," in The
Communication of Ideas, L. Bryson, Ed., ed New York: Institutes for Religious and Social
Studies, 1948.
[18] L. Mingtai and H. Chaohui, "Dissemination and Development of Mazu Culture in the Countries
along the Maritime Silk Road," Journal of Jimei University(Philosophy and Social Sciences),
vol. 18, pp. 1-6, 2015.
[19] X. Qingguo, ""The Belt and Road" Initiative and Its Promotion in the Arab World: Public
Reactions, Promotion Practice and Suggestions," West Asia and Africa, pp. 36-52, 2015.
561
[20] C. Perelman and L. Olbrechts-Tyteca, The new rhetoric: A treatise on argumentation. Notre
Dame: University of Notre Dame Press, 1969.
562

AuthorIndex
A Honglei Wang 494

Adela-Eliza Dumitrascu 255 Hongping Chen 435
Ang Li 192 Huafeng Chen 217
Huarui Sun 185
B
Bailing Zhou 13, 247 J
Benzheng Xiao 94 Jiahui Zou 390
Bin Yang 270 Jiali Li 42
Bing Bai 550 Jian Du 314
Bing Liu 121 Jiang Liu 228
Bing Yang 131 Jiang Zhuo 378
Bo Hu 405, 536 Jianing Niu 408, 414
Boliang Yi 3 Jianining Mi 179
Jianqun An 125, 313
C
Jie Tang 228
Caixia Liu 270
Jikun Qian 441
Can Geng 243
Jin Zhang 539
Chengxiong Chen 555
Jing Chen 213
Chengyan Zhang 348
Jing Tian 273
Chenlu Li 161
Jing Xia 314
Chunlian Zhang 469
Jing Zhong 374
Chunming Li 62
Jinshi Yang 514
Chunnian Wei 161
Jixing Li 104
Chunrong Peng 393
Ju Su 282
D Jun Wang 314
Dan Lu 27 Juncheng Zhu 110
Dinghua Zhang 42 Junqiang Liu 204, 208
Dinghuihong Liu 370
K
Dong Wang 228, 364
Kai Wang 23
Donghua Liu 247
Ke Wu 546
Dorin-Ion Dumitrascu 255
L
E
Lei Guo 104
Entian Qie 13, 247
Lei Shi 125
F Lei Zhang 89, 94, 99
Fan Wang 121 Li Tang 424
Fan Xiao 508 Li Zhang 320
Fang Lu 397 Lili Zhao 508, 514
Fangzhong Shi 175 Lin Li 27, 84, 94, 89, 99
Feng Wang 459 Linan Sun 352
Fengling Wang 352 Linlong Zhao 479
Liquan Han 298
G
Lixin Dai 169, 335, 340
Gan He 264
Gengsheng Zhang 80 M
Guangfa Yang 364 Mei Ye 260, 348
Guorong Qian 441 Meixia Wang 232
Guosong He 110 Mengmeng Gao 84
Guoxia Sun 531 Mengmeng Qiang 18
Guoyu Xu 260, 348 Min Zhang 110
Guozheng Wen 243 Ming Li 502
Ming Sun 325
H
Ming Xu 260, 348
Haixia Lu 310
Mingshun Ai 514
Haixia Zheng 115
Mingxin Shi 32
Han Zhao 452
Mu Zhang 217
Hao Wang 239
Muhammad Ibrar 179
Hao Wu 329
Muhammad Rafiq 179
Hongchao Ning 175
563

AuthorIndex
N Xiangjun Xu 344
Na Liu 277 Xianglei Meng 508
Na Wang 141 Xiangsheng Rong 348
Ningyi Cao 469 Xianying Zhou 68, 74
Xiao Li 550
P
Xiaodan Li 335
Peihong Chen 32
Xiaodong Liu 147
Peng Chen 514
Xiaodong Zhu 374
Pengpeng Yu 508, 514
Xiaohong Wei 36
Pinfei Li 520
Xiaohu Wang 298
Q Xiaomei Li 304
Qian Dai 475 Xin Deng7
Qibin He 286, 292 Xingyong Luo 260
Qiong Zhang 459 Xinyue Kong486
Xiujuan Li 344
R
Xu Fan 36
Rong Cheng 469
Xuan Chen 370
Ruifen Zhao 169
Xuejian Chu 520
S
Y
Sanrong Liu 270
YanKe Zhao 499
Senlin Zhu 228
Yao Liu 204, 208
Shan Li 352
Yao Xiao 13
Shaoqiang Mo 381
Yi An 156
Shicheng Hu 539
Yi Zhang 429
Shihua Tong 381, 386
Ying Chen 169
Shuliang Liu 192
Yong Li 298
Shuyan Guan 36
Yong Yu 429
T Yongfeng Zhao 125
Tao Shi 314 Yongmei Zhu 446
Tao Tang 508 Yongsheng Sun 390
Tiejun Wang 137 YouRan Li 546
Ting Cao 393, 526 Yu Han 435
Yuanyuan Wang 260
W
Yucong Dai 526
Wanxin Sun 99
Yunru Kong42
Wei Liu 546
Weijia Sun 298 Z
Weiliu Yang 151 Zehong Li 185
Weiwei Xiong 420 Zhaomin Ma 405, 536
Weixia Yang 198 Zhen Zhu364
Wenbiao Ma 251 Zhenghong Li 89, 94, 99
Wenpei Chen 49, 53, 57 Zhenhong Li 84
Wenxian Tang 446 Zhenyu Chen358
Wenxin Deng 397 Zhikang Qiu 239
Zhimin Zhang 446
X
Zhiqiong Guo 550
Xia Yang 23
Zhong Lin 452
Xianghong Tian 489
Zhongmin Ma 222
564

China Pakistan Economic Corridor Socio-Cultural Cooperation and Its Impact PDF

Загружено:

Сведения о документе

Оригинальное название

Авторское право

Доступные форматы

Поделиться этим документом

Поделиться или встроить документ

Параметры публикации

Этот документ был вам полезен?

Это неприемлемый материал?

Авторское право:

Доступные форматы

China Pakistan Economic Corridor Socio-Cultural Cooperation and Its Impact PDF

Загружено:

Авторское право:

Доступные форматы

Education Science and Social Science

2016 5th EEM International Conference on Education Science

December 24-25, 2016, Sydney, Australia

Sponsored by Information Engineering Research Institute, USA

Technical co-sponsored by City University of Hong Kong, Hong Kong

IERI & PRESS, USA

Distributed worldwide by Information Engineering Research Institute Canada Office

EEM-ESSS 2016 is co-sponsored by Information Engineering Research Institute, USA and

IERI International Committee

Chapter 2: Literature, Art and Cultural Studies

Chapter 4: Education Science, Teaching, and Linguistics

Chapter 5: Social Science

Effect of Tea Polyphenols on Anti Fatigue after Sports

Keywords: Tea Polyphenols; Sports; Anti fatigue; Effectiveness

2. An overview of the antioxidant activities of tea polyphenols

3. The principle of fatigue after physical exercise

4. The effect of tea polyphenols on anti fatigue after sports

Reasons of Affecting the Accurate Value of Spot Judgment of

Keywords: Basketball referee; Spot judgment; Accurate value

2. Research objects and methods

978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016

3. Results and analysis

4. Conclusion and suggestions

Research on Integrated Development of the University Campus in Urban

Bailing Zhoua,*, Entian Qieb, Yao Xiaoc

Keywords: Integrated development; University campus in Urban Fringe; Pension community

Keywords: SM22; SRF; CArG box; Vascular smooth muscle

2. Experiment material and method

Fig. 1.Electrophoresis of constructed Fig. 2.Electrophoresis of PCR

Fig. 3.Sequence comparison of SM22 and SM22 Mutation

Fig. 4. The effect of Myocardin, SM22 and SM22mutation on Luciferase Assay

The Change and Development of Cloud Computing Data Center Network

Keywords: Cloud; Data center; Network; Virtualization

2. The application of 10G Ethernet

4. Data center network transmission protocol

6. Network virtualization of data centers

7. Cloud computing data center network energy saving

8. The trend and Prospect

A Case Study on Qiqiao in"The Golden Cangue" from the Perspective of

Keywords: Marxist feminism; Gender alienation theory; The golden cangue

2. The origin of gender alienation theory of Marxist feminism

4. The inspiration to solve the dilemma of contemporary women

2. The present situation of parking in Beijing

978-1-61275-502-1/10/$25.00 2016 IERI EEM-ESSS 2016

3. The analysis of the reasons for parking problems in Beijing

4. The solutions of the parking problem in Beijing

The Principal Risks of Public Technician Colleges in Guangzhou

Keywords: Public technician college; Risk classification; Principal risk

1. Questions and literature review

2. Empirical study design and basic situation description

3. The risk analysis of public technician colleges

3.2 The results of risk classification of questionnaires

Fig. 1. The risk distribution of A technician college and B technician college.

Mental health risk -- -- 4

Fig. 2. Risk assessment structure model

Step 2: Establish comparison judgment matrix.

W1=0.06,0.07,0.13,0.12,0.20,0.42 T is calculated according to additivity method. Next,

Consistency ratio =0.037<0.1

Results calculated from the relevant formula:

4. Analysis of the results of interviews

A Study on the Elements and Aesthetic Value of Folk Songs of Yi People

Keywords: Yunnan; Yi people; Folk song of Yi people; Elements; Aesthetic value

2. Narrative folk songs recording life