Академический Документы
Профессиональный Документы
Культура Документы
cn
www.stemcell8.cn
DICTIONARY of
BIOTECHNOLOGY
and
GENETIC ENGINEERING
Third Edition
www.stemcell8.cn
www.stemcell8.cn
DICTIONARY of
BIOTECHNOLOGY
and
GENETIC
ENGINEERING
Third Edition
Copyright 2006, 2001, 1994 by Mark L. Steinberg, Ph.D., and Sharon Cosloy,
Ph.D.
All rights reserved. No part of this book may be reproduced or utilized in any form
or by any means, electronic or mechanical, including photocopying, recording, or by
any information storage or retrieval systems, without permission in writing from the
publisher. For information contact:
TP248.16.S84 2000
660.603dc21 00-035463
Facts On File books are available at special discounts when purchased in bulk quanti-
ties for businesses, associations, institutions, or sales promotions. Please call our Spe-
cial Sales Department in New York at (212) 967-8800 or (800) 322-8755.
MP FOF 10 9 8 7 6 5 4 3 2
And above all, she was a kind and gentle woman with a bright spirit that
still lives on today through the people who were fortunate enough to be
touched in life by her.
CONTENTS
Preface ix
Acknowledgments xi
Entries A to Z 1
Appendixes 261
Acronyms (and Other Abbreviations) 262
The Chemical Elements 267
Periodic Table 268
The Genetic Code 269
Purine and Pyrimidine Bases Found 270
in Nucleic Acids
Side Chains (R Groups) for 271
Individual Amino Acids
Bioinformatics Web Sites 272
Enzymes Used in Gene Cloning 274
www.stemcell8.cn
PREFACE
The last decades of the 20th century produced a dramatic revolution in the
field of biology in which, for the fi rst time, the ability to modify the genetic
makeup of higher organisms in the laboratory rather than by the random
forces of natural selection was realized. This new era was born out of criti-
cal discoveries in the mid-1970s that led to the appearance of new fields of
molecular genetics variously known as gene cloning, genetic engineering, and
biotechnology. The central theme of genetic engineering is the introduction of
genetic material altered in a laboratory into an organism different from that
from which it was originally derived. The introduction of genes from higher
organisms into microorganisms made it possible to isolate, amplify, study
and ultimately engineer individual genes for a variety of specialized purposes.
These techniques have also allowed scientists to look closely at the structure,
function, and regulation of genes and their proteins.
The purpose of this dictionary is to provide readers with access to the basic
vocabulary of modern biotechnology and genetic engineering so that those
with even an elementary knowledge of basic biology and biochemistry will be
able to follow the flood of fast-breaking developments in biotechnology and
genetic engineering that constantly appears in the media.
At the time of the fi rst printing of The Facts On File Dictionary of Biotech-
nology and Genetic Engineering, molecular cloning of genes had only recently
matured. Even then, rapidly accumulating data from large-scale sequence
analyses and the development of new techniques for amplification of DNA
at the microscale level were already yielding information that allowed for the
www.stemcell8.cn
Preface
The new third edition of the dictionary focuses on the new terminology in
the evolving areas of genomics, bioinformatics, cell signaling, and molecular
medicine. In addition, there are a number of biochemical terms pertaining to
recent advances in medicines for the treatment of viral diseases, mental ill-
ness, cholesterol metabolism, plant engineering, and stem cell research.
Since this book addresses an audience from diverse backgrounds and covers a
broad field, we attempted to include both basic as well as more technical ter-
minology in a number of areas including plant and animal biology in order to
meet the needs of as many readers as possible. There has also been an attempt
to make the dictionary self-contained in the sense that, in cases where techni-
cal terms appear in defi nitions, these terms will be defi ned elsewhere in the
book. It is anticipated that the dictionary will be of benefit to a wide-ranging
audience, including high school and college students, lawyers, physicians, sci-
entists, or others with a particular need to keep abreast of the rapidly develop-
ing areas of biotechnology and genetic engineering.
x
www.stemcell8.cn
ACKNOWLEDGMENTS
The authors also thank Mr. Frank K. Darmstadt, executive editor, and the
production department for their support and insight in the creation of this
new edition of the dictionary.
www.stemcell8.cn
www.stemcell8.cn
ABC transporter The largest class of as universal donors. In addition, the ABO
transmembrane proteins. ABC trans- system can be used in paternity suits to
porter is an acronym for ATP (adenosine rule out the possibility that a particular
triphosphate) binding cassette, a region male is the father of the child in question.
of the protein that is conserved in the
transporter in a wide variety of differ- abscisic acid A plant hormone, lipid
ent organisms and is responsible for the in nature, synthesized in wilting leaves.
binding of ATP. In bacteria these pro- It counteracts the effects of most other
teins use energy from ATP to transport a plant hormones by inhibiting cell growth
wide variety of small molecules including and division, seed germination, and bud-
sugars, vitamins, amino acids and ions ding. It induces dormancy.
across the cell membrane. In eukaryotes,
ABC transporters generally move mol- absorbance Often referred to as opti-
ecules either outside the cell or into an cal density. Absorbance is a unit of
organelle such as the endoplasmic retic- measure of the amount of light that is
ulum or mitochondrion. Alterations in absorbed by a solution or by a suspen-
the ABC transporter genes, particularly sion of bacterial cells. The absorbance is
duplications, are the basis of resistance a logarithimic function of the percent of
to chemotherapeutic drugs that many transmission of a particular wavelength
tumors develop. Inhibitors of the ABC of light through a liquid and is measured
transporters involved in drug resistance is by a spectrophotometer or a colorim-
being developed as a strategy to deal with eter. Absorbance values are used to plot
drug resistance in cancer. growth of suspensions of bacteria and to
determine the concentration and purity
ABO blood group A system of anti- of molecules such as nucleic acids or pro-
gens expressed at the surface of human teins in solutions.
red blood cells. Human blood types rep-
resented in this group are A, B, AB, or absorption 1. virology The entry of a
O, depending on which antigen(s), in virus or viral genome into a host cell after
the form of oligosaccharides, are present the virus has absorbed to the cell surface.
at the surface of the erythrocyte mem- (See adsorption.)
branes. The blood serum of Type A indi- 2. photometry When light is neither
viduals contains anti-B antibodies, those reflected nor transmitted, it is said to be
with Type B produce anti-A antibodies, absorbed. Some biological systems can
and those with Type AB produce both. make use of light energy because they
Type O individuals produce neither. have pigments that absorb light at spe-
This system is one of 14 different blood cific wavelengths. These pigments are
group systems consisting of 100 differ- able to harness light energy to drive bio-
ent antigens. This system is of medical chemical reactions in vivo. An example
importance because the recipient of a can be found in plant pigments, such as
blood transfusion must receive blood that chlorophyll, that are used to trap light
is compatible with his or her own type. energy and drive the process of photo-
Type AB individuals are known as uni- synthesis where plants manufacture
versal acceptors, and Type O individuals nutrients.
1
www.stemcell8.cn
absorption spectroscopy
absorption spectroscopy The use of one time, the production of these com-
a spectrophotometer to determine the mercially important chemicals relied on
ability of solutes to absorb light through bacterial fermentation, but this has since
a range of specified wavelengths. Every been replaced by chemical synthesis.
compound has a unique absorption spec-
trum. An absorption spectrum, which is acetylcholine A chemical neurotrans-
defi ned as a plot of the light absorbed ver- mitter that is expelled into the synaptic
sus the wavelength, can be derived from a cleft, or space between two nerve cells.
solution (see absorbance). Absorption This neurotransmitter permits the trans-
spectra are used to identify compounds, mission of an electrical nerve impulse or
determine concentrations, and plot reac- action potential from one nerve cell to
tion rates. another by diffusing across the cleft and
then binding to a cell-membrane receptor.
abzymes Catalytic antibodies that cleave
proteins or carbohydrates at specific acetylcholinesterase An enzyme pres-
residues. They are analogous to restric- ent in the synaptic cleft, or space between
tion enzymes that cleave DNA at specific two nerve cells, that hydrolyzes or
sequences. Catalytic antibodies have the destroys the unbound neurotransmitter
potential to be used as therapeutic agents, acetylcholine once it has diffused through
attacking specific viral or bacterial surface the cleft. This is required to restore the
structures, and as catalysts in reactions in synaptic cleft to a state that is ready to
which no enzyme has been found. receive the next nerve impulse. See ace-
tylcholine.
acentric fragment A fragment of a
chromosome that does not contain a cen- acid blobs Certain sequences of amino
tromere. Because of the absence of a centro- acids on a protein that bind to a tran-
mere, acentric fragments do not segregate scriptional regulatory protein and, in so
at mitosis and eventually disappear. doing, serve to activate transcription.
2
www.stemcell8.cn
actin
7.0 are aspartic and glutamic acids. Also transmitted through casual contact with
referred to as aspartate or glutamate. infected individuals.
Both of these amino acids contain in their
R or variable groups a second carboxyl acridine orange One of a group of
group that is ionized under physiological chemical mutagens known as acridines,
conditions. including proflavin and acriflavine. The
size of the acridines is the same as that
acidophile A classification of microor- of a purine-pyrimidine base pair. For
ganisms that describes the ability or the this reason, they can insert or intercalate
necessity of certain species to exist in an into the helix between two adjacent base
acidic environment. These acid-loving pairs. When DNA that contains an inter-
organisms can exist at a pH range of 0 calated acridine is replicated, an addi-
5.4, well below the optimum of neutral- tional base pair may be added or a base
ity for most bacteria. Facultative acido- pair may be deleted, disrupting the codon
philes can tolerate a range of pH from reading frame in the newly synthesized
low to neutral and include most fungi strand. Such a mutation is called a frame-
and yeasts. However, obligate acido- shift mutation.
philes including members of the genera
Thiobacillus and Sulfolobus require low acrosome (process, reaction, vesicle)
pH for growth. A neutral pH is toxic to A vesicle- or membrane-bound compart-
these species. ment covering the sperm head that con-
tains lytic enzymes. The major enzyme
acivicin An antibiotic that acts as an found in the mammalian sperm acro-
inhibitor of the enzyme gamma-glutamyl some is hyaluronidase, which promotes
transpeptidase (GGT), which is necessary the digestion of the tough outer coat of
for the breakdown and transport of glu- the egg and allows penetration of the
tathione across the cell membrane. As a sperm.
glutamine analog, acivicin is also used as
an anticancer drug because of its ability acrylamide A substance that can poly-
to block glutamine metabolism. merize and form a slab gel when poured
into a mold in its molten state. It is used as
acquired immunodeficiency syndrome semisolid support medium and is immersed
(AIDS) An infectious disease in humans in a conductive buffer through which a
caused by the human immunodeficiency current is passed. When solutions con-
virus (HIV). The virus attacks the hosts taining heterogeneous mixtures of nucleic
immune system leaving him/her suscep- acid fragments or mixtures of proteins are
tible to many other diseases, including placed into slots in the gel and subjected
certain rare forms of cancer and oppor- to the electrical current, the nucleic acid
tunistic microbial infections that would or protein mixtures may be separated into
otherwise be destroyed in an uninfected distinct collections of homogeneous mole-
individual. Most often, AIDS patients die cules located in different regions of the gel,
from these secondary infections that run based on their size or molecular weight.
rampant through the body because of the See electrophoresis.
loss of ability to immunologically sup-
press them. The HIV virus is transmit- ACTH See adrenocorticotropic
ted through the exchange of body fluids hormone.
during sexual contact with an infected
individual, the sharing of needles among actin One of the two major proteins
intravenous drug users, transfusion of responsible for muscle contraction. Actin
contaminated blood products (no longer a and myosin are found in smooth and stri-
threat due to the ability to screen donated ated muscle. Actin monomers together
blood), and from mother to newborn dur- with two other proteins, troponin and
ing delivery. It has not been shown to be tropomysin, can polymerize to form long,
3
www.stemcell8.cn
Actinomyces
thin fi laments that, together with myosin activation energy The energy required
fi laments, can shorten in the presence of for a chemical reaction to proceed. In bio-
ATP (adenosine triphosphate). Actin also logical systems, enzymes lower the activa-
plays a role in the shape and structure of tion energy, allowing chemical reactions
cells. to occur faster under physiological condi-
tions.
Actinomyces A genus of anaerobic
Gram-positive rods that are often found active site The region of an enzyme
in the mouth and throat. They occasion- that contains a special binding site for
ally display a branched fi lamentous mor- substrate(s). This site is uniquely shaped
phology. Many, such as A. israelii, are for the exclusive binding of the particu-
human pathogens. lar substrate molecule(s) and is the site
for the catalytic activity of the enzyme.
actinomycin D An antibiotic produced The three-dimensional folding of the
by Streptomyces parvullus that inhibits enzyme brings distal amino acids in the
RNA transcription in both prokaryotes polypeptide into close proximity, thus
and eukaryotes. It blocks the action of forming the active site at the surface of
RNA Polymerase I, which synthesizes the protein.
ribosomal RNA, and forms complexes
with DNA by intercatating between G- active transport The transport, by
C pairs, preventing the movement of cells or cellular compartments, of ions
DNA- and RNA-synthesizing enzymes. and metabolites through cell membranes
Although toxic, it is sometimes used in against a concentration gradient. This
conjunction with other drugs as a che- type of transport requires cellular energy
motherapeutic agent, due to its antitumor in the form of ATP (adenosine triphos-
properties phate) hydrolysis. One example found in
all animal cells is the active transport of
action potential Also called a nerve Na+ out of cells and the active transport
impulse; sequential wave of depolariza- of K+ into cells. This system is known as
tion and repolarization across the mem- the sodium-potassium pump. The energy
brane of a nerve cell (neuron) in response is provided by a specific ATPase located
to a stimulus. Depolarization is a rever- in the plasma membrane. This active
sal in the distribution of charge between transport system is responsible for the
the inside and the outside of the neuron generation and maintenance of the elec-
membrane. trical potential or voltage gradient across
the cell membrane.
activated sludge process A secondary
sewage-treatment process where biologi- acycloguanosine (acyclovir) An anti-
cal processing of the sewage by microbial viral antibiotic used to treat herpes virus
activity is the main method of treatment. infections. Acycloguanosine is a deriva-
In this step, sewage that has been pre- tive of the normal nucleoside, guano-
viously treated in settling tanks is aer- sine, in which the sugar, ribose, has been
ated in large tanks to encourage growth replaced by an ether chain. Acycloguano-
of microorganisms that oxidize dissolved sine is an inhibitor of viral DNA synthe-
organics to carbon dioxide and water. sis. See hsv.
Bacteria, yeasts, molds, and protozoans
are used. This process proves effective in Acyclovir See acycloguanosine.
reducing intestinal pathogens in sewage
while encouraging growth of nonpatho- acyl carrier protein (ACP) A small
gens. After activated sludge has been pro- protein involved in the synthesis of fatty
duced, additional processing is required, acids. First isolated from E. coli bacteria
including anaerobic digestion, fi ltering, by Roy Vagelos, it was found to be a 77
and chlorination. amino acid polypeptide chain, capable of
4
www.stemcell8.cn
adenosine triphosphate
5
www.stemcell8.cn
adenovirus
6
www.stemcell8.cn
adult polycystic kidney disease
adrenergic
in turn stimulates the adrenal cortex to
adrenaline receptor adenylyl secrete glucocorticoids. One way that
(epinephrine) cyclase
glucocorticoids aid the body in deal-
ing with the physical consequences of
stress is by promoting a metabolic pro-
cess known as gluconeogenesis, which
-G
DP involves the synthesis of glucose from
various noncarbohydrate metabolites in
G
protein GTP the cell.
7
www.stemcell8.cn
aeration
8
www.stemcell8.cn
AIDS
9
www.stemcell8.cn
Akt
10
www.stemcell8.cn
allele-specific oligonucleotides
pying both marine and freshwater environ- is 9.0; and the soil bacterium Agrobacte-
ments. The dinoflagellates and the diatoms rium, whose optimum pH is 12.
are free floating, and the red and brown
algae require a solid substrate to which alkaptonuria The fi rst human genetic
they attach. They are further classified by disease identified when it was found to
their photosynthetic pigments, thus the follow the laws of Mendelian inheri-
names brown, red, green, and blue-green tance. Also known as dark urine dis-
algae. Many are of industrial importance ease, it was studied by Garrod and, in
providing thickeners for foods and bacte- 1902, was recognized to be inherited as
rial culture media. See agar. a recessive trait. Later, the biochemical
nature of the disease was also uncovered.
alignment Placement of sequences of The disease is characterized by a depos-
unknown genes or proteins side by side its of dark pigment in connective tissue
to analyze the similarities or differences and in the urine after exposure to air.
between them. These alignments are Later stages of the disease result in severe
done on computers, utilizing databases in forms of arthritis and possibly death due
which sequences are stored. to blockages in the arteries and valves
of the heart. One in a million people is
alkali Any basic (high pH) solution or born with this disease; it results from a
compound. Alkaline conditions denature deficiency in the enzyme homogentisic
DNA and have been employed in meth- acid deoxygenase, which results in the
ods to isolate plasmid DNA from chro- accumulation of homogentisic acid in the
mosomal DNA. Certain alkali treatments urine.
have been used in the isolation of bacte-
rial proteins. Of course, the success of alkylating agent A type of muta-
this method depends upon the alkali sta- gen that adds alkyl groups such as the
bility of the protein to be isolated. methyl group (CH 3) and the ethyl
group (CH 2CH 3) to bases in DNA.
alkaline phosphatase An enzyme used One such mutagen is ethylmethane sul-
in DNA cloning procedures to remove fonate (EMS), which can alkylate either
the terminal phosphates from the single- thymine or guanine residues and cause
stranded tail of vector molecules that are them to mispair during DNA replication.
cleaved with a restriction enzyme, thus This causes transition type mutations in
preventing recircularization of the vec- DNA.
tor and enhancing the recovery of vectors
with inserts. allele One of several alternative forms
of the same gene. A single gene can have
alkaloids A class of 3,000 compounds as few as one or as many as 100 different
containing nitrogen that are produced by alleles. Alleles are differences in the base
plants but that exert potent physiologi- sequence of a single gene among individu-
cal effects on animals. They are synthe- als in a population or on the two homol-
sized from aromatic amino acid precur- ogous chromosomes in one individual.
sors such as tyrosine, tryptophan, and They are the cause of genetic variation or
phenylalanine. Some examples are mor- different expressions of a trait in a popu-
phine, cocaine, nicotine, codeine, and lation of organisms.
colchicine.
allele-specific oligonucleotides A
alkalophiles (alkalinophiles) These probe designed to detect single base-
are microorganisms that flourish in basic pair changes in a gene. Under very spe-
environments (base loving). Alkalino- cific conditions, a nucleotide sequence of
philes exists at a pH range of about 712. about 20 base pairs will hybridize to its
They include Vibrio cholerae, the causi- complementary sequence, but not to one
tive agent of cholera, whose optimum pH with a one base-pair change.
11
www.stemcell8.cn
allograft immunity
12
www.stemcell8.cn
amide
Alu elements A family of related DNA ecules that allow these mutated tRNAs to
sequences that are widely and randomly recognize the amber mutation UAG (see
dispersed through mammalian genomes. amber mutation). Ordinarily, a UAG
They are about 300 base pairs in length codon in a message signals the termina-
and are classified as moderately repetitive tion of translation, but a tRNA with an
DNA sequences. There are about 600,000 amber-suppressor mutation has an anti-
copies of these sequences in the human codon that is complementary (CUA) to
genome. At the ends of these sequences is the termination codon. It can therefore
a cleavage site for the restriction enzyme insert the amino acid that it is carrying at
Alu. Their purpose, if any, in the genome that site in the growing polypeptide chain
is not known. and avert chain termination.
13
www.stemcell8.cn
amine
group of one amino acid is linked to the acids that are incorporated into proteins
carboxyl group of the next amino acid. is the substrate of one of the enzymes.
In addition, each enzyme recognizes the
amine Compounds that contain an appropriate tRNA(s) to charge.
amino group (NH 2). Amino acids are
amines. See amino acid and amino aminoglycoside antibiotics A group
group. of antibiotics that act to kill a broad range
of bacteria by interfering with protein
amino acid The building blocks of synthesis at the bacterial ribosome. They
proteins. Amino acids contain a free are produced naturally by members of
carboxyl group (COOH), a free amino the soil-dwelling genus Streptomyces and
group (NH 2), a hydrogen atom, and include streptomycin and kanamycin.
a variable side group (R) attached to a
single carbon. (One exception to this is amino group The NH 2 group in
proline, whose amino group is involved a molecule. The presence of an amino
in a cyclic structure.) The physical and group is the defi ning characteristic of the
chemical properties vary among the R group of organic compounds known as
groups. However, there are several clas- amines.
sifications that put certain R groups in
the same category because they share aminolevulinic acid (ALA) The first
similar properties. These are the acidic, committed intermediate in the synthe-
basic, aliphatic, aromatic, and hydroxyl- sis of heme (see heme) and chlorophylls.
containing or sulfur-containing amino Cells that either overproduce ALA or are
side groups. There are 20 different amino fed large amounts of ALA overproduce
acids that are found in proteins. porphyrins, or intermediates in the heme
biosynthetic pathway. Porphyrins produce
aminoacyl-tRNA A tRNA that is car- toxic compounds to the cell when they react
rying its specified amino acid; also called with oxygen. Thus ALA is being tested as
a charged tRNA. The specificity of charg- a weed killer and as a photodynamic agent
ing of tRNA molecules is carried out by in the treatment of skin lesions.
20 different enzymes called aminoacyl
tRNA synthetases. Each of the 20 amino 6-aminopenicillic acid A chemical
structure that is found in the different
natural and semisynthetic penicillins.
This common nucleus of the penicillins
contains the beta-lactam ring structure.
In addition to the common core, 6-
aminopenicillic acid, all penicillins contain
a variable side group that distinguishes
them from one another.
14
www.stemcell8.cn
amplification
group normally found at carbon 2. Two ter of the micelle away from water. Fatty
commonly found amino sugars are D-glu- acids are amphipathic. Amphipathic mol-
cosamine, which is a major component of ecules are responsible for the properties
chitin (the outer hard covering of insects), of biological membranes.
and D-galactosamine, which is found in
cartilage. amphiphysin A protein found in nerve
terminals, particularly at the synapse
amino terminal Also called the N- where it is believed to be involved in the
terminus; one of the ends of a polypeptide recruitment of dynamin at sites of endo-
chain. This end of the polypeptide con- cytosis during the process of synaptic
sists of an unreacted amino group. The transmission. Amphiphysin autoantibod-
other end is called the carboxyl terminus, ies are found in patients with Stiffman
or C-terminus. syndrome (SMS). Amphiphysin autoan-
tibodies are also associated with breast
ammonium sulfate precipitation cancer and small cell lung carcinoma.
Salting out of proteins in solution. A
fi rst step in the purification of proteins amphoteric The description of a sub-
from cell extracts; ammonium sulfate, stance that has both acidic and basic
which promotes hydrophobic interac- groups and has properties of both acids
tions, is the most common salt used to and bases.
fractionate proteins according to their
solubility in the salt solution. ampicillin A semisynthetic form of
the antibiotic penicillin; an antimicro-
amniocentesis A procedure for test- bial agent that kills bacteria by inhibiting
ing the karyotype of a fetus in utero. the formation of bacterial cell walls. The
Cells from the amniotic fluid surround- addition of an amino group to penicillin
ing the fetus are taken from the mother makes ampicillin effective against gram
and cultured in the lab. Karyotype anal- negative organisms, thus widening the
ysis of the cells will determine the sex of antibiotics spectrum of activity.
the fetus, including any gross deformi-
ties of the chromosomes or a chromo- amplifiable selection Exploitation of a
some number that signals certain genetic natural phenomenon in which some
diseases. transformed cell lines undergo local
repeated DNA replication to produce
AMP See adenosine monophosphate. many copies of genes at those locations.
A commonly used system is the use of
amphibolic A metabolic pathway, methotrexate to amplify the region
one that is catalytic and anabolic, that around the dihydrofolate reductase
can both degrade metabolites as well as (DHFR) gene.
synthesize them. These pathways allow
breakdown products of one pathway to amplification Repeated replication of
be used as substrates in the synthesis of a plasmids or sequences. Plasmid amplifi-
compound in another pathway. cation is a process that is used to increase
the replication of plasmids over that of
amphipathic compound A compound chromosomes so that the plasmid isola-
that contains both polar and nonpolar tion from whole cells is facilitated. The
groups. Polar groups are soluble in water process involves growing cells with
(hydrophilic), and nonpolar groups are amplifiable plasmids in the antibiotic
not (hydrophobic). In water or aqueous chloramphenicol that stops chromosomal
environments, amphipathic compounds DNA replication but does not affect plas-
form micelles, or small vesicles with polar mid DNA replication. Specific sequences
regions in contact with water and nonpo- of DNA can be amplified using the tech-
lar regions regions sequestered in the cen- nique of PCR (polymerase chain reaction).
15
www.stemcell8.cn
amplification refractory mutation system
16
www.stemcell8.cn
antigen
17
www.stemcell8.cn
antigenic determinant
antigenic determinant A small portion ple, sulfa drugs that block the synthesis
of the antigen that determines the specifi- of the vitamin folic acid.
cally of the antigen-antibody reaction.
antimorphic allele A mutant allele
antigenic variation A sequential change that has an antagonistic reaction to the
in the structure of an antigen of microor- normal, wild type of allele. A person who
ganisms and viruses so that antigens on has both an antimorphic allele and wild
these pathogens will not be recognized by type of allele for a particular gene will
antibodies already produced in the host. have less of that gene product than an
The disease-relapsing fever, which is char- individual who has a deletion for that
acterized by cyclic infections by the same gene and the wild type of allele.
bacterium, is due to the ability of the bac-
terium to change its antigenic makeup and antimutator A gene that decreases the
thus avoid immunity built up by the host. spontaneous mutation rate of an organ-
A more subtle type of antigenic variation ism. These genes are usually involved in
is seen in the antigenic shift (major anti- some DNA repair or metabolism process.
genic change) and antigenic drift (minor
antigenic change) seen in the influenza anti-oncogene A tumor suppressor
virus that result in loss of immunity by gene, or a gene whose absense is needed
populations and influenza pandemics and for an oncogenic event. Loss or inactiva-
epidemics every number of years. tion of a tumor suppressor gene by either
mutation or deletion is believed to be an
antigen-processing/-presenting cell important event in the development of a
Any of a heterogeneous group of cells tumor.
that bind foreign antigens to their sur-
face and then interact with helper T antiparallel Refers to the structure of
cells, a process that is required for DNA. The two strands of complementary
T-cell activation. Antigen-presenting cells DNA are antiparallel, that is, the 5 end
include dendritic cells in lymphoid tissue, of one stand is paired with the 3 end of
Langerhans cells found in skin, and some the other and vice versa.
macrophages.
antiparasite A substance or chemical
antihelminthic agent A substance or that inhibits or kills parasites.
drug that inhibits the growth or kills hel-
minth parasites. antiport The transport of two sub-
stances across the cell membrane that are
antihistamine A substance or drug coupled but in opposite directions.
that blocks the effects of histamines in
the inflammatory process; a drug that antisense RNA A strand of RNA that
relieves allergy symptoms. is complementary to that of a messenger
RNA. An antisense RNA would bind to
anti-idiotype antibodies An anti- the messenger and prevent synthesis of
body made in response to a unique the protein encoded by the message. Anti-
antigen-combining site of an antibody. sense RNA is being explored as a pos-
The resulting antibody may have a struc- sible therapeutic agent for viral infections
tural similarity to the original antigen and to prevent certain cancer genes from
and may stimulate antibodies against it, being expressed into proteins.
thus serving as a vaccine.
antisense strand Of the two DNA
antimetabolite A chemical that inhib- strands in a double-stranded DNA mol-
its the growth of microorganisms because ecule, the antisense strand is the one that
it blocks the synthesis of some metabolite is not used as the template for RNA syn-
needed by the microorganism, for exam- thesis.
18
www.stemcell8.cn
apyrimidinic site
antiseptic Any chemical that is com- in a variety of ways, the main pathway
monly used to kill microorganisms to is initiated by the binding of a ligand to
prevent infection. the Fas receptor or by binding of tumor
necrosis factor (TNF) to its receptor.
antitermination factor A protein that Activation of the receptors sets off a cas-
prevents the termination of transcription. cade by which proteases called caspases
It is involved in certain mechanisms of are activated, ultimately resulting in deg-
gene expression control. radation of DNA by DNase, proteolysis,
and cell death.
apaf-1 A cytoplasmic protein that initi-
ates the process of apoptosis by cleaving, aptamer An oligonucleotide of
and thereby activating, caspase 9. Acti- DNA or RNA or a peptide that binds to
vation of caspase 9 causes subsequent and inactivates proteins. Often, libraries
activation of other caspases in a reaction of sequences are used to inhibit the pro-
chain that ultimately commits the cell to tein, and the sequences that are success-
undergo apoptosis. Cleavage of caspase ful are amplified and identified. Aptam-
9 requires the formation of a complex ers can be used to study the active site of
between apaf-1, cytochrome c, and dATP the protein or they can be developed into
to form an oligomeric structure called an therapeutics.
apoptosome.
apurinic site A site on the DNA in
APC syndrome Familial adenomatous which a purine is missing but the phos-
polyposis coli; a genetic disease character- phodiester sugar backbone is still intact.
ized by the development of benign polyps
in the colon, a condition that frequently apyrimidinic site A site on the DNA in
precedes the development of malignant which a pyrimidine is missing but the phos-
colon cancer. The genetic locus of APC phodiester sugar backbone is still intact.
has been shown to reside on human chro-
mosome 5. Research aimed at mapping
and then cloning the causative gene(s) via
chromosome walking is currently under Fas
ligand
way. See genetic disease.
TNF
Fas
TNF-R1
19
www.stemcell8.cn
aqueous
aqueous Pertaining to water; for exam- human immunodefi ciency virus (HIV)
ple, the aqueous phase after separation infection, including general malaise,
with an organic solvent would be the night sweats, dementia, wasting, and
water phase. opportunistic diseases associated with
immunodefi ciency such as Kaposis
aqueous two-phase separation A sarcoma (a rare form of skin cancer),
method to partition proteins during puri- pneumonia (generally caused by Pneu-
fication using solutions of polyethylene mocystis carinii), and retinitis (caused
glycol and dextran or polyethylene glycol by cytomegalovirus).
and certain salts such as a phosphate.
Archaebacteria A group of bacte-
arabinosyladenine (AraA) An antivi- ria including those that produce meth-
ral anitibiotic that is used to treat viral ane from carbon dioxide and hydro-
encephalitis. AraA is a derivative of the gen (methanogens) and those that live
normal purine nucleoside, adenosine, in high-salt environments (halophiles)
in which the sugar, ribose, has been that appear to be very different from
replaced with one of its optical isomers, and more primitive than other living
arabinose. bacteria. It is believed that Archaebac-
teria have evolved separately from the
arabinosylcytosine (AraC) An anti- true bacteria (Eubacteria) and from the
biotic that acts by blocking DNA syn- eukaryotes and that they constitute a
thesis. AraC is a derivative of the nor- third group of organisms.
mal pyrimidine nucleoside, cytosine,
in which the sugar, ribose, has been arginine An amino acid with the side
replaced with one of its optical isomers, chain:
arabinose. (CH 2)3 NHC=NH
\
arachidonic acid A 20-carbon fatty NH 2
acid with four double bonds. It serves as
a precursor for the synthesis of prosta- argininemia A disease caused by a
glandins. deficiency of the enzyme arginase that
catalyzes the last step of the urea cycle in
ARC AIDS-related complex, or a which arginine is hydrolyzed to urea and
series of symptoms related to an active ornithine. The syndrome is characterized
by hyperammonemia, encephalopathy,
and respiratory alkalosis. The disease
gene is an autosomal recessive, at gene
map locus 6q23.
20
www.stemcell8.cn
atomic-force microscopy
aseptic Without germs; sterile. AT/GC ratio The ratio of adenine plus
thymine base pairs to guanine plus cyto-
asexual reproduction Reproduction sine base pairs in a molecule of DNA.
in the absence of any sexual process, or
the reproduction of a unicellular organ- ATM A tumor suppressor gene that is
ism by cell division, where a single parent activated by DNA strand breaks. Acti-
is the sole contributer of genetic informa- vated ATM in turn activates the chk2
tion to its offspring. kinase, which results in cell cycle arrest
in G2. ATM is an acronym for ataxia tel-
asparagine An amino acid with the angiectasia mutated because both copies
side chain: of this gene are mutated in patients with
(CH 2)C=O this disease. Mutations in the ATM gene
\ result in hypersensitivity to radiation and
NH 2 a tendency to accumulate mutations in
other genes, which can lead to cancer,
aspartame An artificial sweetener that particularly breast cancer, leukemia,
uses the amino acid phenylalanie as a and lymphoma. Also, mutations in ATM
precursor. can cause cells to die, particularly in the
cerebellum, which results in the prob-
aspartic acid An amino acid with the lems with limb movement seen in ataxia
side chain: telangiectasia. The ATM gene is located
(CH 2) C=O on the long (q) arm of chromosome 11 at
\ position 22.3 (gene map locus 11q22.3).
OH
atomic-force microscopy (AFM) A
Aspergillus A genus of fungi that are device for visualizing objects with a max-
important economically because they imum resolution of about 10 pm, about
21
www.stemcell8.cn
ATP
the size of small molecules. Unlike tra- autogenous control Control of gene
ditional microscopes, the AFM does not expression by the genes product or pro-
contain a lens but utilizes a probe that tein encoded by the gene.
measures the attractive or repulsive forces
between the probe tip and the molecu- autoimmune The inability to distinquish
lar structure being visualized as the tip self from nonself, or a state where the body
is moved along the surface of the speci- produces antibodies to its own cells.
men. The movement of the probe tip gives
rise to an electrical signal, which is trans- autolysin An enzyme that causes cellu-
lated into an image by computer. Unlike lar self-destruction of the same cells that
electron microscopes, AFMs can image synthesize it.
samples either in air or in liquids.
autolysis The self-degradation of a cell
ATP See adenosine triphosphate. by release of hydrolytic enzymes of the
lysosome. In the case of bacteria, autoly-
ATPase Any of a class of enzymes that sis is brought about by self-destruction of
acts to remove one or more phosphate the cell wall by a specific enzyme.
groups from ATP to produce ADP or
AMP and inorganic phosphate by hydro- autonomic nervous system The part
lysis. The release of phosphate is accom- of the nervous system that regulates
panied by the release of energy that is involuntary responses.
used to power various cellular functions.
autonomously replicating sequences
atrial natruiretic factor (ANF) A (ARS) Special nucleotide sequences in
hormone produced by the right atrium of the DNA of chromosomes that serve as
the heart that stimulates sodium excre- sites where DNA replication begins.
tion by the kidneys and is involved in
the regulation of blood pressure. ANF
autoradiography A technique that
is believed to play a key role in cardio-
involves using a radioactively labeled
vascular homeostasis by acting on recep-
compound to localize a reaction in a cell
tors that stimulate the formaton of cyclic
or to study a process and using photo-
GMP (cGMP). ANF is currently the tar-
graphic fi lm to visualize the location of
get of research on new antihypertensive
the label.
and diuretic drugs.
22
www.stemcell8.cn
Azotobacter
auxotroph A bacterial mutant that can axis polarity The orientation of the
no longer make some required nutrient. body in space, depending upon three
axes: the anterior/posterior body axis,
Avastin An anticancer drug that acts by the dorsal/ventral axis, and the medial/
blocking the formation of new blood ves- lateral axis. During the development
sels that feed tumors. Avastin is a recom- of the embryo, genes that control axis
binant antibody to vascular endothelial polarity are the axis formation genes
growth factor (VEGF), which has been that establish embryonic body axis and
engineered by the insertion of certain the axis polarity genes that control ante-
human sequences to avoid rejection by rior/posterior and dorsal/ventral body
the patients immune system. Avastin acts orientation.
by blocking VEGF, a protein that plays a
key role in tumor angiogenesis. Avastin is axon Extention of a nerve cell that con-
used in combination with 5-Fluorouracil ducts impulses away from the cell body.
chemotherapy to treat patients with pri-
mary metastatic cancer of the colon or axoneme The structural core of a cilia
rectum but is currently being tested for or eucaryotic flagellum that is made up of
treatment of other types of cancer includ- nine outer doublets of microtubules and
ing renal cell, breast, and non-small cell an inner pair of microtubules.
lung cancers.
3-azido-3-deoxythymidine (azido-
axenic culture Pure culture or the thymidine [AZT]) An antiviral anti-
growth of one organism. biotic used to treat HIV infection (the
AIDS virus). AZT is a derivative of the
axin A membrane-bound intermediate normal deoxyribonucleoside thymidine
in the Wnt signaling pathway that acti- in which an azide group is attached to
vates the transcription of D-type cyclins. the deoxyribose sugar at the 3 position.
Axin interacts with the adenomatosis AZT is an inhibitor of the virus reverse
polyposis coli (apc) protein, beta-catenin, transcriptase enzyme that blocks viral
and glycogen synthase kinase 3b in spe- replication at the point where viral RNA
cific ways that ultimately regulate the is copied into DNA.
entry of beta-catenin into the nucleus.
The axin protein contains three domains: Azotobacter A genus of free-living
a regulation of G-protein signaling (RGS) microorganisms that are capable of
domain, a disheveled domain, and an biological nitrogen fixation, or the abil-
axin (DIX) domain. Mutations in axin ity to use nitrogen of the atmosphere
are associated with liver and ovarian for synthesis of nitrogen-containing
cancers. compounds.
23
www.stemcell8.cn
A
B
24
www.stemcell8.cn
BamHI
verso
Escherichia coli and has a complex set of baffles Structures on the bottom of
regulatory mechanisms governing whether some culture flasks that increase aeration
the virus will reproduce itself and lyse its when growing a culture of organisms in a
host or lysogenize its host by integration of shaking water bath or incubator.
its genome into its hosts genome. Deriva-
tives of lambda are used as cloning vectors bakers yeast Saccharomyces cerevi-
to introduce foreign DNA into E. coli. siae, a common yeast, or unicellular bud-
ding eukaryotic organism, that ferments
bacteriophage mu A DNA virus that sugars and produces carbon dioxide,
is capable of transposition, or inserting which is used to leaven bread.
its DNA randomly into the genome of its
host. This virus is used in the process of Balbiani rings A very large puff indi-
insertional mutagenesis. cating transcriptional activity that is seen
at a site on the polytene chromosome of
bacteriophage X174 A single-stranded the certain larval insects.
DNA virus that has been used to study
the process of DNA replication. Baltimore, David (b. 1938) A molec-
ular biologist and virologist who won
bacteriophage Q A single-stranded the Nobel Prize in physiology or medi-
RNA bacteriophage. cine in 1975 for the discovery that ret-
roviruses, a group of viruses that have
bacteriophage T4 A large DNA virus. an RNA genome produce an enzyme,
reverse transcriptase. He was found-
bacteriophage T7 A DNA virus with ing director of the Whitehead Institute
a very strong promoter that responds to for Biomedical Research at MIT and held
specific T7 RNA polymerase. A number that position from 1982 to 1990. He
of cloning vectors have been constructed headed the National Institutes of Health
so that foreign DNA is situated next to AIDS Vaccine Research Committee in
a T7 promoter, so that expression of the 1996.
gene can be regulated and amplified by
addition of T7 RNA polymerase. BamHI A restriction enzyme that rec-
ognizes a specific six-base pair sequence
bacteriorhodopsin A transmembrane (GGATCC) and cuts in a staggered man-
protein of the purple membrane of ner, thus creating single-stranded over-
Halobacterium halobium that is capa- hangs (sticky ends) at the cut sites.
25
www.stemcell8.cn
recto islands
Bam
26
www.stemcell8.cn
Beadle, George
verso
W.
1B 1A 2 3 4 5 6 7 8 9 10 11
chromosome 9
c-abl
chromosome 22
bcr
translocation
bcr/abl fusion
27
www.stemcell8.cn
recto
bectoplasm
Edward Tatum, showed that genes control recombinant DNA. He became head of the
enzyme production. Beadle and Tatum NIH Scientific Advisory Committee for
shared the 1958 Nobel Prize in physiol- the Human Genome Project in 1991.
ogy or medicine with J. Lederberg.
beta-adrenergic receptor kinase
bectoplasm An archaic term for the (ARK) An enzyme responsible for
outer portion of the cytoplasm of a cell. the desensitization of the beta-adren-
ergic receptor as a result of continued
Beer-Lambert law The equation that stimulation by the receptor agonist (e.g.
states that the molar concentration of a epinephrine). ARK causes inactiva-
substance is proportional to how much tion of the receptor by phosphorylating
light of a certain wavelength is absorbed serine residues on the cytosolic portion
by a solution of the substance: of the receptor. Inactivation of the beta-
A = ECL adrenergic receptor is due to elevated
Where levels of ARK in cardiac muscle that
A = the absorbance at a given wave- occurs rapidly after a heart attack. The
length ARK gene is located on chromosome
E = the molar extinction coeffi cient 11, centromeric to 11q13 (gene map locus
C = the molar concentration of the solu- 11q13).
tion
L = the length of the light path beta-arrestin (arr) A protein that
binds to the cytosolic portion of the beta-
Bence-Jones protein Part of an anti- adrenergic receptor following phosphory-
body molecule (the light chain) that is lation of the receptor by ARK. Binding
found in the urine of individuals who of arr effectively blocks the binding of
have the disease multiple myeloma, a the G-coupled receptor kinase, thereby
tumor of the bone marrow. These frag- inactivating all subsequent steps in the
ments were instrumental in determining cascade of reactions that releases glucose
the structure of the antibody. from glycogen in muscle and liver.
28
www.stemcell8.cn
bioreactors
verso
ples of beta-blockers are atenolol, meto- down organic matter in water. A measure
prolol, and propranolol. of the organic pollutant load.
29
www.stemcell8.cn
recto
biosynthesis
catalyzed reaction. Such equipment uses the fruit fly, Drosophila melanogaster. See
biocatalysts that are immobilized on a homeobox.
support and controls the contact between
the catalyst and its substrate. bivalent A synapsed pair of homolo-
gous chromosomes found in prophase I
biosynthesis The synthesis of mol- and metaphase I of meiosis; also known
ecules in biological systems. These syn- as a tetrad.
theses are carried out in small discrete
steps, each step catalyzed by an enzyme, BLAST Basic local alignment search
and are energy requiring, usually involv- tool; a set of similarity search programs
ing ATP or GTP as energy sources. designed to look at all of the available
protein or nucleic acid sequence data-
biotin A vitamin prosthetic group that bases. Access BLAST through the home
carries activated carbon dioxide and that page of the National Center for Biotech-
is bound to the enzyme pyruvate decar- nology Information (http://www.ncbi.
boxylase. This is an important enzyme nih.gov).
because it replenishes one of the interme-
diates of the Krebs cycle. blasticidin An antibiotic that inhibits
protein synthesis in both prokaryotes and
biotin labeling (biotinylation) A non- eukaryotes. A gene that confers resistance
radioactive labeling system in which bio- to blasticidin (BSD) has been incorpo-
tin is covalently linked to a nucleic acid. rated into some plasmid vectors so that
the antibiotic can be used to select stable
biotransformations See bioconver- cell lines that carry the vector.
sions.
blastoderm A stage in the develop-
biphasic growth curve The growth ment of insect embryos in which a layer
curve of a microorganism that is char- of nuclei or cells around the embryo sur-
acterized by two exponential growth round an internal mass of yolk.
phases separated by a stationary phase.
Such a growth curve is produced by blastula The stage in animal develop-
culturing the organisms on two carbon ment in which a ball of cells is formed
sources, in which one carbon source is from the cleavage of cells of the zygote.
in a limiting concentration and must be
used up before the second carbon source blood agar A culture medium in which
can be utilized. animal blood, usually rabbit or horse, is
added to provide nutrients or to be used
bispecific antibodies Antibodies in diagnostically for hemolysins (enzymes
which the two binding sites recognize dif- that lyse red blood cells) secreted by cer-
ferent antigens. Such antibodies can have tain strains of bacteria.
one binding site recognize the antigen of
a tumor cell, and the other antigen rec- blood groups See ABO blood
ognize the antigen of a cytotoxic (T cell) group.
lymphocyte, thus effecting the killing of
the tumor cell by the cytotoxic T cell. Bloom syndrome (telangiectatic ery-
Biospecific antibodies can be produced thema) A rare autosomal recessive dis-
chemically, or biologically by fusion of ease characterized by spider veins (telan-
two monoclonal antibodies, producing giectases), sensitivity to light, impairment
hybridomas or cells. of growth and the immune system, and
a predisposition to cancer. Blooms syn-
bithorax A genetic locus in the homeotic drome is caused by a mutation in a gene
box defined by mutations that cause devel- called BLM, at gene map locus 15q26.1.
opmental defects in the thorax region of The BLM protein is a DNA helicase.
30
www.stemcell8.cn
branched-chain alpha-ketoacid dehydrogenase
31
www.stemcell8.cn
branch migration
branch migration A proposed step system, and therefore the disease is char-
in the process of DNA recombination, acterized by many types of systemic and
or DNA crossing over, in which there is pulmonary infections. Infections begin at
movement of the crossover point of the about six months of age when the mater-
recombinant intermediate. nal antibodies begin to decline. In the
absence of B-cell maturation, the organs
BRCA1/BRCA2 The fi rst breast can- where B-cell maturation normally takes
cer genes identified. Both genes are place (the spleen, tonsils, adenoids, Peyer
tumor-suppressor genes. Mutations in patches, and peripheral lymph nodes)
these genes are believed to be responsi- are often reduced in size or completely
ble for about half of the inherited forms absent. The BTK gene is found on the X
of breast cancer. Individuals inherit one chromosome at gene map locus Xq21.3.
copy of the mutated gene because if
an embryo possesses two copies of the buffer A substance in liquid that tends
mutant gene, it does not survive. to resist changes in pH, by absorbing
either hydrogen or hydroxyl ions.
breakage and reunion Physical break-
age of DNA molecules and rejoining of Burkitts lymphoma A tumor that
parts of two different molecules, result- is relatively common in East Africa and
ing in recombination or crossing over. New Guinea but rare in other parts of
the world. The Epstein-Barr virus (EBV),
5-Bromouracil (5-BU) A chemical the etiological agent of infectious mono-
that causes mutations in DNA because it nucleosis, is associated with this disease,
resembles thymine, a natural constituent but it is not currently known whether the
of DNA. When incorporated into DNA in relationship of the virus to the disease is
place of thymine in its enol-shifted form, casual or causal.
it can readily pair with guanine. In its
presence, an A-T base pair is replaced by a bursa of Fabricius A lymphoid organ
G-C base pair after two rounds of replica- of the chicken that is responsible for the
tion. This is called a transition mutation. maturation of B lymphocytes. The B cells
were so named because of this organ.
broth A liquid culture medium for However, humans and other mammals
microorganisms. do not possess a bursa, and its equiva-
lent in these organisms is probably other
Bruton Agammaglobulinemia An X- lymphoid tissues, such as the tonsils, the
linked immunodeficiency disease in males appendix, Peyers patches, and the lym-
that is caused by mutations in a gene phoid follicles.
that codes for an enzyme known as the
Bruton tyrosine kinase (BTK). The BTK burst number The number of viral
enzyme is necessary for the maturation of particles that are produced per cell after
antibody-producing B cells of the immune infection.
32
www.stemcell8.cn
A
C
C3 cycle The Calvin cycle or that part CAAT box A consensus nucleotide
of photosynthesis where CO2 is fi xed to sequence in DNA that has homology to
form a three-carbon organic compound GGT(orC)AATCT and that is found in
that is subsequently converted into a six- the promoter region of many eukaryotic
carbon sugar. genes and is required for efficient tran-
scription.
C4 cycle The Hatch-Slack pathway, or
an accessory very efficient pathway to fi x cadherins A family of proteins found
CO2 used by plants that grow in hot dry on the cell surface that mediate cell-cell
climates with low CO2 levels. adhesion and that play a central role in
normal development. The cadherins
are responsible for the selective cell-cell
C600 A strain of E. coli that is com-
adhesion that accounts for the cell sort-
monly used in genetic experiments and as
ing by which cells are placed at their
a host for cloned plasmids.
proper sites during development. The
typical cadherin protein has five tan-
Cot value A parameter describing the dem repeated extracellular segments, a
rate at which complementary strands of single membrane-spaning segment, and
DNA reassociate with one another to a cytosolic domain. Cadherins function
form double-stranded DNA. Cot values as a signal transduction element in the
are of significance historically because
Wnt signaling pathway. Cell-cell bind-
the theoretical relationship between Cot
ing by E cadherins releases membrane-
and reassociation rate underlies the prin-
bound src, which acts to induce cyclin
ciple of DNA probe hybridization.
D through beta catenin. There is also
If DNA is denatured to a single-
recent evidence that altered expression
stranded state and then allowed to
reassociate back to its native double- of cadherins may be involved in invasion
stranded form, the extent of reassocia- and metastasis of tumor cells.
tion for any particular DNA sample
increases (1) with DNA concentration caldesmon A calmodulin-binding pro-
when allowed to renature for a given tein involved in the regulation of contrac-
amount of time or (2) with time at a tion in smooth muscle. At high calcium con-
given DNA concentration. centrations caldesmon binds to the Ca++-
Cot is the product of the two variables: calmodulin complex. This leads to muscle
C ot = (DNA concentration) (the time contraction by allowing muscle actin to
allowed for reassociation). make contact with myosin.
The concentration (C) of double-
stranded DNA formation as a function calmodulin A ubiquitous calcium-
of Cot is: binding protein that serves as an intracel-
C/C o = 1/(1 + kC ot) lular receptor of Ca++ and, in its active
where k is the reaction rate constant and form, mediates an intracellular response
Co is the initial concentration of unpaired to Ca++ as a second messenger. See sig-
DNA. nal transduction.
33
www.stemcell8.cn
recto
calorie
E-cadherin
integrin
a b
Wnt
ILK Frz
b -catenin b -catenin a a Dsh
a a
tin
Src
ac
tin
ac
b -catenin cond
uctin
P
cytosol axin
GSK-3b
b -catenin b -catenin
Apc Apc
Tcf-4
b -catenin
P
Tcf-4
b -catenin
[transcription]
P
GSK-3b pro
cyclin D1 teo
cyclin D1 lys
is
myc
nucleus
34
www.stemcell8.cn
cardiac muscle
verso
eukaryotic mRNA. The bond is made isms, but fats and some amino acids can
between the 5 phosphate group of the also be utilized for energy production.
nucleotide and the 5 end of the RNA, so
the nucleotide is referred to as inverted. carbonyl group The atoms of car-
This cap may give stability to the mRNA. bon and oxygen, in which the oxygen is
bonded to the carbon via two chemical
capping of mRNA The posttranscrip- bonds, C = O.
tional process that adds a guanosine resi-
due to the 5 end of a eukaryotic mRNA carboxyl group The atoms of carbon,
and then methylates it. oxygen, and hydrogen, in which one oxy-
gen is bonded to the carbon via a double
capsid The protein coat of a virus. bond and the oxygen and hydrogen form
a hydroxyl group (OH) and are bonded
capsomere The protein subunits of the to the carbon via a single bond with the
capsid. oxygen:
C=0
capsule An envelope of carbohy- |
drate, or a slime layer surrounding some OH
microorganisms. Capsules contribute to Carboxyl groups are found on organic
the invasiveness of some bacteria because acids.
they enable the organisms to evade
phagocytosis. carboxyl terminus The end of a mol-
ecule where a carboxyl group is found.
carbohydrate A sugar or the name for Proteins that are made up of amino acids
molecules that contain carbon hydrogen have a carboxyl terminus and an amino
and oxygen in the ratio, Cn H 2nOn and terminus.
that can be simple monomers, such as
glucose or fructose; disaccharides; or two carboxypeptidases Enzymes that re-
molecules joined together by a glycosidic move successive amino acids from pro-
bond (see glycoside), such as sucrose teins starting at the carboxy terminal end
(common table sugar) or lactose (milk (see above) by hydrolyzing the peptide
sugar); or polymers containing as many bond between amino acids.
as thousands of simple sugar molecules,
such as starch, cellulose, and glycogen. carcinogen A cancer-producing agent
or any chemical or physical agent that
carbon dioxide cycle The flow of CO2 can produce a tumor in an animal or
from organisms that can photosynthe- cause normal cells in culture to become
size (plants and algae) and convert it into transformed.
organic foodstuffs to all other organisms
that consume the organic molecules and carcinogenesis The process by which
give off CO2 as waste product. a normal cell transforms into a cancerous
one. See transformation.
carbon fixation The process by which
plants and algae (photosynthesizers) con- carcinoma A tumor derived from
vert inorganic carbon, CO2 , into organic epthielial cells.
molecules, specifically carbohydrates, that
are used as food for other organisms. cardiac muscle The muscle tissue of
the heart, thus responsible for pumping
carbon source Any organic carbon- blood through the bodys circulatory
containing molecule that can be metabo- system. It is striated and looks very simi-
lized to produce energy in the form of ATP lar to skeletal muscle, but both muscles
in an organism. In general, carbohydrates use different carbon sources for energy
serve as carbon sources for most organ- production.
35
www.stemcell8.cn
carotene
recto (beta)
carotene (beta) A specific carot- ate conditions are moved behind promot-
enoid found in plants that assists in ers where they can be expressed. Cassettes
light absorption by the chloroplasts. This can be constructed in the lab by flanking
pigment gives the red color to such veg- the gene or sequence to be made into a
etables as carrots, tomatoes, and yellow cassette with restriction enzyme cutting
squash. sites.
36
www.stemcell8.cn
verso
cdks
making it more efficient for the reaction and HAP5 and stimulates the transcrip-
to proceed. tion of various genes by recognizing and
binding to a CCAAT motif in promoters.
CAT assay An assay for determin- The human gene for CBF is at gene map
ing whether a given DNA fragment may locus 6p21.3.
contain promoter activity by ligating the
fragment to the chloramphenicol acetyl CCBF transciption factor A tran-
transferase (CAT) gene in an expression scription factor involved in regulation
vector and observing whether the CAT of genes (e.g., Cln1 and Cln2) required
enzyme is made when the vector is trans- for progression through the G1 phase of
fected into animal cells. See aph. the cell cycle in yeast. The CCBF tran-
scription factor binds to a specific DNA
catenanes Macromolecular rings that sequence called the cell cycle box in the
are mechanically interlinked with one promoter region(s) of the critical cell
another. Catenanes have been used to cre- cycle genes.
ate molecular machines (nanomachines).
Catenanes are being tested as nanoscale CD3 A complex of transmembrane
robotic devices that may be useful for the proteins in T cells that, in association
development of slow-release drug-delivery with the T cell receptor, helps promote
systems or to control chemical reactions in an interaction between the T cell and
nanoscale laboratories on a chip. another cell containing an antigen on its
surface. As a result of this interaction,
catenation The linking together of there is a proliferation of T cell clones
multiple copies of a macromolecule. that recognize the antigen.
37
www.stemcell8.cn
recto
cDNA
38
www.stemcell8.cn
cell verso
plate
detergentsboth ionic such as sodium extract refers to the soluble portion of the
lauryl sulfate, or nonionic detergents internal cellular contents after removal of
such as Triton X-100 can be used to the organelles and cell membrane debris.
destroy the cell membrane and facili-
tate cell lysis. cell-free protein synthesis The syn-
enzymaticlysozyme, an enzyme pre- thesis of proteins in a test tube using a
pared from hen egg whites, breaks cell-free extract to supply the necessary
down the peptidoglycan cell wall of enzymes and components and dependent
bacteria. on addition of amino acids and mRNA.
grindingphysical disruption of the
bacterial cell wall by grinding with an cell fusion The process of fusing two
abrasive material such as glass beads. different cells together, fi rst creating a
This can be done either in small scale heterokaryon that contains both of the
with a mortar and pestle or in large nuclei and then a fusion of the nuclei to
scale using a cell disrupter apparatus. create a synkaryon. The fusion occurs
osmotic shockrelease of proteins by reaction between the two cell mem-
from the periplasmic space of Gram- branes, brought about by treatment with
negative bacteria (see Gram stain) by Sendai virus or polyethylene glycol.
resuspending the cells fi rst in a solu-
tion of 20 percent sucrose and then cell line A cell culture started from
resuspending them in water. a particular type that can be cultured
shearingpassage of cells through a indefi nitely in the laboratory and is thus
narrow orifice at high pressure. Small- characterized as immortal.
scale operations may use solid shear in
which frozen cell are forced through cell lineage A complete set of ancestral
the orifice. Large-scale preparations cells and cell divisions that makes up a
use liquid shear. certain cell type during development.
sonicationdisruption of cell walls by
high-frequency sound waves. cell-mediated immune system See
cell-mediated immunity.
cell-division-cycle genes Any of
approximately 50 genes that control the cell-mediated immunity A type of
cell cycle in yeast. immunological response that is mediated
by cytotoxic T lymphocytes or killer T
cell-division-cycle mutant Cell-division- cells and is used by the body to destroy
cycle temperature-sensitive mutants of cells that carry foreign antigens, such as
yeast that either become blocked or show virally infected cells, tumor cells, and
aberrent behavior in various parts of the nonmatching tissue grafts.
cell cycle at a temperature at which the
mutation can be expressed (the restrictive cell membrane The boundary that
temperature). See cell cycle. limits the cell contents from its environ-
ment. It is composed of a phospholipid
cell fractionation The process of pre- bilayer that is associated with proteins
paring a cell-free extract and dividing the either embedded in the bilayer (intrin-
cell contents into fractions by centrifuga- sic or transmembrane) or external to it
tion techniques. (extrinsic). The cell membrane provides
a selectively permeable barrier to the cell,
cell-free extract The product of treating allowing entrance by substances that are
a suspension of cells with a substance(s) needed by the cell and preventing leakage
that destroys the cell wall (in the case of of important substances out.
bacteria and plants) and/or the cell mem-
brane, thus releasing the cytoplasm and cell plate The boundary between two
cell organelles. Sometimes the cell-free newly formed nuclei in a plant cell that is
39
www.stemcell8.cn
rectosorter
cell
about to divide into two daughter cells; centimorgan (cm) One hundredth of
these daughter cells consist of cell wall a morgan, the unit of genetic distance
material and cell membrane that grows or a map unit distance, named in honor
and eventually becomes contiguous with of Thomas Morgans contribution to
the existing cell wall and cell membrane. mapping genes in Drosophila. The cen-
It is also called the phragmoplast. timorgan is defi ned by recombination
frequency between two genetic markers
cell sorter An instrument used to sepa- expressed as a percentage.
rate and analyze different classes of cells
from mixed populations. The fluorescence central dogma The concept that all
activated cell sorter (FACS) separates dif- genetic information flows from DNA.
ferent cell types in a population based on The information in the DNA is passed
external antigens that bind to antibodies on to progeny cells by the process of
labeled with fluorescent dyes. DNA replication, and the information
stored in DNA is fi rst transcribed into
cell sorting The process of sorting RNA, which is then translated to syn-
out different cell types in a heteroge- thesize proteins.
neous population. See fluourescence-
activated cell sorting. central nervous system The sensory
and motor cells (neurons) of the brain
cell synchronization The process by and spinal cord.
which all cells in a population come to be
in the same phase of growth and conse- centrifugal force The force that tends
quently undergo cell division simultane- to impel substances outward from a cen-
ously. ter of rotation.
cell theory The theory that states that centrifuge An instrument that sepa-
the cell is the basic structural unit of all rates substances from liquids by centrifu-
organisms and that all cells arise from gal force and separates substances from
preexisting cells. other substances based on how each
moves in a centrifugal field.
cellulase An enzyme that hydrolyzes
long polymers of cellulose to cellobiose, centriole A structure composed of
which is a disaccharide of glucose units. microtubules that is found in the nucleus
and is involved in the formation of the
cell wall The rigid or semirigid layer spindle apparatus that aids in the orderly
peripheral to the cell membrane of bacte- parceling out of duplicated chromosomes
ria, algae, fungi, and plants. In plants the to daughter cells in the process of cell
cell wall is composed of microfibrils of division. The centriole is also identical in
cellulose embedded in a matrix. The bac- appearence to the basal body, the organ-
terial cell wall, the peptidoglycan layer, elle that is embedded at the periphery of
is a complex structure of chains of alter- the cell and serves as the base of the cells
nating residues of N-acetylmuramic acid locomotive appendages, the flagella and
and N-acetyl glucosamine held together cilia.
by peptide bridges.
centromere The point along the chro-
Center for Inherited Disease Research mosome to which duplicated sister chro-
(CIDR) A center of the National Insti- matids are joined before the chromo-
tutes of Health (NIH) supported by nine somes are divided into the two daughter
of the NIH institutes to provide genotyp- cells. It also serves as the site of attach-
ing and statistical genetics services for ment of the kinetochore, the structure on
researchers identifying genes that cause which microtubules of the spindle appa-
human disease. ratus attach to pull the duplicated chro-
40
www.stemcell8.cn
Charon phage
verso
mosomes to opposite ends of the cell dur- brain, that consists of a pair of hollow,
ing mitosis. convoluted lobes.
41
www.stemcell8.cn
recto
checkpoint
checkpoint Places in the cell cycle where some limiting nutrient to the removal of
specialized processes can arrest progression spent medium and cells.
through the cell cycle. Cell-cycle arrest at
a checkpoint is generally caused by DNA chemotaxis The movement of an
damage or other type of injury at an early organism to an attractant and away from
stage, which would lead to malfunction. a repellant.
42
www.stemcell8.cn
chitin
verso
nuclease to cut at that site for recombination cular DNA molecules, is cut by a restric-
or crossing over to occur. It serves as a hot tion enzyme that cuts each circular DNA
spot of recombination as it is used preferen- once. The name is derived from the fact
tially as a site where recombination occurs. that the four-armed structure, as seen by
electron microscopy, resembles the Greek
chi structure The structure generated letter chi.
when the figure eightshaped molecule,
which is an intermediate form in the pro- chitin The structural polysaccharide pre-
cess of recombination between two cir- sent in the exoskeleton of insects, in the cell
Chi structure
43
www.stemcell8.cn
rectokinases
chk
walls of fungi, and in crustacean cells com- partially digested fats and proteins in the
posed of units of N-acetylglucosamine. duodenum.
chk kinases A group of critical inter- cholera toxin A toxic protein produced
mediates (Chk1, Chk2, and Chk3) in an by the bacterium Vibrio cholerae that
important type of checkpoint control that causes the disease cholera. Cholera toxin
operates in the G2 phase of the cell cycle. acts by binding to a receptor (GM1 gangli-
Chk kinases block mitosis in cells that oside) present on intestinal mucosal cells.
have undergone DNA damage and other This activates adenylate cyclase, which
types of injury by phosphorylating cdc25, stimulates the formation of cAMP, which,
which then becomes inactive. Inactivation in turn, causes rapid loss of H 20, Na+, K+,
of cdc25 stops the dephosphorylation of Cl-, and HCO3 - into the small intestine.
cdc2, which is normally carried out by The lost H 2O and electrolytes are replaced
unphosphorylated cdc25. from the blood, which causes the diarrhea,
loss of electrolytes, and dehydration that
chloramphenicol An antibiotic pro- are characteristic of cholera. If untreated,
duced by Streptomyces venezuela that the disease ultimately progresses to shock,
inhibits protein synthesis in bacteria, kidney failure, and death. The toxin con-
mitochodria, and chloroplasts but not in tains five binding (B) subunits, an active
higher organisms. It is used to amplify (A1) subunit, and a bridging piece (A2)
recombinant DNA molecules when a that links A1 to the five B subunits. The
plasmid vector is used to make the recom- A1 subunit is an enzyme that transfers
binant. Chloramphenicol will specifically ADP ribose from NAD to a G protein that
inhibit the host cells replication because more or less irreversibly maintains adenyl
it is dependent on new protein synthesis cyclase in an active state.
but will not inhibit certain plasmid repli-
cation. Thus, in the presence of the anti- cholesterol A nonpolar lipid molecule
biotic, the recombinant molecule prefer- containing four conjugated rings that is a
entially replicates as many as 200 copies major component of cell membranes and
per cell. which is the precursor molecule for a vari-
ety of important biomolecules, including
chlorophyll A light-absorbing pig- steroid hormones, vitamin D, and bile
ment found in the chloroplasts of plants salts. Cholesterol is carried by lipopro-
and algae that is essential as an electron teins in the blood that are responsible for
donor in the process of photosynthesis. It carrying cholesterol to sites where it can
is the pigment that gives the green color be metabolized. Inappropriate deposition
to plants. of cholesterol in the arterial wall is a fac-
tor in the formation of plaques that leads
chloroplast The organelle in plant cells to atherosclerosis.
and algae that is responsible for photo-
synthesis. It contains the chlorophyll and cholinergic The term applied to all
the proteins used to carry out the reac- neurons that utilize acetylcholine as a
tions of photosynthesis. neurotransmitter.
44
www.stemcell8.cn
chromatin remodeling
verso
estradiol
vitamin D3
cholesterol
testosterone cortisol
Derivatives of cholesterol
45
www.stemcell8.cn
recto
chromatographic techniques
46
www.stemcell8.cn
chromosome walking
verso
47
www.stemcell8.cn
recto
chymotrypsin
probe, which can be used in turn to iso- ucts in a cross that does not involve a
late a third probe, until the specific gene recombination event or crossing over)
is found. This procedure is called chro- when crosses are made between genes car-
mosome walking because probes are iso- rying two mutations. If two mutations are
lated and then used to identify portions found on separate genes, they are said to
of the chromosome that are contiguous to be in the trans configuration; if they are
each other. on the same gene, they are in the cis con-
figuration. Complementation will only
chymotrypsin A digestive enzyme that occur between transmutations in different
hydrolyzes peptide bonds, thus cleaving genes, not in the same gene.
proteins to their component amino acids,
found in the small intestine. cistron A genetic unit or gene as defi ned
by the cis-trans test.
cilium (cilia, pl.) Short, hairlike
membrane-bounded appendage com- citric acid An organic acid containing
posed of microtubules used in the loco- three carboxyl groups and an impor-
motion of cells. tant intermediate in a cyclic pathway
called the Krebs cycle, tricarboxylic acid
circadian clock A biological timing (TCA) cycle, or citric acid cycle that is
mechanism that controls a type of natu-
responsible for the metabolism of glucose
ral synchrony (see cell synchroniza-
to water and carbon dioxide in the pres-
tion) by controlling cell division.
ence of oxygen.
cis A term used in genetics to defi ne an
c-jun N-terminal kinase (JNK1,
event or gene whose action occurs on the
JNK2) An enzyme that activates the
same chromosome.
transcription factor AP-1 (AP-1 is
identical to the oncogene product jun) by
cis acting Pertaining to a genetic ele-
addition of phosphate groups to certain
ment that exerts an effect on a target
amino acids at the N-terminal end.
located within the same unit. For exam-
ple, a promoter element is said to be cis
acting with respect to the genes it controls clathrate A semisolid structure in which
because both are on the same strand. water molecules assume a cagelike structure
around a guest molecule. In the most
cis-acting gene A regulatory gene that common clathrates, the guest molecule is
controls transcription of genes that lie methane (CH4). These types of clathrates
near it on the same chromosome by bind- (also known as hydrates) were discovered
ing protein factors needed to turn tran- by Sir Humphrey Davy in 1810. In the nat-
scription on or off. See cis-trans test. ural environment, methane clathrates are
formed by bacterial or thermal degradation
cis face The portion of the Golgi com- of organic materials in oceans. Clathrates
plex stack of vesicles that has just formed, are under consideration as a possible source
also called the forming face, which is of renewable energy.
oriented toward the rough endoplasmic
reticulum. See Golgi apparatus. clathrin A large protein that forms a
basketlike structure around vesicles that
cisterna A flattened membrane-bound transport molecules into or through cells
sac, such as found in the endoplasmic or at sites (coated pits) where endocytosis
reticulum. will occur.
48
www.stemcell8.cn
clustal
verso
49
www.stemcell8.cn
recto pit
coated
50
www.stemcell8.cn
Collins, Francis
verso
and medicine, which he shared with Rita encodes genes for a colicin and immunity
Levi-Montalcini in 1986. proteins that protect Col-harboring cells
from the bacteriocidal effects of the coli-
cohesions See condensins. cin it produces.
51
www.stemcell8.cn
recto
colloid
52
www.stemcell8.cn
complete medium
verso
53
www.stemcell8.cn
recto
complexity
54
www.stemcell8.cn
constant region
verso
molecule for the purpose of enhancing each position when different examples
or altering its function. The attachment are compared. Consensus sequences are
of fluorescent or chromogenic groups found in promoters and are responsible
to antibodies or nucleic acids to create for binding RNA polymerase and other
probes is an example of conjugation. proteins needed for transcription. Con-
sensus sequences also signal other events,
connective tissue Fibroblast cells that such as splicing of introns out of primary
secrete collagen. Collagen gives cells transcripts.
adhesive strength that is needed to main-
tain form. Some examples of connective conservative replication A mecha-
tissue are bone, cartilage, tendons, and nism of DNA replication in which each
ligaments. strand of a parental molecule remains
together after replication. See semicon-
connexon A structure of the gap junc- servative replication.
tion composed of six protein subunits
around a hollow center. Two aligned con- constant region The carboxy termi-
nexons of two cells provide a means of nal regions of the heavy chain or light
communication between the two cells. chain of the antibody molecule, which
has the same or nearly identical amino
consensus sequence An order of bases acid composition as each member of the
that has the most common nucleotide at same class.
Bacterial conjugation
55
www.stemcell8.cn
recto
constitutive gene
constitutive gene Genes that are ex- dilutes the incoming material and is useful
pressed continuously and are not subject in waste treatment or any other procedure
to either induction or repression. Such in which any components of the incoming
genes encode housekeeping functions and substrate would inhibit the enzymatic bio-
are expressed in all cells at a low level. conversion process.
56
www.stemcell8.cn
cosmid
verso
57
www.stemcell8.cn
recto
cos site
cos site The 5 12 base-pair (bp) over- across the cell membrane. See cotrans-
hang termini of bacteriophage lambda port.
DNA that are base-pair complementary
to each other: When a cell is infected with covalent bonds Strong chemical bonds
this bacteriophage, the DNA, injected in formed between atoms in which there is a
as a linear molecule, circularizes through sharing of two or more electrons.
hydrogen bonding between nucleotides
of the overhang termini. Lambda is covalently closed circular DNA A
replicated in long tandem repeats of its circular double-stranded molecule of
genome. The cos sites serve as packaging DNA, such as a plasmid, in which there
markers for an endonuclease that cuts in are no nicks or breaks in the sugar phos-
a staggered fashion, creating unit head- phate backbone. Usually, covalently
fuls of DNA with 5 12 bp overhangs that closed circular (ccc) DNA exists as super-
are packaged into phage coats. coiled; that is, the molecule folds in on
itself due to strain in the molecule. If a
cotransduction The introduction of two nick is introduced into the backbone, the
linked genes into a bacterial cell by the ge- molecule relaxes and is referred to as an
netic transmission process of transduction. open circle (oc). See supercoiled DNA.
58
www.stemcell8.cn
cruciform structures
regenerate the ATP needed for muscle cro protein A protein that interferes
contraction. with the synthesis and action of the C
repressor of a lambda bacteriophage and
CREB Cyclic-AMP response element is necessary in the lytic response of the
binding; CREB proteins are transcrip- phage after infection into a cell.
tion factors that are activated by stimuli
that increase cAMP levels. The binding of crossing over The physical exchange
CREBs to sequences called CRE elements of genetic information between a pair of
in the promoters of a number of genes reg- homologous DNA molecules.
ulates their transcription. cAMP produc-
tion is controlled by the binding of various crosslink A covalent bond between
ligands to certain cell surface receptors strands of DNA. See cross-linking.
linked to adenylyl cyclase. cAMP activates
a protein kinase which, in turn, activates cross-linking A reaction in which two
a protein kinase that migrates into the strands of DNA are covalently bonded
nucleus and activates a CREB protein. together. Certain mutagenic agents, such
CREB proteins have been shown to be as X-rays, cause cross-linking, and the
involved in the process of long-term poten- DNA must be repaired if it is to replicate
tiation in the neurons of lower organisms, and function properly.
including snails, fruit flies, and rats. In
humans abnormalities in the gene coding crossover fi xation An alternative
for the CREB protein CBP is associated model to saltatory replication to explain
with Rubenstein-Taybi syndrome. the occurrence of highly repeated
sequences. In crossover fi xation, addi-
Crick, Francis (19182004) A Brit- tional copies of a certain sequence are
ish scientist who with James Watson won created on one DNA strand by unequal
the Nobel Prize in physiology and med- crossing over.
icine in 1962 for postulating a double-
stranded helical structure for DNA, using cross-reactive antibodies Nonspe-
the X-ray diffraction data of Maurice cific antibodies that will bind to antigens
Wilkins, also a Nobel Prize winner in and give a false positive response in an
1962. The double helix accounted for the antigen-antibody test.
known physical and chemical properties
of DNA, but also suggested a mechanism
crown gall plasmids The Ti (tumor-
for its replication.
inducing) plasmid of Agrobacterium
tumefaciens that is responsible for the
crista The infolding of the inner mem-
malignant transformation of dicotyledon-
brane of the mitochondrion, which in-
ous plants infected with this organism.
creases the surface area of the membrane
Part of the plasmid DNA incorporates
responsible for electron transport and
production of ATP via oxidative phos- into the plant chromosome to cause the
phorylation. production of a tumor. These plasmids
lacking the tumor-producing genes have
critical concentration The minimal been constructed as potential vectors for
concentration of subunits required for recombinant DNA molecules for plant
formation of a polymer. genetic engineering.
critical dissolved oxygen concentra- crown gall tumor See crown gall
tion (Ccrit) The concentration of dis- plasmids.
solved oxygen in a submerged culture
when oxygen is the limiting substrate. The cruciform structures DNA structure
air supply to a fermentor is adjusted to in which strands separate and self-anneal
maintain an oxygen level above its Ccrit. through complementary base pairing
59
www.stemcell8.cn
cryogenics
60
www.stemcell8.cn
cycloserine
61
www.stemcell8.cn
cysteine
Regulation of cell-cycle kinetics by cyclins. The transition from the G2 phase to mitosis (M) is
regulated by a complex between cyclin B and a cyclin-dependent kinase (cdk). p34cdc2 contains
three phosphorylation sites at Thr 14, Tyr 15, and Thr 161; in the active form, Thr 161 is phos-
phorylated, and Thr 14 and Tyr 15 are not (left inset). p34cdc2 is phosphorylated at Thr 161 dur-
ing G1 and becomes additionally phosphorylated at Thr 14 and Tyr 15 on binding to cyclin B that
begins to accumulate at the end of S phase. Dephosphorylation of the Thr 14 and Tyr 15 sites
mediated by the phosphatase p80cdc25 occurs at the G2/M boundary, resulting in the active
complex. Cyclin B is then rapidly degraded by ubiquitin just after the start of mitosis. A-type
cyclins begin to accumulate during S phase and appear to function at the G2/M boundary. Net
synthesis of E-type cyclins occurs in G1; E-type cyclins activate a second cdk, p33 cdk2, which
acts at the G1/S boundary. p33cdk2 acts to induce phosphorylation of histones and certain cel-
lular proteins involved in mitosis.
62
www.stemcell8.cn
cytoplasmic inheritance
63
www.stemcell8.cn
cytoplasmic streaming
64
www.stemcell8.cn
A
D
dalton A unit of mass used generally colon cancer. The name DCC derives
for macromolecules that is equal to 1.000 from the observation that segments of
on the atomic mass scale, or almost the chromosome 18 now known to contain
same as the mass of a hydrogen atom. DCC are frequently deleted in colon car-
The term dalton can be used interchange- cinoma tumors. DCC is expressed on
ably with the term molecular weight. neural membranes, where it appears to
Thus a 100,000 dalton (or 100 kilodal- serve as a receptor for the protein netrin.
ton protein) can be described as having a Its tumor-suppressive activity appears to
molecular weight of 100,000. stem from its ability to induce apopto-
sis in tumor cells. The apoptotic activity
dansyl chloride A compound that of DCC is upregulated by caspase 3 and
reacts with the amino group of an amino downregulated by netrin. DCC gene map
acid to produce a fluorescent derivative locus is 18q21.3.
that can be easily detected and identified.
It is used in procedures to identify the DDBJ See databases.
amino terminal residue of peptides.
ddNTPs Dideoxyribonucleotidetriphos-
dark reactions A series of enzymati- phates. See Sanger sequencing.
cally catalyzed reactions in which organ-
isms that carry out photosynthesis syn- deaminase An enzyme that removes
thesize organic compounds in the form amino groups from molecules.
of sugars from inorganic carbon dioxide.
These reactions use energy, in the form deamination The process by which a
of ATP, and reducing power, in the form deaminase removes amino groups from
of NADPH made during the light-phase molecules. Deamination of bases in DNA
reactions of photosynthesis. results in mutations, and cytosine is the
most susceptible base.
databases Information stored in com-
puters to be used in the sequence analysis death phase The fi nal phase in the
of genes and proteins. The National Insti- growth curve of a population of cells in
tutes of Health maintains such databases which the cells die exponentially; that is,
(GenBank). EMBL is a European database for each time increment, a certain per-
established in 1980 to collect and store centage of cells die.
nucleotide sequence data. Its counterpart,
SwissProt, translates the sequence data into decline phase See death phase.
protein data. EMBL, GenBank, and the
DNA database of Japan, DDBJ, collabo- degrees of freedom The number of
rate to collect and exchange data on a daily independent variables in an experiment.
basis, as sequence data are being deposited
at a rate of one sequence per minute. defective virus A virus that is missing
some essential genetic information so that
DCC Deleted in colon carcinoma; a it cannot reproduce itself. Such viruses
tumor-suppressor gene associated with can be propagated in a host cell only if a
65
www.stemcell8.cn
recto
defensins
helper virus that supplies the missing pro- delayed hypersensitivity An allergic
teins coinfects the same host cell. reaction that takes 24 to 48 hours to
appear. An example is the skin test for
defensins Part of the innate host defense exposure to tuberculosis. After injection
system against invading microbes. These with the allergen, a positive response
small peptides, produced by many differ- (a swelling at the injection site) does not
ent organisms, have a broad spectrum of appear before 48 hours.
activity against bacteria, fungi, and some
enveloped viruses. Defensins have been deletion mutation A change on the
found in great abundance in the phago- DNA due to the elimination of one or
cytic white cells of mammals and birds, more nucleotides. A deletion can alter the
but they have also been found in cells of genetic information in a very profound
the intestine and in skin cells. Their main way. The deletion of one base pair results
mechanism of activity is to insert into the in a frameshift, where every codon is
membranes of microbes and destroy them. changed following the deletion; a dele-
tion of many bases results in a message
defi ned medium A medium used to with fewer codons. See frameshift.
grow organisms in which all the compo-
nents are known. For heterotrophs, that delivery system An artificial system to
would be a medium with a known carbon deliver a drug to a specific target, such
source, nitrogen source, metals, and any as inclusion of a drug in a liposome or
amino acids, vitamins, or other growth conjugating a drug to an antibody. See
factors required by the organism. fusogenic vesicle.
degenerate code Referring to the fact demyelination The loss of the myelin
that in the genetic code many amino sheath, layers of membrane surrounding
acids are specified by more than one segments of nerves that provide rapid
codon or sequence of three bases (triplet). transmission of nerve impulses down
The degeneracy of the code accounts for such nerves. Demyelination occurs in
20 different amino acids encoded by 64 some degenerative nerve diseases, such
possible triplet sequences of four different as multiple sclerosis and polio, resulting
bases (see nucleic acid). For example in loss of function of those demyelinated
the amino acid leucine has six different nerves.
codons, UUA, UUG, CUU, CUC, CUA,
CUG. See wobble. denaturation Change in the three-
dimensional shape or structure of a pro-
degradation The process by which tein or nucleic acid by a physical or chem-
substances are broken down. A degrada- ical agent, such as heat or strong acid (the
tive pathway is one in which molecules denaturant), such that normal function-
are enzymatically cleaved into smaller ing is altered.
molecules.
denaturation of DNA The splitting
dehydration-condensation reaction apart of the double-stranded structure into
The joining of two molecules together single strands by heating the molecule or
with the elimination of a molecule of treating it with acid, alkali, salts, or urea.
water. See hydrolysis.
denaturation of proteins See dena-
dehydrogenation The process by which turation.
hydrogen ions or protons are removed
from an organic molecule. Such a process dendrite A branch of a nerve cell
is also called oxidation. It is carried out the receives signals and transmits them
by enzymes called dehydrogenases. inward toward the nerve cell body.
66
www.stemcell8.cn
density gradient
verso
Denaturation of DNA
67
www.stemcell8.cn
recto gradient centrifugation
density
68
www.stemcell8.cn
dictysome
verso
69
www.stemcell8.cn
recto
dideoxynucleotide
secretion of proteins outside the cell or differentiation The process during the
to target newly synthesized proteins to development of an embryo in which cells
organelles such as the Iysosome. This become specialized in structure and func-
organelle is called the Golgi (see Golgi tion and go on to form different tissues of
apparatus) in animal cells. the adult.
70
www.stemcell8.cn
disaccharide
verso
71
www.stemcell8.cn
rectoelectrophoresis
disc
72
www.stemcell8.cn
DNA probe
verso
73
www.stemcell8.cn
recto profi ling
DNA
DNA polymerase
complementary sequences. Such probes function indicates that the plasmid con-
are used in hybridization procedures tains the gene of interest.
(Southern, northern, slot, and dot blots
and colony or plaque hybridizations) and DNA-RNA hybrid A DNA-RNA du-
are labeled with either a radioactive atom plex molecule composed of a single chain
of 32P or 35S, which allows for detection of deoxyribonucleotides (DNA) and a
using autoradiography, or nonradioactive chain of complementary ribonucleotides
materials such as biotin or digoxigenin, (RNA). Such molecules may be created
which are detected via specific reactions. experimentally from purified DNA and
See probe. RNA and are also formed when chromo-
somal DNA is fragmented, heated, and
DNA profi ling See DNA fi nger- mixed with RNA transcripts.
printing.
DNase I A DNA-degrading enzyme
that catalyzes the cleavage of phosphodi-
DNA repair Any process that restores ester bonds of DNA; DNase I is isolated
damaged DNA. Generally, these are mul- in large quantities from pancreas. See
tistep processes, requiring an enzyme endonuclease.
to remove the damaged nucleotide (see
DNA glycosylase and/or endonucle-
DNase I hypersensitivity sites Regions
ase) alone or with other nucleotides, a on the chromosome that are extremely
polymerase (see DNA polymerase I) to sensitive to digestion by DNase I. These
replace the removed nucleotides, and an sites are generally found near active genes
enzyme to seal the sugar phosphate back- where transcription factors or other reg-
bone. See excision repair. ulatory elements bind to the DNA. See
hypersensitive site.
DNA rescue, in positional cloning A
technique for cloning genes in bacteria DNase I sensitivity Increased suscep-
or yeast by transforming (see transfor- tibility to digestion by DNase I, which
mation, bacterial) plasmids contain- correlates with genes that are actively
ing normal genes into a host containing transcribing RNA. This shows that the
a mutation that inactivates a particular chromatin of genes being expressed has
function, for example, the ability to syn- an open conformation that is accessible
thesize an amino acid. Addition of the to DNase I and that inactive chromatin is
plasmid that leads to reactivation of the condensed.
74
www.stemcell8.cn
double verso
helix
75
www.stemcell8.cn
recto minutes
double
in one strand wrapped about the other to recombinant DNA technology has cloned a
form a helix conformation. See dna. gene and expressed its protein product.
double minutes Small pieces of a chro- Drosophila A genus of small fl ies that
mosome that contain many copies of a includes Drosophila melanogaster, the
particular gene. The amplification of the common fruit fly. A well-defi ned genetic
dihydrofolate reductase (DHFR) gene fol- organism, it is used as a model system
lowing exposure to methotrexate may be to study and understand cell processes,
manifest either in terms of the formation development, and genetics of higher
of double minutes or as a homogeneously organisms.
staining region of a giant chromosome.
See homogeneously staining region. Drosophila heat-shock proteins Sev-
eral proteins that are immediately synthe-
double reciprocal plot A method for sized after the organism is subjected to a
analyzing the kinetic parameters of an short treatment of heat above its lethal
enzyme (Km and Vmax), by plotting 1/v limit. Some of these proteins are highly
versus 1/[S], where v = rate of product for- conserved in evolution in that they are
mation and [S] = substrate concentration.
very similar to hsps found in bacteria and
other higher organisms. Synthesis of these
double thymidine block A technique proteins can also be induced by exposure
used to synchronize cells in culture. A
to certain toxic chemicals, alcohol, and
high concentration of thymidine added to
other types of stress. See heat-shock
the culture will block DNA replication,
proteins.
so all treated cells proceed through their
cell cycle and stop at the same point. See
cell synchronization. drug-delivery systems See delivery
systems.
doubling time The same as a genera-
tion time, or the time it takes for a popu- duplex Another name for double-
lation of cells to double in number. stranded helical DNA. See double helix.
76
www.stemcell8.cn
A
E
77
www.stemcell8.cn
recto
effector
78
www.stemcell8.cn
electron microscopy
verso
O-
C
O
CH3
arachidonic acid
O O-
O- C
O C O
O CH3
CH3
OH OH
O-
leukotriene A4
C prostaglandin E
O O (PGE 1 )
CH3
OH
thromboxane A 2
Eicosanoids
79
www.stemcell8.cn
recto
electron transport
ally fi rst coated with a thin layer of metal ELISA Enzyme linked immunosorbant
that conveys the outlines of the structural assay; a sensitive technique for detec-
features of interest. tion of a substance by allowing the sub-
stance of interest, if present in a sample,
electron transport The process of to attach to an immobilized antibody on
passing electrons among electron carriers some solid substrate such as plastic. The
according to a defi ned sequence. presence of the substance is visualized
and quantitated using a second, labeled
electron transport chain A series of antibody.
large complexes located in the inner mito-
chondrial membrane that uses the energy elongation factor Any of several pro-
contained in electrons derived from the tein factors that are necessary to carry
metabolism of fats and carbohydrates out the part of the process of translation
to generate ATP. The transport chain in which amino acids are added to the
consists of five complexes designated by growing polypeptide chain (elongation).
the roman numerals I, II, III, IV, and V. See translation.
Complexes I and II accept electrons from
metabolites, and these complexes transfer
the electrons to complex III. Complex III elongation factors A group comprised
transfers electrons to complex IV, which of at least three proteins (EF-G, EF-Ts,
then reduces molecular oxygen to form EF-Tu) that are required for the elongation
water. During the process, protons are of a polypeptide that is in the process of
pumped out of the mitochondrion to cre- being synthesized on ribosomes (transla-
ate a proton gradient. The energy stored tion).
in the proton gradient is used by complex
V to create ATP. eluant In column chromatography, the
fluid, such as a buffer solution, that runs
electrophoresis The movement of sub- through a column and in which separated
stances through a medium induced by an substances appear as they are washed
electric field. through the column.
fraction number
Elution profile
80
www.stemcell8.cn
emulsifi
verso er
ELISA
81
www.stemcell8.cn
recto
emulsion
82
www.stemcell8.cn
enterotoxins
verso
can survive harsh environmental condi- engrailed gene One of a class of genes
tions such as prolonged heat, drying, and known as segment polarity genes in Dro-
exposure to toxic chemicals. sophila melanogaster (fruit fly). The
engrailed gene is a major gene responsi-
endosymbiont A symbiotic organism ble for dividing the segments of the Dro-
that lives inside the body of its symbiotic sophila embryo into posterior and anterior
partner. halves.
End-product inhibition
83
www.stemcell8.cn
recto
entomology
taminated with animal fecal matter are enzyme immobilization The chemi-
due to the potent toxin produced by the cal bonding of an enzyme to some solid
enterotoxigenic Escherichia coli (ETEC), matrix in a manner that preserves the
strain E. coli O157:H7. enzymatic activity. The attachment of
enzymes to solid matrices is an essential
entomology The field of study that step in the development of many enzyme-
deals with insects. based biochemical assays.
entropy The variable that measures the enzyme inactivation The loss of the
degree of disorder in a molecule. Changes activity of an enzyme under conditions
in entropy that occur in molecules under- other than that found in the intact cell.
going chemical reaction are one com- Enzyme inactivation is an important
ponent of the free energy change that consideration when purified enzymes are
determines whether a reaction will occur employed in an environment where they
under a given set of conditions. may be subject to conditions of tempera-
ture, salt, pH, and so on that are not
env gene(s) One of the three genes con- found in their native environment. Spon-
tained in most retroviruses that codes for taneous inactivation of enzymes that
the ENV glycoprotein(s). occurs for unknown reasons is also often
observed in enzyme preparations, partic-
ENV glycoproteins The protein prod- ularly in dilute solutions.
uct of the retrovirus env gene(s) which
forms a major component of the virus enzyme replacement therapy The
envelope in the mature virus particle. method used to treat disease states
caused by enzyme deficiencies by direct
enzyme A polypeptide or protein that injection of the missing enzyme. Enzyme
acts as a catalyst for biochemical reac- replacement therapy has been used suc-
tions. Enzymes do not actually cause a cessfully for treating patients with Gau-
reaction to occur, but rather speed up the chers disease.
rate at which an ongoing reaction takes
place. Virtually all significant biochemi- enzyme stabilization Inhibition of
cal reactions in living systems are cata- enzyme inactivation. Enzyme stabiliza-
lyzed by enzymes. tion is often achieved by altering the salt
concentration pH or lowering the tem-
enzyme derepression The induction perature of an enzyme solution. Recently,
of enzyme activity by removing or inac- modification of the enzyme by attach-
tivating an inhibitor such as the induction ment of organic groups or altering the
of a galactosidase activity by lactose. See amino acid compostion of the enzyme
lac operon. polypeptide have been used to achieve
enzyme stabilization.
enzyme engineering Modification of
enzymes through recombinant DNA eosinophil One of the three subclasses
techniques and site-directed muta- of leucocytes. Eosinophils are named for
genesis so that they can be used for their characteristically intense staining
industrial purposes. Some of these with eosin. Eosinophils are amoeboid
modifications include increasing protein scavenger cells similar to macrophages
stability, enhancing catalytic activity and are found in greatly increased num-
and/or substrate specificity, changing bers in the blood of individuals carrying
optimal requirements for catalysis so parasitic infections.
that the engineered enzymes will func-
tion under nonphysiological conditions, ephrins A family of proteins implicated
and/or become resistant to feedback in guiding axons and patterning the ner-
regulation. vous system during neural development.
84
www.stemcell8.cn
Epstein-Barr verso
virus
Ephrins act as ligands for receptors (des- episome Bacterial DNA that is not inte-
ignated EPH-related receptors) that are grated into the bulk of the chromosomal
protein-tyrosine kinases. There are two DNA and therefore replicates separately,
classes of ephrins: the A-subclass (ephrin and in different copy number from, chro-
A1ephrinA5) and the B-subclass (eph- mosomal DNA.
rinB1ephrinB3).
epistasis A term coined by William
epidemiology The field of study devoted Bateson in 1909 to describe the control of
to analysis of the occurrence of disease in a certain phenotypic trait by two or more
a population including the distribution, genes. A gene is considered epistatic when
incidence, and factors that control the it suppresses the effect of another gene.
spread of a disease. Epistatic genes are also called inhibiting
genes because of their suppressive, hypo-
epidermal growth factor (EGF) A static effects on other genes. Pleiotropy,
small polypeptide growth factor discov- in which a single gene controls the expres-
ered by Stanley Cohen as a factor that sion of more than one phenotypic trait, is
caused premature eyelid opening in new- the opposite of epistasis.
born mice. EGF has since been shown to
be active in stimulating the growth of epi-
epistatic gene A gene that suppresses
thelial as well as some nonepithelial cell
the effect of another, nonallelic, gene. See
types. A portion of the gene that codes for
allele.
the EGF cell receptor has been found to be
virtually identical to the Erb-B oncogene.
epithelial Of or pertaining to the cell
epigenetic The term applied to any fac- layers that interface between the tissue
tor that influences cell behavior by means and the external enviornment, such as the
other than via a direct effect on the cells of the skin and the lining of the gut
genetic machinery, that is, the DNA. and lung airway passages.
85
www.stemcell8.cn
recto
equatorial plate
equatorial plate The early stage of the ERCC1 is the homologue of the RAD10
formation of the membrane that divides gene in Saccharomyces cerevisiae, which
two daughter cells at the end of the pro- functions in repair and recombination
cess of mitosis; the metaphase plate. between chromosomes. ERCC1 levels are
elevated in cancer cells that have become
equilibrium centrifugation A tech- resistant to the chemotherapeutic agent,
nique for separation of proteins or nucleic cisplatin. In human syndromes in which
acids from a mixture by subjecting the NER is defective, such as xeroderma
mixture to density gradient centrifuga- pigmentosum (XP), there is a greatly
tion for a period of time sufficient for increased incidence of skin cancer.
each component of the mixture to form a
band at a point equal to its density. ERK Extracellular receptor tyrosine
kinase; a group of transmembrane pro-
equilibrium potential The membrane teins that function as signal transducers
potential at which there is no net diffu- for signals in the form of biochemicals
sion of a particular type of ion across the (ligands) that bind to the ERK extracel-
membrane. Equilibrium potentials are lular domains. Ligand binding activates a
important determinants of nerve-impulse tyrosine kinase function of the intracellu-
generation. lar domain. Phosphorylation of a tyrosine
residue(s) on an intracellular protein(s)
erb-A An oncogene carried by the avi- initiates a series of subsequent biochemi-
an erythroblastosis virus. There are two cal changes.
distinct human erb-A proto-oncogenes,
erb-A and erb-A. Both forms encode erlotinib (Tarceva) An anticancer
proteins that are thyroid hormone recep- drug that acts by blocking the human
tors, but they are located on different epidermal growth factor receptor (EGFR)
chromosomes: erb-A on chromosome that inhibits the tyrosine kinase activity
17q21 and erb-A on chromosome 3p24. of the receptor. Tarceva is a quinazo-
linamine, with the chemical name N-
erb-B An oncogene carried by the avian (3-ethynylphenyl)-6,7-bis(2-methoxye-
erythroblastosis virus. The human proto- thoxy)-4-quinazolinamine.
oncogene of erb-B (c-erb-B) encodes the
protein for the EGF receptor of which error-prone repair Another term for
as many as five variant forms may exist. SOS repair. The terminology is derived
These are designated erbB-1, erbB-2, etc. from the observation that repair of pyrim-
The erb-B proteins are receptor tyro- idine dimer damage is often inaccurate.
sine kinases that stimulate cell division See excision repair and SOS repair
via the MAP kinase signaling pathway. system.
erbB-2 which is also known as HER-2
or neu, has been implicated in a number
erythroblast A bone-marrow stem cell
of highly malignant breast cancers. The
that gives rise to erythrocytes.
erb-B genes are located within the region
of chromosome 7p12.3-p12.1. See EGFR
and heregulin. erythrocyte A red blood cell.
ERCC1 Excision repair cross comple- erythrocyte ghosts Red blood cells
menting; a polypeptide that is required whose contents have been removed.
for nucleotide excision repair (NER) in Erythrocyte ghosts are used as vehicles
DNA that has been damaged. In the nu- to deliver drugs and other bioactive com-
cleotide excision repair mechanism, single- pounds to cells. See delivery system.
stranded cuts are made on either side of
the damage, after which the segment of erythromycin An antibiotic that acts
DNA between the two cuts is excised. by binding to bacterial ribosomes and
86
www.stemcell8.cn
Euglena
verso
essential amino acid Any amino acid ethidium bromide A widely used
that cannot be synthesized by an organ- fluorescent stain for visualizing DNA
ism from other components. In humans under ultraviolet light. Ethidium bro-
about half of the 20 amino acids are mide is called an intercalating dye
essential; in most bacteria none are. because it has a multi-ring structure that
allows it to insert between the nucleotide
essential gene Any gene whose mal- bases. (See figure on next page.)
function is lethal to an organism. A num-
ber of classical experiments on bacterial ethylene A simple two-carbon hydro-
molecular genetics, such as fluctuation carbon with the formula H 2C=CH 2 .
analysis, depended on the use of muta-
tions in essential genes. etiology The study of the cause of a
disease or pathological condition.
established cell line Cells that have
become immortalized during the process
ets oncogene An oncogene that is car-
of maintaining them in cell culture.
ried by Avian leukemia virus E26 (v-ets)
that causes leukemias in chickens. The
establishment of cell lines The pro-
product of the ets proto-oncogene (c-ets)
cess by which cells in tissue culture
is a nuclear protein that has been found
become immortalized so that they can
to have DNA binding activity and is
be maintained indefinitely. Establishment
believed to play a role in the activation
is believed to involve some genetic change
and proliferation of T cells.
that occurs spontaneously during the
course of culture. Because cells derived
from cancerous tissue are more readily
euchromatin One of the two classes of
chromatin seen in interphase cells that is
established than cells from normal tissue,
distinguished from the other class (het-
the genetic changes involved in the process
erochromatin) by being much less con-
of established cell lines are also believed
densed and transcriptionally active.
to be related to the process by which cells
become cancerous.
eugenics The science of selective breed-
esterase A type of enzyme that catalyzes ing to achieve a predetermined set of
the breakage of ester linkages. Esterases are genetic characteristics.
important in the breakdown of many lipids
and in the metabolism of nucleic acids. Euglena A primitive single-celled organ-
ism classified as belonging to the algae in
estrogen A steroid hormone, pro- the plant kingdom. Euglena exhibits the
duced by the ovaries, that cause changes properties attributed to both plants and
in the lining of the uterus in preparation animals, being photosynthetic in the pres-
for implantation of the embryo during ence of light and a motile, food-seeking
estrus. organism in the absence of light. Euglena
87
www.stemcell8.cn
recto
eukaryote
Ethidium bromide
88
www.stemcell8.cn
excision repair
Excision repair
89
www.stemcell8.cn
exergonic
90
www.stemcell8.cn
ezrin
of the trypanosome. See variable sur- extracellular fluid The liquid outside
face glycoprotein. the cells in a tissue.
expression site The term for the extracellular matrix A complex mix-
genetic location of an expression- ture of proteins (such as fibronectin,
linked copy of a variable surface glyco- laminin, collagen) that is deposited on
protein. Expression sites are all located the outside of a cell and plays a crucial
near the telomere of a chromosome. role in the attachments of cells to the sur-
faces on which they grow. The extracel-
expression system An expression vec- lular matrix is believed to play an impor-
tor that contains the cloned DNA it is tant role in regulating the growth and
designed to express, together with the differentiation of a cell partly because the
host with which the vector is to be used. composition of the extracellular matrix
is often dramatically altered in cancerous
expression vector A specialized cloning tissue.
vector that contains the elements needed
to transcribe a cloned DNA. Expression extrinsic protein A protein present in
vectors contain sequences required for a cell or tissue but which originated else-
DNA replication and promoter elements where.
adjacent to the cloned DNA to initiate
transcription. extrusion The energy-requiring pro-
cess by which cells export large particles
extinction coefficient The constant of or organelles.
proportionality relating the molar concen-
tration of a substance and the absorbance ezrin A cytoskeletal element that links
of its solution. See Beer-Lambert law. the transmembrane adhesion molecule,
ICAM-1 (intercellular adhesion molecule
extracellular Outside the cell. 1) to the actin cytoskeleton.
91
www.stemcell8.cn
A
F
F(ab)2 fragment A portion of the IgG ments. The genetic form of the disease
antibody molecule containing the two is an X-linked autosomal recessive. The
antigen binding domains but not the Fc gene for the disease (called FGD1), of as
portion. Such fragments are generally yet unknown function, has been mapped
produced by treating antibodies with cer- to chromosome band Xp11.21. The dis-
tain proteases that specifically cleave the ease was described by the Norwegian
molecule near the end of the Fc segment. pediatrician D. J. Aarskog in 1970 and
American C. I. Scott Jr. in 1971.
F-1 generation First filial generation; the
first generation offspring of a genetic cross. f-actin (fi lamentous actin) The func-
The term is generally applied to the immedi- tional actin fi lament composed of G-actin
ate offspring of higher plants and mammals. subunits.
F-2 generation Second fi lial genera- factor, blood clotting Any of a group
of protein factors in the blood serum that
tion; the offspring of a mating between
act according to a defi ned pathway to
members of the F-1 generation.
produce a blood clot. In blood clotting,
the breakdown of platelets at the wound
Fabrys disease One of the lysosomal site is the fi rst step. Factors VII, VIII,
storage genetic diseases characterized by IX, and XI become activated by tissue
the lack of alpha-galactosidase. When factor and, in the presence of calcium,
this enzyme is missing in the lysosome, convert factor X to activated thrombo-
long-chain carbohydrates that need to be plastin. Thromboplastin then converts
degraded are not. These charbohydrates prothrombin into thrombin, the clotting
then accumulate in the bloodstream and enzyme. Thrombin catalyzes the conver-
deposit in the capillaries and other organs, sion of soluble fibrinogen in the serum
eventually leading to stroke, heat attack, into the insoluble protein fibrin. Fibers
and fatality in the young adult. This is made of fibrin are the basic structure of
a disease that is a promising candidate the fi nal clot and are made fi rm by fac-
for enzyme replacement therapy because tor XIII, the fibrin-stabilizing factor. The
cloned alpha-galactosidase can be admin- genetic disease, hemophilia, is the result
istered to individuals and directed to the of a defect in the gene that codes for one
lysosome, where it needs to function. of these factors (factor VIII).
92
www.stemcell8.cn
feline sarcoma verso
virus
FADD Fas associated via death domain; Fc The portion of the immunoglobulin
a component of the classical apoptosis heavy-chain molecule that does not con-
pathway mediated by Fas. tain the antigen-binding region; the anti-
body molecule constant region.
familial hypercholesterolemia A genetic
disease characterized by abnormally high fecundity The measure of fertility; for
serum cholesterol levels resulting in early example, sperm count or the production
onset atherosclerosis and heart attack. The of viable eggs.
genetic defect results in low tissue levels of
the receptor for low-density lipoproteins feedback control The general term for
(LDLs). Cells lacking these receptors cannot regulation of an enzymes activity by one
take up LDLs from the blood to digest them. of its own metabolites.
93
www.stemcell8.cn
recto
fermentation
fermentor A device for growing large FGP Fluorescent green protein; A nat-
bacterial cultures. A fermentor consists urally occurring fluorescent protein iso-
of a large vessel (usually containing more lated from certain coelenterates such as
than 10 liters of culture) that is mechani- the Pacific jellyfish. Because the gene for
cally shaken or rapidly rotated for aera- FGP has been cloned and found to be
tion of the culture. There is also a heater active when fused to other genes, it has
in contact with the culture vessel that found wide application as a molecular tag
maintains the culture at the proper tem- for determining the cellular location of
perature, usually 37 C. various proteins to which it can be fused
by various molecular genetic techniques.
ferritin A protein that forms a complex
with iron. Ferritin, which normally func- fgr The oncogene carried by the Garden-
tions as an iron storage protein, is used as Rasheed strain of the feline sarcoma
a noradioactive label for visualizing anti- virus.
bodies bound to a specific antigen, such
as in a western blot. fibrin The protein formed from fibrino-
gen that polymerizes to form the fibers
fertilization The fusion of two gam- that comprise a blot clot at the site of a
etes and of their respective nuclei to cre- wound. See factor, blood clotting.
ate a diploid or polyploid zygote.
fibrinogen The protein that is released
fes Feline sarcoma; the oncogene car- by platelets at the site of a wound and
ried by Snyder-Theilen strain of feline that gives rise to fibrin when thrombin is
sarcoma virus (FSV). fes is believed present. See factor, blood clotting.
to be a protein kinase that catalyzes the
phosphorylation of tyrosine residues. fibroblast A cell type that comprises
the bulk of the living cells in connective
fetal calf serum (FCS) The serum tissue and in the supporting matrix (the
from the blood of embryonic calves; an stroma) of skin and other epithelial tis-
essential component of most tissue cul- sues. Fibroblasts are embedded in a com-
ture media. The factors in FCS that pro- plex extracellular matrix, much of which
mote the growth of cells in tissue culture they secrete and that is responsible for the
are largely unknown but are believed to strength and flexibility of the stroma.
include growth factors and hormones.
fibroblast growth factor receptor 3
Feulgen reagent A DNA-specific stain (FGFR3) The cell surface receptor for
(fuchsin sulfite) that, because it was found fibroblast growth factors (FGFs); a family
to stain chromatin in the nucleus strongly, of polypeptide growth factors involved
was cited as evidence that DNA was the in cell division, angiogenesis, and wound
hereditary material in experiments car- healing. The FGF receptor is comprised
ried out by Robert Feulgen in 1914. of an immunoglobulin-like extracellular
domain, a transmembrane domain, and
F factor A bacterial plasmid con- an intracellular tyrosine kinase domain.
taining fertility genes that establish the Mutations in the FGF receptor cause
donor characteristics for conjugation achondroplasia, a disease of bone devel-
(see high-frequency recombination opment characterized by stunted bone
strain). These genes are responsible for growth. The FGFR3 gene is located on
the ability of the donor cell to establish the HD region on chromosome 4 (gene
contact with and transfer its chromosome map locus 4p16.3).
94
www.stemcell8.cn
flagellin
verso
95
www.stemcell8.cn
recto
fl ash evaporator
flash evaporator A device for removing emitted by individual cells. Flow cytom-
solvent from large volumes of a solution etry is carried out in an instrument in
by evaporation to concentrate the solute. which individual cells are illuminated
A flash evaporator consists of a heated, by a laser beam as they pass by a win-
rotating glass sphere with a tube to allow dow where a sensitive photocell records
the evaporating solvent to exhaust. the quantity of light emitted at a given
wavelength. Because antibodies can be
flavin A compound that is derived from labeled with fluorescent compounds,
riboflavin (vitamin B 2). Important flavin this technique has been widely used as
biomolecules are FAD and FMN. See an automated procedure for quantitating
coenzyme. amounts of various antigens present in a
population of cells.
96
www.stemcell8.cn
folate antagonist
verso
97
www.stemcell8.cn
recto
foldback DNA
follicle cells A layer of cells found in forming face The side of the Golgi
both vertebrates and invertebrates that stack where vesicles that have budded off
surround the oocyte and supply it with from the rough endoplasmic reticulum
certain low molecular weight nutrients. fuse to the Golgi apparatus; the cis face
of the Golgi apparatus.
footprint The region on a DNA molecule
to which some particular regulatory pro- forms I, II, and III, DNA The super-
tein binds. The footprint can be visualized coiled, nicked circular, and linear forms,
by partially digesting the protein-bound respectively, of circular episomal DNAs
DNA with DNase 1 and then separating such as viral or plasmid DNAs. Forms
the digested DNA fragments by electropho- II and III are not thought to be natu-
resis. The region bound by the protein will rally occurring forms but are believed to
not be cut by the DNase and will appear as be derived from native supercoiled DNA
a blank area on the gel. (form I) by nicking of one (form II) or
both strands (form III) during the process
forensic science The science developed of extraction.
by Edmund Locard in the early part of
the 20th century to establish whether formycin B A purine derivative that is
there has been a transfer of trace evidence used as an antiparasitic agent. Formycin
between the criminal and crime scene or B inhibits the ability of cells to use sal-
between the crime scene and the crimi- vaged nucleotides from the extracellular
nal. Forensic scientists focus on trace evi- medium for nucleic acid synthesis.
dence such as blood, semen, saliva, and
hairs found at the crime scene. Before the forward mutations Any mutation that
advent of DNA technology, trace evidence causes a change from a normal function-
was analyzed by a series of blood group- ing gene to an improperly functioning, or
ing tests. Now, forensic scientists rely on inactive, gene.
dna fi ngerprinting.
fos The viral oncogene (v-fos) carried
forkhead transcription factors A by Finkel-Biskis-Jinkins (FBJ) murine
family of transcription factors defi ned osteosarcoma retrovirus. The fos homo-
by a common DNA binding domain of logue in human cells codes for a family of
about 100 amino acids called the fork- proteins consisting of four members: Fos,
head domain, fi rst described in a mutant FosB, FosL1, and FosL2. These genes for
of Drosophila melanogaster. Forkhead leucine zipper transcription factors form
transcription factors have been found dimers with the jun family of proteins
in a wide variety of species from yeast to form the transcription factor complex
to humans, including FD1-5 (D. mela- AP1. As transcription factors, the fos
nogaster), HNF-3 (mammalian), HTLF proteins are implicated in cell prolifera-
98
www.stemcell8.cn
freeze-drying
99
www.stemcell8.cn
freeze-etch
essential cell structural features behind. Fura 2 A dye that fluoresces in the
See lyophilization. presence of calcium. Fura-2 fluorescence
can be used to observe and quantitate the
freeze-etch A technique for examin- influx or efflux of calcium in the cytosol.
ing cell structure by electron microscopy
in which a frozen cell sample is cracked furanose A ring form of a sugar in
with a knife to reveal the cell contents. which the ring is made up of four carbon
After freeze-drying, the sample is then atoms and one oxygen. The term desig-
shadowed and examined under the elec- nates a large group of sugars that form
tron microscope. this type of ring when dissolved in water.
freeze fracture A technique for examin- fushi tarazu gene A gene in the pair-
ing the structure of the cell membrane by rule locus of the fruit fly, Drosophila
electron microscopy. The procedure is essen- melanogaster. Mutants of the fushi
tially the same as in freeze-etching, except tarazu (ftz) gene are missing every other
that the sample is fractured along the plane segment. See pair-rule mutants and
of the cell membrane, which is then exam- segments, segmentation.
ined after freeze-drying and shadowing.
fushi tarazu mutation A mutation
Frei test A clinical test to diagnose dis- that causes a failure to produce the seven
eases caused by infectious microbes based embryonic parasegments that appear
on the appearance of a skin reaction when at the blastoderm stage of develop-
a killed preparation of the suspect micro- ment in Drosophila melanogaster (fruit
organism is injected subcutaneously. fly). Experiments centered on this muta-
tion helped identify the pair-rule class of
French pressure cell A device for lys- genes.
ing bacterial cells by subjecting them to
hydrostatic pressure. fusidic acid An antibiotic that acts by
blocking the translocation step in protein
Freunds adjuvant An emulsion con- synthesis (translation) by blocking the
sisting of water, oil, and dead mycobac- release of the elongation factor (EF)-GDP
teria that, when mixed with an immu- complex.
nogen, enhances the immune response
when the immunogen-Freunds adjuvant fusion proteins Proteins that represent
mixture is injected into an animal. the product of the artificial splicing of
two genes.
fructose An isomer of glucose found in
citrus fruits. A phosphorylated form of
fructose is an intermediate metabolite in fusogenic vesicles Liposomes that con-
the oxidation of glucose for energy pro- tain, in the lipid bilayer, specialized fusion-
duction. inducing molecules (e.g., the F protein).
ftz An acronym for fushi tarazu. futile cycle In living systems, a combi-
nation of competing reactions in which
fumarase The enzyme that catalyzes the products of one set of reactions are
the conversion of fumarate to malate, an reconverted to the original reactants.
important step in the Krebs cycle phase The term is generally applied to reactions
of the metabolism of sugars. of energy metabolism such as the inter-
conversion:
fungi See mold. ATP->ADP
fructose-6-phosphate <========>
fungicide An agent that selectively kills ADP->ATP
fungi. fructose-1, 6-bisphosphate
100
www.stemcell8.cn
G1 phase A segment of the cell cycle that converts galactose into glucose. The
representing the time period during disease is characterized by organ enlarge-
which there is an increase in cellular mass ment, mental retardation, and cataract
between the end of mitosis and the onset formation resulting from the accumula-
of DNA synthesis (S phase). tion of D-galactose and D-galactose-1-
phosphate in the bloodstream.
G2 phase A segment of the cell cycle
representing the time period during galactosidase Any one of the class of
which there is an increase in cellular mass enzymes that catalyze the cleavage of
between the end of DNA synthesis (S the glycosidic linkage between galactose
phase) and the onset of mitosis. and another sugar. The galactosidases
are divided into and galactosidases
GABA Gamma amino butyric acid; an depending upon the type of glycosidic
inhibitory neurotransmitter derived from bond that is cleaved (i.e., or ). See
the amino acid glutamate. GABA acts to glycosidic linkage.
inhibit neural transmission by opening
channels that admit chloride ions into the GALT Gut-associated lymphatic tissue;
neuron. The GABA receptor is the target of patches of lymphoid tissue in the small
pharmacologic agents, such as Valium and intestine; Peyers patches.
other diazepams, that act as depressants by
potentiating the action of GABA. gamete The mature product of the
process of meiosis, for example, egg and
GAG 1. Glycosaminoglycans. Long-branched sperm, in organisms that reproduce sexu-
chains of sugar molecules built from repeat- ally.
ing dissacharide subunits containing amino
groups. Glycosaminoglycans are present on gamma chain An immunoglobulin
the surfaces of eukaryotic cells where they (Ig) chain that is found as a transmem-
are believed to play a role in cell-cell and brane protein on the surface of a B cell
cell-substate recognition. and is part of the B-cell antigen-receptor
2. Group-specific antigens. The proteins complex.
encoded for by the GAG gene of a retro-
virus. The GAG proteins are the compo- gamma interferon See interferon.
nents of the virus capsid.
gamma radiation A high-energy elec-
galactose An optical isomer of the tromagnetic radiation that is produced
sugar glucose. Galactose differs from during the process of nuclear decay in
glucose only at the fi fth carbon and is which one subatomic particle is converted
converted into glucose through the action into another; for example, the decay of
of an epimerase enzyme (UDP-glucose 4- a neutron into a proton and an electron
epimerase) that acts on this carbon. also releases gamma radiation.
101
www.stemcell8.cn
gangliosides
102
www.stemcell8.cn
gene cloning
Gel filtration
electric field is slowed in the presence of a various investigators around the world, cur-
particular protein. rently maintained at the National Library
of Medicine. The GenBank, which is the
gelsolin A protein that, in the pres- most comprehensive U.S. national database
ence of calcium, liquefies gels formed of this type, is divided into 13 sequence
from actin and fi lamin. The liquefaction categories: primate, mammal, rodent, ver-
is accomplished by cleavage of the actin tebrate, invertebrate, organelle, RNA, bac-
fi laments and subsequent capping of the teria, plant, viral, bacteriophage, synthetic,
cleaved fi lament ends. and unannotated. See databases.
gel transfer A term applied to the gen- gene A sequence of DNA nucleotides
eral process of transferring substances sep- that carries the complete code required
arated by gel electrophoresis from the gel to for the biosynthesis of a polypeptide.
a membrane for analysis, for example, for
Southern, northern, or western blot analy- gene bank A group of genes that are
sis. Blotting is one type of gel transfer. coordinately controlled.
103
www.stemcell8.cn
gene(s) codominant
Gene cloning
104
www.stemcell8.cn
genetic code
tion of duplicated genes in which a DNA For example, 16p11.2 designates sub-
strand from one gene copy becomes paired band 2 of band number 11 on the p arm
with the complementary DNA strand of chromosome 16.
from the other gene copy; any area of base
mismatch (presumably representing a gene(s) pseudogenes A variant form of
mutation that occurred in one of the gene a particular gene that has become perma-
copies) is then repaired by a mismatch nently inactivated over time as the result
repair system. See mismatch repair. of genetic drift.
105
www.stemcell8.cn
genetic disease
genetic map A map of the genome of germ cell A reproductive cell or any
an organism based on the relative dis- cell giving rise to a reproductive cell, such
tances between genetic markers. See as an oocyte or spermatocyte.
linkage map.
germinal centers A region of the lymph
genetics The study of the process by node that contains a mass of rapidly divid-
which traits are transmitted from parent ing B cells. See B lymphocytes.
to offspring; the study of inheritance.
germination The growth of a plant
genome All the genetic information from a spore or a seed.
carried in the haploid number of chro-
mosomes. germ line Embryologically, the cells
that will, in the adult organism, give rise
genomic DNA The DNA representing to germ cells.
the entire genome. In laboratory termi-
nology, the term genomic DNA is used germ-line therapy A gene therapy
to describe a pure preparation of total based on the introduction of new genetic
native DNA isolated from tissue or a cell material or on alteration of existing
culture. genetic material in cells that give rise to
either sperm or egg. In germ-line therapy,
genomic library A library created in the new or altered genetic material can be
a particular vector from genomic DNA passed from parent to offspring.
such that the entire genome is included in
the library. ghost cells A cell, usually a bacterial
or red blood cell, that lacks much or most
genomics Computer analysis of gene of its internal contents as the result of
sequences from different organisms to lysis and resealing of the cell membrane.
106
www.stemcell8.cn
glucocorticoid
Because ghost cells can fuse with other Gleevec An anticancer pharmaceuti-
cells, ghosts have been used as a means of cal made by Novartis that inhibits the abl
packaging and delivering drugs to other protein-tyrosine kinase that is activated
cell targets. in chronic myelogenous leukemia (CML)
by formation of the Philadelphia chromo-
gibberllin A group of plant hormones some. Gleevec is effective against CML
that induce the plant growth and matura- and some gastrointestinal tumors (GISTs).
tion in flowering plants.
glial cell A cell type that occupies the
Gibbs-Donnan effect The observa- spaces in between the neurons of the
tion that charged molecules on one side brain. Glial cells are divided into five
of a semipermeable membrane often fail major subclasses: Schwann cells, oligo-
to ever become evenly distributed on dendrocytes, microglia, astrocytes, and
both sides of the membrane. This effect ependymal cells.
is explained on the basis of the fact that
other charged substances that cannot glial fibrillary acidic protein
diffuse across the membrane produce an (GFAP) A protein that assembles into a
electric field that influences the migration cytoplasmic network of intermediate fi la-
of charged molecules. ments found only in glial cells.
Gibbs free energy The energy that globin A group of proteins that form
is either released, or used by, a chemi- the subunits of the oxygen-carrying mol-
cal reaction. The free energy absorbed or ecules hemaglobin and myoglobin. A
released during a reaction (G) is the dif- mutation in the globin genes is respon-
ference between the energy of the prod- sible for the oxygen-transporting defect
ucts and the energy of the reactants (G seen in sickle cell anemia.
=Gr-Gf ) and is given by:
G = HtS Globotriaosylceramide A glycolipid
where: molecule that accumulates in patients with
H is the energy released (or used) in Fabrys disease, which is caused by a defi-
chemical bond breakage (or formation) ciency of the enzyme -galactosidase A.
during the chemical reaction.
S is a measure of the change in entropy globular actin (G-actin) The basic
(disorder) of the molecules involved in the monomeric subunit that polymerizes to
reaction. form the characteristic actin fi laments in
t is the temperature at which the reac- muscle. G-actin is a single polypeptide of
tion occurs. 375 amino acids.
107
www.stemcell8.cn
glucogenesis
layer (the cortex) of the adrenal gland. The gen peroxide produced in the reaction can
glucocorticoids cortisone, corticosterone, be used to oxidize certain aromatic com-
and cortisol regulate the metabolism of pounds that form colored products.
glucose. They also act as anti-inflamma-
tory agents and are used to limit inflam- glutamic acid An amino acid whose
mation in certain chronic inflammatory side chain is:
conditions such as arthritis. CH 2 CH 2 COOH
The COOH group gives glutamic acid its
glucogenesis (gluconeogenesis) The acidic nature.
process of creating glucose from its own
metabolites. This pathway is active under glutamine An amino acid whose side
conditions where the rate of metabolism chain is:
of glucose is reduced. CH 2 CH 2 C=O
\
glucose A six-carbon sugar that is the NH 2
major source of energy for most of the Glutamine plays an important role as
animal kingdom. Energy is generated an intermediate in the transfer of amino
through the oxidation of glucose to yield groups in the biosynthesis and degrada-
carbon dioxide and water. See tricar- tion of a number of other amino acids.
boxylic acid cycle.
glutamine-rich domains A region(s)
glucose effect The blockage of the found in certain types of eukaryotic
induction of the lac operon genes by the transcription factors. Glutamine-rich
presence of glucose. domains are involved in interaction with
other transcription factors with which
Glucose Galactose Malabsorption they act in a synergistic manner to upreg-
(GGM) A rare autosomal recessive dis- ulate transcription; in human cells the
order resulting from a defect in the SGLT1 glutamine-rich domains interact with
gene that codes for a transporter for the acidic type transcriptional activators
sugars glucose and galactose. The condi- bound at a separate site. Sp1 and Oct1
tion is characterized by severe diarrhea are examples of transcription factors
and dehydration in neonates and can be that contain glutamine-rich domains. A
fatal unless a sugar-free diet is maintained. glutamine-rich domain in the transcrip-
In GGM most mutations are found to pro- tion factor Sp1 makes contact with the
duce nonfunctional truncated SGLT1 pro- dTAFII110 factor in the Drosophila
teins or in misplacement of the transporter TFIID complex to bring about transcrip-
so that glucose and galactose cannot be tional activation.
removed from the intestinal lumen. The
sugars osmotically remove water from the glutathione A molecule made up of
body tissue into the intestinal space, which three amino acids linked end-to-end (a tri-
causes the diarrhea. peptide: glutamate-cysteine-glycine) that
acts as a reducing agent. Glutathione plays
glucose isomerase The enzyme that a role in determining the proper folding
catalyzes the conversion of glucose into of newly synthesized proteins through the
the structural isomer fructose. cross-linking of cysteine residues.
108
www.stemcell8.cn
glycosidic linkage
into cells. They are large integral mem- cyclin D by phosphorylation. Inhibitors
brane proteins in which a transport chan- of GSK3 are being investigated as thera-
nel is formed from 12 membrane-spanning peutic agents for the control of diabetes
regions. The appearance of GLUT trans- and to limit the degree of neurological
porters on the cell surface is induced by damage in stroke patients.
insulin in liver cells.
glycolipid A sugar or polysaccharide
glycerides (mono-, di-, tri-) A class covalently attached to a lipid. Glycolip-
of lipids in which one or more fatty acids ids are important components of animal
is covalently attached to a glycerol mol- cell membranes. Cerebrosides and gan-
ecule. Glycerides are divided into mono- gliosides that are derivatives of the lipid
glycerides (one fatty acid molecule), di- sphingosine, are important components
glycerides (two fatty acid molecules), and of glycolipids in membrane receptors in
triglycerides (three fatty acids). Glycerides the brain.
are important as storage vehicles of fat.
glycopeptide A polypeptide covalently
glycerol The simplest carbohydrate linked to a sugar or polysaccharide. Gly-
containing three carbon atoms with the copeptides are divided into two classes,
structure: depending on whether the sugar(s) are
H 2CCHCH 2 linked to the polypeptide by an oxygen
| | | atom (O-linked) or a nitrogen atom (N-
HO OH OH linked). See peptidoglycan.
Because of its ability to absorb water, glyc-
erol is used commercially as a moisturizer.
glycophorin A transmembrane glyco-
protein (see transmembrane proteins
glycine The simplest amino acid whose
and glycoproteins) found in erythro-
side chain consists only of a hydrogen atom.
cyte membranes. The critical function
that glycophorin serves is unknown, but
glycocalyx The cell coat; an outer it is believed that charged residues on the
coating, rich in carbohydrates on the sur-
extracellular domain of the protein may
face of most eukaryotic cells. The glyco-
help to prevent blood cells from sticking
calyx also contains some glycolipids and
to one another. Glycophorin has been
proteoglycans that may form part of the
shown to be a site of attachment for the
extracellular matrix (ECM).
influenza virus and the malarial parasite,
Plasmodium falciparum.
glycogen A complex storage polysac-
charide consisting of branching chains
of glucose molecules. Glycogen is the pri-
glycoprotein Proteins linked to sugars
mary source of glucose that is produced and/or polysaccharides that are prevalent
mostly from glycogen breakdown in the on the outside surfaces of cell membranes.
liver under conditions where the amount Glycoproteins are components of special-
of free glucose is insufficient for the ized receptor molecules and the extracel-
bodys needs. lular matrix (ECM) in eukaryotic cells.
109
www.stemcell8.cn
glycosylation
110
www.stemcell8.cn
GRB2
nohypophysis) and act to stimulate the rial cells are fi rst stained with crystal vio-
reproductive organs in various ways. let and iodine and then decolorized with
alcohol. Cells that retain the purple color
gp120 A glycoprotein found on the of the crystal violet after the alcohol treat-
surface of the HIV virus. During viral ment have thick cell walls and are Gram-
infection, the attachment of gp120 to positive. Cells that lose the crystal violet
CD4, a receptor on the surface of the tar- after decolorization but then take up a
get lymphocyte, is a primary event. For pink counterstain, safranin, have thinner
this reason, antibodies created against cell walls with an abundance of lipid in
gp120 epitopes are a major focus in the the cell envelope. These cells are called
development of virus-neutralizing anti- Gram-negative. The Gram-positive Gram-
bodies and anti-AIDS vaccines. negative classification system is particu-
larly useful because, not only does it help
GPR14 G proteincoupled receptor 14; to identify bacteria, but in a wide variety
the membrane receptor for the neuropep- of bacteria the Gram stain shows a corre-
tide hormone urotensin II, which regulates lation with sensitivity to antibiotics.
cardiovascular function and is hypoten-
sive in mammals. GPR14 is predominantly grana Stacks of thylakoid disks inside
expressed in the heart and pancreas and the chloroplast.
in low levels in portions of the brain. The
gene map locus of human GPR14 gene is granulocyte macrophage-colony stim-
17q25.3. ulating factor (GM-CSF) A recombi-
nant protein produced in large scale and
G protein(s) A class of cell membrane- used as an adjunct to cancer chemother-
bound proteins that bind GTP and/or apy since 1991. It stimulates the produc-
GDP and act to alter certain metabolic tion of granulocytes to boost the immu-
pathways or gene expression when a spe- nity of patients taking chemotherapy.
cific ligand binds to a receptor on the out-
side of the cell. granulocytes A class of leucocytes
composed of neutrophils, eosinophils,
graft v. host reaction A deleterious and basophils. Granulocytes are active in
immune reaction in which lymphocytes allergic immune reactions such as allergic
present in grafted tissue attacks the tis- skin lesions and arthritic infl ammation.
sues of the host.
gratuitous inducer A molecule that,
gram A universally adopted measure of because it structurally resembles a cer-
mass in the scientific world. A gram is tain inducer of transcription, can act to
defi ned as one thousandth of the mass of induce transcription in lieu of the authen-
one liter of pure water at a temperature tic inducer, for example, IPTG in lieu of
where its density is greatest, that is, just lactose as a gratuitous inducer of the lac
above the freezing point (0 C). operon.
111
www.stemcell8.cn
Griffith, Frederick
GRB2 is an adaptor protein that binds the TRK phosphotyrosines via an SH2 domain and the
Sos protein via an SH3 domain. Sos then induces exchange of ras-bound GDP for GTP, thereby
activating the ras-GTP complex that binds to the N-terminal end of cytosolic raf, a protein whose
C-terminal end has serine/threonine kinase activity. GAP is a negative regulator of ras that acts
to increase the rate of hydrolysis of ras-bound GTP to GDP.
SH2 domain GRB2 binds to the phos- entering the cell are trapped in the cyto-
phorylated cytoplasmic domain of an sol where they accumulate.
RTK; the GRB2 SH3 domain simultane-
ously binds to a protein called Sos that, growth curve A graph in which the
in turn, stimulates GDP bound to ras on number of individuals in some population
the inner surface of the cell membrane to of organisms, for example, cells in culture,
be exchanged for GTP. animals in a herd, fish in a pond, and so
on, is plotted as a function of time.
Griffith, Frederick (18811941) A
bacteriologist who demonstrated that heat- growth factors A group of small,
killed, pathogenic pneumococcus bacteria secreted polypeptides that bind to recep-
could transform live, nonpathogenic pneu- tors on certain specific target cells and
mococci into the pathogenic form when the stimulate cell division in those target
two were mixed together. This experiment cells. Growth factors have become the
gave rise to the work of Avery, MacCleod, focus of intensive research because of
and McCarty that showed the transform- their ability to influence the physiology
ing factor to be DNA. of growth and also because many of them
have been found to bear a close relation-
griseofulvin An antifungal agent pro- ship to oncogenes.
duced by Penicillium griseofulvum. Gris-
eofulvin appears to act by inhibiting the growth hormone A growth factor pro-
movement of chromosomes during mito- duced by the anterior lobe of the pituitary
sis by interfering with the spindle appa- gland that stimulates the growth of bone
ratus. and muscle during childhood. Growth
hormone was one of the fi rst bioactive
group translocation A type of active factors whose genes were cloned and
transport in bacteria in which compounds expressed in transgenic animals, thereby
that enter the cell by passive diffusion demonstrating the feasibility of curing
are immediately modified, for example, genetic disease by gene therapy.
by phosphorylation such that they can-
not passively diffuse back across the growth media A synthetic solution of
cell membrane. In this way, compounds nutrients to support the growth of cells or
112
www.stemcell8.cn
guanosine, 7-methyl
113
www.stemcell8.cn
recto
guanosine monophosphate
Guanosine nucleosides
114
www.stemcell8.cn
H
A
H-2 histocompatibility The match of but in which the tissue structure is poorly
tissue proteins that, in the mouse, deter- organized. These lesions are believed to
mines whether a tissue graft will or will represent developmental abnormalities
not be rejected by the immune system of rather than true neoplasms.
the host. H-2 compatibility is determined
by a large gene complex that codes for haploid The state of a cell having only
cell surface glycoproteins. See major one set of alleles as opposed to the diploid
histocompatibility complex. state in which a cell normally contains
two copies of each allele.
habituation The tendency of some neu-
rons to require longer than normal refrac- haploid number Having one-half the
tory phases or stimulation by stronger-than- number of chromosomes as are normally
normal nerve impulses to trigger an action present in a diploid cell, thus being in the
potential if action potentials have been trig- haploid state, for example, in gametes.
gered in that neuron in the recent past.
haploinsufficiency One copy of a gene
hairpin loop The folding back of a is not sufficient to assure normal function.
nucleic acid strand on itself. Hairpins are
created by internal base pairing between
haplotype A particular set of markers,
purine and pyrimidine bases along two
for example, RFLPs or alleles, in a cer-
separate segments of the nucleic acid. See
tain region of a chromosome. The term
looped domains.
was originally applied only to clusters
of alleles in the major histocompatibility
half-register In repeated sequences
complex (MHC) but is now applied to
in which the repeat unit can be divided
any specified genetic locus.
into two halves, half-register refers to a
misalignment of the two chromosomal
copies such that the fi rst half of a repeat HA protein Hemagglutinin protein; a
unit is aligned with the second half of the glycoprotein found on the surface of the
other chromosomal copy. For example, influenza virus that binds to sialic acid
if the two halves of the repeat units are residues on the cell membranes of cells
designated X and Y, then the repetitive that are infected by the virus; this bind-
portion could be represented by ing initiates the process of infection. In
...XYXYXYXYXYXYXYX... a subsequent step, the HA protein medi-
and in half register: ates fusion between the viral membrane
...XYXYXYXYXYXYXYX... and the membrane of an endosome that
...XYXYXYXYXYXYXY... encapsulates the virus. This observa-
tion has led researchers to utilize the HA
halophile A type of bacteria requiring protein as a tool to study the process of
sodium chloride (NaC1) as an essential membrane fusion.
nutrient.
hapten A small molecule that can act
hamartoma A mass comprised of the as an immunogen only when combined
normal organ tissues in which it is found with a larger molecule.
115
www.stemcell8.cn
recto
Hardy-Weinberg law
116
www.stemcell8.cn
helix-loop-helix
verso
triple helical
TAGCAGGCTTCTCTCTCTCTCTCT C
ATCGTCCGAAGAGAGAGAGAGAGA GT
C
G TCTCTCTCTCTCTCT A
G
G
TG T
C C AGAGAGAGAGAGAGA
AC AC
T
G
TA GT
AT
C
G
TT GC
C
AA
G
C
H DNA
117
www.stemcell8.cn
recto
helix-turn-helix
118
www.stemcell8.cn
Herpes
verso
hemolytic plaque assay An assay ious drugs, toxic agents, and autoimmune
based on the localized hemolysis of red reaction.
blood cells (RBCs) that appears as a
plaque when the RBCs are spread out in a hepatitis virus The viral agent, a small
layer of agar. The hemolytic plaque assay DNA virus, that causes the infectious
is used to demonstrate the secretion of form of hepatitis that infects a large frac-
specific antibodies by antibody-produc- tion of the individuals in certain areas of
ing cells that are mixed together with the the world. Hepatitis viruses fall into three
RBCs. subclasses, termed simply A, B, and C.
119
www.stemcell8.cn
recto simplex virus
Herpes
acute infections such as chicken pox and cessed RNAs in the nucleus. The name
infections that result from persistent, derives from the great heterogeneity
latent infections, for example, shingles in size and type of RNA present in the
that results from the same virus, that is, nucleus before the RNAs are processed
Herpes zoster. The members of the her- and transported to the cytoplasm.
pes family of viruses are Herpes simplex,
Herpesvirus simiae, Varicella zoster, cyto- heterokaryon A multinucleated hybrid
megalovirus, and Epstein-Barr virus. cell created either from the fusion between
two or more cells or by cell division with-
Herpes simplex virus (HSV) A mem- out cytokinesis.
ber of the herpes family of viruses that
has been implicated as the causative agent heterolactic fermentation Heterofer-
in some cervical cancers. mentation.
120
www.stemcell8.cn
Hognessverso
box
way is the only means by which guanine histamine A substance stored in the
or other purine analogs can enter into granules of mast cells that is released dur-
nucleic acids. Thus, as is true for thymi- ing allergic response. Histamine release
dine kinase in the pyrimidine pathway, causes smooth muscle contraction, secre-
manipulation of this enzymatic step pro- tory activity in mucous epithelium, and
vides an important experimental tool for other symptoms of allergic reaction.
studying gene action by the incorporation
of modified bases into DNA. histidine An amino acid whose side
chain is
HGPRT marker A term that refers CH 2 C=CH
to the use of the gene that codes for the | |
HGPRT enzyme as a selectable marker. HN NH
Cells containing mutant HGPRT genes \ |
are resistant to purine derivatives that are CH
toxic because they become incorporated
into DNA via the HGPRT dependent histocompatability The state of simi-
pathway. See HGPRT. larity or dissimilarity between the pro-
teins of a grafted tissue and proteins of
high-frequency recombination strain the host on which the tissue is grafted.
Certain strains of donor-type bacte- The degree of histocompatibility is the
ria in which the bacterial genomes are major factor in determining whether a
observed to undergo much higher rates host will accept or reject a tissue graft.
of gene transfer and recombination
than other bacteria in the same culture.
histones A group of proteins that are
The high frequency of recombination is
tightly associated with DNA to form struc-
based on the presence of an F factor
tures known as nucleosomes. The histones
that has integrated into the genome,
fall into five subgroups: H2a, H2b, H3,
which allows mating to occur between
H4, and H1. They appear to play a role in
neighboring bacteria. See conjuga-
regulating the expression of genes.
tion, bacterial.
121
www.stemcell8.cn
recto
Holliday junction
122
www.stemcell8.cn
host restriction-modification
verso
homozygous The state in which the host cell Any cell that is infected by
genome contains two copies of the same a virus is referred to as the host cell for
allele of a particular gene. Organisms are that virus.
said to be homozygous for a gene.
host range The group of all cell types
Hoogsteen base pairs An unusual that are susceptible to infection by a par-
type of base pairing that occurs in triple ticular virus.
helical DNAs, a type of structure that is
formed under special conditions. In the host restriction-modification Restric-
triple helix, one of the bases is hydrogen tion enzyme systems that have been devel-
bonded to another base from each of the oped by bacteria that inactivate the DNA
other two strands to form the unusual of infecting bacteriophages by cleav-
base pairs, such as: T=A-T or C=G-C. ing them with restriction enzymes pro-
duced by the bacterial host, while at the
hormone Any molecule that is made same time protecting the host DNA from
and secreted by a specific tissue and cleavage by the same restriction enzyme
that causes or induces a specific action through another system that modifies the
or behavior in another (target) tissue, for host DNA usually by methylation.
123
www.stemcell8.cn
recto
host-vector system
124
www.stemcell8.cn
hydrolysis
verso
fluid that lubricates joints and in the vit- tion probe and the target nucleic. Thus,
reous humor of the eye. the chemical and physical conditions
under which a hybridization occurs can
hybrid An organism that is the off- be adjusted so that the level of homol-
spring of parents of different genotypes. ogy between the probe and the target is
85 percent, 90 percent, and so on. Levels
hybrid-arrested translation An experi- of homology below about 70 percent are
mental technique that identifies a cDNA generally considered to be nonhomolo-
for a specific protein by making a hybrid gous, and so hybridization conditions
between a cDNA and mRNA. If the permitting duplex formation between
cDNA does hybridize to the putative nonhomologous nucleic acids are called
mRNA for the protein, then the mRNA nonstringent.
containing the hybrid will not be able to
be translated in an in vitro translation hybridoma An immortalized antibody-
system, which will be indicated by the secreting cell created by fusing a myeloma
absence of that protein in a protein gel of cell to lymphocytes from the spleen of
the protein products. an animal that has been immunized to
a particular antigen. Antibody-secreting
hybrid cell A cell that was produced by hybridomas are the source of monoclonal
cell fusion but that, after several cell divi- antibodies.
sions following fusion, now contains one
nucleus with chromosomal material from hybrid vigor The state in which an off-
the original parent cells. spring is genetically more robust and/or
better equipped for survival than either
hybrid dysgenesis The term that is parent as the result of heterozygosity,
applied to the inability of certain strains that is, receiving a beneficial combination
of the fruit fly, D. melanogaster, to inter- of traits from its parents.
breed because offspring resulting from
matings between the strains are sterile. hydrocarbon Any organic molecule
composed only of hydrogen and carbon.
hybridization The formation, in vitro, The most common hydrocarbons are
of a double-stranded nucleic acid segment those that are derived from a linear chain
by hydrogen bonding between two single of carbon atoms.
strands. Experimental use of hybridiza-
hydrogen bonds Electrostatic attrac-
tion is the basis of DNA probe technol-
tions between positively charged hydro-
ogy including Southern and northern blot
gen atoms and negatively charged atoms
analyses, primer annealing, and hetero-
on other parts of a molecule or on other
duplex analysis.
molecules. Hydrogen bonds are the
major forces that stabilize the structures
hybridization probe Any labeled nu- of many proteins and the DNA double
cleic acid segment that is used in any of helix.
a variety of assays based on hybridiza-
tion of the labeled nucleic acid to a target hydrolase The general class of enzymes
nucleic acid. that catalyze reactions involving hydro-
lysis.
hybridization stringency A term used
to describe the degree of mismatch tol- hydrolysate The product of the hydro-
erated by a specific set of hybridization lysis of a material, for example, a protein
conditions. Hybridization stringency is hydrolysate or a casein hydrolysate.
usually given in terms of the minimal per-
cent base match that will be required for hydrolysis The breakage of any cova-
duplex formation between the hybridiza- lent bond that involves the insertion of
125
www.stemcell8.cn
recto
hydronium ion
a water molecule across the bond; for hydrops fetalis A type of thalassemia in
example: which all four alpha-chains missing in the
C=O H 2O C=O NH hemaglobin molecule are missing as a result
\ -----------------> \ + \ of a defect in the DNA that codes for these
NH OH H proteins. Infants carrying the defect almost
In the above example, the carbon-nitrogen inevitably die at or before birth.
bond is said to have undergone hydroly-
sis. hydroxyapatite A form of calcium
phosphate (CaPO 4) that is used for sep-
hydronium ion A water molecule to aration of single- and double-stranded
which a hydrogen ion is attached: H+ + nucleic acids by column chromatogra-
H 2O ---> H3O+. Hydronium ions are the phy in which the double-stranded form
form in which hydrogen ions are nor- is preferentially retained on the hydroxy-
mally carried in aqueous solutions. apatite matrix.
126
www.stemcell8.cn
hypoxanthine
verso
127
www.stemcell8.cn
A
I
i-gene The bacterial gene that codes for illegitimate recombination A rare
the lac operon repressor protein. event in which recombination occurs
between two DNAs at an apparently ran-
IgG See immunoglobulin. domly chosen site(s).
128
www.stemcell8.cn
immunoglobulin gene switching
verso
imaginal disk Disk-shaped structures antibodies to the antigen after the antigen
symmetrically located on either side of has been separated according to size and/
the embryos of fly larvae that give rise or charge by gel electrophoresis and then
to certain adult structures, for example, transferred to a membrane.
legs, eyes, and wings.
immunodeficiency The state of im-
immortalized cells Cells that continue pairment of the immune system result-
to divide indefi nitely in tissue culture. ing in the inability or lowered ability of
Immortalization is a defi ning property the immune system to mount an immune
of transformed cells; cells expressing the response to a cell or particular antigen.
properties of cancer cells (i.e., the trans-
formed phenotype). immunodiffusion A technique for
determining the presence of an antigen
immune response The proliferation of by allowing an antigen and an appropri-
specific antibodies or cells of the immune ate antibody to diffuse into a gel where
system, such as macrophages, T and B an immune precipitate forms at the point
lymphocytes, and so on, in response to a where antigen and antibody meet.
foreign antigen.
immunoelectrophoresis A variation
immune system The collection of all of the immunodiffusion technique in
the cells and tissues (thymus, spleen, lym- which the antigen is subjected to elec-
phocytes) that are involved in providing trophoresis in a gel that is then used for
an immune response. assay by immunodiffusion.
129
www.stemcell8.cn
recto
immunolabeling
Immunoglobulin
induction, gene Transcription of a
gene(s) brought about in the presence of
a specific agent that is referred to as the
RNA is spliced so that the products of inducer.
different portions of the immunoglobulin
genes are fused to one another in differ- induction, phage The production of lytic
ent arrangements. bacteriophage in bacteria that carries a lyso-
genic prophage, brought about by treatment
immunolabeling The technique of with some chemical of physical agent.
labeling molecules and/or biologic struc-
tures through the use of antibodies bound informative meiosis A mating that
to other molecules that serve as labels for generates a crossing over between two
the antibody-antigen complex. genetic markers so that linkage between
the two markers can be determined.
immunology The study of the immune Informative meioses have been used in
system. the genetic analyses of genetic disease
such as cystic fibrosis to establish linkage
between RFLPs known to be associated
impermeable junction A term used to
with the disease.
describe any cell-cell junctional complex
that connects cells together so that even
infrared spectroscopy An analytical
small molecules cannot diffuse between
technique for determination of the chemi-
the connected cells. Impermeable junc-
cal structure of an unknown by observing
tions are generally used as synonymous
how much light is absorbed by a sample
with tight junctions. of the unknown at different light wave-
lengths in the infrared spectrum (>1,000
inclusion bodies Clumps of material nm). The absorption of light in this region
that accumulate in the nucleus or cyto- of the spectrum reflects, and is analyzed
plasm of virus-infected cells. Inclusion in terms of, the presence of certain types
bodies consist of aggregates of viral struc- of chemical bonds, for example, C=O,
tural components such as virion proteins. COH, and CC, that produce charac-
teristic absorption patterns.
indirect end labeling A technique for
demonstrating the unique nature of a inhibitory postsynaptic potential A
DNA fragment by hybridizing the frag- membrane potential across the postsyn-
ment to a probe representing an end piece aptic membrane in a neuron that inhib-
of the sequence that it is proposed to rep- its the generation of an action potential
130
www.stemcell8.cn
inverso
situ
131
www.stemcell8.cn
recto
in situ hybridization
in situ hybridization Nucleic acid into the cell membrane; that is, it pen-
hybridization carried out on sections of etrates into the membrane lipid bilayer.
intact tissue or chromosomes. Most eukaryotic receptors (e.g., RTKs)
are integral membrane proteins.
insulin A polypeptide hormone secreted
by a part of the pancreas known as the integrant A cell in which a transfected
islets of Langerhans, which controls the gene has become stably integrated into the
entry of glucose into cells. A deficiency of genome of the recipient. See transfection.
insulin production is the underlying cause
of diabetes. integrase The enzyme that catalyzes
the site-specific recombination of lambda
int 1 gene An oncogene activated by bacteriophage DNA with the bacterial
the nearby integration of the mouse host DNA that results in integration of
mammary-tumor virus (MMTV) that the bacteriophage DNA.
produces mammary tumors in mice.
The int 1 gene homologue in Drosophila integration In molecular genetics, the
melanogaster has been shown to play a insertion of a foreign DNA into the genome
crucial role in wing development, suggest- of a recipient cell. The term is most often
ing that the mammalian int 1 gene may applied to the integration of viral DNA
play a regulatory role in development. into the genome of an infected host, for
example, integration of the prophage in a
intasome A complex between bacterio- bacterium infected by a bacteriophage.
phage DNA and two proteins (Int and IHF)
that is required for bacteriophage DNA to integrin-linked kinase (ILK) An
integrate into the bacterial host DNA when enzyme associated with the cytoplasmic
a bacteriophage enters into lysogeny. domains of integrins and also attached to
the actin cytoskeleton at regions of the cell
integral membrane protein (intrinsic membrane called focal adhesions (FAs).
protein) A protein that is integrated Integrin-linked kinases act to transduce
bacteriophage DNA
intasome
integrated bacteriophage
Intasome
132
www.stemcell8.cn
interleukins
verso
133
www.stemcell8.cn
recto
internal guide sequence
134
www.stemcell8.cn
ionophore
verso
135
www.stemcell8.cn
recto
ion-selective electrode
136
www.stemcell8.cn
A
J
jagged 1 (JAG1) A gene that codes fi rst isolated from the brain tissue of a
for a protein called jagged 1. The jag- patient with progressive multifocal leuko-
ged 1 protein binds to notch proteins encephalopathy (PML), which the virus is
that are receptors on the surfaces of cer- believed to cause.
tain cells. The formation of the jagged
1notch complex sets in motion a series jnk Jun N-terminal kinase; the pro-
of signaling reactions that controls the tein is a member of the MAP kinase
development of various cell types in an family. MAP kinases act as an inte-
embryo, including the heart, liver, eyes, gration point for multiple biochemi-
ears, spinal column, and blood cells. cal signals and are involved in a wide
Certain mutations in JAG1 can cause variety of cellular processes, such as
Alagille syndrome, which is character- proliferation, differentiation, tran-
ized by missing or narrowed bile ducts scription regulation, and development.
in the liver, heart defects, and charac- This kinase is activated by various cell
teristic facial features. Other mutations stimuli and targets specifi c transcrip-
in JAG1 result in various other abnor- tion factors, and thus mediates imme-
malities, including a heart defect called diate-early gene expression in response
Tetralogy of Fallot, deafness, and a to cell stimuli. The activation of this
liver condition called extrahepatic bili- kinase by tumor-necrosis factor alpha
ary atresia (EHBA). The JAG1 gene is (TNF-alpha) is found to be required
located on chromosome 20 at gene map for TNF-alpha-induced apoptosis. This
locus p12.1-11.23. kinase is also involved in ultraviolet
radiationinduced apoptosis, which
is thought to be related to cytochrome
JAKs Janus kinases; tyrosine kinases c-mediated cell-death pathway. Studies
that are one of the two main components of the mouse counterpart of this gene
of the JAK/STAT signaling pathway. suggest that this kinase plays a key
JAKs are activated by certain receptors role in T-cell proliferation, apoptosis,
for cytokines, lymphokines, and growth and differentiation.
factors. Ligand binding causes dimeriza-
tion of the receptors, which then act to joining gene (j gene) A DNA seg-
phosphorylate, and activate, JAKs. The ment in the immunoglobulin gene clus-
activated JAKs in turn phosphorylate ter that joins the constant and variable
the cytoplasmic ends of the receptor, immuno globulin gene regions during B
which then serves as a docking site for cell maturation. During the maturation
STATS. Mutations in the genes for JAKs process, antibody diversity is gener-
are associated with several leukemias, ated by joining a constant region with
including polycythemia vera, thrombo- a large number of different variable
cythemia, and myeloid metaplasia. regions.
137
www.stemcell8.cn
recto virus
junin
ligand
P P
STAT
receptor
STAT P P
STAT STAT
P P
STAT STAT
nucleus
has been found to share identity with the junin virus A member of the taca-
transcription regulation factor, AP-1, and ribe subgroup of the arenaviruses. Junin
apparently exerts its oncogenic effects by virus, which causes hemorrhagic fever, is
inducing aberrant gene transcription. carried by bats and rodents.
138
www.stemcell8.cn
karyogamy The fusion of two nuclei; ketone body Any of either acetone, ace-
for example the fusion of pronuclei that toacetate, or beta-hydroxybutyrate, pro-
occurs during fertilization of the egg. duced as the result of the accumulation
139
www.stemcell8.cn
ketose
140
www.stemcell8.cn
KSS1, FUS3
141
www.stemcell8.cn
lactam ring Any molecule with the lacZ gene The gene that codes for the
general structure enzyme beta-galactosidase in the lac ope-
C=O ron of bacteria. The lacZ gene is incorpo-
/ \ rated into many cloning vectors as a means
(CH 2)n NH of determining whether recombinant vec-
Lac operon
142
www.stemcell8.cn
Lassa fever virus
tors have been stably introduced into a lamella A thin membrane or plate
recipient cell or clone of cells. In a popula- dividing certain biological compart-
tion of transfected cells, expression of the ments, for example, the region in between
lacZ gene in a transfectant(s) can be deter- the cell walls of opposing cells of certain
mined from the appearance of blue color plants (i.e., the middle lamella).
in the cells when they are exposed to the
synthetic galactoside X-gal (5-bromo-4- lamellipoda A cytoplasm-containing
chloro-3-indoyl--D-Galactopyranoside), protrusion or villus extending out of the
which is hydrolyzed by the enzyme to pro- leading edge of an animal cell during its
duce a visible blue precipitate. movement along some substrate and ori-
ented along the axis of movement.
Lafora disease Lafora disease is a form
of epilepsy caused by an autosomal reces- laminar flow A uniform, eddy-free flow
sive mutation(s) in the EPM2A gene car- of air or liquid. Laboratory work requir-
ried on chromosome 6q24. The EPM2A ing particular care to avoid chemical or
gene is believed to code for a protein microbial contamination is carried out in
tyrosine phosphatase. Lafora disease is specialized, laminar flow hoods that main-
a stimulus-sensitive myoclonic epilepsy tain a continuous stream of fi ltered air.
that falls into two subtypes: Unverricht
(earlier onset, more severe) and Lundborg laminin A protein component of the
(later onset, less severe). The disease is basement membrane that forms under-
associated with inclusion bodies in the neath epithelial cells where the cells
neurons of the brain (Lafora bodies); in adhere to the basement membrane or
particular in the cerebral and cerebel- other substrate.
lar cortex and in the brain stem. Lafora
bodies are mostly glucose, 8093 percent lampbrush chromosomes Enlarged
in (1->4) and (1->6), but also contain chromosomes seen in amphibian oocytes
protein (ca. 6 percent). during meiotic prophase. Lampbrush
chromosomes are characterized by large
lagging strand During DNA synthesis, protruding loops of transcriptionally
the DNA strand whose synthesis begins active DNA.
at the replication fork. Because the repli-
cation fork is continually moving, DNA lariat An intermediate stage in the splic-
synthesis on the lagging strand must be ing out of introns during the formation
of mRNA in the nucleus. In a lariat, the
continually reinitiated resulting in a series
intron of an mRNA precursor is cut at
of contiguous but not covalently joined
one end; the cut end then forms a covalent
fragments. See Okazaki fragments.
bond to a nucleotide in the interior of the
intron to form the lariat structure. (See
lag phase The period of slow growth figure on next page.)
between the time when a microorganism
is inoculated into a nutrient broth and the laser Light amplification by stimulated
time when those microorganisms enter emission of radiation; laser light is cre-
into logarithmic growth. ated by causing a group of atoms to emit
photons in synchrony. Lasers are used
lambda exonuclease An enzyme that in varous types of molecular biological
catalyzes the cleavage of single nucleo- analyses, for example, flow cytometry.
tides with 5 phosphate groups from the
5 ends of double-stranded DNA. Lassa fever virus An RNA-containing
virus member of the Arenavirus family.
lambda light chain One the two types First discovered in Nigeria, the virus is
of light chains in IgG antibody molecules; known to cause an acute infection char-
a Bence-Jones protein. See kappa light acterized by fever, malaise, throat lesions,
chain. and pneumonia.
143
www.stemcell8.cn
late genes
intron
UG A AU
5 splice site 3 splice site
A
OH
UG AU
A
G
U AU
lariat
structure
Lariat
late genes In viral infection, a set of the French discoverers of the virus at the
genes that are always expressed late in Pasteur Institute.
the life cycle of the virus. Generally, the
late genes code for proteins required for LD-50 The dose of a test drug that
packaging of the viral DNA that is repli- is fatal to 50 percent of test animals to
cated early in the viral life cycle. which it is administered.
144
www.stemcell8.cn
leptin
145
www.stemcell8.cn
Lesh-Nyhan syndrome
leukemia A cancer of the blood char- ligation The chemical linking of the
acterized by the uncontrolled prolifera- free ends of two nucleic acids to form one
tion of white blood cells (leukocytes). larger strand out of two smaller ones.
leukocyte A white blood cell. The light chain Either of the two shorter
white blood cells are largely composed of peptides that make up an immunoglobulin
the cells of the immune system. molecule.
146
www.stemcell8.cn
linkage map
147
www.stemcell8.cn
linked genes
Lipid bilayer
linked genes Genes that are located mutations whose effect on the activity of
within close enough physical proximity a promoter is to be tested. The promoter
to one another that they appear together sequence that has been altered by inser-
in virtually all organisms to which one or tion of the linker is tested for activity in
the other is transmitted. vitro, for example, by CAT assay.
linker A synthetic molecule that serves linking number The number of com-
as a molecular bridge between two other plete helical turns in a circular DNA mol-
molecules, for example, a synthetic oligo- ecule. The linking number is related to
nucleotide that joins together two DNA the degree of supercoiling of the DNA.
fragments.
linking-number paradox In experi-
linker-scanner mutations The replace- mental determinations of the number of
ment of a segment of DNA with a synthetic winds of DNA around each nucleosome,
oligonucleotide (a linker) that contains the linking-number paradox refers to the
148
www.stemcell8.cn
LOD score
149
www.stemcell8.cn
logarithmic [growth] phase
from one another in the offspring of a isms may not reproduce or give rise to
mating could have occurred if the mark- only one daughter during reproduction.
ers were unlinked from one another.
By convention, a LOD score of 3 is long QT syndrome (LQTS) An
considered the threshold value for declar- hereditary disorder, usually seen in chil-
ing that two markers are linked to one dren, that affects the hearts electrical
another. rhythm such that the interval between the
Q and T parts of the contraction wave
logarithmic [growth] phase The term (contraction-relaxation of the ventricles)
used to describe the growth of a culture of is abnormally long. This leads to a rapid
microorganisms under conditions where, heart rhythm (arrhythmia) called Torsade
on the average, one organism gives rise des pointes, which can cause fainting in
to two daughters at a consistent uniform a matter of seconds. The biological bases
rate. Logarithmic phase of growth fol- of LQTS are mutations in genes that code
lows lag phase during which some organ- for ion channels that cause the channels
reverse
transcriptase
partial degradation
of 5 end of RNA template
R U5 gag pol
resulting in loss of R
head-to-tail alignment of
second viral RNA by base
pairing of R segments
extension of cDNA
by reverse transcriptase R U5 gag pol
continue
reverse transcription
to end of template
LTR
ENV U3 R U5 gag pol
150
www.stemcell8.cn
luxury genes
151
www.stemcell8.cn
lymphocyte
152
www.stemcell8.cn
153
www.stemcell8.cn
malaria
154
www.stemcell8.cn
MDM2
(e.g., hair color) and that resides at a par- haploid cells of opposite mating types.
ticular locus. The mating process converts yeast cells
from haploid asexual cells to diploid sex-
Marshall, Barry J. (19021992) One ually reproducing cells.
of the codiscoverers of the ulcer-
causing bacterium Helicobacter pylori. mating-type locus (MAT) A locus
This discovery earned him the Nobel containing master regulatory genes in
Prize in physiology or medicine in 2005, yeast that determine the male and female
which he shared with Robin Warren. mating types.
Marshall became well known for having
tested the ulcer-causing properties of the
maturing face [trans face (Golgi)] The
bacterium on himself.
outermost membrane in a Golgi stack.
The maturing face of the Golgi stack is
mass spectrometry An analytical
the place where proteins that have been
technique for determining the molecular
structure of an unknown compound by processed in the Golgi exit for various cel-
observing the paths that fragments of the lular destinations. See Golgi apparatus.
molecule take when they are forced to
migrate in a magnetic field. Maxam-Gilbert sequencing A tech-
nique for determining the sequence of a
mast cell A connective tissue cell located nucleic acid by chemical treatments that
near capillaries and most abundant in the cleave the nucleic acid strand at only one
lung, the skin, and the gastrointestinal of the four nucleotide bases (i.e., adenine,
tract. Mast cells possess receptors for IgE cytosine, guanine, or thymine), depend-
and release histamine when bound to IgE. ing on the chemicals used. The fragments
The release of histamine is responsible for produced by chemical cleavage are then
the runny nose, itchiness, and other respi- separated by electrophoresis, and the
ratory symptoms of allergy. sequence is determined from the size of
the different fragments.
master regulatory genes A cluster
of genes that governs the development MBP vector Maltose binding protein
of the major structural features during vector; an expression vector designed to
embryogeneis, for example, the bithorax facilitate the purification of the proteins
complex in Drosophila melanogaster that are expressed via the vector. In MBP
that is responsible for development of the vectors, the gene to be expressed is fused
abdominal and thoracic segments. to the gene coding for the maltose bind-
ing protein. The fusion protein expressed
maternal effect Characteristics con- by the vector can be purified by running
trolled by the mother and expressed in a cell extract over an amylose column.
the offspring. Usually, maternal effects
are caused by mRNA or a transcription
factor produced by the mother and passed McClintock, Barbara (19021992) A
into the egg. geneticist whose work on the cytogenet-
ics of maize led her to postulate the idea
maternal inheritance Inheritance of that genes could be transposable, both
genes of extrachromosomal factors such within a chromosome and between chro-
as the mitochondria that are transmitted mosomes. Her work on transposable ele-
through the egg cytoplasm. ments won her the Nobel Prize in medi-
cine in 1983.
mating type One of two alternative
states ( or a mating types) that the hap- MDM2 Murine double minute 2;
loid (budding) form of yeast can assume MDM2 is a nuclear phosphoprotein
for the purpose of mating. During mat- with an apparent molecular mass of
ing, diploid cells are formed by fusion of 90 kD that forms a complex with the
155
www.stemcell8.cn
mDNA
156
www.stemcell8.cn
metabolic disease
157
www.stemcell8.cn
metabolic pathway
158
www.stemcell8.cn
Michaelis-Menten constant
to methotrexate arises when the DHFR enzyme that catalyzes this reaction is meth-
mutates to a form that no longer responds ylmalonyl-CoA mutase, encoded by a gene
to methotrexate. However, it has been located at gene map locus 6p21.
shown that when methotrexate is added to
certain cell lines, resistance arises due to methyl tetrahydrofolate A form of
the amplification of the gene for DHFR, the B vitamin folic acid that acts as a
thus producing more copies of the protein. coenzyme in methyl group transferring
This phenomenon has been exploited by reactions in the synthesis of purines.
biotechnologists, and methotrexate is used
to amplify genes or parts of chromosomes methyl transferases A set of enzymes
cloned near the gene for DHFR. that catalyzes the transfer of methyl
groups from S-adenosylmethionine (SAM)
methyl-accepting chemotaxis proteins to another substrate, particularly nucleic
(MCPs) A class of bacterial transmem- acids or nucleic acid precursors.
brane proteins involved in chemotaxis.
The portion of the MCPs that extend into methylcellulose An inert polymeric
the bacterial cytosol becomes methyl- substance used to increase the density
ated when the portion of the protein that of culture medium to maintain growing
extends outside the cell binds an attractant microorganisms in suspension.
substance. However, it becomes demethyl-
ated if a repellent substance is bound. 5-methylcytosine (5MeC) A modified
form of cytosine to which a methyl group
methylation of nucleic acids The has been added by a methylase. These
addition of methyl groups to nitrogen modified residues are found at specific sites
atoms on the bases in nucleic acids. Meth- along the DNA and provide hotspots for
ylation of nucleic acids is known to serve transition type mutations. They are readily
at least three functions: spontaneously deaminated, resulting in the
(1) Methylation of the bases in DNA is conversion of 5MeC to thymine, leaving a
believed to be a mechanism for control- mispaired G-T base pair. On subsequent
ling gene expression (methylated DNA is DNA replication, one newly synthesized
not expressed). strand will contain the A-T mutation.
(2) Methylation of the 5 terminal gua-
nine in mRNA is required for the mRNA MHC See major histocompatibility
to be functional. complex.
(3) Methylation of restriction enzyme
sites in the DNA of bacterial cells that micelle A more or less spherical struc-
make restriction enzymes as a defense ture that amphipathic lipids spontane-
against invading bacteriophage; meth- ously assume when mixed with water. In
ylation of the sites on the bacterial DNA a micelle, the polar portion of the lipid is
prevents cleavage of the DNA by its own oriented outward in contact with the water
restriction enzymes. molecules, but the hydrophobic portions of
the lipids are in the interior of the spheroid.
methylmalonic academia An autoso-
mal recessive genetic disorder of the metab- Michaelis-Menten constant (K M) A
olism of any of four amino acids (methio- reaction rate constant pertaining to
nine, threonine, isoleucine, and valine) in enzyme-catalyzed reactions:
which the blood and body tissues become k1 k2
acidic. The acute form is characterized by E + S <-------------------> ES -----------------> E + P
drowsiness, coma, and sometimes seizures. k1
Over the long term, mental retardation may where
be a consequence. The metabolic defect E = free enzyme
is the inability to convert methylmalonyl- S = substrate
CoA to succinyl-CoA, which leads to the ES = enzyme-substrate complex
accumulation of methylmalonic acid. The P = product of the reaction
159
www.stemcell8.cn
Michaelis-Menten equation
160
www.stemcell8.cn
milk agent
resealed ER fragments
microtubule-associated proteins (MAPs)
(microsomes) A large class of proteins that is believed
to stabilize microtubules by binding to
Microsomes their tubulin subunits. Because MAPs
can bind to several tubulin molecules
at once, MAPs also accelerate the rate
sequences interspersed throughout the at which microtubules are polymerized
genome. See DNA fi ngerprinting. from the tubulin subunits. MAPs are also
believed serve as a binding material that
microsomes An experimental prepa- glues microtubules to other proteins and
ration derived by fragmentation of the cellular structures such as the chromo-
endoplasmic reticulum (ER); the small, some centromere.
roughly spherical bodies consisting of bits
of ER membrane that form spontaneously microvillus A fingerlike projection that
when animal cells are broken. Micosomes is actually an actin filamentfilled out-
are categorized as either rough or smooth pocketing of the cell membrane. Because
microsomes depending on whether they microvilli are especially abundant on
are derived from rough or smooth ER. The absorptive cells such as intestinal epithelial
experimental significance of microsomes cells, microvilli are thought to function as
stems from the fact that, whereas the intact a mechanism for increasing the absorptive
ER itself is difficult to isolate, microsomes surface area of the cell membrane.
are not and thus provide a convenient
means of studying ER function. migration-inhibitory factor (MIF) A
factor(s) produced by certain T cells after
microspikes Very thin (0.1 m diam- stimulation by an antigen that inhibits the
eter 510 m long), actin-containing chemotactic response in macrophages.
projections that protrude out of the mem-
brane of cultured animal cells. mil The oncogene of the chicken sar-
coma virus. Mil is believed to function as
microtiter agglutination test A mi- a serine kinase.
croscale test for the presence of an anti-
body or an antigen that is based on the milk agent Mouse mammary tumor
presence of a precipitate formed when an virus (MMTV), a retrovirus that causes
161
www.stemcell8.cn
milligram
162
www.stemcell8.cn
modafi nil
the recombined chromosomes are not percent of cases have mutations in MSH2
passed on to progeny. and about 60 percent of cases have muta-
tions in MLH1.
mitotic shake-off A method for ob-
taining a cell-cycle synchronized popula- MN blood group A group of red
tion of cells in tissue culture. The method blood cell surface glycoproteins (oligo-
depends on the fact that cells engaged saccharide derivatives of the protein gly-
in mitosis are not well attached to the cophorin) that form a blood group family,
bottom of the tissue culture vessel; there- distinguishable on the basis of naturally
fore, the subpopulation of cells that are occurring antibodies, which is distinct
easily detached by light shaking are, for from the ABO blood group.
the most part, those in mitosis. See syn-
chronous culture. mobile genetic element(s) Insertional
elements (IS).
mitotic spindle The microtubule part
of the mitotic apparatus. modafi nil A drug used to treat nar-
colepsy in which its activity is based on
MLH1, MSH2, and MSH6 Genes its ability to act as an agonist of recep-
involved in hereditary nonpolyposis tors for a class of neuropeptides known
colon cancer (HNPCC), a form of colon as orexins. Orexins stimulate wakeful-
cancer with an early age of onset that is ness and mood by binding to receptors
transmitted as an autosomal dominant. in a group of specialized neurons in the
There is a high frequency of association lateral hypothalamus. Modafi nil is also
with mutations in MLH1, MSH2, and currently being used to treat some of the
MSH6, three genes that code for proteins symptoms of Alzheimers disease and
involved in excision repairabout 35 depression.
Mitotic spindle
163
www.stemcell8.cn
molar
164
www.stemcell8.cn
mutagen
X chromosome is always active indicates also the centrosome in most cells, serves
that the cell population is of clonal ori- as a nucleation center for the polymeriza-
gin. This type of analysis has been used tion of microtubules.
to demonstrate that most tumors prob-
ably derive from a single cell. MuD phage A variant of the bacterio-
phage, Mu that has been engineered as a
mos oncogene An oncogene that is vector to be used for the determination of
found in a retrovirus that causes sarcoma promoter activity using the beta-galacto-
tumors in mice. The name is an acronym sidase gene as a reporter gene.
derived from: moloney sarcoma virus.
multidrug-resistant gene Genes that
MPF Maturation-promoting factor; a confer resistance to the lethal effects
factor isolated from the cytoplasm of of certain drugs, particularly chemo-
progesterone-stimulated Xenopus laevis therapeutic agents, for example, metho-
oocytes that was shown to stimulate mei- trexate. Multidrug-resistant genes arise
otic cell division in unstimulated oocytes through massive amplification of a single
when microinjected into the cytoplasm. copy gene and are present in homog-
The maturation-stimulating factor in enously staining regions or double minute
MPF was later shown to consist of a chromosomes.
cyclin B-cdk complex.
multilocus probes (MLP) A tech-
M phase The period of the cell cycle nique used in DNA profi ling in which
covering mitosis. M phase is divided into the DNA from an individual, blotted to
five subphases: prophase, prometaphase, a membrane (see Southern blot), is
metaphase, anaphase, and telophase. mixed with a probe under conditions that
will allow it to bind not only to the target
M-phase promoting factor A protein but also to similar sequences as well.
factor isolated from eggs of the frog, Xen-
opus laevis, that forces cells at any stage
multinucleate Having more than one
in the cell cycle into mitosis (M phase).
nucleus within the same cytoplasm. See
msr, msd Loci that code for an unusual heterokaryon and syncitium.
RNA-DNA hybrid molecule in which
RNA transcribed from msr is covalently mung-bean nuclease An enzyme that
linked to msd DNA. This type of struc- catalyzes the breakdown of single-
ture was fi rst discovered in myxobacteria stranded DNA into single nucleotides and
but has also been discovered in the soil short oligonucleotides that have phos-
bacterium Stigmatella aurantiaca. phate groups on their 5 ends.
165
www.stemcell8.cn
mutagenesis
166
www.stemcell8.cn
myxovirus
myeloid cell The collective term for all myoD One of a family of proteins,
classes of blood cells, not including T and referred to as myogenic proteins, that
B lymphocytes; that is, all bone marrow induces cells to differentiate into muscle
derived blood cells. cells. myoD exhibits the helix-loop-helix
motif characteristic of certain transcrip-
myeloma A tumor of the antibody tion factors and is believed to act, at least
secreting lymphocyte cells. Also known in part, by inducing the transcription of
as plasmacytoma. another mygenic gene, myogenin.
myeloma proteins An antibody mole- myoglobin The protein that carries and
cule of the Ig class secreted by a myeloma exchanges oxygen for CO2 in muscle tis-
tumor. Each myeloma antibody repre- sue. Like hemaglobin, myoglobin carries
sents the specificity of a single antibody oxygen on a heme group attached to a sin-
cell (monoclonal antibody). gle polypeptide (globin), but, unlike hema-
globin, is present only as a monomer.
myoblast Embryonic cells that fuse
with one another to form mature muscle myosin One of the two contractile pro-
cells. teins of muscle. Myosin bundles interdigi-
tate with actin bundles, and muscle con-
myoclonic epilepsy and ragged-red traction is the result of the two proteins
fiber disease (MERRF) A maternally sliding over one another.
inherited disorder of muscle functioning
caused by a mutation in the gene that myxobacteria Bacteria that normally
encodes lysyl tRNA, which in turn leads live in the soil as individual cells but that,
to malfunctioning of a number of other under conditions where nutrients become
important proteins in mitochondria (mi- limiting, form multicellular aggregates sim-
tochondrial encephalomyopathy) that impair ilar to primitive multicellular organisms.
the functioning of the electron transport
chain. The disorder is characterized by myxovirus A class of viruses that was
myoclonic seizures, ataxia, speech dif- identified and characterized on the basis
ficulty (dysarthria), hearing loss, and of their role in causing influenza. Myxo-
dementia. Biopsies of muscle show viruses are divided into two families:
ragged-red fibers. orthomyxoviruses and paramyxoviruses.
167
www.stemcell8.cn
N
A
168
www.stemcell8.cn
neuropeptide
verso
Y
169
www.stemcell8.cn
Neurospora
recto
Y2, Y3, Y4, Y5, and Y6. NPY binding aminobutyric acid (GABA; arousal relax-
to the Y3 receptor inhibits catecholamine ation), and serotonin (mood).
synthesis while the Y2 subtype causes
inhibition of catecholamine release. NPY neutral substitution A change in a
release stimulates appetite in a region nucleotide base in the coding region of
of the hypothalamus called the arcurate a gene that does not produce a change in
nucleus. The gene for NPY is located at the activity of the protein.
gene map locus 7p15.1.
neutrophil One of the three subclasses
Neurospora A genus of mold that has of white blood cells known as granulo-
been used as a tool in genetic experiments cytes, also known as polymorphonuclear
because it is normally haploid and because leucocytes (PMNs). Neutrophils contain
it forms a structure (the ascus) from which large multilobed nuclei and phagocytose
single-celled spores can be readily isolated. small invading organisms such as bacteria.
Neurospora crassa was the organism origi-
nally used to demonstrate that genes coded nick A gap in the sugar-phosphate
for individual proteins. backbone of a nucleic acid.
double-stranded
DNA
single-stranded nicks
Nick translation
170
www.stemcell8.cn
nondisjunction
verso
171
www.stemcell8.cn
recto
nonessential amino acid
172
www.stemcell8.cn
nuclear membrane
verso
173
www.stemcell8.cn
recto pore complex
nuclear
174
www.stemcell8.cn
nystatin
verso
175
www.stemcell8.cn
176
www.stemcell8.cn
orthophosphate
177
www.stemcell8.cn
osmolality
178
www.stemcell8.cn
179
www.stemcell8.cn
parasexual
180
www.stemcell8.cn
pentose
181
www.stemcell8.cn
peptidases
Peptide
182
www.stemcell8.cn
phagocytic index
peroxidase An enzyme that acts to pro- PFGE See pulsed field-gel electro-
mote the breakdown of hydrogen peroxide phoresis.
(H2O2) into water according to the reaction
peroxidase pH A measure of the acidity of an aque-
H2O2 + substrateH2 ---> 2H2O + substrateox ous solution; if the pH value of a solution
is below 7, the solution is considered acid;
peroxidase labeling The attachment solutions with a pH value above 7 are
of a peroxidase enzyme (e.g., horseradish considered alkaline.
peroxidase) to a probe so that the pres-
ence of the probe can be visualized by a phage Short form of bacteriophage (lit-
colorimetric reaction based on the activ- erally meaning bacteria eater), a virus
ity of the enzyme. that infects and then usually destroys the
bacterium that it infects. The destruction
peroxisome Small, self-replicating cyto- of the infected bacterium (the host) with
plasmic organelles that contain no DNA the release of progeny viral particles is
but are composed largely of the peroxi- the last step in the virus life cycle.
dase enzyme, catalase.
phage display A technique used to
peroxisome proliferator-activated re- search for proteins or peptides that will
ceptors (PPARs) PPARs are transcrip- interact with a target protein. A microtiter
tion factors that are activated by receptor- plate is bait-coated, or coated with target
mediated signaling pathways that activate protein. A library of possible interacting
COX enzymes. Three different PPAR iso- proteins or peptides is prepared by cloning
types are known: , and . The gene for DNA, which may encode those sequences
PPAR- codes for a product that regulates into a vector that places the DNA in a
the development of fat cells (adipocytes). gene for a phage head structure. When
The PPARs also function as receptors for the phage is grown, millions of phage par-
two classes of drugs: the hypolipidemic ticles will be produced, each displaying
fibrates and the thiazolidinediones. a different fusion product on its surface.
These phages are then portioned out into
PEST motif A sequence of amino the microtiter plate wells. When the plates
acids (Pro-Glu-Ser-Thr), discovered in are repeatedly washed the phages display-
the Notch protein but also present in ing an interacting peptide to the bait will
other developmentally important pro- stick to the well, and all other phages will
teins, that functions as signal for rapid be washed away. The phages can then be
proteolytic degradation. A number of eluted from the well and grown up to iso-
developmental processes are believed to late the peptide of interest.
be regulated in part by the destruction
of regulatory proteins at critical times in phagemid A cloning vector con-
development. structed with components from plasmids
and bacteriophages so that it can repli-
petite mutant A microorganism (espe- cate either as a plasmid or phage.
cially yeast and euglena) lacking mito-
chondria. In yeast, such mutants form phagocyte Any cell that normally carries
tiny colonies when grown on a nutrient out phagocytosis; usually applied to cer-
source low in sugar. tain white blood cells, for example, macro-
phages that carry out phagocytosis as part
P factors DNA sequences carried on of their function in the immune system.
various chromosomes in the male fruit
fly that bring about hybrid dysgenesis in phagocytic index An assay for the
matings with females of certain strains detection of phagocytic activity in a
(referred to M strains for maternal con- blood specimen. Among the tests used
tributing). See hybrid dysgenesis. for this purpose are staining by the dye
183
www.stemcell8.cn
phagocytosis
nitro-blue tetrazolium (NBT) that turns by the three letter code Phe or by the
blue when particles containing the dye single letter code F. Phenylalanine is also
are phagocytized or uptake of latex beads used in the body to make the neurotrans-
by phagocytic cells. mitter dopamine as well as adrenaline.
184
www.stemcell8.cn
phospholipid
ducing them and can only be expressed phosphodiesterase An enzyme that cata-
when the cells have reached a maximum lyzes the breakage of phosphodiester bonds.
biomass. Thus regulation allows the cells
to grow to the maxiumum density before phosphodiester bond A covalent bond
the toxic protein is expressed. that attaches a phosphate group to any
other group by an oxygen-atom bridge.
phorbol esters A class of compounds Phosphodiester bonds are the linkages
that act as tumor promoters. See TPA. that join the sugar molecules to one
another in the backbone of nucleic acids.
(deoxy)ribose
|
(deoxy)riboseOP=O
|
O
185
www.stemcell8.cn
phosphomycin
phosphomycin A phosphate-containing
antibiotic produced by streptomyces.
Phosphorylation
186
www.stemcell8.cn
phytochrome
visible color or generates some other type repeated a number of times to amplify the
of signal with high detectability. initial photocurrent so that extremely low
levels of light can be detected.
photoautotroph A photosynthetic or-
gan ism capable of living on only minimal photon The unit of light that represents
nutrients, that is, capable of making all one discrete packet of light energy.
its necessary biomolecules from simple
organic molecues. photophosphorylation The process in
which sunlight is used to produce ATP.
photoheterotroph A photosynthetic or-
ganism that is deficient in the ability to photoreactivating enzyme See DNA
make one or more of its essential biomol- photolyase.
ecules and therefore requires nutritional
supplements in its growth medium. photorespiration A salvage process that
occurs in plants under conditions of high
photolithography An automated tech- O2 and low CO2 concentrations, where the
enzyme responsible for fixing CO2 instead
nique for synthesizing oligonucleotides
takes up O2 and releases CO2.
at specific locations (spots) on a micro-
array. In photolithography individual
photosynthesis The process by which
nucleotides are added one at a time to
plants utilize light energy to create sugars
preexisting nucleotide chains by shining
and produce oxygen from carbon dioxide
light through a screen. The light activates
and water.
special light-sensitive nucleotides, caus-
ing them to form a covalent bond with
photosystem A cluster of chlorophylls
the free end of the nucleotide chain(s). An and other pigments that functions to cap-
ordered sequence of screens and activated ture the light energy that is used to carry
nucleotides programmed by computer out photosynthesis.
can generate thousands of oligonucle-
otides with defi ned sequences at specific phototaxis Movement toward light.
locations on the microarray.
phototroph An organism that is wholly
photolyases A group of light-activated, dependent upon light for nourishment via
direct DNA repair enzymes that catalyzes photosynthesis.
the repair of pyrimidine dimmers result-
ing from ultraviolet radiation. Photoly- phragmoplast The enlarged football-
ases use FADH 2 and a folate derivative shaped spindle that is seen toward the
(MTHFpolyGlu; methenyltetrahydrofolyl- end of mitosis in plant cells; the structure
polyglutamate) as coenzymes to repair in which the cell plate forms.
the dimers by reducing the pyrimidine-
pyrimidine bonds. phycomycetes A class of primitive
fungi that shares many features in com-
photomultiplier A photosensitive device mon with fungi.
that makes use of the phenomenon of pho-
toemission and secondary electron emis- phylogeny The construction of evo-
sion to detect low levels of light. Electrons lutionary trees based on relatedness of
emitted from a photosensitive material by organisms. DNA sequencing and the field
incident light are accelerated and focused of bioinformatics are making large con-
onto a secondary-emission surface (called tributions to the understanding of the
a dynode). Several electrons are emitted evolution of genes and organisms.
from the dynode for each primary electron
produced. The secondary electrons are phytochrome A pigment-protein that
then directed onto a second dynode where is believed to play a role in the initiation
more electrons are released. This process is of plant development when activated by
187
www.stemcell8.cn
phytohemagglutinin
light in the red or near-red part of the secretes a number of important polypep-
spectrum. tide hormones including follicle stimulat-
ing hormone (FSH), leutinizing hormone
phytohemagglutinin A class of pro- (LH), and prolactin, all of which play a
teins that causes clumping of red blood role in stimulation of the female repro-
cells (hemagglutination) by binding to ductive organs. The pituitary gland also
certain sugar chains on the cell surface; produces adrenocorticotropic hormone
also referred to as lectins. Examples are (ACTH), somatotropin, and thyrotropin.
concanavalin A and ricin.
pK, pKa Terms that represent the
phytotoxin Any of a number of highly strength of a chemical reaction; the
poisonous substances produced by plants. degree to which some reaction will pro-
ceed in the direction written, for example,
picogram 10 12 or 0.000000000001 A + B C + D. The negative logarithm of
grams. the equilibrium constant (log[K], where
K = [C][D]/[A][B]) for the chemical reac-
picornaviruses A class of RNA vi- tion.
ruses originally termed enteroviruses be-
cause they were initially discovered in plankton The small floating plant and
the intestinal tract. Currently, the picor- animal life in a body of water.
naviruses are classified into two sub-
classes: the enteroviruses (poliovirus, plaque A clear area in an immobilized
coxsackievirus, echovirus, and enterovi- carpet of bacteria that is produced by
rus) and the rhinoviruses (rhinovirus). local destruction of the bacteria in that
The name is derived from pico- (small) area by bacteriophages.
and rna to denote RNA.
plaque assay A means of determining
pilus A hairlike structure, found on the number of bacteriophage in a suspen-
donor type Escherichia coli, that is used sion by counting the number of plaques
in the attachment of donor-type cells (F+ produced in a certain amount of the sus-
and Hfr) to recipient cells (F ) to mediate pension. The results are usually expressed
the transfer of DNA during mating. Also as plaque forming units per milliliter of
called the sex pilus. suspension (PFU/ml).
188
www.stemcell8.cn
polarity
otic cell. The plasma membrane is similar plectonemic supercoiling A term used
in structure to the cell membranes of pro- to describe a type of supercoiling in which
karyotes and consists of a phospholipid the DNA supercoils are folded over them-
bilayer and an overlying extracellular selves to form branches. This type of struc-
layer of glycoproteins. ture is believed to represent a mechanism
by which DNA is compacted. In plectone-
plasma sol The protoplasm of a proto- mically supercoiled DNA, the length of the
zoan that is not in gel form. DNA mass is approximately 40 percent of
the length of the uncompacted DNA.
plasmid A piece of DNA in the cyto-
sol of bacteria that replicates indepen- pleiotropic Any agent, such as a hor-
dently from the bacterial chromosome. mone, having more than one effect or
Naturally occurring plasmids have been having an effect on more than one target.
found to carry a number of genes; per-
haps most important are the genes that pleomorphic Having variable form,
confer resistance to a number of anti- for example, variations in shape, behav-
biotics. Genetically engineered plasmids ior, or other characteristics of organisms
are important vectors for carrying re- of the same species.
combinant DNAs.
point mutation A change in a single
plasminogen activator An enzyme that nucleotide in a gene resulting in loss of
derives its name from the ability to catalyze function or altered functioning of that
the conversion of plasminogen to plasmin, gene.
which then catalyzes the breakdown of
fibrin, a major component of blood clots.
pol One of the three major genes of
The secretion of plasminogen activator is
retroviruses. The pol gene encodes the
a marker of cell transformation to a can-
protein for the viral enzyme reverse tran-
cerous or precancerous state. Plasminogen
scriptase.
activator is used as a therapeutic agent to
dissolve blood clots associated with block-
polar body A small cell that is pro-
age of the coronary arteries.
duced as a result of uneven separation of
plastid An organelle found in plant cytoplasm during meiois when an oocyte
cells that contain its own genome; chloro- is produced; the larger of the daughter
plasts are a type of plastid. cells becomes the oocyte.
189
www.stemcell8.cn
polar microtubules
190
www.stemcell8.cn
polymerase chain reaction
191
www.stemcell8.cn
polymerases
192
www.stemcell8.cn
presenilins
posttranslational import A process PWS was the first human disease based on
by which a certain class of proteins is the phenomenon of genomic imprinting in
brought into the interior of the endo- which genes are differentially expressed
plasmic reticulum (ER) either following depending upon the parent from which
or during its synthesis on ribosomes that the disease originated. DNA methylation
are bound to the ER; polypeptides that at cytosine bases may be the mechanism of
are to be imported are recognized on the this type of imprinting.
basis of the fact that they contain a small
sequence of amino acids known as a sig- precursor A substance from which
nal peptide at one end. another substance is made by a series of
sequential changes in molecular struc-
posttranslational modification Some ture.
alteration in the structure of a polypeptide,
for example, addition of a polysaccharide prednisone A synthetic steroid hor-
chain (glycolsylation), after it is synthe- mone used to reduce chronic inflamma-
sized and usually after it is imported into tion such as occurs in arthritis.
the interior of the endoplasmic reticulum.
Such modification is required for the poly- pre-mRNA The general term given
peptide to take on its biological activity. to that subclass of RNAs present in the
nucleus that will be processed to become
posttranslational processing Removal mature messenger RNA (mRNA) but that
of a specific end piece of a polypeptide has not yet undergone that processing.
known as the signal peptide, following its See posttranscriptional processing.
synthesis on ribosomes; one part of the
process of posttranslational import. preproinsulin A precursor of insulin.
Proinsulin, which is the immediate precu-
sor of insulin, is produced from preproin-
posttranslational transfer The import sulin by cleavage of preproinsulin, result-
of a polypeptide into the membrane of the
ing in the removal of a short polypeptide
endoplasmic reticulum or an organelle
portion.
after synthesis of the polypeptide (i.e.,
translation) is completed.
preprotein The polypeptide precursor
of a membrane-bound protein prior to
poxvirus A class of DNA viruses that its actual insertion into a membrane. Be-
produces transient infl ammatory skin cause the leader sequences of membrane-
lesions, for example, chicken pox and bound proteins are removed on insertion
smallpox. into the membrane, preproteins have
leader sequences.
Prader-Willi syndrome (PWS) A dis-
order caused by chromosomal deletion prenatal diagnosis The diagnosis
and/or disomy involving genes on the that a disease exists in a developing fetus
proximal arm of chromosome 15. The made on the basis of examination of cell
syndrome is characterized by obesity, or tissue samples taken from the fetus in
hypotonia, mental retardation, short stat- the womb.
ure, hypogonadotropic hypogonadism,
and strabismus. About 70 percent of the presenilins Two proteins (PS1 and PS2)
PWS cases show a deletion in the chro- found on the surface of neurons that have
mosome 15 region, 15q11.2-q13. Several been found to be involved in the develop-
genes possibly involved in the disorder ment of familial Alzheimers disease. The
have been mapped to this region, including presenilins act together with another pro-
a small ribonucleoprotein gene (SNRPN), tein (gamma-secretase) to cleave the amy-
type II oculocutaneous albinism (P gene), loid precursor protein that leads to the
and a ubiquitin-protein ligase (UBE3A). accumulation of amyloid plaques, causing
193
www.stemcell8.cn
Pribnow box
rapid deterioration of the central nervous prion A type of protein particle that is
system at an early age (<60 years). responsible for a number of neurodegenera-
tive diseases in humans and animals called
Pribnow box A sequence of bases in the transmissible spongiform encephalopa-
DNA that makes up part of the promoter thies (TSEs). The TSEs caused by prions
of a prokaryotic gene. The Pribnow box includes scrapie (in sheep), kuru (afflicting
occurs at 10 base pairs from the site at the cannibalistic For tribe in Papua New
which transcription starts and consists of Guinea), Creutzfeldt-Jakob disease (CJD),
the sequence TATAAT or a close variation. Chronic Wasting Disease, Fatal Familial
Insomnia (FFI), Gerstmann-Strussler-
primary culture The cell culture that Scheinker syndrome (GSS), and bovine
arises from a tissue specimen when it is spongiform encephalopathy (mad cow dis-
fi rst placed into culture. ease). The name prion is derived from the
descriptor proteinaceous infectious parti-
primary response The elicitation of an cle. Prions are unique as infectious agents
immune response to a foreign antigen after because they contain no nucleic acids.
an animal is first exposed to the antigen. The fi rst prion protein was discovered by
Stanley B. Prusiner, who was awarded the
primary stucture The sequence of Nobel Prize in physiology or medicine in
amino acids that make up a polypeptide. 1997. The infectious agent was named PrP
(prion-related protein) and it is believed
primase The enzyme that catalyzes the that the disease is caused by a change in
formation of short RNA primers that are shape of this protein (the altered version of
required to copy the DNA strand, start- the protein was called PrPSc) and that the
ing from the 5 end. misshapen protein can be transmitted
by inducing the same change in shape to
other nearby normal protein molecules.
primeosome A complex of prepriming
proteins and DnaG primase with a hairpin
fold of single-stranded DNA in the bac-
probe Any oligonucleotide that con-
tains a chemical label allows the oligo-
teriophage X174. This complex is the
nucleotide to be traced when the oligo-
structure in which synthesis of the RNA
nucleotide is annealed by hybridization
primers in Okazaki fragments occurs.
to some target nucleic acid. To a lesser
extent, any biomolecule including a pro-
primer A short oligonucleotide that tein, lipid, or polysaccharide that binds
anneals to a specific region on a DNA or to some target molecule and that bears
RNA strand and is used by a polymerase a chemical label that can be traced after
as a place to begin synthesis of a comple- binding has occurred.
mentary nucleotide strand.
processed pseudogenes Pseudogenes
primer extension A technique of map- that show a close similarity in nucleotide
ping genes in which a primer is annealed sequence to the mRNA for their active
to a DNA or RNA fragment and then counterparts. The existence of processed
extended, using an RNA or DNA poly- pseudogenes has been taken as evidence
merase (e.g., the Klenow fragment of that some pseudogenes were somehow
DNA polymerase I) and the four nucleo- originally derived from mRNAs.
side triphosphates to copy the nucleic acid
to which the primer is annealed. Primer pro-dynorphin/pro-enkephalin/pro-
extension is most commonly used to opiomelanocortin Precursor molecules
detect mRNAs that contain the primer that give rise to various opioid peptides by
sequence. proteolytic processing:
194
www.stemcell8.cn
prokaryote
pro-opiomelanocortin
signal peptide
-MSH met-enkephalin
Opioid peptides
195
www.stemcell8.cn
recto
prolactin
196
www.stemcell8.cn
protoplast fusion
verso
with a fluorescent molecule, and the pres- proteome A bioinformatics term used
ence of a protein that interacts with a to describe the proteins produced by all
certain transcription factor would then genes in a genome. The human genome is
be determined by a fluorescent signal at currently thought to contain a proteome
certain spot(s) on the chip. of ca. 30,000 proteins.
protein hydrolyzate The partial break- proteomics The field of study devoted
down product produced by heating a pro- to the study of the proteins that are
tein mixture or subjecting it to treatment expressed in different cell types. A major
with acid or proteases. technique employed in proteomics is the
comparative analyses of two-dimensional
protein kinase The class of enzymes that protein gels from different cell types or
catalyzes the transfer of a phosphate group from variants of a single cell type.
from one compound onto a protein.
prothrombin A blood protein that is
protein kinase C A protein kinase acted on to form thrombin.
embedded in the cell membrane that acts
as a signaling molecule by virtue of its prothymocytes Immature T cells that
ability to phosphorylate certain cytosolic are formed from stem cells in the bone
proteins on serine and threonine residues. marrow prior to the time they enter the
Protein kinase C is activated by ca++ ions thymus. Prothymocytes are recogniz-
together with diacylglycerol and tumor able by the presence of an incomplete
promoters such as phorbol esters. Acti- set of T-cell receptor proteins on the
vated protein kinase C is then believed to cell surface.
cause transformation to a cancerous state
by phosphorylation of as yet unidentified
proton gradient An uneven distribu-
protein(s).
tion of protons caused by the accumula-
tion of protons on one side of a membrane.
protein synthesis The process by Proton gradients are a means of storing
which amino acids are assembled into
energy for synthesis of ATP in mitochon-
peptides on ribosomes using the informa-
dria and chloroplasts.
tion supplied by a messenger RNA. Pro-
teins and nucleic acids are held together
by bonds that are susceptible to hydroly-
proton-motive force The amount of
sis, and their assembly is accomplished by energy stored in a proton gradient.
a reversal of the hydrolytic reaction. See
translation. proton pump A cluster of membrane-
embedded proteins that transports protons
proteoglycan A large aggregate of pro- from one side of membrane to the other.
tein that forms the core, and long poly-
meric saccharide chains that constitute proto-oncogene A normal cellular gene
the bulk. Hyaluronic acid, chondroitin that, when altered in a particular fashion
sulfate, heparan sulfate, dermatan sulfate, (activation), acts to induce a cancerous
and keratan sulfate are polysaccharides state.
commonly found in proteoglycans. Pro-
teoglycans are major components of the protoplast A plant cell or bacte-
extracellular matrix and other extracellu- rial cell in which the cell wall has been
lar structural components such as carti- removed, for example, by treatment with
lage. See GAG. lysozyme.
197
www.stemcell8.cn
recto
prototroph
198
www.stemcell8.cn
pyrogen
verso
199
www.stemcell8.cn
200
www.stemcell8.cn
R1 particle An intermediate stage in the RAG2) that catalyze the cleavage of DNA
formation of the 30S ribosomal subunit. segments within the immunoglobulin genes
An R1 particle is formed from a strand of that is the first step in immunoglobulin gene
16S RNA and 15 ribosomal proteins. rearrangements whereby different V (vari-
able) segments are linked with different J
racemate A mixture of two different forms (joining) segments to create a large spectrum
of a molecule that do not differ from each of immunoglobulin molecules with many
other chemically but that have a different different specificities. The RAG proteins
physical arrangement of atoms that can be dis- generate double-strand breaks at sites called
tinguished by methods using polarized light. recombination signal sequences (RSS) that
are present in both the V and J segments.
radial immunodiffusion An immuno-
logical test based on the reaction of an anti- Ramachandran plot For a given pep-
body with a protein that has been allowed tide, a graph that plots the angle of rota-
to seep out of a central well into a slab of tion around the bond between the alpha
agar where the reaction takes place. carbon and the carbonyl carbon () ver-
sus the angle of rotation around the bond
radioimmunoassay A sensitive test for between the alpha carbon and the amide
a particular protein, based on the reac- nitrogen (). This type of plot is used to
tion of that protein with an antibody give an idea of the combinations of bond
specific for it, where one of the reacting angles that occur in the peptide. This
agents is radioactively labeled. information can be used to help deter-
mine how the peptide is folded.
raf A protein intermediate in the signal-
transduction-cascade pathway initiated Raman spectroscopy A type of spec-
by receptor tyrosine kinase activation. In troscopy that measures the wavelength of
this pathway a ras-GTP complex binds inelastically scattered photons (i.e., scat-
to the N terminal end of cytosolic raf, tered photons whose wavelength is differ-
whose C terminal end has serine/threo- ent from that of the incident photons). The
nine kinase activity that acts to phos- scattering of light occurs at wavelengths
phorylate and thereby activate MEK, a that are shifted from those of the incident
MAP-kinase kinase (MAPKK). light by the energies of molecular vibrations
(bond stretching). Like infrared spectroscopy,
raf oncogene An oncogene that is Raman spectroscopy gives information about
found in murine sarcoma virus and that the type of bonds present in a compound but
is associated with fibrosarcoma tumors is different from infrared spectroscopy by
in both rodents and humans. The normal being able to see signals from bonds that are
homologue of the raf oncogene encodes perfectly symmetrical and therefore have no
the protein raf. raf is an acronym derived dipole. Raman spectroscopy is used in mak-
from rat fibrosarcoma. ing structure determinations of biomolecules.
201
www.stemcell8.cn
ras oncogene
Reading frame
202
www.stemcell8.cn
recombination
203
www.stemcell8.cn
recombinational repair
204
www.stemcell8.cn
replication eye
rel oncogene The oncogene product car- replica plating A procedure by which
ried by the avian reticuloendotheliosis virus bacterial colonies growing on one bac-
strain T (v-rel); the cellular product relA is terial plate are reproduced on a second
the p65 subunit of the NF-kappa B tran- bacterial plate in the exact relative posi-
scription factor, a member of the rel/NF- tions to one another as they were in the
kappa B family of transcription factors; original plate.
these transcription factors are critical media-
tors of immune and inflammatory responses. replication eye The opening cre-
In most cells NFkB is associated with IkB, ated between DNA strands as a result of
an inhibitory protein. A number of stimuli, unwinding of the DNA helix during the
205
www.stemcell8.cn
rel oncogene
membrane
cytoplasm
rel
(p65) IkB
p65-p50 dimer
nucleus
phophorylation of IkB
releases p65-p50 dimer
IkB P
translocation
of p65-p50
dimer to nucleus
activation of
transcription
nucleus
206
www.stemcell8.cn
response coefficient
replicon The exact site on the DNA at response coefficient A number that
which replication is actively taking place. gives a measure of how the rate of flow th-
See replication origin. rough a given biochemical pathway chan-
ges as a result of some outside influence
replicon fusion The meeting of two such as a hormone or change in the con-
replicons approaching each other from centration of an ion. The response coef-
opposite ends of replicating DNA. ficient (R) is made up of two components:
the sensitivity of the pathway to the en-
replisome The complex of factors that zyme (C) and the sensitivity of the enzyme
are active at a DNA replication fork. The to the outside influence (), R = C. If
207
www.stemcell8.cn
resting potential
208
www.stemcell8.cn
reverse transcriptase
Retrovirus
209
www.stemcell8.cn
recto transcription
reverse
reverse transcription The term that The presence of the Rh factor in a fetus
describes the action of the enzyme, whose mother is Rh may provoke a life-
reverse transcriptase. threatening agglutination of the fetal blood
cells. The term is named for the rhesus
rhesus blood groups Classification of monkey, the organism that was used to
blood cells according to whether or not demonstrate the presence of the antigen.
they react with antibodies to the blood There are at least 30 distinct subtypes of
cells of rhesus monkeys. Rh factor.
210
www.stemcell8.cn
rifampicin
verso
211
www.stemcell8.cn
recto
R loops
siRNA
dicer
enzyme
double-stranded RNA
small degraded
RNA fragments
degraded mRNA
212
www.stemcell8.cn
rRNA
verso
cess of protein synthesis: messenger RNA strands that are shortened into functional
(mRNA), transfer RNA (tRNA), ribo- tRNAs.
somal RNA (rRNA), and small nuclear
RNA (snRNA). RNase H An enzyme that cuts RNA
chains from within the chain, creating
RNA-DNA hybrid(s) A double- nicks in the phosphodiester backbone.
stranded hybrid molecule in which RNA This enzyme is used during production
is based paired with a complementary of cDNA. After the fi rst strand of DNA is
strand of DNA. made from the RNA template, Rnase H is
used to nick the template to create primer
RNA interference (RNAi) An experi- ends for second DNA strand synthesis.
mental technique for silencing expression
of a specific gene(s) through the use of RNA tumor virus A subclass of retro-
small double-stranded RNA (dsRNA) to viruses that produces cancers by activa-
specifically target an homologous mRNA. tion of oncogenes.
In this technique dsRNA, which is intro-
duced into a cell, is cleaved into small (ca. RNP Ribonucleoprotein.
23 bp) fragments by an enzyme called
Dicer. The small RNAs (called short ros oncogene An oncogene that is
interfering RNAs; siRNAs) are trig- found in a stain of avian sarcoma virus
ger molecules for the siRNA-Dicer com- and that is associated with sarcoma
plex to recruit other factors to form an tumors in birds. The name is an acronym
RNA-induced silencing complex (RISC). derived from Rochester 2 sarcoma virus.
The siRNAs in the RISC can base pair
with mRNAs that have complementary Rot In the annealing of RNA to DNA, a
sequences which are then also cleaved variable equal to the molar concentration
and degraded by RISC. of the RNA multiplied by time allowed
for RNA-DNA annealing. Rot values are
RNA maturase An enzyme involved generally used in plots of the annealing of
in the splicing of transcripts in the yeast RNA to complementary DNA sequences.
mitochodial cytochrome b gene. The See Cot value.
RNA maturase gene is unusual in that
part of the gene is found in an intron of rotavirus A class of RNA-containing
the cytochrome b gene itself. viruses that infects the intestinal tract
and is responsible for epidemic gastroen-
RNA polymerases The class of enzymes teritis and infantile diarrhea.
that catalyzes the synthesis of a strand of
RNA using DNA as a template to guide rough ER Endoplasmic reticulum cov-
the assembly of ribonucleotides so that the ered with attached ribosomes. Proteins
order of the purine and pyrimidine bases synthesized by the ribosomes on the
in the DNA template is precisely copied, in rough ER are destined to be transported
complementary fashion, in the newly syn- out of the cell via vesicles that are derived
thesized RNA. from the endoplasmic reticulum.
RNA secondary structure The hairpin Rous sarcoma virus (RSV) A retro-
folding of an RNA molecule caused by virus that produces sarcoma tumors in
internal base pairing of complementary chickens. RSV, discovered and named for
stretches of purine and pyrimidine bases. Peyton Rous, was the fi rst RNA tumor
virus discovered.
RNase D An exonuclease that removes
nucleotides from the 3 end of an RNA rRNA Abbreviation for ribosomal RNA,
in one-at-a-time fashion. RNase D is the RNA strands that are, together with
involved in the maturation of tRNAs the ribosomal proteins, the basic compo-
that are synthesized in large precursor nents of ribosomes. In eukaryotic cells
213
www.stemcell8.cn
recto
RTK
RTK
there are two major rRNAs denoted as rubella An RNA-containing virus (toga-
18s (found in the small ribosome subunit) virus) responsible for German measles.
and 28s (found in the large subunit).
rumen bacteria Bacteria that live in
RTK Receptor tyrosine kinase; a class the rumen of ruminant animals such as
of transmembrane proteins whose extra- cows. The rumen bacteria utilize urea
cellular domain functions as a cell sur- that would otherwise be excreted to make
face receptor; the cytosolic domain acts amino acids, that are then returned to the
as a tyrosine kinase. Binding of a ligand circulatory system of the animal.
to the receptor domain initiates the pro-
cess of signal transduction by activating Runting syndrome A pathological
the tyrosine kinase domain that, in turn, condition, characterized by skin lesions,
brings about a cascade of subsequent pro- diarrhea, and death, that results when the
tein phosphorylations, ultimately lead- lymphocytes from a mature animal are
ing to induction of transcription of genes placed in and then attack the tissues of a
involved in cell-growth regulation. newborn.
214
www.stemcell8.cn
A
S
S1 nuclease An enzyme that catalyzes for typhoid fever and a number of wide-
the breakdown of any single-stranded (or ranging intestinal disorders.
single-stranded region of a) nucleic acid.
saltatory movement The directed
S1 nuclease mapping A technique of movements of organelles in the cell cyto-
determining where, on a segment of DNA, plasm. This type of movement is thought
the precise location of the sequences from to be controlled by microtubules.
which a given RNA is transcribed.
saltatory replication Replication of a
S-100 (calgranulin) Pro-inflammatory DNA sequence that produce extra copies of
cytokines expressed by types of leukocytes the sequence along the same DNA strand.
called monocytes and granulocytes under This type of process is believed to have been
conditions of chronic inflammation; ele- responsible for the highly repeated, tandemly
vated levels of calgranulins are found in arrayed sequences seen in satellite DNA.
patients with cystic fibrosis. The calgranu-
lins are calcium-binding proteins that con- salting out The phenomenon of causing
sist of at least two different polypeptides, dissolved proteins or nucleic acids to precip-
designated A and B, coded for by genes itate out of solution by the addition of salts.
on human chromosome 1q12-q21. A cell-
surface receptor for S100A12, known salt stabilization A phenomenon whereby
as RAGE, interacts with a factor called slow denaturation of proteins and nucleic
ENRAGE (extracellular newly identified acids in aqueous solution is prevented by the
RAGE-binding protein) in endothelium, addition of salts.
mononuclear phagocytes, and lympho-
cytes and triggers the generation of key Sanger, Frederick (b. 1918) Discov-
pro-inflammatory mediators. erer of the first means by which the amino
acid sequence of a polypeptide could by
saccharide The biochemical term for a determined. Sanger is famous for the dis-
sugar. covery of the amino acid sequence of insu-
lin in 1954; he was awarded the Nobel
Saccharomyces cerevisiae A yeast Prize in chemistry in 1956.
that is widely used as a vehicle for cloning
extremely large segments of foreign DNA Sanger method A method for deter-
(see yeast artificial chromosome) mining the sequence of a polypeptide
and for molecular studies on many ani- based on determination of the identity of
mal genes that have homologues in yeast. the terminal amino acids of small sub-
fragments of the original polypeptide.
saline A solution of sodium chloride at
a concentration exactly equivalent (eight Sanger (dideoxy) sequencing A tech-
grams per liter; 0.8 percent) to that found nique for determining the sequence of a seg-
in bodily fluids. ment of DNA that utilizes synthetic nucleo-
tides (dideoxy nucleotides) to create small
Salmonella A group of Gram-negative, polynucleotides representing small subfrag-
rod-shaped bacteria that is responsible ments of the DNA that are to be sequenced
215
www.stemcell8.cn
recto
saprotroph
but that can be made to terminate specifi- of the trematode worms of the genus
cally at any one of the four purine or pyrim- Schistosoma. Schistosomaiasis is endemic
idine bases. See dideoxy sequencing. in the populations of Africa, the Middle
East, and South America.
saprotroph An organism that obtains
nourishment from nonliving matter. schizonte A subgroup of protozoa (spo-
rozoa) that reproduces asexually. Plasmo-
sarcoma-derived growth factor (SGF) dium is a schizonte that causes malaria.
A growth factor secreted by cells infected
with murine sarcoma virus, an RNA Schwann cells A type of brain cell
tumor virus. Because noninfected cells that encompasses the axon of a neu-
treated with SGF undergo changes gener- ron, thereby forming a sheath of myelin
ally characteristic of cells transformed into around the axon. The myelin sheath is
a cancerous state, sarcoma derived growth essential for proper transmission of nerve
factor is now referred to as transforming impulses between neurons. Multiple
growth factor (TGF). sclerosis is an example of a disease that
induces loss of muscle control by causing
sarcoplasmic reticulum A membranous demyelination of the axon.
structure that surrounds the myofibrils in
muscle tissue. The sarcoplasmic contains scintillation counter A sensitive device
calcium pumps that regulate the level of for detecting single emissions of particles
calcium ion (Ca++) in muscle tissue. produced by radioactive decay.
sarcosine A component of the antibiotic, screen A method developed to detect and/
actinomycin D, an inhibitor of transcription. or select a recombinant protein, mutant, inter-
Chemically, sarcosine is N-methyl glycine. acting protein, drug, hybridoma, and so on.
satellite DNA A type of DNA made up SDS Sodium dodecyl sulfate; a detergent
mostly of repeated sequences that are not widely used to dissociate biological mate-
transcribed into RNA and that are found rials into their component molecules.
near the chromosome centromere.
SDS-polyacrylamide-gel electropho-
satellite RNAs See virusoids. resis (PAGE) A variation of the poly-
acrylamide-gel electrophoresis technique
scanning electron microscopy (SEM) A
in which SDS is dissolved in the poly-
variation of electron microscopy in which the
acrylamide gel. This type of gel is widely
specimen is given a thin coat of metal so that
the electron beam can be used to visualize used to separate proteins in mixture from
details of the cell surface as opposed to inter- one another on the basis of size.
nal structures.
secondary culture The cell culture that
scatter plot A graph that shows the is derived from the original outgrowth of
relationship between two variables as a cells derived directly from a tissue speci-
set of data points. men (i.e., the primary culture).
216
www.stemcell8.cn
Sendai verso
virus
secretion The ability of the host cells that ture of oligonucleotides is passed through
produce recombinant proteins products to a column containing a matrix to which
release the products extracellularly. Large- the target molecule (for example, ATP)
scale production of recombinant proteins is attached. Oligonucleotides that bind to
requires the secretion of the product into the target will be retained on the column,
the culture medium for easy harvesting. while nonbonding oligonucleotides will
Vectors have been developed that fuse wash through the column. The retained
recombinant DNA protein products with oligonucleotides can be eluted and ampli-
sequences that will direct the proteins to the fied and passed through the column again
surface of the host cells. In addition, bacte- in order to select oligonucleotides with
rial hosts are being developed that more stronger binding affi nities to the target.
This is repeated multiple times to select a
easily secrete proteins than E. coli hosts.
few candidate oligonucleotides with very
high binding affi nities to the target.
segment polarity mutants Mutants of
the fruit fly, Drosophila melanogaster, in
which one of the halves of each segment self-assembly The spontaneous, unas-
(the P compartment) is replaced by the sisted assembly of the components of a
other half (the A compartment) so that complex structure, for example, the pro-
each segment contains two mirror images tein viral coat of tobacco mosaic virus.
of one of the normal halves.
self-protein Any protein that, as the
segments, segmentation A pattern result of immunological screening in early
that develops in the embryo of the fruit life, is determined to be self and there-
fly, Drosophila melanogaster, which is fore not recognized as a foreign antigen that
defi ned by indentations giving the embryo would be attacked by the immune system.
the appearance of stacked disks with Certain illnesses, referred to as autoimmune
each disk representing a segment. Vari- diseases, result from a failure of the immune
ous structures of the adult such as legs, system to recognize self-proteins.
antennae, wings, and eyes develop from
specific segments. Each segment consists self-tolerance The lack of an immune
of two halves: the A (anterior) compart- response to a self-protein.
ment and the P (posterior) compartment.
semiconservative replication The mode
selection The ability to detect a recom- of DNA replication in which each of
binant protein, mutant, interacting protein, the original parental DNA strands is
hybridoma, and so on. Selection techniques based paired with one newly synthesized
may make use of selective medium or spe- daughter strand. Experiments performed
cific markers on cells to be detected. by Matthew Meselson and Franklin
Stahl in the mid-1950s demonstrated that
selective medium A growth medium DNA replication was semiconservative as
that, either by the inclusion of a toxic opposed to conservative. This fi nding laid
substance or by the lack of an essential the foundation for future experiments
nutrient, promotes the growth of only cer- that ultimately elucidated the molecular
tain variant organisms in a population, for details of the process of DNA replication.
example, the growth of penicillin-resistant
bacteria on a nutrient agar that contains semidiscontinuous replication DNA
penicillin. See synthetic medium. replication involving the synthesis of many
small fragments that occurs on the lagging
SELEX Systematic evolution of ligands strand of double-stranded DNA in the
by exponential enrichment; an iterative form of Okazaki fragments.
technique for selecting oligonucleotides
that bind to certain target molecules Sendai virus A member of the para-
from a mixture of random oligonucle- myxoviruses that is used to induce cell
otides. In the SELEX technique, a mix- fusion, a technique for creating hybrid
217
www.stemcell8.cn
recto
sensitization
218
www.stemcell8.cn
serotonin
verso
serum The liquid part of blood from (TDF), which initiates sex determination in
which the blood cells have been removed males. Mutations in SRY give rise to XY
by clotting. females with a condition called gonadal
dysgenesis (Swyer syndrome), in which
serum albumin One of the most abun- there is gonadal degeneration leaving only
dant proteins in blood (albumin con- streak gonads of fibrous tissue and ovar-
stiutes about 50 percent of the plasma ian stroma. In these patients there is no
protein). Albumin has at least two main development of secondary sexual character-
functions: (1) to regulate water content istics at puberty. Part of the Y chromosome
of the tissues and (2) as a carrier of fatty containing SRY can also translocate to the
acids in the blood stream. X chromosome, which causes a condition
known as XX male syndrome.
serum globulins A group of abundant
blood proteins with wide-ranging func- SH2, SH3 domains Domains of
tions. The globulins are divided into the GRB2 protein that function to
three categories: alpha, beta, and gamma. mediate binding reactions of the signal-
Gamma globulins are the category that transduction protein, GRB2. The SH2
includes all the serum antibodies; the domain of GRB2 binds to the phosphory-
alpha and beta globulins form essen- latred tyrosine residues on the cytoplas-
tial complexes with various substances, mic domains of receptor tyrosine kinases
for example, lipids (these complexes are and the SH3 domains bind to the protein,
known as lipoproteins), carbohydrates SOS. The SH prefi x stands for Src Homol-
(mucoproteins and glycoproteins), iron ogy because of their homology to the src
(transferrin), and copper (ceruloplasmin). oncoprotein of rous sarcoma virus.
severe combined immunodeficiency shadowing The process of coating
(SCID) A group of inherited disorders a specimen with a thin layer of metal,
in which an individual lacks an immune
such as platinum or palladium, by heat
response due to a lack of infection-fighting
evaporation under a vacuum. Shadowing
lymphocytes. SCID is known in the pop-
is necessary to view surface detail of the
ular media as the bubble boy disease,
specimen under an electron microscope.
for David Vetter, a boy with SCID who
lived in a germ-free plastic bubble in the
1970s. There are several forms of SCID.
shaker mutation A mutation in a K+
channel in Drosophila that causes fl ies
One form is X-linked and so is most com-
carrying the mutation to shake uncontrol-
mon in males. In another form the condi-
lably under anesthesia. The K+ channel
tion is caused by a deficiency of the enzyme
adenosine deaminase (ADA). SCID mice was cloned from shaker mutants, and this
are widely used in research to carry tissue allowed critical experiments to be carried
xenografts from other animals, including out on how K+ channels function in the
humans, because their weakened immune generation of action potentials.
systems allow the tissue to grow without
being rejected. In this way the tissue can shikimate pathway A major biochem-
be studied while it is growing in an animal. ical pathway by which all the aromatic
See ADA. amino acids (tyrosine, phenylalanine, and
tryptophan) are synthesized from one
sex chromosome See X chromosome. parent chemical, shikimate.
220
www.stemcell8.cn
silencers
verso
221
www.stemcell8.cn
recto mutation
silent
greater than one kilobase away from the or because the effect of the mutation is
promoter sequences on which they act. masked.
silent mutation A mutation whose silent sites DNA nucleotide bases that,
effect is not manifest either because it when changed (for example, by muta-
occurs in a nonessential region of DNA tion), do not result in any change in the
222
www.stemcell8.cn
Smads
verso
amino acids in the polypeptide coded for site-specific drug delivery A tech-
by the DNA. nique for targeting drugs to certain tis-
sues. Various strategies may be employed
simian virus 40 A small DNA virus to accomplish this, for example, chemical
accidentally discovered as a contaminant linkage of antibodies to the drug mol-
in cultured African green monkey kidney ecule or attachment of the drug molecule
cells that are used to grow polio virus for to a ligand that is specific for a cell sur-
vaccine development. The virus was later face receptor. See fusogenic vesicles.
found to be oncogenic in mice although
not in humans or in its natural host. site-specific recombination Recombi-
nation between two DNAs that occurs at
simple sequence DNA DNA sequences a specific site on each DNA. Site-specific
that are extremely highly repeated th- recombination is exemplified by integra-
roughout the genome of an organism. tion of lambda bacteriophage DNA in
These highly repeated sequences that are which recombination takes place at a site
generally very short in length are referred designated as attP on the bacteriophage
to as simple sequences. DNA and the corresponding site (desig-
nated attB) on the bacterial host DNA.
sindbis virus A member of the family of
RNA-containing togaviruses (alphavirus
Skatchard analysis (plot) A math-
ematical method for estimating both the
group). Infection in humans and other
number of receptors for a certain ligand
mammals is via mosquitoes where varying
and the affi nity of the ligand for its recep-
degrees of encephalopathy are produced.
tor from a plot of the amount of unbound
ligand versus (bound ligand)/(free ligand).
single-locus probes (SLP) A tech-
nique used in DNA profi ling in which
skeletal muscle The relatively more-
the DNA from an individual, blotted to a
striated muscle tissue associated with
membrane (see Southern blot hybrid-
voluntary movement, for example, in the
ization) is mixed with a probe in a series
movement of the limbs.
of sequential tests that will detect a single
sequence. Usually, only two bands are
ski oncogene The oncogene carried by
detected at each stage of the test.
a strain of avian sarcoma virus, it derives
it name from Sloan-Kettering Institute,
sis oncogene An oncogene that is where it was discovered. The oncogene
found in simian sarcoma virus and that is was identified on the basis of its ability to
associated with sarcoma tumors in both transform cultured cells to a cancer-like
monkeys and cats. The name is an acro- state. ski has subsequently been shown to
nym derived from simian sarcoma. The cause non-muscle cells to differentiate into
sis oncogene protein is virtually identical skeletal muscle. The proteins encoded
to one of the subunits of platelet-derived by ski regulate transcription of genes by
growth factor (PDGF). forming complexes with various tran-
scription factors, including NF-I, Smad2,
sister-chromatid exchange The ex- and Smad3. The ski proto-oncogene
change of material between the two (c-ski) gene map locus is 1q22-q24.
daughter strands of a replicated chromo-
some (i.e., chromatids) during meiosis; Smads Signal transduction elements
recombination occurring at the chromo- associated with signaling by TGF recep-
somal level. tors. Binding of members of the TGF fam-
ily of growth factors to their receptors
site-directed mutagenesis The tech- causes Smads on the cytosolic side of the
nique by which specific bases on a seg- membrane to become activated by phos-
ment of DNA are experimentally altered. phorylation. Activated Smads form dimers
223
www.stemcell8.cn
recto proteins
SMC
that migrate into the cell nucleus, where fusion of a transport vesicle with the
they activate transcription of certain tar- Golgi.
get genes. Smads fall into classes: R-Smads
(those activated by phosphorylation by SNARES A family of proteins that
the kinase domains of receptors), I-Smads mediate the fusion of synaptic vesicles
(inhibitory), and Co-Smads. The R-Smads with the synaptic membrane during the
are comprised of Smads 1, 2, 3, 5, and 8. process of neurotransmitter release. The
Smads 2 and 3 are involved in signaling SNARES present on the surface of the
via the TGF- family, and Smads 1, 5, and synaptic vesicle are called v-SNARES, and
8 respond signaling via the BMP subfam- those on the cell membrane are called t-
ily of growth factors. Smad4 is a co-Smad.
SNARES. During synaptic fusion, the
The R-Smads and Co-Smads contain
v-SNARES and t-SNARES bind to one
two conserved structural domains: MH1
another together with a protein called
(MAD Homology domain) and MH2.
SNAP25 to initiate the fusion process that
Phosphorylated R-Smads form complexes
with the Co-Smad, Smad4. The MH1 releases neurotransmitter. The SNARE-
domain of the R-Smads is responsible for SNAP25 complex is targeted by the toxin
the DNA-binding activity of the complex, of the bacterium Clostridium botulinum.
while the MH2 domain is involved in
interaction with the receptor. snRNA Small nuclear RNA; a very short
piece of RNA that complexes with a set
SMC proteins Structural maintenance of proteins (snRNPs) to form a structure
of chromosomes; a family of proteins that whose function is to clip out loops in other
are involved in chromosome condensation, RNAs, particularly for splicing of RNAs
sister-chromatid cohesion, DNA repair, that are destined to become mRNAs
and recombination. There are six core
SMCs in eukaryotes (SMC1SMC6) that sodium-potassium pump A special-
form functional complexes with other pro- ized transmembrane protein that pumps
teins. The cohesin complex contains SMC1 sodium ions out of the interior of the
and SMC3 (together with cohesin proteins cell and at the same time pumps potas-
Scc1 and Scc3), which is needed for sister- sium ions into the cell. Although sodium-
chromatid cohesion during mitosis. The potassium pumps are found in a variety
SMC1 and SMC3 also forms a complex of cell types, they especially abundant in
with DNA polymerase and ligase III that nerve cells where they serve to establish
mediate recombination. SMC2 and SMC4 an electric potential across the membrane
are components of the condensin complex, that is the basis of nerve impulse transmis-
which functions in the process of chromo- sion.
some condensation during mitosis. The func-
tions of SMC5 and SMC6 are not known,
although SMC is believed to be involved in soma A term for the entire body of an
recombination-based DNA repair processes. organism without reproductive cells.
224
www.stemcell8.cn
spectrin
verso
225
www.stemcell8.cn
recto
spermatids
226
www.stemcell8.cn
Spliceosome
227
www.stemcell8.cn
recto
src
lication and without the action of muta- START A point in the G1 phase of the
genic agents. yeast cell cycle that represents the com-
mitment of the cell to transit into S phase.
src The oncogene that is carried by the See CLN1, CLN2, CLN3.
Rous sarcoma virus that produces sarco-
mas in birds. The product of the src gene STAT Signal transducers and activators
is a phosphorylated protein denoted as of transcription; a class of transcription fac-
pp60. The src protein is a tyrosine kinase tors that constitute one of the main compo-
and is believed to cause transformation nents of the JAK/STAT signaling pathway.
as a result of its ability to carry out phos- STATS are activated by phosphorylation
phorylation of critical proteins. catalyzed by JAKs. Once activated, STATS
dimerize and move into the nucleus, where
SSCP Single strand conformation poly- they bind to specific sequences in the pro-
morphism; an analytical technique for moters of target genes whose transcription
determining the presence of changes in is subsequently induced.
nucleic acid primary structure by observ-
ing the rate of migration of nucleic acid statins A class of drugs that lower the
fragments in a gel where the nucleic acids levels of cholesterol in the blood by inhib-
are kept in a denatured state by chemicals iting the pathway by which cholesterol is
such as urea or formamide. This technique synthesized in the liver. The statins have
is highly sensitive to changes in nucleotide structures similar to mevolonate, the nor-
sequence and is frequently used to analyze mal substrate of the enzyme HMG-CoA
genes for the presence of small mutations. reductase, which controls the key step
in cholesterol biosynthesis. The statins
staggered cut A term applied to the type therefore inhibit cholesterol biosynthe-
of cleavage of DNA molecules produced sis by serving as competitive inhibitors of
by most restriction enzymes in which one HMG-CoA reductase. Zocor, Pravacol,
end (usually the 5 end) protrudes past the Mevacor and other pharmaceutical statins
cut end of the other strand. are chemically modified versions of statins
that were originally derived from fungi.
standard deviation A statistical value
given by the square root of the variance of stationary phase The point at which,
a set of experimental values. This quantity in a bacterial culture, the cells become
is a measure of the average amount each so numerous that the nutrient sup-
experimental value or observation in a ply is exhausted and growth ceases. See
series differs from the mean of that series. growth phases.
228
www.stemcell8.cn
stereoisomer
verso
STE genes A family of genes whose potent, that is, have the capability to give
products function as part of a signal- rise to all the different cell types character-
transduction cascade to mediate mating in istic of the different body tissues. Modern
yeast; the STE designation is derived from stem-cell research focuses on identifying
the word sterile to indicate the fact that the signals that can cause stem cells to dif-
mutations in these genes result in sterility ferentiate into a particular cell type. If such
in yeast. STE2 and STE3 are receptors for signals can be found, it is believed that
mating pheromones in the and a mating stem cells can then be used to replace dam-
types, respectively. Other STE proteins are aged tissues seen in a number of conditions
components of G proteins or function as such as Alzheimers disease, Parkinsons
protein kinases. STE12 is a transcription disease, spinal cord injuries, and others.
factor. See KSS1, FUS3.
stem-loop structure A structure form-
stem cell Any cell that, in a tissue, is ed by nucleic acids, but particularly
itself immature but gives rise, through cell RNAs, in which a segment of the
division, to cells that become the mature nucleic acid strand base pairs with a dis-
form of the cells that characterize the tant complementary sequence; the base-
tissue. The marrow in bone is a classic paired sequences form the stem and the
example of stem cells that give rise to the sequences intervening between the base-
mature differentiated blood cells, includ- paired regions form the loop.
ing red blood cells, macrophages, and the
antibody-producing cells of the immune stereoisomer A form of a molecule
system. However, only the completely involving different arrangements of atoms
undifferentiated stem cells derived from or molecules around a central atom, usually
embryos (embryonic stem cells) are toti- carbon in biomolecules. Stereoisomers are
Stereoisomer
229
www.stemcell8.cn
recto
sterile
also referred to as optical isomers because effects of the nerve impulse from another
crystals of stereoisomers cause polarized neuron.
light to slant in ways that are characteristic
for each stereoisomer. See dextrorota- stock culture A culture of cells that
tory isomer and levorotatory isomer. serves as a common source of cells for
experimental purposes.
sterile Completely free of living material.
stop codon A sequence of three nucle-
sterilization The process by which otide bases that do not represent the code
objects or liquids are made sterile, usu- for an amino acid but serve as signals for
ally for the purpose of preventing disease, the termination of translation by the ribo-
infection, or contamination. Common some. There are three RNA stop codons:
methods of sterilization include heating UAA, UGA, and UAG.
to temperatures above 125C and pro-
longed exposure to ultraviolet light.
stop-transfer signal For preproteins
that are to be inserted into, but not com-
steroid A class of potent hormones pletely through, a membrane, a stop-
derived from cholesterol. Cortisone and transfer signal is a group of amino acids
the sex hormones, estrogen and testoster- on the polypeptide that serves as a signal
one, are examples of steroid hormones. to stop its movement at a time when the
polypeptide is properly positioned in the
sticky ends The single-stranded ends of membrane.
any two nucleic acids whose nucleotide
base sequences are complementary to one strand displacement A variant of the
another. normal mechanism of DNA replication
in which replication of one of the DNA
stimulatory neuron A neuron that, strands proceeds from opposite ends of a
when stimulated, functions to enhance the linear DNA molecule.
Strand displacement
230
www.stemcell8.cn
stress-activated kinases
verso
cellular
stress
MEKK1
SEK1 or MKK7
SAPK
jnk
nuclear
translocation
jnk
c-jun
(gene transcription)
Stress-activated kinases
231
www.stemcell8.cn
recto fibers
stress
naling that are activated by a variety of stroma 1. The space between the grana
environmental stressors such as ultravio- and the chloroplast membrane that con-
let irradiation, toxic chemicals, oxida- tains some of the enzymes of the dark
tive conditions, hypoxia and anoxia, heat reaction in photosynthesis as well as the
shock, inhibitors of protein synthesis, chloroplast RNA and DNA.
and inflammatory cytokines. Activated 2. The connective tissue underlying the epi-
SAPKs bind to, and phosphorylate, the thelial cell layer, for example, in skin, the
N-terminal domain of the c-jun transcrip- digestive tract, and the airways in lung.
tion factor, which subsequently translo-
cates to the nucleus, where it upregulates
structural gene A gene in an operon
the expression of genes involved in vari-
that codes for the functional protein that
ous stress responses. The SAPKs are acti-
is essential to the metabolism of the bacte-
vated by the upstream factors SEK1 and
rial cell, for example, an enzyme, as dis-
MKK7. There are three SAPK genes: ,
, and that code for 810 isoforms by tinguished from the genes for a repressor
alternative splicing mechanisms. protein that controls the expression of a
structural gene.
stress fibers The fibrillar arrays that are
seen on the surface of a cell that is ori- STS Sequence tagged site; a means of
ented parallel to the direction in which a cataloguing sequence data by record-
cell is moving. Stress fibers appear to be ing only that part of the whole sequence
directly related to cell movement in that necessary to create primers that can be
they are known to coincide with the actin used to amplify the entire sequence from
filaments. a DNA sample by the polymerase chain
reaction (PCR).
stress proteins Proteins encoded by
heat-shock genes and expressed when the stuffer region That part of the lambda
cell undergoes stress conditions, such as phage that can be replaced by foreign
a rise in temperature or exposure to cer- DNA and still reproduce so that the
tain chemicals. Many of these proteins phage can be used as a cloning vector.
are chaperons that aid in maintaining the
structure of the protein under conditions subcutaneous Just underneath the skin;
of denaturation. as in subcutaneous injections.
stringency The conditions of tem- substrate Any one of the reacting chem-
perature and ionic strength used dur-
icals in an enzyme-catalyzed reaction.
ing nucleic acid hybridization methods,
for example, northerns or Southerns, to
ensure proper binding of the probe to its substrate analogue A chemical that is
target. Low stringency conditions allows similar in form to a particular substrate
for the probe to bind with less specific- but that does not participate in the chem-
ity to targets; high stringency conditions ical reaction of the substrate. Substrate
only will permit very specific binding of analogues used for various purposes such
probe to its target. as inhibition of certain enzyme systems
or for studying the mechanism of enzyme
stringent response A bacterial response action. See competitive inhibition.
to conditions of nutritional deprivation in
which expression of nonessential genes is substrate channeling The direct trans-
shut down. A stringent response involves fer of intermediates from one enzyme
a rapid downregulating of certain bacte- to the next in multienzyme complexes. For
rial biosynthetic pathways (e.g., synthesis example, the pyruvate dehydrogenase com-
of ribosomal and transfer RNAs) when plex processes pyruvate into acetyl CoA by
the amino acid supply becomes limited. a series of enzymatic reactions catalyzed by
See alarmones. five separate enzymes in a large complex.
232
www.stemcell8.cn
sugar
verso
Sugar
233
www.stemcell8.cn
recto
supercoiled DNA
234
www.stemcell8.cn
neurotransmitter
vesicles
v-SNARE
SNAP25
t-SNARE
synaptic membrane
complex of v-SNARE,
t-SNARE, and SNAP25
membrane fusion
235
www.stemcell8.cn
recto
synaptophysin
236
www.stemcell8.cn
A
T
237
www.stemcell8.cn
rectopolymerase
Taq
responsible for transformation of the cells for so-called cell-mediated immunity, the
to a cancerous phenotype. immune function directed toward detect-
ing and destroying foreign cells rather
Taq polymerase A DNA polymerase than foreign proteins.
isolated from the thermophilic bacterium
Thermus acquaticus. T-DNA A term for the Ti plasmid car-
ried by Agrobacterium, a parasite that
tariquidar (XR9576) An experimen- induces various plant tumors. The tumors
tal drug used to inhibit the ability of are a direct result of expression of the
cancer cells to become resistant to che- genes carried by Ti in the plant cells.
motherapeutic agents (multidrug resis-
tance). Tariquidar acts by binding to a teichoic acid A long polymer of glyc-
membrane glycoprotein known as P-gp erol or ribitol molecules linked together by
(P-glycoprotein pump), a transmembrane phosphate groups. Teichoic acid is a struc-
protein that acts to pump administered tural component of the outer cell wall of
anticancer drugs out of the tumor cell. Gram-positive bacteria. See Gram stain.
The binding of tariquidar blocks the
ability of P-gp to act as a pump, thereby telomere(s) Special tandemly arranged,
allowing the chemotherapeutic agent to guanine-rich, repeated sequences that
be retained in the cell. prevent loss of DNA at the end of a DNA
strand during chromosome replication
tastin A cytoplasmic cell-adhesion mol- and so are required for faithful replica-
ecule that, in combination with bystin, tion of the DNA in a chromosome.
forms part of the machinery that medi-
ates the process by which the embryo telomeric sequences Special sequences
attaches to the wall of the uterus. on the ends of DNA strands that are
required for synthesis of the terminal seg-
TATA box Another name for the Prib- ments of the lagging strand. Telomeric
now box. sequences are present on the ends of chro-
mosomes (the telomeric region) and are
tautomerism The rapid and continual used in the construction of yeast artificial
transition between different forms of a mole- chromosomes (YACs).
cule based on delocalization of an electron(s)
on different atoms of the molecule. telophase The stage of mitosis in which
the new cell membrane that divides the
taxol A plant alkaloid that stabilizes daughter cells forms (the cell plate) and chro-
microtubules, thereby freezing cells in mosomes reform into diffuse chromatin.
mitosis. Because cancer cells are rapidly
dividing cells, taxol is currently being temperate phage A bacteriophage that
used as a chemotherapeutic agent. is capable of establishing lysogeny in a
host rather than undergoing a normal
taxonomy The science of classification. lytic cycle.
238
www.stemcell8.cn
verso
TGF
Terminal redundancy
239
www.stemcell8.cn
recto
thalassemia
thalassemia A disease that results from term is usually applied to genes and/or
a mutation, often a deletion of DNA their products whose activity is rapidly
within the gene, that causes a reduction increased when the temperature rises by
or complete loss of expression of one or several degrees higher than optimal for
both of the globin proteins (alpha or beta), the growth of the organism.
resulting in gross defects in hemoglobin
function that may be fatal. The thalas- thermophile An organism that thrives
semias are examples of genetic disease at high temperature.
brought about by uneven crossing over.
theta structure The term used to
thalassemia, A type of thalassemia describe the structure formed when a cir-
cular, double-stranded DNA molecule is
affecting the biosynthesis of the globin
engaged in replication proceeding in both
chain of hemoglobin. Some thalasse-
clockwise and counterclockwise direc-
mias have been found to be due to defects
tions from the same starting point.
in gene regulation such as RNA process-
ing in the nucleus and so have provided thiamine Also known as vitamin B1.
important insights into mechanisms of An important cofactor for the reactions
the control of gene expression. involved in the O2 dependent oxidation
of sugars (respiration) in energy (ATP)
thermogenin (uncoupling protein) A production.
protein that forms a channel in the inner
mitochondrial membrane for the passage thiazolidinediones A class of drugs
of protons from the cytosolic side of the that lowers the levels of fatty acids in the
membrane into the mitochondrial matrix. blood. Thiazolidinediones act by binding
Because the path of proton flow using to and activating PPAR, which, in fat tis-
this channel bypasses the FoF1 ATPase, sue, leads to the induction of the enzyme
energy from the oxidation of fats and phosphoenolpyruvate carboxykinase. This
sugars is released in the form of heat that in turn diverts pyruvate away from fatty
is used to raise body temperature. acid synthesis.
Theta structure
240
www.stemcell8.cn
thymosin
verso
ecules on the basis of their differing solu- light-reacting pigments and other compo-
bility in various solvents. The sensitivity nents of the light reaction in photosyn-
of the technique derives from running the thesis; these components are contained in
sample on a thin, inert matrix to maintain the membrane of the thylakoid disk.
the sample in a concentrated form.
thymectomy Removal of the thymus by
thiol The sulfur containing analog of surgery. A procedure frequently performed
an alcohol (OH) group. for the purpose of rendering an animal
unable to mount an immune response to
thiostrepton An antibiotic that acts by foreign cells, for example, tissue grafts or
blocking a critical step (translocation) in lymphocytes from another animal.
protein synthesis (i.e., translation) by bind-
ing to the large subunit of the ribosome. thymic nurse cells (TNC) Cells that
engulf developing T lymphocyes to edu-
6-thioguanine A purine derivative cate the lymphocytes. Once the T cells
that is acted on by the enzyme hypoxan- are released from the TNC, they possess
thine-guanine phosphoribosyl transfer- the appropriate receptors to interact with
ase (HGPRT) to form a toxic compound. foreign cells that invade the body.
For this reason, 6-thioguanine is used
to select cells that contain low levels of thymidine A pyrimidine base attached
HGPRT. See HAT selection. to the deoxyribose sugar in deoxyribo-
nucleotides.
1-thiouridine An unusual pyrimi-
dine base that is found only in tRNA. thymidine kinase An enzyme that
Thiouridine is derived from uridine by catalyzes the major step in the formation
the replacement of an oxygen atom with of TTP from thymine. Because this path-
sulfur. See transfer RNA. way is the only means by which thymine
or thymine analogs can enter into nucleic
threonine An amino acid that, like serine acids, manipulation of this enzymatic
and tyrosine, contains an OH group on its step provides an important experimental
side chain. For this reason, threonine serves tool for studying gene action by the incor-
as a site of phosphorylation in proteins. poration of modified bases into DNA.
241
www.stemcell8.cn
recto
thymus
242
www.stemcell8.cn
verso
trans
243
www.stemcell8.cn
recto acting
trans
as changes in gene expression caused by therefore, proteins to enter into the same
an agent acting on the gene from a dis- biochemical pathway by which sugars are
tance (e.g., a hormone). oxidized for energy (i.e., ATP) produc-
tion. See transaminase.
trans acting Pertaining to a genetic
element exerting an effect on a target transcellular transport A mechanism
that is located on a physically separate for carrying certain substances from one
unit. For example, a gene coding for a side of a cell to the other. This type of
regulatory protein is said to be trans transport is the means by which sub-
acting with respect to the genes it con- stances (for example, glucose) move
trols because the target genes may be across the epithelial cells that line the
located on DNA strands or even chro- intestinal tract to the bloodstream.
mosomes at some distance from the reg-
ulatory gene. transcription The process of making
an RNA complementary to a strand of
transamination A type of biochemi- DNA. In transcription, an RNA poly-
cal reaction that allows amino acids and, merase, using the order of nucleotide
DNA TATA
TFIIB
TFIIF
RNA polymerase
TFIIE
TFIIH
TFIID
TFIIF
TFIIA TFIIB
TBP RNA polymerase
TFIIH TFIIE
244
www.stemcell8.cn
transforming growth factor
verso
bases present in the DNA template as a of methyl groups from one molecule to
guide, assembles nucleotides from the another.
four ribonucleotides (ATP, CTP, GTP,
and UTP) to create the RNA strand. transferrin A plasma protein that car-
ries iron in the blood. Transferrin trans-
transcription factor A protein or hor- fers the bound iron to the appropriate
mone that binds to a certain sequence cells via a special cell surface receptor.
on the regulatory region of a gene at the
promoter or the enhancer and either transfer RNA (tRNA) A type of
turns on transcription, enhances tran- RNA that recognizes the codon on the
scription (up-regulation), or inhibits tran- mRNA during the process of transla-
scription (down-regulation). tion and brings the proper amino acid
(attached to it) into close proximity to
transducin An alternative term for G the end of the peptide chain being synthe-
protein. sized so that the amino acid can be added
to the peptide chain. The tRNA molecule
transducing phage A bacteriophage is folded so that a group of three nucleo-
tides complementary to the codon in the
that, during its normal replicative cycle,
middle of the molecule (the anticodon)
occasionally packages some of the DNA
is exposed, while the end of the tRNA
from the host into the bacteriophage head,
is used for attachment of the amino acid
along with the normal bacteriophage
that corresponds to the codon. See adap-
DNA. The DNA so packaged can then be
tor molecules.
carried from the previous host and intro-
duced into a new host that is infected by
transformation, cancerous or neo-
the transducing bacteriophage.
plastic The process by which a normal
cell comes to attain the characteristics
transduction The term for the process of a cancerous cell. Because the actual
of carrying sections of DNA from one
transformation process cannot be direct-
bacterial cell to another by a transducing ly observed, steps in the process are
bacteriophage. inferred by the expression of certain
properties that cells taken from tumors
transfection The technique of intro- exhibit when grown in culture (e.g., the
ducing DNA into eukaryotic cells. ability to grow without being attached to
Transfection is the process homologous a solid surface and lowered dependence
to transformation in bacteria. Trans- of growth on serum).
fection encompasses a number of tech-
niques that utilize different principles transformation, DNA The process of
to introduce the DNA including electro- introducing foreign DNA into bacteria.
poration and precipitation by calcium See competence.
phosphate.
transforming growth factor (TGF)
transfer factor An as yet unidentified Any of a group of proteins secreted by
factor extracted from living T cells that, transformed cells that can stimulate the
when taken from one human and injected growth of normal cells. Transforming
into another, induces some of the cell- growth factor alpha (TGF or TGF-A)
mediated immunity that was present in binds the epidermal growth factor recep-
the donor. tor (EGFR) and stimulates the growth
of endothelial cells. TGF is produced
transferase A class of enzymes that by macrophages and keratinocytes and
catalyzes the transfer of a chemical is secreted at high levels by some human
group from one substrate to another, for tumors. Transforming growth factor beta
example, methyl transferases for transfer (TGF or TGF-B) has two subtypes 1 and
245
www.stemcell8.cn
recto
transgenic animal
246
www.stemcell8.cn
transposon
verso
247
www.stemcell8.cn
recto
transvection
Transposon
248
www.stemcell8.cn
tunicamycin
verso
triskelion A subunit of the clathrin are critical regulators of cell growth that
coat of coated pits. The triskelion is are believed to act as negative regulators
named for its tripartite structure consist- of S6 kinase 1 (S6K1) and eukaryotic
ing of three light and three heavy poly- initiation factor 4E binding protein 1
peptide chains. (4E-BP1).
Triton X-100 A nonionic detergent tubulins Two proteins (alpha and beta)
used for the biochemical isolation of cell of about 55,000 daltons each that consti-
membranes and nuclei. tute the subunit proteins of microtubules.
tuberous sclerosis complex (TSC) tumor virus Any virus that induces the
An inherited genetic disease of organ sys- formation of a tumor in the tissue that it
tems, particularly the brain, skin, heart, infects.
lungs, and kidneys. This can result in
epilepsy, learning and behavioral dif- tunicamycin An antibiotic isolated from
ficulties, skin and renal lesions; kidney Streptomyces lysosuperfi cus that inhibits
complications can include cysts, polycys- the synthesis of N-linked glycoproteins.
tic renal disease, and renal carcinoma. Tunicamycin is a structural analog of
Tuberous sclerosis complex is caused UDP-N-acetylglucosamine (UDP-GlcNAc)
by mutations in the tumor suppressors that acts as a competitive inhibitor of the
hamartin (located on chromosome 9q34) critical reaction between UDP-GlcNAc
and tuberin (located on chromosome and Dolichol phosphate, the fi rst step in
16p13.3) that are encoded by the genes the process of N-glycosylation. Tunica-
TSC1 and TSC2. Hamartin and tuberin mycin is widely used as a research tool
249
www.stemcell8.cn
recto
turgor/turgor pressure
for studying the process of protein glyco- Tween 80 A nonionic detergent used
sylation. for isolation of cell membranes and to
reduce background signal interference in
turgor/turgor pressure Water pres- immunoblotting.
sure resulting from the diffusion of water
into cells. The term is usually applied twin sectors If the process of transpo-
to the rigidity of plant structures, for sition carried out by a transposon occurs
example, leaves and stems resulting from just at the time of cell division such that
osmotic pressure. only one daughter cell carries the trans-
position, then the descendants of such
Turners syndrome A genetic defect genotypically different daughter cells are
in which the cells of the afflicted indi- called twin sectors.
vidual contain one X chromosome but
no Y chromosome. Although such indi- twisting number For a given double
viduals have the outward appearance of helical DNA, a number representing the
females, the sexual organs are incomplete total number of helical turns. The twist-
or undeveloped. ing number is calculated as the total
number of base pairs in the DNA under
turnover number For an enzyme- consideration divided by the number of
catalyzed reaction, the number of sub- base pairs per turn.
strate molecules undergoing reaction per
unit time. For example, in the reaction Ty 1 elements A type of transposon in
catalyzed by carbonic anhydrase, yeast; Ty is an acronym for transposon
CO2 + H 2O H 2CO3, yeast. The Ty elements are about 6.3 kb
the enzyme has a turnover number of long and contain genes similar to the gag
600,000 molecules of CO2 per second. and pol genes of retroviruses.
250
www.stemcell8.cn
ubiquitin A protein originally discov- then recopies the region using the remain-
ered in the nucleosomes of the fruit fly, ing strand as a template. See excision
Drosophila melanogaster, whose binding repair.
to A- and B-type mitotic cyclins leads to
their destruction at the end of mitosis. unequal crossing over A form of
Ubiquitin binding to the cyclin allows it recombination in which a segment of
to be proteolytically degraded by a multi- DNA from one chromosome is trans-
protein proteosome complex. ferred to a position adjacent to its own
allele on the homologous chromosome:
ultracentrifugation Centrifugation at -+ ----------------- +-
speeds great enough to produce forces of X allele
greater than 300,000 times the force of -+ ----------------- +-
gravity. The forces produced by ultracen- X allele
trifugation are capable of separating mol-
ecules of different sizes from one another.
The ultracentrafuge was invented by the
Swedish physical chemist Theodor Sved- X allele X allele
berg in 1923. -+ ------- + ------- +-
251
www.stemcell8.cn
uridine
252
www.stemcell8.cn
253
www.stemcell8.cn
vasoactive intestinal peptide
growth factor (PlGF)that are all encoded cells that line the gut and the discharge of
by separate genes. New anticancer drugs, neurotransmitters into the synaptic cleft.
such as Avastin, target VEGF or its receptor
as a means of starving tumors by depriv- Venter, J. Craig (b. 1946) Founder of
ing them of blood supply from new blood The Institute for Genomic Research (TIGR)
vessel growth induced by tumor-derived who, backed by venture capital, competed
VEGF. with the NIH-backed Human Genome
Project in sequencing the entire human
vasoactive intestinal peptide (VIP) A genome. Venter is known for employing
neuropeptide hormone that is found an innovative shotgun approach that uti-
to have effects on the immune system, lized robotic sequencing of short genomic
including anti-inflammatory effects, inhi- fragments and advanced computer algo-
bition of cytokine production, and inhi- rithms to assemble the sequence data.
bition of macrophage functions such as
chemotaxis and phagocytosis. VIP has veratridine A powerful neurotoxin,
been found to exert some of these effects derived from the lily Schoenocaulon offi -
via a cAMP-mediated signal transduction cinalis, that is used to study nerve func-
system. tion. Veratridine interferes with the action
of sodium channels such that sodium ions
vasopressin A polypeptide hormone, can pass freely into the neuron.
produced by the posterior part of the
pituitary gland, that causes an increase very short patch repair (VSPR) The
in blood pressure but also decreases the type of excision repair that involves mis-
flow of urine. Previously known as antid- matches between single bases.
iuretic hormone.
vimentin A protein comprising one of
vav-1 oncogene A rho-type guanine the subclasses of intermediate filaments
nucleotide exchange factor (GEF) of the that make up a tissue-specific cytoskeleton
Dbl family. vav-1 plays a role in develop- in mammalian cells. Vimentin fi laments
ment and activation of T and B cells. vav- are characteristically found in cells of
1 is the binding partner of the HIV-1 nef mesenchymal origin such as fibroblasts.
proteins. The vav-1/nef complex causes
cytoskeletal rearrangements, activates the vinblastine An antitumor drug isolated
JNK/SAPK signaling cascade, and upreg- from the Madagascar periwinkle plant
ulates HIV transcription and replication. (Vinca rosea). Vinblastine acts to cause
The vav gene map locus is 19p13.2 depolymerization of microtubules by
binding to the tubulin protein subunits.
vector Any DNA that can propagate
itself rapidly in a host and can also main- vincristine An antitumor drug isolated
tain this capability after insertion of from the Madagascar periwinkle plant
foreign DNA into the vector. Although (Vinca rosea); a chemical variant of vin-
there are many types of vectors, the most blastine that acts to cause depolymeriza-
common ones are derived from bacterial tion in the same manner as vinblastine.
plasmids or the DNAs of both bacterial See vinblastine.
and animal viruses. Most vectors in use
today have been subjected to genetic engi- vinculin A component of the adhesion
neering for specific purposes such as the plaque that, together with alpha-actinin,
expression of foreign proteins in bacteria attaches to both the terminus of a stress
or animal cells (expression vectors). fiber and a transmembrane integrin mol-
ecule to form an adapter complex that
vectorial discharge Secretion of a sub- connects the integrin to the stress fiber.
stance by a cell at only one location or The phosphorylation of tyrosine residues
area on the cell surface. Examples of vec- in vinculin in transformed cells is believed
torial discharge include the secretion of to play a role in the altered cell-substrate
mucin at the apical surface of epithelial interactions that is seen in transformed
254
www.stemcell8.cn
von Willebrand disease
cells grown in tissue culture. See extra- ment, visual purple, and also has profound
cellular matrix. effects on the differentiation of epithelial
including anticancer effects. Derivatives of
viomycin An antibiotic that acts by vitamin A have been used as therapeutic
blocking a critical step in protein synthesis agents for a variety of skin conditions such
(translocation), thereby causing the synthe- as icthyosis, acne, and wrinkling.
sis of a polypeptide to be blocked before
completion. Viomycin is itself a peptide vitamin B12 A ring-shaped, cobalt-con-
that binds to either the large or the small taining molecule also known as cobala-
ribosomal subunit to block translocation. mine. Vitamin B12 is an essential cofac-
tor for the entry of certain amino acids
virion A complete virus particle that and fatty acids into the tricarboxylic acid
includes the viral nucleic acid (either RNA cycle (Krebs cycle).
or DNA) and, in some cases, enzyme mol-
ecules enclosed in a protein capsid. vitamin B6 Any of various derivatives
of pyridoxine (e.g., pyridoxal phosphate)
viroid An unusual infectious agent that used as a cofactor in the transamination
produces diseases in plants and consists reaction, the critical step by which amino
only of a naked, circular strand of RNA. acids enter into the tricarboxylic acid
cycle (Krebs cycle).
virulent, virulence The property of
rapid spread of a pathogenic agent (e.g., voltage-gated channel A specialized
a virus or bacteria) through a susceptible type of transmembrane channel that opens
population. only when there is an electrical potential
of a certain value across the plasma mem-
virus An agent that infects single cells brane (the threshold). Voltage-gated chan-
but consists only of the components of the nels for ions are present on a variety of
virion and does not possess the cellular cell types but are especially characteristic
machinery required for its own replica- of neurons where they are responsible for
tion. For this reason, viruses are, of neces- the generation of an action potential.
sity, intracellular parasites that are not
clearly classifiable as living organisms. von Willebrand disease (vWD) An
inherited disorder in which blood fails to
virusoids One of two classes of small clot properly. Symptoms of vWD include
infectious RNA molecules in plants. bleeding from the gums, nose, and intes-
Virusoids do not contain genes for their tinal lining and prolonged or excessive
own replication or packaging but require bleeding from small cuts. vWD is caused
a second, helper virus to accomplish these by mutations in a gene coding for a sub-
functions. Virusoids are also referred to stance known as von Willebrand factor,
as satellite RNAs. which causes platelets to stick to damaged
blood vessels and which carries a clotting
viscosity The property of resistance to factor, called factor VIII. There are three
flow exhibited by a substance in a fluid, types of von Willebrand disease:
semisolid state. In biochemical solutions,
viscosity is an indicator of a solution con- type 1, in which lower levels than nor-
taining large macromolecules. mal of von Willebrand factor are pres-
ent in the blood
vitamin An essential nutrient in the
diets of mammals; any of a number of type 2, in which a defective von Wil-
organic molecules that generally function lebrand factor is made
as cofactors for specific enzyme-catalyzed type 3, in which von Willebrand fac-
reactions involved in energy production. tor is virtually absent and there are
very low levels of factor VIII
vitamin A Any of the various chemical
relatives of retinol (e.g., retinoic acid). Vita- The gene map locus for von Willebrand
min A is the precursor of the visual pig- factor is 12p13.3.
255
www.stemcell8.cn
256
www.stemcell8.cn
writhing number
from the gray matter of the brain that give triplets but that the second and third posi-
it a characteristic white color. tions of the triplets will vary or wobble,
with the third base of the triplet exhibiting
wild-type gene The normal, nonmu- the most wobble. See codon.
tated version of a gene.
writhing number (W) A number
wobble hypothesis The idea that, for representing the turning of the axis of a
an amino acid for which there is more than supercoiled DNA: W = L T, where L =
one triplet in the genetic code, the first base the linking number and T = the twisting
will always be the same in the different number.
257
www.stemcell8.cn
A
X
258
www.stemcell8.cn
A
Y
259
www.stemcell8.cn
A
Z
260
www.stemcell8.cn
verso
Appendixes
261
www.stemcell8.cn
Appendixes
A
ACP
adenine A
acyl carrier protein
ACTH adrenocorticotrophic hormone
ADP adenosine diphosphate
AIDS acquired immunodeficiency syndrome
AMP adenosine monophosphate
APC adenomatous polyposis coli
APH aminoglycoside-3-phosphotransferase
araA arabinosyladenine
araC arabinosylcytosine
ARC AIDS-related complex
ARS autonomously replicating sequences
ATP adenosine triphosphate
AZT 3-azido-3-deoxythymidine
BAP benzylaminopurine
BOD biochemical oxygen demand
bp base pair
5-BU 5-Bromuracil
C cytosine
cAMP cyclic AMP
CAP catabolite activator protein
CAT chloramphenical acetyl transferase
ccc DNA covalently closed circular DNA
Ccrit critical dissolved oxygen concentration
cdc cell-division cycle
cDNA complementary DNA
CF complement-fixation
CFT cystic fibrosis transmembrane conductance
CFTR cystic fibrosis transmembrane conductance regulator
CFU colony-forming unit
cM centimorgan
CML chronic myelogenous leukemia
CMP cytidine monophosphate
CNBr cyanogen bromide
CoA/CoASH coenzyme A
con A concanavalin A
CRP catabolite repression protein
CsCl cesium chloride
ctDNA chloroplast DNA
CTP cytidine triphosphate
d deoxy
DAG diacylglycerol
dATP deoxyadenosine triphosphate
dCTP deoxycytidine triphosphate
dd dideoxy
ddNTP dideoxyribonucleotide triphosphate
dGTP deoxyguanosine triphosphate
DHFR dihydrofolate reductase
DMSO dimethyl sulfoxide
262
www.stemcell8.cn
Appendixes
verso
DMT dimethoxytrityl
DNA deoxyribonucleic acid (See also ctDNA, mtDNA.)
DNase deoxyribonuclease
dNTP deoxyribonucleotide triphosphate
DP docking protein
EBV Epstein-Barr virus
ECM extracellular matrix
E. coli Escherichia coli
EDTA ethylenediaminetetraacetate
EF elongation factor
EGF epidermal growth factor
ELC expression-linked copy
ELISA enzyme-linked immunoabsorbent assay
EMBL European Molecular Biology Lab
EMS ethylmethane sulfonate
ER endoplasmic reticulum
erb erythroblastosis
ERK extracellular receptor tyrosine kinase
EST expressed sequence tags
FACS flourescence-activated cell sorter
f-actin filamentous actin
FAD flavin adenine dinucleotide
FBJ Finkel, Biskis, and Jinkins (discoverers of the FBJ murine
osteosarcoma virus)
FCS fetal calf serum
fes feline sarcoma
FFU focus-forming unit
FGP fluorescent green protein
FISH fluoresence in situ hybridization
5-FU 5-fluorouracil
FMN flavin mononucleotide
FRA fos-related antigens
FRAP fluorescence recovery after photobleaching
FSH follicle-stimulating hormone
FSV feline sarcoma virus
ftz fushi tarazu
G guanine
G actin globular actin
GABA gamma amino butyric acid
GAG glycosaminoglycan
gal galactosidase
GALT gut-associated lymphatic tissue
GAP GTPase-activating proteins
GC gas chromatography
GDP guanosine diphosphate
GEF guanine nucleotide exchange factor
GFAP glial fibrillary acidic protein
GH growth hormone
GLC gas-liquid chromatography
GMP guanosine monophosphate
gpt guanine phosphoribosyl transferase
GST Glutathione S-transferases
GTP guanosine triphosphate
263
www.stemcell8.cn
recto
Appendixes
HAT hypoxanthine-aminopterin-thymine
HCG human chorionic gonadotropin
HDL high-density lipoproteins
Hfr high-frequency recombination strain
HGPRT hypoxanthine-guanine phosphoribosyl transferase
HIV human immunodeficiency virus
HLA human leukocyte-associated antigens
HLTV human T-cell leukemia virus
HMG high-mobility group
HN hemagglutinin-neuraminadase
hnRNA heterogeneous nuclear RNA
HPFH hereditary persistence of fetal hemoglobin
HPLC high-performance liquid chromatography
HPV human papilloma virus
HRP horseradish peroxidase
HSE heat-shock response element
hsp heat-shock protein
HSR homogeneously staining region
HSV herpes simplex virus
IAA indole acetic acid
IDL intermediate-density lipoprotein
IF initiation factor
IL interleukin
IMP inosine monophosphate
IPTG isopropyl--D-thiogalactopyranoside
IR infrared
IS insertion sequence
IUdR iododeoxyuridine
j gene-joining gene
KD diffusion coefficient/constant
Ki-MuSV Kirsten sarcoma virus
kM Michaelis-Menten constant
LAV lympho adenopathy virus
LDL low-density lipoprotein
LH lutinizing hormone
LINES long-period interspersed sequences
LTR long terminal repeat
MAPS microtubule-associated proteins
MAR matrix attachment regions
MAT mating-type locus
MBP maltose binding protein
MCP methyl-accepting chemotaxis protein
mdr multidrug resistance
5MeC 5-methylcytosine
MHC major histocompatibility complex
MIF migration-inhibitory factor
MMTV mouse mammary tumor virus
MPF M-phase promoting factor
mRNA messenger RNA
mtDNA mitochondrial DNA
MTOC microtubule organizing center
MuLV murine leukemia virus
MVR minisatellite variant repeat
264
www.stemcell8.cn
Appendixes
verso
myb myeloblastosis
myc myelocytomatosis
NAD nicotamide adenine dinucleotide
NADP nicotamide adenine dinucleotide phosphate
NANA N-acetylneuraminic acid
NBT nitro-blue tetrazolium
N-CAM neural cell adhesion molecule
NCBI National Center for Biotechnology Information
NGF nerve growth factor
NHGRI National Human Genome Research Institute
NK cells natural killer cells
NMR nuclear magnetic resonance
NP40 nonidet P40
NTG neomycin, thymidine kinase, glucocerebroside
oc open circle
PAGE polyacrylamide gel electrophoresis
PaPoVa papilloma, polyoma, and vacuolating viruses
PAS periodic acid-Schiff stain
PCR polymerase chain reaction
PDGF platelet-derived growth factor
PE phosphatidylethanolamine
PEG polyethylene glycol
PEP phosphoenol pyruvate
PFU plaque-forming unit
PITC phenyl isothiocyanate
PKU phenylketonuria
PML progressive multifocal leukoencephalopathy
PMU polymorphonuclear leukocyte
poly U polyuridylic acid
PPLO pleuropneumonialike organisms
PVP polyvinylpyrrolidone
raf rat fibrosarcoma
ras rat sarcoma
RBC red blood cell
RER rough endoplasmic reticulum
RES reticuloendothelial system
RFLP restriction fragment-length polymorphism
RG resorufin--D-galactopyranoside
RNA ribonucleic acid (See also hnRNA, mRNA, rRNA,
snRNA, tRNA.)
RNP ribonucleoprotein
ros Rochester 2 sarcoma
rRNA ribosomal RNA
RSV Rous sarcoma virus
RTK receptor tyrosine kinase
RVE reconstituted viral envelope
SAM S-adenosylmethionine
SAR scaffold attachment regions
SDGF sarcoma-derived growth factor
SDS sodium dodecyl sulfate
SEM scanning electron microscopy
sis simian sarcoma
snRNA small nuclear RNA
265
www.stemcell8.cn
recto
Appendixes
266
The Chemical Elements
element symbol a.n. element symbol a.n. element symbol a.n. element symbol a.n.
actinium Ac 89 erbium Er 68 molybdenum Mo 42 selenium Se 34
aluminum Al 13 europium Eu 63 neodymium Nd 60 silicon Si 14
americium Am 95 fermium Fm 100 neon Ne 10 silver Ag 47
antimony Sb 51 fluorine F 9 neptunium Np 93 sodium Na 11
argon Ar 18 francium Fr 87 nickel Ni 28 strontium Sr 38
arsenic As 33 gadolinium Gd 64 niobium Nb 41 sulfur S 16
astatine At 85 gallium Ga 31 nitrogen N 7 tantalum Ta 73
barium Ba 56 germanium Ge 32 nobelium No 102 technetium Tc 43
berkelium Bk 97 gold Au 79 osmium Os 76 tellurium Te 52
beryllium Be 4 hafnium Hf 72 oxygen O 8 terbium Tb 65
bismuth Bi 83 hassium Hs 108 palladium Pd 46 thallium Tl 81
bohrium Bh 107 helium He 2 phosphorus P 15 thorium Th 90
boron B 5 holmium Ho 67 platinum Pt 78 thulium Tm 69
bromine Br 35 hydrogen H 1 plutonium Pu 94 tin Sn 50
267
cadmium Cd 48 indium In 49 polonium Po 84 titanium Ti 22
calcium Ca 20 iodine I 53 potassium K 19 tungsten W 74
californium Cf 98 iridium Ir 77 praseodymium Pr 59 ununbium Uub 112
carbon C 6 iron Fe 26 promethium Pm 61 ununpentium Uup 115
cerium Ce 58 krypton Kr 36 protactinium Pa 91 ununquadium Uuq 114
cesium Cs 55 lanthanum La 57 radium Ra 88 ununtrium Uut 113
chlorine Cl 17 lawrencium Lr 103 radon Rn 86 unununium Uuu 111
www.stemcell8.cn
268
55 56 57-71* 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86
Cs Ba Hf Ta W Re Os Ir Pt Au Hg Tl Pb Bi Po At Rn
132.9 137.3 178.5 180.9 183.9 186.2 190.2 192.2 195.1 197.0 200.6 204.4 207.2 209.0 (210) (210) (222)
87 88 89-103 104 105 106 107 108 109 110 111 112 113 114 115
III. Periodic Table
57 58 59 60 61 62 63 64 65 66 67 68 69 70 71
*lanthanide La Ce Pr Nd Pm Sm Eu Gd Tb Dy Ho Er Tm Yb Lu
series 138.9 140.1 140.9 144.2 (145) 150.4 152.0 157.3 158.9 162.5 164.9 167.3 168.9 173.0 175.0
89 90 91 92 93 94 95 96 97 98 99 100 101 102 103
actinide Ac Th Pa U Np Pu Am Cm Bk Cf Es Fm Md No Lr
series (227) 232.0 231.0 238.0 (237) (244) (243) (247) (247) (251) (252) (257) (258) (259) (260)
269
www.stemcell8.cn
recto
Appendixes
Purines Pyrimidines
270
www.stemcell8.cn
Appendixes
verso
271
www.stemcell8.cn
Appendixes
AlignACE Mitomap
A Web site for identifying motifs by align- A database of variant human mitochon-
ments of multiple sequences. The AlignACE drial genomes detailing known polymor-
software can be downloaded. http://atlas. phisms and mutations and literature refer-
med.harvard.edu/cgi-bin/alignace.pl. ences. http://www.mitomap.org. Accessed
Accessed on September 12, 2005. on September 12, 2005.
272
www.stemcell8.cn
Appendixes
verso
273
www.stemcell8.cn
Appendixes
275
www.stemcell8.cn