Вы находитесь на странице: 1из 119

International Journal for Parasitology

Volume 35, Issue 6, Pages 583-701 (May 2005)

1. Editorial board Page co2

2. Biolistic transformation of Schistosoma mansoni with 5 ′ flanking regions of two peptidase genes
2. Biolistic transformation of Schistosoma mansoni with 5 ′ flanking regions of two peptidase genes
2.
2.
2. Biolistic transformation of Schistosoma mansoni with 5 ′ flanking regions of two peptidase genes promotes
2. Biolistic transformation of Schistosoma mansoni with 5 ′ flanking regions of two peptidase genes promotes
2. Biolistic transformation of Schistosoma mansoni with 5 ′ flanking regions of two peptidase genes promotes
2. Biolistic transformation of Schistosoma mansoni with 5 ′ flanking regions of two peptidase genes promotes
2. Biolistic transformation of Schistosoma mansoni with 5 ′ flanking regions of two peptidase genes promotes

Biolistic transformation of Schistosoma mansoni with 5flanking regions of two peptidase genes promotes tissue-specific expression Pages 583-589 Volker Wippersteg, Mohammed Sajid, Deirdre Walshe, Dustin Khiem, Jason P. Salter, James H. McKerrow, Christoph G. Grevelding and Conor R. Caffrey

Sajid, Deirdre Walshe, Dustin Khiem, Jason P. Salter, James H. McKerrow, Christoph G. Grevelding and Conor

3. Opisthorchis viverrini antigen induces the expression of Toll-like receptor 2 in macrophage RAW cell line Pages 591-596 Somchai Pinlaor, Saeko Tada-Oikawa, Yusuke Hiraku, Porntip Pinlaor, Ning Ma, Paiboon Sithithaworn and Shosuke Kawanishi

4.
4.

Insights into unique physiological features of neutral lipids in Apicomplexa:

from storage to potential mediation in parasite metabolic activities Pages 597-615 Isabelle Coppens and Ole Vielemeyer

 

5. Annexin-like alpha giardins: a new cytoskeletal gene family in Giardia lamblia Pages 617-626 Malin E.-L. Weiland, Andrew G. McArthur, Hilary G. Morrison, Mitchell L. Sogin and Staffan G. Svärd

6. Hsp90 is essential in the filarial nematode Brugia pahangi • Pages 627-636 Eileen Devaney,
6. Hsp90 is essential in the filarial nematode Brugia pahangi • Pages 627-636 Eileen Devaney,
6.
6.
6. Hsp90 is essential in the filarial nematode Brugia pahangi • Pages 627-636 Eileen Devaney, Kerry
6. Hsp90 is essential in the filarial nematode Brugia pahangi • Pages 627-636 Eileen Devaney, Kerry
6. Hsp90 is essential in the filarial nematode Brugia pahangi • Pages 627-636 Eileen Devaney, Kerry
6. Hsp90 is essential in the filarial nematode Brugia pahangi • Pages 627-636 Eileen Devaney, Kerry
6. Hsp90 is essential in the filarial nematode Brugia pahangi • Pages 627-636 Eileen Devaney, Kerry

Hsp90 is essential in the filarial nematode Brugia pahangi Pages 627-636 Eileen Devaney, Kerry O'Neill, William Harnett, Luke Whitesell and Jane H. Kinnaird

pahangi • Pages 627-636 Eileen Devaney, Kerry O'Neill, William Harnett, Luke Whitesell and Jane H. Kinnaird

7. Differential effects of polyamine derivative compounds against Leishmania infantum promastigotes and axenic amastigotes Pages 637-646 J. Tavares, A. Ouaissi, P.K.T. Lin, A. Tomás and A. Cordeiro-da-Silva

8. Patterns of host specificity and transmission among parasites of wild primates • Pages 647-657
8. Patterns of host specificity and transmission among parasites of wild primates • Pages 647-657
8.
8.
8. Patterns of host specificity and transmission among parasites of wild primates • Pages 647-657 Amy
8. Patterns of host specificity and transmission among parasites of wild primates • Pages 647-657 Amy
8. Patterns of host specificity and transmission among parasites of wild primates • Pages 647-657 Amy
8. Patterns of host specificity and transmission among parasites of wild primates • Pages 647-657 Amy
8. Patterns of host specificity and transmission among parasites of wild primates • Pages 647-657 Amy

Patterns of host specificity and transmission among parasites of wild primates Pages 647-657 Amy B. Pedersen, Sonia Altizer, Mary Poss, Andrew A. Cunningham and Charles L. Nunn

wild primates • Pages 647-657 Amy B. Pedersen, Sonia Altizer, Mary Poss, Andrew A. Cunningham and

9. Redescription of Besnoitia bennetti (Protozoa: Apicomplexa) from the donkey (Equus asinus) Pages 659-672 J.P. Dubey, C. Sreekumar, T. Donovan, M. Rozmanec, B.M. Rosenthal, M.C.B. Vianna, W.P. Davis and J.S. Belden

10. Clams ( Corbicula fluminea ) as bioindicators of fecal contamination with Cryptosporidium and Giardia
10. Clams ( Corbicula fluminea ) as bioindicators of fecal contamination with Cryptosporidium and Giardia
10.
10.
10. Clams ( Corbicula fluminea ) as bioindicators of fecal contamination with Cryptosporidium and Giardia spp.
10. Clams ( Corbicula fluminea ) as bioindicators of fecal contamination with Cryptosporidium and Giardia spp.
10. Clams ( Corbicula fluminea ) as bioindicators of fecal contamination with Cryptosporidium and Giardia spp.
10. Clams ( Corbicula fluminea ) as bioindicators of fecal contamination with Cryptosporidium and Giardia spp.
10. Clams ( Corbicula fluminea ) as bioindicators of fecal contamination with Cryptosporidium and Giardia spp.

Clams (Corbicula fluminea) as bioindicators of fecal contamination with Cryptosporidium and Giardia spp. in freshwater ecosystems in California Pages 673-684 Woutrina A. Miller, Edward R. Atwill, Ian A. Gardner, Melissa A. Miller, Heather M. Fritz, Ronald P. Hedrick, Ann C. Melli, Nicole M. Barnes and Patricia A. Conrad

Gardner, Melissa A. Miller, Heather M. Fritz, Ronald P. Hedrick, Ann C. Melli, Nicole M. Barnes

11. Developmental expression and molecular analysis of two Meloidogyne incognita pectate lyase genes Pages 685-692 Guozhong Huang, Ruihua Dong, Rex Allen, Eric L. Davis, Thomas J. Baum and Richard S. Hussey

12. Echinococcus shiquicus n. sp., a taeniid cestode from Tibetan fox and plateau pika in
12. Echinococcus shiquicus n. sp., a taeniid cestode from Tibetan fox and plateau pika in
12.
12.
12. Echinococcus shiquicus n. sp., a taeniid cestode from Tibetan fox and plateau pika in China
12. Echinococcus shiquicus n. sp., a taeniid cestode from Tibetan fox and plateau pika in China
12. Echinococcus shiquicus n. sp., a taeniid cestode from Tibetan fox and plateau pika in China
12. Echinococcus shiquicus n. sp., a taeniid cestode from Tibetan fox and plateau pika in China
12. Echinococcus shiquicus n. sp., a taeniid cestode from Tibetan fox and plateau pika in China

Echinococcus shiquicus n. sp., a taeniid cestode from Tibetan fox and plateau pika in China Pages 693-701 Ning Xiao, Jiamin Qiu, Minoru Nakao, Tiaoying Li, Wen Yang, Xingwang Chen, Peter M. Schantz, Philip S. Craig and Akira Ito

Xiao, Jiamin Qiu, Minoru Nakao, Tiaoying Li, Wen Yang, Xingwang Chen, Peter M. Schantz, Philip S.

Editor-in-Chief

Nicholas Sangster, Faculty of Veterinary Science, Building B14, University of Sydney, NSW 2006, Australia Fax: +61 (0) 2 9036 9485; E-mail: IJP@vetp.usyd.edu.au

Deputy Editor

John T. Ellis, Department of Cell and Molecular Biology, University of Technology, Sydney, NSW 2065, Australia

Editorial Assistant

Maria Meuleman, Faculty of Veterinary Science, Building B14, University of Sydney, NSW 2006, Australia Fax: +61 (0) 2 9036 9485; E-mail: IJP@vetp.usyd.edu.au

Specialist Editors

Peter F. Billingsley —University of Aberdeen, UK Paul J. Brindley—Tulane University Health Sciences Center, USA Graham H. Coombs—University of Glasgow, UK John P. Dalton —University of Technology, Sydney, Australia Jean E. Feagin—Seattle Biomedical Research Institute, USA Robin B. Gasser—University of Melbourne, Australia Timothy G. Geary—Pfizer Animal Health, USA Matthias Greiner—Danish Veterinary Institute, Denmark Emanuela Handman—Walter and Eliza Hall Institute of Medical Research, Australia Wayne R. Hein—AgResearch Limited, New Zealand Andrew Hemphill—University of Berne, Switzerland Nicholas H. Hunt—University of Sydney, Australia Al Ivens—Sanger Institute, UK Mark C. Jenkins—Agricultural Research Service, USDA, USA John T. Jones—Scottish Crop Research Institute, Scotland

James W. Kazura—Case Western Reserve University, USA Nirbhay Kumar—Johns Hopkins University, USA Armand M. Kuris—University of California, USA David S. Lindsay—Virginia Tech, USA

D. Timothy J. Littlewood—The Natural History

Museum, UK Aaron G. Maule—Queen’s University Belfast, UK David A. Morrison—National Veterinary Institute, Sweden

Yukifumi Nawa—University of Miyazaki, Japan Edoardo Pozio—Istituto Superiore di Sanità, Italy

R. Mark Sandeman—La Trobe University, Australia

Alan L. Scott—Johns Hopkins University, USA Arne Skorping—University of Bergen, Norway Dominique Soldati—University of Geneva, Switzerland Mary M. Stevenson—McGill University Health Centre Research Institute, Canada Louis M. Weiss—Albert Einstein College of Medicine,

USA

Copyright © 2005 Australian Society for Parasitology Inc.

International Journal for Parasitology 35 (2005) 583–589 www.parasitology-online.com Rapid communication Biolistic
International Journal for Parasitology 35 (2005) 583–589 www.parasitology-online.com Rapid communication Biolistic

International Journal for Parasitology 35 (2005) 583–589

International Journal for Parasitology 35 (2005) 583–589 www.parasitology-online.com Rapid communication Biolistic

Rapid communication

Biolistic transformation of Schistosoma mansoni with 5 0 flanking regions of two peptidase genes promotes tissue-specific expression *

Volker Wippersteg a , Mohammed Sajid b , Deirdre Walshe b , Dustin Khiem b , Jason P. Salter b , James H. McKerrow b , Christoph G. Grevelding a , Conor R. Caffrey b, *

a Insitute for Genetics, Heinrich-Heine-University, Universita¨tsstraße 1, D-40225 Du¨sseldorf, Germany b Sandler Center for Basic Research in Parasitic Diseases, Box 0511, University of California San Francisco, San Francisco, CA 94143, USA

Received 24 November 2004; received in revised form 10 February 2005; accepted 14 February 2005

Abstract

The gene-regulatory elements controlling peptidase expression in Schistosoma mansoni are unknown. A genomic DNA library was constructed from which 5 0 flanking fragments of the cathepsins F (SmCF; 649 bp) and B2 (SmCB2; 810 bp) peptidase genes were isolated. These were cloned into a GFP-expression vector for biolistic transformation of schistosomes. Both fragments promoted expression of GFP that was localised in the gut for SmCF and tegument for SmCB2, consistent with previous immunochemical data. Promoter-deletion of the SmCF gene indicated the importance of one or more transcription factor binding sites in the first 169 bp for both GFP-expression and its tissue specificity. q 2005 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

Keywords: Gene promoter; GFP; Peptidase; Schistosoma; Transcription factor

Adults of the digenean trematode Schistosoma mansoni express peptidases for their metabolic needs, including nutrition and reproduction. Alimentary digestion of the blood meal is facilitated by a number of gut-associated peptidases including the Clan CA cysteine peptidases (http://merops.sanger.ac.uk/for terminology) S. mansoni cathepsin B1 (SmCB1, aka Sm31) and SmCF (aka SmCL1, Caffrey et al., 2004 for a review). The potential of gut-associated peptidases as targets for diagnosis, vaccination and chemotherapy has spurred the molecular and biochemical characterisation of these molecules (Caffrey et al., 2004). In addition, cysteine peptidases have been localised in adult tissues other than the gut, such as SmCB2, which is found in the tegument (Caffrey et al.,

2002).

* Note: Nucleotide sequence data reported in this paper have been submitted to the GenBankTM, EMBL and DDBJ databases with the accession numbers AJ786389 and AJ786390 for the 5 0 -flanking gene regions of SmCF and SmCB2, respectively. * Corresponding author. Tel.: C1 415 502 6866; fax: C1 415 514 3165. E-mail address: caffrey@cgl.ucsf.edu (C.R. Caffrey).

The recent development of a reliable biolistic transform- ation system for adult S. mansoni (Wippersteg et al., 2002b) provides an opportunity to study more fundamental aspects of peptidase gene expression including the spatial and temporal regulation of expression conferred by cognate gene promoter elements. Thus, the tissue-specific expression of the endoplasmic recticular cysteine peptidase, ER60, has been demonstrated by placing the requisite 5 0 regulatory region into a plasmid construct upstream of the gene for green fluorescent protein (GFP; Wippersteg et al.,

2002a).

Using biolistic transfer, we wished to determine whether the 5 0 flanking region of S. mansoni peptidase genes could promote GFP expression and, if so, whether such expression is restricted in a tissue-specific manner. To accomplish this, we focused on the genes for SmCF and SmCB2 that are localised in the gut (Brady et al., 1999) and tegument (Caffrey et al., 2002), respectively. We isolated and sequenced 5 0 flanking region fragments of both peptidase genes and sub-cloned them into a plasmid construct containing the GFP reporter gene (Wippersteg et al., 2002b). Finally, we used promoter-deletion to identify

0020-7519/$30.00 q 2005 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

doi:10.1016/j.ijpara.2005.02.002

584

V. Wippersteg et al. / International Journal for Parasitology 35 (2005) 583–589

the sub-region within the SmCF flanking gene sequence that was required for GFP-expression. A Liberian strain of S. mansoni was maintained in the snail Biomphalaria glabrata and in Syrian golden hamsters (Mesocricetus auratus). Adult worms were obtained by perfusion 49 days after infection with 1500 cercariae and washed three times in M199 medium (Invitrogen) sup- plemented with 10% FCS, 1% HEPES (1 M, pH 7.4) and 1% ABAM (Antibiotics/Antimycotics; Sigma). The worms were then maintained at 37 8C and 5% CO 2 in the

and combined with the vector pCR 2.1-TOPO according to the manufacturer’s instructions (Invitrogen). Transform- ations of chemically competent One Shot TOP10 cells (Invitrogen) were performed according to the manufac- turer’s instructions. Colonies returned on Luria Broth (LB) agar plates under ampicillin selection were expanded in 3 ml LB-ampicillin broth. Plasmid DNA was isolated (QiaPrep spin Mini-Prep Kit; Qiagen) and bidirectional sequencing performed at the University of California San Francisco Biomolecular Resource Center using the M13

GCGATCCATGGTTTTATTACATAATAAACAATTA-

supplemented M199 medium (Wippersteg et al., 2003). To construct a genomic (g)DNA library, gDNA (10 mg) from adult mixed sex S. mansoni was purified (Qiagen DNeasy kit) and digested overnight at 37 8C with the following restriction endonucleases (Roche); BamH I, EcoR I, Hind III, Kpn I, Not I, Pst I, Sac I, Sal I, Spe I, Xba I, Xho I and Xma I. Reaction volumes for gDNA digests were 100 ml containing 10 U of each endonuclease. pBluescript II SK (K) (3 mg; Invitrogen) was similarly digested in a final volume of 30 ml with 3 U of each restriction enzyme. Digested genomic and vector DNA were pooled, purified using the QiaQuick gel extraction kit (Qiagen), and eluted in

reverse and M13 forward (K20) primers. To construct vectors for transformation, two recombinant pCR 2.1-TOPO clones, containing 810 and 649 bp upstream regions of the SmCB2 and SmCF genes, respectively, were used as templates for PCR. Reactions included 1 U Taq DNA polymerase and 25 pmol of the primer pairs, CB2f and CB2r or CFf and CFr, selective for the upstream regions of the SmCB2 and SmCF genes, respectively. Sense and antisense primers included restriction endonucleases sites for EcoR I and Nco I, respectively, for ligation into the heat shock protein (HSP) 70-GFP-HSP70 plasmid previously described (Wippersteg et al., 2002b). Primers were as

40

ml water. The DNA pool was ligated for 8 h at room

follows: CB2f 5 0 -O3 0 GCGCGGAATTCATCTCTA-

temperature using T4 DNA ligase (10 U; Roche) and the appropriate compensating volume of 10! ligation buffer. A

Primary PCR reactions were carried out in a total volume of

TACCTGGCAAGTAATTGTCATGT, CB2r 5 0 -O3 0

further 10 U of ligase and the appropriate volume of 10! ligation buffer were then added and the reaction allowed to continue overnight at room temperature. Ligation reactions were stored at K20 8C. Rapid amplification of genomic ends (RAGE) was employed to amplify, clone and sequence upstream regions of the open reading frames (ORF) of SmCB2 and SmCF.

GAATATT, CFf 5 0 -O3 0 GCGCGGAATTCAATATC- GAAAAACACAAAGTCCACCTAT and CFr 5 0 -O3 0 GCGATCCATGGTCTCGGGATAGCAGATCGACAAC TTTCAAG. The purified amplicons were sequentially digested with EcoR I and Nco I. For the HSP70-GFP- HSP70 plasmid, restriction digestion with the same endonucleases removes the HSP70 5 0 -flanking region for replacement by the 5 0 regions of either SmCB2 or SmCF.

25

ml that contained 1 ml ligated gDNA (w0.1 mg), 2.5 U

Ligation reactions were transformed into One Shot TOP10

Taq DNA Polymerase (New England Biolabs) and 25 pmol of each primer. Thermocycling conditions were as follows:

cells. Bacterial propagation, isolation and sequencing of plasmid DNA were as described above. Large-scale plasmid

45

s at 94 8C, 1 min at 60 8C (range 50–65 8C) and 3 min at

DNA was then prepared (Maxi-Prep kit; Qiagen).

72

8C for 30 cycles. Secondary (full nested) PCR reactions

For promoter deletion analysis, three progressively

were completed in a total volume of 50 ml and contained 0.5 ml of the primary PCR product, 2.5 U Taq DNA Polymerase and 50 pmol of each primer. Thermocycling conditions were as above. Sense primers targeting the vector for the primary and

truncated amplicons of SmCF, (designated SmCFA, B and C) and incorporating 5 0 EcoR I and 3 0 Nco I restriction enzyme sites were prepared by PCR using the SmCF-GFP- HSP70 plasmid as template. Sense primers were: CFf(a) (489 bp amplicon), 5 0 -O3 0 GTATGATTTCTCTCTCTG

secondary PCRs were 5 0 -O3 0 ACAGGAAACAGCTAT- GACCATG and 5 0 -O3 0 GCGCAATTAACCCTCAC- TAAAG, respectively. Primary and secondary antisense

TTTTG; CFf(b) (329 bp amplicon) 5 0 -O3 0 CAGATATGT AGCATTTGACGCTA and CFf(c) (169 bp amplicon) 5 0 -O 3 0 GCACACTTGGGACCTTGCTTGT. The same antisense

primers targeted the 5 0 ends of the ORF of SmCB2 (Accession no. AJ312106) and SmCF (U07345), as follows:

primer, CFr (above), was used for all PCRs. After 1% agarose gel electrophoresis and gel extraction, amplicons

SmCB2 primary 5 0 -O3 0 ACG TTT ATG TCG TCT AGC ATC AA and secondary 5 0 -O3 0 CAT TTA AAG TCC CAT AAC TCA GTA; SmCF primary 5 0 -O3 0 TCT CAT CTT

were purified and ligated into the GFP-HSP70 plasmid for eventual large-scale preparation. All reaction conditions were as described above.

 

CTG

TCT CAT GAT ACT and secondary 5 0 -O3 0 GTT

As microprojectiles, 0.6 mm gold particles were coated

TTC TAT ATT TTA GCT TGA ATT GT. Secondary PCR reactions were analysed by 1% agarose gel electrophoresis and staining with ethidium bromide. Amplicons greater than 500 bp were excised, purified (gel extraction kit; Qiagen)

with purified recombinant vector DNA (containing either the SmCB2 or SmCF 5 0 flanking region) as described (Wippersteg et al., 2002b). Particle bombardment, incorpor- ating a total of 5 mg of plasmid DNA, was performed with

V. Wippersteg et al. / International Journal for Parasitology 35 (2005) 583–589

585

the PDS 1000/HE system (Bio-Rad) under 1550 psi of helium gas pressure and a chamber vacuum of 38–50 mmHg with the target distance stage set to position one (3 cm). Control bombardments used gold particles without DNA. For each bombardment, approximately 25 males per 6 cm culture dish were cultured for 1 day after perfusion. Following gene transfer, the worms were washed once with medium and cultured for 24–48 h before microscopy. GFP reporter gene activity was detected with a Leica TCS NT confocal laser scanning microscope at an excitation wavelength of 488 nm.

Total RNA from bombarded worms was isolated using the RNA II Isolation Kit from Machery and Nagel (Du¨ren, Germany). The amount of RNA recovered was determined spectrometrically. Reverse transcriptase PCR (RT-PCR) was done stepwise in separate reactions. For reverse transcriptase, about 500 ng S. mansoni total RNA was denatured for 5 min at 70 8C and transcribed into cDNA for 60 min at 42 8C using 200 U M-MuLV reverse transcriptase (New England Biolabs), 40 U RNAsin (Promega), 10% glycerol and 1 mM of a GFP-selective primer (GFP-3:

ATCCTTATTTGTATAGTTCATCC). PCR amplifications,

(GFP-3: ATCCTTATTTGTATAGTTCATCC). PCR amplifications, Fig. 1. The 5 0 flanking region of the SmCF gene

Fig. 1. The 5 0 flanking region of the SmCF gene promotes expression of GFP that is restricted to the parasite gut. Adult male Schistosoma mansoni were examined by confocal laser scanning microscopy 24–48 h after biolistic transformation with a GFP-HSP70 plasmid construct containing a 649 bp 5 0 flanking fragment of the SmCF gene. Fluorescence and bright field images are presented for the anterior (panel A) and posterior (panel B) regions of the gut. Magnifications are indicated and includes a higher magnification (630!; within the red box) of the anterior bifurcated gut and its vesicular contents.

586

V. Wippersteg et al. / International Journal for Parasitology 35 (2005) 583–589

/ International Journal for Parasitology 35 (2005) 583–589 Fig. 2. The 5 0 flanking region of

Fig. 2. The 5 0 flanking region of the SmCB2 gene promotes expression of GFP that is restricted to the parasite tegument. Adult male Schistosoma mansoni were examined by con-focal laser scanning microscopy 24–48 h after biolistic transformation with a GFP-HSP70 plasmid construct containing a 810 bp 5 0 flanking fragment of the SmCB2 gene. Fluorescence (A) and bright field (B) images are presented in which the lateral surface tegument and tubercles are clearly visible. The magnification (200!) is indicated.

to yield a 420 bp amplicon, were performed with the primer combination GFP-3 and GFP-5 (GGGAACTACAAGA- CACGTGC) in a total volume of 25 ml as described elsewhere in detail (Wippersteg et al., 2002b). Negative control reactions were performed without reverse transcrip- tase for each worm population or without template. As a positive control, 1 ng of GFP-plasmid DNA was used as template. After biolistic transformation and a 24–48 h incubation period in medium, worms exhibited a wide distribution of gold particles by bright field microscopy. However, upon viewing at 488 nm, a distinct GFP-derived fluorescence was localised in the gut after transformation with the 5 0 regulatory region of SmCF (Fig. 1). Fluorescence was seen throughout the length of the gut including the anterior (Fig. 1A) and posterior (Fig. 1B) regions. By contrast, transformation with the SmCB2 construct yielded fluor- escence that was solely localised in the tegument, including the tegumental tubercles (Fig. 2). Control transformations using gold particles alone yielded no fluorescence (not shown) in agreement with previously published data (Wippersteg et al., 2002b). To examine which sub-region(s) of the cloned SmCF 5 0 gene flanking sequence (649 bp) is essential for GFP expression, three promoter deletion constructs, SmCFA, SmCFB and SmCFC, were prepared. These and the full- length construct were used for biolistic experiments. After a 24–48 h incubation period, GFP was only detected in schistosomes transformed with the full length construct (data not shown). To confirm this result at the molecular level, total RNA was extracted from schistosomes bom- barded with each of the promoter deletion constructs and used for comparative RT-PCR analyses employing GFP- specific primers. As shown in Fig. 3, the expected amplicon of 420 bp was only observed for worms transformed with the full-length construct. These findings indicate the absolute requirement of the first 169 bp of the cloned

SmCF gene 5 0 regulatory region for both transcription of GFP and its tissue-specificity (see Fig. 4). Putative transcription factor binding sites (TFBS) were identified using the MatInspector software (Quandt et al., 1995; http://www.genomatix.de/index.html) setting the core and matrix similarities to 1.0 and 0.8, respectively. A relatively simple profile of TFBS for SmCF was identified with the majority of sites being distributed within that 5 0 169 bp region required for expression of GFP (Fig. 4). These sites included Oct (K625 with respect to the start ATG), GATA (K585), PPAR/RXR (K548), NF-AT(K543), STAT (K517) and AP1 (K511). Further, downstream, two NF-Y elements (aka CCAAT-boxes) at K459 and K353 were identified, as were GATA (K330) and TATA- box elements (K243).

as were GATA ( K 330) and TATA- box elements ( K 243). Fig. 3. Deletion

Fig. 3. Deletion of the 5 0 flanking region of the SmCF gene leads to loss of the GFP reporter transcript. RNA was extracted from male Schistosoma mansoni worms transfected with various deletion constructs of the SmCF 5 0 flanking gene region. Reverse transcriptase PCR was performed with equal amounts of total RNA using primers selective for GFP that amplify a single product of 420 bp. (M) molecular ladder, (1) full-length SmCF, (2) deletion A, (3) deletion B, (4) deletion C, (5) worms transfected with gold particles without DNA, (6) PCR without template, (7) PCR positive control with plasmid as template. Only in lanes 1 and 7 is the expected 420 bp amplicon visible. Other control reactions without the reverse transcriptase step yielded no amplification product (data not shown). Identical results were obtained in a second independent experiment.

V. Wippersteg et al. / International Journal for Parasitology 35 (2005) 583–589

587

Journal for Parasitology 35 (2005) 583–589 587 Fig. 4. Nucleotide sequence and putative transcription

Fig. 4. Nucleotide sequence and putative transcription factor binding sites in the 5 0 flanking region of the SmCF gene. Transcription factor binding sites (shaded areas) were identified using the MatInspector software (http://www.genomatix.de/index.html). Core regions of transcription factor binding sites are underlined. Negative numbers are used to mark their position upstream of the translation initiation codon ATG (marked in bold type face). The vertical lines with arrows termed A, B and C indicate the three deletions of the SmCF 5 0 flanking region used to biolistically transform Schistosoma mansoni.

For SmCB2, MatInspector analysis only identified TFBS that have a more general function in transcription such as Yin-Yang, NF-Y and AP4 (Mantovani, 1999; Usheva and Shenk, 1996; Aranburu et al., 2001; data not shown). Therefore, promoter deletion analysis was not considered further at this stage. In spite of the considerable biochemical and functional characterisation of schistosome peptidases (Caffrey et al., 2004), the gene regulatory elements determining their spatial and temporal expression are unknown. However, the recent availability of a biolistic transformation system for adult S. mansoni, incorporating plasmid constructs with gene-specific flanking elements upstream of GFP (Wippersteg et al., 2002a,b, 2003), provides one means by which gene-regulation can be studied. Using biolistics, therefore, our data demonstrate that the 5 0 genomic fragments for two S. mansoni peptidase genes are sufficient to promote expression of GFP. Moreover, expression is tissue-specific, in a manner consistent with the previous immunochemical localisations of SmCF and SmCB2 to the gut (Brady et al., 1999) and tegument (Caffrey et al., 2002), respectively. For promoter-deletions, we focused on SmCF because of the higher number of candidate TFBS identified that were considered necessary for tissue-specificity (dis- cussed below). All three SmCF deletions failed to promote

expression of GFP as visualised by microscopy. Further, these observations were confirmed by RT-PCR selective for GFP. The results, therefore, demonstrate the necessity of one or more TFBS within the first 169 bp of the cloned SmCF gene 5 0 flanking region for directing both gene expression and its restriction to the gut. Prior to biolistic transformation and in the absence of extensive archived genomic sequence information, it had been necessary to characterise the requisite 5 0 flanking sequences. This was accomplished by constructing a gDNA library and performing RAGE using nested PCRs with vector-specific forward and gene-ORF-specific reverse primers. Towards the end of this study, however, consider- ably more genomic sequence information had been deposited in the relevant databases. We, therefore, compared our clones against the genomic database available at The Wellcome Trust Sanger Institute S. mansoni Blast server (http://www. sanger.ac.uk/cgi-bin/blast/submitblast/s_mansoni). At the time of writing, for SmCF, the latest contig with a greater than 99% identity was 333748.c005310846.Contig1 cover- ing all 649 bp of our cloned 5 0 UTR together with at least 12 bp of the SmCF ORF. For SmCB2, the respective contig was 333748.c003608915.Contig1 covering 506 bp of the 5 0 end of our cloned UTR and also the clone ‘SMECS44TR’ covering 245 bp plus 144 bp of the SmCB2 ORF. Thus, our

588

V. Wippersteg et al. / International Journal for Parasitology 35 (2005) 583–589

clones are consistent with the archived sequence information. The MatInspector software allowed for both the identification of putative TFBS in the SmCF 5 0 upstream fragment and some interpretation of the results obtained with the promoter deletion experiments. Interestingly, most of the putative TFBS (six of 10 sites) were located within the critical 5 0 flanking 169 bp region (see Fig. 4). K625 to K227 upstream of the ATG start codon. Of particular interest is the identification of a palin- dromic STAT motif (TT(N) 5 AA) at position K517. STAT elements are also present in the cathepsin L gene promoters of Fasciola gigantica (Grams et al., 2001; accession no. AB010923) and Onchocerca volvulus (Hashmi et al., 2002; AF442768) at similar positions upstream of the ATG start codon (K543 and K668, respectively). This suggests that STATs may function in the spatial regulation of cathepsin L-like genes because the Fasciola ortholog is also expressed in the gut (Grams et al., 2001) and a Caenorhabditis elegans line carrying a heterologous O. volvulus cathepsin L gene promoter linked to a lacZ reporter gene revealed an expression pattern that was restricted to gut cells (Hashmi et al., 2002). In mammals, STAT proteins are a family of cytoplasmic transcription factors that are involved in signal transduction cascades induced by cytokines, hormones and growth factors (Decker, 1999). For example, upon stimu- lation of human cells by interferon-gamma, binding of STAT-1 to the promoter of the cysteine peptidase gene caspase-11 is required for its expression (Schauvliege et al.,

2002).

Closely associated with the STAT element are putative NF-AT (K543) and AP-1 (K511) binding sites. These often occur in tandem to cooperatively bind transcription factors involved in tissue-specific gene regulation (Rao et al., 1997). Further, composite binding sites that would allow the cooperative binding and dimerisation of PPARs (peroxisome proliferator-activated receptors) and RXR (9- cis retinoic acid receptor) were detected at K548. This heterodimer would then bind PPREs (PP response elements) to control tissue-specific and developmentally regulate transcription (Qi et al., 2000). Finally, within the first 169 bp region of the SmCF 5 0 flanking fragment, are TFBS for Oct-1/2 (K625) and GATA-binding proteins (K585). Both are involved in the tissue-specific expression of a number of genes in organisms such as insects (Harshman and James, 1998) and C. elegans. In C. elegans, the importance of GATA elements in gut development has been demonstrated (Maduro and Rothman, 2002). Further, the number and placement of GATA elements are crucial in the gut- specific regulation of a C. elegans cathepsin B gene (Britton et al., 1998). The present biolistic and promoter-deletion data provide a basis for further enquiry of those gene regulatory elements directing the temporal and spatial expression of peptidases in schistosomes. Such studies will be greatly aided by the

future availability of the entire S. mansoni genome sequence. An improved understanding of the function and regulation of peptidase genes could contribute to the design of specific intervention strategies.

Acknowledgements

This work was financially supported by the Sandler Family Supporting Foundation, NIAID grant AI053247 and the Deutsche Forschungsgemeinschaft (Grant-No.: GR 1549/1-3). We thank Dr Ben Kelly of the Sandler Center for his critical reading of the manuscript.

References

Aranburu, A., Carlsson, R., Persson, C., Leanderson, T., 2001. Transcrip- tion factor AP-4 is a ligand for immunoglobulin-kappa promoter E-box elements. Biochem. J. 354, 431–438. Brady, C.P., Dowd, A.J., Brindley, P.J., Ryan, T., Day, S.R., Dalton, J.P., 1999. Recombinant expression and localization of Schistosoma mansoni cathepsin L1 support its role in the degradation of host hemoglobin. Infect. Immun. 67, 368–374. Britton, C., McKerrow, J.H., Johnstone, I.L., 1998. Regulation of the Caenorhabditis elegans gut cysteine protease gene cpr-1: requirement for GATA motifs. J. Mol. Biol. 283, 15–27. Caffrey, C.R., Salter, J.P., Lucas, K.D., Khiem, D., Hsieh, I., Lim, K.C., Ruppel, A., McKerrow, J.H., Sajid, M., 2002. SmCB2, a novel tegumental cathepsin B from adult Schistosoma mansoni. Mol. Biochem. Parasitol. 121, 49–61.

Caffrey, C.R., McKerrow, J.H., Salter, J.P., Sajid, M., 2004. Blood ‘n’ guts:

an update on schistosome digestive peptidases. Trends Parasitol. 20,

241–248.

Decker, T., 1999. STATs as essential intracellular mediators of cytokine response. Cell. Mol. Life Sci. 55, 1505–1508. Grams, R., Vichasri-Grams, S., Sobhon, P., Upatham, E.S., Viyanant, V.,

2001. Molecular cloning and characterization of cathepsin L encoding

genes from Fasciola gigantica. Parasitol. Int. 50, 105–114.

Harshman, L.G., James, A.A., 1998. Differential gene expression in insects:

transcriptional control. Annu. Rev. Entomol. 43, 671–700. Hashmi, S., Britton, C., Liu, J., Guiliano, D.B., Oksov, Y., Lustigman, S.,

2002. Cathepsin L is essential for embryogenesis and development of

Caenorhabditis elegans. J. Biol. Chem. 277, 3477–3486. Maduro, M.F., Rothman, J.H., 2002. Making worm guts: the gene regulatory network of the Caenorhabditis elegans endoderm. Dev. Biol. 246, 68–85. Mantovani, R., 1999. The molecular biology of the CCAAT-binding factor NF-Y. Gene 239, 15–27. Qi, C., Zhu, Y., Reddy, J.K., 2000. Peroxisome proliferator-activated receptors, coactivators, and downstream targets. Cell. Biochem. Biophys. 32, 187–204. Quandt, K., Frech, K., Karas, H., Wingender, E., Werner, T., 1995. MatInd and MatInspector: new fast and versatile tools for detection of consensus matches in nucleotide sequence data. Nucleic Acids Res. 23, 4878–4884. Rao, A., Luo, C., Hogan, P.G., 1997. Transcription factors of the NF-AT family: regulation and function. Annu. Rev. Immunol. 15,

707–747.

Schauvliege, R., Vanrobaeys, J., Schotte, P., Beyaert, R., 2002. Caspase-11 gene expression in response to lipopolysaccharide and

V. Wippersteg et al. / International Journal for Parasitology 35 (2005) 583–589

589

interferon-gamma requires nuclear factor-kappa B and signal transducer and activator of transcription (STAT) 1. J. Biol. Chem. 277, 41624–41630. Usheva, A., Shenk, T., 1996. YY1 transcriptional initiator: protein interactions and association with a DNA site containing unpaired strands. Proc. Natl Acad. Sci. USA 93, 13571–13576. Wippersteg, V., Kapp, K., Kunz, W., Grevelding, C.G., 2002a. Character- isation of the cysteine protease ER60 in transgenic Schistosoma mansoni larvae. Int. J. Parasitol. 32, 1219–1224.

Wippersteg, V., Kapp, K., Kunz, W., Jackstadt, P., Zahner, H., Grevelding, C.G., 2002b. HSP70-controlled GFP expression in transiently transformed schistosomes. Mol. Biochem. Parasitol. 120,

141–150.

Wippersteg, V., Ribeiro, F., Liedtke, S., Kusel, J.R., Grevelding, C.G., 2003. The uptake of Texas Red-BSA in the excretory system of schistosomes and it’s colocalisation with ER60 promoter-induced GFP in transiently transformed adult males. Int. J. Parasitol. 33,

1139–1143.

International Journal for Parasitology 35 (2005) 591–596 www.parasitology-online.com Rapid Communication Opisthorchis
International Journal for Parasitology 35 (2005) 591–596 www.parasitology-online.com Rapid Communication Opisthorchis

International Journal for Parasitology 35 (2005) 591–596

International Journal for Parasitology 35 (2005) 591–596 www.parasitology-online.com Rapid Communication Opisthorchis

Rapid Communication

Opisthorchis viverrini antigen induces the expression of Toll-like receptor 2 in macrophage RAW cell line

Somchai Pinlaor a,e , Saeko Tada-Oikawa b , Yusuke Hiraku b , Porntip Pinlaor c,e , Ning Ma d , Paiboon Sithithaworn a,e , Shosuke Kawanishi b, *

a Department of Parasitology, Khon Kaen University, Khon Kaen 40002, Thailand b Department of Environmental and Molecular Medicine, Mie University School of Medicine, 2-174, Edobashi, Tsu, Mie 514-8507, Japan c Department of Clinical Microbiology, Faculty of Associated Medical Science, Khon Kaen University, Khon Kaen 40002, Thailand d Department of Anatomy, Mie University School of Medicine, Mie 514-8507, Japan e Liver Fluke and Cholangiocarcinoma Research Center, Faculty of Medicine, Khon Kaen University, Khon Kaen 40002, Thailand

Received 28 December 2004; received in revised form 17 February 2005; accepted 18 February 2005

Abstract

Opisthorchis viverrini infection induces inflammation in and around the bile duct, leading to cholangiocarcinoma in humans. To examine the mechanism of O. viverrini-induced inflammatory response, we assessed the expression of Toll-like receptors (TLRs) in RAW 264.7 macrophage cell line treated with an extract of O. viverrini antigen. Flow cytometry and immunocytochemistry showed that O. viverrini antigen induced the expression of TLR2 but not TLR4. Western blotting and immunocytochemistry revealed that nuclear factor-kB (NF-kB), inducible nitric oxide synthase (iNOS) and cyclooxygenase-2 (COX-2) were expressed in RAW 264.7 cells treated with O. viverrini antigen in a dose-dependent manner. These results suggest that O. viverrini induces inflammatory response through TLR2-mediated pathway leading to NF-kB-mediated expression of iNOS and COX-2. q 2005 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

Keywords: Opisthorchis viverrini; Toll-like receptor 2; Inducible nitric oxide synthase; Nuclear factor-kB; Cyclooxygenase-2; RAW 264.7 macrophage cell line

Opisthorchis viverrini infection is a major risk factor of cholangiocarcinoma (CCA) development in humans (IARC, 1994). Nitric oxide (NO) produced by inducible nitric oxide synthase (iNOS) has been implicated in inflammation- mediated carcinogenesis (Hussain et al., 2003) including

O. viverrini-caused CCA (Haswell-Elkins et al., 1994).

Recently, we have demonstrated that chronic inflammation

triggered by repeated O. viverrini infection mediates iNOS- dependent DNA damage in intrahepatic bile duct epithelium and inflammatory cells of hamsters, which may play an important role in CCA development (Pinlaor et al., 2003, 2004a). However, the underlining mechanism of

O. viverrini-induced inflammatory response remains to be

clarified.

* Corresponding author. Tel./fax: C81 59 231 5011. E-mail address: kawanisi@doc.medic.mie-u.ac.jp (S. Kawanishi).

Sripa and Kaewkes (2000) observed O. viverrini antigen in bile ducts of the liver, liver cells, Kupffer cells, macrophages, epithelioid and giant cells in the egg granuloma. The presence of the antigens was associated with heavy inflammatory cell infiltration, particularly with mononuclear cells. Importantly, Akai et al. demonstrated that antibody level against O. viverrini antigen was positively associated with the severity of hepatobiliary disease and CCA (Akai et al., 1994). Thus, local parasite- specific immune responses induced by O. viverrini antigens would play a role in the pathogenesis of opisthorchiasis associated with CCA development. Toll-like receptors (TLR) are an important membrane receptor family, which actively participates in the stimu- lation of the innate immune response. To date, 10 TLR homologs have been found in humans. It has been reported that TLR2 and TLR4 contribute to immune response to parasitic infection including protozoa (Kropf et al., 2004)

0020-7519/$30.00 q 2005 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

doi:10.1016/j.ijpara.2005.02.003

592

S. Pinlaor et al. / International Journal for Parasitology 35 (2005) 591–596

and helminth (van der Kleij et al., 2002). TLRs activate homologous signal transduction pathways leading to nuclear localization of NF-kB/Rel-type transcription factors. NF-kB is a key player in inflammation that regulates expression of various genes involved in controlling inflammatory response such as proinflammatory mediator, iNOS and cyclooxygenese-2 (COX-2) expression (Balkwill and Coussens, 2004; Surh et al., 2001). In addition, COX-2 is involved in carcinogenesis through the induction of inflammatory process (Surh et al., 2001). The expression of COX-2 is increased in tumor tissue of CCA patients (Endo et al., 2002). Relevantly, NF-kB functions as a tumor promoter in inflammation-associated cancer (Pikarsky et al.,

2004).

In the present study, we investigated expression of TLRs, NF-kB, iNOS and COX-2 in RAW 264.7 macrophage cell line treated with O. viverrini antigen using flow cytometry and immunofluorescence techniques. To confirm the expression of these molecules, we also performed Western blotting. O. viverrini crude antigen was prepared as described previously (Pinlaor et al., 2004b) with a minor modification. Four months after hamsters were infected with 50 O. viverrini, adult worms were collected. Following the addition of protease inhibitors (0.1 mM phenylmethyl

sulphonyl fluoride, 0.1 mM L-1-tosylamine-2-phenylethyl chloromethyl ketone and 0.1 mM trans-epoxysuccinyl- L-leucylamido-(4-guanidino)butane (E64)), the worms were homogenized with 10 passes of a microhomogenizer with a Teflon-coated pestle. The homogenate was frozen in liquid nitrogen and then thawed at 37 8C. The homogenate was centrifuged at 12,000 g at 4 8C for 30 min. The supernatant containing crude somatic antigen was stored at K80 8C until use. The protein concentration in the supernatant was determined using the Coomassie w Protein Assay Reagent Kit (Pierce Biotechnology, Rockford, USA). RAW 264.7 mouse macrophage cell line was cultured in high glucose Dulbecco’s modified Eagle’s medium (Gibco/BRL, New York, NY, USA) containing 10% heat- inactivated fetal bovine serum and 100 mg/l kanamycin. The cells (1!10 6 cells) were detached from culture dishes by vigorous pipetting, and were centrifuged and resus- pended in 1 ml fresh medium. Cells (1!10 6 cells/ml) were incubated with crude O. viverrini antigen at 37 8C for indicated durations. For analysis of TLR expression, O. viverrini antigen- treated RAW 264.7 cells were treated with 1 mg/ml of rabbit polyclonal anti-TLR2 antibody or mouse monoclonal anti- TLR4 antibody (Santa Cruz Biotechnology, Santa Cruz, CA, USA) and then incubated with 1 mg/ml of Alexa

Cruz, CA, USA) and then incubated with 1 m g/ml of Alexa Fig. 1. TLR expression

Fig. 1. TLR expression induced by Opisthorchis viverrini antigen. (A) Immunocytochemical analysis of TLR2 expression in RAW 264.7 cells treated with O. viverrini antigen. RAW 264.7 cells were treated with O. viverrini antigen for 12 h at 37 8C, and then treated with anti-TLR2 antibody overnight at room temperature. The cells were incubated with Alexa 594 anti-rabbit IgG antibody for 3 h and then viewed under a fluorescent microscope. Scale barZ10 mm. (B) Flow cytometric fluorescence distribution of RAW 264.7 cells treated with O. viverrini antigen. RAW 264.7 cells were treated with 100 mg/ml of O. viverrini antigen for 12 h at 37 8C, and then incubated with anti-TLR2 or anti-TLR4 antibody for 30 min. The cells were then incubated with Alexa 488 anti-rabbit IgG or anti-mouse IgG antibody for 30 min and then analyzed with a flow cytometer. Open peaks, nontreated control cells; shaded peaks, O. viverrini antigen- treated cells.

S. Pinlaor et al. / International Journal for Parasitology 35 (2005) 591–596

593

488-labeled goat antibody against mouse IgG or against rabbit IgG (Molecular Probes, Eugene, OR, USA). The cells were resuspended in PBS, and then analyzed on a flow cytometer (FACScan; Becton Dickinson). Localization of NF-kB and iNOS expression was assessed as described previously (Pinlaor et al., 2004a) with a minor modification. RAW 264.7 cells treated with O. viverrini antigen were smeared on a glass slide. After drying at 60 8C for 2 h, cells were fixed with 4% formaldehyde in PBS for 20 min at room temperature. The cells were treated with 0.1% Triton X K1 100 for 15 min and then incubated with 1% skim milk for 30 min. For simultaneous analysis of iNOS and NF-kB expression, the cells were incubated with the primary antibodies, rabbit polyclonal anti-iNOS antibody (1:300, Calbiochem-Novabiochem Corporation, San Diego, USA) and mouse monoclonal anti-NF-kB antibody (1:300, Santa Cruz Biotechnology, Inc, USA) overnight at room

temperature. Then, the cells were incubated with Alexa 594-labeled goat antibody against rabbit IgG and Alexa 488-labeled goat antibody against mouse IgG (1:400, Molecular Probes) for 3 h. The cells were examined under an inverted Laser Scan Microscope (LSM 410, Zeiss, Gottingen, Germany). For analysis of the expression of TLR2, TLR4 and COX-2, the cells were incubated with the primary antibody [rabbit polyclonal anti-TLR2 antibody, mouse monoclonal anti-TLR4 antibody (1 mg/ml, Santa Cruz Biotechnology) or rabbit polyclonal anti-COX-2 antibody (1:400, Oxford Biomedical Research, Oxford, Michigan, USA)] overnight at room temperature. Subsequently, the cells were incubated with Alexa 594-labeled goat antibody against rabbit IgG or Alexa 488-labeled goat antibody against mouse IgG (1:400, Molecular Probes). The cells were examined under an inverted Laser Scan Microscope as described above.

under an inverted Laser Scan Microscope as described above. Fig. 2. Expression of NF- k B

Fig. 2. Expression of NF-kB and iNOS induced by Opisthorchis viverrini antigen. (A) Immunocytochemical analysis of iNOS and NF-kB expression in RAW 264.7 cells treated with O. viverrini antigen. RAW 264.7 cells were treated with indicated concentration of O. viverrini antigen for 12 h, and then incubated with anti-iNOS and anti-NF-kB antibodies followed by Alexa 594 anti-rabbit IgG or Alexa 488 anti-mouse IgG antibodies for 3 h and then viewed under an inverted Laser Scan Microscope. iNOS expression (red color) is observed in the cytoplasm, whereas NF-kB (green color) is expressed in both nucleus and cytoplasm. Scale barZ10 mm. (B, C) Western blotting analysis of NF-kB and iNOS expression in RAW 264.7 cells treated with O. viverrini antigen. Proteins extracted from O. viverrini antigen-treated RAW 264.7 cells were immunoblotted and probed with mouse monoclonal anti-NF-kB antibody (B) or rabbit polyclonal anti-iNOS antibody (C). (For interpretation of the reference to colour in this legend, the reader is referred to the web version of this article.)

594

S. Pinlaor et al. / International Journal for Parasitology 35 (2005) 591–596

RAW 264.7 cells treated with crude O. viverrini antigen were solubilized in sample buffer and boiled for 5 min. Samples were separated by 4–20% SDS-PAGE and blotted onto polyvinylidene difluoride (PVDF) membranes. The membranes were incubated with 5% skim milk in Tris- buffered saline containing 0.1% Tween 20 (TBS, pH 7.5). The membranes were then incubated with the primary antibody [mouse monoclonal anti-NF-kB antibody (1:1000), rabbit polyclonal anti-iNOS antibody (1:2000) or rabbit polyclonal anti-COX-2 antibody (1:1000)]. The membranes were washed in TBS and then incubated with horseradish peroxidase (HRP)-conjugated anti-mouse IgG antibody (1:2000, Santa Cruz Biotechnology) or anti-rabbit IgG antibody (1:2000, New England Biolabs, Beverly, MA, USA). After extensive washings in TBS, enhanced chemi- luminescence assay was performed using an ECL detection reagent (Amersham) and positive bands were detected on X-ray films. Fig. 1 shows the expression of TLRs in RAW 264.7 cells treated with O. viverrini antigen. Immunocytochemistry revealed that O. viverrini antigen increased the expression of TLR2 dose-dependently (Fig. 1A), but not TLR4 (data not shown). TLR2 was not expressed in nontreated control cells (Fig. 1A). Flow cytometry confirmed that O. viverrini antigen increased the fluorescence intensity of TLR2, but not TLR4 (Fig. 1B). Fig. 2 shows the expression of NF-kB and iNOS in RAW 264.7 cells treated with O. viverrini antigen. iNOS expression (red color) was observed in the cytoplasm, whereas NF-kB expression (green color) was observed in

both nucleus and cytoplasm (Fig. 2A). O. viverrini antigen increased expression of NF-kB and iNOS dose-dependently. Western blotting showed that the expression of NF-kB (approximately 65 kDa, Fig. 2B) and iNOS (approximately 130 kDa, Fig. 2C) were increased dose-dependently in RAW 264.7 cells treated with O. viverrini antigen. Fig. 3 shows COX-2 expression in RAW 264.7 cells treated with O. viverrini antigen. The immunoreactivity of COX-2 increased in the cytoplasm depending on the concentration of O. viverrini antigen (Fig. 3A). COX-2 expression was not observed in nontreated control cells (Fig. 3A). Western blotting showed that COX-2 protein (approximately 70 kDa) was increased dose-dependently in RAW 264.7 cells treated with O. viverrini antigen (Fig. 3B). This is the first study showing that O. viverrini antigen induces the expression of TLR2, which may participate in NF- kB-mediated expression of iNOS and COX-2 in RAW 264.7 cells. The expression of these proteins was dependent on the concentration of O. viverrini antigen. TLR family recognizes conserved organism structures and activates signaling pathways (Barton and Medzhitov, 2003). Relevantly, it was reported that in schistosome infection, purified schistosomal antigen activates TLR2 in dendritic cells (van der Kleij et al., 2002). O. viverrini may mediate TLR2-dependent pathway through binding its lipoproteins as demonstrated using bacterial lipoproteins (Aliprantis et al., 1999). Our data can reasonably explain the clinical data showing that parasite-specific antibody levels in human hepatobili- ary disease were associated with O. viverrini infection (Haswell-Elkins et al., 1991). On the other hand, TLR4

( Haswell-Elkins et al., 1991 ). On the other hand, TLR4 Fig. 3. COX-2 expression induced

Fig. 3. COX-2 expression induced by Opisthorchis viverrini antigen. (A) Immunocytochemical analysis of COX-2 expression in RAW 264.7 cells. RAW 264.7 cells were treated with indicated concentration of O. viverrini antigen for 12 h, and then incubated with anti-COX-2 antibody followed by Alexa 594 anti-rabbit IgG antibody and then viewed under an inverted Laser Scan Microscope. COX-2 expression was observed in the cytoplasm dose-dependently, but not in untreated cells. Scale barZ10 mm. (B) Western blotting analysis of COX-2 expression in RAW 264.7 cells treated with O. viverrini antigen. Proteins extracted from RAW 264.7 cells treated with O. viverrini antigen were immunoblotted and probed with anti-COX-2 antibody.

S. Pinlaor et al. / International Journal for Parasitology 35 (2005) 591–596

595

contributes to efficient control of infection with protozoa such as Leishmania major (Kropf et al., 2004), and lipopolysaccharide, a major component of the outer surface of Gram-negative bacteria (Andonegui et al., 2003). In the present study, TLR4 expression was not increased in O. viverrini antigen-treated cultured cells. It has been reported that constitutively active TLR4 induces NF-kB activation and subsequent production of inflamma- tory cytokines (Medzhitov et al., 1997). Thus, TLR4 may also participate in pathogenesis of O. viverrini infection. Our results showed that NF-kB was expressed in both the nucleus and cytoplasm, suggesting that O. viverrini antigen induces not only NF-kB expression, but also its nuclear translocation and activation. NF-kB regulates the expression of iNOS and COX-2 (Surh et al., 2001; Balkwill and Coussens, 2004). We have previously reported that O. viverrini infection strongly induces iNOS in bile duct epithelial cells and inflammatory cells (Pinlaor et al., 2004a). This finding can be explained by assuming that O. viverrini antigen mediates NF-kB-mediated iNOS expression depending on TLR, since it has been reported that O. viverrini antigen is present in both epithelial bile duct and inflammatory cells (Sripa and Kaewkes, 2000). Relevantly, Harada et al. have reported that NF-kB is expressed through TLR and related molecules in cultured biliary epithelial cells treated with bacterial LPS (Harada et al., 2003). COX- 2 expression induces inflammatory cell infiltration (Surh et al., 2001) and participates in carcinogenesis (Oshima et al., 2004). Moreover, COX-2 expression is increased in tumor tissue of cholangiocarcinoma patients (Endo et al., 2002). Thus, COX-2 may participate in the pathogenesis of O. viverrini infection through an additional inflammatory response. We have recently demonstrated that O. viverrini infection induces inflammation-mediated DNA damage through NO production via iNOS expression (Pinlaor et al., 2004a). DNA damage was observed in bile duct epithelial cells and inflammatory cells in the liver of hamsters with repeated O. viverrini infection and was associated with the progression of pathological changes (Pinlaor et al., 2004a). In the present study, in vitro experiments have shown that O. viverrini antigen induces the expression of TLR2, NF-kB, iNOS and COX-2 in macrophage cell line. It is reasonably considered that TLR2 expression mediates NF-kB expression and its nuclear translocation, leading to expression of iNOS and COX-2. In conclusion, the pathogenesis of O. viverrini infection, including carcinogenesis, may be mediated by inflammatory response triggered by its antigen via TLR2- dependent pathway.

Acknowledgements

This work was supported by Khon Kaen University, Research Fund and Faculty of Medicine, Khon Kaen

University, Thailand, and Grants-in-Aid for Scientific Research from the Ministry of Education, Science, Sports and Culture of Japan.

References

Akai, P.S., Pungpak, S., Chaicumpa, W., Viroj, K., Bunnag, D., Befus, A.D., 1994. Serum antibody response to Opisthorchis viverrini antigen as a marker for opisthorchiasis-associated cholangiocarcinoma. Trans. R. Soc. Trop. Med. Hyg. 88, 471–474. Aliprantis, A.O., Yang, R.B., Mark, M.R., Suggett, S., Devaux, B., Radolf, J.D., Klimpel, G.R., Godowski, P., Zychlinsky, A., 1999. Cell activation and apoptosis by bacterial lipoproteins through toll-like receptor-2. Science 285, 736–739. Andonegui, G., Bonder, C.S., Green, F., Mullaly, S.C., Zbytnuik, L., Raharjo, E., Kubes, P., 2003. Endothelium-derived Toll-like receptor-4 is the key molecule in LPS-induced neutrophil sequestration into lungs. J. Clin. Invest. 111, 1011–1020. Balkwill, F., Coussens, L.M., 2004. Cancer: an inflammatory link. Nature 431, 405–406. Barton, G.M., Medzhitov, R., 2003. Toll-like receptor signaling pathways. Science 300, 1524–1525. Endo, K., Yoon, B.I., Pairojkul, C., Demetris, A.J., Sirica, A.E., 2002. ERBB-2 overexpression and cyclooxygenase-2 up-regulation in human

cholangiocarcinoma and risk conditions. Hepatology 36, 439–450. Harada, K., Ohira, S., Isse, K., Ozaki, S., Zen, Y., Sato, Y., Nakanuma, Y., 2003. Lipopolysaccharide activates nuclear factor-kB through toll-like receptors and related molecules in cultured biliary epithelial cells. Lab. Invest. 83, 1657–1667. Haswell-Elkins, M.R., Sithithaworn, P., Mairiang, E., Elkins, D.B., Wongratanacheewin, S., Kaewkes, S., Mairiang, P., 1991. Immune responsiveness and parasite-specific antibody levels in human hepato- biliary disease associated with Opisthorchis viverrini infection. Clin. Exp. Immunol. 84, 213–218. Haswell-Elkins, M.R., Satarug, S., Tsuda, M., Mairiang, E., Esumi, H., Sithithaworn, P., Mairiang, P., Saitoh, M., Yongvanit, P., Elkins, D.B.,

1994. Liver fluke infection and cholangiocarcinoma: model of

endogenous nitric oxide and extragastric nitrosation in human carcinogenesis. Mutat. Res. 305, 241–252. Hussain, S.P., Hofseth, L.J., Harris, C.C., 2003. Radical causes of cancer. Nat. Rev. Cancer 3, 276–285. IARC Working Group, 1994. Infection with liver flukes (Opisthorchis viverrini, Opisthorchis felineus and Clonorchis sinensis), In: IARC Monographs on the Evaluation of Carcinogenic Risks to Humans, vol. 61. IARC Lyon pp. 121–175. Kropf, P., Freudenberg, M.A., Modolell, M., Price, H.P., Herath, S., Antoniazi, S., Galanos, C., Smith, D.F., Muller, I., 2004. Toll-like receptor 4 contributes to efficient control of infection with the protozoan parasite Leishmania major. Infect. Immun. 72, 1920–1928. Medzhitov, R., Preston-Hurlburt, P., Janeway Jr., C.A., 1997. A human homologue of the Drosophila Toll protein signals activation of adaptive immunity. Nature 388, 394–397. Oshima, H., Oshima, M., Inaba, K., Taketo, M.M., 2004. Hyperplastic gastric tumors induced by activated macrophages in COX-2/mPGES-1 transgenic mice. EMBO J. 23, 1669–1678.

Pikarsky, E., Porat, R.M., Stein, I., Abramovitch, R., Amit, S., Kasem, S., Gutkovich-Pyest, E., Urieli-Shoval, S., Galun, E., Ben-Neriah, Y.,

2004. NF-kB functions as a tumour promoter in inflammation-

associated cancer. Nature 431, 461–466. Pinlaor, S., Yongvanit, P., Hiraku, Y., Ma, N., Semba, R., Oikawa, S., Murata, M., Sripa, B., Sithithaworn, P., Kawanishi, S., 2003. 8-Nitrogua- nine formation in the liver of hamsters infected with Opisthorchis viverrini. Biochem. Biophys. Res. Commun. 309, 567–571. Pinlaor, S., Ma, N., Hiraku, Y., Yongvanit, P., Semba, R., Oikawa, S., Murata, M., Sripa, B., Sithithaworn, P., Kawanishi, S., 2004a. Repeated

596

S. Pinlaor et al. / International Journal for Parasitology 35 (2005) 591–596

infection with Opisthorchis viverrini induces accumulation of 8- nitroguanine and 8-oxo-7,8-dihydro-2 0 -deoxyguanine in the bile duct of hamsters via inducible nitric oxide synthase. Carcinogenesis 25,

1535–1542.

Pinlaor, S., Sripa, B., Sithithaworn, P., Yongvanit, P., 2004b. Hepatobiliary changes, antibody response, and alteration of liver enzymes in hamsters re-infected with Opisthorchis viverrini. Exp. Parasitol. 108, 32–39. Sripa, B., Kaewkes, S., 2000. Localisation of parasite antigens and inflammatory responses in experimental opisthorchiasis. Int. J. Parasitol. 30, 735–740.

Surh, Y.J., Chun, K.S., Cha, H.H., Han, S.S., Keum, Y.S., Park, K.K., Lee, S.S., 2001. Molecular mechanisms underlying chemopreventive activities of anti-inflammatory phytochemicals: down-regulation of COX-2 and iNOS through suppression of NF-kB activation. Mutat. Res. 480-481, 243–268. van der Kleij, D., Latz, E., Brouwers, J.F., Kruize, Y.C., Schmitz, M., Kurt- Jones, E.A., Espevik, T., de Jong, E.C., Kapsenberg, M.L., Golenbock, D.T., Tielens, A.G., Yazdanbakhsh, M., 2002. A novel host-parasite lipid cross-talk. Schistosomal lyso-phosphatidylserine activates toll-like receptor 2 and affects immune polarization. J. Biol. Chem. 277, 48122–48129.

International Journal for Parasitology 35 (2005) 597–615 www.parasitology-online.com Invited review Insights into unique
International Journal for Parasitology 35 (2005) 597–615 www.parasitology-online.com Invited review Insights into unique

International Journal for Parasitology 35 (2005) 597–615

International Journal for Parasitology 35 (2005) 597–615 www.parasitology-online.com Invited review Insights into unique

Invited review

Insights into unique physiological features of neutral lipids in Apicomplexa: from storage to potential mediation in parasite metabolic activities

Isabelle Coppens a, *, Ole Vielemeyer b

a Department of Molecular Microbiology and Immunology, Johns Hopkins Bloomberg School of Public Health, 615 N. Wolfe Street, Baltimore, MD 21205-2223, USA b Laboratoires Constant Burg, Institut Curie, UMR 144/CNRS/IC, 26, rue d’Ulm, 75248 Paris, Cedex 05, France

Received 9 June 2004; received in revised form 5 January 2005; accepted 13 January 2005

Abstract

The fast intracellular multiplication of apicomplexan parasites including Toxoplasma and Plasmodium, requires large amounts of lipids necessary for the membrane biogenesis of new progenies. Hence, the study of lipids is fundamental in order to understand the biology and pathogenesis of these deadly organisms. Much has been reported on the importance of polar lipids, e.g. phospholipids in Plasmodium. Comparatively, little attention has been paid to the metabolism of neutral lipids, including sterols, steryl esters and acylglycerols. In eukaryotic cells, free sterols are membrane components whereas steryl esters and acylglycerols are stored in cytosolic lipid inclusions. The first part of this review describes the recent advances in neutral lipid synthesis and storage in Toxoplasma and Plasmodium. New potential pharmacological targets in the pathways producing neutral lipids are outlined. In addition to lipid bodies, Apicomplexa contain unique secretory organelles involved in parasite invasion named rhoptries. These compartments appear to sequester most of the cholesterol found in the exocytic pathway. The second part of the review focuses on rhoptry cholesterol and its potential roles in the biogenesis, structural organisation and function of these unique organelles among eukaryotes. q 2005 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

Keywords: Toxoplasma; Plasmodium; Lipid bodies; Rhoptries; Multivesicular bodies; Cholesterol; Cholesteryl esters; Triacylglycerol

1. Apicomplexa and lipid bodies

1.1. Lipid bodies in eukaryotic cells are more than simple energy storage structures

The formation of intracellular lipid particles occurs at some point in the life cycle of nearly all organisms, including plants, mammals, non-mammalian cells, algae and yeast as well as in some prokaryotes (reviewed in Zweytick et al., 2000). These structures are known as lipid bodies, lipid droplets (in adipocytes), adiposomes or oil bodies (in plants). Lipid bodies can be defined as a major form of macromolecular lipid assembly in biological systems. In contrast to the bilayer membrane of organelles,

* Corresponding author. Tel.: C1 443 287 1589; fax: C1 410 955 0105. E-mail address: icoppens@jhsph.edu (I. Coppens).

lipid bodies are surrounded by only one monolayer of amphipathic phospholipids, glycolipids and/or sterols that encircles a hydrophobic core of neutral lipids, such as steryl esters, diacylglycerol (DAG) and triacylglycerol (TAG). In mammalian cells, the major enzymes involved in lipid esterification are members of the membrane bound O-acyl transferase (MBOAT) family (Hofmann, 2000) that include acyl-CoA:cholesterol acyltransferase (ACAT) and acyl- CoA:diacylglycerol acyltransferase (DGAT), producing cholesteryl ester and TAG, respectively (Murphy, 2001). Two mammalian enzymes ACAT1 and ACAT2, utilising fatty acyl-CoA and cholesterol to produce cholesteryl esters, have been identified (summarised in Buhman et al., 2000; Chang et al., 2001). They are mainly localised within the endoplasmic reticulum, and both proteins display similar enzymologic properties with broad acyl-CoA specificity. The glycerol-3-phosphate pathway, also known

0020-7519/$30.00 q 2005 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

doi:10.1016/j.ijpara.2005.01.009

598

I. Coppens, O. Vielemeyer / International Journal for Parasitology 35 (2005) 597–615

as the Kennedy pathway is the major route for de novo TAG biosynthesis in all TAG-accumulating organisms (Lehner and Kuksis, 1996). This pathway involves the stepwise acylation of glycerol-3-phosphate and/or dihydroxyacetone phosphate to phosphatidic acid, which in turn is hydrolysed to DAG. DGAT catalyses the final and rate-limiting step, the transfer of the acyl group from acyl-CoA to DAG to form TAG (Lehner and Kuksis, 1996). Two different DGAT have been identified in eukaryotes. DGAT1 is phylogeneti- cally related to ACAT family members (Lehner and Kuksis, 1996; Cases et al., 1998; Oelkers et al., 1998; Bouvier-Nave et al., 2000; Farese et al., 2000; Sorger and Daum, 2002) while DGAT2 is not related to any known enzymes (Cases et al., 2001; Lardizabal et al., 2001). In mammals, DGAT1 is solely a microsomal membrane-protein (Farese et al., 2000) while in plants and yeast, this enzyme has a dual localisation and is found both on the endoplasmic reticulum and lipid (oil) bodies (Bouvier-Nave et al., 2000; Sorger and Daum, 2002). DGAT1 and DGAT2 have similar maximal capacities of TAG synthesis and share, like their ACAT counterparts, broad acyl-CoA specificities (Cases et al., 2001). In addition to the reaction catalysed by DGAT, other mechanisms for TAG synthesis have been observed in plants and yeast (Dahlqvist et al., 2000). Those include an acyl-CoA-independent pathway involving a phospholipid:

diacylglycerol acyltransferase, which is distantly related to the mammalian enzyme lecithin:cholesterol acyltransferase (Oelkers et al., 2000). Recently, a new type of DGAT, the bifunctional wax ester synthase/DGAT, has been identified in some bacteria and plants (Kalscheuer and Steinbu¨chel,

2003).

In multicellular organisms, DGAT displays a variety of physiological functions, including lipoprotein assembly, regulation of plasma TAG concentration or cytosolic DAG levels. As an allosteric activator of the protein kinase C, DAG links extracellular signals to intracellular events, resulting in important biological processes like cell proliferation and differentiation. In addition to its messenger properties, DAG is also a central metabolite in de novo biosynthesis of phospholipids (reviewed in van Blitterswijk and Houssa, 2000). In unicellular microorganisms, TAG can function as a reservoir for metabolic energy and stored TAG may be used as a fatty acid source for phospholipid biosynthesis. Neither neutral lipid biosynthesis nor lipid bodies are essential for yeast growth (Sandager et al., 2002) but accumulation of lipid bodies containing TAG appears to be specifically induced in response to metabolic stress or environmental changes (e.g. osmotic stress, nitrogen depletion; Murphy, 1990, 2001; van Blitterswijk and Houssa, 2000). There is now increasing evidence that most lipid bodies contain different populations of proteins that are more or less tightly bound to their surfaces. In mammalian cells, proteomic analysis of lipid body-associated proteins identified structural proteins; multiple enzymes involved in the synthesis, storage, utilisation (e.g. perilipin,

adipophilin; reviewed in Fujimoto et al., 2004), and degradation of cholesteryl esters and TAG; different Rab GTPases involved in regulating membrane traffic; signaling molecules; and proteins found in caveolae and lipid rafts (Liu et al., 2004; Fujimoto et al., 2004). Higher eukaryotic cells and yeast lipid bodies have strikingly similar proteomes that emphasise common functions in lipid metabolism (Athenstaedt et al., 1999). In plants, the major oil body-associated proteins, oleosins function as stabilisers of TAG. These proteins prevent subcellular oil bodies from coalescence, maintaining them as individual structures in plant seeds even after a long period of storage (reviewed in Zweytick et al., 2000). It is well known that lipid bodies store neutral lipids utilisable for energy (e.g. fatty acids as respiratory substrates), for membrane biogenesis (e.g. fatty acids, cholesterol) and/or for the formation of specific lipophilic components, (e.g. steroid hormones). However, the con- stellation of proteins associated with the lipid droplets, as listed above, indicates that these compartments are complex and metabolically active. In fact, they may be a nodal point for multiple intersecting membrane pathways, and be directly involved in membrane lipid recycling. In plants, for instance, another role of oil bodies might be to channel away toxic fatty acids from membranes by incorporating them in TAG (Ohlrogge and Jaworski, 1997). Yeast lipid body particles may serve as a degradation compartment for enzymes that are no longer needed or have been produced in excess (Lum and Wright, 1995). There are several models describing the biogenesis of intracellular lipid bodies (Fig. 1). First, the ‘budding model’ proposes that droplets of neutral lipids are formed within the bilayer of the endoplasmic reticulum, and then become free cytoplasmic particles, shielded by a phospholipid mono- layer after budding of these specific microdomains from the endoplasmic reticulum. The second ‘vesicle flux model’ hypothesises a mechanism of translocation of vesicles from the endoplasmic reticulum, which contain either neutral lipids or proteins, followed by their fusion to produce mature lipid bodies. As a third alternative, the ‘aggregation model’ suggests that specific lipid particle proteins form aggregates in the cytosol and encapsulate neutral lipids that pinched off from the endoplasmic reticulum (summarised in Murphy and Vance, 1999; Zweytick et al., 2000). Of importance, some of the most widespread human diseases such as atheroma, steatosis, obesity, and certain cancer types (Heid et al., 1998; Murphy and Vance, 1999) are linked to malfunction of lipid body metabolism. In addition, there is a series of recent findings demonstrating a mistargeting of unexpected proteins to the surface of lipid droplets under pathological conditions. Examples include the a-synuclein as a major component of the pathologic lesions characteristic of the Parkinson’s disease (Cole et al., 2002) and the Nir2 protein involved in retinal degeneration (Litvak et al., 2002). This further substantiates the emerging

I. Coppens, O. Vielemeyer / International Journal for Parasitology 35 (2005) 597–615

599

A BUDDING

mature LB

mature LB

cytosol

lumen ER

cytosol lumen ER
 

DGAT

ACAT

B VESICLE FLUX

 
 

mature LB

cytosol lumen ER

cytosol

lumen ER

 

DGAT

ACAT

C AGGREGATION

 

cytosol

lumen ER

cytosol lumen ER mature LB
cytosol lumen ER mature LB

mature LB

 

DGAT

ACAT

neutral lipids

neutral lipids

LB-associated protein

LB-associated protein

Fig. 1. Schematic depiction of three models for lipid body biogenesis (adapted from Zweytick et al., 2000). See text (Section 1.1) for details. ER, endoplasmic reticulum; LB, lipid body.

central role of lipid bodies and their proteins in many human physiological ailments.

1.2. Morphological observations illustrate that protozoa are also fat accumulators

Surprisingly, there is a paucity of information about neutral lipid metabolism and storage in ancient eukaryotes. In many comprehensive reviews on lipid bodies, no reference is made to lipid bodies in lower eukaryotes (Murphy and Vance, 1999; Zweytick et al., 2000; Murphy, 2001). However, microscopy studies performed on different

2001 ). However, microscopy studies performed on different Fig. 2. Ultrastructure of neutral lipid stores in

Fig. 2. Ultrastructure of neutral lipid stores in intracellular apicomplexan parasites. (A). Toxoplasma gondii inside a parasitophorous vacuole (PV) formed during the invasion of a human fibroblast. The parasites exhibit several lipid inclusions (arrows) in their cytoplasm, which are morpho- logically comparable with lipid bodies present in the host cells. For this image, malachite green was added to the fixative solution in order to stabilise the lipid elements and to enhance the staining of lipid-containing structures (Pourcho et al., 1978). Under such conditions, lipid structures in host cell and parasites alike appear compact, with a deeply stained matrix and an irregular border with small protruding granules but no discernable membrane. Toxoplasma lipid bodies contain cholesteryl esters and triacylglycerol (TAG). (B). Intravacuolar schizonts of Plasmodium falciparum inside a human red blood cell (RBC). As the parasites mature within erythrocytes, the number and size of lipid bodies (arrows) increase. The phenomenon coincides with the production of TAG in this parasite. Rh, rhoptries; A, apicoplast; Mt, mitochondrion; Mi, microneme; ER, endoplasmic reticulum; N, nucleus. Bars are 1 mm.

species of protozoa illustrate the presence of cytoplasmic lipid structures of 0.1–1.5 mm in diameter and devoid of membranous profiles. These compartments morphologically resemble lipid bodies in higher eukaryotic cells (Fig. 2(A)). Such presumed lipid inclusions have been identified in various apicomplexan parasites such as in the malarial agent

600

I. Coppens, O. Vielemeyer / International Journal for Parasitology 35 (2005) 597–615

Plasmodium falciparum (Fig. 2(B); Nawabi et al., 2003; Palacpac et al., 2004a,b; Vielemeyer et al., 2004), Toxo- plasma gondii the etiologic agent of toxoplasmosis (Fig. 2(A); Lindsay et al., 1993; Dubey et al., 1998; Coppens et al., 2000; Sonda et al., 2001; Charron and Sibley, 2002; Quittnat et al., 2004; Nishikawa et al., in press), Neospora caninum responsible for neosporosis in animals (Lindsay et al., 1993), Sarcocystis neurona causing equine myeloen- cephalitis (Speer and Dubey, 2001), Perkinsus marinus infecting oysters (Chu et al., 2000), Isospora suis causing porcine enteric diseases (Lindsay et al., 1991), Pterospora floridiensis living in the body cavity of polychaeta (Landers, 2002), Caryospora bigenetica infecting snakes and mam- mals (Sundermann and Lindsay, 1989), Eimeria nieschulzi infecting rodents (Sibert and Speer, 1980), as well as in different mammalian flagellates including trypanosomatids (Soares et al., 1987; Figueiredo et al., 1994), phytoflagellates (Klut et al., 1988), and in the ciliate Paramecium primaurelia (Ramoino et al., 2002). Recently, several investigator teams have tackled the task of analysing the composition and biogenesis of lipid bodies in some apicomplexan parasites at the molecular level. They have furthermore attempted to determine the role of neutral lipids in the pathogenesis of these parasites of great medical importance. Below we summarise the unique features of neutral lipid metabolism in P. falciparum and T. gondii and highlight the common themes in lipid body formation conserved from Apicomplexa to mammalian cells.

1.3. Toxoplasma is competent to synthesise cholesteryl esters using host mammalian cholesterol, but Plasmodium does not produce any steryl esters

In mammalian cells, cholesterol synthesised de novo and acquired exogenously via the low-density lipoprotein (LDL) pathway is esterified by fatty acids and stored in lipid bodies. Toxoplasma contains cholesterol (Foussard et al., 1991) but lacks the biosynthetic machinery to produce sterols (Coppens et al., 2000) as do many other protozoa (Furlong, 1989). Instead it diverts LDL-derived cholesterol from host mammalian cells by an unknown mechanism. Cultivation of intracellular T. gondii in the presence of LDL results in a remarkable increase in the number of lipid bodies and synthesis of cholesteryl esters in a LDL concentration-dependent manner (Nishikawa et al., in press). This clearly indicates that akin to mammalian cells, this parasite has developed a mechanism for cholesterol sensing, and following a massive delivery of exogenous cholesterol, it can expand its cholesterol storage pools through esterification of cholesterol-derived LDL (Charron and Sibley, 2002; Nishikawa et al., in press). Lipoprotein depletion, on the contrary, causes a progressive consumption of material stored in parasite’s lipid bodies, and after 2 days of LDL starvation, lipid dye-positive

structures can no longer be found in the cytoplasm of the parasite. While cholesteryl oleate is the main ester synthesised in mammalian cells (Yang et al., 1997), Toxoplasma prefer- entially utilises palmitate to esterify cholesterol (Nishikawa et al., in press). In addition, cultivation of intracellular parasites with excess palmitate results in a significant increase in cholesteryl ester synthesis and formation of lipid bodies. This preference might be due to a relatively facilitated uptake of exogenous palmitate in comparison with other fatty acids, and/or a selective biosynthesis of this fatty acid by the parasite. An explanation for the difference in fatty acid specificity between host cell and Toxoplasma enzymes may be related to a slight difference in the composition of the respective membrane regions where the ACAT are anchored (see below). The accessibility of coenzyme A to the active site of the acyltransferase may depend on the length and degree of desaturation of the acyl chains. In Toxoplasma, the function of esterification and storage of cholesterol molecules may be physiologically important since the parasite has to rely on an external source for this lipid. In fact, during its lifecycle T. gondii experiences a quiescent encysted stage and a brief extracellular phase that requires metabolic adaptations, such as the accumulation of a lipid reserve. In stark contrast to Toxoplasma, no erythrocytic stages of Plasmodium show any evidence for steryl ester synthesis, as shown in metabolic labeling experiments (Vial et al., 1984; Nawabi et al., 2003; Palacpac et al., 2004a,b; Vielemeyer et al., 2004). This observation is corroborated by the insensitivity of Plasmodium to potent inhibitors of steryl esterification, the lack of influence of exogenous cholesterol on lipid body formation (Vielemeyer et al., 2004), and finally the absence of genes in the malarial genome (http:// plasmodb.org/) encoding enzymes involved in sterol esterification. Stores of cholesteryl esters may not be required for the replication of erythrocytic stages of Plasmodium since plasmodial membranes contain only traces of cholesterol (Wunderlich et al., 1991; Nawabi et al., 2003; Palacpac et al., 2004a,b).

1.4. In Apicomplexa, TAG synthesis occurs via the glycerol- 3-phosphate pathway and is developmentally regulated in Plasmodium

Early studies document the presence of TAG in some plasmodial species and an increase of TAG level in the mature stages of erythrocytic Plasmodium grown in vivo and in vitro (Beach et al., 1977; Vial et al., 1982a,b). More recently, metabolic labeling studies using either saturated or unsaturated fatty acids, or DAG reveal an efficient incorporation of these lipid precursors into the TAG fraction of P. falciparum (Mitamura et al., 2000; Nawabi et al., 2003; Palacpac et al., 2004a,b; Vielemeyer et al., 2004). The accumulation of TAG increases with parasite maturation and seems strikingly more pronounced in mature

I. Coppens, O. Vielemeyer / International Journal for Parasitology 35 (2005) 597–615

601

trophozoites (26 h p.i.) compared to schizonts (38 h p.i.), indicating that TAG stores must be essential during the last steps of the intraerythrocytic development. The production of TAG in Plasmodium correlates with the biogenesis of cytoplasmic lipid bodies, which become relatively more abundant and larger as the parasites mature (Fig. 2(B)). Forty-two hours p.i., TAG degradation ensues, and the resulting breakdown products—the free fatty acids—are released into the medium during merozoite egress from erythrocytes (48 h p.i.; Palacpac et al., 2004a,b). Such TAG catabolism implies the existence of functional (phospho)- lipases and TAG lipase during the erythrocytic development of these parasites (Athenstaedt et al., 1999), for which a candidate gene is present in the Plasmodium database, during the erythrocytic development of these parasites. Incubation with trifluoperazine, a modulator of fatty acid incorporation into TAG, results in the disappearance of plasmodial lipid bodies (Palacpac et al., 2004a,b). This strongly suggests that a de novo TAG biosynthetic pathway via phosphatidic acid contributes to lipid body formation in Plasmodium. Incubation of Plasmodium-infected erythro- cytes with monoacylglycerol in the presence of oleate results in the production of DAG as a consequence of monoacylglycerol acylation (our personal data). Thus, as described in higher eukaryotic cells (Chen and Farese, 2000), the monoacylglycerol pathway leading to TAG production through a DGAT-mediated pathway is present in Plasmodium. What can be the physiological relevance of synthesis and accumulation of TAG in Plasmodium? As suggested for Toxoplasma (Charron and Sibley, 2002), lipid bodies in Plasmodium bloodstages might serve as an intracellular compartment to divert and concentrate host cell lipids for the biogenesis of parasite membranes, and possibly as a place for lipid metabolism during proliferation. Indeed, P. falciparum is capable of conversion of TAG to essential phospholipids (Vial et al., 2003). However, TAG as a reservoir of fatty acids for phospholipid synthesis seems less probable in Plasmodium, since no lipid bodies are detectable in ring stage parasites, which are rapidly growing and expanding to form large trophozoites, thus requiring a massive supply of lipids for membrane biogenesis. Instead, lipid stores are abundant in late trophozoites and schizonts, where most of the new membranes are already formed. Another possibility is that TAG may serve as a reservoir for fatty acids for oxidative catabolism to generate ATP. However, this is likewise improbable because this parasite seems to have an extremely low capacity for b-oxidation of fatty acids based on chromatography assays (Holz, 1977; Palacpac et al., 2004). This observation is supported by the lack of classical enzymes required for fatty acid catabolism in plasmodial genomes (Gardner et al., 2002). Nevertheless, this latter statement deserves deeper investigation by using, for example, integrated computational genomics to corro- borate the absence of any functional pathways linked to fatty acid oxidation in malarial parasites. Plasmodial

TAG could serve as a source of fatty acyl chains for the synthesis of glycerophospholipids or glycosylphosphatidy- linositol (GPI). This seems also unlikely, though, because the production rate and concentration of these two lipids are significantly higher, when compared with TAG (Vial et al., 1982a; Naik et al., 2000; Palacpac et al., 2004a,b). Alternatively, Mitamura and colleagues have evoked the possibility that TAG metabolism can be regarded as a unique dynamic cellular event that facilitates Plasmodium egress from the host erythrocyte. According to this hypothesis, a sudden massive release of fatty acids from TAG stores in the mature stages would destabilise and rupture both, the parasitophorous vacuole membrane (PVM) and the erythrocyte plasma membrane, facilitating parasite release and dissemination. Nonetheless, this scenario implies a selective targeting of parasite fatty acids to the PVM and host cell membranes, excluding parasite internal membranes, which is difficult to conceive in the context of our current knowledge on lipid trafficking. Metabolic labeling experiments using fatty acids or DAG performed on intracellular Toxoplasma demonstrate that this parasite is also able to take up both lipid precursors and incorporate them into a TAG fraction (Quittnat et al., 2004). Oleate can be incorporated into Toxoplasma DAG, reveal- ing that DAG is the acyl acceptor (Cases et al., 1998). As monitored for cholesteryl ester synthesis, T. gondii also incorporates preferentially palmitate into TAG, as com- pared to other fatty acids. Stored TAG may be a reservoir of fatty acids utilisable for phospholipid biosynthesis and/or exploitable as respiratory substrates in Toxoplasma, although a mechanism of oxidative degradation of fatty acids remains to be demonstrated in this parasite.

1.5. Toxoplasma has one DGAT and at least two isoforms of ACAT while the genome of Plasmodium contains only one member of the MBOAT family, probably involved in TAG synthesis

The genome of Toxoplasma (http://toxodb.org/) contains at least two genes encoding enzymes of the MBOAT family. Based on analysis of the predicted protein sequences and the conserved domains characterising the members of the MBOAT family, one Toxoplasma candidate has the major hallmarks of a DGAT1 enzyme (Fig. 3(A); Oelkers et al., 1998; Bouvier-Nave et al., 2000), while the other candidate shares the characteristics of mammalian ACAT1 (Fig. 3(B)). Similarly to their mammalian counterparts (Cases et al., 1998), the Toxoplasma-related DGAT1 and ACAT1 protein sequences, named TgDGAT1 or TgACAT1, respectively, have several membrane spanning domains as well as potential sites for N-glycosylation and tyrosine phosphoryl- ation, though the significance of the latter features is still unknown (Quittnat et al., 2004; Nishikawa et al., in press). The genes of TgDGAT1 and TgACAT1 contain multiple exons (Quittnat et al., 2004), as described for

602

I. Coppens, O. Vielemeyer / International Journal for Parasitology 35 (2005) 597–615

/ International Journal for Parasitology 35 (2005) 597–615 Fig. 3. Presence of conserved signatures characterising MB

Fig. 3. Presence of conserved signatures characterising MBOAT, ACAT and DGAT in the predicted protein sequences of TgACAT1, TgDGAT1 and PfDGAT1. (A). Sequence comparisons between TgDGAT1, PfDGAT1 and Homo sapiens DGAT1 (GenBank accession number L21934; Oelkers et al., 1998) show the presence of an invariant histidine positioned within a long hydrophobic region that characterises the superfamily of MBOAT (Hofmann, 2000; Cases et al., 1998); a remarkable motif thought to include the putative fatty acid binding site that is shared between all ACAT and DGAT1 (Bouvier-Nave et al., 2000); and two unique signatures of DGAT, one of them corresponding to the DAG/phorbol ester binding site located downstream of the a putative fatty acid binding site signature. (B). Sequence comparisons between TgACAT1 and Homo sapiens ACAT1 (accession number L21934; Chang et al., 1993) reveal the motif characterising the superfamily of MBOAT (see above); the putative fatty acid binding site; and the potential cholesterol binding site including a serine surrounded by an aromatic and/or basic amino acids (Guo et al., 2001). All these possible functional domains are consistent with the substrate utilisation properties of the parasite acyltransferases (Quittnat et al., 2004; Nishikawa et al., in press).

the mammalian homologues (Bouvier-Nave et al., 2000). Interestingly, two isoforms of TgACAT1, designated TgACAT1a and TgACAT1b derived from two full-length cDNA have been demonstrated in Toxoplamsa (Nishikawa et al., in press). TgACAT1a harbors a long hydrophilic

serine-rich region at the N-terminus, which is missing in TgACAT1b (Quittnat et al., 2004). TgDGAT, TgACAT1a and TgACAT1b are all integral membrane proteins localised to the parasite cortical and perinuclear endoplas- mic reticulum, and have never been detected at the surface of lipid bodies as found in plants or yeast (Sorger and Daum,

2002).

The transformation of a Saccharomyces cerevisiae mutant strain lacking neutral lipid production and so devoid of lipid bodies (quadruple knock-out are1D,are2D,dga1D, lro1D; Sandager et al., 2002) with a full length TgDGAT1 construct results in a significant increase of TAG synthesis. Furthermore, this TAG synthesis in mutant yeast correlates with formation of cytosolic lipid inclusions, resembling lipid bodies present in Toxoplasma (Quittnat et al., 2004). ACAT-deficient mammalian cells, when transfected with either TgACAT1a or TgACAT1b are restored in their capacity to synthesise cholesteryl ester (Quittnat et al., 2004). Mutagenesis of the conserved fatty acid and cholesterol binding sites of TgACAT1a abolishes the ACAT activity. When the mutant yeast strain is transformed with TgACAT1a in the absence of cholesterol, ergosteryl esters are produced, although neither ergosterol nor ergosteryl esters have ever been detected in Toxoplasma. The addition of cholesterol to the culture medium induces the synthesis of cholesteryl esters by the transformed mutant yeast strain. This demonstrates that unlike in higher eukaryotes or in yeast, where one particular steryl ester is predominantly synthesised (Yang et al., 1997), the ester- ification reaction in Toxoplasma is not specific to changes in the sterol side chain since both cholesteryl and ergosteryl esters are produced by the heterogeneously expressed Toxoplasma ACAT. In higher eukaryotic cells and yeast, ACAT and DGAT are encoded by two related groups of genes and their predicted sequences share highly homologous domains (Bouvier-Nave et al., 2000), suggesting that DGAT and ACAT genes might have arisen from a common ancestor, having displayed both functions. The divergence of Apicomplexa as well as dinoflagellates and ciliates is believed to have occurred more than one billion years ago, possibly before the separation of the three multicellular kingdoms of animals, plants and fungi (Escalante and Ayala, 1995). However, when heterogeneously expressed, TgDGAT1 cannot synthesise steryl esters just as TgACAT1 shows no activity of TAG production (Quittnat et al., 2004; Nishikawa et al., in press). This observation, thus assigns clearly separate enzymatic function to the two proteins present in lower eukaryotes. In Toxoplasma, both LDL-derived cholesterol and free fatty acids can serve as ACAT activators. The TgACAT1 mRNA expression, cellular cholesterol esterification and lipid droplet biogenesis appear to be coordinately regulated. Such a mechanism of transcriptional regulation of TgACAT1 suggests a unique sterol regulatory-like element present within the TgACAT1 gene promotors.

I. Coppens, O. Vielemeyer / International Journal for Parasitology 35 (2005) 597–615

603

In mammalian cells, by contrast, ACAT1 is regulated primarily by post-translational mechanisms (Chang et al., 1997). Only the expression level of one of the four human ACAT1 mRNAs changes due to the exogenous supply of cholesterol. Free fatty acids can increase mammalian ACAT1 mRNA levels of two on the four transcripts in a cell type specific manner and with some acyl-CoA preferences (Seo et al., 2001). Only one gene with significant homology to known members of the MBOAT family is present in the P. falciparum genome. This protein has numerous potential hydrophobic domains and is localised to the endoplasmic reticulum. Phylogenetic analysis shows that the parasite predicted protein sequence possesses the major hallmarks of the DGAT1 family (Fig. 3(A)), with the highest degree of homology with plant DGAT1. Recently, a direct role for PfDGAT1 in plasmodial TAG synthesis has been assigned to the parasite after transfection of mammalian cells with a synthetic PfDGAT1 gene, which showed an increase in DGAT activity compared to non transfected cells (Palacpac et al., 2004). In addition, this PfDGAT1 immunoreacts specifically with antibodies against TgDGAT1 and its transcription peak occurs during the late trophozoite stage, which coincides with maximal TAG synthesis and lipid body formation (Vielemeyer et al., 2004). Alternatively TAG synthesis may also occur through a non-DGAT pathway in Plasmodium as identified in yeast. Indeed, a phospholipid:diacylglycerol acyltransferase hom- ologue, which is distantly related to the mammalian enzyme lecithin:cholesterol acyltransferase (Dahlqvist et al., 2000; Sorger and Daum, 2003) does exist in the Plasmodium genome, although it does not have a significant percentage of identity with the yeast enzyme and its peak of transcription occurs not in the late trophozoite but the ring stage (Bozdech et al., 2003). However, experimental evidence reveals that disruption of the PfDGAT1 gene is deleterious in Plasmodium, leading to the presumption that PfDGAT1 plays a fundamental role in the intraerythrocytic proliferation of P. falciparum and that it likely acts as the major contributor for TAG biosynthesis. Being the only predicted plasmodial MBOAT, PfDGAT1 may also partici- pate in other aspects of lipid metabolism, e.g. modification of the fatty acid composition of phospholipids.

1.6. In addition to the cytoplasm, apicomplexan parasites accumulate neutral lipid components in unusual compartments

The location of neutral lipid components can been finely determined by exploiting the fluorescence properties of Nile Red, known to label membranes in addition to neutral lipid particles (Greenspan et al., 1985), or by using the malachite green aldehyde fixative technique, which is efficient to stabilise lipid elements that are otherwise extracted from cells during the preparations of samples for electron microscopy (Pourcho et al., 1978). In Toxoplasma, Nile Red

( Pourcho et al., 1978 ). In Toxoplasma , Nile Red Fig. 4. Ultrastructure of neutral

Fig. 4. Ultrastructure of neutral lipid deposits inside the parasitophorous vacuole (PV) of Toxoplasma and the digestive vacuole of Plasmodium. (A). Intravacuolar Toxoplasma gondii in a human fibroblast incubated in the presence of excess fatty acids. The arrows pinpoint large deposits of malachite green-positive material in the lumen of the PV, which faces host organelles associated with the parasitophorous vacuole membrane (PVM). This observation might substantiate the hypothesis on a biochemical exchange between host mitochondrial-associated membranes and the PVM to deliver lipids to the parasites. (B). Intravacuolar trophozoite of Plasmodium falciparum inside a human red blood cell (RBC). The presence of the malachite green-positive material closely associated with the digestive vacuole suggests that neutral lipids may contribute to the catalysis of hemozoin formation. Indeed, arrows clearly show a close association of neutral lipid deposits with hemozoin crystals. A, apicoplast; DV, digestive vacuole; Mt, mitochondrion; ER, endoplasmic reticulum; LB, lipid bodies; N, nucleus. Bars are 0.5 mm.

prominently decorates cytosolic lipid bodies and to a lesser extent the endoplasmic reticulum, the PVM and plasma membrane (Sonda et al., 2001; Charron and Sibley, 2002; Quittnat et al., 2004; Nishikawa et al., in press). Surprisingly, the Toxoplasma vacuole appears to be intensely labeled with Nile Red upon incubation with excess fatty acids, thus revealing neutral lipid deposits in the vacuolar space (Quittnat et al., 2004). Ultrastructural studies confirm large and abundant malachite green-positive structures in the lumen of the PV, mainly located between parasites and host mitochondria or endoplasmic reticulum associated with the PVM (Fig. 4(A); Quittnat et al., 2004). Shortly after parasite invasion, the PVM physically interacts with the host cell mitochondria and endoplasmic reticulum,

604

I. Coppens, O. Vielemeyer / International Journal for Parasitology 35 (2005) 597–615

owing to the anchoring of a secreted parasite protein into the PVM and the membranes of both mitochondria and endoplasmic reticulum (Sinai and Joiner, 2001). The close apposition of these host cell organelles with the PVM raises the possibility that a mechanism of direct interorganellar exchange (e.g. lipids) exists between host organelles and the PV. In mammalian cells, lipids manufactured in the endoplasmic reticulum transit from this organelle to mitochondria via specialised regions named the mitochon- drial-associated membrane (MAM), involving translocators that deliver phospholipids to the mitochondrial membranes for further modifications (Shiao et al., 1995). By analogy, lipid mobilisation to Toxoplasma may be facilitated by the physical association between host cell organelles and specific regions of the PVM. If so, the specific recruitment of host organelles mediated by invading parasites may be an important adaptation for lipid acquisition that facilitates intracellular Toxoplasma growth. The large lipid deposits visible in the lumen of the vacuole of intravacuolar parasites upon excess fatty acids may also be a direct consequence of parasite ACAT overexpression, ensuing neutral lipid secretion, as observed with mammalian apolipoprotein B from hepatocytes (Spady et al., 2000) and lipoprotein-like particles from astrocytes (Mutka et al., 2004). In Plasmodium, Nile Red identifies cytoplasmic lipid bodies as well as a population of intensely stained particles of a few hundred nanometers in size that are closely associated with the digestive vacuole and are composed of DAG and TAG (Fig. 4(B); Jackson et al., 2004). These particles may represent neutral lipid storage structures for lipid intermediates that are generated during digestion of phospholipids in the digestive vacuole. Indeed, there must be a large turnover of phospholipids during the growth of Plasmodium as it ingests the host haemoglobin through the cytostome. The endocytic compartments that are formed are surrounded by a double membrane originating from the parasite plasma membrane and the PVM. The outer membrane of the vesicles fuses with the digestive vacuole membrane, whereas the inner membrane is thought to be degraded by phospholipases (Yayon et al., 1984; Slomianny, 1990). Subsequently, the phospholipid break- down products may assemble into TAG. The close association of neutral lipids with the digestive vacuole suggests that they may function in processes occurring within this organelle. The digestive vacuole is the site of degradation of haemoglobin, which is endocy- tosed from the host cell cytosol. The digestion process results in the production of potentially toxic free haem. An important pathway for the detoxification of haem is the formation of crystals of haemozoin, the characteristic malarial pigment present within the digestive vacuole. Previous studies report that monoacylglycerol, DAG and TAG suspensions promote b-haematin (the synthetic equivalent of haemozoin) formation in vitro (Fitch et al., 1999; Papalexi et al., 2001; Pandey et al., 2003; Jackson et al., 2004). This observation raises the possibility that

the neutral lipid deposits associated with the parasite digestive vacuole may represent the site of haemozin

formation in vivo and that their lipid content assist in the crystallisation of haemozoin. In this context, it can be assumed that aggregates of DAG and other TAG precursors accumulate in the digestive vacuole before incorporation into neutral lipid bodies and play a role in haem detoxification during the early trophozoite stage of infec- tion. It has been reported that plasmodial histidine-rich proteins contribute to the catalysis of haemozoin formation

in vivo (Sullivan et al., 1996; Francis et al., 1997); however,

the levels of these proteins in the digestive vacuole are too

low to provide sufficient catalytic activity of haemoglobin (Papalexis et al., 2001; Akompong et al., 2002). Apicomplexa harbor a unique plastid-like organelle named the apicoplast, which probably is derived from the engulfment of a red alga in ancient times (reviewed in Waller and McFadden, 2005). Like plant chloroplasts, apicoplasts are semi-autonomous with their own genome and expression machinery. Apicoplasts possess two primary metabolic pathways for lipid synthesis: the type II pathway for de novo fatty acid synthesis, which provides the large bulk of fatty acids for apicomplexan parasites, and the 1-deoxy-D-xylulose 5-phosphate (DOXP) pathway produ- cing isoprenoids, which largely replaces the mevalonate pathway which has a very low activity in these parasites. In contrast to Toxoplasma and Plasmodium, plants also synthesise TAG in chloroplasts using a DGAT1 protein associated with chloroplast membranes; in plant chloro- plasts, the specific role of TAG appears to be the sequestration of fatty acids released from the catabolism of thylakoid galactolipids (Kaup et al., 2002). So far no stores of acylglycerols have been identified in apicoplasts.

1.7. ACAT and DGAT as pharmacological targets in Apicomplexa

It has been extensively shown for several protozoan parasites that lipid biosynthetic pathways are essential for their development and that these pathways represent valid targets for chemotherapeutic intervention (reviewed in Vial et al., 2003; Mitamura and Palacpac, 2003). Interfering with host cholesterol acquisition by Toxoplasma impairs parasite growth (Coppens et al., 2000). Since the parasite does not have the capability to synthesise sterols de novo, impairing cholesterol storage may be also detrimental for parasite survival in host cells. In mammalian cells, perturbation of the balance between cholesteryl esters and free cholesterol using pharmacological inhibitors of ACAT leads to the accumulation of excess amounts of free intracellular

cholesterol. This, in turn results in cell toxicity, and once

a critical mass of cholesterol is reached, free cholesterol

crystallisation occurs within the membrane bilayer (Kellner-Weibel et al., 1998). When added to the extracellular milieu, cholesterol acceptors (e.g. serum, high-density lipoproteins, apolipoprotein E, apolipoprotein

I. Coppens, O. Vielemeyer / International Journal for Parasitology 35 (2005) 597–615

605

A-I/phospholipid particles) can desorbs cholesterol from membranes and prevent a nucleation event from occurring. Incubation of intracellular Toxoplasma in the presence of selected ACAT inhibitors at non-toxic concentrations for mammalian cells, leads to a rapid rupture of parasite plasma membrane (Nishikawa et al., in press). This cytopathic effect is irreversible and likely linked to a massive incorporation of cholesterol into the parasite plasma membrane, provoking a complete destabilisation of the lipid bilayer. The higher sensitivity of Toxoplasma towards cholesterol esterification inhibitors compared to mammalian cells may be explained by the absence of physiological acceptors of cholesterol in the parasitophorous vacuolar space. In addition, Toxoplasma lacks caveolin and caveolae (our unpublished data), which in mammalian cells transfer cholesterol from the endoplasmic reticulum to the plasma membrane, and so mediate the efflux of free cholesterol (reviewed in Batetta et al., 2003). Therefore, the process of cholesterol esterification may be a potential drug target, since pharmacological reduction of cholesteryl esters results in a toxic buildup of free cholesterol in Toxoplasma. Both TgDGAT1 and PfDGAT1 mRNA are encoded by a single copy gene and disruption of the gene by knockout strategy results in the generation of non viable parasites (our personal data; Palacpac et al., 2004a,b), suggesting that the production of TAG is vital for Toxoplasma and Plasmodium and relies largely on their respective DGAT1, as described in higher eukaryotic cells. In these parasites, the step of DAG esterification may thus also be exploitable for the pharmacological reduction of the TAG levels. In plasmodial parasites, the potential role of neutral lipids in haemozoin formation may lead to the exploitation of these lipid-rich aggregates in the digestive vacuole to interfere with haemoglobin detoxification as anti-malarial targets.

2. Apicomplexa and rhoptries

2.1. Rhoptries have unique morphological and compositional features

In apicomplexan parasites, rhoptries are the largest apical organelles extending from the nuclear area through the conoid to the anterior plasma membrane. They vary in number depending on the life-cycle stage and the species (reviewed in Blackman and Bannister, 2001). Toxoplasma contains 8–12 rhoptries, while Plasmodium blood and insect stages have only two. Furthermore, mature rhoptries vary considerably in size and shape, ranging from pear-like structures in Plasmodium to long club-shaped organelles with a bulbous base and a narrowing apical peduncle in Toxoplasma. Rhoptries are membrane-bound organelles containing densely packaged granular material. In the intraerythrocytic stages of Plasmodium, maturing rhoptries form two distinctive regions, an apical reticular zone with electron-lucent areas separated by cords of granular

material, and a basal region with a more homogenously granular pattern (Bannister et al., 2000). Rhoptries in Toxoplasma are somewhat different as they contain a homogenous electron-dense apical region and a more heterogeneous basal portion with a honeycomb-like appear- ance, resembling internal lamellar structures (Fig. 5(A)). These remarkable ultrastructural distinctions between the duct and bulb, found in both parasites, might be ascribed to their differing polypeptide and lipid compositions, although the mechanism of such sub-compartmentalisation within rhoptries is still unclear (reviewed in Ngo et al., 2004). All rhoptry proteins identified so far are synthesised as inactive prepro-proteins (Ngo et al., 2004). The signal sequence is cleaved in the endoplasmic reticulum, while the pro-domain trimming occurs within the rhoptry compartment, which is acidic (Shaw et al., 1998) and contains various proteases. Toxoplasma and Plasmodium rhoptry proteins do not share any significant protein sequence homologies (detailed in Preiser et al., 2000). However, many of them in both parasites have predicted membrane-spanning domains and are found inserted into host cell membranes, suggesting a common role for rhoptry proteins (summarised in Sam-Yellowe, 1996). In fact, such transmembrane proteins are implicated in the invasion process, first promoting parasite adhesion to the host cell and subsequently expanding the PVM. In addition, some rhoptry proteins are involved in the host cell remodeling after completion of invasion. Fascinating examples include the host mitochondria and endoplasmic reticulum recruitment to the PV of Toxoplasma (Sinai and Joiner, 2001), possibly for nutrient scavenging from these organelles, and the structural modifications of the plasma membrane of Plasmodium-infected erythrocytes for promoting the cytoadhesion of infected cells to endothelial cells (Allred and Al-Khedery, 2004; Ling et al., 2004). More detailed studies reveal that Toxoplasma rhoptries contain lipids, including large amounts of phosphatidyl- choline and cholesterol (Fig. 5(B); Foussard et al., 1991; Coppens and Joiner, 2003). Morphological observations demonstrate a preponderance of cholesterol at the basal bulbous portions (Coppens and Joiner, 2003).

2.2. Rhoptries are analogous to secretory lysosomes and are derived from multivesicular endosomal precursors

Because of the striking morphology of rhoptries and their complex composition, the biogenesis of these organelles has been a long-standing puzzle. Indeed, the lack of early organelle markers has hindered the identification of rhoptry precursors, called immature, pre- or proto-rhoptries. Fol- lowing the attachment of Plasmodium to the erythrocyte surface, rhoptries discharge their contents into the host plasma membrane, then they disappear after parasite internalisation and are formed again de novo at the end of each erythrocytic cycle (Bannister et al., 1986). During this

606

I. Coppens, O. Vielemeyer / International Journal for Parasitology 35 (2005) 597–615

/ International Journal for Parasitology 35 (2005) 597–615 Fig. 5. Fine detailed analysis of the structure

Fig. 5. Fine detailed analysis of the structure of the rhoptry compartment in Toxoplasma gondii and comparison with mammalian multivesicular bodies (MVB). (A). Electron micrograph illustrating the intraluminal granular material in the bulbous base of rhoptries, reminiscent of lamellar sheets found in secretory lysosomes. Bar is 0.5 mm. (B). Fluorescence microscopy picture showing the pattern of filipin labeling associated with an intravacuolar parasite 20-min after invasion of a human fibroblast. Clearly the apical rhoptries and the parasitophorous vacuole membrane (PVM) are filipin-stained, and thus contain sterol (modified from Coppens and Joiner, 2003). (C). Serial sections of electron micrographs showing a rhoptry compartment containing internal vesicles. This organelle shares morphological similarities with MVB in higher eukaryotic cells, and may correspond to a multivesicular endosomal precursor of rhoptries. Bars are 0.2 mm. (D). Electron micrograph representing a typical MVB in a human fibroblast containing lamellar sheets and multiple small vesicles presumably originating from the invagination and pinching off of the limiting membrane into the luminal space. Bar is 0.2 mm. Rh, rhoptry; DG, dense granule; Mi microneme.

process, rhoptries first form as spheroidal structures that grow progressively by fusion of small vesicles around their margins. Microscopic observation suggests that rhoptry proteins travel through the secretory pathway while

maturing, and that they are formed by sequential fusion of post-Golgi vesicles (Jaikaria et al., 1993; Bannister et al., 2000). Recent studies emphasise that Plasmodium rhoptry proteins are selectively concentrated in distinctive lipid-rich

I. Coppens, O. Vielemeyer / International Journal for Parasitology 35 (2005) 597–615

607

microdomains of the endoplasmic reticulum and Golgi (Topolska et al., 2004). These microdomains first bud to form non-pedunculated condensing vesicles and later mature into rhoptries. There are multiple lines of evidence suggesting that rhoptries are analogous to lysosomal secretory organelles (Ngo et al., 2004). This hypothesis is based on the arguments that follow. In mammalian cells, secretory lysosomes release their content upon stimulation using a unique molecular machinery (reviewed in Blott and Griffiths, 2002). Similarly, the discharge of the rhoptry content is regulated, although the signal that triggers rhoptry secretion at the time of invasion remains to be identified. Mature secretory lysosomes have diverse types of structures, containing either dense cores or multilamellar sheaths, which are morphologically compar- able to the granular material accumulated inside the basal portion of rhoptries. Both secretory lysosomes and rhoptries have a low luminal pH and contain mature forms of lysosomal acid proteases. Furthermore, mammalian secretory lysosomes are pro- ducts of both biosynthetic and endocytic pathways. Their biogenesis initially involves small multivesicular bodies (MVB), in which the inner vesicles will progressively increase in size and number (reviewed in Blott and Griffiths, 2002). The formation of secretory lysosomes is dependent on adaptor complexes and sorting of transmembrane cargo containing cytoplasmic-tail tyrosine- and dileucine-target- ing signals. The internal membrane structures stored in the rhoptry lumen (Fig. 5(A) and (C)) are reminiscent of the intraluminal vesicles found in MVB and secretory lyso- somes (Fig. 5(D)), which are released into the extracellular milieu as exosomes (Denzer et al., 2000). Indeed, upon host cell invasion, such rhoptry-derived exosomal vesicles from Toxoplasma (Hakansson et al., 2001) or Plasmodium (Nichols et al., 1983; Stewart et al., 1986) contribute to parasite lipids and proteins of the PVM. In mammalian cells, MVB constitute common stations in the biosynthetic and endocytic pathways and function as spatial and temporal intermediates between early endosomes and lysosomes (Denzer et al., 2000; Raposo and Marks, 2002). Their internal vesicles originate from inward invaginations of the endosomal limiting membrane, enwrap- ping cytosolic material (van Deurs et al., 1993). During this process, selected membrane proteins are sequestered within these vesicles, whereas others remain at the limiting membrane. The sorting of some proteins to the internal vesicles is clearly determined by their association with specific lipid microdomains and/or recognition of sorting signals of pre-proteins by membrane receptors. Apicomplexa also utilise conserved endocytic proteins (e.g. rab proteins; Chaturvedi et al., 1999; Robibaro et al., 2002; Stedman et al., 2003; Quevillon et al., 2003) and coat proteins (e.g. adaptor- complex 1; Ngo et al., 2003) at the trans-Golgi network (TGN) and/or early endosomes to regulate protein trafficking to parasite compartments, including rhoptries. The delivery of pre-rhoptry proteins to mature rhoptries is mediated by

cytoplasmic-tail tyrosine- and dileucine-targeting signals that bind to the tyrosine-binding pocket of the adaptor- complex 1 (Hoppe et al., 2000; Ngo et al., 2003). There is emerging evidence that multivesicular endo- somes may intersect the rhoptry biogenesis pathway in Apicomplexa (Fig. 6; Yang et al., 2004). The inner vesicles of multivesicular precursors containing rhoptry proteins appear to be delivered to mature rhoptries along a pathway involving the protein-specific chaperone, vacuolar protein sorting 4 (VPS4; Babst et al., 1998; Beyer et al., 2003). Subsequently, the MVB morphology disappears and large electron-lucent vacuoles appear in the parasite cytoplasm. In yeast, the members of the class E of the VPS family may promote the formation of luminal membranes within MVB. Yeast mutant strains lacking any of the class E genes accumulate an exaggerated prevacuolar/late endosome compartment that amasses large multilamellar cisternal structures and contains both recycling TGN proteins and vacuolar proteins (Bishop and Woodman, 2000). The same phenomenon can be observed in mammalian cells deleted of genes homologous to the class E (Fujita et al., 2003). In an attempt to visualise multivesicular endosomes containing rhoptry material in Plasmodium or Toxoplasma as rhoptry precursors, parasite VPS4 orthologs containing dominant-negative mutations have been expressed in both parasites (Fig. 6; Yang et al., 2004). As observed in other eukaryotic cells, the expression of the VPS4 mutant leads to the accumulation of large swollen endosomal compart- ments, where the mutant VPS4 gene product, rhoptry proteins, endocytic markers (e.g. Rab5) as well as cholesterol accumulate. This observation demonstrates that VPS4 is a key regulatory protein in the membrane dynamics of endosomes in Apicomplexa and provides strong support that these parasites use multivesicular endosomes as intermediates at the cross-road of the endocytic and exocytic pathways for rhoptry formation.

2.3. Potential roles of rhoptry cholesterol in apicomplexan cell biology

Electron and epifluorescence microscopy studies using filipin, a cytomarker forming specific complexes with sterols, demonstrate the presence of sterol-filipin complexes at the apical pole of Toxoplasma (Fig. 5(B); Coppens and Joiner, 2003). Likewise, lipid analysis of rhoptry-enriched fractions reveals a relatively high level of free cholesterol. The molar cholesterol to phospholipid ratio in rhoptry organelles ranges from 1.4 to 1.5 (Foussard et al., 1991; Coppens and Joiner, 2003). This stands in sharp contrast to the amounts of cholesterol found in mammalian plasma membranes contain- ing the majority of cell cholesterol, which range between 0.5 and 1.0 (reviewed in Mason et al., 2003). Nevertheless, a variety of organised cholesterol-rich domains exist in biological membranes, which are essential for normal cell functions (summarised in Addadi et al., 2003). For example, sphingolipids and cholesterol

608

I. Coppens, O. Vielemeyer / International Journal for Parasitology 35 (2005) 597–615

/ International Journal for Parasitology 35 (2005) 597–615 Fig. 6. Hypothetical model of rhoptry biogenesis in

Fig. 6. Hypothetical model of rhoptry biogenesis in apicomplexan parasites. (A). Rhoptries are formed by contributions from both secretory and endocytic pathways. Biogenesis of rhoptries is mediated by adaptor-based vesicular trafficking (AP-1), most closely related to the sorting mechanism for secretory lysosomes. The cargo of rhoptry proteins from the trans-Golgi network (TGN) transits the endosomal pathway through a multivesicular body (MVB) en route to the immature rhoptry. Vacuolar protein sorting 4 (VPS4) may act as a regulator of membrane dynamics in the rhoptry endosomal pathway and/or a mediator of cholesterol transport. Cholesterol may be involved in MVB organisation and operate to sort and transport rhoptry proteins to the mature rhoptries. (B). Evidence for multivesicular endosomes (MVE) intersecting the rhoptry biogenesis pathway is derived from observations that Toxoplasma expressing parasite negative- dominant mutant of VPS4 exhibit arrested and enlarged MVE (adapted from Yang et al., 2004), where cholesterol, markers for early endosomes and rhoptry proteins lacking targeting signals accumulate. AP-1, adaptor complex-1; Go, Golgi; N, nucleus; Mt, mitochondrion; Rh, rhoptry; A, apicoplast. Bar is 0.25 mm.

dynamically cluster to form rafts that move within the lipid bilayer as distinct units; the cholesterol/phospholipid (C/PL) molar ratio is 1.2 in lipid rafts. Another remarkable motif of membrane cholesterol enrichment is observed in the plasma membrane of eye lens fiber cells, in which the C/PL molar ratio reaches values as high as 3.7 (Jacob et al., 2001). Lipid organisation of the lens membranes consists of the coexistence of distinct sterol-poor and -rich regions, in

which sterol monomers are arranged in a tail-to-tail orientation (Mason et al., 2003). The C/PL molar ratio is lowered down to 1.6 in the cataractous lens membranes (Jacob et al., 2001), suggesting that the maintenance of distinct cholesterol-enriched domains is necessary for the normal function of lens fiber cells. It can be assumed that cholesterol associated with rhoptries is relevant for rhoptry function, and therefore,

I. Coppens, O. Vielemeyer / International Journal for Parasitology 35 (2005) 597–615

609

may play a key role in the pathogenesis of Apicomplexa. So far it has not been determined whether cholesterol is highly concentrated at the level of the limiting membrane and/or is distributed towards the intraluminal vesicles of rhoptries. Likewise there is no evidence for a specific organisation of cholesterol into discrete domains in rhoptry membranes. Although the functional significance of rhoptry cholesterol is still enigmatic, several functions for this lipid can be proposed, based on recent data on rhoptry composition, biogenesis and role in parasite invasion.

2.3.1. Role in rhoptry structure

It is well established that cholesterol is the appropriate molecule to maintain a delicate balance between membrane rigidity (e.g. to allow large cell volumes) and membrane softness and fluidity (e.g. to allow membrane-embedded proteins to function properly; Bretscher and Munro, 1993). Cholesterol in amounts up to 3.0 mol% softens the lipid bilayer, and at concentrations higher than 4.0 mol% it leads to rigification, which is responsible for mechanical coher- ence of eukaryotic plasma membranes (reviewed in Rukmini et al., 2001). The plasma membrane, which contains more than 85% of total membrane cholesterol, is more rigid than any organellar membranes (Lancrajan et al., 2001). Acute cholesterol depletion causes accumulation of elastic flat-coated membranes and a corresponding decrease in stiff deep-coated pits (Subtil et al., 1999). In nervous tissues, the formation of cholesterol-rich domains induced by a myristoylated neuronal protein, transforms a smooth cell surface into convoluted structures (Maekawa et al., 1999; Epand et al., 2001). The extraordinarily high cholesterol content within the plasma membrane of eye lens fiber cells contributes to lens-cell rigidity and structural order. Indeed, the lens fiber cells are elongated, ordered in compact concentric lamellae, which minimises the extra- cellular space, a potential light scattering region detrimental for lens transparency (Mason et al., 2003). In Apicomplexa, cholesterol may be present in large excess within the limiting membrane of rhoptries. Serving as a building material, this lipid may play a structural role that contributes to the well-defined morphology of rhoptries, entailing the stiffness of the organelle.

2.3.2. Role in rhoptry protein sorting and MVB formation

In addition to proteinaceous coats, lipids as the major components of membranes play active roles in regulating membrane dynamics (reviewed in Gu et al., 2001; Miwako et al., 2001). Both, cholesterol–protein interactions and cholesterol-rich microdomains seem to be necessary in order to induce vesicle curvature and to assemble vesicle- specific proteins and lipids, respectively (Rukmini et al., 2001; Huttner and Zimmerberg, 2001). In mammalian cells, internal vesicles of MVB are also enriched in cholesterol (Mobius et al., 2003). This lipid is clearly implicated in MVB reorganisation that drives the sorting/transport of materials destined for the Golgi out of the pathways towards

lysosomes (Miwako et al., 2001). It is conceivable that in Apicomplexa, cholesterol might modulate the MVB traffic connected to mature rhoptries.

2.3.3. Role in formation of signaling platforms In general, rafts represent a type of membrane domain wherein lipids dynamically associate with each other, to form platforms important for membrane protein sorting and assembly of signaling complexes (Simons and Toomre, 2000). In mammalian cells, lipid rafts have been identified in different cell compartments (reviewed in Helms and Zurzolo, 2004). These include the endoplasmic reticulum (role in stabilisation of the association of GPI-proteins with the endoplasmic reticulum membranes), early Golgi cister- nae (role in maintenance of Golgi structure and function), the TGN (role in sorting of apical cargo proteins through specific interaction with apical targeting signals), the plasma membrane (after internalisation and fusion with the early endosomal system, role in raft-associated protein sorting towards the Golgi via late endosomes or the plasma membrane via the recycling compartment), early endo- somes (role in protein sorting towards the Golgi via late endosomes or recycling endosomes), internal vesicles of late endosomal MVB (role in protein sorting towards lysosomes or the plasma membrane), and consequently exosomes (participation in vesicle formation and structure; de Gassart et al., 2003). Cholesterol plays a central role in lipid raft organisation (Schroeder et al., 1998). Cellular cholesterol depletion or abnormal cholesterol accumulation in lipid raft-associated compartments results in mistrafficking of raft components (Pagano, 2003). In one of several models concerning the nature of rafts (reviewed in Simons and Ikonen, 1997; Pralle et al., 2000; Edidin, 2003; Zurzolo et al., 2003), it has been suggested that rafts are constructed of lipid shells. This model is based on interactions between lipids and proteins (e.g. caveolins, flotillins, stomatins). These proteins pene- trate the lipid bilayer and allow intimate contact with membrane lipids, which creates and stabilises liquid ordered phases in biological membranes (reviewed in Helms and Zurzolo, 2004). The existence of endoplasmic reticulum- and Golgi- localised rafts has been suggested in Plasmodium (Topolska et al., 2004). These lipid raft analogs contain a GPI- anchored protein, the rhoptry-associated membrane antigen (RAMA), which can form complexes with rhoptry proteins. Domains within parasite Golgi membranes enriched in RAMA bud to form vesicles that later generate proto-rhoptries. More interestingly, the nascent PVM of Plasmodium contains non-caveolar cholesterol-rich deter- gent-resistant membrane (DRM) rafts from both, parasite and host cell origin (Haldar et al., 2001; Murphy et al., 2004). A Plasmodium stomatin secreted from rhoptries and an erythrocyte stomatin-like protein-2 are strong candidates for the assembly of these lipid rafts (Hiller et al., 2003). In addition, DRM rafts are also present on the parasite plasma

610

I. Coppens, O. Vielemeyer / International Journal for Parasitology 35 (2005) 597–615

membrane, suggesting that establishment of malarial erythrocyte infection is linked to multiple DRM rafts. The association of stomatin with rhoptry raises the possibility that lipid rafts are present on the membranes of inner vesicles inside rhoptries before incorporation into the PVM. Wherever its localisation, stomatin in Plasmodium and in Toxoplasma where it is also present in the genome, may promote nucleation or stabilisation of raft domains in membranes of Apicomplexa, as reported for stomatin in various species.

2.3.4. Role in PVM formation

Studies on Plasmodium invasion suggest that the vacuolar membrane is derived mostly from lipids of rhoptries (Dluzewski et al., 1995; Bannister and Mitchell, 1989). In contrast, Ward et al. (1993) suggest that the PVM comes mainly from the erythrocyte bilayer. Upon Toxo- plasma entry, the plasma membrane of the host cell contributes the bulk of the lipids and selected proteins that are required for the formation of the PVM (Suss-Toby et al., 1996). Thereafter, Toxoplasma rhoptry-derived secretory vesicles may supply critical parasite proteins and lipids for the nascent formation of the hybrid PVM (Hakansson et al., 2001). The PVM surrounding Toxoplasma contains choles- terol at the time of invasion (Fig. 5(B); Coppens and Joiner, 2003). It has been speculated that rhoptry cholesterol is essential for the formation of the nascent PVM. When rhoptry cholesterol is depleted, however, parasite invasion is not impaired. In contrast, depletion of cholesterol from the host cell plasma membrane blocks parasite organelle exocytosis and invasion (Coppens and Joiner, 2003). The available data are not in favour of a substantial role of rhoptry cholesterol as extracellular effector at the time of invasion. Nevertheless, cholesterol molecules may be discharged into the PVM throughout the parasite’s intra- cellular lifecycle. This process could endow the PVM with properties favourable for parasite survival by giving it a lipid composition different from that of the host cell membranes.

for dense granules (Chaturvedi et al., 1999) and in the export of vesicular structures into the erythrocyte infected by Plasmodium (Hayashi et al., 2001). A direct role of cholesterol in the release of rhoptry proteins has been investigated using parasites depleted in rhoptry cholesterol, but data show that rhoptry discharge seems to be preserved under such conditions (Coppens and Joiner, 2003). This may suggest that rhoptry secretion does not rely on a direct fusion mechanism between the rhoptry membrane and the plasma membrane. The orientation of rhoptries with their peduncle pointed toward the top suggests that rhoptries have

a stable connection with the apical structures, or even a

permanent opening with the outside, regulated by unknown cholesterol-independent mechanisms.

2.3.6. Role in modulation of rhoptry protein functions Because cholesterol affects membrane properties, it can also manipulate the behavior and functions of proteins residing in membranes. In mammalian cells, a variety of integral membrane proteins, including ion channels, mem- brane receptors and enzymes, are sensitive to physical changes in the surrounding lipid bilayer (O’Connell et al., 2004; Harder, 2004). Some proteins can bind cholesterol directly via a sterol-sensing domain; as a result, they become either activated or inactivated (Kuwabara and Labouesse, 2002). Alternatively, it has been shown that the ordered arrangement of membrane cholesterol in lens fiber cells

interfere with the ability of extrinsic cataractogenic proteins

to aggregate at the cell surface (Mason et al., 2003).

The unique environment of the rhoptry contents includ- ing both protein and lipid components, which assemble to form membrane-like structures, leads to the assumption that specific biomolecular interactions between proteins and cholesterol must be prevailing in these organelles. The identification of rhoptry proteins that can bind to choles- terol, resulting in their functional activation or inhibition, will shed some light on the involvement of rhoptry cholesterol in pathogenesis of apicomplexan parasites.

2.3.5. Role in rhoptry exocytosis

Recent studies suggest that cholesterol and sphingolipid- rich microdomains in the plasma membrane play an essential role in regulated exocytosis pathways (summarised in Salaun et al., 2004). The association of soluble N-ethylmaleimide-sensitive factor-attachment protein receptor (SNARE) mediators of membrane fusion with lipid rafts act to concentrate the SNARE regulatory proteins, such as the N-ethylmaleimide-sensitive factor attachment protein (SNAP) at defined sites of the plasma membrane. Cholesterol depletion inhibits regulated exocytosis, suggesting that SNARE-dependent exocytosis occurs in cholesterol-rich domains in the plasma membrane. The soluble N-ethylmaleimide-sensitive factor (NSF)/ SNAP/SNARE machinery is present and functional in Apicomplexa and has been shown to participate in the discharge of secretory organelles in Toxoplasma, as shown

3. Concluding remarks

On one hand, Toxoplasma and Plasmodium share with mammalian cells the same typical organelles and conserved metabolic pathways found in any eukaryotic cells. How- ever, several studies have revealed that these parasites often employ them in unconventional ways. The presence of lipid bodies in the cytoplasm of apicomplexan parasites is to some extent not surprising, considering the important role of neutral lipids in membrane lipid metabolism reported for many organisms. Nonetheless, further research on lipid body composition, organisation, function and biogenesis in Apicomplexa will identify novel and unexpected features. For example, Toxoplasma and Plasmodium genome data- bases do not reveal any sequences homologous to lipid- body-associated proteins found in mammalian cells, plants

I. Coppens, O. Vielemeyer / International Journal for Parasitology 35 (2005) 597–615

611

Table 1 Questions for future research

On lipid bodies

What are the molecular mechanisms for host cholesterol transport to the

parasitophorous vacuole of Toxoplasma?

What are the carriers involved in host cholesterol translocation across the Toxoplasma plasma membrane and trafficking between parasite organelles?

How do nascent lipid bodies bud off from parasite membranes? Is it from the endoplasmic reticulum?

How is the mature size of lipid bodies determined?

What are the triggers of cholesteryl esters and triacylglycerol

remobilisation from lipid bodies?

What is the nature of the parasite specific lipid body-associated

proteins?

Is the neutral lipid biosynthesis coordinated with the synthesis of lipid body-associated proteins?

Do the cytosolic lipid bodies exchange their lipid cargo with

organelles?

Is lipid storage in lipid bodies essential or dispensable for Apicomplexa development?

What are the common themes in lipid body biogenesis between higher and lower eukaryotes?

On rhoptries

What is the mechanism underlying cholesterol tropism and

concentration into rhoptries?

How can Apicomplexa regulate the cholesterol content associated with

rhoptries?

Is cholesterol delivery to the rhoptries coordinated with the synthesis of specific rhoptry proteins?

What are the potential rhoptry proteins that can bind cholesterol and what is the nature of their physical interactions with cholesterol?

What is the fine organisation of membrane cholesterol in rhoptries?

What is the physiological relevance of cholesterol accumulation in rhoptries?

If secreted into the parasite environment, what is the fate of rhoptry cholesterol?

Do rhoptries play a role in cholesterol exchange between parasite organelles?

or yeast, although such regulatory molecules are likely present at the surface of their lipid bodies. On the other hand, Toxoplasma and Plasmodium have unusual organelles among eukaryotes, exemplified by rhoptries exclusively present in the Apicomplexa phylum. Rhoptries have begun to emerge from relative obscurity with the recognition that they are complex proteolipid organelles playing dynamic roles in parasite invasion, and perhaps in cholesterol metabolism. From the cell biology’s point of view, the original features provided by the study of rhoptries may offer a unique perspective to elucidate basic concepts in mammalian cell biology, such as the formation of MVB, exosomal secretion, and cholesterol homeostasis. From a therapeutical point of view, new information on lipid bodies or rhoptries in Apicomplexa could pinpoint potential drug targets exploitable to cure infection caused by these deadly parasites. Although current studies on lipid bodies and rhoptries in apicomplexan parasites leave innumerable questions (see Table 1), the increasing sophistication of molecular and biochemical techniques and a greater

awareness of comparative studies between higher and lower eukaryotes makes us optimistic that many of these questions will be soon answered.

Acknowledgements

We are grateful to members of our laboratory, labora- tories of Keith Joiner (Yale University, CT) and Vern Carruthers (Johns Hopkins University, MD) as well as to our collaborators who have been studying the fascinating aspects of neutral lipid metabolism in apicomplexan parasites. This work was supported by a grant from the American Heart Association (SDG 0230079N) to IC.

References

Addadi, L., Geva, M., Kruth, H.S., 2003. Structural information about organized cholesterol domains from specific antibody recognition. Biochim. Biophys. Acta 1610, 208–216. Akompong, T., Kadekoppala, M., Harrison, T., Oksman, A., Goldberg, D.E., Fujioka, H., Samuel, B.U., Sullivan, D., Haldar, K.,

2002. Trans-expression of a Plasmodium falciparum histidine-rich protein II (HRPII) reveals sorting of soluble proteins in the periphery of the host erythrocyte and disrupts transport to the malarial food vacuole. J. Biol. Chem. 277, 28923–28933. Allred, D.R., Al-Khedery, B., 2004. Antigenic variation and cytoadhesion in Babesia bovis and Plasmodium falciparum: different logics achieve the same goal. Mol. Biochem. Parasitol. 134, 27–35. Athenstaedt, K., Zweytick, D., Jandrositz, A., Kohlwein, S.D., Daum, G.,

1999. Identification and characterisation of major lipid particle proteins

of the yeast Saccharomyces cerevisiae. J. Bacteriol. 181, 6441–6448. Babst, M., Wendland, B., Estepa, E.J., Emr, S.D., 1998. The Vps4p AAA ATPase regulates membrane association of a Vps protein complex required for normal endosome function. Eur. Mol. Biol. Org. J. 17,

2982–2993.

Bannister, L.H., Mitchell, G.H., Butcher, G.A., Dennis, E.D., 1986. Lamellar membranes associated with rhoptries in erythrocytic merozoites of Plasmodium knowlesi: a clue to the mechanism of invasion. Parasitology 92, 291–303. Bannister, L.H., Mitchell, G.H., 1989. The fine structure of secretion by Plasmodium knowlesi merozoites during red cell invasion. J. Protozool. 36, 362–367.

Bannister, L.H., Hopkins, J.M., Fowler, R.E., Krishna, S., Mitchell, G.H.,

2000. Ultrastructure of rhoptry development in Plasmodium falciparum

erythrocytic schizonts. Parasitology 121, 273–287. Batetta, B., Mulas, M.F., Sanna, F., Putzolu, M., Bonatesta, R.R., Gasperi-

Campani, A., Roncuzzi, L., Baiocchi, D., Dessi, S., 2003. Role of

cholesterol ester pathway in the control of cell cycle in human aortic smooth muscle cells. Fed. Am. Soc. Exp. Biol. J. 17, 746–748.

, lophurae, and of erythrocytes and plasma of normal and P. lophurae- infected Pekin ducklings. J. Parasitol. 63, 62–75. Beyer, A., Scheuring, S., Muller, S., Mincheva, A., Lichter, P., Kohrer, K., 2003. Comparative sequence and expression analyses of four mammalian VPS4 genes. Gene 305, 47–59. Bishop, N., Woodman, P., 2000. ATPase-defective mammalian VPS4 localises to aberrant endosomes and impairs cholesterol trafficking. Mol. Biol. Cell 11, 227–239. Blackman, M.J., Bannister, L.H., 2001. Apical organelles of Apicomplexa:

Beach, D.H., Sherman, I.W., Holz Jr

G.G., 1977. Lipids of Plasmodium

biology and isolation by subcellular fractionation. Mol. Biochem. Parasitol. 117, 11–25.

612

I. Coppens, O. Vielemeyer / International Journal for Parasitology 35 (2005) 597–615

Blott, E.J., Griffiths, G.M., 2002. Secretory lysosomes. Nature Rev. Mol. Cell Biol. 3, 122–131.

Dluzewski, A.R., Zicha, D., Dunn, G.A., Gratzer, W.B., 1995. Origins of the parasitophorous vacuole membrane of the malaria parasite: surface

Bouvier-Nave, P., Benveniste, P., Oelkers, P., Sturley, S.L., Schaller, H.,

area of the parasitized red cell. Eur. J. Cell. Biol. 68, 446–449.

2000.

Expression in yeast and tobacco of plant cDNAs encoding acyl

Dubey, J.P., Lindsay, D.S., Speer, C.A., 1998. Structures of Toxoplasma

CoA:diacylglycerol acyltransferase. Eur. J. Biochem. 267, 85–96. Bozdech, Z., Llinas, M., Pulliam, B.L., Wong, E.D., Zhu, J., DeRisi, J.L.,

gondii tachyzoites, bradyzoites, and sporozoites and biology and development of tissue cysts. Clin. Microbiol. Rev. 11, 267–299.

2003.

The transcriptome of the intraerythrocytic developmental cycle of

Edidin, M., 2003. The state of lipid rafts: from model membranes to cells.

Plasmodium falciparum,. PLoS Biol. 1, 85–100. Bretscher, M.S., Munro, S., 1993. Cholesterol and the golgi apparatus. Science 261, 1280–1281. Buhman, K.F., Accad, M., Farese, R.V., 2000. Mammalian acyl- 3CoA:cholesterol acyltransferases. Biochim. Biophys. Acta 1529,

Annu. Rev. Biophys. Biomol. Struct. 32, 257–283. Epand, R.M., Maekawa, S., Yip, C.M., Epand, R.F., 2001. Protein-induced formation of cholesterol-rich domains. Biochemistry 40, 10514–10521. Escalante, A.A., Ayala, F.J., 1995. Evolutionary origin of Plasmodium and other Apicomplexa based on rRNA genes. Proc. Natl Acad. Sci. USA

142–154.

Cases, S., Smith, S.J., Zheng, Y.W., Myers, H.M., Lear, S.R., Sande, E., Novak, S., Collins, C., Welch, C.B., Lusis, A.J., Erickson, S.K., Farese Jr., R.V., 1998. Identification of a gene encoding an acyl CoA:dia- cylglycerol acyltransferase, a key enzyme in triacylglycerol synthesis. Proc. Natl Acad. Sci. USA 95, 13018–13023. Cases, S., Stone, S.J., Zhou, P., Yen, E., Tow, B., Lardizabal, K.D.,

R.V., 2001. Cloning of DGAT2, a second

, mammalian diacylglycerol acyltransferase, and related family mem- bers. J. Biol. Chem. 276, 38870–38876. Chang, C.C., Huh, H.Y., Cadigan, K.M., Chang, T.Y., 1993. Molecular cloning and functional expression of human acyl-coenzyme A:choles- terol acyltransferase cDNA in mutant Chinese hamster ovary cells.

Voelker, T., Farese Jr

Opin. Lipidol. 12, 289–296.

92, 5793–5797. Farese Jr., R.V., Cases, S., Smith, S.J., 2000. Triglyceride synthesis:

insights from the cloning of diacylglycerol acyltransferase. Curr. Opin. Lipidol. 11, 229–234. Figueiredo, R.C., Steindel, M., Soares, M.J., 1994. The reservosomes of epimastigote forms of Trypanosoma cruzi: occurrence during in vitro cultivation. Parasitol. Res. 80, 517–522. Fitch, C.D., Cai, G.Z., Chen, Y.F., Shoemaker, J.D., 1999. Involvement of lipids in ferriprotoporphyrin IX polymerization in malaria. Biochim. Biophys. Acta 1454, 31–37. Foussard, F., Leriche, M.A., Dubremetz, J.F., 1991. Characterization of the lipid content of Toxoplasma gondii rhoptries. Parasitology 102,

367–370.

J. Biol. Chem. 268, 20747–20755. Chang, T.Y., Chang, C.C., Cheng, D., 1997. Acyl-coenzyme A:cholesterol acyltransferase. Annu. Rev. Biochem. 66, 613–638. Chang, T.Y., Chang, C.C., Lin, S., Yu, C., Li, B.L., Miyazaki, A., 2001. Roles of acyl-coenzyme A:cholesterol acyltransferase-1 and -2. Curr.

Charron, A.J., Sibley, L.D., 2002. Host cells: mobilizable lipid resources for the intracellular parasite Toxoplasma gondii. J. Cell Sci. 115, 3049–

Francis, S.E., Sullivan Jr., D.J., Goldberg, D.E., 1997. Hemoglobin metabolism in the malaria parasite Plasmodium falciparum. Annu. Rev. Microbiol. 51, 97–123. Fujimoto, Y., Itabe, H., Sakai, J., Makita, M., Noda, J., Mori, M., Higashi, Y., Kojima, S., Takano, T., 2004. Identification of major proteins in the lipid droplet-enriched fraction isolated from the human hepatocyte cell line HuH7. Biochim. Biophys. Acta 1644, 47–59. Fujita, H., Yamanaka, M., Imamura, K., Tanaka, Y., Nara, A.,

3059.

Yoshimori, T., Yokota, S., Himeno, M., 2003. A dominant negative

Chaturvedi, S., Qi, H., Coleman, D., Rodriguez, A., Hanson, P.I., Striepen, B., Roos, D.S., Joiner, K.A., 1999. Constitutive calcium-

form of the AAA ATPase SKD1/VPS4 impairs membrane trafficking out of endosomal/lysosomal compartments: class E vps phenotype in

independent release of Toxoplasma gondii dense granules occurs through the NSF/SNAP/SNARE/Rab machinery. J. Biol. Chem. 274,

mammalian cells. J. Cell Sci. 116, 401–414. Furlong, S.T., 1989. Sterols of parasitic protozoa and helminths. Exp.

2424–2431.

Parasitol. 68, 482–485.

Chen, H.C., Farese Jr

,

R.V., 2000. DGAT and triglyceride synthesis:

Gardner, M.J., Shallom, S.J., Carlton, J.M., Salzberg, S.L., Nene, V.,

a

new target for obesity treatment?. Trends Cardiovasc. Med. 10,

Shoaibi, A., Ciecko, A., Lynn, J., Rizzo, M., Weaver, B., Jarrahi, B.,

188–192.

Brenner, M., Parvizi, B., Tallon, L., Moazzez, A., Granger, D., Fujii, C.,

Chu, F.E., Soudant, P., Volety, A.K., Huang, Y., 2000. Uptake and interconversion of fluorescent lipid analogs in the protozoan parasite, perkinsus marinus, of the oyster, crassostrea virginica. Exp. Parasitol. 95, 240–251. Cole, N.B., Murphy, D.D., Grider, T., Rueter, S., Brasaemle, D., Nussbaum, R.L., 2002. Lipid droplet binding and oligomerization properties of the parkinson’s disease protein a-synuclein. J. Biol. Chem. 277, 6344–6352. Coppens, I., Joiner, K.A., 2003. Host but not parasite cholesterol controls Toxoplasma cell entry by modulating organelle discharge. Mol. Biol. Cell 14, 3804–3820. Coppens, I., Sinai, A.P., Joiner, K.A., 2000. Toxoplasma gondii exploits

Hansen, C., Pederson, J., Feldblyum, T., Peterson, J., Suh, B., Angiuoli, S., Pertea, M., Allen, J., Selengut, J., White, O., Cummings, L.M., Smith, H.O., Adams, M.D., Venter, J.C., Carucci, D.J., Hoffman, S.L., Fraser, C.M., 2002. Sequence of Plasmodium falciparum chromosomes 2, 10, 11 and 14. Nature 419, 531–534. Greenspan, P., Mayer, E.P., Fowler, S.D., 1985. Nile Red: a selective fluorescent stain for intracellular lipid droplets. J. Cell Biol. 100, 965–973. Gu, F., Crump, C.M., Thomas, G., 2001. Trans-golgi network sorting. Cell. Mol. Life Sci. 58, 1067–1084. Guo, Z., Cromley, D., Billheimer, J.T., Sturley, S.L., 2001. Identification of potential substrate-binding sites in yeast and human acyl-CoA sterol

host LDL receptor-mediated endocytosis for cholesterol acquisition. J. Cell Biol. 149, 167–180.

acyltransferases by mutagenesis of conserved sequences. J. Lipid Res. 42, 1282–1291.

Dahlqvist, A., Stahl, U., Lenman, M., Banas, A., Lee, M., Sandager, L., Ronne, H., Stymne, S., 2000. Phospholipid:diacylglycerol acyltransfer- ase: an enzyme that catalyzes the acyl-CoA-independent formation

Hakansson, S., Charron, A.J., Sibley, L.D., 2001. Toxoplasma evacuoles: a two-step process of secretion and fusion forms the parasitophorous vacuole. Eur. Mol. Biol. Org. J. 20, 3132–3144.

of

triacylglycerol in yeast and plants. Proc. Natl Acad. Sci. USA 97,

Haldar, K., Samuel, B.U., Mohandas, N., Harrison, T., Hiller, N.L., 2001.

6487–6492.

Transport mechanisms in Plasmodium-infected erythrocytes: lipid rafts

de Gassart, A., Geminard, C., Fevrier, B., Raposo, G., Vidal, M., 2003. Lipid raft-associated protein sorting in exosomes. Blood 102,

and a tubovesicular network. Int. J. Parasitol. 31, 1393–1401. Harder, T., 2004. Lipid raft domains and protein networks in T-cell receptor

4336–4344.

signal transduction. Curr. Opin. Immunol. 16, 353–359.

Denzer, K., Kleijmeer, M.J., Heijnen, H.F., Stoorvogel, W., Geuze, H.J.,

Hayashi, M., Taniguchi, S., Ishizuka, Y., Kim, H.S., Wataya, Y.,

2000.

Exosome: from internal vesicle of the multivesicular body to

Yamamoto, A., Moriyama, Y., 2001. A homologue of N-ethylmalei-

intercellular signaling device. J. Cell Sci. 19, 3365–3374.

mide-sensitive factor in the malaria parasite Plasmodium falciparum is

I. Coppens, O. Vielemeyer / International Journal for Parasitology 35 (2005) 597–615

613

exported and localised in vesicular structures in the cytoplasm of infected erythrocytes in the brefeldin A-sensitive pathway. J. Biol. Chem. 276, 15249–15255. Heid, H.W., Moll, R., Schwetlick, I., Rackwitz, H.R., Keenan, T.W., 1998. Adipophilin is a specific marker of lipid accumulation in diverse cell types and diseases. Cell Tissue Res. 294, 309–321.

Helms, J.B., Zurzolo, C., 2004. Lipids as targeting signals: lipid rafts and intracellular trafficking. Traffic 5, 247–254. Hiller, N.L., Akompong, T., Morrow, J.S., Holder, A.A., Haldar, K., 2003. Identification of a stomatin orthologue in vacuoles induced in human erythrocytes by malaria parasites. J. Biol. Chem. 278, 48413–48421. Hofmann, K., 2000. A superfamily of membrane-bound o-acyltransferases with implications for wnt signaling. Trends Biochem. Sci. 25, 111–112.

G.G., 1977. Lipids and the malarial parasite. World Health Organ

Holz Jr

, 55, 237–248 (Bull). Hoppe, H.C., Ngo, H.M., Yang, M., Joiner, K.A., 2000. Targeting to rhoptry organelles of Toxoplasma gondii involves evolutionarily

conserved mechanisms. Nature Cell Biol. 2, 449–456. Huttner, W.B., Zimmerberg, J., 2001. Implications of lipid microdomains for membrane curvature, budding and fission. Curr. Opin. Cell Biol. 13,

478–484.

Jackson, K.E., Klonis, N., Ferguson, D.J., Adisa, A., Dogovski, C., Tilley, L., 2004. Food vacuole-associated lipid bodies and hetero- geneous lipid environments in the malaria parasite, Plasmodium falciparum. Mol. Microbiol. 54, 109–122. Jacob, R.F., Cenedella, R.J., Mason, R.P., 2001. Evidence for distinct cholesterol domains in fiber cell membranes from cataractous human lenses. J. Biol. Chem. 276, 13573–13578.

Jaikaria, N.S., Rozario, C., Ridley, R.G., Perkins, M.E., 1993. Biogenesis of rhoptry organelles in Plasmodium falciparum. Mol. Biochem. Parasitol. 57, 269–279. Kalscheuer, R., Steinbuchel, A., 2003. A novel bifunctional wax ester synthase/acyl-CoA:diacylglycerol acyltransferase mediates wax ester and triacylglycerol biosynthesis in Acinetobacter calcoaceticus ADP1.

J. Biol. Chem. 278, 8075–8082.

Kaup, M.T., Froese, C.D., Thompson, J.E., 2002. A role for diacylglycerol

acyltransferase during leaf senescence. Plant Physiol. 129, 1616–1626. Kellner-Weibel, G., Jerome, W.G., Small, D.M., Warner, G.J., Stoltenborg, J.K., Kearney, M.A., Corjay, M.H., Phillips, M.C., Rothblat, G.H., 1998. Effects of intracellular free cholesterol accumu- lation on macrophage viability: a model for foam cell death. Arterioscler. Thromb. Vasc. Biol. 18, 423–431.

Klut, M.E., Bisalputra, T., Antia, N.J., 1988. The use of fluorochromes in the cytochemical characterization of some phytoflagellates. Histochem.

J. 20, 35–40.

Kuwabara, P.E., Labouesse, M., 2002. The sterol-sensing domain: multiple families, a unique role?. Trends Genet. 18, 193–201. Lancrajan, I., Diehl, H.A., Socaciu, C., Engelke, M., Zorn-Kruppa, M., 2001. Carotenoid incorporation into natural membranes from artificial carriers: liposomes and beta-cyclodextrins. Chem. Phys. Lipids 112, 1–10. Landers, S.C., 2002. The fine structure of the gamont of Pterospora

floridiensis (Apicomplexa: Eugregarinida). J. Eukaryot. Microbiol. 49,

220–226.

Lardizabal, K., Mai, J.T., Wagner, N.W., Wyrick, A., Voelker, T.,

Hawkins, D.J., 2001. DGAT2 is a new diacylglycerol acyltransferase gene family: purification, cloning, and expression in insect cells of two polypeptides from Mortierella ramanniana with diacylglycerol acyl- transferase activity. J. Biol. Chem. 276, 38862–38869. Lehner, R., Kuksis, A., 1996. Biosynthesis of triacylglycerols. Prog. Lipid Res. 35, 169–201. Lindsay, D.S., Blagburn, B.L., Toivio-Kinnucan, M., 1991. Ultrastructure of developing Isospora suis in cultured cells. Am. J. Vet. Res. 52,

471–473.

Lindsay, D.S., Speer, C.A., Toivio-Kinnucan, M.A., Dubey, J.P.,

Blagburn, B.L., 1993. Use of infected cultured cells to

compare ultrastructural features of Neospora caninum from dogs and Toxoplasma gondii. Am. J. Vet. Res. 54, 103–106. Ling, I.T., Florens, L., Dluzewski, A.R., Kaneko, O., Grainger, M., Yim Lim, B.Y., Tsuboi, T., Hopkins, J.M., Johnson, J.R., Torii, M., Bannister, L.H., Yates 3rd., J.R., Holder, A.A., Mattei, D., 2004. The Plasmodium falciparum clag9 gene encodes a rhoptry protein that is transferred to the host erythrocyte upon invasion. Mol. Microbiol. 52,

107–118.

Litvak, V., Shaul, Y.D., Shulewitz, M., Amarilio, R., Carmon, S., Lev, S.,

2002. Targeting of Nir2 to lipid droplets is regulated by a specific

threonine residue within its PI-transfer domain. Curr. Biol. 12, 1513–

1518.

Liu, P., Ying, Y., Zhao, Y., Mundy, D.I., Zhu, M., Anderson, R.G., 2004. Chinese hamster ovary K2 cell lipid droplets appear to be metabolic

organelles involved in membrane traffic. J. Biol. Chem. 279,

3787–3792.

Lum, P.Y., Wright, R., 1995. Degradation of HMG-CoA reductase-induced membranes in the fission yeast, Schizosaccharomyces pombe. J. Cell Biol. 131, 81–94. Maekawa, S., Sato, C., Kitajima, C.K., Funatsu, N., Kumanogoh, H., Sokawa, Y., 1999. Cholesterol-dependent localisation of NAP-22 on

a neuronal membrane microdomain (raft). J. Biol. Chem. 274,

21369–21374.

Mason, P.R., Tulenko, T.N., Jacob, R.F., 2003. Direct evidence for cholesterol crystalline domains in biological membranes: role in human pathology. Biochim. Biophysica. Acta 1610, 198–207. Mitamura, T., Palacpac, N.M., 2003. Lipid metabolism in Plasmodium falciparum-infected erythrocytes: possible new targets for malaria

chemotherapy. Microbes Infect. 5, 545–552. Mitamura, T., Hanada, K., Ko-Mitamura, E.P., Nishijima, M., Horii, T.,

2000. Serum factors governing intraerythrocytic development and

cell cycle progression of Plasmodium falciparum. Parasitol. Int. 49,

219–229.

Miwako, I., Yamamoto, A., Kitamura, T., Nagayama, K., Ohashi, M., 2001. Cholesterol requirement for cation-independent mannose 6-phosphate receptor exit from multivesicular late endosomes to the Golgi. J. Cell Sci. 114, 1765–1776. Mobius, W., van Donselaar, E., Ohno-Iwashita, Y., Shimada, Y., Heijnen, H.F., Slot, J.W., Geuze, H.J., 2003. Recycling compartments and the internal vesicles of multivesicular bodies harbor most of the cholesterol found in the endocytic pathway. Traffic 4, 222–231. Murphy, D.J., 1990. Storage lipid bodies in plants and other organisms. Prog. Lipid Res. 29, 299–324. Murphy, D.J., 2001. The biogenesis and functions of lipid bodies in animals, plants and microorganisms. Prog. Lipid Res. 40, 325–438. Murphy, D.J., Vance, J., 1999. Mechanisms of lipid-body formation. Trends Biochem. Sci. 24, 109–115. Murphy, S.C., Samuel, B.U., Harrison, T., Speicher, K.D., Speicher, D.W., Reid, M.E., Prohaska, R., Low, P.S., Tanner, M.J., Mohandas, N., Haldar, K., 2004. Erythrocyte detergent-resistant membrane proteins:

their characterization and selective uptake during malarial infection. Blood 103, 1920–1928. Mutka, A.L., Lusa, S., Linder, M.D., Jokitalo, E., Kopra, O., Jauhiainen, M., Ikonen, E., 2004. Secretion of sterols and the NPC2

protein from primary astrocytes. J. Biol. Chem. 279, 48654–48662. Naik, R.S., Davidson, E.A., Gowda, D.C., 2000. Developmental stage- specific biosynthesis of glycosylphosphatidylinositol anchors in intraerythrocytic Plasmodium falciparum and its inhibition in a novel manner by mannosamine. J. Biol. Chem. 275, 24506–24511.

Nawabi, P., Lykidis, A., Ji, D., Haldar, K., 2003. Neutral-lipid analysis reveals elevation of acylglycerols and lack of cholesterol esters

in Plasmodium falciparum-infected erythrocytes. Eukaryot. Cell 2,

1128–1131.

Ngo, H.M., Yang, M., Pypaert, M., Hoppe, H.C., Joiner, K.A., 2003. Biogenesis of secretory organelles in an apicomplexan parasite is dependent on the AP-1 adaptin. J. Biol. Chem. 278, 5343–5352.

614

I. Coppens, O. Vielemeyer / International Journal for Parasitology 35 (2005) 597–615

Ngo, H.M., Yang, M., Joiner, K.A., 2004. Are rhoptries in Apicomplexan parasites secretory granules or secretory lysosomal granules? Mol. Microbiol. 52, 1531–1541. Nichols, B.A., Chiappino, M.L., O’Connor, G.R., 1983. Secretion from the rhoptries of Toxoplasma gondii during host-cell invasion. J. Ultrastruct. Res. 83, 85–98. Nishikawa, Y., Quittnat, F., Stedman, T.T., Voelker, D.R., Choi, J.Y., Zahn, M., Yang, M., Joiner, K.A., Coppens, I, in press. Host cell lipids control cholesteryl ester synthesis and storage in intracellular Toxoplasma. Cell. Microbiol, in press. O’Connell, K.M., Martens, J.R., Tamkun, M.M., 2004. Localization of ion channels to lipid raft domains within the cardiovascular system. Trends Cardiovasc. Med. 14, 37–42. Oelkers, P., Behari, A., Cromley, D., Billheimer, J.T., Sturley, S.L., 1998. Characterization of two human genes encoding acyl coenzyme A:cholesterol acyltransferase-related enzymes. J. Biol. Chem. 273,

26765–26771.

Oelkers, P., Tinkelenberg, A., Erdeniz, N., Cromley, D., Billheimer, J.T., Sturley, S.L., 2000. A lecithin cholesterol acyltransferase-like gene mediates diacylglycerol esterification in yeast. J. Biol. Chem. 275,

15609–15612.

Ohlrogge, J.B., Jaworski, J.G., 1997. Regulation of fatty acid synthesis. Annu. Rev. Plant. Physiol. Plant Mol. Biol. 48, 109–136. Pagano, R.E., 2003. Endocytic trafficking of glycosphingolipids in sphingolipid storage diseases. Philos. Trans. R. Soc. Lond. B Biol. Sci. 358, 885–891. Palacpac, N.M., Hiramine, Y., Mi-Ichi, F., Torii, M., Kita, K., Hiramatsu, R., Horii, T., Mitamura, T., 2004a. Developmental-stage- specific triacylglycerol biosynthesis, degradation and trafficking as lipid bodies in Plasmodium falciparum-infected erythrocytes. J. Cell Sci. 117, 1469–1480. Palacpac, N.M., Hiramine, Y., Shintaro Seto, S., Hiramatsu, R., Horii, T., Mitamura, T., 2004b. Evidence that Plasmodium falciparum diacyl- glycerol acyltransferase is essential for intraerythrocytic proliferation. Biochem. Biophys. Res. Commun. 321, 1062–1068. Pandey, A.V., Babbarwal, V.K., Okoyeh, J.N., Joshi, R.M., Puri, S.K., Singh, R.L., Chauhan, V.S., 2003. Hemozoin formation in malaria: a two-step process involving histidine-rich proteins and lipids. Biochem. Biophys. Res. Commun. 308, 736–743. Papalexis, V., Siomos, M.A., Campanale, N., Guo, X., Kocak, G., Foley, M., Tilley, L., 2001. Histidine-rich protein 2 of the malaria parasite, Plasmodium falciparum, is involved in detoxification of the by-products of haemoglobin degradation. Mol. Biochem. Parasitol. 115,

77–86.

Pourcho, R.G., Bernstein, M.H., Gould, S.F., 1978. Malachite green:

applications in electron microscopy. Stain Technol. 53, 29–35. Pralle, A., Keller, P., Florin, E.L., Simons, K., Horber, J.K., 2000. Sphingolipid-cholesterol rafts diffuse as small entities in the plasma membrane of mammalian cells. J. Cell Biol. 148, 997–1008. Preiser, P., Kaviratne, M., Khan, S., Bannister, L., Jarra, W., 2000. The apical organelles of malaria merozoites: host cell selection, invasion, host immunity and immune evasion. Microbes Infect. 2, 1461–1477. Quevillon, E., Spielmann, T., Brahimi, K., Chattopadhyay, D., Yeramian, E., Langsley, G., 2003. The Plasmodium falciparum family of Rab GTPases. Gene 306, 13–25. Quittnat, F., Nishikawa, Y., Stedman, T.T., Voelker, D.R., Choi, J.Y., Zahn, M.M., Murphy, R.C., Barkley, R.M., Pypaert, M., Joiner, K.A., Coppens, I., 2004. On the biogenesis of lipid bodies in ancient eukaryotes: synthesis of triacylglycerols by a Toxoplasma DGAT1- related enzyme. Mol. Biochem. Parasitol. 138, 107–122. Ramoino, P., Fronte, P., Fato, M., Beltrame, F., Diaspro, A., 2002. Mapping cholesteryl ester analogue uptake and intracellular flow in Paramecium by confocal fluorescence microscopy. J. Microsc. 208, 167–176. Raposo, G., Marks, M.S., 2002. The dark side of lysosome-related organelles: specialization of the endocytic pathway for melanosome biogenesis. Traffic 3, 237–248.

Robibaro, B., Stedman, T.T., Coppens, I., Ngo, H.M., Pypaert, M., Bivona, T., Nam, H.W., Joiner, K.A., 2002. Toxoplasma gondii Rab5 enhances cholesterol acquisition from host cells. Cell. Microbiol. 4,

139–152.

Rukmini, R., Rawat, S.S., Biswas, S.C., Chattopadhyay, A., 2001. Cholesterol organization in membranes at low concentrations: effects of curvature stress and membrane thickness. Biophys. J. 81, 2122–2134. Salaun, C., James, D.J., Chamberlain, L.H., 2004. Lipid rafts and the regulation of exocytosis. Traffic 5, 255–264. Sam-Yellowe, T.Y., 1996. Rhoptry organelles of the apicomplexa: their role in host cell invasion and intracellular survival. Parasitol. Today 12,

308–316.

Sandager, L., Gustavsson, M.H., Stahl, U., Dahlqvist, A., Wiberg, E., Banas, A., Lenman, M., Ronne, H., Stymne, S., 2002. Storage lipid synthesis is non-essential in yeast. J. Biol. Chem. 277, 6478–6482. Schroeder, R.J., Ahmed, S.N., Zhu, Y., London, E., Brown, D.A., 1998. Cholesterol and sphingolipid enhance the triton X-100 insolubility of glycosylphosphatidylinositol-anchored proteins by promoting the formation of detergent-insoluble ordered membrane domains. J. Biol. Chem. 273, 1150–1157. Seo, T., Oelkers, P.M., Giattina, M.R., Worgall, T.S., Sturley, S.L., Deckelbaum, R.J., 2001. Differential modulation of ACAT1 and ACAT2 transcription and activity by long chain free fatty acids in cultured cells. Biochemistry 40, 4756–4762. Shaw, M.K., Roos, D.S., Tilney, L.G., 1998. Acidic compartments and rhoptry formation in Toxoplasma gondii. Parasitology 117, 435–443. Shiao, Y.J., Lupo, G., Vance, J.E., 1995. Evidence that phosphatidylserine is imported into mitochondria via a mitochondria-associated membrane and that the majority of mitochondrial phosphatidylethanolamine is derived from decarboxylation of phosphatidylserine. J. Biol. Chem. 270, 11190–11198. Sibert, G.J., Speer, C.A., 1980. Fine structure of zygotes and oocysts of Eimeria nieschulzi. J. Protozool. 27, 374–379. Simons, K., Ikonen, E., 1997. Functional rafts in cell membranes. Nature 387, 569–572. Simons, K., Toomre, D., 2000. Lipid rafts and signal transduction. Nat. Rev. Mol. Cell Biol. 1, 31–39. Sinai, A.P., Joiner, K.A., 2001. The Toxoplasma gondii protein ROP2 mediates host organelle association with the parasitophorous vacuole membrane. J. Cell Biol. 154, 95–108. Slomianny, C., 1990. Three-dimensional reconstruction of the feeding process of the malaria parasite. Blood Cells 16, 369–378. Soares, M.J., De Souza, M.F., De Souza, W., 1987. Ultrastructural visualization of lipids in trypanosomatids. J. Protozool. 34, 199–203. Sonda, S., Ting, L.M., Novak, S., Kim, K., Maher, J.J., Farese Jr., R.V., Ernst, J.D., 2001. Cholesterol esterification by host and parasite is essential for optimal proliferation of Toxoplasma gondii. J. Biol. Chem. 276, 34434–34440. Sorger, D., Daum, G., 2002. Synthesis of triacylglycerols by the acyl- coenzyme A:diacyl-glycerol acyltransferase Dga1p in lipid particles of the yeast Saccharomyces cerevisiae. J. Bacteriol. 184, 519–524. Sorger, D., Daum, G., 2003. Triacylglycerol biosynthesis in yeast. Appl. Microbiol. Biotechnol. 61, 289–299. Spady, D.K., Willard, M.N., Meidell, R.S., 2000. Role of acyl-coenzyme A:cholesterol acyltransferase-1 in the control of hepatic very low density lipoprotein secretion and low density lipoprotein receptor expression in the mouse and hamster. J. Biol. Chem. 275, 27005–27012. Speer, C.A., Dubey, J.P., 2001. Ultrastructure of schizonts and merozoites of Sarcocystis neurona. Vet. Parasitol. 95, 263–271. Stedman, T.T., Sussmann, A.R., Joiner, K.A., 2003. Toxoplasma gondii Rab6 mediates a retrograde pathway for sorting of constitutively secreted proteins to the Golgi complex. J. Biol. Chem. 278, 5433–5443. Stewart, M.J., Schulman, S., Vanderberg, J.P., 1986. Rhoptry secretion of membranous whorls by Plasmodium falciparum merozoites. Am. J. Trop. Med. Hyg. 35, 37–44.

I. Coppens, O. Vielemeyer / International Journal for Parasitology 35 (2005) 597–615

615

Subtil, A., Gaidarov, I., Kobylarz, K., Lampson, M.A., Keen, J.H., McGraw, T.E., 1999. Acute cholesterol depletion inhibits clathrin- coated pit budding. Proc. Natl Acad. Sci. USA 96, 6775–6780. Sullivan, D.J., Gluzman, I.Y., Goldberg, D.E, 1996. Plasmodium hemozoin

formation mediated by histidine-rich proteins. Science 271, 219–222. Sundermann, C.A., Lindsay, D.S., 1989. Ultrastructure of in vivo-produced caryocysts containing the coccidian Caryospora bigenetica (Apicom- plexa: Eimeriidae). J. Protozool. 36, 81–86. Suss-Toby, E., Zimmerberg, J., Ward, G.E., 1996. Toxoplasma invasion:

the parasitophorous vacuole is formed from host cell plasma membrane and pinches off via a fission pore. Proc. Natl Acad. Sci. USA 93, 8413–

8418.

Topolska, A.E., Lidgett, A., Truman, D., Fujioka, H., Coppel, R.L., 2004. Characterization of a membrane-associated rhoptry protein of Plasmo- dium falciparum. J. Biol. Chem. 279, 4648–4656. van Blitterswijk, W.J., Houssa, B., 2000. Properties and functions of diacylglycerol kinases. Cell Signal. 12, 595–605. van Deurs, B., Holm, P.K., Kayser, L., Sandvig, K., Hansen, S.H., 1993. Multivesicular bodies in HEp-2 cells are maturing endosomes. Eur. J. Cell Biol. 61, 208–224. Vial, H.J., Thuet, M.J., Broussal, J.L., Philippot, J.R., 1982a. Phospholipid biosynthesis by Plasmodium knowlesi-infected erythrocytes: the incorporation of phospohlipid precursors and the identification of previously undetected metabolic pathways. J. Parasitol. 68, 379–391. Vial, H.J., Thuet, M.J., Philippot, J.R., 1982b. Phospholipid biosynthesis in synchronous Plasmodium falciparum cultures. J. Protozool. 29,

258–263.

Vial, H.J., Philippot, J.R., Wallach, D.F., 1984. A reevaluation of the status of cholesterol in erythrocytes infected by Plasmodium knowlesi and P. falciparum. Mol. Biochem. Parasitol. 13, 53–65.

Vial, H.J., Eldin, P., Tielens, A.G., van Hellemond, J.J., 2003. Phospholipids in parasitic protozoa. Mol. Biochem. Parasitol. 126,

143–154.

Vielemeyer, O., McIntosh, M.T., Joiner, K.A., Coppens, I., 2004. Neutral

lipid synthesis and storage in the intraerythrocytic stages of Plasmo- dium falciparum. Mol. Biochem. Parasitol. 135, 197–209. Waller, R.F., McFadden, G.I., 2005. The apicoplast: a review of the derived plastid of apicomplexan parasites. Curr. Issues Mol. Biol. 7, 57–79. Ward, G.E., Miller, L.H., Dvorak, J.A., 1993. The origin of parasitophorous vacuole membrane lipids in malaria-infected erythrocytes. J. Cell Sci. 106, 237–248. Wunderlich, F., Fiebig, S., Vial, H., Kleinig, H., 1991. Distinct lipid compositions of parasite and host cell plasma membranes from Plasmodium chabaudi-infected erythrocytes. Mol. Biochem. Parasitol. 44, 271–277. Yang, H., Cromley, D., Wang, H., Billheimer, J.T., Sturley, S.L., 1997. Functional expression of a cDNA to human acyl-coenzyme A:choles- terol acyltransferase in yeast. Species-dependent substrate specificity and inhibitor sensitivity. J. Biol. Chem. 272, 3980–3985. Yang, M., Coppens, I., Wormsley, S., Baevova, P., Hoppe, H.C., Joiner, K.A., 2004. Rhoptry biogenesis in apicomplexan parasites involves a multivesicular body intermediate. J. Cell Sci. 117, 3831–

3838.

Yayon, A., Timberg, R., Friedman, S., Ginsburg, H., 1984. Effects of chloroquine on the feeding mechanism of the intraerythrocytic human malarial parasite Plasmodium falciparum. J. Protozool. 31, 367–372. Zurzolo, C., van Meer, G., Mayor, S., 2003. The order of rafts. Conference on microdomains, lipid rafts and caveolae. Eur. Mol. Biol. Org. J. 4,

1117–1121.

Zweytick, D., Athenstaedt, K., Daum, G., 2000. Intracellular lipid particles of eukaryotic cells. Biochim. Biophys. Acta 1469, 101–120.

International Journal for Parasitology 35 (2005) 617–626 www.parasitology-online.com Annexin-like alpha giardins: a new
International Journal for Parasitology 35 (2005) 617–626 www.parasitology-online.com Annexin-like alpha giardins: a new

International Journal for Parasitology 35 (2005) 617–626

International Journal for Parasitology 35 (2005) 617–626 www.parasitology-online.com Annexin-like alpha giardins: a new

Annexin-like alpha giardins: a new cytoskeletal gene family in Giardia lamblia *

Malin E.-L. Weiland a , Andrew G. McArthur b , Hilary G. Morrison b , Mitchell L. Sogin b , Staffan G. Sva¨rd a,c, *

a Microbiology and Tumor Biology Center, Karolinska Institutet, SE-171 77 Stockholm, Sweden b Marine Biological Laboratory, Woods Hole, MA, USA c Department of Cell and Molecular Biology, Uppsala University, BMC Box 596, SE-751 24 Uppsala, Sweden

Received 28 October 2004; received in revised form 10 December 2004; accepted 14 December 2004

Abstract

Through a genome survey and phylogenetic analysis, we have identified and sequenced 14 new coding regions for alpha-giardins in Giardia lamblia. These proteins are related to annexins and comprise a multi-gene family with 21 members. Many alpha giardins are highly expressed proteins that are very immunogenic during acute giardiasis in humans. However, little is known about the function of these proteins. By using PCR with different combinations of gene-specific primers, we demonstrated that several of the genes localised to the same chromosomal fragment. These data point towards a molecular evolution through gene duplication and subsequent functional divergence. Semi-quantitative reverse transcriptase-PCR analysis of the Giardia life cycle revealed large differences in mRNA expression levels of the alpha giardins. Epitope tagging of the alpha-giardins localised them to different cytoskeletal components, such as the flagella and the adhesive disc, but also to the plasma membrane. These localisation experiments suggest alpha-giardins play a role in cell motility, attachment and membrane stability. q 2005 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

Keywords: Giardia; Parasite; Annexin; Cytoskeleton; Flagella

1. Introduction

Giardia lamblia, a commonly found intestinal protozoan parasite, occurs throughout the world and triggers a form of diarrhea called giardiasis. Giardia is thought to be an early diverging eukaryote and has a simple life cycle that alternates between the cyst stage and the trophozoite stage. Infection starts through ingestion of the infectious cysts. The cysts’ passage through the stomach triggers excystation and the cysts transform into trophozoites that will attach, divide and colonise the upper part of the small

* Nucleotide sequence data reported in this paper are available in the GenBanke, under the accession numbers AY781314–AY781334. * Corresponding author. Address: Microbiology and Tumor Biology Center, Karolinska Institutet, SE-171 77 Stockholm, Sweden. Tel.: C46 18 4714558; fax: C46 18 530396. E-mail address: staffan.svard@icm.uu.se (S.G. Sva¨rd).

intestine. To ensure transmission and survival outside the host, Giardia undergoes encystation into highly resistant, dormant cysts, which are shed to the environment through feces, thereby completing the life cycle. The genome sequencing of G. lamblia is nearly complete, with greater than 99% of Giardia’s coding capacity represented in contigs or unplaced reads available on GiardiaDB (www.mbl.edu/Giardia) (McArthur et al., 2000). This enables researchers to compare specific genes between early and late diverging eukaryotes. We have recently characterised some of the immunodominant proteins during acute human giardiasis (Palm et al., 2003). One of these proteins was alpha-1 giardin, a protein that we recently characterised as an annexin with glycosaminogly- can-binding activity (Weiland et al., 2003). Crossley and Holberton originally described giardins as cytoskeletal proteins unique to Giardia (Crossley and Holberton, 1983a,b). The giardins are associated with

0020-7519/$30.00 q 2005 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

doi:10.1016/j.ijpara.2004.12.009

618

M.E.-L. Weiland et al. / International Journal for Parasitology 35 (2005) 617–626

the cytoskeleton and belong to at least three separate gene families: the alpha giardins–annexin homologs (Morgan and Fernandez, 1995, 1997), beta giardin, a striated fibre (SF)- assemblin homolog (Weber et al., 1993) and gamma giardin, a protein without notable homologs (Nohria et al., 1992). Up until now, published reports identified six alpha giardins including, alpha-1 and -2 giardin (Peattie et al., 1989; Alonso and Peattie, 1992), alpha-3 (Weiland et al., 2003), as well as alpha-7.1, -7.2 and -7.3 giardin (Palm et al., 2003). These genes share an ancestry with human annexins (Morgan and Fernandez, 1995; Szkodowska et al.,

2002).

Annexins are Ca 2C and phospholipid-binding proteins forming an evolutionary conserved multigene family (Gerke and Moss, 2002). The name annexin derives from terms meaning ‘bring/hold together’ and describes the principal property of binding to and possibly holding together membranes. Today, more than 160 unique annexin proteins are known from more than 65 different eukaryotic species (Gerke and Moss, 2002). Annexins have a wide range of biological functions. Despite detailed biochemical and structural knowledge, a clear physiological function for most annexins remains unknown. In Giardia, there is a strong link between the cytoske- leton and virulence, since Giardia, by aid of its cytoskele- ton, has to move within the intestine and attach to the epithelium to avoid being swept away (Elmendorf et al., 2003). Novel cytoskeletal proteins might be potential drug targets for treatment of giardiasis. During Giardia differen- tiation, there are extensive, highly organised rearrangements of the cytoskeleton and membranous compartments (Que et al., 1996). Annexins interact with the cytoskeleton, in particular F-actin, suggesting their participation in such rearrangements (Gerke and Moss, 2002). In this study, we characterise 14 new members belonging to the alpha giardin multigene family of annexin-like proteins from Giardia, and

explore their role in regulation of membrane-cytoskeleton dynamics.

2. Materials and methods

2.1. Reagents, cell culture and differentiation

Unless otherwise indicated, reagents were obtained from Sigma Chemical Co, St Louis, MO. All restriction enzymes used were obtained from Invitrogen. Giardia lamblia strain WB (ATCC 50803) clone C6 or A11 trophozoites were grown vegetatively and encysted as described (Bernander et al., 2001). Excystation was carried out by a two-step method as described (Boucher and Gillin, 1990).

2.2. Cloning and sequencing of genes belonging to alpha

giardin gene family

PCR primers (Table 1) were designed to amplify complete giardin genes from G. lamblia strain WB clone C6 genomic DNA, using Ready To Go PCR beads (Amersham Pharmacia Biotech) or Platinum Taq DNA polymerase (Invitrogen). PCR conditions were as described by each manufacturer, with 35 cycles at 95 8C for 30 s, 55 8C for 30 s and 72 8C for 1 min. The amplified gene products were run on a 1% agarose gel, cut out, and gel-extracted using a QIAquick Gel Extraction Kit (Qiagen). Purified gene products were cloned into the TOPO TA cloning vector for DNA sequencing (Invitro- gen). Sequencing of the PCR amplified genes was performed using an ABI PRISM Big Dye Terminator version 3.0 cycle sequencing kit (Applied Biosystems) with T3 and T7 primers on an ABI 377 automatic DNA sequencer.

Table 1 PCR primers (5 0 –3 0 ) used for cloning and sequencing of alpha-giardins (see text for numbering)

Primer

Forward primer

Reverse primer

A4

TGC GGG TCT GGA AGA ACT TCC G CCT GTA AAC CTT CGA ACC CTT CGC CAC GGT CAT AAT ACT TTG GAT AAT TAT ACG TGC GCA ACC CGA TGA CCT CTT TTG TGA ACC CTT TTC ATT AAA TC TAT CGG CCA GAG ACA TCG TCC GCC GCA TTT GAA TAA GGT GTG ACT GTT GGT GCG CCG GAT TCA GTC TAG GCA TTT AAC AGG TGT GAA TTA ATA GTC AGT AAA TGT GTG GGA AGT CAC GAA GCC ACG CAG CCC CTG AAA ACA TAG TAA AGG CGA CTG TAG TTT TGA C CGA CTC AGT TGA GTG TAG GAC ATA GTT GTG CCG CAT CAA CTC CCG

GAC CAT GCC TTT ACT CAT GAG ATG CAT TTT CTA AAT GTA AGC GCT CAG AA CCT TTG GCT CAC ACA ACT GGA GAT GCT AGT AGA TAA GCT GGG CCA AAT G TAT TAA TTC ACA CCT GTT AAA TGC GTG ACT TCC CAC ACA TTT ACT GAC TAA ATT GAA GAG TGA CAC GCG GCC CTC GTA GTC AGA CAT CTG CCT GAA G TTT AAA GTC CGT CAG TTT ACC CTG AAC AGT CAC ACC TTA TTC AAA TGC GCG TCG GAC AGG CTC CGC AGC AGT T TGG CCT ACT ATA TTC CCG TAT GAC ATG CAT TTA GCG CAA TCA CTT G TCA GTC GCC GCG GGG AGT CGA G

A5

A6

A8

A9

A10

A11

A12

A13

A15

A16

A17

A18

A19

M.E.-L. Weiland et al. / International Journal for Parasitology 35 (2005) 617–626

619

2.3. Phylogenetic analysis

To identify proteins homologous to already known alpha giardins (alpha-1, -2, -3, -7.1, -7.2 and -7.3 giardin) we performed a survey of the G. lamblia genome database (McArthur et al., 2000). We identified 14 additional genes belonging to the annexin-like alpha giardin gene family (alpha-4 to -6, -8 to -13 and -15 to -19 giardin). In order to clarify the nomenclature prior to phylogenetic analysis on all members of the annexin-like alpha giardin gene family, we renamed the already identified annexin XXI (Morgan and Fernandez, 1997) to alpha-14 giardin. All giardin amino acid sequences were aligned using ClustalX 1.81 (Thompson et al., 1997), with manual correction using MacClade 4.0fc4 (Maddison and Maddison, 1989). Gaps and highly divergent or ambiguous regions of the alignments were excluded from analyses. A number of vertebrate annexin sequences served as outgroups, based on their similarity to giardins in BLAST searches (Altschul and Koonin, 1998). The alignment is available upon request. Phylogenetic relationships of the giardin sequences were assessed using a Bayesian statistical procedure, as implemented by the computer program Mr Bayes (Huelsenbeck and Ronquist, 2001). Mr Bayes performs a Metropolis-coupled Markov chain Monte Carlo (MC 3 ) estimation of posterior probabilities (Shoemaker et al., 1999; Lewis and Swofford, 2001; Huelsenbeck et al., 2002). We performed MC 3 estimation of posterior probabilities using non-informative prior probabilities, the JTTCICG (Jones et al., 1992) substitution model with inclusion of unequal amino acid frequencies, and four incrementally heated Markov chains with different random starting trees. The Markov chains were run for 10,000,000 generations, with sampling of topologies every 100 generations. Posterior probabilities of topologies, clades, and parameters were estimated from the sampled topologies after removal of MC 3 burn-in.

2.4. RNA extraction and DNAse I treatment

Giardia lamblia strain WB clone A11 cultures of 500 ml trophozoites, 4 h encysted cells, 10 h encysted cells and cysts (water treated, 24 h encysted cells) were put on ice 20 min before harvesting by centrifugation at 2500 rpm for 5 min. Cells were washed two to three times in PBS before homogenising the resulting cell pellet in 1 ml Trizol (Invitrogen) or 1 ml Trizol plus glass beads for cysts. The homogenates, were snap frozen to K80 8C and stored until use. Total cellular RNA was extracted, precipitated and washed according to the manufacturer (Invitrogen). RNA from cysts was extracted after shaking the homogenates with glass beads for 60 s at maximum speed in bead beater (Techtum Lab). The RNA pellets were dissolved in 43 ml ddH 2 O, 5 ml of One Phor All (OPA) buffer (Amersham Pharmacia Biotech), 1 ml DNAse I (Stratagene) and 1 ml RNaseOUT (Invitrogen) and DNAse I treated at 37 8C for

30 min followed by enzyme inactivation for 5 min at 95 8C. The RNA was precipitated by adding 160 ml pure ethanol and incubated at K20 8C overnight, before being dissolved in ddH 2 O and quantified by measuring OD 260 .

2.5. Reverse transciptase polymerase chain reaction

(RT-PCR)

Complementary DNA was prepared from 5 mg DNAse I treated total parasite RNA by Superscript II RNase H- Reverse Transcriptase (Invitrogen) according to the manu- facturer. Briefly, 5 mg total RNA was mixed with 2 ml oligo dT primer, 2 ml dNTP and ddH 2 O, and incubated for 5 min at 65 8C. After addition of 2 ml RNaseOUT (Invitrogen), 4 ml 0.1 M DTT and 8 ml first strand buffer, the reaction mixture was incubated for 2 min at 42 8C. Two microliters of Superscript II were added and incubation continued at 42 8C for 50 min. The reaction was inactivated for 15 min at 70 8C and stored at K20 8C. As a control all reactions were made with or without Superscript II to check for genomic DNA contamination.

2.6. Semi-quantitative expression analysis of alpha giardins

To remove RNA from the synthesised cDNA, heating at 95 8C for 5 min inactivated the Superscript II enzyme and digestion with 0.5 ml RNace-It (Stratagene) at 37 8C for 30 min degraded residual RNA. A final incubation at 95 8C for 5 min inactivated the enzyme in RNace-It. Gene-specific primers were designed for semi-quantitative PCR (Table 2). The semi-quantitative analysis was done by comparing the alpha giardin gene expression to the expression of beta giardin, which was used as a standard in a reverse transcriptase PCR (RT-PCR) experiment). All PCR reac- tions were run in triplicate for 25–30 cycles with denaturation at 95 8C for 30 s, annealing at 55 8C for 30 s and extension at 72 8C for 1 min. Amplified gene products were run on a 1% agarose gel and analysed with the program Quantity One Volume Quick Analysis (Biorad). The PCR fragments of the alpha giardin genes 8, 12, 15 and 16 had similar size as beta giardin and were therefore amplified separately, although analysed on a gel containing beta giardin in separate lanes.

2.7. Construction of AU-1 tagged alpha giardins

The promoter and coding sequence of each alpha giardin gene was amplified from G. lamblia strain WB clone six genomic DNA as an EcoRI/MluI fragment (Table 3). The alpha-2 giardin promoter and coding sequence was cut out from 2 mg of the AU-1 expression vector (Weiland et al., 2003) with EcoRI and MluI and run on a 1% agarose gel. The cut vector fragment was gel extracted using a QIAquick Gel Extraction Kit (Qiagen) and ligated with the purified EcoRI/MluI cut PCR fragment of the alpha giardin genes at 16 8C overnight. Ligations were transformed into

620

M.E.-L. Weiland et al. / International Journal for Parasitology 35 (2005) 617–626

Table 2 PCR primers (5 0 –3 0 ) used for semi-quantitative RT-PCR analysis of alpha giardins (see text for numbering)

Primer

Forward primer

Reverse primer

A1 exp

ACG AGG TCC AGA TCG CGT TCA TAG ATG CCA AGG ACG AGG CCC AGA TCG GGT CGT AGC GGA CCT GAA TGC CGC CAT TCC AGC CTA TCA CGC AAA C CTC AGA TAT GCT CGG ATC TCA AGG TCC AAT GAG CAG ATG ATA GCA GG AGG AGC GTC GCC GAC TTC GAC GAC AGG AGC GTC GCC GAC TTC GAC GAT GCG AGG AGC GTC GCC GAC TTC AAT AGA GAC GCA TTG GTG GAC CTT G GCA CCG AGA CAA GGT CGT AAT C ATT TAT CAA GGT TGC AGA CGA GCT G TCA AGA AGT GCA TCA AGA ATG GCC CGT CAA AGC GAC ATT CAT TCA CG CAA AGG GAC AAG GTC CTT CCG CTG GCG GTT GTG CAG AAG GTT GTG G AGA TGT CTC ACG ACG CAG GAT G GAA GCA CGG ATG TTA GAC TTA GCG GGA GAT GAG GTT GGC CTG GCT GTG ATG CAT TTA GCG CAA TCA CTT G CGA CGA CCT CAC CCG CAG TGC GAC

ATC TCT CGA TGT CTG TGC CCA TGT C CAC CTT TCG ACG TCG GCT TTC ATA C TCT TCA ACC GCA TCC TTA AAG GCG TCG CAA AGC CAG TGG TGT G GGC CAT TCG CTC GTC AAA GCA GCG TCG CTG ACC GAT GTG GTT CC AGG ACC TTG CAC TGC TCC GCC TGA GCG TAG AGG ACC TTG CAC TGC TCT TTC CTG ATG TCC TTG GCT AAG TTC TTG TTT GTG TGC TCC TCG TAA GC CGT AGT TGG ACG CAA TAA GGG TC CTC GCC GAA ATT GCT CTT GAA CAC CAG AAC ATG AGG CAT GCA TCG CGG TTC CTG TGG TAG CAC TGG GTT C CGC AGA TCT GCT GCT AGT GAT CC CAA CTC GAG AGT CAT CGG CCT G TCC ACA GGA GGC AAA GTT TCG C TGC CCT GAG CGT TTT GGA TTC GCT AAG ATC CTT GTC AGT AAC AGC CTA TAT CTT CCA GAC TGT TGC GTT CTG GAG ATT TGT CTC AAC G

A2 exp

A3 exp

A4 exp

A5 exp

A6 exp

A7.1 exp

A7.2 exp

A7.3 exp

A8k exp

A9 exp

A10 exp

A11 exp

A12k exp

A13 exp

A14 exp

A15k exp

A16k exp

A17 exp

A18 exp

B exp

Escherichia coli Top10 for identification of complete constructs. Trophozoite