Вы находитесь на странице: 1из 288

www.stemcell8.

cn
www.stemcell8.cn

The Facts On File

DICTIONARY of
BIOTECHNOLOGY
and
GENETIC ENGINEERING
Third Edition
www.stemcell8.cn
www.stemcell8.cn

The Facts On File

DICTIONARY of
BIOTECHNOLOGY
and
GENETIC
ENGINEERING
Third Edition

Mark L. Steinberg, Ph.D.


Sharon D. Cosloy, Ph.D.
www.stemcell8.cn

The Facts On File Dictionary of Biotechnology and Genetic Engineering


Third Edition

Copyright 2006, 2001, 1994 by Mark L. Steinberg, Ph.D., and Sharon Cosloy,
Ph.D.

Illustrations 2006 by Infobase Publishing

All rights reserved. No part of this book may be reproduced or utilized in any form
or by any means, electronic or mechanical, including photocopying, recording, or by
any information storage or retrieval systems, without permission in writing from the
publisher. For information contact:

Facts On File, Inc.


An imprint of Infobase Publishing
132 West 31st Street
New York NY 10001

Library of Congress Cataloging-in-Publication Data

Steinberg, Mark (Mark L.)


The Facts on File dictionary of biotechnology and genetic engineering/
Mark L. Steinberg and Sharon D. CosloyThird ed.
p. cm. (The Facts On File science library)
Includes index.
ISBN 0-8160-6351-6 (alk.paper)
1. BiotechnologyDictionaries. 2. Genetic engineeringDictionaries.
I. Cosloy, Sharon D. II. Title. III. Series.

TP248.16.S84 2000
660.603dc21 00-035463

Facts On File books are available at special discounts when purchased in bulk quanti-
ties for businesses, associations, institutions, or sales promotions. Please call our Spe-
cial Sales Department in New York at (212) 967-8800 or (800) 322-8755.

You can fi nd Facts On File on the World Wide Web at


http://www.factsonfi le.com

Text and cover design by Cathy Rincon

Printed in the United States of America

MP FOF 10 9 8 7 6 5 4 3 2

This book is printed on acid-free paper.


www.stemcell8.cn

This edition is dedicated to the memory of Dr. Sharon Cosloy by her


children, Michael and Rebecca, and her husband, Edward. Sharon was a
loving mother, a devoted wife, a dedicated mentor, and an accomplished
professor and researcher.

And above all, she was a kind and gentle woman with a bright spirit that
still lives on today through the people who were fortunate enough to be
touched in life by her.

From MLS: To Sharon, in memoriam, a good friend and valued


colleague. You are greatly missed.
www.stemcell8.cn
www.stemcell8.cn

CONTENTS

Preface ix

Acknowledgments xi

Entries A to Z 1

Appendixes 261
Acronyms (and Other Abbreviations) 262
The Chemical Elements 267
Periodic Table 268
The Genetic Code 269
Purine and Pyrimidine Bases Found 270
in Nucleic Acids
Side Chains (R Groups) for 271
Individual Amino Acids
Bioinformatics Web Sites 272
Enzymes Used in Gene Cloning 274
www.stemcell8.cn

PREFACE

The last decades of the 20th century produced a dramatic revolution in the
field of biology in which, for the fi rst time, the ability to modify the genetic
makeup of higher organisms in the laboratory rather than by the random
forces of natural selection was realized. This new era was born out of criti-
cal discoveries in the mid-1970s that led to the appearance of new fields of
molecular genetics variously known as gene cloning, genetic engineering, and
biotechnology. The central theme of genetic engineering is the introduction of
genetic material altered in a laboratory into an organism different from that
from which it was originally derived. The introduction of genes from higher
organisms into microorganisms made it possible to isolate, amplify, study
and ultimately engineer individual genes for a variety of specialized purposes.
These techniques have also allowed scientists to look closely at the structure,
function, and regulation of genes and their proteins.

Genetic engineering has given rise to technologies that were unthinkable


barely two decades ago: recombinant antibodies to fight cancer, the isolation
of genes responsible for genetic diseases, the synthesis of unlimited quantities
of therapeutic agents, human hormones and critical blood factors in bacterial
factories, the creation of genetically engineered plants and animals, and
the decoding of the human genomeonly a few examples of technologies
that have been realized even at the time of the fi rst printing of this dictionary.
Much of the research in biotechnology and genetic engineering has moved
from the academic world into the industrial setting. As a consequence, many
new and potential applications are in the hands of private enterprises where,
fueled by more substantial funding and motivated by the forces of the market-
place, the development of new products has reached an explosive pace. This
has also meant that even as the rapidly increasing pace of progress taxes the
ability to keep up with new developments, there is an ever-increasing need to
understand the legal and ethical issues that inevitably accompany any new
technology. However, in contrast to other new technologies, the products of
genetic engineering deal directly with fundamental biological processes and
are, by their very nature, certain to have an immediate and profound impact
on all areas of human health.

The purpose of this dictionary is to provide readers with access to the basic
vocabulary of modern biotechnology and genetic engineering so that those
with even an elementary knowledge of basic biology and biochemistry will be
able to follow the flood of fast-breaking developments in biotechnology and
genetic engineering that constantly appears in the media.

At the time of the fi rst printing of The Facts On File Dictionary of Biotech-
nology and Genetic Engineering, molecular cloning of genes had only recently
matured. Even then, rapidly accumulating data from large-scale sequence
analyses and the development of new techniques for amplification of DNA
at the microscale level were already yielding information that allowed for the
www.stemcell8.cn
Preface

determination of gene function, including the molecular nature of defects


underlying numerous genetic diseases. A revised edition of the dictionary
added terminology of the developing biomedical fields of molecular medicine,
DNA technology, gene therapy, and genomics. In recent years, new areas of
research have elucidated signaling pathways that are now known to regulate
essential biochemical pathways, including cell growth, metabolism, and dif-
ferentiation. Many modern pharmaceuticals are agents that target critical
signaling pathways involved in disease processes. Among these are drugs
for the treatment of high blood pressure, allergies, sexual dysfunction, anti-
inflammatory and anti-viral agents, various cancer chemotherapies, and many
others. In a parallel track, the completion of the Human Genome Project in
2003, together with the computer technologies for data mining and relational
analyses, created the new area of computational biology known as bioinfor-
matics. The application of bioinformatic methods to burgeoning nucleotide
and protein databases has yielded new insights into many genetic diseases
and has helped elucidate the relationships between genes and the biochemical
pathways that the gene products regulate. Bioinformatics is currently provid-
ing new approaches to drug design based on predictive computer models to
tailor drugs to act on specific molecular targets. The dictionary was updated
to account for these as well as other new developments in this rapidly chang-
ing field.

The new third edition of the dictionary focuses on the new terminology in
the evolving areas of genomics, bioinformatics, cell signaling, and molecular
medicine. In addition, there are a number of biochemical terms pertaining to
recent advances in medicines for the treatment of viral diseases, mental ill-
ness, cholesterol metabolism, plant engineering, and stem cell research.

Since this book addresses an audience from diverse backgrounds and covers a
broad field, we attempted to include both basic as well as more technical ter-
minology in a number of areas including plant and animal biology in order to
meet the needs of as many readers as possible. There has also been an attempt
to make the dictionary self-contained in the sense that, in cases where techni-
cal terms appear in defi nitions, these terms will be defi ned elsewhere in the
book. It is anticipated that the dictionary will be of benefit to a wide-ranging
audience, including high school and college students, lawyers, physicians, sci-
entists, or others with a particular need to keep abreast of the rapidly develop-
ing areas of biotechnology and genetic engineering.

x
www.stemcell8.cn

ACKNOWLEDGMENTS

The authors gratefully acknowledge the support of the RCMI research


facilities, where they carry out their research at the City College of
New York.

The authors also thank Mr. Frank K. Darmstadt, executive editor, and the
production department for their support and insight in the creation of this
new edition of the dictionary.
www.stemcell8.cn
www.stemcell8.cn

ABC transporter The largest class of as universal donors. In addition, the ABO
transmembrane proteins. ABC trans- system can be used in paternity suits to
porter is an acronym for ATP (adenosine rule out the possibility that a particular
triphosphate) binding cassette, a region male is the father of the child in question.
of the protein that is conserved in the
transporter in a wide variety of differ- abscisic acid A plant hormone, lipid
ent organisms and is responsible for the in nature, synthesized in wilting leaves.
binding of ATP. In bacteria these pro- It counteracts the effects of most other
teins use energy from ATP to transport a plant hormones by inhibiting cell growth
wide variety of small molecules including and division, seed germination, and bud-
sugars, vitamins, amino acids and ions ding. It induces dormancy.
across the cell membrane. In eukaryotes,
ABC transporters generally move mol- absorbance Often referred to as opti-
ecules either outside the cell or into an cal density. Absorbance is a unit of
organelle such as the endoplasmic retic- measure of the amount of light that is
ulum or mitochondrion. Alterations in absorbed by a solution or by a suspen-
the ABC transporter genes, particularly sion of bacterial cells. The absorbance is
duplications, are the basis of resistance a logarithimic function of the percent of
to chemotherapeutic drugs that many transmission of a particular wavelength
tumors develop. Inhibitors of the ABC of light through a liquid and is measured
transporters involved in drug resistance is by a spectrophotometer or a colorim-
being developed as a strategy to deal with eter. Absorbance values are used to plot
drug resistance in cancer. growth of suspensions of bacteria and to
determine the concentration and purity
ABO blood group A system of anti- of molecules such as nucleic acids or pro-
gens expressed at the surface of human teins in solutions.
red blood cells. Human blood types rep-
resented in this group are A, B, AB, or absorption 1. virology The entry of a
O, depending on which antigen(s), in virus or viral genome into a host cell after
the form of oligosaccharides, are present the virus has absorbed to the cell surface.
at the surface of the erythrocyte mem- (See adsorption.)
branes. The blood serum of Type A indi- 2. photometry When light is neither
viduals contains anti-B antibodies, those reflected nor transmitted, it is said to be
with Type B produce anti-A antibodies, absorbed. Some biological systems can
and those with Type AB produce both. make use of light energy because they
Type O individuals produce neither. have pigments that absorb light at spe-
This system is one of 14 different blood cific wavelengths. These pigments are
group systems consisting of 100 differ- able to harness light energy to drive bio-
ent antigens. This system is of medical chemical reactions in vivo. An example
importance because the recipient of a can be found in plant pigments, such as
blood transfusion must receive blood that chlorophyll, that are used to trap light
is compatible with his or her own type. energy and drive the process of photo-
Type AB individuals are known as uni- synthesis where plants manufacture
versal acceptors, and Type O individuals nutrients.

1
www.stemcell8.cn
absorption spectroscopy

absorption spectroscopy The use of one time, the production of these com-
a spectrophotometer to determine the mercially important chemicals relied on
ability of solutes to absorb light through bacterial fermentation, but this has since
a range of specified wavelengths. Every been replaced by chemical synthesis.
compound has a unique absorption spec-
trum. An absorption spectrum, which is acetylcholine A chemical neurotrans-
defi ned as a plot of the light absorbed ver- mitter that is expelled into the synaptic
sus the wavelength, can be derived from a cleft, or space between two nerve cells.
solution (see absorbance). Absorption This neurotransmitter permits the trans-
spectra are used to identify compounds, mission of an electrical nerve impulse or
determine concentrations, and plot reac- action potential from one nerve cell to
tion rates. another by diffusing across the cleft and
then binding to a cell-membrane receptor.
abzymes Catalytic antibodies that cleave
proteins or carbohydrates at specific acetylcholinesterase An enzyme pres-
residues. They are analogous to restric- ent in the synaptic cleft, or space between
tion enzymes that cleave DNA at specific two nerve cells, that hydrolyzes or
sequences. Catalytic antibodies have the destroys the unbound neurotransmitter
potential to be used as therapeutic agents, acetylcholine once it has diffused through
attacking specific viral or bacterial surface the cleft. This is required to restore the
structures, and as catalysts in reactions in synaptic cleft to a state that is ready to
which no enzyme has been found. receive the next nerve impulse. See ace-
tylcholine.
acentric fragment A fragment of a
chromosome that does not contain a cen- acid blobs Certain sequences of amino
tromere. Because of the absence of a centro- acids on a protein that bind to a tran-
mere, acentric fragments do not segregate scriptional regulatory protein and, in so
at mitosis and eventually disappear. doing, serve to activate transcription.

Acetobacter A genus of Gram- acid growth hypothesis The hypoth-


negative flagella-endowed bacteria that esis that elongation of plant cells caused
are acid-tolerant aerobic rods. They are by the plant hormones known as auxins
also known as the acetic-acid bacteria involves a mechanism for creating an acid
due to their ability to oxidize ethanol to environment (lowered pH) in the spe-
acetic acid. They are found on fruits and cific region of the cell where growth is to
vegetables and can be isolated from alco- occur. The acidification of a plant cell in
holic beverages. They are used commer- a localized region helps account for cer-
cially in the production of vinegar, but tain tropic behaviors seen in plants, for
because of their ability to produce acetic example, phototropism.
acid, they are nuisance organisms in the
brewing industry. acidic activation domain In certain
types of eukaryotic transcription fac-
Acetobacter aceti An organism used tors (for example, the GAL4 transcrip-
in the commercial production of vinegar. tion factor in yeast or the herpes simplex
When introduced into wine or cider con- virus VP16 protein), a region containing
taining 10 percent12 percent alcohol, it a number of contiguous acidic amino acid
will convert to acetic acid. See Aceto- residues that appears to be required for
bacter. the recruitment of other additional fac-
tors needed to regulate the transcription
acetone-butanol fermentation The process for different genes.
anaerobic fermentation of glucose by
Clostridium acetobutylicum to form acidic amino acids The two amino
acetone and butanol as end products. At acids that are negatively charged at pH

2
www.stemcell8.cn
actin

7.0 are aspartic and glutamic acids. Also transmitted through casual contact with
referred to as aspartate or glutamate. infected individuals.
Both of these amino acids contain in their
R or variable groups a second carboxyl acridine orange One of a group of
group that is ionized under physiological chemical mutagens known as acridines,
conditions. including proflavin and acriflavine. The
size of the acridines is the same as that
acidophile A classification of microor- of a purine-pyrimidine base pair. For
ganisms that describes the ability or the this reason, they can insert or intercalate
necessity of certain species to exist in an into the helix between two adjacent base
acidic environment. These acid-loving pairs. When DNA that contains an inter-
organisms can exist at a pH range of 0 calated acridine is replicated, an addi-
5.4, well below the optimum of neutral- tional base pair may be added or a base
ity for most bacteria. Facultative acido- pair may be deleted, disrupting the codon
philes can tolerate a range of pH from reading frame in the newly synthesized
low to neutral and include most fungi strand. Such a mutation is called a frame-
and yeasts. However, obligate acido- shift mutation.
philes including members of the genera
Thiobacillus and Sulfolobus require low acrosome (process, reaction, vesicle)
pH for growth. A neutral pH is toxic to A vesicle- or membrane-bound compart-
these species. ment covering the sperm head that con-
tains lytic enzymes. The major enzyme
acivicin An antibiotic that acts as an found in the mammalian sperm acro-
inhibitor of the enzyme gamma-glutamyl some is hyaluronidase, which promotes
transpeptidase (GGT), which is necessary the digestion of the tough outer coat of
for the breakdown and transport of glu- the egg and allows penetration of the
tathione across the cell membrane. As a sperm.
glutamine analog, acivicin is also used as
an anticancer drug because of its ability acrylamide A substance that can poly-
to block glutamine metabolism. merize and form a slab gel when poured
into a mold in its molten state. It is used as
acquired immunodeficiency syndrome semisolid support medium and is immersed
(AIDS) An infectious disease in humans in a conductive buffer through which a
caused by the human immunodeficiency current is passed. When solutions con-
virus (HIV). The virus attacks the hosts taining heterogeneous mixtures of nucleic
immune system leaving him/her suscep- acid fragments or mixtures of proteins are
tible to many other diseases, including placed into slots in the gel and subjected
certain rare forms of cancer and oppor- to the electrical current, the nucleic acid
tunistic microbial infections that would or protein mixtures may be separated into
otherwise be destroyed in an uninfected distinct collections of homogeneous mole-
individual. Most often, AIDS patients die cules located in different regions of the gel,
from these secondary infections that run based on their size or molecular weight.
rampant through the body because of the See electrophoresis.
loss of ability to immunologically sup-
press them. The HIV virus is transmit- ACTH See adrenocorticotropic
ted through the exchange of body fluids hormone.
during sexual contact with an infected
individual, the sharing of needles among actin One of the two major proteins
intravenous drug users, transfusion of responsible for muscle contraction. Actin
contaminated blood products (no longer a and myosin are found in smooth and stri-
threat due to the ability to screen donated ated muscle. Actin monomers together
blood), and from mother to newborn dur- with two other proteins, troponin and
ing delivery. It has not been shown to be tropomysin, can polymerize to form long,

3
www.stemcell8.cn
Actinomyces

thin fi laments that, together with myosin activation energy The energy required
fi laments, can shorten in the presence of for a chemical reaction to proceed. In bio-
ATP (adenosine triphosphate). Actin also logical systems, enzymes lower the activa-
plays a role in the shape and structure of tion energy, allowing chemical reactions
cells. to occur faster under physiological condi-
tions.
Actinomyces A genus of anaerobic
Gram-positive rods that are often found active site The region of an enzyme
in the mouth and throat. They occasion- that contains a special binding site for
ally display a branched fi lamentous mor- substrate(s). This site is uniquely shaped
phology. Many, such as A. israelii, are for the exclusive binding of the particu-
human pathogens. lar substrate molecule(s) and is the site
for the catalytic activity of the enzyme.
actinomycin D An antibiotic produced The three-dimensional folding of the
by Streptomyces parvullus that inhibits enzyme brings distal amino acids in the
RNA transcription in both prokaryotes polypeptide into close proximity, thus
and eukaryotes. It blocks the action of forming the active site at the surface of
RNA Polymerase I, which synthesizes the protein.
ribosomal RNA, and forms complexes
with DNA by intercatating between G- active transport The transport, by
C pairs, preventing the movement of cells or cellular compartments, of ions
DNA- and RNA-synthesizing enzymes. and metabolites through cell membranes
Although toxic, it is sometimes used in against a concentration gradient. This
conjunction with other drugs as a che- type of transport requires cellular energy
motherapeutic agent, due to its antitumor in the form of ATP (adenosine triphos-
properties phate) hydrolysis. One example found in
all animal cells is the active transport of
action potential Also called a nerve Na+ out of cells and the active transport
impulse; sequential wave of depolariza- of K+ into cells. This system is known as
tion and repolarization across the mem- the sodium-potassium pump. The energy
brane of a nerve cell (neuron) in response is provided by a specific ATPase located
to a stimulus. Depolarization is a rever- in the plasma membrane. This active
sal in the distribution of charge between transport system is responsible for the
the inside and the outside of the neuron generation and maintenance of the elec-
membrane. trical potential or voltage gradient across
the cell membrane.
activated sludge process A secondary
sewage-treatment process where biologi- acycloguanosine (acyclovir) An anti-
cal processing of the sewage by microbial viral antibiotic used to treat herpes virus
activity is the main method of treatment. infections. Acycloguanosine is a deriva-
In this step, sewage that has been pre- tive of the normal nucleoside, guano-
viously treated in settling tanks is aer- sine, in which the sugar, ribose, has been
ated in large tanks to encourage growth replaced by an ether chain. Acycloguano-
of microorganisms that oxidize dissolved sine is an inhibitor of viral DNA synthe-
organics to carbon dioxide and water. sis. See hsv.
Bacteria, yeasts, molds, and protozoans
are used. This process proves effective in Acyclovir See acycloguanosine.
reducing intestinal pathogens in sewage
while encouraging growth of nonpatho- acyl carrier protein (ACP) A small
gens. After activated sludge has been pro- protein involved in the synthesis of fatty
duced, additional processing is required, acids. First isolated from E. coli bacteria
including anaerobic digestion, fi ltering, by Roy Vagelos, it was found to be a 77
and chlorination. amino acid polypeptide chain, capable of

4
www.stemcell8.cn
adenosine triphosphate

binding six other enzymes required for adenosine A nucleoside containing


fatty acid synthesis. the pentose sugar ribose and the purine
base adenine. When a phosphate group
adaptation 1. sensory A progressive is attached to the 5 carbon in the ribose,
decrease in the number of impulses that the nucleoside becomes a nucleotide, a
pass over a sensory neuron even when basic building block of nucleic acids.
there is continuous or repetitive sensory
stimulation to the sense organ involved. adenosine deaminase deficiency (ADA)
Sensory adaptation provides an organ- A genetic condition in which the lack of
ism with a way to deal with the constant the enzyme adenosine deaminase results
bombardment of the sense organs with in the disease severe combined immuno-
useless information in the environment deficiency (SCID). This rare disease leaves
and the ability to screen for the appropri- individuals with no functioning immune
ate stimuli to which to respond. system and results in death at a very early
2. evolution A genetic change in a popu- age. This was one of the fi rst diseases to
lation of organisms that arises as a result be treated with enzyme replacement ther-
of random chance, involving structures apy and then gene replacement therapy.
or behaviors that will enable that group
and its offspring to be better suited to adenosine diphosphate (ADP) A
their environment. product of the hydrolysis or enzymatic
cleavage of the terminal phosphate
adaptive enzymes Enzymes that are group of adenosine triphosphate (ATP).
produced by microbes only when their The other product produced during this
substrates are present. When not needed, reaction is inorganic phosphate. ATP is
they are not produced. This is in contrast cleaved to provide energy for cells to do
to constitutive enzymes, which are always work.
produced.
adenosine monophosphate (AMP)
adaptor molecules A term used to A product of the hydrolysis or enzymatic
describe transfer RNA due to its role during cleavage of the terminal two phosphate
translation of mRNA. Several properties of group of adenosine triphosphate (ATP).
the tRNA molecule enable it to act as an The other product produced during this
adaptor molecule. The highly specific nature reaction is inorganic pyrophosphate (PPi).
of tRNA-amino acid binding, the comple- In this reaction, energy is produced both
mentary base pairing of the tRNA anticodon from the release of pyrophosphate from
with a specific codon in the message, and ATP and from the subsequent cleavage of
its ability to carry its designated amino acid the pyrophosphate to form two molecules
to the mRNA template in the ribosome are of phosphoric acid.
all factors that allow the information in the
message to be translated into a polypeptide. adenosine triphosphate (ATP) The
single most important energy source
adenine One of the four major bases in biological systems; the energy cur-
found in nucleic acids. Adenine and gua- rency of the cell. All cells do work that
nine are purines; cytosine, thymine, and requires energy. Work can be mechani-
uracil are pyrimidines. These nitrogenous cal, biosynthetic, active transport of mol-
bases are a component of the basic build- ecules into and out of cells and cellular
ing blocks of nucleic acids called nucleo- compartments (see active transport),
tides. Within the DNA double helix, ade- and all require the hydrolysis of ATP or
nine forms a double hydrogen bond with the breaking of phophate bonds in the
thymine. energy-rich ATP molecule. ATP is made
up of adenine, which is linked to the 5-
adenoma A benign tumor of glandular carbon sugar ribose. In addition, there
tissue. are three phosphate groups linked to the

5
www.stemcell8.cn
adenovirus

ribose in a linear arrangement. The two ADH1 A yeast-transcription termination


terminal phosphate groups possess high- signal that is incorporated into yeast expres-
energy bonds that, when cleaved, provide sion vectors so that cloned yeast genes
energy for the cell. will form properly terminated mRNA to
ensure high amounts of protein expressed.
adenovirus This is a DNA-containing In many cases, mRNA that is not prop-
virus whose outer protein coat is in the erly terminated is unstable, thus resulting
shape of an icosahedron. There are more in decreased amounts of protein expressed
than 40 different types of adenoviruses, from the cloned insert.
some of which are among the many
viruses that are responsible for the com- adjuvent A substance that increases the
mon cold. potency of an immunogen or enhances
the ability of a weak antigen to induce an
adenylate cyclase An enzyme that cat- antibody response.
alyzes the synthesis of cyclic AMP from
ATP. See adenosine monophosphate; A-DNA One of the several forms that
adenosine triphosphate; and cyclic a double helix can assume under different
AMP. conditions in vivo or in vitro. The molec-
ular characteristics of this helix type dif-
adherens junctions Junctional com- fer from the more common B form that is
plexes that occur at (and anchor) the ter- believed to be predominant under physio-
mini of actin (see actin) cytoskeletal (see logical conditions. The A form is stable in
cytoskeleton) elements. Adherens junc- a less humid milieu and is both the form
tions bear a similarity to desmosomes of a DNA-RNA hybrid helix and the con-
(see desmosome) and hemidesmosomes formation assumed by regions of double-
(see hemidesmosome) in that adherens stranded RNA. A-DNA is a right-handed
junctional complexes on neighboring cells helix; however, it is more compact than
directly oppose one another. the B form. Other forms of DNA include
C-DNA and Z-DNA.
adhering junction A type of cell-cell
junction that is a highly specialized region adoptive immunity The transfer of
of the cells surfaces. It is also called a immunity to allografts to an animal that
desmosome. Adherent junctions are com- was previously tolerant of such allografts.
monly found in tissues that are subjected This is done by injection of lympho-
to mechanical stress such as the skin. cytes from an animal that is immune to
They provide very tight contact between allografts into the tolerant animal.
adjacent cells and enable groups of cells
to function as a unit in tissues. ADP See adenosine diphosphate.

adhesion plaque One of specialized adrenergic Pertaining to the general


regions of the plasma membrane that class of neurons that utilizes catechol-
are involved in the adherence of cells to amines (adrenaline, dopamine, and nor-
solid surfaces. Bundles of actin microfi la- adrenaline) as a neurotransmitter. See
ments called stress fibers attach to the neurotransmitter.
plasma membrane in adhesion plaques.
The protein vinculin is localized in adhe- adrenergic receptors Membrane recep-
sion plaques and serves to anchor these tors for adrenaline (epinephrine). Binding
microfi laments in place. When cells are of the adrenergic ligands to their recep-
transformed into a cancerous state, the tors upregulates various cellular pro-
adhesion plaques become disordered and cesses by activating G-proteins coupled
cells lose their ability to adhere properly to the receptor(s), which in turn activates
(loss of anchorage dependence), contrib- the enzyme, adenylyl cyclase, which cata-
uting to metastasis. lyzes the formation of cAMP. There are

6
www.stemcell8.cn
adult polycystic kidney disease

adrenergic
in turn stimulates the adrenal cortex to
adrenaline receptor adenylyl secrete glucocorticoids. One way that
(epinephrine) cyclase
glucocorticoids aid the body in deal-
ing with the physical consequences of
stress is by promoting a metabolic pro-
cess known as gluconeogenesis, which
-G
DP involves the synthesis of glucose from
various noncarbohydrate metabolites in
G
protein GTP the cell.

GDP adrenoleukodystrophy (X-linked ALD)


A group of disorders caused by the
inability to break down very long chain
saturated fatty acids (VLCFA) that, as
a consequence, accumulate in the adre-
-G nal cortex and brain, which leads to
TP
the breakdown of the myelin sheath of
nerve cells. The X-linked form (X-ALD),
in which there is an abnormal gene on
the X-chromosome, is the most common
form. Symptoms include vision loss, sei-
zures, difficulty swallowing, deafness,
and dementia.

GTP- adsorption A step in the replication of


bacterial viruses where the virus attaches
to a specific receptor located on the
ATP outer surface of the cell. The receptor is
cAMP complementary to the attachment site on
the virus. The specificity of a virus for
Adrenergic receptor a particular host or a small number of
hosts can be explained by the fact that
the virus can only adsorb to species of
four types of adrenergic receptors: 1, 2 , bacterial cells that make the appropri-
1, and 2 . In skeletal muscle and liver, ate receptors. Following adsorption, the
adrenergic receptors stimulate glycogen phage genome penetrates the cell where it
breakdown (glycogenolysis) to produce is replicated, transcribed, and translated
glucose for energy. On smooth muscle and viral components self-assemble into
cells, alpha receptors cause muscle con- new viral particles. This is followed by
traction while beta receptors on cardiac cell lysis, or the bursting open of the cell,
muscle cells act to cause more rapid and the release of the newly synthesized
contraction. virions, which can range in number from
50 to 200, depending on the virus.
adrenocorticotrophic hormone (ACTH)
A hormone, secreted by the anterior lobe adult polycystic kidney disease
of the pituitary gland, that controls the (APKD) A genetic kidney disease that
production and secretion of adrenal cor- is transmitted in an autosomal dominant
tex hormones. It is called a tropic hor- pattern of inheritance. The disease is
mone because it regulates the activity of characterized by the formation of large
other hormones. It, in turn, is regulated cysts in the kidneys resulting in gradual
by a factor that is produced by the hypo- loss of kidney tissue that can lead to renal
thalamus. Under conditions of stress, the failure. The disease is caused mainly by
anterior pituitary secretes ACTH that mutations in the genes PKD1 (polycys-

7
www.stemcell8.cn
aeration

tin 1; gene map locus 16p13.3-p13.12) afferent Refers to the direction in


and PKD2 (polycystin 2; gene map locus which a nerve impulse is moving toward
4q21-q23). Polycystin 1 codes for a pro- the central nervous system. Afferent
tein that interacts with polycystin 2, a neurons are those nerve cells that carry
protein that is involved in cell cycle regu- impulses from sensory organs, such
lation and intracellular calcium transport. as skin and tongue, toward the central
About 85 percent of APKD cases show an nervous system (i.e., the brain and the
abnormality in polycystin 1, while 515 spinal cord). This is opposed to efferent
percent of the cases involve polycystin 2. neurons, which carry impulses from the
central nervous system to effector organs
aeration The process whereby small such as muscle.
bubbles of air or oxygen are introduced
to liquid cultures of bacteria with agita- affi nity partitioning A modification
tion or stirring to ensure that the cells are of the aqueous two-phase separation
receiving a continuous and adequate sup- technique of using polymers and salts
ply of molecular oxygen. Aeration tech- to purify proteins. Affi nity partitioning
niques are applied to growth of microbes employs polymers with ligands attached
in industrial fermentors that have large to them, thus making them specific for
volume capacities, as well as to ordinary the proteins to be isolated.
flasks that are grown on a gyrating plat-
form in an incubator or waterbath. affi nity tailing Addition of specific
residues to the end of a protein so that
aerobe A microorganism that requires the protein can be easily identified or iso-
free oxygen for growth. During the pro- lated. This is accomplished by cloning the
cess of respiration, oxygen is the fi nal gene for a protein into an expression vec-
electron acceptor in the electron transport tor having a tail sequence at the 3 end
chain in these organisms. There are sev- of the insert, thus allowing a fusion of
eral different categories of aerobes. Obli- the cloned gene with the tail sequence.
gate aerobes die in the absence of oxygen. A common tail is six histidine residues
Microaerophiles thrive in the presence of that bind to a column of a nickel-charged
low amounts of oxygen, and facultative resin. Another molecule that is used to
anaerobes normally use oxygen but can tail a protein is thioredoxin: This allows
switch to an anaerobic metabolism when the protein to be purified on an agarose-
oxygen is depleted. Aerobes are more effi- based support with phenylarsine oxide
cient at producing energy than organisms (PAO) covalently bound to it or identified
that do not use oxygen. with an antithioredoxin antibody.

aerosol A mist or a cloud of water aflatoxin A highly toxic chemical in a


droplets suspended in air that can carry class of compounds called mycotoxins,
airborne pathogens and provide a vehicle which is produced by molds. Aflatoxin
for transmission. Aerosols may be formed is produced by Aspergillus fl avus, which
in the environment in numerous ways, grows on grains and has been found to
such as coughing, sneezing, splashing of contaminate many foodstuffs, including
falling raindrops, and spray from break- beans, cereals, and peanuts. Aflatoxin
ing waves. has been shown to be one of the most
potent liver carcinogens in existence.
aerotolerant Aerotolerant anaerobes
are microorganisms that do not use oxy- African sleeping sickness A disease
gen during metabolism but, unlike obli- also known as African trypanosomiasis
gate anaerobes, can survive in its pres- that affects humans and other mammals in
ence (see anaerobe). Members of the central Africa. It is spread by the tsetse fly,
genus Lactobacillus represent examples which is found in this region of the world.
of aerotolerant microorganisms. The fly is host to the parasitic protozoans,

8
www.stemcell8.cn
AIDS

the trypanosomes (T. brucei gambiense molecules in solutions of nucleic acids or


and T. brucei rhodesiense), which are the solutions of proteins according to their
causative agents. After being bitten by the size. In this way, molecular weights can
fly, the trypanosome enters the victims be determined or certain specific species
bloodstream. Without treatment, the dis- of molecules can be isolated and purified.
ease is nearly always fatal because the try- Ranges of sizes of fragments that can be
panosome enters the central nervous sys- separated are determined in part by the
tem and coma ensues. The trypanosomes percentage of agarose in the gel. The gels
have the ability to evade the hosts immune are immersed in a chamber containing a
system because they can repeatedly change buffer that can conduct a current across
their coat proteins, against which the host the gel. First, the samples are loaded into
makes antibodies. This pathogen is the slots in the top of the gel, then a dye is
subject of intense study due to its devastat- added, and fi nally the current is turned
ing effects on humans and livestock and to on.
the unusual characteristics of its molecular
biology. agglutination The clumping of cells
to one another caused by the binding of
agar A complex polysaccharide made by molecules (the agglutinin) to the cell sur-
the red marine alga Gelidium. It is used to face so that one or more cells are linked
thicken or solidify bacterial culture media to one another by an agglutinin bridge.
as well as certain foods. It was fi rst applied See hemagglutination.
for the use of culturing microorganisms
by the wife of Walter Hesse, a German Agrobacterium A genus of Gram-
microbiologist in the late 1800s. The negative aerobic bacteria that live in soil
properties of agar make it well suited for and cause crown gall disease in broad-
use in the culturing of microorganisms. leafed plants. This disease is seen as the
Very few microorganisms can degrade or growth of tumors on the trunks and
digest it, so it remains solidified in their sometimes the roots of infected plants.
presence. It remains solid at high enough The pathogenicity of the organisms is
temperatures (close to 100C) to be able due to the presence of a bacterial plas-
to incubate most microbes. When in mid called the Ti plasmid that can be
a molten state, it will solidify when the transferred to the plants cells from the
temperature drops below 42C, but it can bacteria. The plasmid contains genes
be kept in a liquid state for long periods that direct the plant cells to make nutri-
of time if incubated at 50C and above. ents that are useful for the bacteria and
It can be poured into tubes, flasks, petri gene products that interfere with normal
plates, and any other support and placed plant cell growth and division. Microbial
in any position to solidify, such as slanted geneticists and molecular biologists are
or straight to shape the surface to either intensely studying A. tumefaciens with
maximize or minimize oxygen availablity the hopes of being able to use this organ-
and surface area. Most solid media are ism to transfer useful genes into crop
1.5 percent agar. plants. This can be accomplished by using
the Ti plasmid as a vehicle to transfer
agarose A cross-linked polysaccharide genes such as those involved in nitrogen
that is isolated from red algae and used fi xation into crop plants after the plasmid
as a support medium in a number of mol- has been genetically engineered to elimi-
ecule separation and/or quantification nate its pathogenicity.
techniques, including gel electrophoresis
(see below), electroimmunodiffusion, and Agrobacterium tumefaciens See
immunoelectrophoresis. Agrobacterium.

agarose gel electrophoresis A proce- AIDS See acquired immunodefi-


dure that uses agarose gels to separate ciency syndrome.

9
www.stemcell8.cn
Akt

Akt A component of signaling path- coaguable, water-soluble globular protein


ways that involve phosphorylated phos- found in egg white, blood plasma (50 per-
phatidylinositol (PIPi). These pathways cent of protein content of human plasma),
are activated by a variety of growth and and various other animal and vegetable
survival factors that bind to cell mem- tissues. Bovine serum albumin is often
brane receptors, which then produce used in reaction mixtures and storage
PIPi, which, in turn, activates Akt. Once tubes to stabilize enzymes.
activated, Akt can either, 1) inhibit apop-
tosis or, 2) promote cell survival by acti- alcohol An organic compound that
vating the transcription factor, NF-kb. contains one or more hydroxyl groups
Akt, which is a serine/threonine kinase, (OH). Also the common name for etha-
is the cellular homologue of the retrovi- nol. Other alcohols include methanol and
rus oncogene, v-Akt. propanol.

Alagille syndrome A rare inherited alcohol dehydrogenase An enzyme


liver disease in which there is a buildup of that is responsible for the last step in
bile in the liver due to a lack or deficiency alcoholic fermentation by yeast, which
of bile ducts. This disease is seen in infants produces the alcohol in alcoholic bever-
and young children and is characterized ages. This enzyme converts acetaldehyde
by jaundice, stunted growth, and deformi- to ethanol.
ties of the face and other internal organs.
alcohol fuel An energy source that is
alanine One of the 20 amino acids that produced by a process known as biocon-
are incorporated into polypeptides. Ala- version, where organic waste material can
nine has an aliphatic uncharged R group be converted into fuel by microorganisms.
at pH 7.0 that consists of a methyl (CH3) One example is gasohol (90 percent gaso-
group as its side chain. Of all the amino line and 10 percent ethanol), which is an
acids with aliphatic side groups, it is the alternative fuel for automobiles. Another
least hydrophobic. is methane, which is an alternative to fos-
sil fuels and natural gas. Methane is a
alarmones Unusual dinucleotides con- by-product of the anaerobic treatment of
taining multiple phosphate groups that sewage.
are produced by bacteria under condi-
tions of stress, such as exposure to oxida- aldose A group of monosaccharides
tive agents (for example, hydrogen per- that contain an aldehyde group (CHO).
oxide) and which act in a hormonelike
fashion to regulate bacterial metabolism aldosterone A hormone secreted by the
under such conditions. adrenal cortex. Aldosterone is classified
as a mineralocorticoid, and it acts mainly
on the kidneys to control the water and
electrolyte balance in the body. This
enzyme ensures the retention of sodium
ions and water by causing their reabsorp-
tion into the blood before urine excre-
tion. It also causes the excretion of potas-
sium ions in the urine.

diadenosine 5,5-P1,P4-tetra algae Algae are photosynthetic eukary-


An alarmone otic organisms. Some are classified as Pro-
tista and others as plants according to their
morphology, which is varied. Some exist as
albumin The most abundant human single-celled organisms, and some are mul-
blood-plasma protein. It is a heat- ticellular. Usually, algae are aquatic, occu-

10
www.stemcell8.cn
allele-specific oligonucleotides

pying both marine and freshwater environ- is 9.0; and the soil bacterium Agrobacte-
ments. The dinoflagellates and the diatoms rium, whose optimum pH is 12.
are free floating, and the red and brown
algae require a solid substrate to which alkaptonuria The fi rst human genetic
they attach. They are further classified by disease identified when it was found to
their photosynthetic pigments, thus the follow the laws of Mendelian inheri-
names brown, red, green, and blue-green tance. Also known as dark urine dis-
algae. Many are of industrial importance ease, it was studied by Garrod and, in
providing thickeners for foods and bacte- 1902, was recognized to be inherited as
rial culture media. See agar. a recessive trait. Later, the biochemical
nature of the disease was also uncovered.
alignment Placement of sequences of The disease is characterized by a depos-
unknown genes or proteins side by side its of dark pigment in connective tissue
to analyze the similarities or differences and in the urine after exposure to air.
between them. These alignments are Later stages of the disease result in severe
done on computers, utilizing databases in forms of arthritis and possibly death due
which sequences are stored. to blockages in the arteries and valves
of the heart. One in a million people is
alkali Any basic (high pH) solution or born with this disease; it results from a
compound. Alkaline conditions denature deficiency in the enzyme homogentisic
DNA and have been employed in meth- acid deoxygenase, which results in the
ods to isolate plasmid DNA from chro- accumulation of homogentisic acid in the
mosomal DNA. Certain alkali treatments urine.
have been used in the isolation of bacte-
rial proteins. Of course, the success of alkylating agent A type of muta-
this method depends upon the alkali sta- gen that adds alkyl groups such as the
bility of the protein to be isolated. methyl group (CH 3) and the ethyl
group (CH 2CH 3) to bases in DNA.
alkaline phosphatase An enzyme used One such mutagen is ethylmethane sul-
in DNA cloning procedures to remove fonate (EMS), which can alkylate either
the terminal phosphates from the single- thymine or guanine residues and cause
stranded tail of vector molecules that are them to mispair during DNA replication.
cleaved with a restriction enzyme, thus This causes transition type mutations in
preventing recircularization of the vec- DNA.
tor and enhancing the recovery of vectors
with inserts. allele One of several alternative forms
of the same gene. A single gene can have
alkaloids A class of 3,000 compounds as few as one or as many as 100 different
containing nitrogen that are produced by alleles. Alleles are differences in the base
plants but that exert potent physiologi- sequence of a single gene among individu-
cal effects on animals. They are synthe- als in a population or on the two homol-
sized from aromatic amino acid precur- ogous chromosomes in one individual.
sors such as tyrosine, tryptophan, and They are the cause of genetic variation or
phenylalanine. Some examples are mor- different expressions of a trait in a popu-
phine, cocaine, nicotine, codeine, and lation of organisms.
colchicine.
allele-specific oligonucleotides A
alkalophiles (alkalinophiles) These probe designed to detect single base-
are microorganisms that flourish in basic pair changes in a gene. Under very spe-
environments (base loving). Alkalino- cific conditions, a nucleotide sequence of
philes exists at a pH range of about 712. about 20 base pairs will hybridize to its
They include Vibrio cholerae, the causi- complementary sequence, but not to one
tive agent of cholera, whose optimum pH with a one base-pair change.

11
www.stemcell8.cn
allograft immunity

allograft immunity The state of the alpha-actinin A protein that binds


immune system in which grafted tissue to the actin fiber in an adhesion plaque,
originating from a genetically dissimilar where it is localized.
animal provokes attack by the immune
system of the host animal (i.e., graft alpha-amanitin A potent toxin derived
rejection). from the Amanita mushroom, also known
as death cap or destroying angel. It has
allolactose A derivative of lactose and been used to distinquish the three nuclear
the true inducer of the lactose operon in RNA polymerases of eucaryotes, Poly-
bacteria. Inside the cell, lactose is con- merase I is insensitive to alpha-amanitin,
verted to allolactose, which in turn acti- but RNA polymerase II is highly sensi-
vates the three structural genes involved tive, and RNA polymerase III is sensitive
in the utilization of lactose as a carbon but at higher concentrations of the toxin.
source. When lactose is present in the
medium, the genes required for its break- alpha-blockers A class of drugs that
down are active; when it is not present, are used to treat high blood pressure
they are shut off. See lac operon. as well as urinary problems related to
enlarged prostate (benign prostatic
allopolyploid A hybrid organism, usu- hyperplasia; BPH) by acting as antago-
ally a plant, that has been bred from two nists of alpha adrenergic receptors on
closely related species and contains one smooth muscle. In blood vessels, this
or more extra full sets of chromosomes. inhibits contraction of the muscle, which
For example, if the parents each have two causes vasodilation, thus lowering blood
sets of chromosomes, the allopolyploid pressure. In prostate tissue, relaxation of
offspring, instead of having the normal smooth muscle allows increased urinary
two sets, may have four. The hybrid con- flow. Cardura, Terazosin, and Doxazosin
tains genetic information that is different are examples of alpha-blockers.
from either parent.
alpha-fetoprotein An embryonic pro-
allopurinol A derivative of the purine tein that is believed to function as the
base hypoxanthine used to treat gout. As embryonic counterpart of albumin and
an inhibitor of the enzyme xanthine oxi- with which it shows great similarity in
dase, allopurinol acts by preventing the amino acid sequence and structure.
accumulation of uric acid. See uric acid. The presence of alpha-fetoprotein in
adult serum is a diagnostic indicator for
all-or-nothing phenomenon This phrase some types of tumors such as teratomas
refers to the condition in which a nerve and liver cancers (hepatomas). Alpha-
cell must receive its threshold level fetoprotein is also present in the sera of
of stimulation to respond and start an pregnant women. Abnormal levels of
action potential. A nerve will either fi re alpha-fetoprotein during pregnancy may
an impulse or not fi re at all if the stimulus be indicative of certain fetal disorders.
is below threshold. There is no such thing
as a weak response to a weak stimulus. alpha-helix Refers to one type of three-
See action potential. dimensional conformation that a protein
assumes in the cell. An alpha-helix is sta-
allosteric enzymes Enzymes that have bilized by the formation of many hydro-
many subunits and many active sites. gen bonds between nearby amino acids
They display substrate-induced conforma- in the protein. Hydrogen bonds form
tional changes and have different roles or between every three amino acid residues.
functions in their different conformations. This provides the regularity to the struc-
They play an important role in the regula- ture of the helix. Another conformation
tion of metabolic pathways and the regula- of proteins is the beta pleated sheet. See
tion of gene expression. beta-pleated sheet.

12
www.stemcell8.cn
amide

Alu elements A family of related DNA ecules that allow these mutated tRNAs to
sequences that are widely and randomly recognize the amber mutation UAG (see
dispersed through mammalian genomes. amber mutation). Ordinarily, a UAG
They are about 300 base pairs in length codon in a message signals the termina-
and are classified as moderately repetitive tion of translation, but a tRNA with an
DNA sequences. There are about 600,000 amber-suppressor mutation has an anti-
copies of these sequences in the human codon that is complementary (CUA) to
genome. At the ends of these sequences is the termination codon. It can therefore
a cleavage site for the restriction enzyme insert the amino acid that it is carrying at
Alu. Their purpose, if any, in the genome that site in the growing polypeptide chain
is not known. and avert chain termination.

Alzheimers disease (AD) A progres- ambient The physical conditions in an


sive disease of the brain characterized by organisms surrounding environment.
memory loss and cognitive dysfunction Microorganisms that live in the human
that was fi rst described in 1907 by Dr. gut, for example, have an ambient tem-
Alois Alzheimer. Alzheimers disease is perature of 37C. Organisms that exist in
caused by the deposition of beta amyloid dust particles in a room have an ambient
protein, which forms plaques and causes temperature of about 23C, or room tem-
the death of nerve cells in critical areas of perature. Ambient conditions also can
the brain. While the vast majority of AD include atmospheric pressure, humidity,
cases are seen in later life, a small num- oxygen levels, and other physical param-
ber (<3 percent) of cases show a pattern eters that surround an organism.
of inheritance, and these tend to manifest
much earlier (early onset Alzheimers). Ames test A method for screening
The inherited form of AD has been traced potential mutagens and carcinogens.
to dominant mutations in at least three This test was developed by Bruce Ames
genes: Amyloid Precursor Protein (APP) in the early 1970s and cut down drasti-
located on chromosome 21, presenilin 1 cally on the time and expense that is
located on chromosome 14, and preseni- involved in animal testing. The Ames
lin 2 located on chromosome 1. test requires the use of bacteria to deter-
mine the possible mutagenic potential of
amber codon The codon UAG, which a chemical. It relies on the principle that
is one of the three codons that does not the chemical structure and properties
code for an amino acid but represents a of DNA are universal. In addition, the
stop signal. mechanisms for toxicity in a bacterium
mimic those of a mammal if the appro-
amber mutation A type of genetic priate liver enzymes are provided to
mutation in a class called nonsense muta- process the chemical in the same way a
tions. An amber mutation arises when a mammal would. A chemical that causes
three-base-pair sequence in DNA (codon) mutations in bacteria would likely do the
such as UUG, coding for a specific amino same in a mammal, and because 90 per-
acid, mutates to a UAG codon that does cent of all known carcinogens are muta-
not code for any amino acid. UAG is a gens, a chemical found to be a mutagen
termination codon because it causes the in the Ames test would be a suspected
termination of protein synthesis. Any carcinogen.
mutation that results in a UAG termina-
tion codon is called an amber mutation. amide The product of the reaction
There are also mutations called opal and between an amine compound and car-
ochre that are also nonsense mutations. boxylic acid. peptide bonds are the
bonds that link amino acids together in
amber suppressor Mutations in the proteins and are a type of amide bond
anticodon of several different tRNA mol- between two amino acids. The amino

13
www.stemcell8.cn
amine

group of one amino acid is linked to the acids that are incorporated into proteins
carboxyl group of the next amino acid. is the substrate of one of the enzymes.
In addition, each enzyme recognizes the
amine Compounds that contain an appropriate tRNA(s) to charge.
amino group (NH 2). Amino acids are
amines. See amino acid and amino aminoglycoside antibiotics A group
group. of antibiotics that act to kill a broad range
of bacteria by interfering with protein
amino acid The building blocks of synthesis at the bacterial ribosome. They
proteins. Amino acids contain a free are produced naturally by members of
carboxyl group (COOH), a free amino the soil-dwelling genus Streptomyces and
group (NH 2), a hydrogen atom, and include streptomycin and kanamycin.
a variable side group (R) attached to a
single carbon. (One exception to this is amino group The NH 2 group in
proline, whose amino group is involved a molecule. The presence of an amino
in a cyclic structure.) The physical and group is the defi ning characteristic of the
chemical properties vary among the R group of organic compounds known as
groups. However, there are several clas- amines.
sifications that put certain R groups in
the same category because they share aminolevulinic acid (ALA) The first
similar properties. These are the acidic, committed intermediate in the synthe-
basic, aliphatic, aromatic, and hydroxyl- sis of heme (see heme) and chlorophylls.
containing or sulfur-containing amino Cells that either overproduce ALA or are
side groups. There are 20 different amino fed large amounts of ALA overproduce
acids that are found in proteins. porphyrins, or intermediates in the heme
biosynthetic pathway. Porphyrins produce
aminoacyl-tRNA A tRNA that is car- toxic compounds to the cell when they react
rying its specified amino acid; also called with oxygen. Thus ALA is being tested as
a charged tRNA. The specificity of charg- a weed killer and as a photodynamic agent
ing of tRNA molecules is carried out by in the treatment of skin lesions.
20 different enzymes called aminoacyl
tRNA synthetases. Each of the 20 amino 6-aminopenicillic acid A chemical
structure that is found in the different
natural and semisynthetic penicillins.
This common nucleus of the penicillins
contains the beta-lactam ring structure.
In addition to the common core, 6-
aminopenicillic acid, all penicillins contain
a variable side group that distinguishes
them from one another.

2-aminopurine A purine derivative that


is a potent mutagenic agent because it be-
comes incorporated into DNA in place of
adenine. As a result, it induces mistakes in
DNA during DNA replication.

amino side groups See amino acid.

amino sugars These are derivatives of


simple sugars that have been modified to
form amines because of the addition of
Aminoacyl-tRNA an NH 2 group in place of the hydroxyl

14
www.stemcell8.cn
amplification

group normally found at carbon 2. Two ter of the micelle away from water. Fatty
commonly found amino sugars are D-glu- acids are amphipathic. Amphipathic mol-
cosamine, which is a major component of ecules are responsible for the properties
chitin (the outer hard covering of insects), of biological membranes.
and D-galactosamine, which is found in
cartilage. amphiphysin A protein found in nerve
terminals, particularly at the synapse
amino terminal Also called the N- where it is believed to be involved in the
terminus; one of the ends of a polypeptide recruitment of dynamin at sites of endo-
chain. This end of the polypeptide con- cytosis during the process of synaptic
sists of an unreacted amino group. The transmission. Amphiphysin autoantibod-
other end is called the carboxyl terminus, ies are found in patients with Stiffman
or C-terminus. syndrome (SMS). Amphiphysin autoan-
tibodies are also associated with breast
ammonium sulfate precipitation cancer and small cell lung carcinoma.
Salting out of proteins in solution. A
fi rst step in the purification of proteins amphoteric The description of a sub-
from cell extracts; ammonium sulfate, stance that has both acidic and basic
which promotes hydrophobic interac- groups and has properties of both acids
tions, is the most common salt used to and bases.
fractionate proteins according to their
solubility in the salt solution. ampicillin A semisynthetic form of
the antibiotic penicillin; an antimicro-
amniocentesis A procedure for test- bial agent that kills bacteria by inhibiting
ing the karyotype of a fetus in utero. the formation of bacterial cell walls. The
Cells from the amniotic fluid surround- addition of an amino group to penicillin
ing the fetus are taken from the mother makes ampicillin effective against gram
and cultured in the lab. Karyotype anal- negative organisms, thus widening the
ysis of the cells will determine the sex of antibiotics spectrum of activity.
the fetus, including any gross deformi-
ties of the chromosomes or a chromo- amplifiable selection Exploitation of a
some number that signals certain genetic natural phenomenon in which some
diseases. transformed cell lines undergo local
repeated DNA replication to produce
AMP See adenosine monophosphate. many copies of genes at those locations.
A commonly used system is the use of
amphibolic A metabolic pathway, methotrexate to amplify the region
one that is catalytic and anabolic, that around the dihydrofolate reductase
can both degrade metabolites as well as (DHFR) gene.
synthesize them. These pathways allow
breakdown products of one pathway to amplification Repeated replication of
be used as substrates in the synthesis of a plasmids or sequences. Plasmid amplifi-
compound in another pathway. cation is a process that is used to increase
the replication of plasmids over that of
amphipathic compound A compound chromosomes so that the plasmid isola-
that contains both polar and nonpolar tion from whole cells is facilitated. The
groups. Polar groups are soluble in water process involves growing cells with
(hydrophilic), and nonpolar groups are amplifiable plasmids in the antibiotic
not (hydrophobic). In water or aqueous chloramphenicol that stops chromosomal
environments, amphipathic compounds DNA replication but does not affect plas-
form micelles, or small vesicles with polar mid DNA replication. Specific sequences
regions in contact with water and nonpo- of DNA can be amplified using the tech-
lar regions regions sequestered in the cen- nique of PCR (polymerase chain reaction).

15
www.stemcell8.cn
amplification refractory mutation system

amplification refractory mutation sys- and/or function to another compound or


tem (ARMS) A PCR (polymerase chain biomolecule.
reaction) technique that is used to differ-
entially amplify specific alleles of a gene. anaphase A stage during mitosis or cell
Primers (oligonucleotides) for the PCR are division where chromosomes split at the
constructed so that the 3 base contains centromere and the resulting chromatids
the specific base change of the allele. Only move to opposite ends of the cell. During
DNA targets that hybridize (see hybrid- meiosis, or reduction division, there are
ization) to the primer will be amplified, two anaphase stages. During anaphase I,
and all other alleles with mismatch base homologous pairs of chromosomes sepa-
pairs and that do not pair with the 3 base rate from each other with their centro-
of the primer will not be amplified. meres intact and move to opposite ends of
the cell. Anaphase II, during the second
amyloid protein The protein form- meiotic division, resembles the anaphase
ing the core of the characteristic plaques stage in mitosis, as described above.
seen in Alzheimers disease. The pro-
tein is composed of 3943 amino acids anaphylotoxin A substance released
and exhibits a tendency to form insoluble by the body as part of an immunological
precipitates in solution. The formation of response to the presence of a foreign anti-
plaques is believed to reflect the tendency gen. Anaphylotoxins stimulate the release
to aggregate out of the cell fluid, causing of histamines, which cause inflammation
interruption of neural transmission. in tissues.

amylose A starch made up of a long, androgens A group of male sex hor-


unbranched chain of glucose. A polymer mones that are responsible for the devel-
of monosaccharides is called a polysac- opment and the maintainence of mascu-
charide. Amylose is the principle storage line features and organs. Testosterone is
starch of plants. an androgen.

anabolic A type of metabolic pathway aneuploid An unbalanced set of chro-


in which complex molecules are synthe- mosomes that results from either the loss
sized from smaller precursors, usually in or the gain of chromosomes. An individ-
a series of steps; the type of metabolism ual with the normal complement of two
that builds molecules as opposed to cata- copies of each chromosome (diploid) is
bolic metabolism, which is degradative. disomic. Trisomy is the condition of hav-
Energy is usually required for anabolic ing one extra chromosome, and mono-
metabolism. An example would be the somy is a loss of one chromosome.
synthesis of polypeptides from amino
acids or the synthesis of nucleic acids Angelman syndrome (AS) A neuro-
from nucleotides. See catabolism. logical condition fi rst described by Dr.
Harry Angelman in 1965 that is char-
anaerobe A microorganism that does acterized by small head size, severe
not or cannot use oxygen during respi- learning difficulties, fi ne tremors, jerky
ration. Obligate anaerobes such as the limb movements, and epileptic seizures.
genus Clostridium will die in the pres- Cytogenetically, the disease is associated
ence of oxygen. Others such as E. coli are with a deletion of chromosome 15 and is
classified as facultative anaerobes because now known to involve a cluster of genes
they will use oxygen when present but involved in the regulation of ubiquitin at
can switch to anaerobic respiration in its gene map locus 15q11-13.
absence.
angiogenesis The process by which
analog A compound that has impor- new capillaries are formed from endothe-
tant biochemical similarities in structure lial B cells. Angiogenesis is stimulated by

16
www.stemcell8.cn
antigen

a signal in the form of a growth factor(s) antibiotic resistance Microorganisms may


and is comprised of at least four compo- have a natural resistance or develop resis-
nents: (1) the production of proteases that tance to an antibiotic so that the drug is not
allows endothelial cells to invade the sur- effective in inhibiting growth or killing.
rounding tissue, (2) directed movement
of endothelial cells toward the source of antibiotic-resistance genes Genes that
the stimulating growth factors, (3) prolif- confer antibiotic resistance to a microor-
eration, and (4) formation of tubules (i.e., ganism. Examples are genes that encode
capillaries). enzymes that destroy the antibiotic; genes
that code for the target of the antibiotic
angiopoietins A group of secreted fac- but that become mutated so that the tar-
tors (Ang-1, Ang-2, Ang-3, Ang-4) that, get no longer responds to the drug; or
together with VEGF, regulates endothe- genes that encode proteins that prevent
lial cell survival and capillary formation the antibiotic from being taken up by the
through the receptor tyrosine kinase, Tie- mircroorganism.
2, on the endothelial cell surfaces. The
angiopoietins are found in the mamma- antibodies Proteins that circulate in the
lian metanephros, the precursor of the bloodstream and bind to foreign invading
kidney, and they are implicated in dereg- substances (antigens, e.g., bacteria, tox-
ulated vessel growth in Wilms kidney ins, certain viruses) with a great deal of
tumors and in blood vessel remodeling specificity. Antibodies are the mediators
kidney tissue following toxic injury. of the immune response to soluble anti-
gens. Immunoglobulins.
angstrom () A unit of measurement
usually used for wavelengths or cellular antibody-producing cell An activated
structures. B lymphocyte or plasma cell secretes anti-
1 = 10 10 meters, or 10 6 millimeters, bodies. Each plasma cell secretes an anti-
or 10 4 (0.0001) micrometers, body with specificity for one antigen.
or 0.1 nanometers.
anticoagulant A chemical substance
anion A negatively charged ion. that prevents the coagulation of blood.

anneal Complementary single strands anticodon A three-nucleotide base-


of DNA or DNA and RNA that form pair sequence that is antiparallel and
hydrogen bonds between complementary complementary to a codon. The antico-
base pairs to form double-stranded DNA don is found on a tRNA and interacts
or DNA-RNA hybrids. with a specifi c codon on the mRNA so
that an amino acid will be placed in
antennapedia complex A genetic locus the correct position according to the
in the homeotic box that is defi ned by mRNA during translation or protein
mutations that cause developmental synthesis.
defects in the thoracic and head segments
of the fruit fly, Drosophila melanogaster. antidiuretic A chemical substance that
See homeobox. counteracts a diuretic.

antibiotic A substance usually made antifungicide A substance or drug that


by a microorganism that inhibits the kills fungi.
growth or kills another microorganism,
for example, penicillin. There are many antigen A substance that will stimulate
synthetic or manufactured antibiotics the production of specific neutralizing
that are derivatives of naturally occurring antibodies in an immune response. Any
antibiotics and are available for medici- chemical substance, usually a protein,
nal or research purposes. that will interact with an antibody.

17
www.stemcell8.cn
antigenic determinant

antigenic determinant A small portion ple, sulfa drugs that block the synthesis
of the antigen that determines the specifi- of the vitamin folic acid.
cally of the antigen-antibody reaction.
antimorphic allele A mutant allele
antigenic variation A sequential change that has an antagonistic reaction to the
in the structure of an antigen of microor- normal, wild type of allele. A person who
ganisms and viruses so that antigens on has both an antimorphic allele and wild
these pathogens will not be recognized by type of allele for a particular gene will
antibodies already produced in the host. have less of that gene product than an
The disease-relapsing fever, which is char- individual who has a deletion for that
acterized by cyclic infections by the same gene and the wild type of allele.
bacterium, is due to the ability of the bac-
terium to change its antigenic makeup and antimutator A gene that decreases the
thus avoid immunity built up by the host. spontaneous mutation rate of an organ-
A more subtle type of antigenic variation ism. These genes are usually involved in
is seen in the antigenic shift (major anti- some DNA repair or metabolism process.
genic change) and antigenic drift (minor
antigenic change) seen in the influenza anti-oncogene A tumor suppressor
virus that result in loss of immunity by gene, or a gene whose absense is needed
populations and influenza pandemics and for an oncogenic event. Loss or inactiva-
epidemics every number of years. tion of a tumor suppressor gene by either
mutation or deletion is believed to be an
antigen-processing/-presenting cell important event in the development of a
Any of a heterogeneous group of cells tumor.
that bind foreign antigens to their sur-
face and then interact with helper T antiparallel Refers to the structure of
cells, a process that is required for DNA. The two strands of complementary
T-cell activation. Antigen-presenting cells DNA are antiparallel, that is, the 5 end
include dendritic cells in lymphoid tissue, of one stand is paired with the 3 end of
Langerhans cells found in skin, and some the other and vice versa.
macrophages.
antiparasite A substance or chemical
antihelminthic agent A substance or that inhibits or kills parasites.
drug that inhibits the growth or kills hel-
minth parasites. antiport The transport of two sub-
stances across the cell membrane that are
antihistamine A substance or drug coupled but in opposite directions.
that blocks the effects of histamines in
the inflammatory process; a drug that antisense RNA A strand of RNA that
relieves allergy symptoms. is complementary to that of a messenger
RNA. An antisense RNA would bind to
anti-idiotype antibodies An anti- the messenger and prevent synthesis of
body made in response to a unique the protein encoded by the message. Anti-
antigen-combining site of an antibody. sense RNA is being explored as a pos-
The resulting antibody may have a struc- sible therapeutic agent for viral infections
tural similarity to the original antigen and to prevent certain cancer genes from
and may stimulate antibodies against it, being expressed into proteins.
thus serving as a vaccine.
antisense strand Of the two DNA
antimetabolite A chemical that inhib- strands in a double-stranded DNA mol-
its the growth of microorganisms because ecule, the antisense strand is the one that
it blocks the synthesis of some metabolite is not used as the template for RNA syn-
needed by the microorganism, for exam- thesis.

18
www.stemcell8.cn
apyrimidinic site

antiseptic Any chemical that is com- in a variety of ways, the main pathway
monly used to kill microorganisms to is initiated by the binding of a ligand to
prevent infection. the Fas receptor or by binding of tumor
necrosis factor (TNF) to its receptor.
antitermination factor A protein that Activation of the receptors sets off a cas-
prevents the termination of transcription. cade by which proteases called caspases
It is involved in certain mechanisms of are activated, ultimately resulting in deg-
gene expression control. radation of DNA by DNase, proteolysis,
and cell death.
apaf-1 A cytoplasmic protein that initi-
ates the process of apoptosis by cleaving, aptamer An oligonucleotide of
and thereby activating, caspase 9. Acti- DNA or RNA or a peptide that binds to
vation of caspase 9 causes subsequent and inactivates proteins. Often, libraries
activation of other caspases in a reaction of sequences are used to inhibit the pro-
chain that ultimately commits the cell to tein, and the sequences that are success-
undergo apoptosis. Cleavage of caspase ful are amplified and identified. Aptam-
9 requires the formation of a complex ers can be used to study the active site of
between apaf-1, cytochrome c, and dATP the protein or they can be developed into
to form an oligomeric structure called an therapeutics.
apoptosome.
apurinic site A site on the DNA in
APC syndrome Familial adenomatous which a purine is missing but the phos-
polyposis coli; a genetic disease character- phodiester sugar backbone is still intact.
ized by the development of benign polyps
in the colon, a condition that frequently apyrimidinic site A site on the DNA in
precedes the development of malignant which a pyrimidine is missing but the phos-
colon cancer. The genetic locus of APC phodiester sugar backbone is still intact.
has been shown to reside on human chro-
mosome 5. Research aimed at mapping
and then cloning the causative gene(s) via
chromosome walking is currently under Fas
ligand
way. See genetic disease.
TNF
Fas

TNF-R1

APH Aminoglycoside 3 phosphotrans-


ferase; a bacterial gene that codes for
an enzyme that confers resistance to the FADD TRADD

antibiotic neomycin. The APH gene is


caspase 8
commonly used as a selectable marker in
transfection experiments in that cells that
do not contain the gene can be eliminated
from a population by exposure to neomy-
cin. See negative selection. mitochondrion
cytochrome c

apoenzyme The protein moiety or part effector


caspases
of an enzyme without its cofactor; nor-
mally inactive.

apoptosis Programmed cell death, or a degradation of


regulated set of reactions that results in DNA and protein
cell death. Apoptosis regulates the bal-
ance between cell growth and multipli- cell death
cation and eliminates unnecessary cells.
Although apoptosis can be brought about Apoptosis

19
www.stemcell8.cn
aqueous

aqueous Pertaining to water; for exam- human immunodefi ciency virus (HIV)
ple, the aqueous phase after separation infection, including general malaise,
with an organic solvent would be the night sweats, dementia, wasting, and
water phase. opportunistic diseases associated with
immunodefi ciency such as Kaposis
aqueous two-phase separation A sarcoma (a rare form of skin cancer),
method to partition proteins during puri- pneumonia (generally caused by Pneu-
fication using solutions of polyethylene mocystis carinii), and retinitis (caused
glycol and dextran or polyethylene glycol by cytomegalovirus).
and certain salts such as a phosphate.
Archaebacteria A group of bacte-
arabinosyladenine (AraA) An antivi- ria including those that produce meth-
ral anitibiotic that is used to treat viral ane from carbon dioxide and hydro-
encephalitis. AraA is a derivative of the gen (methanogens) and those that live
normal purine nucleoside, adenosine, in high-salt environments (halophiles)
in which the sugar, ribose, has been that appear to be very different from
replaced with one of its optical isomers, and more primitive than other living
arabinose. bacteria. It is believed that Archaebac-
teria have evolved separately from the
arabinosylcytosine (AraC) An anti- true bacteria (Eubacteria) and from the
biotic that acts by blocking DNA syn- eukaryotes and that they constitute a
thesis. AraC is a derivative of the nor- third group of organisms.
mal pyrimidine nucleoside, cytosine,
in which the sugar, ribose, has been arginine An amino acid with the side
replaced with one of its optical isomers, chain:
arabinose. (CH 2)3 NHC=NH
\
arachidonic acid A 20-carbon fatty NH 2
acid with four double bonds. It serves as
a precursor for the synthesis of prosta- argininemia A disease caused by a
glandins. deficiency of the enzyme arginase that
catalyzes the last step of the urea cycle in
ARC AIDS-related complex, or a which arginine is hydrolyzed to urea and
series of symptoms related to an active ornithine. The syndrome is characterized
by hyperammonemia, encephalopathy,
and respiratory alkalosis. The disease
gene is an autosomal recessive, at gene
map locus 6q23.

ARMS See amplification refrac-


tory mutation system.

aromatic An organic compound that


contains a benzene-derived ring.

ARS element Autonomously replicat-


ing sequences (ARS) found on yeast plas-
mids that are initiation sites for plasmid
replication. Plasmids that lack such sites
will not replicate.

Arthus reaction An inflammatory


Arabinosylcytosine response caused by the production or

20
www.stemcell8.cn
atomic-force microscopy

depositing of antigen-antibody complexes are used in a number of industrial


in tissues. fermentations.

artifact The appearance of a structure assay A test. In an enzyme assay, an


in microscopy or an experimental result enzyme is tested for activity under spe-
that is not real but is due to experimental cific conditions.
procedures used.
ataxia telangiectasia (AT) A rare
Ascomycetes A class of fungi that is human disease associated with a defect
distinguished by a structure, the ascus. in the DNA repair system. It is a fatal dis-
ease that is characterized by a damaged
ascorbic acid Vitamin C. Lack of immune system, premature aging and a
this vitamin in the diet results in the predisposition to some cancers. Individu-
disease scurvy. Ascorbic acid is a reduc- als who have only one copy of the gene
ing agent that keeps the enzyme pro- ATM do not have the disease but are very
lyl hydrolase in active form. Collagen sensitive to X-rays or chemicals, which
synthesized in the absence of ascorbic cause DNA damage, and these individuals
acid is insuffi ciently hydroxylated, can are prone to developing cancer. The gene
not form fi bers properly, and causes involved in AT (called ATM) is one of a
the skin lesions that are associated class of genes called tumor suppressors.
with scurvy.
AT content The fraction of the total
ascus A saclike structure that pro- nucleotides in a DNA molecule that are
duces ascospores, or the sexual spores of either adenine or thymine nucleotides;
the ascomycetes. generally given as a percentage.

aseptic Without germs; sterile. AT/GC ratio The ratio of adenine plus
thymine base pairs to guanine plus cyto-
asexual reproduction Reproduction sine base pairs in a molecule of DNA.
in the absence of any sexual process, or
the reproduction of a unicellular organ- ATM A tumor suppressor gene that is
ism by cell division, where a single parent activated by DNA strand breaks. Acti-
is the sole contributer of genetic informa- vated ATM in turn activates the chk2
tion to its offspring. kinase, which results in cell cycle arrest
in G2. ATM is an acronym for ataxia tel-
asparagine An amino acid with the angiectasia mutated because both copies
side chain: of this gene are mutated in patients with
(CH 2)C=O this disease. Mutations in the ATM gene
\ result in hypersensitivity to radiation and
NH 2 a tendency to accumulate mutations in
other genes, which can lead to cancer,
aspartame An artificial sweetener that particularly breast cancer, leukemia,
uses the amino acid phenylalanie as a and lymphoma. Also, mutations in ATM
precursor. can cause cells to die, particularly in the
cerebellum, which results in the prob-
aspartic acid An amino acid with the lems with limb movement seen in ataxia
side chain: telangiectasia. The ATM gene is located
(CH 2) C=O on the long (q) arm of chromosome 11 at
\ position 22.3 (gene map locus 11q22.3).
OH
atomic-force microscopy (AFM) A
Aspergillus A genus of fungi that are device for visualizing objects with a max-
important economically because they imum resolution of about 10 pm, about

21
www.stemcell8.cn
ATP

the size of small molecules. Unlike tra- autogenous control Control of gene
ditional microscopes, the AFM does not expression by the genes product or pro-
contain a lens but utilizes a probe that tein encoded by the gene.
measures the attractive or repulsive forces
between the probe tip and the molecu- autoimmune The inability to distinquish
lar structure being visualized as the tip self from nonself, or a state where the body
is moved along the surface of the speci- produces antibodies to its own cells.
men. The movement of the probe tip gives
rise to an electrical signal, which is trans- autolysin An enzyme that causes cellu-
lated into an image by computer. Unlike lar self-destruction of the same cells that
electron microscopes, AFMs can image synthesize it.
samples either in air or in liquids.
autolysis The self-degradation of a cell
ATP See adenosine triphosphate. by release of hydrolytic enzymes of the
lysosome. In the case of bacteria, autoly-
ATPase Any of a class of enzymes that sis is brought about by self-destruction of
acts to remove one or more phosphate the cell wall by a specific enzyme.
groups from ATP to produce ADP or
AMP and inorganic phosphate by hydro- autonomic nervous system The part
lysis. The release of phosphate is accom- of the nervous system that regulates
panied by the release of energy that is involuntary responses.
used to power various cellular functions.
autonomously replicating sequences
atrial natruiretic factor (ANF) A (ARS) Special nucleotide sequences in
hormone produced by the right atrium of the DNA of chromosomes that serve as
the heart that stimulates sodium excre- sites where DNA replication begins.
tion by the kidneys and is involved in
the regulation of blood pressure. ANF
autoradiography A technique that
is believed to play a key role in cardio-
involves using a radioactively labeled
vascular homeostasis by acting on recep-
compound to localize a reaction in a cell
tors that stimulate the formaton of cyclic
or to study a process and using photo-
GMP (cGMP). ANF is currently the tar-
graphic fi lm to visualize the location of
get of research on new antihypertensive
the label.
and diuretic drugs.

attenuation 1. A decrease in virulence autosomal dominant A mutant allele


of a pathogen. found on one of the autosomes that will
2. A mechanism of gene regulation in always produce a specific trait or disease.
bacteria in which availability of certain Therefore the chance of passing the gene
amino acids will control the expression of or the disease to progeny in a pregnancy
genes for their own synthesis by causing is 50 percent.
premature termination of transcription of
the genes involved in the synthesis. autosome A chromosome that is not a
sex chromosome.
att site A site on the Escherichia coli
bacterial chromosome that interacts with autotroph An organism that can make
the bacteriophage lambda genome and at its own nutrients and organic carbon
which the bacteriophage genome integrates compounds from inorganic carbon in the
into the bacterial genome resulting in lysog- form of carbon dioxide.
enization of the bacterium. See lysogenic.
auxin A plant hormone that regulates
autoclave An apparatus that uses steam cell reproduction and cell elongation in
under pressure to sterilize materials. certain tissues.

22
www.stemcell8.cn
Azotobacter

auxotroph A bacterial mutant that can axis polarity The orientation of the
no longer make some required nutrient. body in space, depending upon three
axes: the anterior/posterior body axis,
Avastin An anticancer drug that acts by the dorsal/ventral axis, and the medial/
blocking the formation of new blood ves- lateral axis. During the development
sels that feed tumors. Avastin is a recom- of the embryo, genes that control axis
binant antibody to vascular endothelial polarity are the axis formation genes
growth factor (VEGF), which has been that establish embryonic body axis and
engineered by the insertion of certain the axis polarity genes that control ante-
human sequences to avoid rejection by rior/posterior and dorsal/ventral body
the patients immune system. Avastin acts orientation.
by blocking VEGF, a protein that plays a
key role in tumor angiogenesis. Avastin is axon Extention of a nerve cell that con-
used in combination with 5-Fluorouracil ducts impulses away from the cell body.
chemotherapy to treat patients with pri-
mary metastatic cancer of the colon or axoneme The structural core of a cilia
rectum but is currently being tested for or eucaryotic flagellum that is made up of
treatment of other types of cancer includ- nine outer doublets of microtubules and
ing renal cell, breast, and non-small cell an inner pair of microtubules.
lung cancers.
3-azido-3-deoxythymidine (azido-
axenic culture Pure culture or the thymidine [AZT]) An antiviral anti-
growth of one organism. biotic used to treat HIV infection (the
AIDS virus). AZT is a derivative of the
axin A membrane-bound intermediate normal deoxyribonucleoside thymidine
in the Wnt signaling pathway that acti- in which an azide group is attached to
vates the transcription of D-type cyclins. the deoxyribose sugar at the 3 position.
Axin interacts with the adenomatosis AZT is an inhibitor of the virus reverse
polyposis coli (apc) protein, beta-catenin, transcriptase enzyme that blocks viral
and glycogen synthase kinase 3b in spe- replication at the point where viral RNA
cific ways that ultimately regulate the is copied into DNA.
entry of beta-catenin into the nucleus.
The axin protein contains three domains: Azotobacter A genus of free-living
a regulation of G-protein signaling (RGS) microorganisms that are capable of
domain, a disheveled domain, and an biological nitrogen fixation, or the abil-
axin (DIX) domain. Mutations in axin ity to use nitrogen of the atmosphere
are associated with liver and ovarian for synthesis of nitrogen-containing
cancers. compounds.

23
www.stemcell8.cn

A
B

BAC Bacterial artificial chromosome; mutant phenotype is changed back to


a laboratory-constructed plasmid that is the wild type.
capable of replicating in bacteria, usually
E. coli, with a very large insert of up to bacteria A group of single celled pro-
300 kb of foreign DNA. caryotic organisms that divide by binary
fission, are haploid or contain one copy of
Bacillus A genus of free-living rod- a chromosome, do not possess organelles
shaped bacteria that produce extremely such as mitochondria and chloroplasts,
resistant spores, that ensures the organisms and do not have a membrane-bound
survival under harsh environmental condi- nucleus.
tions. Some species produce antibiotics.
bacterial transformation A genetic
Bacillus Calmette-Gurin (BCG) A transfer process where cell-free, isolated
nonvirulent form of Mycobacterium DNA is taken up by a recipient cell and
bovis, an organism that causes tubercu- incorporated into its genome.
losis in cows. It was isolated by Calmette
and Gurin of the Pasteur Institute and bacterial virus A bacteriophage, or a
has been used since 1928 as a vaccine, virus that uses a bacterium as its host to
primarily in Europe and Japan, against reproduce.
tuberculosis.
bacteriocidal Describing a chemical or
bacitracin An antibiotic that is effec- drug that can kill bacteria.
tive against Gram-positive bacteria. It
inhibits cell-wall synthesis. bacteriophage A bacterial virus that
utilizes the bacterial host replicative
backbone 1. The spinal column of a systems for its own replication, after
vertebrate organism. which the host cell is usually destroyed
2. A structural feature of a molecule that releasing progeny bacteriophage. Many
arises from its primary structure. Pro- bacteriophage particles consist of an
tein backbones arise from the linking of icosohedral-shaped head that carries the
amino acids through the peptide bond bacteriophage DNA genome. The bac-
between the carboxyl group of one amino teriophage attaches to its bacterial host
acid and the amino group of the other. by means of a cylindrical tail that then
Nucleic acid backbones are formed from serves as a conduit to inject the DNA into
the joining of nucleotides through sugar- the host through a hollow core.
phosphate linkages.
bacteriophage, transducing A phage
back cross A genetic cross between a that acts as a vector in a gene transfer
heterozygote and one of the its parental process by injecting donor bacterial DNA
homozygotes. into a recipient on viral infection.

back mutation A mutation that bacteriophage lambda A DNA-


reverts a previous mutation, so the containing bacterial virus that infects

24
www.stemcell8.cn
BamHI
verso

ble of transporting protons across the


bacterial membrane, thereby creating a
light-dependent electrochemical proton
gradient.

bacteriostatic A chemical or drug that


inhibits the growth of bacteria but does
not kill them.

bacteroid A group of anaerobic, Gram-


negative, small-rod bacteria.

baculovirus An insect cell virus that is


used as a cloning vector. Proteins made
from cloned DNA in baculovirus are gly-
cosylated, a process that does not occur
Bacteriophage when cloning in bacteria.

Escherichia coli and has a complex set of baffles Structures on the bottom of
regulatory mechanisms governing whether some culture flasks that increase aeration
the virus will reproduce itself and lyse its when growing a culture of organisms in a
host or lysogenize its host by integration of shaking water bath or incubator.
its genome into its hosts genome. Deriva-
tives of lambda are used as cloning vectors bakers yeast Saccharomyces cerevi-
to introduce foreign DNA into E. coli. siae, a common yeast, or unicellular bud-
ding eukaryotic organism, that ferments
bacteriophage mu A DNA virus that sugars and produces carbon dioxide,
is capable of transposition, or inserting which is used to leaven bread.
its DNA randomly into the genome of its
host. This virus is used in the process of Balbiani rings A very large puff indi-
insertional mutagenesis. cating transcriptional activity that is seen
at a site on the polytene chromosome of
bacteriophage X174 A single-stranded the certain larval insects.
DNA virus that has been used to study
the process of DNA replication. Baltimore, David (b. 1938) A molec-
ular biologist and virologist who won
bacteriophage Q A single-stranded the Nobel Prize in physiology or medi-
RNA bacteriophage. cine in 1975 for the discovery that ret-
roviruses, a group of viruses that have
bacteriophage T4 A large DNA virus. an RNA genome produce an enzyme,
reverse transcriptase. He was found-
bacteriophage T7 A DNA virus with ing director of the Whitehead Institute
a very strong promoter that responds to for Biomedical Research at MIT and held
specific T7 RNA polymerase. A number that position from 1982 to 1990. He
of cloning vectors have been constructed headed the National Institutes of Health
so that foreign DNA is situated next to AIDS Vaccine Research Committee in
a T7 promoter, so that expression of the 1996.
gene can be regulated and amplified by
addition of T7 RNA polymerase. BamHI A restriction enzyme that rec-
ognizes a specific six-base pair sequence
bacteriorhodopsin A transmembrane (GGATCC) and cuts in a staggered man-
protein of the purple membrane of ner, thus creating single-stranded over-
Halobacterium halobium that is capa- hangs (sticky ends) at the cut sites.

25
www.stemcell8.cn
recto islands
Bam

Bam islands Repeated sequences of


fi xed length in a nontranscribed spacer
region. The designation comes from the
fact that these sequences were fi rst iso-
lated by digestion of the spacer region
with the restriction enzyme, BamHI.

barophile An organism that grows


under conditions of high hydrostatic
pressure but cannot grow under normal
atmospheric pressure. Such organisms
have been isolated from deep seas where
the hydrostatic pressure exists at less than
100 atmospheres.

barotolerant An organism that can


tolerate high hydrostatic pressure.

Barr body A condensed X chromo-


some seen in the interphase. The genes
on it are not expressed; thus the chromo-
some is inactive.

basal body Centriole.

basal lamina The thin layer that


underlies epithelial cells, which consists
of various extracellular matrix proteins
including laminin and collagen. The thin
membrane surrounding the ovarian fol-
licle is also referred to as a basal lamina.

base 1. A substance that decreases the


concentration of H+ ions in solution, or
an alkaline substance.
2. A purine or pyrimidine found in
nucleic acids. Base pair

base analog A purine or pyrimidine base substitution A type of mutation


base other than the ones normally found in which one base or base pair is different
in nucleic acids. in the mutant than in the wild type.

base pair (bp) Complementary rela- basket centrifuges Instruments that


tionships between purine and pyrimi- operate at very low centrifi cal forces
dine molecules that allow adenine to and act as centrifi cal fi lters, collect-
form two hydrogen bonds with thymine ing large particulate matter. These
or uracil and guanosine to form three are useful to collect proteins that have
hydrogen bonds with cytosine. Base been absorbed to materials such as ion
pairing enables nucleic acids to recog- exchange supports in the batch adsorp-
nize each other and plays an important tion method.
role in reactions involving nucleic acids
such as DNA replication, transcription, basophile An organism that lives in
and translation. alkaline environments.

26
www.stemcell8.cn
Beadle, George
verso
W.

batch centrifuges Those centrifuges in terms of the length of the transcripts


that can accommodate solutions varying with the larger transcript giving rise to
from less than 10 ml to liters at a wide the apoptosis repressor form and the
range of centrifical forces. smaller transcript coding for the apopto-
sis promoting form. The same gene char-
batch culture Growth of microorgan- acterized in chicken is known as bcl-x,
isms in a closed system under proscribed and that described in humans is known
conditions of medium, temperature, and as bax.
aeration.
bcr A region on human chromosome 22
B cells See B lymphocytes. known as the breakpoint cluster region,
at which chromosome breakage and
bcl2 An anti-apoptotic factor found in translocation occurs in cases of chronic
the mitochondrial outer membrane that myelogenous leukemia (CML) and acute
acts to block the release of cytochrome c lymphoblastic leukemia (ALL). In these
from the mitochondrion. The inhibition of cancers, there is a reciprocal transloca-
cytochrome c blocks the activation of cas- tion between chromosomes 22 and 9 that
pase 9 by apaf-1. Bcl2 was originally dis- results in the formation of a hybrid chro-
covered as an oncogene activated by chro- mosome (the Philadelphia Chromosome)
mosomal translocations in lymphomas. in which the abl oncogene is fused to a
gene in the bcr region. The bcr-abl fusion
bcl-x/bax A bcl2-related gene that product contains an activated form of abl
can either mimic the function of bcl2 that results in transformation of the cell
as a repressor of apoptosis or, in an to a cancerous state.
alternatively spliced form, act to pro-
mote apoptosis. The alternative splicing Beadle, George W. (19031991) A
products of the gene are characterized geneticist who, in collaboration with

1B 1A 2 3 4 5 6 7 8 9 10 11
chromosome 9
c-abl

chromosome 22
bcr

translocation

bcr/abl fusion

Breakpoint cluster region (bcr)

27
www.stemcell8.cn
recto
bectoplasm

Edward Tatum, showed that genes control recombinant DNA. He became head of the
enzyme production. Beadle and Tatum NIH Scientific Advisory Committee for
shared the 1958 Nobel Prize in physiol- the Human Genome Project in 1991.
ogy or medicine with J. Lederberg.
beta-adrenergic receptor kinase
bectoplasm An archaic term for the (ARK) An enzyme responsible for
outer portion of the cytoplasm of a cell. the desensitization of the beta-adren-
ergic receptor as a result of continued
Beer-Lambert law The equation that stimulation by the receptor agonist (e.g.
states that the molar concentration of a epinephrine). ARK causes inactiva-
substance is proportional to how much tion of the receptor by phosphorylating
light of a certain wavelength is absorbed serine residues on the cytosolic portion
by a solution of the substance: of the receptor. Inactivation of the beta-
A = ECL adrenergic receptor is due to elevated
Where levels of ARK in cardiac muscle that
A = the absorbance at a given wave- occurs rapidly after a heart attack. The
length ARK gene is located on chromosome
E = the molar extinction coeffi cient 11, centromeric to 11q13 (gene map locus
C = the molar concentration of the solu- 11q13).
tion
L = the length of the light path beta-arrestin (arr) A protein that
binds to the cytosolic portion of the beta-
Bence-Jones protein Part of an anti- adrenergic receptor following phosphory-
body molecule (the light chain) that is lation of the receptor by ARK. Binding
found in the urine of individuals who of arr effectively blocks the binding of
have the disease multiple myeloma, a the G-coupled receptor kinase, thereby
tumor of the bone marrow. These frag- inactivating all subsequent steps in the
ments were instrumental in determining cascade of reactions that releases glucose
the structure of the antibody. from glycogen in muscle and liver.

benign Referring to a tumor that does beta-barrel A type of structure


not proliferate and does not invade sur- assumed by some transmembrane proteins
rounding tissues. in which the polypeptide(s) are arranged
in a such a way as to give the appearance
Benzer, Seymour (b. 1921) A geneti- of a barrel. In a beta-barrel, 20 or more
cist who studied, and then employed, the transmembrane polypeptide segments are
process of recombination in bacterio- aligned in a regular manner to form to a
phages to create the fi rst fi ne structure cylinder that acts as a channel to trans-
maps of genes. He is credited with estab- port solutes across the cell membrane.
lishing the relationship between genetic Porins, which form channels in bacterial
units (genes) and proteins as formulated and mitochondrial membranes, are one
in the one geneone protein hypoth- of the best-known examples of beta-
esis. barrel structures.

Berg, Paul (b. 1926) A biochemist beta-blockers A class of drugs used


who gained fame for his work with recom- to treat high blood pressure (hyperten-
binant DNA. He was a member of the sion), congestive heart failure, abnormal
National Academy of Sciences who helped heart rhythm (arrhythmia), and angina.
formulate National Institutes of Health Beta-blockers act by blocking beta-
policy on recombinant DNA in the mid- adrenergic receptors mostly on cardiac
1970s. Berg was awarded the Nobel Prize muscle tissue. Beta-blockers, particularly
in chemistry in 1980, along with Walter those specific for beta1 receptors, are
Gilbert and Frederick Sanger, for work on selective for cardiac tissue. Some exam-

28
www.stemcell8.cn
bioreactors
verso

ples of beta-blockers are atenolol, meto- down organic matter in water. A measure
prolol, and propranolol. of the organic pollutant load.

beta-carotene A pigment that harvests biochemistry The chemistry of biolog-


light energy and transfers this energy to ical systems and processes.
other photosensitive pigments, such as
chlorophylls, in a photosystem. This pig- bioconversions The use of microbes
ment gives a red or orange color to car- to catalyze the production of economi-
rots, tomatoes, and other plants. cally valuable products. The process of
fermentation is a bioconversion or a bio-
beta-galactosidase An enzyme that transformation.
catalyzes the hydrolysis of the disaccha-
ride lactose to the monosaccharides glu- biodegradation The fi eld of study
cose and galactose. The gene encoding this devoted to methods for removal of
enzyme in E. coli is part of the lac operon. environmental pollutants using the
degradative properties of microorgan-
beta-lactam ring A basic structure of isms. Much of the work in this fi eld
penicillins and their synthetic derivatives. centers on the creation of genetically
engineered microorganisms designed
beta-pleated sheet Rigid, extended to degrade organic compounds that are
sheetlike secondary structure of proteins generated in industrial waste or that
that is held together by hydrogen bonds. capture toxic metals present in toxic
waste dump sites.
bFGF Basic fibroblast growth factor;
one of a family of growth factors that bioenergetics The field covering ther-
induces angiogenesis and acts as a che- modynamic principles that are applied to
moattractant for fibroblasts and other biological systems.
cell types. It binds to heparan sulfate in
the extracellular matrix. biogel A matrix made out of a variety
of materials such as dextran, polyacryl-
BglII A restriction enzyme that recog-
amide, agarose, and cellulose used in
nizes a specific six base-pair sequence
chromatography to purify proteins. See
(AGATCT) and cuts the DNA in a stag-
chromatographic techniques.
gered manner, creating single-stranded
overhangs at the cut site.
bioinformatics Computational molec-
bicoid genes A group of genes that ular biology and genetics. The use of com-
code for proteins that play a determining puters to store and analyze data, usually
role in the development of the head and nucleotide sequence data that can be ana-
the thorax in the embryo of the fruit fly, lyzed for control regions of genes, amino
Drosophila melanogaster. acid sequence data that can be used to
fi nd functional domains of proteins, and
bidirectional replication Replication both kinds of data used to fi nd sequence
of a DNA molecule by two replication similarities to other genes or parts of
forks moving in opposite directions from genes. Such gene sequence comparisons
a single initiation point. are being used to understand evolution of
genes and organisms.
binary fission Division of one cell into
two after replication of the DNA. biomass The total mass of living mat-
ter present on Earth.
biochemical oxygen demand (BOD) A
measure of the amount of oxygen con- bioreactors Equipment designed to
sumed in biological processes that breaks maximize product formation in a bio-

29
www.stemcell8.cn
recto
biosynthesis

catalyzed reaction. Such equipment uses the fruit fly, Drosophila melanogaster. See
biocatalysts that are immobilized on a homeobox.
support and controls the contact between
the catalyst and its substrate. bivalent A synapsed pair of homolo-
gous chromosomes found in prophase I
biosynthesis The synthesis of mol- and metaphase I of meiosis; also known
ecules in biological systems. These syn- as a tetrad.
theses are carried out in small discrete
steps, each step catalyzed by an enzyme, BLAST Basic local alignment search
and are energy requiring, usually involv- tool; a set of similarity search programs
ing ATP or GTP as energy sources. designed to look at all of the available
protein or nucleic acid sequence data-
biotin A vitamin prosthetic group that bases. Access BLAST through the home
carries activated carbon dioxide and that page of the National Center for Biotech-
is bound to the enzyme pyruvate decar- nology Information (http://www.ncbi.
boxylase. This is an important enzyme nih.gov).
because it replenishes one of the interme-
diates of the Krebs cycle. blasticidin An antibiotic that inhibits
protein synthesis in both prokaryotes and
biotin labeling (biotinylation) A non- eukaryotes. A gene that confers resistance
radioactive labeling system in which bio- to blasticidin (BSD) has been incorpo-
tin is covalently linked to a nucleic acid. rated into some plasmid vectors so that
the antibiotic can be used to select stable
biotransformations See bioconver- cell lines that carry the vector.
sions.
blastoderm A stage in the develop-
biphasic growth curve The growth ment of insect embryos in which a layer
curve of a microorganism that is char- of nuclei or cells around the embryo sur-
acterized by two exponential growth round an internal mass of yolk.
phases separated by a stationary phase.
Such a growth curve is produced by blastula The stage in animal develop-
culturing the organisms on two carbon ment in which a ball of cells is formed
sources, in which one carbon source is from the cleavage of cells of the zygote.
in a limiting concentration and must be
used up before the second carbon source blood agar A culture medium in which
can be utilized. animal blood, usually rabbit or horse, is
added to provide nutrients or to be used
bispecific antibodies Antibodies in diagnostically for hemolysins (enzymes
which the two binding sites recognize dif- that lyse red blood cells) secreted by cer-
ferent antigens. Such antibodies can have tain strains of bacteria.
one binding site recognize the antigen of
a tumor cell, and the other antigen rec- blood groups See ABO blood
ognize the antigen of a cytotoxic (T cell) group.
lymphocyte, thus effecting the killing of
the tumor cell by the cytotoxic T cell. Bloom syndrome (telangiectatic ery-
Biospecific antibodies can be produced thema) A rare autosomal recessive dis-
chemically, or biologically by fusion of ease characterized by spider veins (telan-
two monoclonal antibodies, producing giectases), sensitivity to light, impairment
hybridomas or cells. of growth and the immune system, and
a predisposition to cancer. Blooms syn-
bithorax A genetic locus in the homeotic drome is caused by a mutation in a gene
box defined by mutations that cause devel- called BLM, at gene map locus 15q26.1.
opmental defects in the thorax region of The BLM protein is a DNA helicase.

30
www.stemcell8.cn
branched-chain alpha-ketoacid dehydrogenase

blot A nylon or nitrocellulose mem- homology, about 20 so-called growth/


brane onto to which nucleic acids or differentiation factors (GDFs) have been
proteins are transferred for the purpose classified as BMPs. BMPs are being tested
of hybridization or interaction with anti- as a means of inducing bone growth at
bodies. See northern blot and South- sites of extensive injury or after surgical
ern blot hybridization. procedures involving bone removal.

blotting, capillary diffusion A pro- Bovine somatotrophin (BST) A


cedure that transfers nucleic acid from a growth hormone that has been manufac-
gel to a nylon or nitrocellulose membrane tured in large quantities through recom-
by capillary diffusion, that is, movement binant DNA techniques used to enhance
of water through the gel and through the the production of milk. This is a very
membrane that results in depositing and controversial product because of the pub-
trapping the nucleic acid on the mem- lics concern over the long-term effects
brane as the water moves. of recombinant DNA on the quality and
safety of food.
blotting, electrophoretic A variant
of capillary-diffusion-blotting procedure Boyer, Herbert (b. 1936) A biochem-
but using an electrical field to facilitate ist whose discovery of restriction enzymes
the transfer of the nucleic acid to the and their application in creating recombi-
membrane. nant DNAs initiated the field of genetic
engineering. He and Stanley Cohen cre-
blunt-end DNA Both strands of DNA ated the fi rst recombinant DNAs that
at one end are even; that is, there are could be grown in bacteria. In 1976 he
no single-stranded overhangs. This term and Robert Swanson founded Genentech
is often used in reference to restriction (for genetic engineering technology), the
enzymes that cut the DNA at the same fi rst biotechnology company. In 1985
position on both strands, as opposed to Genentech was the fi rst biotech company
enzymes that make staggered cuts. to produce a biopharmaceutical product,
human growth hormone.
blunt-end ligation A cloning tech-
nique in which both the vector and the branched-chain alpha-ketoacid dehy-
insert to be spliced into the vector have drogenase (BCKDH) An enzyme that,
blunt ends that must be joined together by if inactivated by mutation in any of the
the enzyme ligase. Such a ligation is more subunit genes (E1a, E1b, E2, E3), leads to
difficult to achieve than one in which the a condition know as Maple Syrup Urine
vector and the insert have complementary Disease (MSUD). BCKDH is necessary
single-stranded overhangs that fi rst form for the metabolism of the three branched-
hydrogen bonds before the ligation step. chain amino acids: leucine, valine, and
isoleucine. Enzyme deficiency results in
blunt ends See blunt-end DNA. spillover of these amino acids and their
corresponding alpha-ketoacids into the
B lymphocytes The antibody-producing blood and urine, giving the urine a char-
cell of the humoral immune response. acteristic color and odor from which the
When stimulated with antibody, these name of the condition is derived. MSUD
cells divide and differentiate into plasma was fi rst described in 1954 and leads to
cells that secrete antibodies. mental and physical disabilities and can
be fatal if untreated. The genes for the
BMP Bone morphogenetic proteins; different subunits are located on differ-
a family of proteins that can induce the ent chromosomes: E1a at gene map locus
formation of new bone (osteogenesis). The 19q13.1, E1b at gene map locus 6p21-22,
gene sequences of the BMPs place them in E2 at gene map locus 1p21-31, and E3 at
the TGF-b superfamily. Based on sequence gene map locus 7q31-32.

31
www.stemcell8.cn
branch migration

branch migration A proposed step system, and therefore the disease is char-
in the process of DNA recombination, acterized by many types of systemic and
or DNA crossing over, in which there is pulmonary infections. Infections begin at
movement of the crossover point of the about six months of age when the mater-
recombinant intermediate. nal antibodies begin to decline. In the
absence of B-cell maturation, the organs
BRCA1/BRCA2 The fi rst breast can- where B-cell maturation normally takes
cer genes identified. Both genes are place (the spleen, tonsils, adenoids, Peyer
tumor-suppressor genes. Mutations in patches, and peripheral lymph nodes)
these genes are believed to be responsi- are often reduced in size or completely
ble for about half of the inherited forms absent. The BTK gene is found on the X
of breast cancer. Individuals inherit one chromosome at gene map locus Xq21.3.
copy of the mutated gene because if
an embryo possesses two copies of the buffer A substance in liquid that tends
mutant gene, it does not survive. to resist changes in pH, by absorbing
either hydrogen or hydroxyl ions.
breakage and reunion Physical break-
age of DNA molecules and rejoining of Burkitts lymphoma A tumor that
parts of two different molecules, result- is relatively common in East Africa and
ing in recombination or crossing over. New Guinea but rare in other parts of
the world. The Epstein-Barr virus (EBV),
5-Bromouracil (5-BU) A chemical the etiological agent of infectious mono-
that causes mutations in DNA because it nucleosis, is associated with this disease,
resembles thymine, a natural constituent but it is not currently known whether the
of DNA. When incorporated into DNA in relationship of the virus to the disease is
place of thymine in its enol-shifted form, casual or causal.
it can readily pair with guanine. In its
presence, an A-T base pair is replaced by a bursa of Fabricius A lymphoid organ
G-C base pair after two rounds of replica- of the chicken that is responsible for the
tion. This is called a transition mutation. maturation of B lymphocytes. The B cells
were so named because of this organ.
broth A liquid culture medium for However, humans and other mammals
microorganisms. do not possess a bursa, and its equiva-
lent in these organisms is probably other
Bruton Agammaglobulinemia An X- lymphoid tissues, such as the tonsils, the
linked immunodeficiency disease in males appendix, Peyers patches, and the lym-
that is caused by mutations in a gene phoid follicles.
that codes for an enzyme known as the
Bruton tyrosine kinase (BTK). The BTK burst number The number of viral
enzyme is necessary for the maturation of particles that are produced per cell after
antibody-producing B cells of the immune infection.

32
www.stemcell8.cn

A
C

C3 cycle The Calvin cycle or that part CAAT box A consensus nucleotide
of photosynthesis where CO2 is fi xed to sequence in DNA that has homology to
form a three-carbon organic compound GGT(orC)AATCT and that is found in
that is subsequently converted into a six- the promoter region of many eukaryotic
carbon sugar. genes and is required for efficient tran-
scription.
C4 cycle The Hatch-Slack pathway, or
an accessory very efficient pathway to fi x cadherins A family of proteins found
CO2 used by plants that grow in hot dry on the cell surface that mediate cell-cell
climates with low CO2 levels. adhesion and that play a central role in
normal development. The cadherins
are responsible for the selective cell-cell
C600 A strain of E. coli that is com-
adhesion that accounts for the cell sort-
monly used in genetic experiments and as
ing by which cells are placed at their
a host for cloned plasmids.
proper sites during development. The
typical cadherin protein has five tan-
Cot value A parameter describing the dem repeated extracellular segments, a
rate at which complementary strands of single membrane-spaning segment, and
DNA reassociate with one another to a cytosolic domain. Cadherins function
form double-stranded DNA. Cot values as a signal transduction element in the
are of significance historically because
Wnt signaling pathway. Cell-cell bind-
the theoretical relationship between Cot
ing by E cadherins releases membrane-
and reassociation rate underlies the prin-
bound src, which acts to induce cyclin
ciple of DNA probe hybridization.
D through beta catenin. There is also
If DNA is denatured to a single-
recent evidence that altered expression
stranded state and then allowed to
reassociate back to its native double- of cadherins may be involved in invasion
stranded form, the extent of reassocia- and metastasis of tumor cells.
tion for any particular DNA sample
increases (1) with DNA concentration caldesmon A calmodulin-binding pro-
when allowed to renature for a given tein involved in the regulation of contrac-
amount of time or (2) with time at a tion in smooth muscle. At high calcium con-
given DNA concentration. centrations caldesmon binds to the Ca++-
Cot is the product of the two variables: calmodulin complex. This leads to muscle
C ot = (DNA concentration) (the time contraction by allowing muscle actin to
allowed for reassociation). make contact with myosin.
The concentration (C) of double-
stranded DNA formation as a function calmodulin A ubiquitous calcium-
of Cot is: binding protein that serves as an intracel-
C/C o = 1/(1 + kC ot) lular receptor of Ca++ and, in its active
where k is the reaction rate constant and form, mediates an intracellular response
Co is the initial concentration of unpaired to Ca++ as a second messenger. See sig-
DNA. nal transduction.

33
www.stemcell8.cn
recto
calorie

E-cadherin
integrin

a b
Wnt
ILK Frz
b -catenin b -catenin a a Dsh
a a

tin
Src

ac
tin
ac
b -catenin cond
uctin
P
cytosol axin
GSK-3b
b -catenin b -catenin

Apc Apc
Tcf-4

b -catenin
P
Tcf-4
b -catenin

[transcription]
P
GSK-3b pro
cyclin D1 teo
cyclin D1 lys
is
myc

nucleus

Cadherins function as a signal transduction element in the Wnt signaling pathway

calorie A unit of energy measurement: smooth muscle. Binding of calponin to


the amount of energy needed to raise the muscle myosin head groups results in a
temperature of 1 gram of water by 1C. state of relaxation.

calpains A group of calcium-dependent cAMP See cyclic AMP.


proteases that act on various cytoskeletal,
membrane, and certain proteins involved in cancer A class of diseases in which
regulatory processes. Calpains exist in two normal cell control is lost so that certain
major isoformscalpain I and calpain II cells in the body proliferate uncontrol-
that have different calcium requirements lably, invade other tissues, and spread to
for activation. Calpains has been linked to distant sites (metastases) in the body.
both neurodegenerative conditions, includ-
ing ischemia and Alzheimers disease. Cal- CAP Catabolite activator protein, or
pain appears to play a role in apoptosis. catabolite repressor protein (CRP); a pro-
Calpain-mediated proteolytic activation of tein that when bound to cAMP will bind
apoptotic pathways leading to cell death is to the promoter region of some operons,
a late-stage event brought about by exci- encoding enzymes that metabolize sug-
totoxic compounds, and therefore, thera- ars in bacteria to enhance transcription.
peutic strategies aimed at limiting neuronal Thus, the protein bound to cAMP acts as
damage by selectively inhibiting calpains a positive regulator of transcription. See
are currently under investigation. lac operon.

calponin A protein of about 34 kDa capped 5 ends A methylated guano-


involved in regulation of contraction in sine residue attached to the 5 end of a

34
www.stemcell8.cn
cardiac muscle
verso

eukaryotic mRNA. The bond is made isms, but fats and some amino acids can
between the 5 phosphate group of the also be utilized for energy production.
nucleotide and the 5 end of the RNA, so
the nucleotide is referred to as inverted. carbonyl group The atoms of car-
This cap may give stability to the mRNA. bon and oxygen, in which the oxygen is
bonded to the carbon via two chemical
capping of mRNA The posttranscrip- bonds, C = O.
tional process that adds a guanosine resi-
due to the 5 end of a eukaryotic mRNA carboxyl group The atoms of carbon,
and then methylates it. oxygen, and hydrogen, in which one oxy-
gen is bonded to the carbon via a double
capsid The protein coat of a virus. bond and the oxygen and hydrogen form
a hydroxyl group (OH) and are bonded
capsomere The protein subunits of the to the carbon via a single bond with the
capsid. oxygen:
C=0
capsule An envelope of carbohy- |
drate, or a slime layer surrounding some OH
microorganisms. Capsules contribute to Carboxyl groups are found on organic
the invasiveness of some bacteria because acids.
they enable the organisms to evade
phagocytosis. carboxyl terminus The end of a mol-
ecule where a carboxyl group is found.
carbohydrate A sugar or the name for Proteins that are made up of amino acids
molecules that contain carbon hydrogen have a carboxyl terminus and an amino
and oxygen in the ratio, Cn H 2nOn and terminus.
that can be simple monomers, such as
glucose or fructose; disaccharides; or two carboxypeptidases Enzymes that re-
molecules joined together by a glycosidic move successive amino acids from pro-
bond (see glycoside), such as sucrose teins starting at the carboxy terminal end
(common table sugar) or lactose (milk (see above) by hydrolyzing the peptide
sugar); or polymers containing as many bond between amino acids.
as thousands of simple sugar molecules,
such as starch, cellulose, and glycogen. carcinogen A cancer-producing agent
or any chemical or physical agent that
carbon dioxide cycle The flow of CO2 can produce a tumor in an animal or
from organisms that can photosynthe- cause normal cells in culture to become
size (plants and algae) and convert it into transformed.
organic foodstuffs to all other organisms
that consume the organic molecules and carcinogenesis The process by which
give off CO2 as waste product. a normal cell transforms into a cancerous
one. See transformation.
carbon fixation The process by which
plants and algae (photosynthesizers) con- carcinoma A tumor derived from
vert inorganic carbon, CO2 , into organic epthielial cells.
molecules, specifically carbohydrates, that
are used as food for other organisms. cardiac muscle The muscle tissue of
the heart, thus responsible for pumping
carbon source Any organic carbon- blood through the bodys circulatory
containing molecule that can be metabo- system. It is striated and looks very simi-
lized to produce energy in the form of ATP lar to skeletal muscle, but both muscles
in an organism. In general, carbohydrates use different carbon sources for energy
serve as carbon sources for most organ- production.

35
www.stemcell8.cn
carotene
recto (beta)

carotene (beta) A specific carot- ate conditions are moved behind promot-
enoid found in plants that assists in ers where they can be expressed. Cassettes
light absorption by the chloroplasts. This can be constructed in the lab by flanking
pigment gives the red color to such veg- the gene or sequence to be made into a
etables as carrots, tomatoes, and yellow cassette with restriction enzyme cutting
squash. sites.

carotenoids A family of pigments that catabolic pathway A series of reac-


can absorb a range of wavelengths of light tions that breaks down compounds to
and funnel the energy to chloroplyll a, the simpler ones, usually with the release of
major photosynthetic pigment of plants. energy that is trapped into high-energy
Thus, these accessory pigments greatly molecules such as ATP.
extend the range of wavelengths of light
that can be used for photosynthesis. catabolism The degradation of com-
plex substances to simple ones.
carrier A substance involved with the
transport of materials. catabolite A substance that can be bro-
ken down by an organism to yield energy,
carrier protein A protein embedded usually in the form of ATP.
within the cell membrane that binds to a
specific compound or group of related com- catabolite repression A process found
pounds and aids in transporting it from the in certain bacteria in which there is
outside of the cell through the membrane decreased synthesis of enzymes invol-
lipid bilayer to the interior of the cell. ved in catabolism when a preferred
alternative catabolite is present. For
casamino acids A mixture of amino example, the enzymes that metabolize
acids that results from the enzymatic the sugar lactose are not synthesized by
breakdown of the milk protein, casein. bacteria when they are grown on the
sugar glucose.
cascade A series of reactions that is trig-
gered off by one reaction or compound. catalase An enzyme that breaks down
hydrogen peroxide, a toxic waste product
casein hydrolysate The breakdown of metabolism, to water and oxygen; usu-
product of the milk protein casein to ally found in the microbody or peroxi-
its constituent amino acids by either some organelles.
enzymes or acid hydrolyzing the peptide
bonds between the amino acids. catalysis (catalytic) The acceleration
of a reaction by a catalyst.
caspase 3 (ced-3) A component of
the apoptosis pathway that is activated catalyst A substance or physical agent
by cleavage of procaspase 3 by caspase that speeds up a reaction but is not con-
9. Caspase 3 is an effector caspase that sumed during the course of the reaction.
directly leads to the macro changes Catalysts in biochemical reactions are
observed in apoptosis, such as membrane enzymes. Catalysts change the rate at
and DNA damage and large-scale proteo- which reactions approach equilibrium but
lytic degradation. Ced-3 is the same pro- do not affect the position of equilibrium.
tein characterized independently in the
nematode C. elegans. catalytic site The location on an
enzyme where the active site or the place
cassettes Genes or nucleotide sequences where substrates bind and the reaction
that can be easily spliced into chromo- proceeds. The catalytic site brings reac-
somes or plasmids. Some cassettes are tants of a reaction close together eliminat-
naturally occurring and under appropri- ing the need for random collisions, thus

36
www.stemcell8.cn
verso
cdks

making it more efficient for the reaction and HAP5 and stimulates the transcrip-
to proceed. tion of various genes by recognizing and
binding to a CCAAT motif in promoters.
CAT assay An assay for determin- The human gene for CBF is at gene map
ing whether a given DNA fragment may locus 6p21.3.
contain promoter activity by ligating the
fragment to the chloramphenicol acetyl CCBF transciption factor A tran-
transferase (CAT) gene in an expression scription factor involved in regulation
vector and observing whether the CAT of genes (e.g., Cln1 and Cln2) required
enzyme is made when the vector is trans- for progression through the G1 phase of
fected into animal cells. See aph. the cell cycle in yeast. The CCBF tran-
scription factor binds to a specific DNA
catenanes Macromolecular rings that sequence called the cell cycle box in the
are mechanically interlinked with one promoter region(s) of the critical cell
another. Catenanes have been used to cre- cycle genes.
ate molecular machines (nanomachines).
Catenanes are being tested as nanoscale CD3 A complex of transmembrane
robotic devices that may be useful for the proteins in T cells that, in association
development of slow-release drug-delivery with the T cell receptor, helps promote
systems or to control chemical reactions in an interaction between the T cell and
nanoscale laboratories on a chip. another cell containing an antigen on its
surface. As a result of this interaction,
catenation The linking together of there is a proliferation of T cell clones
multiple copies of a macromolecule. that recognize the antigen.

CAT gene Chloramphenicol acetyl CD4 A transmembrane protein in


t cells that, like CD3, functions in the
transferase gene; a bacterial gene that
interaction of a T cell with an antigen-
catalyzes the transfer of an acetyl group
presenting cell to promote the prolifera-
to chloramphenicol. The CAT gene is
tion of a T-cell clone specific for the anti-
commonly used as a reporter gene in
gen. During the interaction of the T cell
experiments designed to demonstrate that
and the antigen-presenting cell, CD4 (and
certain DNA sequences can function as
CD8) activates a tyrosine kinase inside
promoters.
the T cell that leads to the proliferative
response of the T cell.
cation A positively charged ion.
CD8 A T-cell transmembrane protein
C-banding A technique for staining that functions in essentially the same way
the highly repeated DNA sequences in the as CD4.
region of the chromosome surrounding
the centromere. See satellite DNA. cdc An acronym for cell division cycle.
CBF See CCAAT-binding factor. cdks (cyclin-dependent kinases) The
enzymatic subunit of the complexes that
CCAAT-binding factor (CBF) A tran- regulate progression of a cell through the
scription factor complex that binds to the cell cycle. Cyclin-dependent kinases are
CCAAT motif upstream of the promoters generally specific for tyrosine (tyrosine
of many different genes, for example, type kinase) but are inactive unless they are
1 collagen, albumin, and beta-actin genes. complexed with a cyclin; the cyclin thus
In the yeast Saccharomyces, CBF binding functions as the regulatory subunit of the
induces the transcription of genes required cyclin-cdk complex. Different combina-
for growth based on a nonferment- tions of cyclins and cdks control passage
able carbon source. CBF consists of four through different phases of the cell cycle.
known subunits: HAP2, HAP3, HAP4, In mammalian cells:

37
www.stemcell8.cn
recto
cDNA

Cyclin D-Cdk4 or 6 controls progres- circumferential belta ring of actin


sion through G1 phase. and myosin bundles that encircles the
Cyclin E-Cdk2 controls entry to S inner surface (cytoplasmic side) of the
phase. cell membrane just at the location of
adherens junctions.
Cyclin A-Cdk2 controls progression hyaluronan (hyaluronic acid: HA) is a
through S. long acidic polysaccharide found in
Cyclin A-Cdk1 controls progression the extracellular matrix all over the
through G2. cell surface. The presence of HA inter-
Cyclin B-Cdk1 initiates the onset of feres with close cell-cell contacts and
M phase. thus inhibits cell-cell junctions that
mediate adhesion.
stress fibersbundles of actin and
cDNA (complementary DNA) The
myosin that run internally along the
single-stranded complementary DNA
ventral surface of cell. Stress fibers
that is copied from mRNA by the enzyme
are attached at one end to adhesion
reverse transcriptase.
plaques, and it is believed that they
function in cell movement and cell-sub-
cDNA cloning A recombinant DNA
strate attachment.
technique in which double-standed cDNA
proteins in cell adhesioncell surface
is spliced into vectors so that the gene can
proteins that mediate cell-cell adhe-
be amplified or expressed.
sion. These proteins fall into three
major classes: cadherins, selectins,
cDNA library A collection of cDNA and immunoglobulins.
molecules spliced into vectors, made by
using all the mRNA molecules in a cell cell coat A layer of carbohydrates that
or organism and copying it with reverse protrude out into the extracellular space
transcriptase. The library is subsequently from the cell membrane in animal cells
screened with appropriate probes to and is seen in the electron microscope as
pick out the clone of choice. See clone an electron dense coat on the surface of
library and library. the cell.

cell The smallest membrane-bound unit cell culture A population of cells


capable of replication. Cells may either grown in a medium.
function independently, such as those of
unicellular microorganisms, or function cell cycle A sequence of events involved
cooperatively as the cells of a tissue or in the replication of the genetic material of
organ. the cell and the orderly parceling of it out
to two daughter cells. The cell cycle con-
cell abalation The selective destruc- sists of the G1, S, and G2 phases that make
tion of cells. The technique of cell aba- up the interphase and the M phase or mito-
lation is used in studies of the role of sis where chromosome division occurs.
differentiating cells in the development of
an organism. Genes encoding cytotoxins cell-disruption techniques The re-
such as diphtheria toxin are introduced lease of intracellular proteins and nucleic
into the cells to be destroyed behind cell- acids from microorganisms. The tech-
specific promoters. niques to be used depend on the sensitivity
of the protein or nucleic acid to be isolated
cell adhesion Any mechanical cou- to each treatment and whether the extrac-
pling of one cell to another or of a cell to tion procedure is small scale or large scale:
a solid support (the substrate). Cell adhe- chemicalalkali conditions can be
sion is mediated by specialized cell-cell or used to release certain proteins from
cell-substrate junctions or the extracel- microorganisms in both small-scale
lular matrix: and large-scale preparations.

38
www.stemcell8.cn
cell verso
plate

detergentsboth ionic such as sodium extract refers to the soluble portion of the
lauryl sulfate, or nonionic detergents internal cellular contents after removal of
such as Triton X-100 can be used to the organelles and cell membrane debris.
destroy the cell membrane and facili-
tate cell lysis. cell-free protein synthesis The syn-
enzymaticlysozyme, an enzyme pre- thesis of proteins in a test tube using a
pared from hen egg whites, breaks cell-free extract to supply the necessary
down the peptidoglycan cell wall of enzymes and components and dependent
bacteria. on addition of amino acids and mRNA.
grindingphysical disruption of the
bacterial cell wall by grinding with an cell fusion The process of fusing two
abrasive material such as glass beads. different cells together, fi rst creating a
This can be done either in small scale heterokaryon that contains both of the
with a mortar and pestle or in large nuclei and then a fusion of the nuclei to
scale using a cell disrupter apparatus. create a synkaryon. The fusion occurs
osmotic shockrelease of proteins by reaction between the two cell mem-
from the periplasmic space of Gram- branes, brought about by treatment with
negative bacteria (see Gram stain) by Sendai virus or polyethylene glycol.
resuspending the cells fi rst in a solu-
tion of 20 percent sucrose and then cell line A cell culture started from
resuspending them in water. a particular type that can be cultured
shearingpassage of cells through a indefi nitely in the laboratory and is thus
narrow orifice at high pressure. Small- characterized as immortal.
scale operations may use solid shear in
which frozen cell are forced through cell lineage A complete set of ancestral
the orifice. Large-scale preparations cells and cell divisions that makes up a
use liquid shear. certain cell type during development.
sonicationdisruption of cell walls by
high-frequency sound waves. cell-mediated immune system See
cell-mediated immunity.
cell-division-cycle genes Any of
approximately 50 genes that control the cell-mediated immunity A type of
cell cycle in yeast. immunological response that is mediated
by cytotoxic T lymphocytes or killer T
cell-division-cycle mutant Cell-division- cells and is used by the body to destroy
cycle temperature-sensitive mutants of cells that carry foreign antigens, such as
yeast that either become blocked or show virally infected cells, tumor cells, and
aberrent behavior in various parts of the nonmatching tissue grafts.
cell cycle at a temperature at which the
mutation can be expressed (the restrictive cell membrane The boundary that
temperature). See cell cycle. limits the cell contents from its environ-
ment. It is composed of a phospholipid
cell fractionation The process of pre- bilayer that is associated with proteins
paring a cell-free extract and dividing the either embedded in the bilayer (intrin-
cell contents into fractions by centrifuga- sic or transmembrane) or external to it
tion techniques. (extrinsic). The cell membrane provides
a selectively permeable barrier to the cell,
cell-free extract The product of treating allowing entrance by substances that are
a suspension of cells with a substance(s) needed by the cell and preventing leakage
that destroys the cell wall (in the case of of important substances out.
bacteria and plants) and/or the cell mem-
brane, thus releasing the cytoplasm and cell plate The boundary between two
cell organelles. Sometimes the cell-free newly formed nuclei in a plant cell that is

39
www.stemcell8.cn
rectosorter
cell

about to divide into two daughter cells; centimorgan (cm) One hundredth of
these daughter cells consist of cell wall a morgan, the unit of genetic distance
material and cell membrane that grows or a map unit distance, named in honor
and eventually becomes contiguous with of Thomas Morgans contribution to
the existing cell wall and cell membrane. mapping genes in Drosophila. The cen-
It is also called the phragmoplast. timorgan is defi ned by recombination
frequency between two genetic markers
cell sorter An instrument used to sepa- expressed as a percentage.
rate and analyze different classes of cells
from mixed populations. The fluorescence central dogma The concept that all
activated cell sorter (FACS) separates dif- genetic information flows from DNA.
ferent cell types in a population based on The information in the DNA is passed
external antigens that bind to antibodies on to progeny cells by the process of
labeled with fluorescent dyes. DNA replication, and the information
stored in DNA is fi rst transcribed into
cell sorting The process of sorting RNA, which is then translated to syn-
out different cell types in a heteroge- thesize proteins.
neous population. See fluourescence-
activated cell sorting. central nervous system The sensory
and motor cells (neurons) of the brain
cell synchronization The process by and spinal cord.
which all cells in a population come to be
in the same phase of growth and conse- centrifugal force The force that tends
quently undergo cell division simultane- to impel substances outward from a cen-
ously. ter of rotation.

cell theory The theory that states that centrifuge An instrument that sepa-
the cell is the basic structural unit of all rates substances from liquids by centrifu-
organisms and that all cells arise from gal force and separates substances from
preexisting cells. other substances based on how each
moves in a centrifugal field.
cellulase An enzyme that hydrolyzes
long polymers of cellulose to cellobiose, centriole A structure composed of
which is a disaccharide of glucose units. microtubules that is found in the nucleus
and is involved in the formation of the
cell wall The rigid or semirigid layer spindle apparatus that aids in the orderly
peripheral to the cell membrane of bacte- parceling out of duplicated chromosomes
ria, algae, fungi, and plants. In plants the to daughter cells in the process of cell
cell wall is composed of microfibrils of division. The centriole is also identical in
cellulose embedded in a matrix. The bac- appearence to the basal body, the organ-
terial cell wall, the peptidoglycan layer, elle that is embedded at the periphery of
is a complex structure of chains of alter- the cell and serves as the base of the cells
nating residues of N-acetylmuramic acid locomotive appendages, the flagella and
and N-acetyl glucosamine held together cilia.
by peptide bridges.
centromere The point along the chro-
Center for Inherited Disease Research mosome to which duplicated sister chro-
(CIDR) A center of the National Insti- matids are joined before the chromo-
tutes of Health (NIH) supported by nine somes are divided into the two daughter
of the NIH institutes to provide genotyp- cells. It also serves as the site of attach-
ing and statistical genetics services for ment of the kinetochore, the structure on
researchers identifying genes that cause which microtubules of the spindle appa-
human disease. ratus attach to pull the duplicated chro-

40
www.stemcell8.cn
Charon phage
verso

mosomes to opposite ends of the cell dur- brain, that consists of a pair of hollow,
ing mitosis. convoluted lobes.

centromere binding factor A com- cesium chloride gradient centrifuga-


plex of proteins that binds to a particular tion A method used to separate and/or
DNA sequence in the centromeric region purify molecules, usually nucleic acids.
of the yeast chromosome (the CEN The nucleic acids to be separated are
sequence) and also to one of a microtu- mixed with an appropriate density of the
bule in the spindle fiber. In this way, the dense chemically inert salt, cesium chlo-
centromere binding factor forms a physi- ride, and centrifuged at high speeds for
cal connection between the chromosome hours to days. The cesium chloride estab-
and the spindle apparatus during mitosis. lishes a density gradient during the cen-
trifugation, and the molecules of nucleic
centromeric sequences Special nucleo- acid move up or down the gradient to
tide sequences in the DNA of chromosomes reach their position of bouyant density in
that serve as sites where the spindle appara- the gradient.
tus attaches to chromosomes during mito-
sis. See yeast artificial chromosomes. CFTR See Cystic Fibrosis Trans-
membrane Conductance Regulator.
centrosome The cell center or a micro-
tubule organizing center consisting of
CH3 choline A small alcohol of the
granular material surrounding two cen-
structure, HOCH 2 CH 2 N(CH3)3, that
trioles (see centriole).
is found in membrane phospholipids and
is part of the important neurotransmitter,
cephalosporin-C One of a group of acetylcholine.
antibiotics, the cephalosporins, that is
produced by the fungus Cephalosporium
and that resembles penicillin in structure channel protein A cell-membrane-
and mode of action. embedded protein, part of a channel
structure that allows substances of appro-
cerebellum Part of the hindbrain con- priate size and charge to pass through the
sisting of two hemispheres and a small membrane by diffusion.
central portion.
chaotrophic The ability of an agent to
cerebroside A class of membrane lipids disrupt the structure of water. Such sub-
derived from sphingosine similar in struc- stances weaken hydophobic interactions.
ture to gangliosides but differing in that
cerebrosides have only a single sugar mol- chaperones Proteins responsible for
ecule. Both gangliosides and cerebrosides the proper folding of proteins once they
are widely found in the cell membranes are translated (see heat-shock genes).
of neural cells, where they play essential
roles in neural functioning. Chargaffs rules The discovery that in
DNA the concentration of adenine always
cerebrospinal fluid (CSF) The fluid equals the concentration of thymine and
that is produced in the ventricles of the that the concentration of guanine always
brain and fi lls the ventricles and the cen- equals the concentration of cytosine.
tral canal of the spinal cord. It serves to
cushion the brain and protect it from Charon phage A vector used for clon-
blows to the skull or bruises resulting ing DNA constructed from bacteriophage
from sudden movements of the head. lambda. The name Charon is taken from
the ancient Greek myth of the ferryman
cerebrum That part of the brain, Charon, who transported the spirits of
located above and in front of the hind- the dead across the river Styx.

41
www.stemcell8.cn
recto
checkpoint

checkpoint Places in the cell cycle where some limiting nutrient to the removal of
specialized processes can arrest progression spent medium and cells.
through the cell cycle. Cell-cycle arrest at
a checkpoint is generally caused by DNA chemotaxis The movement of an
damage or other type of injury at an early organism to an attractant and away from
stage, which would lead to malfunction. a repellant.

chelator An organic compound in chemotherapy The treatment of a dis-


which atoms form bonds with metals, thus ease with chemicals, but the term is usu-
removing free metal ions from solution. ally used to defi ne the treatment of can-
cer with drugs that selectively kill faster
chemiluminescence The emission of light growing tumor cells.
as the result of a chemical reaction. Che-
miluminescence is widely used as a means chemotroph An organism that obtains
of detecting DNA and protein probes in its energy from the oxidation of chemi-
various analytic techniques, particularly in cal bonds. See chemoautotroph and
Southern, northern, and western blotting. chemoorganotroph.

chemiosmotic theory A model pro- chiasma (chiasmata, pl.) The location


posed by Peter Mitchell that couples elec- of a crossover event between two chro-
tron transport to oxidative phosphoryla- matids in the tetrad structure of synapsed
tion (ATP synthesis during respiration) duplicated pairs of chromosomes that
or photophosphorylation (ATP synthesis occurs during prophase I of meiosis.
during photosynthesis). It postulates that
the energy needed to drive the synthesis chimera An animal formed from
ATP is stored in a proton gradient across aggregates of genetically different groups
the inner membrane of the mitochondrion of cells. Chimeras are made by combining
or the thylakoid membrane of the chloro- early stage embryos that arise from fertil-
plast and that this gradient forms dur- ized eggs of two different sets of parents
ing electron transport. When the gradi- or by injecting cells from an early embryo
ent is relieved by the transport of protons of one genotype into the blastocyst of
across the membrane, the stored energy is another genotype. The term chimera is
used to drive the synthesis of ATP. derived from the name of the mythologi-
cal creature with the head of a lion, the
chemoautotroph An organism that body of a goat, and the tail of a serpent.
obtains its energy from the oxidation of
chemical bonds, usually the oxidation of chimeric DNA A recombinant DNA
inorganic metal ions, and can use inor- molecule, or one in which a fragment of
ganic carbon (C) or carbon dioxide (CO2) DNA from a some source is spliced into a
to make biological molecules. vector from another source.

chemolithotroph A synonym for chiral compound A compound, usu-


chemoautotroph. ally a carbon compound, that is optically
active, that is, has the ability to rotate the
chemoorganotroph An organism that plane of polarized light to the left or to
obtains its energy from the oxidation of the right, due to its ability to exist in one
chemical bonds and requires organic car- of two mirror images. See enantiomers.
bon compounds for growth. A heterotroph.
chirality The nonidentity of a compound
chemostat An apparatus used to main- with its mirror image. See enantiomers.
tain a bacterial culture in continuous cul-
ture or exponential growth. This is done chi sequence A sequence of bases on the
by coordinating the rate of addition of genome of the bacterium E. coli that signals a

42
www.stemcell8.cn
chitin
verso

nuclease to cut at that site for recombination cular DNA molecules, is cut by a restric-
or crossing over to occur. It serves as a hot tion enzyme that cuts each circular DNA
spot of recombination as it is used preferen- once. The name is derived from the fact
tially as a site where recombination occurs. that the four-armed structure, as seen by
electron microscopy, resembles the Greek
chi structure The structure generated letter chi.
when the figure eightshaped molecule,
which is an intermediate form in the pro- chitin The structural polysaccharide pre-
cess of recombination between two cir- sent in the exoskeleton of insects, in the cell

Chi structure

43
www.stemcell8.cn
rectokinases
chk

walls of fungi, and in crustacean cells com- partially digested fats and proteins in the
posed of units of N-acetylglucosamine. duodenum.

chk kinases A group of critical inter- cholera toxin A toxic protein produced
mediates (Chk1, Chk2, and Chk3) in an by the bacterium Vibrio cholerae that
important type of checkpoint control that causes the disease cholera. Cholera toxin
operates in the G2 phase of the cell cycle. acts by binding to a receptor (GM1 gangli-
Chk kinases block mitosis in cells that oside) present on intestinal mucosal cells.
have undergone DNA damage and other This activates adenylate cyclase, which
types of injury by phosphorylating cdc25, stimulates the formation of cAMP, which,
which then becomes inactive. Inactivation in turn, causes rapid loss of H 20, Na+, K+,
of cdc25 stops the dephosphorylation of Cl-, and HCO3 - into the small intestine.
cdc2, which is normally carried out by The lost H 2O and electrolytes are replaced
unphosphorylated cdc25. from the blood, which causes the diarrhea,
loss of electrolytes, and dehydration that
chloramphenicol An antibiotic pro- are characteristic of cholera. If untreated,
duced by Streptomyces venezuela that the disease ultimately progresses to shock,
inhibits protein synthesis in bacteria, kidney failure, and death. The toxin con-
mitochodria, and chloroplasts but not in tains five binding (B) subunits, an active
higher organisms. It is used to amplify (A1) subunit, and a bridging piece (A2)
recombinant DNA molecules when a that links A1 to the five B subunits. The
plasmid vector is used to make the recom- A1 subunit is an enzyme that transfers
binant. Chloramphenicol will specifically ADP ribose from NAD to a G protein that
inhibit the host cells replication because more or less irreversibly maintains adenyl
it is dependent on new protein synthesis cyclase in an active state.
but will not inhibit certain plasmid repli-
cation. Thus, in the presence of the anti- cholesterol A nonpolar lipid molecule
biotic, the recombinant molecule prefer- containing four conjugated rings that is a
entially replicates as many as 200 copies major component of cell membranes and
per cell. which is the precursor molecule for a vari-
ety of important biomolecules, including
chlorophyll A light-absorbing pig- steroid hormones, vitamin D, and bile
ment found in the chloroplasts of plants salts. Cholesterol is carried by lipopro-
and algae that is essential as an electron teins in the blood that are responsible for
donor in the process of photosynthesis. It carrying cholesterol to sites where it can
is the pigment that gives the green color be metabolized. Inappropriate deposition
to plants. of cholesterol in the arterial wall is a fac-
tor in the formation of plaques that leads
chloroplast The organelle in plant cells to atherosclerosis.
and algae that is responsible for photo-
synthesis. It contains the chlorophyll and cholinergic The term applied to all
the proteins used to carry out the reac- neurons that utilize acetylcholine as a
tions of photosynthesis. neurotransmitter.

cholecystokinin A small polypeptide cholinergic neuron Pertaining to the


hormone secreted by the mucosal epithe- general class of neurons that utilizes ace-
lial cells of the duodenum and also by the tylcholine as a neurotransmitter.
nerve cells of the enteric nervous system
that stimulates the release of digestive chondroitin sulfate A sugar acid that is
enzymes stored in the pancreas and bile commonly a component of the fuzzy layer,
stored in the gallbladder into the small an extracellular layer of collagen and gly-
intestines. The secretion of cholecys- cosaminoglycans peripheral to the cell
tokinin is stimulated by the presence of coat of some animal cells.

44
www.stemcell8.cn
chromatin remodeling
verso

chromatid One of the daughter- chromatin to allow access of transcription


duplicated chromosomes that is joined at factors to the promoter regions of genes.
the centromere to its sister chromatid Chromatin remodeling is carried out by
and is seen at the prophase and meta- protein complexes known as chromatin
phases stages of mitosis and meiosis. remodeling factors (or machines) that
temporarily remove nucleosomes from
chromatin The material of the chro- the DNA in regions of DNA where the
mosome, consisting of DNA associated transcription factors bind. The remodeling
with histone proteins. complex in yeast is called the SWI/SNF
complex, which contains an ATP-binding
chromatin remodeling The process protein that provides energy for the move-
of altering the DNA-protein complexes in ment of the complex along the DNA.

estradiol
vitamin D3

cholesterol

testosterone cortisol

Derivatives of cholesterol

45
www.stemcell8.cn
recto
chromatographic techniques

chromatographic techniques high-performance liquid chromatog-


affi nity chromatographya technique raphy (HPLC)a chromatographic
for separating a substance from a method in which a high resolution of
mixture based on its natural tendency separation is achieved by improve-
to bind to another substance (a ligand) ments in the packing of columns and
for which it is said have an affi nity. the flow of solvents through the col-
In affi nity chromatography, a liquid umns under high pressure. Such a
suspension or solution containing the method yields very sharp peaks of
mixture is generally poured through a substances eluted from the column.
hollow column containing the ligand hydroxyapatite chromatographythe
that is bound to some inert supporting separation of molecules based on
substance. The substance to be sepa- their relative binding to a column pre-
rated remains bound to the ligand in pared with calcium phosphate. Such
the column while the unbound mol- a column is used to separate double-
ecules in the mixture pass through the stranded DNA that will bind to it
column. from single-stranded DNA, which will
column chromatographythe sepa- pass through.
ration or purification of substances, ion-exchange chromatographythe se-
generally proteins, based on their spe- paration of substances based upon
cific binding to a column, prepared their charge and thus their affi nity to a
by attaching a ligand to some support column prepared with a charged sup-
that will specifically bind to the sub- port material. Substances are eluted
stance and washing the bound column from the column with a solution of
with a solution that will compete with ions that compete with the substances
the bound substance for the column. binding to the column.
gas-liquid chromatography (GLC)a paper chromatographythe separation
type of chromatography in which of substances based on their relative
substances in a sample are evapo- solubilities in a mixture of solvents.
rated into a stream of an inert gas Substances to be separated are applied
such as argon, helium, or nitrogen to paper support, and the solvents
and then separated at a high tempera- travel up or down the paper via capil-
ture by passing the evaporated mate- lary action, dissolving and transport-
rial through a column containing a ing the substances on the paper.
liquid, such as silicone oil or polyeth- reverse-phase chromatographythe se-
ylene glycol, on an inert matrix mate- paration of substances based on their
rial such as fi rebrick. relative hydrophobicities. The sup-
gel-exclusion chromatographya vari- port matrix is prepared to contain
ant of gel fi ltration in which sepa- large hydrophobic carbon chains that
ration of substances in a mixture is will bind hydrophobic proteins more
achieved by collecting the fraction of strongly and are thus eluted from the
the sample containing the molecules column more slowly than hydrophilic
whose size is greater than the exclu- ones.
sion size of the gel beads. thin-layer chromatographythe same
gel-fi ltration chromatographythe se- as paper chromatography, but the sup-
paration of molecules, generally pro- port is a glass plate that is coated with
teins, based on their sizes, as seen by a silica gel.
their flow through a column prepared
with porous beads of a carbohydrate chromatography An analytical tech-
polymer that will trap smaller mole- nique used to separate molecules from
cules impeding their flow but permit each other based on differences in their
larger molecules to flow faster. This affi nities and/or migration on some sup-
procedure is also called molecular port resulting from the flow of a solvent
sieving. See gel filtration. (see specific types in chromatographic

46
www.stemcell8.cn
chromosome walking
verso

techniques). Chromatographic meth- S phase Relaxation of the chroma-


ods differ with respect to the nature of tin and unwinding of the DNA helices
the solid support and the type of mobile during DNA replication
phase (solvent). G2 phase Condensation of chroma-
tin begins.
chromogenic label Any molecule atta-
ched to a biological probe molecule that Mitosis
generates a colored compound(s) as a PROPHASE Sister chromatids become
means of visualizing the location and detectable.
amount of probe bound to a particular Assembly of the mitotic spindle
target. Breakdown of the nuclear envelope
METAPHASE Alignment of centro-
chromomeres The beadlike structures meres
on lampbrush chromosomes that are seen
ANAPHASE Disjunction of sister
during meiosis when the chromosomes
chromatids
become extended. See lampbrush chro-
mosome. TELOPHASE Disassembly of chromo-
somes
chromosomal mutation A change in
the sequence of base pairs of the DNA chromosome jumping See chromo-
encoding a gene that results in a change some walking.
on the protein. The change can be as
simple as a change in one base (missense chromosome mapping The techni-
mutation involving one amino acid on the ques used to assign specific genes loca-
protein) or the addition or deletion of one tions on the chromosome, based upon
base (resulting in a change in the reading crossover frequencies and linkage fre-
frame, thus affecting many amino acids quencies between genes.
on the protein), to more complex changes,
such as the addition or deletion of many chromosome puffs The uncoiled re-
bases or the transposition of part of one gions of DNA found on the giant poly-
chromosome to the other. tene chromosomes of the salivary glands
of certain members of the Diptera group
chromosome The structure in the (e.g., fruit fly) with the appearance of
nucleus that contains the genetic informa- puffs when observed by conventional
tion composed of DNA and the histone light microscopy, which have been shown
proteins associated with the DNA. The to be sites where the chromosomal DNA
term chromosome is also used to refer is actively in the process of transcription.
to the genes-containing unit of bacteria,
viruses, mitochondria, and chloroplasts, chromosome walking (jumping,
although these do not resemble the chro- crawling) A procedure used to locate
mosomes of higher organisms in struc- a gene by using cloned genes close to
ture or histone content. the target, preparing probes from these
genes, and using them to isolate mem-
chromosome cycle A term fi rst bers of a genomic library that hybridize
coined by Barbara McClintock in 1942 to the probe but contain other genetically
to describe the cyclical series of changes linked material. If each member of the
in chromosome structure that takes place library contains an insert of 10,000 base
during the cell cycle. pairs (bp), a probe that can hybridize to
The chromosome cycle: the fi rst 100 bp can be used to isolate
a gene that is located 9,000 bp away. If
G1 phase Chromosomes become the gene is, in fact, located more than
dispersed as a result of changes in the 10,000 bp away, then the fi rst probe is
way chromatin fibers are coiled. used to isolate a clone to make a second

47
www.stemcell8.cn
recto
chymotrypsin

probe, which can be used in turn to iso- ucts in a cross that does not involve a
late a third probe, until the specific gene recombination event or crossing over)
is found. This procedure is called chro- when crosses are made between genes car-
mosome walking because probes are iso- rying two mutations. If two mutations are
lated and then used to identify portions found on separate genes, they are said to
of the chromosome that are contiguous to be in the trans configuration; if they are
each other. on the same gene, they are in the cis con-
figuration. Complementation will only
chymotrypsin A digestive enzyme that occur between transmutations in different
hydrolyzes peptide bonds, thus cleaving genes, not in the same gene.
proteins to their component amino acids,
found in the small intestine. cistron A genetic unit or gene as defi ned
by the cis-trans test.
cilium (cilia, pl.) Short, hairlike
membrane-bounded appendage com- citric acid An organic acid containing
posed of microtubules used in the loco- three carboxyl groups and an impor-
motion of cells. tant intermediate in a cyclic pathway
called the Krebs cycle, tricarboxylic acid
circadian clock A biological timing (TCA) cycle, or citric acid cycle that is
mechanism that controls a type of natu-
responsible for the metabolism of glucose
ral synchrony (see cell synchroniza-
to water and carbon dioxide in the pres-
tion) by controlling cell division.
ence of oxygen.
cis A term used in genetics to defi ne an
c-jun N-terminal kinase (JNK1,
event or gene whose action occurs on the
JNK2) An enzyme that activates the
same chromosome.
transcription factor AP-1 (AP-1 is
identical to the oncogene product jun) by
cis acting Pertaining to a genetic ele-
addition of phosphate groups to certain
ment that exerts an effect on a target
amino acids at the N-terminal end.
located within the same unit. For exam-
ple, a promoter element is said to be cis
acting with respect to the genes it controls clathrate A semisolid structure in which
because both are on the same strand. water molecules assume a cagelike structure
around a guest molecule. In the most
cis-acting gene A regulatory gene that common clathrates, the guest molecule is
controls transcription of genes that lie methane (CH4). These types of clathrates
near it on the same chromosome by bind- (also known as hydrates) were discovered
ing protein factors needed to turn tran- by Sir Humphrey Davy in 1810. In the nat-
scription on or off. See cis-trans test. ural environment, methane clathrates are
formed by bacterial or thermal degradation
cis face The portion of the Golgi com- of organic materials in oceans. Clathrates
plex stack of vesicles that has just formed, are under consideration as a possible source
also called the forming face, which is of renewable energy.
oriented toward the rough endoplasmic
reticulum. See Golgi apparatus. clathrin A large protein that forms a
basketlike structure around vesicles that
cisterna A flattened membrane-bound transport molecules into or through cells
sac, such as found in the endoplasmic or at sites (coated pits) where endocytosis
reticulum. will occur.

cis-trans test A test to determine a cleavage 1. The breaking of bonds of


functional genetic unit or the gene (see between units of macromolecules, such
cistron) by genetic complementation as the enzymatic cleavage of amino acids
(the ability to make functional gene prod- from protein.

48
www.stemcell8.cn
clustal
verso

2. The furrowing that occurs in animal duced after being instructed to do so


cells to form two daughter cells from a by contact with the antigen.
parent cell after mitosis when the chro-
mosomes have divided. clone (cellular) A population of cells
3. A series of cell divisions that occur that have been derived from the divisions
during early animal embryogenesis. of one cell, so the population is geneti-
cally identical.
cleavage divisions See cleavage.
clone (DNA) Recombinant DNA mol-
cleavage furrows See cleavage. ecule or recombinant molecule. A gene or
fragment of DNA that has been spliced
clinical trials Testing of new drugs or into a vector, so that the DNA can be
therapies on humans in a rigorous, con- amplified many times by transferring the
trolled setting. recombinant molecule into a host organ-
ism (usually a bacterium or yeast) that
CLN1, CLN2, CLN3 The genes that can be grown in large quantities.
code for the three G1 phase cyclins
cln1, cln2 and cln3in yeast. These clone bank A collection of recombinant
cyclins function to drive the initiation of DNA molecules of the genomic material of
S phase in the yeast cell cycle by forming a particular organism, prepared by frag-
complexes with cdc28, the yeast homo- menting the DNA of the organism and
logue of the mammalian cyclin dependent splicing each of the fragments into vector
kinase, cdc2. cln3 forms a complex with molecules. Also known as a library.
cdc28, which stimulates transcription of
the CLN1 and CLN2 genes. This results clone library See clone bank.
in accumulation of the cln1 and cln2
cyclins, which then form complexes with cloning The process of creating a
cdc28. The cln1-cdc28 and cln2-cdc28 recombinant DNA molecule, isolating it
complexes induce the transition from G1 and amplifying it. See gene cloning.
into S phase.
cloning vector The molecule of DNA
clonal deletion The selective loss, that is used to house the DNA fragment
early in development, of B and T cells to be cloned. Vectors are small chromo-
of the immune system that produce anti- somes, either plasmid or bacteriophage,
bodies or have receptors for antigens that capable of self-replication in a host cell
are an integral part of the organism (self and producing many copies of itself per
antigens). This process is necessary to host cell, thus amplifying the number of
prevent the immune system from attack- copies of the cloned fragment.
ing the cells and tissues of the organism
later in life (autoimmunity). Clostridium The genus of organisms
that are obligate anaerobes and produce
clonal selection The theory that the spores. Members of this group produce
stimulation of an immune response spe- powerful toxins and are responsible for
cific caused by the introduction of a for- diseases such as botulism, gas gangrene,
eign antigen results from proliferation of and tetanus.
a single preexisting antibody-producing
cell of the immune system such that a clustal A computer program for
clone of cells bearing antibodies specific aligning multiple nucleotide or peptide
for the antigen is produced. Clonal selec- sequences. Carrying out alignments on
tion was originally put forth as a coun- multiple sequences simultaneously allows
terhypothesis to the instructional theory the delineation of similar segments in
that stated that an antibody-producing genes from different sources. This infor-
cell altered the type of antibody it pro- mation can be used to group sequences

49
www.stemcell8.cn
recto pit
coated

into gene families or to defi ne regula- coenzyme Also called cofactor, a


tory elements or other motifs or to study small nonprotein organic molecule asso-
molecular evolution. ciated with an enzyme (apoenzyme) and
is required for catalytic activity. The
coated pit An invaginated site on the coenzyme plus the apoenzyme is called
cell membrane that is lined with clathrin a holoenzyme. Although the apoenzyme
facing the interior of the cell and con- does not change during the course of
taining specific receptors at the exterior catalysis, the coenzyme may be chemi-
where molecules interact with the recep- cally altered, but it is regenerated and
tors for transport into the cell via recep- reused in subsequent reactions. A num-
tor mediated endocytosis. ber of vitamins serve as components of
coenzymes. For example, two common
coated vesicle Small, membrane- coenzymes involved in energy metabo-
bound droplets coated with a basket of lism are nicotinamide adenine dinucle-
clathrin transporting molecules either otide (NAD+) and fl avin adenine dinu-
from the outside of the cell via recep- cleotide (FAD). Both the nicotinamide
tor mediated endocytosis, having arisen and fl avin portions of the molecules are
from coated pits, or transporting newly derivatives of the B vitamins, nicotinic
made proteins to be sorted to either acid and ribofl avin.
organelles or secreted to the outside of
the cell. coenzyme A (CoA or CoASH) A
small organic molecule composed of ade-
coat protein(s) The proteins that make nosine diphosphate that is linked to the
up the outer layer, or coat of a virus. vitamin pantheteine phosphate, which
serves as a carrier of acyl groups. CoA is
coccus (cocci, pl.) The name for a type particularly important as an acyl carrier
bacterial cell with a round morphology. during the oxidation of sugars for energy
production.
Cockayne syndrome A rare heredi-
tary disease fi rst described by Edward cofactor A metal ion, such as Mg++,
Alfred Cockayne that is characterized by Fe+++, or Mn+, or coenzyme that func-
sensitivity to sunlight, short stature, and tions in association with enzyme proteins
an aged appearance. The molecular basis and that are necessary for complete enzy-
of the disease is the inability to perform matic activity.
a certain type of rapid DNA repair called
transcription-coupled DNA repair Cohen, Stanley (b. 1922) A molecular
after exposure to ultraviolet light. biologist who carried out the first cloning
Defects in at least two genes have been experiments by splicing the gene encod-
identified in Cockayne syndrome: CSA ing resistance to the antibiotic tetracyclin
(also called ERCC8 for Excision-Repair from one strain of bacteria (Staphylococ-
Cross Complementing rodent repair defi- cus aureus) into a plasmid from another
ciency), located on chromosome 5, and strain (Escherichia coli) in a test tube. The
CSB (also called ERCC6), at gene map recombinant molecules were transferred
locus 10q11-21. into cells of E. coli, and transformed cells
with tetracyclin resistance grew into colo-
code Refers to the way the genetic nies. These experiments demonstrated
information is stored in the DNA. See that genes isolated from one organism,
codon. spliced into a vector, and transferred into
a host organism are intact and capable of
coding strand The strand of DNA that producing functional proteins. However
is used as a template to make mRNA. It it was the discovery of growth factors,
contains the complement of the code to including epidermal growth factor, that
be translated. won him the Nobel Prize in physiology

50
www.stemcell8.cn
Collins, Francis
verso

and medicine, which he shared with Rita encodes genes for a colicin and immunity
Levi-Montalcini in 1986. proteins that protect Col-harboring cells
from the bacteriocidal effects of the coli-
cohesions See condensins. cin it produces.

cohesive ends Also known as sticky colicin An antibiotic that is encoded by


ends. The single-stranded extentions of certain E. coli plasmids, such as ColE1.
a double-stranded DNA molecule that Colicins kill bacteria by a number of dif-
show complementarity to other single- ferent mechanisms, including inhibition
stranded extensions of DNA molecules. of protein synthesis, inhibition of active
Such sticky ends are generated by restric- transport, and DNA degradation.
tion endonucleases.
coliforms A group of bacteria that
coiled-coil A type of higher-order pro- includes the genera Escherichia, Kleb-
tein structure in which two helices are siella, Enterobacter, and Citrobacter,
wrapped around each other. Because the which are small rod-shaped facultative
wrapping causes each helix to be shaped anaerobes, stain Gram negative, and fer-
into another helix form, the helix coils ment lactose with gas production within
are thought of as being a coiled-coil in 48 hours of growth. They are used to
this configuration. assess fecal pollution of water.

coincidental evolution (concerted colinear Having the linear array or


evolution) In genes that have become sequence of one molecule correspond to
duplicated, the tendency for mutations that of another. The sequence of bases
occurring in one copy to appear in the found on the mRNA corresponds to the
other with the result that the effects of sequence of amino acids found on the
evolution appear in both copies at the protein that it encodes. This relation-
same time. ship extends to the sequence of bases
on the DNA for bacteria, but in higher
cointegrate structure A molecule of organisms, the DNA also contains some
DNA in which a transposon has medi- intervening sequences (see introns) that
ated the joining of two plasmids, with must be eliminated before obtaining
copies of the transposon occurring at the colinearity.
joints between the two plasmids. This
is the fi rst step in the transposition of colinearity The condition of being
the transposon from one plasmid to colinear. See colinear.
another.
coliphage A bacterial virus that infects
colcemid A drug that blocks microtu- and reproduces in coliforms.
bule formation and thus disrupts events,
such as chromosome separation during collagen A fibrous protein that is a
mitosis, which depend upon microtubule major component of connective tissue
function. and is found in the fuzzy layer that envel-
ops animal cells.
colchicine A drug that disrupts micro-
tubule function as does colcemid. Collins, Francis (b. 1950) A researcher
in the field of genetic disease who gained
ColE1 A naturally occurring plasmid fame as the head of the scientific team
that is carried by some strains of E. coli that succeeded in cloning the gene for cys-
and has been used as a basis for con- tic fibrosis through chromosome walking
structing a number of cloning vectors for in 1989. He is currently director of the
making recombinant DNA molecules. Human Genome Project at the National
It is one of a family of plasmids that Institutes of Health.

51
www.stemcell8.cn
recto
colloid

colloid A suspension of microscopic promegapoietin. CSFs are used to treat


particles ranging in size from 1 nm to conditions of low white-blood-cell counts,
1 m that is dispersed in some medium. such as in patients receiving radiation or
Hydrophilic colloids are composed of chemotherapy, patients with AIDS, and
macromolecules that remain dispersed in those with white-blood-cell diseases.
an aqueous solution because of the par- Commercially available CSFs are gener-
ticles affi nity for water. Hydrophobic ally made by recombinant DNA tech-
colloids are less stable and are composed niques.
of insolubles particles suspended in water
and remaining in a suspended state due colorimeter An instrument that quan-
to repulsive forces among particles. titates amount of substance in solution by
measuring the amount of light, at a given
colony A group of cells that grow from wavelength, that is absorbed by the solu-
a single cell on some solid medium, such tion. Colorimetry is based on Beers and
as an agar plate. Lamberts laws defi ning extinction coef-
ficient of a substance and the relation-
colony counter An instrument used to ship of light absorbed by a substance to
count the number of colonies on an agar its concentration. Colorimeters are also
plate. There are two types. The manual used to measure the turbidity of solutions,
type has an electronic stylus that creates which is an indication of the number of
a signal that is counted when touched to particles in suspension or the number of
a colony. Automatic colony counters have bacterial cells in a culture.
scanners that detect density differences
and can read an entire plate for the total combinatorial library A mixture of
number of colonies. polymeric chains in which individual
chains differ from one another by virtue
colony-forming unit (CFU) A viable of the linear arrangement of the mono-
cell that gives rise to a colony. mers that make up the polymer. For
example, a combinatorial peptide library
colony hybridization A method used would contain polypeptides that are cre-
to identify colonies harboring a particu- ated from the same amino acids, but the
lar gene or DNA sequence. Colonies on amino acids in different polypeptides in
an agar plate are partially transferred to the library would be arranged in a unique
a membrane, generally nitrocellulose or order, for example, Ala-Leu-Tyr-Ser- . . .
nylon, by gently pressing the membrane v. Leu-Ser-Tyr-Ala-. . . .
on top of the colonies. The membrane
is treated with alkalai to denature the combining site The site on an antibody
DNA in the cells, heated to fi x the DNA molecule where the antigen interacts.
onto it, then washed with a labeled probe
to identify those colonies that carry the commensalism A relationship between
sequence. Once the colony is identified on members of different species living within
the membrane, it can be picked from the the same cultural environment with one
original plate and cultured to study or to organism benefiting from the relation-
further isolate the gene or sequence. ship, but the other not being affected.

colony-stimulating factors (CSFs) A comparative genomics A branch of


group of hormonelike substances that bioinformatics concerned with the anal-
stimulates the production of various types ysis of gene structure and function by
of white blood cells. Colony-stimulating comparing similarities and differences
factors include: granulocyte-macrophage in DNA and protein sequences from dif-
colony-stimulating factors (GM-CSF or ferent organisms. Comparative genom-
sargramostim), granulocyte colony-stim- ics uses computer programs to compare
ulating factors (G-CSF or fi lgrastim), and DNA and protein sequences in genetic

52
www.stemcell8.cn
complete medium
verso

databases such as the GenBank and complementary base sequence A


Swiss Protein Database. These pro- sequence of bases that can form hydrogen
grams align multiple sequences to look bonds with another sequence. See com-
for regions of similarity. This type of plementary base pairing.
analysis is used to predict the function
of genes in higher organisms from the complementary DNA See cDNA.
known functions of similar genes in
lower organisms such as bacteria and complementation 1. The ability of
yeast. Differences among similar genes one chain of polynucleotides (either DNA
from different organisms can be used to or RNA) to form hydrogen bonds with
create models of evolutionary relation- another chain because of a coincidence
ships (molecular evolution). of adenine/thymine pairs of bases and
guanine/cytosine pairs of bases on each
compatibility group Defi ning a group strand.
of plasmids on their ability to coexist in 2. Genetic complementation is the ability
the same cell with another plasmid from of one mutant to supply a required func-
a different group. tion to another mutant. See cis-trans
test.
competence The state of a bacterial cell 3. Also, cloning by complementation
that has the ability to take up DNA from is a technique in which a mutant host
the environment. Some species of bacte- cell (e.g., lacks the ability to synthesize
ria develop natural competence by syn- some nutrient) is infected with a library
thesizing competence factors and DNA and a clone is picked that has the abil-
receptor proteins that aid in the uptake of ity to synthesize the nutrient. This clone
DNA into the cell. Other species, such as is derived from a mutant cell that picked
E. coli can be made competent by treat- up a recombinant molecule containing
ment of cells with high concentrations of a functional gene that has the ability to
CaCl 2 in the cold. replace its own faulty one.

competition hybridization A tech- complementation test See cis-trans


nique for determining the degree of test.
similarity between two nucleic acids by
measuring the degree to which the two complement-fi xation test (CF) A
nucleic acids hybrize to one another in serological test for antibodies based on
the presence of a third nucleic acid that the ability of complement to lyse red
acts as a standard. blood cells. Serum to be tested is mixed
with antigen and complement. An indica-
competitive inhibition The inhibition tor system of sheep red blood cells (RBCs)
of an enzyme by a substance that revers- and antibody against the sheep RBCs is
ibly binds to the active site of the enzyme added. If specific antibody for the antigen
and thus competes with the substrate for is present in the serum, it will combine
the site. with the antigen and bind the comple-
ment, and no complement will be avail-
complement A group of serum pro- able to lyse the sheep RBCs. Thus no lysis
teins that are activated by reaction with of sheep RBCs indicates the presence of
antigen-antibody complexes. Once acti- antibody in the serum in a complement-
vated, they aid in the killing of pathogenic fi xation test.
bacteria and/or facilitate phagocytosis.
complete medium A culture medium
complementary base pairing The for- that supplies all the nutrients (amino
mation of hydrogen bonds between ade- acids, vitamins, and bases found in
nine and thymine and between guanine nucleic acids) that an organism needs for
and cytosine. See complementation. growth.

53
www.stemcell8.cn
recto
complexity

complexity A measure of the num- chromosome condensation involves an


ber of different base-pair sequences on a ordered coiling of the DNA-chromatin
given genome. that uses energy derived from hydrolysis
of ATP. The cohesions are highly con-
composite transposon A transposable served in evolution and are found in
element made up of insertion sequence eukaryotes and prokaryotes.
(IS) elements flanking a central portion
of DNA sequence that usually contains conditional mutation A mutation that is
a gene or genes encoding antibiotic resis- expressed only under certain conditions. An
tance determinants. Common composite example, is a temperature-sensitive mutation
transposons are Tn5 and Tn10. that encodes a protein functional at certain
permissive temperatures (e.g., 32C), but
compost A mixture of decaying not functional at higher nonpermissive tem-
organic material used for fertilization or peratures (e.g., 42C). Such mutations can
rejuvenation of soil. define essential genes because mutations in
essential functions are lethal events, but con-
concanavilin A (con A) A lectin ditional mutations allow the organisms to
isolated from the jack bean (Canavalia survive at permissive temperatures.
ensiformis) that binds to certain sugar
residues. It is used in affi nity chroma- conformation The three-dimensional
tography to purify glycoproteins and structure of a macromolecule, such as a
is also used to agglutinate cells by cross- protein.
linking glycoproteins found at the cell
surfaces. In addition, con A induces rest- congenital Aquired during develop-
ing lymphocytes to divide. ment in the uterus.

concatamer A series of the same DNA conidiophore A specialized fungal


molecules linked in tandem, thus creating structure that bears the spores of conidia.
a dimer, a trimer, or a multimer.
conjugation A means of gene transmis-
c-oncogene A normal cellular gene sion between any coliform bacterial strain
that has a viral oncogene, or tumor- that carries an F factor (carried either on
producing homologue. Such genes are the bacterial chromosome or extrachro-
also called proto-oncogenes and can be mosomally) and another strain that lacks
activated by mutation, amplification, the F factor. During conjugation, neigh-
or overepression to become a cancer- boring bacteria come into direct contact
producing cell. with one another and transfer DNA from
one (the donor) to another (the recipient)
condensation The chemical reaction by means of a mating tube formed at the
that results in the joining of two mol- point of contact. Because the genes from
ecules with the elimination of a water the donor are always transferred in a given
molecule. An example is the formation order, conjugation has been used to map
of the peptide bond between two amino genes on the bacterial genome by observ-
acids. ing which genes are transferred to recipi-
ents following controlled interruption of
condensing vacuole A membrane- the mating process. See HFR strain.
bound vacuole arising from the Golgi
complex and developing into a secretory conjugation, bacterial A means of
granule by the progressive loss of water. gene transmission between bacteria by
cell-to-cell contact or bacterial mating.
condensins Families of proteins that
mediate the condensation of chromo- conjugation, chemical The covalent
somes during mitosis. The process of attachment of a molecular group to a

54
www.stemcell8.cn
constant region
verso

molecule for the purpose of enhancing each position when different examples
or altering its function. The attachment are compared. Consensus sequences are
of fluorescent or chromogenic groups found in promoters and are responsible
to antibodies or nucleic acids to create for binding RNA polymerase and other
probes is an example of conjugation. proteins needed for transcription. Con-
sensus sequences also signal other events,
connective tissue Fibroblast cells that such as splicing of introns out of primary
secrete collagen. Collagen gives cells transcripts.
adhesive strength that is needed to main-
tain form. Some examples of connective conservative replication A mecha-
tissue are bone, cartilage, tendons, and nism of DNA replication in which each
ligaments. strand of a parental molecule remains
together after replication. See semicon-
connexon A structure of the gap junc- servative replication.
tion composed of six protein subunits
around a hollow center. Two aligned con- constant region The carboxy termi-
nexons of two cells provide a means of nal regions of the heavy chain or light
communication between the two cells. chain of the antibody molecule, which
has the same or nearly identical amino
consensus sequence An order of bases acid composition as each member of the
that has the most common nucleotide at same class.

Bacterial conjugation

55
www.stemcell8.cn
recto
constitutive gene

constitutive gene Genes that are ex- dilutes the incoming material and is useful
pressed continuously and are not subject in waste treatment or any other procedure
to either induction or repression. Such in which any components of the incoming
genes encode housekeeping functions and substrate would inhibit the enzymatic bio-
are expressed in all cells at a low level. conversion process.

constitutive heterochromatin Chro- contractile ring A beltlike structure


mosomal regions that remain in a perma- composed of actin microfi laments and
nently condensed state during interphase found under the plasma membrane that
in every cell in the organism and are functions to divide an animal cell into
never genetically active in any cell, such two daughter cells after mitosis.
as the centromere.
controlling element Transposable ele-
constitutive mutant An organism that ments of maize that were found to cause
has a mutation in some regulatory gene mutations and chromosomal breakage
so that the expression of the gene(s) it when they transposed into or excised out
controls is constitutively expressed. See of genes.
constitutive gene.
Coombs reaction An immunological
contact inhibition The property of test for identifying blood groups using
normal animal cells in culture to stop specific antibodies to antigens of red blood
dividing once they have formed a con- cells, red blood cells, and antiantibodies to
tiguous monolayer over the surface of the overcome a natural replusion by red blood
medium on which they are growing. cells, which can mask a positive test.

contamination Growth of undesirable coordinated enzyme synthesis The


organisms in some culture or material. regulation by the same event or signal
of the synthesis enzymes involved in the
contig A term that describes the assem- same metabolic process. In bacteria this is
bly of sequence data from multiple over- accomplished generally by the organiza-
lapping DNA fragments into a larger seg- tion of the genes that encode the enzymes
ment. The term reflects the practical size into operons with a single regulatory ele-
limitations of the sequencing techniques ment. In higher organisms, the genes are
used for sequencing large stretches of usually scattered but have common regu-
genomic DNAs such as those employed in latory elements that respond to the same
the Human Genome Project. Because only signal.
relatively short fragments can be reliably
sequenced in a single run, sequence data coordinate regulation The expression
representing a large DNA segment, such of multiple genes in unison, for example,
as may be present in a yeast artificial chro- the genes of an operon.
mosome (YAC), must be derived by assem-
bling data from many smaller pieces. copia elements A family of transpos-
able elements found in Drosophila. A
continuous culture A system that typical Drosophila genome carries about
maintains a cell culture at a steady 50 of these elements in widely scattered
growth rate. This is achieved by use of a regions.
chemostat or turbidostat.
copolymer A synthetic polymer of two
continuously fed stirred tank reactor deoxyribonucleotides in random order
(CSTR) A bioreactor apparatus in (e.g., ACACCACCCAA), or two ribo-
which fresh substrate is continuously fed nucleotides in alternating order (e.g.,
in and a corresponding volume of con- AUAUAUAUAU). These were used to elu-
tents is removed. Such procedure quickly cidate the genetic code by using them in

56
www.stemcell8.cn
cosmid
verso

an in vitro protein synthesizing system corpus luteum The temporary endo-


and analyzing the amino acid composi- crine gland formed from a ruptured ovar-
tion of the resulting polypeptides. ian follicle after release of an egg.

copy choice A mechanism of genetic cortical cytoplasm A region of the egg


recombination in which the recombinant cytoplasm just under the cell membrane
molecule is formed by selectively replicat- that undergoes rearrangements after fer-
ing parts of the parental DNA molecules. tilization and has profound consequences
in the development of the embryo.
copy number The number of plasmid
molecules per bacterial cell. Some plas- cortical reaction Release of enzymes
mids are said to be relaxed in the con- from the cortical vesicles after fertiliza-
trol of their replication and are defi ned tion of an animal egg that results in a
as high-copy-number plasmids, e.g., more hardening of the vitrelline membrane to
than 20 to 100 copies per cell. These are prevent additional sperm penetration.
used as cloning vectors and result in high
yields of recombinant DNA or the pro- cortical vesicles Membrane-bound str-
tein encoded by the recombinant. Strin- uctures of the egg cell that release prote-
gently controlled plasmids exist in cells in ases and other enzymes during the pro-
low copy number, or one to a few copies cess of fertilization.
per cell. These plasmids are used to clone
genes that produce proteins that are toxic corticosteroid The steroid hormone, a
to bacterial cells when produced in high derivative of cholesterol, that is synthe-
concentrations. sized in the adrenal cortex.

cordycepin An antibiotic that acts by COS cells A derivative of CV-1 mon-


blocking transcription. Cordycepin is a key cells that are infected with, but do
derivative of the normal nucleoside, ade- not produce SV40 virus. COS cells
nosine, in which the hydroxyl group on express the SV40 early genes (T antigens)
the 3 carbon is missing. When cordycepin needed for viral replication. COS cells
becomes incorporated into newly synthe- are used as host cells in cloning experi-
sized RNA in place of the normal adenine ments, when derivatives of SV40, lacking
nucleoside, the RNA strand terminates. the early genes, are used as cloning vec-
tors for eukaryotic DNA. The early genes
core particle An octamer of histones expressed by the COS cells allows the
(H2A, H2B, H3, and H4) with 146 base recombinant molecules to replicate and
pairs of DNA wrapped 13/4 times around thus amplify its cloned inserts.
in a nucleosome.
cosmid A cloning vector constructed of
corepressor The effector molecule that a plasmid origin of replication, an anti-
binds to a repressor to form a complex. biotic resistance gene, and the cos sites
The effectorcorepressor complex func- of lambda DNA. These molecules can be
tions to repress or prevent transcription packaged in vitro into a lambda phage
of a bacterial operon. coat and can then be transferred into host
cells by viral infection. Colonies contain-
Cornybacteria A genus of small ing the cosmid are selected on medium
Gram-positive straight to slightly curved supplemented with the antibiotic of the
rod-shaped bacteria, frequently club resistance gene on the cosmid. Such clon-
shaped, with aerobic to facultative che- ing vectors can be used to clone frag-
moorganic (see chemoorganotroph) ments up to about 47 kilobases long. This
metabolism. A pathogenic member of is about three times the amount of DNA
this group is C. diphtheriae, the causative that can be cloned into lambda-phage-
agent of diphtheria. derived vectors.

57
www.stemcell8.cn
recto
cos site

cos site The 5 12 base-pair (bp) over- across the cell membrane. See cotrans-
hang termini of bacteriophage lambda port.
DNA that are base-pair complementary
to each other: When a cell is infected with covalent bonds Strong chemical bonds
this bacteriophage, the DNA, injected in formed between atoms in which there is a
as a linear molecule, circularizes through sharing of two or more electrons.
hydrogen bonding between nucleotides
of the overhang termini. Lambda is covalently closed circular DNA A
replicated in long tandem repeats of its circular double-stranded molecule of
genome. The cos sites serve as packaging DNA, such as a plasmid, in which there
markers for an endonuclease that cuts in are no nicks or breaks in the sugar phos-
a staggered fashion, creating unit head- phate backbone. Usually, covalently
fuls of DNA with 5 12 bp overhangs that closed circular (ccc) DNA exists as super-
are packaged into phage coats. coiled; that is, the molecule folds in on
itself due to strain in the molecule. If a
cotransduction The introduction of two nick is introduced into the backbone, the
linked genes into a bacterial cell by the ge- molecule relaxes and is referred to as an
netic transmission process of transduction. open circle (oc). See supercoiled DNA.

cotransformation The introduction of Coxsackie viruses An antigenically


two linked genes into a bacterial cell on distinct group of viruses of the entero-
the same fragment of DNA by the genetic virus genus (viruses that are found in
transmission process of transformation. the intestines and excreted in the feces),
including some human pathogens.
cotranslational transfer The insertion
of one end of a polypeptide into the mem-
CpG rich islands Regions of DNA
believed to be regulatory elements of
brane of the endoplasmic reticulum
gene activity that are characterized by
before synthesis of the whole polypeptide
an unusually high content of cytosine
is completed. See leader sequence.
and guanine nucleotides arranged in the
repeating sequence: CGCGCGC. . . .
cotransport The simultaneous move- CpG islands are located in a segment 5
ment across a membrane of two different to the coding region in many genes and
substances in a coupled manner. The two are often sites of methylation.
substances may move in the same direc-
tion (symport) or in the opposite direc- C-reactive protein A protein whose
tion (antiport). levels increase during systemic inflam-
mation and which functions to activate
Coulter counter An instrument that the complement pathway and prepares
automatically counts cells by measuring foreign substances for phagocytosis. C-
the changes in resistance that occur when reactive protein is a member of the pen-
cells in suspension are passed through a traxin protein family, was discovered
small slit. by Tillet and Frances in 1930, and was
named for the fact that it reacts with the
coupled reactions Two enzymatically C polysaccharide of Streptococcus pneu-
controlled chemical reactions that must moniae. C-reactive protein is made in the
occur simultaneously. For example, many liver, and blood levels increase within six
reactions that require an input of energy hours of an acute inflammatory stimu-
to proceed are coupled to the hydrolysis lus. These protein levels in the blood are
of ATP (ATP ADP + Pi), which releases 7 under investigation as a means of assess-
kcal of energy. ing cardiovascular disease risk.

coupled transport The obligatory creatine phosphate A high-energy


simultaneous transport of two solutes compound in muscle cells that is used to

58
www.stemcell8.cn
cruciform structures

regenerate the ATP needed for muscle cro protein A protein that interferes
contraction. with the synthesis and action of the C
repressor of a lambda bacteriophage and
CREB Cyclic-AMP response element is necessary in the lytic response of the
binding; CREB proteins are transcrip- phage after infection into a cell.
tion factors that are activated by stimuli
that increase cAMP levels. The binding of crossing over The physical exchange
CREBs to sequences called CRE elements of genetic information between a pair of
in the promoters of a number of genes reg- homologous DNA molecules.
ulates their transcription. cAMP produc-
tion is controlled by the binding of various crosslink A covalent bond between
ligands to certain cell surface receptors strands of DNA. See cross-linking.
linked to adenylyl cyclase. cAMP activates
a protein kinase which, in turn, activates cross-linking A reaction in which two
a protein kinase that migrates into the strands of DNA are covalently bonded
nucleus and activates a CREB protein. together. Certain mutagenic agents, such
CREB proteins have been shown to be as X-rays, cause cross-linking, and the
involved in the process of long-term poten- DNA must be repaired if it is to replicate
tiation in the neurons of lower organisms, and function properly.
including snails, fruit flies, and rats. In
humans abnormalities in the gene coding crossover fi xation An alternative
for the CREB protein CBP is associated model to saltatory replication to explain
with Rubenstein-Taybi syndrome. the occurrence of highly repeated
sequences. In crossover fi xation, addi-
Crick, Francis (19182004) A Brit- tional copies of a certain sequence are
ish scientist who with James Watson won created on one DNA strand by unequal
the Nobel Prize in physiology and med- crossing over.
icine in 1962 for postulating a double-
stranded helical structure for DNA, using cross-reactive antibodies Nonspe-
the X-ray diffraction data of Maurice cific antibodies that will bind to antigens
Wilkins, also a Nobel Prize winner in and give a false positive response in an
1962. The double helix accounted for the antigen-antibody test.
known physical and chemical properties
of DNA, but also suggested a mechanism
crown gall plasmids The Ti (tumor-
for its replication.
inducing) plasmid of Agrobacterium
tumefaciens that is responsible for the
crista The infolding of the inner mem-
malignant transformation of dicotyledon-
brane of the mitochondrion, which in-
ous plants infected with this organism.
creases the surface area of the membrane
Part of the plasmid DNA incorporates
responsible for electron transport and
production of ATP via oxidative phos- into the plant chromosome to cause the
phorylation. production of a tumor. These plasmids
lacking the tumor-producing genes have
critical concentration The minimal been constructed as potential vectors for
concentration of subunits required for recombinant DNA molecules for plant
formation of a polymer. genetic engineering.

critical dissolved oxygen concentra- crown gall tumor See crown gall
tion (Ccrit) The concentration of dis- plasmids.
solved oxygen in a submerged culture
when oxygen is the limiting substrate. The cruciform structures DNA structure
air supply to a fermentor is adjusted to in which strands separate and self-anneal
maintain an oxygen level above its Ccrit. through complementary base pairing

59
www.stemcell8.cn
cryogenics

is enhanced. Common cryoprotectants


are dimethyl sulfoxide (DMSO), glycerol,
and sucrose.

cryptic plasmid A plasmid that con-


tains no genes or apparent phenotypic
markers other than those needed for rep-
lication and transfer.

crystallography (X-ray) A technique


used to analyze the structure of mole-
cules by analysis of diffraction patterns
of X-rays that pass through crystal spec-
imens.

CsCI centrifugation See cesium


chloride gradient centrifugation.

ctDNA The DNA found in a chloro-


plast.

culture A population of cells cultivated


in a medium.

curing Any action that causes the loss


of a plasmid or lysogenic bacteriophage
from a culture of bacteria.

cutaneous Pertaining to, existing on,


Cruciform structures or affecting the skin.

cuvette The container for samples for a


to form cruciforms or crosslike struc-
spectrophotometer, or other instruments
tures. Cruciforms can arise at regions of
that are used to make measurements on
inverted base-pair repeats.
liquid samples.
cryogenics The science of freezing, C value A value representing the total
especially with reference to methods for amount of DNA, given in base pairs, in
producing very low temperatures. the haploid genome of a particular spe-
cies.
cryopreservation The preservation of
cells, organs, tissues, or other biological cyanine dyes Water-soluble fluores-
materials at very low temperatures, in cent dyes widely used as labeling mol-
freezers (80C), over dry ice (79C), or ecules in a variety of probe applications,
in liquid nitrogen (196C). At low tem- including probe hybridizations for micro-
peratures, preserved biological materials arrays and analytic techniques based on
remain genetically stable and metaboli- antigen-antibody reactions. Cyanine dye-
cally inert. labeled molecules can be detected with
sensitivities close to that for radiolabels.
cryoprotectants Chemicals that reduce The most commonly used cyanine dyes
the formation of ice crystals during freez- are Cyanine 3 (or 5) bihexanoic Acid;
ing so that survival of cryopreserved cells Cy3 or Cy5.

60
www.stemcell8.cn
cycloserine

cyanobacteria Blue-green algae. Pro- groups to proteins, either at a serine


caryotic, photosynthetic, oxygen-evolving or tyrosine residue. Phosphorylation
organisms. of proteins is an important mechanism
of regulation of metabolism in higher
cyanogen bromide (CNBr) A chemi- organisms because the added phosphate
cal that recognizes methionine residues and group either activates or inactivates the
cleaves polypeptide chains at these residues. protein and thus stimulates or inhibits
CNBr is used to cleave genetically engi- the metabolic reaction.
neered proteins that have been constructed
as a composite of cloned material and vec- cyclic GMP A molecule of guanosine
tor material. CNBr is also used to cross- monophosphate in which there is a cova-
link proteins to various support materials lent bond between the 3 hydroxyl (OH)
for affinity chromatography purposes. and the 5 phosphate group.

cyclic AMP (cAMP) A molecule of cyclin(s) The regulatory subunits of


adenosine monophosphate in which there cyclin-dependent kinases (cdks); cdks
is a covalent bond between the 3 hydroxyl are activated upon binding a specifi c
(OH) and the 5 phosphate group. It is cyclin. Once activated, cdks induce cells
an important molecule in controlling to transit through a certain stage of the
metabolic processes in higher organisms cell cycle. Originally discovered as a
(see cyclic AMPdependent protein component of MPF (mitosis-promoting
kinases). Because its intracellular concen- factor), a substance isolated from cells
tration is often controlled by hormonal of embryos of the frog Xenopus laevis
action and the metabolic activities it con- that were found to induce entry of cells
trols is in response to the hormone, it is at any stage of the cell cycle into mitosis
called a second message. cAMP also plays (M phase).
a role in the control of bacterial metabo-
lism by binding with the catabolite activa-
tor protein and regulating transcription of
cyclohexamide An antibiotic that
inhibits yeasts and other fungi but does
some genes.
not inhibit bacteria. It is used as an agri-
cultural fungicide.
cyclic AMPdependent protein kin-
ases Enzymes that add phosphate
cyclooxygenase enzymes Cyclooxy-
genases (COXs) are mixed-function oxi-
dases that catalyze the addition of oxygen
atoms to carbons 9, 11, and 15 as well as
form a covalent bond between carbons 8
and 12 of arachidonic acid to create pros-
taglandin H 2 (PGH 2), the precursor of
other prostaglandins. The COX enzymes
are also known as prostaglandin H2 syn-
thases. COXs have two isozymic forms
termed COX-1 and COX-2. Aspirin acts
to inhibit both COX isozymes by acety-
lating a serine residue in the active site.

cycloserine An antibiotic from Strep-


tomycetes that acts by blocking two steps
in the biochemical pathway by which
the bacterial cell wall is synthesized.
Because cycloserine is structurally
Cyclic AMP (cAMP) similar to the amino acid D-alanine, it

61
www.stemcell8.cn
cysteine

Regulation of cell-cycle kinetics by cyclins. The transition from the G2 phase to mitosis (M) is
regulated by a complex between cyclin B and a cyclin-dependent kinase (cdk). p34cdc2 contains
three phosphorylation sites at Thr 14, Tyr 15, and Thr 161; in the active form, Thr 161 is phos-
phorylated, and Thr 14 and Tyr 15 are not (left inset). p34cdc2 is phosphorylated at Thr 161 dur-
ing G1 and becomes additionally phosphorylated at Thr 14 and Tyr 15 on binding to cyclin B that
begins to accumulate at the end of S phase. Dephosphorylation of the Thr 14 and Tyr 15 sites
mediated by the phosphatase p80cdc25 occurs at the G2/M boundary, resulting in the active
complex. Cyclin B is then rapidly degraded by ubiquitin just after the start of mitosis. A-type
cyclins begin to accumulate during S phase and appear to function at the G2/M boundary. Net
synthesis of E-type cyclins occurs in G1; E-type cyclins activate a second cdk, p33 cdk2, which
acts at the G1/S boundary. p33cdk2 acts to induce phosphorylation of histones and certain cel-
lular proteins involved in mitosis.

competitively inhibits the incorporation between chains contributes to the overall


of D-alanine into a pentapeptide that shape of the protein.
is used to construct the bacterial cell
wall. cystic fibrosis An inherited disease
that affl icts almost one in 2,000 children
cysteine An amino acid with a sulfhy- in the United States. In 1989 the gene,
dryl in its side chain: whose mutant allele accounts for a major-
NH 2 ity of the cases, was cloned.
|
HS-CH 2-CH-COOH Cystic Fibrosis Transmembrane Con-
Disulfide bonds between two cysteine ductance Regulator (CFTR) A pro-
residues on the same polypeptide chain or tein that functions as a channel for the

62
www.stemcell8.cn
cytoplasmic inheritance

transport of chloride ions across the acteristic of epithelial cells previously


cell membrane. Mutations in CFTR are identified as tonofi laments by electron
responsible for the diseases cystic fibrosis microscopy. The cytokeratin family con-
and congenital bilateral aplasia of the vas tains a number of different proteins, and
deferens. The CFTR gene is located on keratin fi laments found in different types
chromosome 7q31.2. of epithelia are comprised of different
keratin proteins. Expression of keratins is
used clinically as a diagnostic criterion in
cytidine monophosphate (CMP) The
tumor diagnosis.
nitogenous base cytosine attached to a
ribose sugar molecule with a phosphate
residue at the 5 end of the ribose.
cytokinesis The process of dividing
the cytoplasm of a cell into two daughter
cells following mitosis.
cytidine triphosphate (CTP) The same
as CMP above, but with three phosphate cytokinins Substances that promote
residues. cell division and cell-and-shoot differ-
entiation in plant tissue cultures. Some
common cytokinins are benzylaminopu-
cytochalasins A family of drugs pro-
rine (BAP) and 2-isopentenyladenine.
duced by certain fungi that interferes
with polymerization of actin microfi la-
ments and hence inhibits cell movements cytology The study of cells based on
that depend on actin polymerization- microscopic observations.
depolymerization reactions.
cytomegalovirus (CMV) A usually
cytochrome c oxidase An enzyme nonpathogenic human virus that can
complex of the electron transport chain be pathogenic in immunocompromised
that reduces molecular oxygen to water. hosts. Following infection, the virus per-
sists in the host but the carrier is protected
cytochrome P-450 (also P450) A from disease by its immune system. Both
cytochrome found in the smooth endo- (T-cell immunity) and humoral (antibody)
plasmic reticulum that is important in activities are believed to be involved in
drug detoxification, especially in the liver. the defense against such CMV-induced
Cytochrome P-450 is a type of mixed- disease, and thus the organism is a good
function oxidase that carries out hydrox- model to study immunological processes.
ylation reactions (addition of OH groups) Many plasmid vectors have incorporated
to molecules, thus aiding in solubilizing a promoter from CMV so that mamma-
them so that they can be flushed out of lian genes cloned behind the promoter
the body. will be expressed in cell culture.

cytochromes Heme-containing proteins cytoplasm The liquid colloidal sub-


of the electron transport chain involved stance between the cell membrane and
in cellular respiration that carry out oxi- nucleus of the cell.
dation-reductions reactions, thus pass-
ing electrons down the chain from iron cytoplasmic inheritance Patterns of
atom of one cytochrome to iron atom of inheritance carried by genes not con-
another until it is passed to the fi nal elec- tained in the chromosomal DNA; i.e.,
tron acceptor, molecular oxygen. the genes carried in mitochondria or
chloroplasts. Since the sperm cytoplasm
cytogenetics That area of study of does not contain mitochondria, pat-
chromosomes and their behavior. terns of cytoplasmic inheritance involv-
ing mitochondria are always maternal.
cytokeratins A class of proteins that One example of cytoplasmic inheritance
make up the intermediate fi laments char- in humans is LHON (Lebers Hereditary

63
www.stemcell8.cn
cytoplasmic streaming

Optic Neuropathy), which is caused by cytosine One of the nitrogenous bases


defects in the electron transport Com- found in nucleic acids. Cytosine is a
plex I in mitochondria. Other examples pyrimidine that forms hydrogen bonds
include: MELAS syndrome (mitochon- with the purine guanine.
drial myopathy, encephalopathy, lactic
acidosis, and stroke-like episodes), caused cytoskeleton A complex network of
in most cases by an A to G transition in a microtubules, microfilaments, and interme-
mitochondrial leu-tRNA; Kearns-Sayre diate filaments extending throughout the
syndrome (KSS), which leads to loss of
cytoplasm that gives shape to a eukaryotic
vision, hearing, and heart problems due
cell and is involved in cellular movement.
to the accumulation of defective mito-
chondria; and MMC (maternally inher-
ited myopathy and cardiomyopathy), cytosol The cytoplasm that contains
where energy-demanding muscle cells are the organelles of a eukaryotic cell.
compromised.
cytotoxic T cell An activated T lym-
cytoplasmic streaming The back-and- phocyte, also known as a killer T cell,
forth movement of cytoplasm in some that Iyses cells that are recognized as a
algae and the circular flow of cytoplasm combination of self and foreign, such as
around a central vacuole in plant cell, virally infected cells, tumor cells, and for-
also known as cyclosis. eign tissue graphs.

64
www.stemcell8.cn

A
D

dalton A unit of mass used generally colon cancer. The name DCC derives
for macromolecules that is equal to 1.000 from the observation that segments of
on the atomic mass scale, or almost the chromosome 18 now known to contain
same as the mass of a hydrogen atom. DCC are frequently deleted in colon car-
The term dalton can be used interchange- cinoma tumors. DCC is expressed on
ably with the term molecular weight. neural membranes, where it appears to
Thus a 100,000 dalton (or 100 kilodal- serve as a receptor for the protein netrin.
ton protein) can be described as having a Its tumor-suppressive activity appears to
molecular weight of 100,000. stem from its ability to induce apopto-
sis in tumor cells. The apoptotic activity
dansyl chloride A compound that of DCC is upregulated by caspase 3 and
reacts with the amino group of an amino downregulated by netrin. DCC gene map
acid to produce a fluorescent derivative locus is 18q21.3.
that can be easily detected and identified.
It is used in procedures to identify the DDBJ See databases.
amino terminal residue of peptides.
ddNTPs Dideoxyribonucleotidetriphos-
dark reactions A series of enzymati- phates. See Sanger sequencing.
cally catalyzed reactions in which organ-
isms that carry out photosynthesis syn- deaminase An enzyme that removes
thesize organic compounds in the form amino groups from molecules.
of sugars from inorganic carbon dioxide.
These reactions use energy, in the form deamination The process by which a
of ATP, and reducing power, in the form deaminase removes amino groups from
of NADPH made during the light-phase molecules. Deamination of bases in DNA
reactions of photosynthesis. results in mutations, and cytosine is the
most susceptible base.
databases Information stored in com-
puters to be used in the sequence analysis death phase The fi nal phase in the
of genes and proteins. The National Insti- growth curve of a population of cells in
tutes of Health maintains such databases which the cells die exponentially; that is,
(GenBank). EMBL is a European database for each time increment, a certain per-
established in 1980 to collect and store centage of cells die.
nucleotide sequence data. Its counterpart,
SwissProt, translates the sequence data into decline phase See death phase.
protein data. EMBL, GenBank, and the
DNA database of Japan, DDBJ, collabo- degrees of freedom The number of
rate to collect and exchange data on a daily independent variables in an experiment.
basis, as sequence data are being deposited
at a rate of one sequence per minute. defective virus A virus that is missing
some essential genetic information so that
DCC Deleted in colon carcinoma; a it cannot reproduce itself. Such viruses
tumor-suppressor gene associated with can be propagated in a host cell only if a

65
www.stemcell8.cn
recto
defensins

helper virus that supplies the missing pro- delayed hypersensitivity An allergic
teins coinfects the same host cell. reaction that takes 24 to 48 hours to
appear. An example is the skin test for
defensins Part of the innate host defense exposure to tuberculosis. After injection
system against invading microbes. These with the allergen, a positive response
small peptides, produced by many differ- (a swelling at the injection site) does not
ent organisms, have a broad spectrum of appear before 48 hours.
activity against bacteria, fungi, and some
enveloped viruses. Defensins have been deletion mutation A change on the
found in great abundance in the phago- DNA due to the elimination of one or
cytic white cells of mammals and birds, more nucleotides. A deletion can alter the
but they have also been found in cells of genetic information in a very profound
the intestine and in skin cells. Their main way. The deletion of one base pair results
mechanism of activity is to insert into the in a frameshift, where every codon is
membranes of microbes and destroy them. changed following the deletion; a dele-
tion of many bases results in a message
defi ned medium A medium used to with fewer codons. See frameshift.
grow organisms in which all the compo-
nents are known. For heterotrophs, that delivery system An artificial system to
would be a medium with a known carbon deliver a drug to a specific target, such
source, nitrogen source, metals, and any as inclusion of a drug in a liposome or
amino acids, vitamins, or other growth conjugating a drug to an antibody. See
factors required by the organism. fusogenic vesicle.

degenerate code Referring to the fact demyelination The loss of the myelin
that in the genetic code many amino sheath, layers of membrane surrounding
acids are specified by more than one segments of nerves that provide rapid
codon or sequence of three bases (triplet). transmission of nerve impulses down
The degeneracy of the code accounts for such nerves. Demyelination occurs in
20 different amino acids encoded by 64 some degenerative nerve diseases, such
possible triplet sequences of four different as multiple sclerosis and polio, resulting
bases (see nucleic acid). For example in loss of function of those demyelinated
the amino acid leucine has six different nerves.
codons, UUA, UUG, CUU, CUC, CUA,
CUG. See wobble. denaturation Change in the three-
dimensional shape or structure of a pro-
degradation The process by which tein or nucleic acid by a physical or chem-
substances are broken down. A degrada- ical agent, such as heat or strong acid (the
tive pathway is one in which molecules denaturant), such that normal function-
are enzymatically cleaved into smaller ing is altered.
molecules.
denaturation of DNA The splitting
dehydration-condensation reaction apart of the double-stranded structure into
The joining of two molecules together single strands by heating the molecule or
with the elimination of a molecule of treating it with acid, alkali, salts, or urea.
water. See hydrolysis.
denaturation of proteins See dena-
dehydrogenation The process by which turation.
hydrogen ions or protons are removed
from an organic molecule. Such a process dendrite A branch of a nerve cell
is also called oxidation. It is carried out the receives signals and transmits them
by enzymes called dehydrogenases. inward toward the nerve cell body.

66
www.stemcell8.cn
density gradient
verso

Denaturation of DNA

Denhardts solution A commonly used


solution for carrying out probe hybridiza-
tions on fi lters, for example, Southern and
northern blots. Denhardts solution con-
tains polyvinylpyrrolidone (PVP), ficoll,
bovine serum albumin, and a nonspe-
cific DNA at high concentration to pre-
vent nonspecific probe hybridization. See
Southern blot hybridization.

denitrification The process of reducing


nitrogen compounds to a lower oxidation
level, e.g., nitro (NO3) to nitrate (NO2)
or nitrate to nitrite (NO).

density gradient A solution in which


there is a range of densities with the sol-
ute being more concentrated at the bot-
tom and less concentrated at the top.
These gradients can be stepwise, formed
by discrete layers of different density
solutions, or continuous, formed by small
incremental changes in density. The gra-
dients are generally made from solutions
of sucrose or the heavy salts, cesium chlo-
ride or cesium sulfate. Density gradient centrifugation

67
www.stemcell8.cn
recto gradient centrifugation
density

density gradient centrifugation Tech- deoxyribonucleotide A deoxyribonu-


nique used to separate macromolecules cleoside with phosphate groups attached
according to their buoyant densities by to the sugar, usually at the 5 position.
either layering the macromolecules on top This is the basic building block of DNA.
of a preformed gradient and subjecting the See nucleotide.
gradient to centrifugation, or mixing the
molecules in a solution of some support depolarization The change in electrical
that will form a gradient on centrifuga- charge across a membrane. When a nerve
tion. See centrifuge, cesium chloride cell receives an impulse, it becomes momen-
density centrifugation, and density tarily depolarized; its interior becomes
gradient. more positivily charged with respect to its
exterior. Repolarization restores its interior
deoxynucleoside Any of the nitroge- to a negative charge. A nerve impulse is
nous bases found in nucleic acids (adenine, propagated down a nerve fiber by waves
guanine, thymine, uracil, or cytosine) of depolarization-repolarization events. See
attached to deoxyribose, a five- carbon action potential.
sugar. See nucleoside.
depurination Removal of purines
deoxyribonuclease (DNase) An (guanine or cytosine) from DNA with
enzyme that breaks the chemical bond the sugar-phosphate backbone remaining
between the phosphate and sugar groups intact. Such a process occurs either enzy-
(the backbone) of DNA molecules. These matically, as in a DNA repair process, or
enzymes can be exonucleases, removing nonenzymatically, when a chemical inter-
deoxynucleotides from the ends of the acts with the base and weakens its bond
to its sugar residue.
molecule, or endonucleases, that cleave
bonds of internal nucleotides.
desalting Removal of salt. This can be
accomplished for preparations of macro-
deoxyribonucleic acid (DNA) A
molecules by dialysis or by column chro-
macromolecule consisting of two com-
matography. See gel filtration.
plementary (see complementary base
pairs) chains of deoxyribonucleotides.
desmin A protein component of the
The chains are formed by chemical
intermediate filaments found in mus-
bonds between the sugar and phosphate cle cells.
portions of the deoxyribonucleotides,
and the two chains are held together desmoplaquin One of the protein com-
by hydrogen bonds between the bases ponents of the desmosome.
(A pairs with T and G pairs with C).
This molecule contains the genetic infor- desmosome Regions of tight contact
mation of the cell because the sequence between adjacent epithelial cells; this con-
of nucleotides of the chains specify the tact gives strength to tissues and enables
sequence of amino acids of proteins cells of a tissue to function together.
made by the cell. There are two types of desmosomes: Belt
desmosomes are bands of attachment that
encircle the cell, and spot desmosomes
are small local points of contact.

desmotubule A tubular structure that


lies in a channel of the plasmadesmata,
a means of communication between two
plant cells. Such a channel is made up of
the fusion of cell membranes from two
adacent cells through the pores of the cell
Deoxyribose wall.

68
www.stemcell8.cn
dictysome
verso

desulfurization The removal of sulfur diagnostic 1. n. A test that is used to


from a molecule. determine the source of a problem.
2. The method of determining the nature
detergent A molecule with a hydro- of a disease by analyzing the symptoms.
phobic part and a hyrophilic portion. adj. A specific characteristic that allows
The detergent can dissolve lipids (fats and one to determine the source of a problem
oils). or the nature of a disease.

determination The irreversible com- diagnostic test A procedure that gives


mittment of a cell to a particular devel- the ability to determine the nature of a
opmental pathway. If a determined cell is problem. See diagnostic.
transplanted, it will develop into the struc-
ture it would have if it had not been trans- dialysis 1. A technique used to sepa-
planted. rate molecules from each other through
a semipermeable membrane that allows
deuteromycetes One of the four major water and small molecules such as salts to
classes of fungi, also called Fungi imper- pass through. The separation is based on
fecti. The deuteromycetes are important the permeability of the molecules. Large
because this group contains the majority molecules are retained by the membrane
of human pathogens. and smaller ones pass through. Thus pro-
teins can be desalted by dialysis.
dextran A storage polysaccharide in 2. A medical procedure used to clear the
yeasts and bacteria that is made up of blood of impurities after kidney failure.
glucose. See desalting.

dextranase An enzyme that catalyzes dialyzable The ability to be dialyzed.


the breakdown of dextran. See dialysis.

dextrin A molecule made up of several diatomaceous earth A fi nely pulver-


glucose residues and one of the products ized mixture of earth composed largely
resulting from alpha-amylase hydrolysis of the silicon shells of the microorgan-
of starch. isms diatoms used as a fi ltering substance
or as an absorbant.
dextrose Another name for D-glucose,
the most common sugar found in living dibasic An acid that has two hydrogen
organisms. atoms that may be replaced by basic mol-
ecules or metal ions to form a salt.
dextrotatory isomer An isomer of a
sugar that rotates polarized light to the dicentric chromosome A chromo-
right. Dextrose is the dextrotatory isomer somal aberration involving breakage and
of glucose. then fusion of chromosomal fragments
resulting in the formation of a hybrid
diacylglycerol (DAG) A molecule of chromosome with two centromeres.
glycerol with two fatty acids attached to
it by ester linkages. It is formed along dicotyledon Any plant characterized
with inositol triphosphate (InsP3) by by flower parts in fours and fives, net-
hydrolysis of a membrane lipid (phospha- veined leaves, a cambium, and an embryo
tidylinositol-4,5- bisphosphate) by the with two cotyledons, or two seed leaves.
enzyme phospholipase c. Both DAG
and InsP3 serve as second messengers in dictysome A stack of flattened mem-
the cell. DAG activates protein kinase C, branous sacs found in plant cells located
which in turn activates other enzymes. adjacent to the endoplasmic reticu-
See protein kinase. lum. Its function is to mediate the

69
www.stemcell8.cn
recto
dideoxynucleotide

secretion of proteins outside the cell or differentiation The process during the
to target newly synthesized proteins to development of an embryo in which cells
organelles such as the Iysosome. This become specialized in structure and func-
organelle is called the Golgi (see Golgi tion and go on to form different tissues of
apparatus) in animal cells. the adult.

dideoxynucleotide A nucleotide with differentiation antigen Any biomole-


a ribose having a hydrogen atom at the cule that is detectable by an immunologic
3 position instead of an OH group. assay only in a specific cell subtype in an
Such a nucleotide cannot form a 3 to organism and that may therefore be used
5 phosphodiester linkage (the linkage of
as a marker of that subtype.
the sugar phosphate backbone of DNA)
with another nucleotide. Thus, adding
a dideoxy nucleotide to a growing DNA
diffusion The free movement of mol-
chain will terminate further synthesis of ecules from an area of greater concentra-
the chain. See dideoxy sequencing. tion to an area of lower concentration.

dideoxy sequencing An enzymatic diffusion coefficient or constant


method of sequencing DNA using dide- (k D) The measure of the ability of a
oxynucleotides to stop the synthesis of solute to diffuse through a concentration
DNA chains at specifi c points prema- gradient. The factors that affect the value
turely, developed by Fred Sanger. DNA of the k D include the size of the particle,
to be sequenced is divided into four its degree of polarity, and temperature.
tubes containing DNA polymerase, the The rate of diffusion depends upon the k D
four deoxynucleotides (dA,dT,dG,dC) in the following way: v = k D ([X]outside-
and one of the dideoxynucleotides, [X]inside); where v is the rate of diffusion
either ddA, or ddT, or ddG, or ddC. The and ([X]outside-[X]inside) represents the
ratio of dideoxynucleotide to regular concentrations of solute [X] of the con-
nucleotide is fi xed so that during DNA centration gradient.
synthesis the DNA polymerase has the
option of incorporating a regular or digitalis A cardiac drug derived from
dideoxynucleotide. Because incorpo- the plant foxglove that is used to treat con-
ration of a dideoxynucleotide into gestive heart failure and arrhythmias. Dig-
a growing DNA chain stops further italis was discovered by the Scottish doctor
synthesis of that chain, each tube will William Withering in 1785 and was found
contain a series of fragments, each end- to contain a mixture of steroids including
ing with the dideoxynucleotide of that
digoxigenin and digitoxigenin that act to
tube, for example, the tube containing
slow the heart rate while increasing the
ddA will have fragments that end in A.
intensity of the contraction.
The size of each of the fragments can
be determined by gel electrophoresis,
and the sequence can be read up the gel. digoxigenin A plant-derived steroid
For example, if the tube containing ddA that, when covalently bound to a biologi-
produces three fragments, with sizes of cal probe molecule, has been used as a
four bases, seven bases, and 10 bases, hapten in some antibody-hapten-based
the sequence of the DNA synthesized has probe systems. See hapten.
an A residue at the fourth, seventh, and
10th position. See Sanger sequencing. dihybrid cross A cross between two
individuals who are heterozygous for
differential centrifugation A tech- two different genes; for example, a cross
nique used to separate cells, organelles, or between pea plants that carry heterozy-
molecules that differ in size or density by gous alleles for short/tall and for red/
using successively higher centrifigal forces. white flower phenotypes.

70
www.stemcell8.cn
disaccharide
verso

dihydrouridine An unusual pyrimi-


dine base that is found only in tRNA.
Dihydrouridine is derived from uri-
dine by the addition of two hydrogen
atoms.

dimer 1. A molecule that has two sub-


units. The subunits may or may not be
identical.
2. Denoting two units, for example, a
dimer of nucleotides, dCdG.

dimorphism The state of having two


different forms. In botony this can be
seen in a plant or a species of plant that
has two distinct leaf types, flowers, or
some other structure. In zoology this can Dipole
be seen in two individuals of the same
species exhibiting coloring, size, or other skin lesions, swollen lymph glands, sore
characteristics. throat, and fever. Diphtheria toxin con-
sists of two subunits, A and B. The toxin
dioxin A group of heterocyclic hydro- binds to a receptor (called the HB-EGF
carbons or any of a number of isomers receptor) and is taken into the cytosol in
of the chlorinated teratogen, TCDD, an endosome where proteolytic cleavage
which is highly toxic and is found releases the A subunit. The A subunit has
as impurities in some defoliants and enzymatic activity that causes ADP-ribose
herbicides. from NAD to ribosylate the eukaryotic
Elongation Factor 2, which then blocks
diploid Having two sets of chromo- the function of this factor in protein syn-
somes so that each gene is represented thesis and ultimately causes cell death.
twice in a cell or an organism. Describ-
ing a cell or an organism that contains direct terminal repeats Sequences of
two copies of each chromosome. See nucleotides that are duplicated on each
haploid. end of a polynucleotide molecule. See
long terminal repeat and terminal
diplotene One of the stages of pro- redundancy.
phase I during meiosis I in the formation
of germ cells. During diplotene, the chias- disaccharide A molecule consisting of
mata, or region where crossing over took any two sugar units. Maltose is a disac-
place, can be visualized. charide consisting of two glucose mole-
cules linked together by a beta-glycosidic
dipole A polar molecule in which the bond. Sucrose is composed of fructose
centers of positive and negative charge
are separated. A molecule of water has
a triangular shape and exists as a dipole.
The oxygen at the head of the triangle
is electronegative, and the two hydrogen
tails are electropositive. See polarity.

diphtheria toxin The toxin secreted


by the bacterium Corynebacterium diph-
theriae, the pathogen that causes the dis-
ease diphtheria, which is characterized by Disaccharide

71
www.stemcell8.cn
rectoelectrophoresis
disc

and glucose linked together by a beta- D loop A structure of DNA in which


glycosidic bond. there is a localized denaturation of
the duplex or displacement of a single
disc electrophoresis Shortened term strand from the duplex resulting in
for discontinuous electrophoresis, a a shape that resembles the letter D.
refi nement of polyacrylamide gel electro- This structure is usually stabilized with
phoresis in which the sample is electro- proteins called single-stranded binding
phoresed through two polyacrylamide proteins.
phases: a low percentage (stacking) gel
that sits on top of a higher percent- DMSO Dimethylsulfoxide [(CH3)2SO];
age (resolving) gel. The two-phase app- a reagent used for the cryopreservation of
roach produces higher resolution between cultured animal cells. DMSO is also used
closely migrating bands. See gel elec- to increase the efficiency of transfection
trophoresis. of DNA. See cryoprotectants.
disinfectant Any chemical that can kill DMT Dimethoxy trityl; a molecule
bacteria and viruses. that is used as a blocking group to pre-
vent unwanted reactions in automated
disjunction The separation of chro- oligonucleotide synthesis.
mosomes during anaphase of mitosis or
meiosis. DNA, repetitive Sequences repeated
many times on the genome. These
dissociation constant The constant sequences vary in length from three to
that relates the dissociation of two atoms,
fi ve base pairs to 300 base pairs and
molecules, or even large particles from
are found on the genome in hundreds to
one another. For the dissociation of sub-
thousands of copies. Some of the repeti-
stance A from substance B, where AB is a
tive DNA makes up the satellite DNA,
complex of A and B:
a distinct band from the bulk of chro-
AB A + B
mosomal DNA found after cesium chlo-
Kdissociation = [A][B]/[AB]
where ride density centrifugation. See Alu
[A] is the molar concentration of A elements.
[B] is the molar concentration of B
[AB] is the molar concentration of AB DNA cloning Any procedure that gen-
erates many copies of a particular DNA
distillation The process of separat- sequence. The sequence can be inserted
ing and purifying liquids from a mixture into a plasmid or bacteriophage, which
based on each liquids boiling tempera- will be duplicated manyfold in a bacte-
ture. The more volatile substance will boil rial cell, or the sequence can be copied
at a lower temperature from the others in manyfold by polymerase chain reaction,
a mixture. The vapor is then collected, or PCR.
cooled, and condensed, thus extracting
and refi ning it from the mixture. DNA fingerprinting A process of
identifying trace evidence such as
disulfide bond A covalent bond blood, semen, saliva, and hair found
between two sulfhydryl (SH) groups by at crime scenes. The most common
oxidation to form an S-S linkage. Such procedure is to amplify specific re-
bonds occur in proteins between cys- gions of DNA found in the evidence
teine residues and stabilize the tertiary by PCR and then analyze them using
structure of the protein. specific probes to Southern blots (see
Southern blot hybridization) of
divalent An atom or radical group hav- the amplified DNA. Because certain
ing two valences or the ability to combine regions of human DNA are very vari-
with two different atoms or molecules. able, comparisons between blots of

72
www.stemcell8.cn
DNA probe
verso

relaxes positively supercoiled DNA by


unwinding one strand of duplex DNA
around the other so that each strand is
wrapped around the other less than one
turn per every 10 bases.

DNA linkers Short stretches of


nucleotide-sequence-carrying restriction-
enzyme (see restriction endonucle-
ase) cutting sites that can be added by
ligation to the ends of the sequence
of a gene to facilitate the cloning of the
gene into a vector.

DNA photolyase An enzyme that


catalyzes the repair of pyrimidine
dimers formed as the result of ultra-
violet irradiation. The fi rst step in the
repair involves the excision of the dimer
that takes place only in the presence
of visible light. DNA photolyase is also
known as photoreactivating enzyme.
See ultraviolet repair.

DNA polymerase(s) Any enzyme that


can use a chain or a strand of deoxy-
nucleotides as a template, a primer that
Double-stranded DNA is a short fragment of deoxy nucleotides
and that can synthesize a complementary
DNA of suspects, victims, and evidence strand. All DNA polymerases synthesize
can be used to ascertain with great DNA from the 5 phosphorylated end to
likelihood whether the trace evidence the 3 hydroxyl end.
came from a particular individual.
DNA polymerase I A specific DNA
dna genes The genes encoding the polymerase that has not only the 5 to 3
DNA proteins (dnaA, dnaB, dnaC) polymerizing activity but also has two
that function in the initiation of DNA nucleolytic or degradative activities, a 3
replication at the replication origin to 5 exonuclease, an editing function,
in prokaryotic genomes and plasmid and a 5 to 3 exonuclease. This enzyme,
DNAs. with all of its activities, is used by the
cell during different steps of DNA repli-
DNA glycosylase An enzyme that rec- cation. It is also used during DNA repair
ognizes a deaminated base and catalyzes processes. In addition, purifi ed DNA
its removal from the DNA molecule, cre- polymerase I with or without its nucle-
ating an apurninic or apyrimidinic site in ase activities is used in various in vitro
the DNA molecule. procedures, such as preparing of labeled
DNA probes and DNA sequencing via
DnaG primase The enzyme responsible the dideoxy method. See Kornberg
for catalyzing the formation of the short enzyme.
RNA primers in Okazaki fragments.
DNA probe A sequence of deoxynu-
DNA gyrase An enzyme that catalyzes cleotides used to identify or isolate spe-
the introduction of negative supercoils or cific genes or RNA transcripts that have

73
www.stemcell8.cn
recto profi ling
DNA

DNA polymerase

complementary sequences. Such probes function indicates that the plasmid con-
are used in hybridization procedures tains the gene of interest.
(Southern, northern, slot, and dot blots
and colony or plaque hybridizations) and DNA-RNA hybrid A DNA-RNA du-
are labeled with either a radioactive atom plex molecule composed of a single chain
of 32P or 35S, which allows for detection of deoxyribonucleotides (DNA) and a
using autoradiography, or nonradioactive chain of complementary ribonucleotides
materials such as biotin or digoxigenin, (RNA). Such molecules may be created
which are detected via specific reactions. experimentally from purified DNA and
See probe. RNA and are also formed when chromo-
somal DNA is fragmented, heated, and
DNA profi ling See DNA fi nger- mixed with RNA transcripts.
printing.
DNase I A DNA-degrading enzyme
that catalyzes the cleavage of phosphodi-
DNA repair Any process that restores ester bonds of DNA; DNase I is isolated
damaged DNA. Generally, these are mul- in large quantities from pancreas. See
tistep processes, requiring an enzyme endonuclease.
to remove the damaged nucleotide (see
DNA glycosylase and/or endonucle-
DNase I hypersensitivity sites Regions
ase) alone or with other nucleotides, a on the chromosome that are extremely
polymerase (see DNA polymerase I) to sensitive to digestion by DNase I. These
replace the removed nucleotides, and an sites are generally found near active genes
enzyme to seal the sugar phosphate back- where transcription factors or other reg-
bone. See excision repair. ulatory elements bind to the DNA. See
hypersensitive site.
DNA rescue, in positional cloning A
technique for cloning genes in bacteria DNase I sensitivity Increased suscep-
or yeast by transforming (see transfor- tibility to digestion by DNase I, which
mation, bacterial) plasmids contain- correlates with genes that are actively
ing normal genes into a host containing transcribing RNA. This shows that the
a mutation that inactivates a particular chromatin of genes being expressed has
function, for example, the ability to syn- an open conformation that is accessible
thesize an amino acid. Addition of the to DNase I and that inactive chromatin is
plasmid that leads to reactivation of the condensed.

74
www.stemcell8.cn
double verso
helix

DNA sequencing A method to deter- dominance The ability of a genetic


mine the order of nucleotides on a DNA trait to be phenotypically or physically
fragment or molecule. Methods include expressed, whether it occurs as heterozy-
use of chemicals to break the DNA chains gous or homozygous. See recessive.
at specific bases (see Maxam-Gilbert
sequencing) and enzymatic incorporation dominant control regions (DCRs)
of dideoxynucleotides that result in chain An enhancer element found in the
termination. See dideoxy sequencing. human beta-globin gene cluster that is
being incorporated into viral vectors to
docking protein (DP) A receptor pro- stimulate and regulate the expression of
tein located on the membrane of the rough genes cloned into such vectors.
endoplasmic reticulum (RER) that binds
the signal recognition particle (SRP). This dominant negative Any mutant that
protein-RNA complex bound to the initial codes for an inactive protein that, in the
sequence of a protein is in the process of heterozygous state, is expressed in domi-
being synthesized and is destined for secre- nant manner over the functional, or wild
tion outside the cell. The docking protein type protein.
anchors the partially synthesized protein
to the membrane of the RER so that as dopamine A monamine neurotransmit-
its synthesis is completed, it is deposited ter derived from the amino acid tyrosine.
into the RER, where it will be targeted for Dopamine is involved in several clinical
secretion. See rough ER. syndromes including schizophrenia and
amphetamine-induced psychoses. A defi-
dolichol phosphate A group of phos- ciency of dopamine is responsible for Par-
phorylated long-chain hydrocarbons com- kinsons disease.
prised of cis-isoprene repeat units that
acts to collect sugars for glycosylation of dosage effect The ability of a pheno-
proteins being processed in the endoplas- type to be altered by an increase in the
mic reticulum for export to the cell sur- amount of gene product.
face. Branched sugar chains attached to
dot blot A hybridization technique
the phosphate moiety on dolichol phos-
used to quantitate rapidly the amount of
phate are transferred to proteins in the
DNA or RNA in a crude preparation that
lumen of the rough ER.
is placed directly onto a hybridization
membrane. See blot.
domain A compact globular unit of
protein structure. Many large proteins double crossover Two recombination
have a number of domains usually con- events on the same chromosome. See
nected by flexible regions of polypeptide crossing over.
chain. In the antibody molecule, there are
variable domains that recognize differ- double digestion The treatment of a
ent antigens, as well as constant domains preparation of DNA with two restriction
that characterize each class of antibody enzymes. This technique is used to map
molecule. See epitope. DNA and to isolate fragments of DNA
with two distinct sticky ends to clone into
a vector in a particular orientation. See
restriction enzymes and cloning.

double helix Another name for a mole-


P cule of DNA, consisting of two antiparallel,
n (9-22) complementary strands of deoxypolynu-
cleotides held together by hydrogen bonds
between the complementary pairs. The
Dolichol phosphate
Dolichol phosphate molecule has a right-handed twist resulting

75
www.stemcell8.cn
recto minutes
double

in one strand wrapped about the other to recombinant DNA technology has cloned a
form a helix conformation. See dna. gene and expressed its protein product.

double minutes Small pieces of a chro- Drosophila A genus of small fl ies that
mosome that contain many copies of a includes Drosophila melanogaster, the
particular gene. The amplification of the common fruit fly. A well-defi ned genetic
dihydrofolate reductase (DHFR) gene fol- organism, it is used as a model system
lowing exposure to methotrexate may be to study and understand cell processes,
manifest either in terms of the formation development, and genetics of higher
of double minutes or as a homogeneously organisms.
staining region of a giant chromosome.
See homogeneously staining region. Drosophila heat-shock proteins Sev-
eral proteins that are immediately synthe-
double reciprocal plot A method for sized after the organism is subjected to a
analyzing the kinetic parameters of an short treatment of heat above its lethal
enzyme (Km and Vmax), by plotting 1/v limit. Some of these proteins are highly
versus 1/[S], where v = rate of product for- conserved in evolution in that they are
mation and [S] = substrate concentration.
very similar to hsps found in bacteria and
other higher organisms. Synthesis of these
double thymidine block A technique proteins can also be induced by exposure
used to synchronize cells in culture. A
to certain toxic chemicals, alcohol, and
high concentration of thymidine added to
other types of stress. See heat-shock
the culture will block DNA replication,
proteins.
so all treated cells proceed through their
cell cycle and stop at the same point. See
cell synchronization. drug-delivery systems See delivery
systems.
doubling time The same as a genera-
tion time, or the time it takes for a popu- duplex Another name for double-
lation of cells to double in number. stranded helical DNA. See double helix.

down-promoter mutation A mutation duplex melting The process of dena-


or change in the sequence of the promoter turing double-stranded DNA by heating
of a gene that results in less expression or so that the hydrogen bonds between com-
transcription of that gene. See promoter. plementary bases are disrupted. See DNA
denaturation.
Downs syndrome The most frequent
genetic cause of mental retardation. The dyad Two units, or a pair.
disease also includes variety of phenotypic
abnormalities: broad skull, short stature, dyad symmetry of DNA Two regions
epicauthal fold (a fold of skin around the of the DNA that have inverted, repeat-
eye), stubby hands and feet. The disease is ed, or palindromic base-pair sequences.
the result of an individual inheriting three Restriction-enzyme cutting sites exhibit
copies (trisomy) of chromosome number 21. dyad symmetry.

downstream Denoting the region of a dystrophin One of a number of pro-


gene that is located away from the gene in teins that serve to anchor the muscle
the direction of the 5 end. myofibril to the plasma membrane. The
protein derives its name from the fi nding
downstream processing An industrial that a defect in the structure of dystro-
term referring to the process of protein phin, or absence of the protein, is found
extraction and purification that occurs after in patients with muscular dystrophy.

76
www.stemcell8.cn

A
E

E1A An adenovirus early gene that is under minimal nutritional conditions, E.


responsible for the oncogenic properties coli is widely used as a vehicle for carry-
of the virus. ing recombinant DNAs and as material
for studying bacterial genetics.
E2A A transcription factor that
acts in a complex with a second transcrip- ecology The field of study that deals
tion factor, MyoD, to bring about the with the interrelationship between a
developmental process that causes cells to population of organisms and the envi-
become myoblasts. ronment, including physical factors and
populations of organisms.
early development A stage in the
growth cycle of a bacteriophage that pre- EcoRI A restriction enzyme derived
cedes DNA synthesis. from the bacterium E. coli that has the
recognition sequence:
early genes Viral genes that are the first 5-GAATTC-3
to be expressed after the virus infects its 3-CTTAAG-5
host. The early genes are generally respon-
sible for replication of the virus DNA and EcoRI methylase An enzyme that cat-
for inducing expression of the late genes at alyzes the transfer of methyl groups from
some specific point in the viral life cycle. the compound s-adenosylmethionine to
an adenine nucleotide in the restriction
E-cadherin A transmembrane pro- site of the enzyme EcoRI:
tein that anchors cells to one another at EcoRI me
specialized junctions (adherens junc- methylase |
tions) and desmosomes where the mem- GAATTC GAATTC
branes of two adjacent cells make con- CTTAAG s-adenosyl CTTAAG
tact with one another. The extracellular methionine |
domains of two opposing E-cadherins me
make contact with one another on the
extracellular side of the cell membrane. Edman degradation A procedure for
The intracellular domains of E-cadher- determining the sequence of amino acids
ins are embedded in a plaque that also in a polypeptide. The procedure is based
anchors cytoskeletal fi laments. on reaction of each amino acid in the
peptide chain, in order, with the Edman
ecdysone A hormone that induces reagent, phenyl isothiocyate (PITC). The
expression of critical genes during lar- Edman degradation is used in devices for
val development in insects. Ecdysone is automated polypeptide sequencing.
known to be responsible for gene tran-
scription seen in chromosome puffs. EDTA Ethylene diamine tetra acetate;
a chemical that binds tightly to mag-
E. coli Escherichia coli, a bacterium nesium and calcium and that is used to
normally found in the intestinal tract. remove even trace amounts of these met-
Because of its ability to grow rapidly als effectively from a solution. EDTA is

77
www.stemcell8.cn
recto
effector

used to control unwanted magnesium- eicosanoids A group of paracrine hor-


and calcium-dependent side reactions in a mones derived from arachidonic acid
biochemical mixture. through a series of enzymatic pathways,
involving cyclooxygenases (COX1, COX2)
effector A regulatory molecule; a and lipoxygenases. The eicosanoids de-
chemical that brings about an increase or rived from COX reactions are prostaglan-
a decrease in the rate of reaction in a spe- dins and thromboxane, while lipoxygenases
cific biochemical pathway. transform arachidonic acid to the leukotri-
enes and lipoxins.
efferent Running in the direction away
from a certain structure. For example, electroblotting A technique that uti-
efferent nerve fibers carry nerve impulses lizes an electric field to transfer protein
away from the brain to an effector such or nucleic acids from a gel to a blotting
as a motor neuron. membrane, generally for the purpose of
carrying out northern, Southern, or west-
effluent Waste fluid such as buffer ern blot hybridizations.
emerging from a chromatographic col-
umn either before or after the actual electrodialysis The technique of acceler-
chromatography. ating the process of dialysis by applying an
electric field across the dialysis membrane.
EGFR Epidermal growth factor receptor;
a family of transmembrane proteins whose electrodiffusion The induction of move-
extracellular domains are the receptors for ment of a charged substance by an electric
epidermal growth factor and whose cyto- field.
solic domains are receptor tyrosine kinases.
The EGFR family consists of four members, electroendosmosis The diffusion of
EGF-R (ErbB1), ErbB2 (Neu), ErbB3, and water into or out of a gel or membrane in
ErbB4. In addition to the normal ligand the presence of an electric field. Electro-
(EGF), the tyrosine kinase portion of EGFR endosmosis resulting in the shrinkage or
can be activated by various chemical stimuli swelling of an agarose gel is a factor that
and ultraviolet radiation. The EGFR tyro- influences the migration of nucleic acids
sine kinase activates the MAP kinase sig- during agarose gel electrophoresis.
naling pathway, which in turn activates the
transcription factors fos, AP-1, and Elk-1 electroimmunodiffusion A method of
that stimulate gene expression related to cell quantifying antigen-antibody reactions in
proliferation. Abnormal stimulation of the which antisera is incorporated into a layer
EGFRs or mutations in an EGFR gene have of support medium such as agarose and
been implicated in the development of can- the antigen that reacts with the antibody
cers of the lung, breast, prostate, colon, and is induced to migrate through the gel
ovary. electrophoretically (see electrophore-
sis). Interactions of antigen and antibody
egg The common term for an oocyte. produce rocket-shaped precipitin lines,
the heights of which are proportional to
egg coat A specialized extracellular the antigen concentration.
matrix, comprised of glycoproteins, that
surrounds the oocyte plasma membrane. electrolyte A charged atom or molecule
In mammalian eggs, the egg coat is called in solution.
the zona pellucida; in sea urchins, it is
referred to as the vitelline layer. In addi- electron carrier In the biochemical
tion to protecting the egg, the egg coat context, a molecule that accepts electrons
sometimes functions as a selective barrier or hydrogen atoms from a specific donor
to fertilization by sperm from different molecule and then transfers them to a spe-
species. cific electron acceptor. FAD, NAD+, and

78
www.stemcell8.cn
electron microscopy
verso

O-
C
O
CH3

arachidonic acid

O O-
O- C
O C O
O CH3
CH3
OH OH
O-
leukotriene A4
C prostaglandin E
O O (PGE 1 )
CH3

OH
thromboxane A 2

Eicosanoids

ubiquinone are examples of important


biochemical electron carriers.

electronegativity The affi nity that an


atom or molecule has for electrons.

electronic potential The measure of


electron pressure in volts; the relative dif-
ference in the concentration of electrons
in two compartments, such as the inside
of a cell membrane versus the outside of
the membrane.

electron microscope A device that uti-


lizes a beam of electrons passing through
a specimen, instead of light, to visualize
and magnify the features of the specimen.
In an electron microscope, a powerful
magnet that is used to bend the electron
beam is the equivalent of the glass lens
that, in a conventional microscope, is
used to bend the light beam as a means of
achieving magnification.

electron microscopy A procedure for


using the electron microscope to achieve
high levels of magnification. Because elec-
tron microscopy must be carried out in a
vacuum, biological specimens are gener- Electron microscope

79
www.stemcell8.cn
recto
electron transport

ally fi rst coated with a thin layer of metal ELISA Enzyme linked immunosorbant
that conveys the outlines of the structural assay; a sensitive technique for detec-
features of interest. tion of a substance by allowing the sub-
stance of interest, if present in a sample,
electron transport The process of to attach to an immobilized antibody on
passing electrons among electron carriers some solid substrate such as plastic. The
according to a defi ned sequence. presence of the substance is visualized
and quantitated using a second, labeled
electron transport chain A series of antibody.
large complexes located in the inner mito-
chondrial membrane that uses the energy elongation factor Any of several pro-
contained in electrons derived from the tein factors that are necessary to carry
metabolism of fats and carbohydrates out the part of the process of translation
to generate ATP. The transport chain in which amino acids are added to the
consists of five complexes designated by growing polypeptide chain (elongation).
the roman numerals I, II, III, IV, and V. See translation.
Complexes I and II accept electrons from
metabolites, and these complexes transfer
the electrons to complex III. Complex III elongation factors A group comprised
transfers electrons to complex IV, which of at least three proteins (EF-G, EF-Ts,
then reduces molecular oxygen to form EF-Tu) that are required for the elongation
water. During the process, protons are of a polypeptide that is in the process of
pumped out of the mitochondrion to cre- being synthesized on ribosomes (transla-
ate a proton gradient. The energy stored tion).
in the proton gradient is used by complex
V to create ATP. eluant In column chromatography, the
fluid, such as a buffer solution, that runs
electrophoresis The movement of sub- through a column and in which separated
stances through a medium induced by an substances appear as they are washed
electric field. through the column.

electroporation A technique for intro- elution profi le In column chroma-


ducing substances into cells by using a tography, a graph showing the amount
pulsed electric field to cause the target of material appearing in the eluant of a
substance to be electrophoresed across column over time. The elution profi le is
the cell membrane. generally seen as a series of peaks rep-

fraction number

Elution profile

80
www.stemcell8.cn
emulsifi
verso er

ELISA

resenting the optical density or biologi- embryo In vertebrates the organism


cal activity of the eluant at various times that develops from the fertilized egg at
during elution of the material that is any stage prior to birth.
undergoing separation.
embryology The field of study devoted
elution volume In column chroma- to the development of the embryo.
tography, the amount of eluant that
passes through a column before a par- emulsifier A chemical, such as a deter-
ticular peak in the elution profi le is gent, that is capable of breaking up a
observed. mass of insoluble material into small par-
ticles that then form an emulsion. The
EMBL See databases. most common biochemical emulsifiers

81
www.stemcell8.cn
recto
emulsion

produce emulsions from otherwise water- endogenous Originating from within;


insoluble fatty substances. as from within a cell or a tissue.

emulsion For two unmixable liquids, a endogenous virus A virus present,


colloid of one of the liquids suspended in usually in a latent form, inside a cell.
the other (e.g., emulsified oil and water). This term applies to various viruses that
are found in an inactive state in the cells
enantiomers A pair of optical iso- they infect but that may become acti-
mers that are direct mirror images of one vated following exposure of the infected
another. cells to various chemical and physical
agents. This is true of bacteriophage
encapsulation The process by which proviruses and of some forms of herpes
particles become engulfed in or coated by virus.
a continuous matrix.
endonuclease A type of enzyme that
3-end The terminal nucleotide at one end produces nucleic-acid-strand breaks in
of a polynucleotide chain, whose 3 carbon the interior of the nucleic acid strand.
carries an unreacted hydroxyl group (OH
group). The other end is the 5-end.
endoplasm The inner part of the cell
cytoplasm, that is, the portion closest to
5-end The terminal nucleotide at one
the nucleus.
end of a polynucleotide chain, whose 5
carbon carries an unreacted phosphate
group. The other end is the 3-end. endoplasmic reticulum (ER) A com-
plex cytoplasm membrane network to
endergonic reaction A chemical reac- which ribosomes engaged in the synthe-
tion that requires the input of energy, sis of proteins destined to be exported
such as heat, or mechanical agitation. outside the cell are attached. Portions of
the endoplasmic reticulum containing
end-fi lling Creating a blunt end from a completed proteins for export are trans-
ragged-ended or staggered-ended double- ported to the Golgi apparatus to which
stranded DNA through the use of a DNA they fuse.
polymerase.
endorphin Any of a group of short
endocrinology The field of study peptides that bind to receptors on neurons
devoted to the function and pathology in the brain with the effect of reducing
of the endocrine glands, for example, the the sensation of pain. The term is derived
thyroid and pituitary glands. from endo- or endogenous morphine
because endorphins are seen as naturally
endocytic vesicle The membrane en- produced opiates. See methionine-
closed vesicle that forms in the cyto- enkephalin.
plasm of a cell during the process of
endocytosis. endosome The structure formed by
the fusion of several endocytic vesicles
endocytosis A process in which cells in the cytoplasm following endocytosis.
take up small particles or large mol- See clathrin, coated pit, and coated
ecules by an invagination of the cell vesicle.
membrane, which leads to the formation
of a membrane-enclosed vesicle in the endospore A tough, resistant, mem-
cell cytoplasm. A number of important brane-enclosed cell that is formed by
effectors influence cell behavior includ- some Gram-positive bacteria and actino-
ing the induction of gene transcription mycetes under conditions of limited food
after being delivered to the cytoplasm via supply. The endospore is highly dehy-
endocytosis. drated and metabolically inactive and

82
www.stemcell8.cn
enterotoxins
verso

can survive harsh environmental condi- engrailed gene One of a class of genes
tions such as prolonged heat, drying, and known as segment polarity genes in Dro-
exposure to toxic chemicals. sophila melanogaster (fruit fly). The
engrailed gene is a major gene responsi-
endosymbiont A symbiotic organism ble for dividing the segments of the Dro-
that lives inside the body of its symbiotic sophila embryo into posterior and anterior
partner. halves.

endothelial cells The cell type of enhancers Certain DNA nucleotide


which blood vessels are comprised. base sequences that act over distances
as great as several kilobases to stimulate
endothelial growth factors A class transcriptional activity of a particular
of growth factors released by various tis- gene or group of genes.
sues under conditions of oxygen depri-
vation that stimulates angiogenesis. The enriched medium A supplemented
production of angiogenic factors includ- nutrient broth for the culture of cells or
ing endothelial growth factors by tumors microorganisms that require unusual
accounts for the vascularization of large nutrients or unusually high levels of
tumor masses that would otherwise normal nutrients. Enriched medium is
become internally necrotic. For this rea- required for the culture of auxotrophic
son, these factors are studied as a tar- mutants.
get of cancer therapies designed to kill
tumors by starvation. enteric organism A microorganism
that inhabits the intestinal tract.
endothermic A term used to describe
a chemical reaction that requires heat in
Enterobacteriacae Any of a large group
order to proceed.
of bacteria that inhabit the intestinal tract.
endotoxins Toxic lipopolysaccharides enterotoxins Toxins that affect the
associated with the cell wall of Gram- intestine, or those that cause food poi-
negative (see Gram stain) bacteria. soning. These toxins are secreted by
These cell-bound toxins cause a variety the bacteria that produce them and are
of physiological effects, including fever, ingested in foods contaminated with
hemorrhagic shock, and diarrhea. these enterotoxigenic (toxin-producing)
bacteria. Enterotoxin A is produced by
end product The fi nal chemical prod- the Gram-positive (see Gram stain)
uct of the series of enzymatic reactions in bacterium, Staphylococcus aureus,
a particular biochemical pathway. and is most frequently associated with
outbreaks of food poisoning. Recently
end-product repression See feed- epidemics of food poisoning caused by
back inhibition. ingestion of water, meat, or fruit con-

End-product inhibition

83
www.stemcell8.cn
recto
entomology

taminated with animal fecal matter are enzyme immobilization The chemi-
due to the potent toxin produced by the cal bonding of an enzyme to some solid
enterotoxigenic Escherichia coli (ETEC), matrix in a manner that preserves the
strain E. coli O157:H7. enzymatic activity. The attachment of
enzymes to solid matrices is an essential
entomology The field of study that step in the development of many enzyme-
deals with insects. based biochemical assays.

entropy The variable that measures the enzyme inactivation The loss of the
degree of disorder in a molecule. Changes activity of an enzyme under conditions
in entropy that occur in molecules under- other than that found in the intact cell.
going chemical reaction are one com- Enzyme inactivation is an important
ponent of the free energy change that consideration when purified enzymes are
determines whether a reaction will occur employed in an environment where they
under a given set of conditions. may be subject to conditions of tempera-
ture, salt, pH, and so on that are not
env gene(s) One of the three genes con- found in their native environment. Spon-
tained in most retroviruses that codes for taneous inactivation of enzymes that
the ENV glycoprotein(s). occurs for unknown reasons is also often
observed in enzyme preparations, partic-
ENV glycoproteins The protein prod- ularly in dilute solutions.
uct of the retrovirus env gene(s) which
forms a major component of the virus enzyme replacement therapy The
envelope in the mature virus particle. method used to treat disease states
caused by enzyme deficiencies by direct
enzyme A polypeptide or protein that injection of the missing enzyme. Enzyme
acts as a catalyst for biochemical reac- replacement therapy has been used suc-
tions. Enzymes do not actually cause a cessfully for treating patients with Gau-
reaction to occur, but rather speed up the chers disease.
rate at which an ongoing reaction takes
place. Virtually all significant biochemi- enzyme stabilization Inhibition of
cal reactions in living systems are cata- enzyme inactivation. Enzyme stabiliza-
lyzed by enzymes. tion is often achieved by altering the salt
concentration pH or lowering the tem-
enzyme derepression The induction perature of an enzyme solution. Recently,
of enzyme activity by removing or inac- modification of the enzyme by attach-
tivating an inhibitor such as the induction ment of organic groups or altering the
of a galactosidase activity by lactose. See amino acid compostion of the enzyme
lac operon. polypeptide have been used to achieve
enzyme stabilization.
enzyme engineering Modification of
enzymes through recombinant DNA eosinophil One of the three subclasses
techniques and site-directed muta- of leucocytes. Eosinophils are named for
genesis so that they can be used for their characteristically intense staining
industrial purposes. Some of these with eosin. Eosinophils are amoeboid
modifications include increasing protein scavenger cells similar to macrophages
stability, enhancing catalytic activity and are found in greatly increased num-
and/or substrate specificity, changing bers in the blood of individuals carrying
optimal requirements for catalysis so parasitic infections.
that the engineered enzymes will func-
tion under nonphysiological conditions, ephrins A family of proteins implicated
and/or become resistant to feedback in guiding axons and patterning the ner-
regulation. vous system during neural development.

84
www.stemcell8.cn
Epstein-Barr verso
virus

Ephrins act as ligands for receptors (des- episome Bacterial DNA that is not inte-
ignated EPH-related receptors) that are grated into the bulk of the chromosomal
protein-tyrosine kinases. There are two DNA and therefore replicates separately,
classes of ephrins: the A-subclass (ephrin and in different copy number from, chro-
A1ephrinA5) and the B-subclass (eph- mosomal DNA.
rinB1ephrinB3).
epistasis A term coined by William
epidemiology The field of study devoted Bateson in 1909 to describe the control of
to analysis of the occurrence of disease in a certain phenotypic trait by two or more
a population including the distribution, genes. A gene is considered epistatic when
incidence, and factors that control the it suppresses the effect of another gene.
spread of a disease. Epistatic genes are also called inhibiting
genes because of their suppressive, hypo-
epidermal growth factor (EGF) A static effects on other genes. Pleiotropy,
small polypeptide growth factor discov- in which a single gene controls the expres-
ered by Stanley Cohen as a factor that sion of more than one phenotypic trait, is
caused premature eyelid opening in new- the opposite of epistasis.
born mice. EGF has since been shown to
be active in stimulating the growth of epi-
epistatic gene A gene that suppresses
thelial as well as some nonepithelial cell
the effect of another, nonallelic, gene. See
types. A portion of the gene that codes for
allele.
the EGF cell receptor has been found to be
virtually identical to the Erb-B oncogene.
epithelial Of or pertaining to the cell
epigenetic The term applied to any fac- layers that interface between the tissue
tor that influences cell behavior by means and the external enviornment, such as the
other than via a direct effect on the cells of the skin and the lining of the gut
genetic machinery, that is, the DNA. and lung airway passages.

epimerase A type of enzyme that cata- epitope The segment on a polypeptide


lyzes the conversion of one epimer into its that constitutes the actual site of antibody
opposite epimer. binding by a specific antibody molecule.
The antigenic determinant.
epimers Optical isomers that differ
from one another at only a single carbon epitope tag A technique by which the
atom. The sugars glucose and galactose function of a protein can be studied by
are examples of epimers. inserting a short nucleotide segment that
codes for a known epitope (an antigenic
epinephrine (adrenaline) The bio- oligopeptide) into the gene for the protein
chemical secreted by the adrenal glands to be studied. When the protein is made,
and by the synaptic vesicles of certain it will contain the epitope. Antibodies to
types of neurons. Epinephrine serves the epitope can then be used to obtain
as both a hormone that stimulates the various kinds of information on the pro-
breakdown of glycogen into glucose and tein, such as where it is located in the cell,
a neurotransmitter. what other proteins it interacts with, if
there are changes in location within the
cell in response to stimuli, if there is a
subunit structure, etc.

Epstein-Barr virus A member of the


herpes family of DNA viruses that has
been associated with Burkitts lymphoma
Epinephrine in West Africa and New Guinea.

85
www.stemcell8.cn
recto
equatorial plate

equatorial plate The early stage of the ERCC1 is the homologue of the RAD10
formation of the membrane that divides gene in Saccharomyces cerevisiae, which
two daughter cells at the end of the pro- functions in repair and recombination
cess of mitosis; the metaphase plate. between chromosomes. ERCC1 levels are
elevated in cancer cells that have become
equilibrium centrifugation A tech- resistant to the chemotherapeutic agent,
nique for separation of proteins or nucleic cisplatin. In human syndromes in which
acids from a mixture by subjecting the NER is defective, such as xeroderma
mixture to density gradient centrifuga- pigmentosum (XP), there is a greatly
tion for a period of time sufficient for increased incidence of skin cancer.
each component of the mixture to form a
band at a point equal to its density. ERK Extracellular receptor tyrosine
kinase; a group of transmembrane pro-
equilibrium potential The membrane teins that function as signal transducers
potential at which there is no net diffu- for signals in the form of biochemicals
sion of a particular type of ion across the (ligands) that bind to the ERK extracel-
membrane. Equilibrium potentials are lular domains. Ligand binding activates a
important determinants of nerve-impulse tyrosine kinase function of the intracellu-
generation. lar domain. Phosphorylation of a tyrosine
residue(s) on an intracellular protein(s)
erb-A An oncogene carried by the avi- initiates a series of subsequent biochemi-
an erythroblastosis virus. There are two cal changes.
distinct human erb-A proto-oncogenes,
erb-A and erb-A. Both forms encode erlotinib (Tarceva) An anticancer
proteins that are thyroid hormone recep- drug that acts by blocking the human
tors, but they are located on different epidermal growth factor receptor (EGFR)
chromosomes: erb-A on chromosome that inhibits the tyrosine kinase activity
17q21 and erb-A on chromosome 3p24. of the receptor. Tarceva is a quinazo-
linamine, with the chemical name N-
erb-B An oncogene carried by the avian (3-ethynylphenyl)-6,7-bis(2-methoxye-
erythroblastosis virus. The human proto- thoxy)-4-quinazolinamine.
oncogene of erb-B (c-erb-B) encodes the
protein for the EGF receptor of which error-prone repair Another term for
as many as five variant forms may exist. SOS repair. The terminology is derived
These are designated erbB-1, erbB-2, etc. from the observation that repair of pyrim-
The erb-B proteins are receptor tyro- idine dimer damage is often inaccurate.
sine kinases that stimulate cell division See excision repair and SOS repair
via the MAP kinase signaling pathway. system.
erbB-2 which is also known as HER-2
or neu, has been implicated in a number
erythroblast A bone-marrow stem cell
of highly malignant breast cancers. The
that gives rise to erythrocytes.
erb-B genes are located within the region
of chromosome 7p12.3-p12.1. See EGFR
and heregulin. erythrocyte A red blood cell.

ERCC1 Excision repair cross comple- erythrocyte ghosts Red blood cells
menting; a polypeptide that is required whose contents have been removed.
for nucleotide excision repair (NER) in Erythrocyte ghosts are used as vehicles
DNA that has been damaged. In the nu- to deliver drugs and other bioactive com-
cleotide excision repair mechanism, single- pounds to cells. See delivery system.
stranded cuts are made on either side of
the damage, after which the segment of erythromycin An antibiotic that acts
DNA between the two cuts is excised. by binding to bacterial ribosomes and

86
www.stemcell8.cn
Euglena
verso

inhibiting the process of translocation estrus cycle A set of changes occur-


during protein sysnthesis. ring periodically in female primates that
prepare the reproductive tract for preg-
erythropoesis The process by which nancy and are governed by changes in
erythrocytes are generated from stem the levels of the female hormones. The
cells in the bone marrow. peak of the cycle (called estrus) coincides
with ovulation.
erythropoetin A glycoprotein, pro-
duced by the kidney, that stimulates ethanol Ethyl alcohol (drinking alco-
erythropoesis. hol); the alcohol produced from the fer-
mentation of sugar by certain strains of
Escherichia coli See E. coli. anaerobic yeast.

essential amino acid Any amino acid ethidium bromide A widely used
that cannot be synthesized by an organ- fluorescent stain for visualizing DNA
ism from other components. In humans under ultraviolet light. Ethidium bro-
about half of the 20 amino acids are mide is called an intercalating dye
essential; in most bacteria none are. because it has a multi-ring structure that
allows it to insert between the nucleotide
essential gene Any gene whose mal- bases. (See figure on next page.)
function is lethal to an organism. A num-
ber of classical experiments on bacterial ethylene A simple two-carbon hydro-
molecular genetics, such as fluctuation carbon with the formula H 2C=CH 2 .
analysis, depended on the use of muta-
tions in essential genes. etiology The study of the cause of a
disease or pathological condition.
established cell line Cells that have
become immortalized during the process
ets oncogene An oncogene that is car-
of maintaining them in cell culture.
ried by Avian leukemia virus E26 (v-ets)
that causes leukemias in chickens. The
establishment of cell lines The pro-
product of the ets proto-oncogene (c-ets)
cess by which cells in tissue culture
is a nuclear protein that has been found
become immortalized so that they can
to have DNA binding activity and is
be maintained indefinitely. Establishment
believed to play a role in the activation
is believed to involve some genetic change
and proliferation of T cells.
that occurs spontaneously during the
course of culture. Because cells derived
from cancerous tissue are more readily
euchromatin One of the two classes of
chromatin seen in interphase cells that is
established than cells from normal tissue,
distinguished from the other class (het-
the genetic changes involved in the process
erochromatin) by being much less con-
of established cell lines are also believed
densed and transcriptionally active.
to be related to the process by which cells
become cancerous.
eugenics The science of selective breed-
esterase A type of enzyme that catalyzes ing to achieve a predetermined set of
the breakage of ester linkages. Esterases are genetic characteristics.
important in the breakdown of many lipids
and in the metabolism of nucleic acids. Euglena A primitive single-celled organ-
ism classified as belonging to the algae in
estrogen A steroid hormone, pro- the plant kingdom. Euglena exhibits the
duced by the ovaries, that cause changes properties attributed to both plants and
in the lining of the uterus in preparation animals, being photosynthetic in the pres-
for implantation of the embryo during ence of light and a motile, food-seeking
estrus. organism in the absence of light. Euglena

87
www.stemcell8.cn
recto
eukaryote

Ethidium bromide

is believed to represent or be related to plant and animal kingdoms other than


ancestral organisms that gave rise to both bacteria and viruses.
plants and animals.
European Bioinformatics Institute
eukaryote The general term for any (EBI) The European Bioinformat-
higher plant or animal distinguished by ics Institute (EBI) is a molecular genet-
the presence of a true nucleus that con- ics facility that forms part of the pub-
tains the DNA. Bacteria and viruses are lic domain European Molecular Biology
the organisms that comprise the noneu- Laboratory (EMBL) that was established
karyotes (i.e., prokaryotes). in Heidelberg, Germany, in 1980. The
EBI is organized into three subprograms:
eukaryotic cell Any cell in which the
cellular genome is contained in a mem- 1. Service program: biological databases
brane-enclosed nucleus. In general, and information services. The EBI
eukaryotic cells include all cells in the provides access to the EMBL Nucle-

88
www.stemcell8.cn
excision repair

otide Sequence Database, SWISS- and maintained in Heidelberg, Germany;


PROT protein-sequence databases, it is the European equivalent of the Gen-
the Macromolecular Structure Data- Bank DNA sequence databank.
base (EBI-MSD), and the RHdb data-
base of radiation-hybrid maps evolution In the biological context, the
2. Research program: tools and infor- term evolution is generally equated with
mation for the study of molecular natural selection as proposed by Darwin:
structure, gene comparison, metabolic the process of change in the composition
pathways, three-dimensional struc- of a population resulting from the selec-
ture, and database searching tion of a subpopulation that is better fit
3. Industry program: molecular bio- than the population as a whole for sur-
logical resources geared to the needs vival under a particular set of environ-
of the biotechnology, chemical, and mental conditions.
pharmaceutical industries
excision repair The process of repair-
European Molecular Biology Lab ing damaged regions of DNA that
(EMBL) The EMBL has a large DNA involves the removal of the damaged
sequence database containing sequence region by excision followed by recopying
data compiled from international sources of the excised region by DNA polymerase

Excision repair

89
www.stemcell8.cn
exergonic

and ligation of recopied region by DNA exonuclease III An exonuclease that


ligase. See ultraviolet repair. catalyzes the cleavage of single nucleo-
tides one at a time from the 5 end of
exergonic A chemical reaction that double-stranded DNA that has a non-
releases energy in various forms such as phosphorylated 3 end.
heat or light.
exonuclease VII An exonuclease that
exit domain One of the two major catalyzes the cleavage of short oligonucle-
classes of binding sites on the ribosome. otides from both the 3 and 5 ends of
The fi nished polypeptide that is the prod- single-stranded DNA.
uct of the process of translation leaves
the ribosome at this site. exotoxin Any of a variety of toxic sub-
stances produced by a microorganism
exocellular Pertaining to processes or and released to the surrounding fluid.
reactions that originate within the cell
but take place outside the cell. For exam- expansins A class of plant cell wall
ple, the digestion of extracellular proteins proteins required for cell growth. Under
by proteolytic enzymes secreted by a cell conditions of low pH, expansins induce
is an exocellular event. the breakdown of the hydrogen bonds that
bind cellulose microfibrils to one another.
This makes the plant cell wall less rigid,
exocrine Secretion of a glandular-
which, in turn, allows cell growth to
produced substance via a duct or canal
occur.
that leads to the exterior. Exocrine
glands are distinguished from endocrine
explant The growth of a portion of a
glands, which secrete their products into
tissue outside of its normal location.
the bloodstream. Sweat produced by
eccrine glands or milk produced by mam-
exponential growth phase The phase
mary glands are examples of exocrine
of growth of a population of cells or
secretion.
organisms during which the overall popu-
lation number is seen to double at a regu-
exocytosis The process in which sub- lar interval. See biphasic growth and
stances contained in a specialized ves- growth phases.
icle within the cytoplasm of a cell are
secreted to the outside by fusion of the export The transport of substances
vesicle with cell plasma membrane. The across the cell membrane from the inte-
secretion of neurotransmitters in syn- rior of a cell to the exterior via special-
aptic vesicles by neurons is a common ized systems.
example of exocytosis.
expressed sequence tags (EST) Short
exon The regions of a gene in eukary- cDNA sequences used to link physical
otic cells that, as opposed to the introns, maps of genomes.
actually contain the coding sequences
for a polypeptide. See intron and expression library A library of DNA
splicing. fragments that has been created using a
vector designed to express any genes that
exon shuffl ing The evolutionary pro- are present in the library. See expression
cess of creating new genes by duplication system and expression vector.
and recombination of preexisting exons.
expression-linked copy (ELC) The
exonuclease A class of enzymes that particular variable surface glycoprotein
catalyze the cleavage of nucleotides from gene that is being expressed at any one
the end(s) of a nucleic acid. time during the developmentmental cycle

90
www.stemcell8.cn
ezrin

of the trypanosome. See variable sur- extracellular fluid The liquid outside
face glycoprotein. the cells in a tissue.

expression site The term for the extracellular matrix A complex mix-
genetic location of an expression- ture of proteins (such as fibronectin,
linked copy of a variable surface glyco- laminin, collagen) that is deposited on
protein. Expression sites are all located the outside of a cell and plays a crucial
near the telomere of a chromosome. role in the attachments of cells to the sur-
faces on which they grow. The extracel-
expression system An expression vec- lular matrix is believed to play an impor-
tor that contains the cloned DNA it is tant role in regulating the growth and
designed to express, together with the differentiation of a cell partly because the
host with which the vector is to be used. composition of the extracellular matrix
is often dramatically altered in cancerous
expression vector A specialized cloning tissue.
vector that contains the elements needed
to transcribe a cloned DNA. Expression extrinsic protein A protein present in
vectors contain sequences required for a cell or tissue but which originated else-
DNA replication and promoter elements where.
adjacent to the cloned DNA to initiate
transcription. extrusion The energy-requiring pro-
cess by which cells export large particles
extinction coefficient The constant of or organelles.
proportionality relating the molar concen-
tration of a substance and the absorbance ezrin A cytoskeletal element that links
of its solution. See Beer-Lambert law. the transmembrane adhesion molecule,
ICAM-1 (intercellular adhesion molecule
extracellular Outside the cell. 1) to the actin cytoskeleton.

91
www.stemcell8.cn

A
F

F(ab)2 fragment A portion of the IgG ments. The genetic form of the disease
antibody molecule containing the two is an X-linked autosomal recessive. The
antigen binding domains but not the Fc gene for the disease (called FGD1), of as
portion. Such fragments are generally yet unknown function, has been mapped
produced by treating antibodies with cer- to chromosome band Xp11.21. The dis-
tain proteases that specifically cleave the ease was described by the Norwegian
molecule near the end of the Fc segment. pediatrician D. J. Aarskog in 1970 and
American C. I. Scott Jr. in 1971.
F-1 generation First filial generation; the
first generation offspring of a genetic cross. f-actin (fi lamentous actin) The func-
The term is generally applied to the immedi- tional actin fi lament composed of G-actin
ate offspring of higher plants and mammals. subunits.

F-2 generation Second fi lial genera- factor, blood clotting Any of a group
of protein factors in the blood serum that
tion; the offspring of a mating between
act according to a defi ned pathway to
members of the F-1 generation.
produce a blood clot. In blood clotting,
the breakdown of platelets at the wound
Fabrys disease One of the lysosomal site is the fi rst step. Factors VII, VIII,
storage genetic diseases characterized by IX, and XI become activated by tissue
the lack of alpha-galactosidase. When factor and, in the presence of calcium,
this enzyme is missing in the lysosome, convert factor X to activated thrombo-
long-chain carbohydrates that need to be plastin. Thromboplastin then converts
degraded are not. These charbohydrates prothrombin into thrombin, the clotting
then accumulate in the bloodstream and enzyme. Thrombin catalyzes the conver-
deposit in the capillaries and other organs, sion of soluble fibrinogen in the serum
eventually leading to stroke, heat attack, into the insoluble protein fibrin. Fibers
and fatality in the young adult. This is made of fibrin are the basic structure of
a disease that is a promising candidate the fi nal clot and are made fi rm by fac-
for enzyme replacement therapy because tor XIII, the fibrin-stabilizing factor. The
cloned alpha-galactosidase can be admin- genetic disease, hemophilia, is the result
istered to individuals and directed to the of a defect in the gene that codes for one
lysosome, where it needs to function. of these factors (factor VIII).

facilitated diffusion The process of facultative anaerobe A microbe that


passive diffusion through a membrane lives under anaerobic conditions but that
via membrane channels or with the aid of can adjust its metabolism to utilize oxygen
carrier proteins in the membrane. when placed in an aerobic environment.

faciogenital dysplasia (Aarskog-Scott facultative heterochromatin A highly


syndrome) A disorder characterized by condensed form of heterochromatin that
wide-spaced eyes (ocular hypertelorism), is believed to not be transcribed.
anteverted nostrils, a malformed scro-
tum, and excessive looseness of the liga- facultative microoganisms See aerobe.

92
www.stemcell8.cn
feline sarcoma verso
virus

reassociates fi rst when the strands of a


native DNA helix are dissociated from
one another, for example, when heated
and then allowed to reassociate. The fast
component was shown to contain highly
repeated DNA sequences.

fastidious Pertaining to microrganisms


with complex nutritional requirements;
requiring enriched media. See enriched
FAD (flavin adenine dinucleotide) medium.

fatty acid Any of a group of long-chain


FAD, FADH 2 Flavin adenine dinucle- carboxylic acids that are found mostly
otide; a cofactor for enzymes involved in in animal fat. The most common fatty
oxidoreductions and electron transfer in acids found in animal tissues are oleic,
numerous biochemical reactions, but par- palmitic, stearic, and palmitoleic acid.
ticularly those involved in the oxidative
metabolism of sugars for energy produc- FBJ An acronym derived from the
tion. FAD is a combination of two nucle- names of the discoverers (Finkel, Biskis,
otides, one of which is derived from the B and Jinkins) of the FBJ murine osteosar-
vitamin riboflavin (vitamin B2). coma virus. See fos.

FADD Fas associated via death domain; Fc The portion of the immunoglobulin
a component of the classical apoptosis heavy-chain molecule that does not con-
pathway mediated by Fas. tain the antigen-binding region; the anti-
body molecule constant region.
familial hypercholesterolemia A genetic
disease characterized by abnormally high fecundity The measure of fertility; for
serum cholesterol levels resulting in early example, sperm count or the production
onset atherosclerosis and heart attack. The of viable eggs.
genetic defect results in low tissue levels of
the receptor for low-density lipoproteins feedback control The general term for
(LDLs). Cells lacking these receptors cannot regulation of an enzymes activity by one
take up LDLs from the blood to digest them. of its own metabolites.

familial Mediterranean fever A gen- feedback inhibition Inhibition of en-


etic disease characterized by recurrent zyme activity by a product (generally the
fevers and inflammation of the abdomi- fi nal product) of the metabolic pathway
nal cavity resulting in severe abdominal of which the enzyme is part.
pain. Other symptoms include arthritis,
chest pains, and skin rashes. feeder layer In tissue culture, a layer
of cells that produces a product that sup-
Fas A transmembrane receptor protein ports the growth of another cell type in
involved in the classical apoptosis path- co-culture. Feeder layers are used as a
way. In this pathway, activation of the means of growing cells that will not grow
Fas receptor (caused by binding of ligand in purely synthetic culture medium.
to the extracellular portion of Fas) results
in activation of caspase-8 (also known as feedforward control Stimulation of
FLICE) by FADD, which is bound to the enzyme activity by a product of the meta-
cytosolic domain of the Fas receptor. bolic pathway of which the enzyme is part.

fast component That portion of a feline sarcoma virus (FSV) A retrovi-


preparation of eukaryotic DNA that rus that causes sarcoma tumors in cats.

93
www.stemcell8.cn
recto
fermentation

fermentation The process in micro- to the recipient. F plasmids are F factors


organisms in which the metabolism of that have picked up a region of the bacte-
sugars for energy is accompanied by the rial chromosome after a faulty recombi-
formation of alcohol or lactic acid. nation event in an Hfr strain.

fermentor A device for growing large FGP Fluorescent green protein; A nat-
bacterial cultures. A fermentor consists urally occurring fluorescent protein iso-
of a large vessel (usually containing more lated from certain coelenterates such as
than 10 liters of culture) that is mechani- the Pacific jellyfish. Because the gene for
cally shaken or rapidly rotated for aera- FGP has been cloned and found to be
tion of the culture. There is also a heater active when fused to other genes, it has
in contact with the culture vessel that found wide application as a molecular tag
maintains the culture at the proper tem- for determining the cellular location of
perature, usually 37 C. various proteins to which it can be fused
by various molecular genetic techniques.
ferritin A protein that forms a complex
with iron. Ferritin, which normally func- fgr The oncogene carried by the Garden-
tions as an iron storage protein, is used as Rasheed strain of the feline sarcoma
a noradioactive label for visualizing anti- virus.
bodies bound to a specific antigen, such
as in a western blot. fibrin The protein formed from fibrino-
gen that polymerizes to form the fibers
fertilization The fusion of two gam- that comprise a blot clot at the site of a
etes and of their respective nuclei to cre- wound. See factor, blood clotting.
ate a diploid or polyploid zygote.
fibrinogen The protein that is released
fes Feline sarcoma; the oncogene car- by platelets at the site of a wound and
ried by Snyder-Theilen strain of feline that gives rise to fibrin when thrombin is
sarcoma virus (FSV). fes is believed present. See factor, blood clotting.
to be a protein kinase that catalyzes the
phosphorylation of tyrosine residues. fibroblast A cell type that comprises
the bulk of the living cells in connective
fetal calf serum (FCS) The serum tissue and in the supporting matrix (the
from the blood of embryonic calves; an stroma) of skin and other epithelial tis-
essential component of most tissue cul- sues. Fibroblasts are embedded in a com-
ture media. The factors in FCS that pro- plex extracellular matrix, much of which
mote the growth of cells in tissue culture they secrete and that is responsible for the
are largely unknown but are believed to strength and flexibility of the stroma.
include growth factors and hormones.
fibroblast growth factor receptor 3
Feulgen reagent A DNA-specific stain (FGFR3) The cell surface receptor for
(fuchsin sulfite) that, because it was found fibroblast growth factors (FGFs); a family
to stain chromatin in the nucleus strongly, of polypeptide growth factors involved
was cited as evidence that DNA was the in cell division, angiogenesis, and wound
hereditary material in experiments car- healing. The FGF receptor is comprised
ried out by Robert Feulgen in 1914. of an immunoglobulin-like extracellular
domain, a transmembrane domain, and
F factor A bacterial plasmid con- an intracellular tyrosine kinase domain.
taining fertility genes that establish the Mutations in the FGF receptor cause
donor characteristics for conjugation achondroplasia, a disease of bone devel-
(see high-frequency recombination opment characterized by stunted bone
strain). These genes are responsible for growth. The FGFR3 gene is located on
the ability of the donor cell to establish the HD region on chromosome 4 (gene
contact with and transfer its chromosome map locus 4p16.3).

94
www.stemcell8.cn
flagellin
verso

fibronectin A ubiquitous glycoprotein fi lter sterilize A technique for render-


found in blood and in virtually all tissues ing a solution sterile (i.e., free of microbes
of the body that is thought to play a key the size of bacteria) by passing it through
role in cell adhesion and in the control a fi ne fi lter.
of cell growth and differentiation. Fibro-
nectin is particularly prominent in the fi ne-structure mapping A mapping
fibroblast-containing tissues where it is technique that can detect changes in
complexed with collagen. nucleotide base sequence covering a few
nucleotides based on very rare recombi-
Ficks law of diffusion The premise nation events between strands of DNA
that a substance in solution will diffuse carrying different forms of the same gene
in a direction that will tend to eliminate (alleles).
any concentration gradient, that is, make
the solution homogenous with respect to fi ngerprinting A general term for tech-
concentration. niques that defi ne a unique identity for
a given protein or nucleic acid molecule
ficoll A synthetic polymer of the sugar by breaking the molecule into a pattern
sucrose. Ficoll is biochemically inert and of fragments based on its amino acid or
is used primarily to increase the den- nucleotide base sequence by using various
sity of solutions for purposes of density proteases or restriction enzymes. Finger-
gradient centrifugation and nucleic acid printing has been developed as a tool in
hybridization. forensic medicine primarily in the form of
DNA fi ngerprinting in which an individu-
als unique pattern of DNA fragments is
ficoll gradient A solution of fi coll visualized by Southern blot hybridization
created in such a way that the con- using a probe for a gene that is known to
centration of fi coll varies continu- vary widely.
ously along an axis through the solu-
tion. Ficoll gradients are often used to fi nger protein A protein that contains
separate different cell types from one segments of regularly spaced cysteine
another by sedimentation. See density amino acids that appear to be involved
gradient. in binding zinc atoms. This type of struc-
ture is characteristic of nucleic acid bind-
figure eight An intermediate stage in ing proteins.
the process of recombination in which
two circular DNAs are covalently bound fi rst-order kinetics Any chemical reac-
to one another. tion in which the rate at which the reac-
tion occurs is proportional to the molar
fi lamentous bacteriophage A sub- concentration of only one reactant. For
class of single-stranded DNA bacterio- example, for the reaction
phage in which the bacteriophage genome A --- > B + C, the rate of reaction = k[A],
is encapsidated by an elongated viral coat where k is the reaction rate constant.
resembling a fi lament. F1 and M13 are
the most common members of this class flagella Long, external, flexible fila-
of bacteriophage. ments that are used to propel cells in a
liquid medium. Bacterial flagella, which
fi lamin A dimeric protein that cross- differ in structure from the flagella in
links actin fi laments to produce a viscous eukaryotic cells, also serve as a chemo-
aggregate with the properties of a gel. tactic organ that guides the cell to sources
of food.
fi lopodia Long microspikes (50 m)
that extend out of the growing tip of the flagellin The protein that makes up the
axon of a developing neuron. bacterial flagellum.

95
www.stemcell8.cn
recto
fl ash evaporator

flash evaporator A device for removing emitted by individual cells. Flow cytom-
solvent from large volumes of a solution etry is carried out in an instrument in
by evaporation to concentrate the solute. which individual cells are illuminated
A flash evaporator consists of a heated, by a laser beam as they pass by a win-
rotating glass sphere with a tube to allow dow where a sensitive photocell records
the evaporating solvent to exhaust. the quantity of light emitted at a given
wavelength. Because antibodies can be
flavin A compound that is derived from labeled with fluorescent compounds,
riboflavin (vitamin B 2). Important flavin this technique has been widely used as
biomolecules are FAD and FMN. See an automated procedure for quantitating
coenzyme. amounts of various antigens present in a
population of cells.

fluctuation analysis A method devel-


oped by Salvatore Luria and Max Del-
bruck in 1943 that used statistical analy-
sis of the rate of mutation occurring in
bacterial cultures containing small num-
bers of cells to demonstrate that muta-
tions occur spontaneously.
A flavin molecule
fluid mosaic model A model of the
eukaryotic cell membrane proposed by S. J.
Singer and G. L. Nicolson in 1972. The
FLICE Fadd-like ICE; an alternative model is based on the idea of a semisolid
name for caspase 8. FLICE-2 is an alter- lipid bilayer into which transmembrane
native name for caspase 10. and integral membrane proteins are
embedded.
fl ippases A group of enzymes that cat-
alyzes the movement of membrane lipids fluorescence The property of cer-
from one membrane leaflet to the other tain molecules whereby they emit light
(fl ipping). Flippases are believed to serve at a specific wavelength (emission wave-
important functions in the trafficking of length) when illuminated by a light beam
vesicles, particularly for the formation of at another specific wavelength (excitation
secretory and endocytic vesicles. Some wavelength).
fl ippases do not require an energy source,
while others require energy derived from fluorescence-activated cell sorting
the hydrolysis of ATP. (FACS) A variation of flow cytometry
in which fluorescently labeled cells are
flocculation The rapid precipitation out physically sorted into different compart-
of solution of large amounts of material. ments based on the amount of fluores-
cence emitted at a given wavelength.
flora Plant life.
fluorescence in situ hybridization
flow cytoenzymology A technique for (FISH) A process like autoradiog-
separation and analysis of cells by fluo- raphy, but instead of using radioactively
rescence-activated cell sorting (FACS) labeled DNA, the DNA probe is tagged
based on the presence of certain enzymes with a fluorescent dye that will vividly
that generate colored compounds from show up chromosomes or parts of chro-
synthetic substrates. mosomes.

flow cytometry A technique based on fluorescence resonance energy transfer


automated measurement of fluorescence (FRET) The direct transfer of an excited

96
www.stemcell8.cn
folate antagonist
verso

photon from one fluorescent molecule to change in substrate concentration when


another located within 1-50 from one the system is isolated, but increases only
another. Since the ability to transfer the by 2 percent when the enzyme is in the
photon from one molecule to the next var- intact cell, the enzyme would have a flux-
ies as a function of the sixth power of the control coefficient of 2/5, or 0.4.
distance, the transfer of the photon (which
can be measured from the fluorescence of FMN Flavin mononucleotide; a nucleo-
the recipient molecule) is a sensitive indica- tide derived from the vitamin ribofl a-
tor of the distance between the two mol- vin (vitamin B2). FMN, one of the two
ecules. nucleotides that comprise FAD, also fun-
ctions in the transport of electrons dur-
fluorescent-antibody techniques Tech- ing the oxidative metabolism of sugars
niques for visualization of the location of for energy production. See coenzyme
a certain antigen in a tissue section or and fl avin.
other cell preparation that is based on the
binding of an antibody with a fluorescent Fmoc A molecule (9-fluorenymethoxy-
label to the antigen of interest. carbonyl) used to protect the free amino
end of a growing peptide chain against
fluorescent label Any molecule that unwanted side reactions during the chem-
fluoresces and can be attached to another, ical synthesis of a peptide.
nonfluorescing probe molecule such as an
antibody or a DNA hybridization probe. fms The oncogene carried by the
McDonough strain of feline sarcoma
virus. The human proto-oncogene (c-fms)
fluorimetry Quantitative measurement
encodes a protein that is the membrane
of fluorescence.
receptor for macrophage colony stimu-
lating factor (MCSF). The chromosomal
5-fluorodeoxyuridine The nucleotide
location of the c-fms gene is 5q33.2-
derivative of 5-fluorouracil that is formed
5q33.3.
in cells treated with 5-fluorouracil. 5-
fluorodeoxyuridine and 5-fluorouracil are focus-forming assay A test for the
both used as anticancer agents. presence of DNA that contains onco-
genic activity. In a focus-forming assay,
5-fluorouracil (5-FU) An analog of test DNA is transfected into animal cells
thymine used as an anticancer agent. 5- that ordinarily show contact inhibition.
FU is an inhibitor of the enzyme, dihy- If the test DNA contains oncogenic activ-
drofolate reductase (dHFR) and therefore ity, the recipient cells lose contact inhibi-
is an inhibitor of nucleotide synthesis, tion, begin to divide, and then form areas
which is particularly harmful to the rap- of dense packing (foci). The appearance
idly growing cells in tumors. of foci is taken as an indication of onco-
genic activity.
flush ends Termini of a double-
stranded DNA molecule that have no focus-forming units (FFU) A mea-
single-stranded overhanging regions. See sure of the concentration of live virus
blunt-end DNA. in a given volume of fluid. Focus-form-
ing units are determined by spreading a
flux-control coefficient A measure of known amount of virus-containing fluid
the relative change in flux (i.e., change over a layer of cells that the virus infects
in the rate of substrate conversion to and then observing the number of areas
product) caused by some specific modula- in the cell layer that show evidence of
tion of an enzyme (e.g., chemically alter- viral infection. See titer.
ing its activity) when the system is in a
steady state. If the activity of an enzyme folate antagonist A type of compound,
increases by 5 percent in response to a for example, methotrexate, that blocks

97
www.stemcell8.cn
recto
foldback DNA

certain critical reactions in the synthe- (human), and HCM1 (Saccharomyces


sis of nucleotides and that requires the B cerevisiae). Most forkhead factors are
vitamin, folic acid. Folate antagonists are involved in embryonic development,
widely used as chemotherapeutic agents but some factors have been shown to be
for treatment of cancer because the rap- involved in other functions, including
idly growing cells of malignant tumors regulation of circadian rhythm, cell-cycle
are more dependent on these reactions control, and life span.
than normal cells.
formamide One of the most com-
foldback DNA A segment of DNA that monly used chemicals for denaturing
contains palindromic repeat sequences nucleic acids in hybridization techniques.
that may base pair to one another during Formamide has the chemical formula:
reassociation. See palindrome. CONH 2 .

follicle cells A layer of cells found in forming face The side of the Golgi
both vertebrates and invertebrates that stack where vesicles that have budded off
surround the oocyte and supply it with from the rough endoplasmic reticulum
certain low molecular weight nutrients. fuse to the Golgi apparatus; the cis face
of the Golgi apparatus.
footprint The region on a DNA molecule
to which some particular regulatory pro- forms I, II, and III, DNA The super-
tein binds. The footprint can be visualized coiled, nicked circular, and linear forms,
by partially digesting the protein-bound respectively, of circular episomal DNAs
DNA with DNase 1 and then separating such as viral or plasmid DNAs. Forms
the digested DNA fragments by electropho- II and III are not thought to be natu-
resis. The region bound by the protein will rally occurring forms but are believed to
not be cut by the DNase and will appear as be derived from native supercoiled DNA
a blank area on the gel. (form I) by nicking of one (form II) or
both strands (form III) during the process
forensic science The science developed of extraction.
by Edmund Locard in the early part of
the 20th century to establish whether formycin B A purine derivative that is
there has been a transfer of trace evidence used as an antiparasitic agent. Formycin
between the criminal and crime scene or B inhibits the ability of cells to use sal-
between the crime scene and the crimi- vaged nucleotides from the extracellular
nal. Forensic scientists focus on trace evi- medium for nucleic acid synthesis.
dence such as blood, semen, saliva, and
hairs found at the crime scene. Before the forward mutations Any mutation that
advent of DNA technology, trace evidence causes a change from a normal function-
was analyzed by a series of blood group- ing gene to an improperly functioning, or
ing tests. Now, forensic scientists rely on inactive, gene.
dna fi ngerprinting.
fos The viral oncogene (v-fos) carried
forkhead transcription factors A by Finkel-Biskis-Jinkins (FBJ) murine
family of transcription factors defi ned osteosarcoma retrovirus. The fos homo-
by a common DNA binding domain of logue in human cells codes for a family of
about 100 amino acids called the fork- proteins consisting of four members: Fos,
head domain, fi rst described in a mutant FosB, FosL1, and FosL2. These genes for
of Drosophila melanogaster. Forkhead leucine zipper transcription factors form
transcription factors have been found dimers with the jun family of proteins
in a wide variety of species from yeast to form the transcription factor complex
to humans, including FD1-5 (D. mela- AP1. As transcription factors, the fos
nogaster), HNF-3 (mammalian), HTLF proteins are implicated in cell prolifera-

98
www.stemcell8.cn
freeze-drying

tion, differentiation, and transformation. are sites where chromosomal transloca-


The human c-fos gene is located on chro- tion is observed.
mosome 14q21-31.
fragile X syndrome The second most
fosfomycin (fosfonomycin) An antibi- frequent genetic cause of mental retarda-
otic that acts by blocking an early step tion after Downs syndrome. This dis-
in the biochemical pathway by which the ease belongs to a group of diseases that
bacterial cell wall is synthesized. Fosfo- result from a repeating sequence of three
mycin, which is a structural analog of bases (triplet) on a chromosome, caused
phosphoenol pyruvate (PEP), blocks the by DNA polymerase slippage during
step at which PEP is required to create DNA replication. Fragile X is caused
the pentapeptide that is used to construct by increasing the numbers of the triplet
the bacterial cell wall. CGG on the X chromosome. The larger
the number of repeats, the more severe
fos-related antigens (FRA) A group the disease. Individuals with only a few
of nuclear phosphoproteins that are simi- repeats are carriers of the disease but in
lar in structure to the product of the fos general do not have the symptoms.
oncogene.
frame-shift mutation A type of
founder effect The presence of a chro- mutation in which nucleotide bases are
mosome, a portion of a chromosome, or inserted or deleted in the coding region
even a particular allele in the members of gene causing the triplet codons to be
of a given population that can be traced translated in the wrong reading frame.
back to a single individual.

four-strand crossing over Crossing Franklin, Rosalind (19201958) A


over between two sister chromatids that physical chemist who carried out the high-
involves breaking of both DNA strands resolution X-ray diffraction studies that
on both chromosomes. This differs from led to the elucidation of the double heli-
the usual case that involves only one cal nature of DNA for which James Wat-
DNA strand from each chromatid. See son and Francis Crick were awarded the
crossing over. Nobel Prize.

F protein The Sendai virusderived FRAP Fluorescence recovery after pho-


protein that is responsible for the ability tobleaching; a technique whereby fluores-
of the virus to cause cell fusion. The F cent molecules located in a specific cellular
protein is used in the creation of fuso- structure, for example, the nucleus or cell
genic vesicles. membrane, are bleached by a microscopic
light beam. The bleached area is exam-
fps (fes oncogene) The oncogene car- ined at various periods of time after the
ried by the Snyder-Theilen strain of feline photobleaching to determine how fast the
sarcoma virus (FSV). The human homo- cellular structure regenerates the material
logue of fps (c-fps) encodes a cytoplasmic in the bleached area. The FRAP technique
tyrosine kinase. The feline gene causes is best known for its use in studies of cell
sarcoma tumors, but the association of membrane synthesis and fluidity.
the human fps gene with cancer has not
yet been clearly established. The location free energy See Gibbs free energy.
of the human fps gene is chromosome
15q26.1. freeze-drying The removal of ice from
a frozen cell sample to be examined by
fragile sites Sites on chromosomes that the freeze-etch technique by subjecting
show a higher than normal probability of the sample to a vacuum as the tempera-
breakage and therefore more commonly ture is slowly raised, thereby leaving the

99
www.stemcell8.cn
freeze-etch

essential cell structural features behind. Fura 2 A dye that fluoresces in the
See lyophilization. presence of calcium. Fura-2 fluorescence
can be used to observe and quantitate the
freeze-etch A technique for examin- influx or efflux of calcium in the cytosol.
ing cell structure by electron microscopy
in which a frozen cell sample is cracked furanose A ring form of a sugar in
with a knife to reveal the cell contents. which the ring is made up of four carbon
After freeze-drying, the sample is then atoms and one oxygen. The term desig-
shadowed and examined under the elec- nates a large group of sugars that form
tron microscope. this type of ring when dissolved in water.

freeze fracture A technique for examin- fushi tarazu gene A gene in the pair-
ing the structure of the cell membrane by rule locus of the fruit fly, Drosophila
electron microscopy. The procedure is essen- melanogaster. Mutants of the fushi
tially the same as in freeze-etching, except tarazu (ftz) gene are missing every other
that the sample is fractured along the plane segment. See pair-rule mutants and
of the cell membrane, which is then exam- segments, segmentation.
ined after freeze-drying and shadowing.
fushi tarazu mutation A mutation
Frei test A clinical test to diagnose dis- that causes a failure to produce the seven
eases caused by infectious microbes based embryonic parasegments that appear
on the appearance of a skin reaction when at the blastoderm stage of develop-
a killed preparation of the suspect micro- ment in Drosophila melanogaster (fruit
organism is injected subcutaneously. fly). Experiments centered on this muta-
tion helped identify the pair-rule class of
French pressure cell A device for lys- genes.
ing bacterial cells by subjecting them to
hydrostatic pressure. fusidic acid An antibiotic that acts by
blocking the translocation step in protein
Freunds adjuvant An emulsion con- synthesis (translation) by blocking the
sisting of water, oil, and dead mycobac- release of the elongation factor (EF)-GDP
teria that, when mixed with an immu- complex.
nogen, enhances the immune response
when the immunogen-Freunds adjuvant fusion proteins Proteins that represent
mixture is injected into an animal. the product of the artificial splicing of
two genes.
fructose An isomer of glucose found in
citrus fruits. A phosphorylated form of
fructose is an intermediate metabolite in fusogenic vesicles Liposomes that con-
the oxidation of glucose for energy pro- tain, in the lipid bilayer, specialized fusion-
duction. inducing molecules (e.g., the F protein).

ftz An acronym for fushi tarazu. futile cycle In living systems, a combi-
nation of competing reactions in which
fumarase The enzyme that catalyzes the products of one set of reactions are
the conversion of fumarate to malate, an reconverted to the original reactants.
important step in the Krebs cycle phase The term is generally applied to reactions
of the metabolism of sugars. of energy metabolism such as the inter-
conversion:
fungi See mold. ATP->ADP
fructose-6-phosphate <========>
fungicide An agent that selectively kills ADP->ATP
fungi. fructose-1, 6-bisphosphate

100
www.stemcell8.cn

G1 phase A segment of the cell cycle that converts galactose into glucose. The
representing the time period during disease is characterized by organ enlarge-
which there is an increase in cellular mass ment, mental retardation, and cataract
between the end of mitosis and the onset formation resulting from the accumula-
of DNA synthesis (S phase). tion of D-galactose and D-galactose-1-
phosphate in the bloodstream.
G2 phase A segment of the cell cycle
representing the time period during galactosidase Any one of the class of
which there is an increase in cellular mass enzymes that catalyze the cleavage of
between the end of DNA synthesis (S the glycosidic linkage between galactose
phase) and the onset of mitosis. and another sugar. The galactosidases
are divided into and galactosidases
GABA Gamma amino butyric acid; an depending upon the type of glycosidic
inhibitory neurotransmitter derived from bond that is cleaved (i.e., or ). See
the amino acid glutamate. GABA acts to glycosidic linkage.
inhibit neural transmission by opening
channels that admit chloride ions into the GALT Gut-associated lymphatic tissue;
neuron. The GABA receptor is the target of patches of lymphoid tissue in the small
pharmacologic agents, such as Valium and intestine; Peyers patches.
other diazepams, that act as depressants by
potentiating the action of GABA. gamete The mature product of the
process of meiosis, for example, egg and
GAG 1. Glycosaminoglycans. Long-branched sperm, in organisms that reproduce sexu-
chains of sugar molecules built from repeat- ally.
ing dissacharide subunits containing amino
groups. Glycosaminoglycans are present on gamma chain An immunoglobulin
the surfaces of eukaryotic cells where they (Ig) chain that is found as a transmem-
are believed to play a role in cell-cell and brane protein on the surface of a B cell
cell-substate recognition. and is part of the B-cell antigen-receptor
2. Group-specific antigens. The proteins complex.
encoded for by the GAG gene of a retro-
virus. The GAG proteins are the compo- gamma interferon See interferon.
nents of the virus capsid.
gamma radiation A high-energy elec-
galactose An optical isomer of the tromagnetic radiation that is produced
sugar glucose. Galactose differs from during the process of nuclear decay in
glucose only at the fi fth carbon and is which one subatomic particle is converted
converted into glucose through the action into another; for example, the decay of
of an epimerase enzyme (UDP-glucose 4- a neutron into a proton and an electron
epimerase) that acts on this carbon. also releases gamma radiation.

galactosemia A genetic disease caused ganglion A collection of neurons that,


by a deficiency of the epimerase enzyme in mammals, are centers of lower brain

101
www.stemcell8.cn
gangliosides

function outside the brain proper. In GC box A sequence of nucleotides


lower animals such as worms and inver- (GGGCGG) that is found in the promot-
tebrates, which lack a brain, ganglia con- ers of mammalian cells and that appears
stitute the centers of all brain function. to be a binding site for certain transcrip-
tion factors.
gangliosides A class of cell membrane
lipids found almost entirely in brain neu- GC content The fraction of the total
rons. Ganglioside molecules form part of nucleotides in a DNA molecule that are
the brain-receptor complex for pituitary cytosine and guanine nucleotides, gener-
polypeptide hormones. ally given as a percentage of the total.

GAP GTPase-activating proteins. A gel A semisolid colloidal solution.


group of proteins that inactivate the ras-
GTP by inducing hydrolysis of the bound gel electrophoresis A technique for
GTP to produce ras-GDP. The ras-GDP separation of substances, principally
complex remains inactive until the GDP nucleic acids and proteins, in a mixture
is exchanged for GTP. The inactivation by using an electric field to induce them
of ras-GTP by GAPs is an important step to migrate through a gel. Separation of
in the signal transduction pathway medi- the individual component substances in
ated by ras. the original mixture is based on the size
of the molecules (gel fi ltration) and/or
gap genes A group of genes (hunchback, the electric charge. Agarose gels are com-
Kruppel, knirps) that play a key role in the monly used for separation of mixtures
development of segmentation in the embryo of nucleic acids, and polyacrylamide gels
of the fruit fly, Drosophila melanogaster. are generally used for separation of pro-
Gap genes have been identified on the basis teins and nucleic acids.
of mutations that result in the absence of
segments in the midportion of the embryo. gel fi ltration A technique for sepa-
ration of a substance from others in a
gap junction A specialized channel mixture by passing the mixture usually
that forms between two adjacent cells at through gel beads in a column. Separa-
their mutual point of contact and that tion is based on the size of the molecules
connects the cells so that small molecules and depends on the size of the spaces
(about 2,000 kilodaltons or less in size) between the polymeric gel molecules (i.e.,
can pass between them. Gap junctions are the pores). Substances whose molecules
believed to be a mechanism of intercellu- are smaller in size than the pores enter
lar communication involved in the con- the gel, so their movement through the gel
trol of cell growth and differentiation. is slower than larger molecules that have
less of a tendency to pass through the gel
gap mutants Mutants of the fruit fly, pores but, instead, pass around the gel
Drosophila melanogaster, in which sev- beads. Each type of gel has a characteris-
eral adjacent segments fail to appear dur- tic pore size that determines the exclusion
ing the course of development. See seg- size: the maximum molecular size that
ments, segmentation. can enter the gel. Molecules larger than
the exclusion size are completely excluded
gasohol A mixture of 90 percent gaso- from the gel.
line and 10 percent ethyl alcohol. Gaso-
hol is purported to be a cleaner and more gel-retardation assay A technique for
energy-efficient alternative to gasoline. It determining the presence of DNA
has been proposed that ethyl alchohol for protein complexes in a given DNA frag-
this purpose could be cheaply obtained ment by observing whether or not the
by bacterial fermentation. rate of movement of the fragment in an

102
www.stemcell8.cn
gene cloning

Gel filtration

electric field is slowed in the presence of a various investigators around the world, cur-
particular protein. rently maintained at the National Library
of Medicine. The GenBank, which is the
gelsolin A protein that, in the pres- most comprehensive U.S. national database
ence of calcium, liquefies gels formed of this type, is divided into 13 sequence
from actin and fi lamin. The liquefaction categories: primate, mammal, rodent, ver-
is accomplished by cleavage of the actin tebrate, invertebrate, organelle, RNA, bac-
fi laments and subsequent capping of the teria, plant, viral, bacteriophage, synthetic,
cleaved fi lament ends. and unannotated. See databases.

gel transfer A term applied to the gen- gene A sequence of DNA nucleotides
eral process of transferring substances sep- that carries the complete code required
arated by gel electrophoresis from the gel to for the biosynthesis of a polypeptide.
a membrane for analysis, for example, for
Southern, northern, or western blot analy- gene bank A group of genes that are
sis. Blotting is one type of gel transfer. coordinately controlled.

GenBank A national database of nucleic gene cloning The science of creating


acid and protein sequences contributed by recombinant DNAs that can be inserted

103
www.stemcell8.cn
gene(s) codominant

into and copied by a host microorganism. gene(s) codominant Different versions


The term and the power of the technique (alleles) of a particular gene, both of which
derives from the ability to rapidly grow are active in the heterozygous state.
and easily manipulate large populations of
microorganisms carrying the recombinant gene conversion A mechanism pro-
DNA from a single cell (i.e., a clone). posed to explain coincidental evolu-

Gene cloning

104
www.stemcell8.cn
genetic code

tion of duplicated genes in which a DNA For example, 16p11.2 designates sub-
strand from one gene copy becomes paired band 2 of band number 11 on the p arm
with the complementary DNA strand of chromosome 16.
from the other gene copy; any area of base
mismatch (presumably representing a gene(s) pseudogenes A variant form of
mutation that occurred in one of the gene a particular gene that has become perma-
copies) is then repaired by a mismatch nently inactivated over time as the result
repair system. See mismatch repair. of genetic drift.

gene(s) dominant A version of a par- generation time The average time


ticular gene (allele) whose expression between the appearance of parent and
obscures the expression of its recessive progeny generations in a population.
allelic form when both are present in the
heterozygous state. gene(s) recessive A version of a par-
ticular gene (allele) whose expression is
gene duplication An error in the nor- obscured by the expression of its domi-
mal process by which genes are copied nant allelic form when both are present
and that results in a copy of a gene being in an organism (the heterozygous state).
placed in the same DNA strand as the
gene from which it was copied. gene splicing A term that is applied
to the general area of recombinant DNA
gene expression Any gene activity. but that is also applied to the process of
Gene expression may include gene tran- splicing of eukaryotic RNAs. See exon,
scription into mRNA, translation of intron, and splicing.
mRNA into protein, or activation of a
preexisting gene product (protein). gene therapy The treatment of human
genetic diseases by the transfer of a wild
gene families A group of genes whose type, or good, gene into a person whose
nucleotide base sequences show a high disease is the result of a faulty gene. Such
degree of sequence homology to one therapies depend on creating the appro-
another. In evolution, gene families are priate vector to bring the replacement
believed to arise through gene duplication. gene into the appropriate tissue. Some
blood diseases, such as thalassemia and
gene flow The tendency for gene fre- hemophilia, are amenable to such treat-
quency to appear in one population as ment because wild-type genes missing in
the result of interbreeding with another patients suffering from these diseases can
population in which the gene is present. be inserted into stem blood cells and intro-
duced into the patients by bone marrow
gene frequency The relative percentage transplants. Gene therapy has been used
of occurrence of a particular gene relative to treat familial hypercholesteremia, a dis-
to all versions (i.e., alleles) of that gene. ease in which patients have a faulty gene
for a protein that is responsible for clear-
gene library See library. ing the blood of cholesterol. Because the
process requires alteration of the genetic
gene map locus The chromosomal loca- material of an individual and may be
tion of a gene. Gene map locus is defi ned risky, such procedures require monitoring
by chromosome number, p or q arm, band by local and federal oversight committees
number, and sub-band number. Gene map involving scientists, ethicists, and lawyers.
locus is written as: Xp (or q) y.z where:
X is the chromosome number; genetic code The sequence of three
p or q designates the chromosome arm; consecutive nucleotide bases in a strand
y is the band number; and of DNA or RNA that specifies an amino
z is the sub-band number. acid.

105
www.stemcell8.cn
genetic disease

genetic disease A disease caused by understand functional relationships be-


an alteration or mutation in a gene that tween parts of genes and to assess evolu-
results in an aberrant form of the protein tionary relationships between species. See
coded for by the gene. Because genetic alignment and databases.
diseases are based on alterations in genes
themselves, genetic diseases are trans- genotype The set of all genes, includ-
missable to offspring that receive the ing the different alleles, either expressed
faulty gene. Hemophilia and sickle-cell or not expressed, that is carried in the
anemia are examples of genetic diseases. DNA of an organism.

genetic drift The process of changes in gentamycin An aminoglycoside antibi-


structure of a gene in evolution as the otic isolated from Actinomycetes that is
result of a random substitutions, loss, active against a number of Gram-positive
or insertions of nucleotide bases in the cocci-type bacteria.
DNA.
genus A subclassification of organisms
genetic engineering The manipulation between family and species. The stan-
of genes through the use of recombinant dard classification categories in order of
DNA techniques for the purpose of modi- general to increasingly detailed biologi-
fying the function of a gene or genes for a cal characteristics is: kingdom, phylum,
specific purpose. class, order, family, genus, species.

genetic information Any information germacide Any agent, chemical or


that is carried in terms of the sequence of physical, that destroys microbes that
nucleotide bases in DNA. cause disease.

genetic map A map of the genome of germ cell A reproductive cell or any
an organism based on the relative dis- cell giving rise to a reproductive cell, such
tances between genetic markers. See as an oocyte or spermatocyte.
linkage map.
germinal centers A region of the lymph
genetics The study of the process by node that contains a mass of rapidly divid-
which traits are transmitted from parent ing B cells. See B lymphocytes.
to offspring; the study of inheritance.
germination The growth of a plant
genome All the genetic information from a spore or a seed.
carried in the haploid number of chro-
mosomes. germ line Embryologically, the cells
that will, in the adult organism, give rise
genomic DNA The DNA representing to germ cells.
the entire genome. In laboratory termi-
nology, the term genomic DNA is used germ-line therapy A gene therapy
to describe a pure preparation of total based on the introduction of new genetic
native DNA isolated from tissue or a cell material or on alteration of existing
culture. genetic material in cells that give rise to
either sperm or egg. In germ-line therapy,
genomic library A library created in the new or altered genetic material can be
a particular vector from genomic DNA passed from parent to offspring.
such that the entire genome is included in
the library. ghost cells A cell, usually a bacterial
or red blood cell, that lacks much or most
genomics Computer analysis of gene of its internal contents as the result of
sequences from different organisms to lysis and resealing of the cell membrane.

106
www.stemcell8.cn
glucocorticoid

Because ghost cells can fuse with other Gleevec An anticancer pharmaceuti-
cells, ghosts have been used as a means of cal made by Novartis that inhibits the abl
packaging and delivering drugs to other protein-tyrosine kinase that is activated
cell targets. in chronic myelogenous leukemia (CML)
by formation of the Philadelphia chromo-
gibberllin A group of plant hormones some. Gleevec is effective against CML
that induce the plant growth and matura- and some gastrointestinal tumors (GISTs).
tion in flowering plants.
glial cell A cell type that occupies the
Gibbs-Donnan effect The observa- spaces in between the neurons of the
tion that charged molecules on one side brain. Glial cells are divided into five
of a semipermeable membrane often fail major subclasses: Schwann cells, oligo-
to ever become evenly distributed on dendrocytes, microglia, astrocytes, and
both sides of the membrane. This effect ependymal cells.
is explained on the basis of the fact that
other charged substances that cannot glial fibrillary acidic protein
diffuse across the membrane produce an (GFAP) A protein that assembles into a
electric field that influences the migration cytoplasmic network of intermediate fi la-
of charged molecules. ments found only in glial cells.

Gibbs free energy The energy that globin A group of proteins that form
is either released, or used by, a chemi- the subunits of the oxygen-carrying mol-
cal reaction. The free energy absorbed or ecules hemaglobin and myoglobin. A
released during a reaction (G) is the dif- mutation in the globin genes is respon-
ference between the energy of the prod- sible for the oxygen-transporting defect
ucts and the energy of the reactants (G seen in sickle cell anemia.
=Gr-Gf ) and is given by:
G = HtS Globotriaosylceramide A glycolipid
where: molecule that accumulates in patients with
H is the energy released (or used) in Fabrys disease, which is caused by a defi-
chemical bond breakage (or formation) ciency of the enzyme -galactosidase A.
during the chemical reaction.
S is a measure of the change in entropy globular actin (G-actin) The basic
(disorder) of the molecules involved in the monomeric subunit that polymerizes to
reaction. form the characteristic actin fi laments in
t is the temperature at which the reac- muscle. G-actin is a single polypeptide of
tion occurs. 375 amino acids.

For a bimolecular reaction, A + B --> C + D glucagon A small (29 amino acids)


G = G + RT ln([C]c[D]d /[A]a[B]b) polypeptide hormone that stimulates the
where G is the standard free energy breakdown of glycogen into glucose pri-
for the reaction under standard biologi- marily in the liver.
cal conditions. See standard trans-
formed constants. glucoamylase An enzyme, found largely
in saliva but also in the juices of the lower
Gilbert, Walter (b. 1932) Walter digestive tract, that catalyzes the break-
Gilbert became famous as a coinventor down of complex sugars, for example,
of the Maxam-Gilbert technique of DNA starch, by cleaving the bonds between
sequencing and for his research on the two adjacent glucose subunits.
intron-exon structure of eukaryotic genes.
He shared the Nobel Prize in chemistry in glucocorticoid One of the three classes
1980 with Paul Berg. of steroid hormones produced by the outer

107
www.stemcell8.cn
glucogenesis

layer (the cortex) of the adrenal gland. The gen peroxide produced in the reaction can
glucocorticoids cortisone, corticosterone, be used to oxidize certain aromatic com-
and cortisol regulate the metabolism of pounds that form colored products.
glucose. They also act as anti-inflamma-
tory agents and are used to limit inflam- glutamic acid An amino acid whose
mation in certain chronic inflammatory side chain is:
conditions such as arthritis. CH 2 CH 2 COOH
The COOH group gives glutamic acid its
glucogenesis (gluconeogenesis) The acidic nature.
process of creating glucose from its own
metabolites. This pathway is active under glutamine An amino acid whose side
conditions where the rate of metabolism chain is:
of glucose is reduced. CH 2 CH 2 C=O
\
glucose A six-carbon sugar that is the NH 2
major source of energy for most of the Glutamine plays an important role as
animal kingdom. Energy is generated an intermediate in the transfer of amino
through the oxidation of glucose to yield groups in the biosynthesis and degrada-
carbon dioxide and water. See tricar- tion of a number of other amino acids.
boxylic acid cycle.
glutamine-rich domains A region(s)
glucose effect The blockage of the found in certain types of eukaryotic
induction of the lac operon genes by the transcription factors. Glutamine-rich
presence of glucose. domains are involved in interaction with
other transcription factors with which
Glucose Galactose Malabsorption they act in a synergistic manner to upreg-
(GGM) A rare autosomal recessive dis- ulate transcription; in human cells the
order resulting from a defect in the SGLT1 glutamine-rich domains interact with
gene that codes for a transporter for the acidic type transcriptional activators
sugars glucose and galactose. The condi- bound at a separate site. Sp1 and Oct1
tion is characterized by severe diarrhea are examples of transcription factors
and dehydration in neonates and can be that contain glutamine-rich domains. A
fatal unless a sugar-free diet is maintained. glutamine-rich domain in the transcrip-
In GGM most mutations are found to pro- tion factor Sp1 makes contact with the
duce nonfunctional truncated SGLT1 pro- dTAFII110 factor in the Drosophila
teins or in misplacement of the transporter TFIID complex to bring about transcrip-
so that glucose and galactose cannot be tional activation.
removed from the intestinal lumen. The
sugars osmotically remove water from the glutathione A molecule made up of
body tissue into the intestinal space, which three amino acids linked end-to-end (a tri-
causes the diarrhea. peptide: glutamate-cysteine-glycine) that
acts as a reducing agent. Glutathione plays
glucose isomerase The enzyme that a role in determining the proper folding
catalyzes the conversion of glucose into of newly synthesized proteins through the
the structural isomer fructose. cross-linking of cysteine residues.

glucose oxidase An enzyme derived GLUT transporters A group of trans-


from certain molds that catalyzes the con- porters (GLUT1, GLUT2, GLUT3,
version of glucose into gluconic acid with GLUT4, and GLUT5) which function to
the formation of hydrogen peroxide. Glu- transport glucose and other hexoses such
cose oxidase is widely used for the deter- as galactose and fructose into the cell. The
mination of glucose in the urine in the GLUT transporters allow sugars to diffuse
diagnosis of diabetes because the hydro- passively, down a concentration gradient,

108
www.stemcell8.cn
glycosidic linkage

into cells. They are large integral mem- cyclin D by phosphorylation. Inhibitors
brane proteins in which a transport chan- of GSK3 are being investigated as thera-
nel is formed from 12 membrane-spanning peutic agents for the control of diabetes
regions. The appearance of GLUT trans- and to limit the degree of neurological
porters on the cell surface is induced by damage in stroke patients.
insulin in liver cells.
glycolipid A sugar or polysaccharide
glycerides (mono-, di-, tri-) A class covalently attached to a lipid. Glycolip-
of lipids in which one or more fatty acids ids are important components of animal
is covalently attached to a glycerol mol- cell membranes. Cerebrosides and gan-
ecule. Glycerides are divided into mono- gliosides that are derivatives of the lipid
glycerides (one fatty acid molecule), di- sphingosine, are important components
glycerides (two fatty acid molecules), and of glycolipids in membrane receptors in
triglycerides (three fatty acids). Glycerides the brain.
are important as storage vehicles of fat.
glycopeptide A polypeptide covalently
glycerol The simplest carbohydrate linked to a sugar or polysaccharide. Gly-
containing three carbon atoms with the copeptides are divided into two classes,
structure: depending on whether the sugar(s) are
H 2CCHCH 2 linked to the polypeptide by an oxygen
| | | atom (O-linked) or a nitrogen atom (N-
HO OH OH linked). See peptidoglycan.
Because of its ability to absorb water, glyc-
erol is used commercially as a moisturizer.
glycophorin A transmembrane glyco-
protein (see transmembrane proteins
glycine The simplest amino acid whose
and glycoproteins) found in erythro-
side chain consists only of a hydrogen atom.
cyte membranes. The critical function
that glycophorin serves is unknown, but
glycocalyx The cell coat; an outer it is believed that charged residues on the
coating, rich in carbohydrates on the sur-
extracellular domain of the protein may
face of most eukaryotic cells. The glyco-
help to prevent blood cells from sticking
calyx also contains some glycolipids and
to one another. Glycophorin has been
proteoglycans that may form part of the
shown to be a site of attachment for the
extracellular matrix (ECM).
influenza virus and the malarial parasite,
Plasmodium falciparum.
glycogen A complex storage polysac-
charide consisting of branching chains
of glucose molecules. Glycogen is the pri-
glycoprotein Proteins linked to sugars
mary source of glucose that is produced and/or polysaccharides that are prevalent
mostly from glycogen breakdown in the on the outside surfaces of cell membranes.
liver under conditions where the amount Glycoproteins are components of special-
of free glucose is insufficient for the ized receptor molecules and the extracel-
bodys needs. lular matrix (ECM) in eukaryotic cells.

glycogen synthase kinase 3 (GSK3) glycosaminoglycans See GAG.


A serine/threonine protein kinase that
activates the enzyme glycogen synthase glycoside A compound formed between
by phosphorylation. The isoform a sugar and some other type of molecule,
of GSK3 (GSK-3; one of the two iso- for example, a protein, lipid, or other
forms) is also known as Factor A, which organic molecule.
activates the phosphatase PP-1. GSK-3
is also a component of the Wnt signal- glycosidic linkage (bond) A cova-
ing pathway, where it regulates levels of lent bond between the anomeric carbon

109
www.stemcell8.cn
glycosylation

of a sugar and another molecule, usually Golgi apparatus (Golgi body) In


another sugar, protein, or lipid. eukaryotic cells, a series of membrane-
bound vesicles arranged in a stack in
glycosylation The process of adding which the polysaccharides of glycosylated
polysaccharides to polypeptides that are polypeptides are progressively altered or
destined to become glycoproteins. Glyco- processed prior to their being sorted or
sylation takes place primarily in the inte- transported to the cell surface.
rior of the endoplasmic reticulum (ER)
during the synthesis of the polypeptide gonadotropic hormones (gonado-
that is to be glycosylated. tropins) A group of polypeptide hor-
mones made by the pituitary gland that
glyoxylate cycle A pathway used by stimulate accessory cells surrounding the
plants and bacteria for obtaining energy oocyte to release progesterone, which in
from acetate and other two carbon com- turn causes the oocyte to mature. In ani-
pounds that are metabolized into acetate mals, gonadotropins begin to appear at
or acetyl groups. The glyoxylate cycle is the age of sexual maturity.
analogous to the Krebs cycle with many
of the same intermediate steps. gonadatropin The collective name for
follicle-stimulating hormone (FSH) and
glyoxysome An organelle in plants where lutinizing hormone (LH); small polypep-
the glyoxylate cycle, a biochemical pathway tide hormones that are made in the ante-
used to convert fats to sugar, is located. rior portion of the pituitary gland (ade-

rough endoplasmic reticulum

Golgi apparatus (Golgi body)

110
www.stemcell8.cn
GRB2

nohypophysis) and act to stimulate the rial cells are fi rst stained with crystal vio-
reproductive organs in various ways. let and iodine and then decolorized with
alcohol. Cells that retain the purple color
gp120 A glycoprotein found on the of the crystal violet after the alcohol treat-
surface of the HIV virus. During viral ment have thick cell walls and are Gram-
infection, the attachment of gp120 to positive. Cells that lose the crystal violet
CD4, a receptor on the surface of the tar- after decolorization but then take up a
get lymphocyte, is a primary event. For pink counterstain, safranin, have thinner
this reason, antibodies created against cell walls with an abundance of lipid in
gp120 epitopes are a major focus in the the cell envelope. These cells are called
development of virus-neutralizing anti- Gram-negative. The Gram-positive Gram-
bodies and anti-AIDS vaccines. negative classification system is particu-
larly useful because, not only does it help
GPR14 G proteincoupled receptor 14; to identify bacteria, but in a wide variety
the membrane receptor for the neuropep- of bacteria the Gram stain shows a corre-
tide hormone urotensin II, which regulates lation with sensitivity to antibiotics.
cardiovascular function and is hypoten-
sive in mammals. GPR14 is predominantly grana Stacks of thylakoid disks inside
expressed in the heart and pancreas and the chloroplast.
in low levels in portions of the brain. The
gene map locus of human GPR14 gene is granulocyte macrophage-colony stim-
17q25.3. ulating factor (GM-CSF) A recombi-
nant protein produced in large scale and
G protein(s) A class of cell membrane- used as an adjunct to cancer chemother-
bound proteins that bind GTP and/or apy since 1991. It stimulates the produc-
GDP and act to alter certain metabolic tion of granulocytes to boost the immu-
pathways or gene expression when a spe- nity of patients taking chemotherapy.
cific ligand binds to a receptor on the out-
side of the cell. granulocytes A class of leucocytes
composed of neutrophils, eosinophils,
graft v. host reaction A deleterious and basophils. Granulocytes are active in
immune reaction in which lymphocytes allergic immune reactions such as allergic
present in grafted tissue attacks the tis- skin lesions and arthritic infl ammation.
sues of the host.
gratuitous inducer A molecule that,
gram A universally adopted measure of because it structurally resembles a cer-
mass in the scientific world. A gram is tain inducer of transcription, can act to
defi ned as one thousandth of the mass of induce transcription in lieu of the authen-
one liter of pure water at a temperature tic inducer, for example, IPTG in lieu of
where its density is greatest, that is, just lactose as a gratuitous inducer of the lac
above the freezing point (0 C). operon.

gramicidins A class of polypeptide gray matter That portion of the neural


antibiotics isolated from Bacillus brevis. tissue of the spinal cord that is composed
Gramicidins act as ionophores in which of the nerve cell bodies in contrast to the
ions are carried across the bacterial cell white matter, which is made up of the
wall in the interior of the circular mol- nerve-cell axons and dendrites. In cross-
ecule. section, the gray matter is seen as a but-
terfly shaped structure that runs through
Gram stain A method for differentially the interior of the spinal cord.
staining bacteria developed by Christian
Gram in 1884. Staining depends on the GRB2 An intermediate in the RTK-ras
cell-wall properties of the bacteria. Bacte- signal transduction pathway. The

111
www.stemcell8.cn
Griffith, Frederick

GRB2 is an adaptor protein that binds the TRK phosphotyrosines via an SH2 domain and the
Sos protein via an SH3 domain. Sos then induces exchange of ras-bound GDP for GTP, thereby
activating the ras-GTP complex that binds to the N-terminal end of cytosolic raf, a protein whose
C-terminal end has serine/threonine kinase activity. GAP is a negative regulator of ras that acts
to increase the rate of hydrolysis of ras-bound GTP to GDP.

SH2 domain GRB2 binds to the phos- entering the cell are trapped in the cyto-
phorylated cytoplasmic domain of an sol where they accumulate.
RTK; the GRB2 SH3 domain simultane-
ously binds to a protein called Sos that, growth curve A graph in which the
in turn, stimulates GDP bound to ras on number of individuals in some population
the inner surface of the cell membrane to of organisms, for example, cells in culture,
be exchanged for GTP. animals in a herd, fish in a pond, and so
on, is plotted as a function of time.
Griffith, Frederick (18811941) A
bacteriologist who demonstrated that heat- growth factors A group of small,
killed, pathogenic pneumococcus bacteria secreted polypeptides that bind to recep-
could transform live, nonpathogenic pneu- tors on certain specific target cells and
mococci into the pathogenic form when the stimulate cell division in those target
two were mixed together. This experiment cells. Growth factors have become the
gave rise to the work of Avery, MacCleod, focus of intensive research because of
and McCarty that showed the transform- their ability to influence the physiology
ing factor to be DNA. of growth and also because many of them
have been found to bear a close relation-
griseofulvin An antifungal agent pro- ship to oncogenes.
duced by Penicillium griseofulvum. Gris-
eofulvin appears to act by inhibiting the growth hormone A growth factor pro-
movement of chromosomes during mito- duced by the anterior lobe of the pituitary
sis by interfering with the spindle appa- gland that stimulates the growth of bone
ratus. and muscle during childhood. Growth
hormone was one of the fi rst bioactive
group translocation A type of active factors whose genes were cloned and
transport in bacteria in which compounds expressed in transgenic animals, thereby
that enter the cell by passive diffusion demonstrating the feasibility of curing
are immediately modified, for example, genetic disease by gene therapy.
by phosphorylation such that they can-
not passively diffuse back across the growth media A synthetic solution of
cell membrane. In this way, compounds nutrients to support the growth of cells or

112
www.stemcell8.cn
guanosine, 7-methyl

stationary by acting on the agent after it has been


phase bound to glutathione via the sulfur (S)
atom attached to the cysteine residue in
Number glutathione.
of cells log phase
or (exponential phase)
organisms
GT-AG rule The observation that
intron sequences in DNA always begin
lag
phase with GT as the fi rst two nucleotides
and always end with AG as the last two
Time
nucleotides. The GT-AG rule plays a role
Growth phase in the mechanism of RNA splicing by
which messenger RNA (mRNA) is cre-
ated from heterogeneous nuclear RNA
microorganisms in culture. See defi ned
(hnRNA).
medium and minimal medium.

growth phases The different stages of GTP-binding protein (G protein) A


growth of a culture of microorganisms membrane-bound protein that acts
(usually applied to cultures of bacteria) as an intermediate between the bind-
as reflected in the shape of the growth ing of a stimulatory molecule, such as
curve. There are three growth phases: a hormone to a receptor on the out-
(1) a period of slow growth just after side of the cell, and the biochemical
the organisms are inoculated into fresh effect that ultimately takes place inside
growth medium (lag phase), (2) a period the cell. The mechanism by which G
during which the population doubles at a proteins transmit the signal (i.e., the
fi xed interval of time (exponential phase binding of the stimulatory molecule to
or log phase), and (3) an indefi nite period its receptor) from the outside of the cell
during which growth is slow or com- to the inside is not entirely understood
pletely stopped as the culture becomes but is known to involve the exchange
overcrowded and nutrients are displaced of a molecule of GDP for a molecule
(stationary phase). of GTP by the G protein as part of the
process.
growth rate The change in the num-
ber of organisms in a population divided guanine One of the four purine bases
by the length of the time interval over normally found in DNA and RNA. See
which the change in the population num- purine.
ber took place. For example, a culture of
cells in which there were 2,500 organ- guanine nucleotide exhange factor
isms on one day and 7,000 organisms (GEF) A protein factor required in the
three days later would be said to have peptide-elongation step in protein syn-
shown a growth rate of (7,0002,500)/3, thesis. Following the hydrolysis of GTP
or 1,500 organisms/day. bound to elongation factor Tu (EF-Tu),
GEF is involved in the regeneration of
Grunstein and Hogness method The the EF-Tu complex by mediating the
technique of hybridization of a DNA exchange of bound GDP for GTP.
probe to whole, lysed, bacterial colonies
that have been transferred by blotting guanosine A ribonucleoside consisting
onto a nitrocellulose fi lter or other hybrid- of guanine and the sugar, ribose.
ization membrane; colony hybridization.
guanosine, 7-methyl A derivative of
GST Glutathione S-transferase; a class the normal nucleoside, guanosine, that is
of enzymes that aid in the detoxifica- found in the cap of eukaryotic mRNAs.
tion of xenobiotics or toxic electrophiles See capped 5 ends.

113
www.stemcell8.cn
recto
guanosine monophosphate

Guanosine nucleosides

guanosine monophosphate (GMP) attached to the fi fth carbon atom of the


The ribonucleotide containing guanine; a ribose sugar. GTP, together with ATP,
derivative of guanosine formed by phos- CTP, and UTP, is a direct precursor of
phorylation of fifth carbon of the ribose. RNA and a high-energy compound that
provides energy that drives other bio-
guanosine triphosphate (GTP) Gua- chemical reactions.
nosine with three phosphate groups

114
www.stemcell8.cn

H
A

H-2 histocompatibility The match of but in which the tissue structure is poorly
tissue proteins that, in the mouse, deter- organized. These lesions are believed to
mines whether a tissue graft will or will represent developmental abnormalities
not be rejected by the immune system of rather than true neoplasms.
the host. H-2 compatibility is determined
by a large gene complex that codes for haploid The state of a cell having only
cell surface glycoproteins. See major one set of alleles as opposed to the diploid
histocompatibility complex. state in which a cell normally contains
two copies of each allele.
habituation The tendency of some neu-
rons to require longer than normal refrac- haploid number Having one-half the
tory phases or stimulation by stronger-than- number of chromosomes as are normally
normal nerve impulses to trigger an action present in a diploid cell, thus being in the
potential if action potentials have been trig- haploid state, for example, in gametes.
gered in that neuron in the recent past.
haploinsufficiency One copy of a gene
hairpin loop The folding back of a is not sufficient to assure normal function.
nucleic acid strand on itself. Hairpins are
created by internal base pairing between
haplotype A particular set of markers,
purine and pyrimidine bases along two
for example, RFLPs or alleles, in a cer-
separate segments of the nucleic acid. See
tain region of a chromosome. The term
looped domains.
was originally applied only to clusters
of alleles in the major histocompatibility
half-register In repeated sequences
complex (MHC) but is now applied to
in which the repeat unit can be divided
any specified genetic locus.
into two halves, half-register refers to a
misalignment of the two chromosomal
copies such that the fi rst half of a repeat HA protein Hemagglutinin protein; a
unit is aligned with the second half of the glycoprotein found on the surface of the
other chromosomal copy. For example, influenza virus that binds to sialic acid
if the two halves of the repeat units are residues on the cell membranes of cells
designated X and Y, then the repetitive that are infected by the virus; this bind-
portion could be represented by ing initiates the process of infection. In
...XYXYXYXYXYXYXYX... a subsequent step, the HA protein medi-
and in half register: ates fusion between the viral membrane
...XYXYXYXYXYXYXYX... and the membrane of an endosome that
...XYXYXYXYXYXYXY... encapsulates the virus. This observa-
tion has led researchers to utilize the HA
halophile A type of bacteria requiring protein as a tool to study the process of
sodium chloride (NaC1) as an essential membrane fusion.
nutrient.
hapten A small molecule that can act
hamartoma A mass comprised of the as an immunogen only when combined
normal organ tissues in which it is found with a larger molecule.

115
www.stemcell8.cn
recto
Hardy-Weinberg law

Hardy-Weinberg law A mathematical tion formulas are largely used to represent


formulation describing how two differ- the furanose and pyranose rings of sugars
ent alleles are distributed among the indi- to show the three-dimensional differences
viduals in a population. For two allelic between structural, conformational, and
forms of a certain gene, D and d, assum- optical isomers.
ing that (1) mating between individuals
is random, and, (2) if the frequency of a HB101 A substrain of the bacterium,
certain allele, D, in the population is p, Escherichia coli, that is widely used as a
and the frequency of the d allele form is host in which to grow recombinant vec-
q, then tors because of its high efficiency of DNA
uptake and transformation.
1. The fraction of individuals homozy-
gous for D (DD) will always be given HCG Human chorionic gonadotro-
by p2; pin; an ovary-stimulating hormone pro-
duced in the placenta after the embryo
2. The fraction of individuals heterozy- implants into the wall of the uterus. HCG
gous for D (Dd) will always be given is referred to as the pregnancy hormone
by 2pq; and because antibodies to HCG are used to
3. The fraction of individuals homozy- diagnose pregnancy.
gous for d (dd) will always be given
by q2 . HDAC Histone deacetylase(s); a group
of 11 enzymes (isoforms) that catalyze
harvesting Collection of cells, organ- acetylation/deacetylation of histones that
isms, or growth medium from an experi- are complexed with DNA in chromatin.
mental population, generally for purposes Since aetylation of histones represses tran-
of analysis or extraction of biochemicals. scription, HDACs are considered to have a
transcriptional repressor function. Because
HAT medium A type of cell-culture some of the genes whose expression is
growth medium containing hypoxan- repressed by HDACs are tumor suppres-
thine, aminopterin, and thymine used for sors, inhibitors of HDACs are being tested
negative selection (i.e., HAT selection) of as anticancer agents.
certain kinds of mutant cells that cannot
utilize hypoxanthine and/or thymine to H DNA An unusual structure found
make nucleic acids. in DNA segments with long stretches of
polypyrimidines or polypurines in which
HAT selection The procedure for there is also a palindromic repeat. In these
selecting cells in HAT medium. The pro- regions DNA can fold back upon itself to
cedure is based on the principle that only form a hairpin in which three of the DNA
those cells that can utilize hypoxanthine strands are base paired with one another
and thymine supplied from outside the to form a triple helix while the fourth
cell to make their nucleic acids will sur- strand remains unpaired. The formation
vive in the presence of the drug aminop- of H DNA structures is believed to play a
terin or other folate antagonists, which role in the control of gene expression.
prevents cells from synthesizing their own
purine and pyrimidine nucleotides. heat-shock genes A set of genes found
throughout the animal kingdom that are
Haworth projection formula A type of suddenly and rapidly transcribed in a
representation of organic ring compounds coordinated fashion when cells are sub-
that shows some of the characteristics of jected to certain kinds of stress, such as
the three-dimensional structure, particu- a sudden rise in temperature. Many of
larly the spatial arrangement of the substit- these heat-shock genes encode chaperons,
uent groups along the ring with respect to proteins that aid in the folding or unfold-
one another and the ring. Haworth projec- ing of proteins.

116
www.stemcell8.cn
helix-loop-helix
verso

triple helical

TAGCAGGCTTCTCTCTCTCTCTCT C
ATCGTCCGAAGAGAGAGAGAGAGA GT
C
G TCTCTCTCTCTCTCT A
G
G
TG T
C C AGAGAGAGAGAGAGA
AC AC
T
G
TA GT
AT
C
G
TT GC
C
AA

G
C

H DNA

heat-shock proteins (HSPs) A large of a transcriptional enhancer protein to


group of proteins that are rapidly induced this sequence is the fi rst event in the acti-
in response to various forms of stress vation of the heat-shock genes.
such as exposure of cells to changes in
temperature, sudden lack of availabil- heavy chain (immunoglobulin heavy
ity of nutrients, oxygen deprivation, chain) The longer of the two peptide
etc. The heat-shock proteins are also chains that make up an antibody mol-
present under normal conditions, where ecule, for example, IgG.
they function as molecular chaperones
that aid in correct protein folding and in HeLa cell A line of tissue culture cells
shuttling proteins between intracellular derived from a cervical cancer by Gey,
compartments and to destinations out-
Coffman, and Kubicek in February 1951.
side the cell. HSPs are usually designated
The cell-line designation is derived from
according to their molecular weightfor
the name of the tumor donor and was the
example, HSP70 or HSP40 (70 and 40
first epitheliallike cell derived from human
kilodaltons)but may have unsystem-
tissue to be placed into tissue culture.
atic names such as GrpE and DnaJ. HSPs
are believed to play a role in eliciting the
immune response by presenting frag- helicase An enzyme(s) that catalyzes
ments of proteins (peptides) onto the cell the unwinding of the DNA helix during
surface to help the immune system recog- DNA replication at a point just ahead of
nize diseased cells. the replication fork.

heat-shock response element (HSE) helix-loop-helix A structural motif


A certain nucleotide sequence in the consisting of two helices separated by an
promoter of the heat-shock genes oligopeptide loop found on many eukary-
(CNNGAANNTCCNNG). The binding otic regulatory proteins. DNA binding is

117
www.stemcell8.cn
recto
helix-turn-helix

effected by a short stretch of basic amino hemagglutinin/neuraminidase pro-


acids just adjacent to the helix-loop-helix tein (HN protein) A protein derived
motif. from the coat of the paramyxovirus, Sen-
dai virus, that binds strongly to the cell
helix-turn-helix A structural motif con- membranes of many types of animal cells.
sisting of two short (seven to nine amino For this reason, the HN protein is used
acids) helices separated by a turn found to create liposomes that are intended to
on many prokaryotic DNA-binding regu- deliver agents (e.g., therapeutic agents) to
latory proteins. One of the helices, called various animal cells (fusogenic vesicles).
the recognition helix, interacts with DNA
along the major groove. One example of a heme An organic, iron-containing,
regulatory helix-turn-helix protein is the ring-shaped molecule that is the oxygen-
cro protein of lambda bacteriophage. binding group in hemaglobin.

helper T cell A specialized type of T hemicellulose The name given to a


cell whose function is to stimulate other mixture of long polysaccharides with a
T lymphocytes (for example, cytotoxic T celluloselike structure that, together with
cells) that then go on to carry out vari- pectin, forms an amorphous matrix in
ous immune functions. Helper T cells which the cellulose fibrils of the plant cell
are stimulated to divide after they are wall are embedded.
exposed to a foreign MHC antigen that is
presented to it by specialized antigen pro- hemidesmosome Literally meaning half-
cessing cells; the stimulatory activity of T desmosome, a hemidesmosome is spe-
helper cells is mediated by interleukins. cialized membrane-junctional complex
in the epithelial cell membrane that
helper virus A virus that provides structurally resembles a desmosome but,
a critical function to a defective virus unlike a desmosome, is present at the site
when they both simultaneously infect where an epithelial makes contact with
the same cell. The oncogene-carrying the basal lamina.
retroviruses are examples of replica-
tion-defective viruses that can grow only hemizygous The cellular state of hav-
when coinfected with the normal wild- ing one copy of a gene in a genome that
type counterpart that does not carry an is normally diploid for all genes. The
oncogene. term always refers to a particular gene or
group of genes; for example, a cell is said
hemagglutinin Any substance that can to be hemizygous for gene x.
cause red blood cells (RBCs) to agglu-
tinate by binding to certain sites on the hemoglobin The large blood-borne
RBC membrane. Because the clumping molecule that carries oxygen and car-
(agglutination) of RBCs is easily seen even bon dioxide between the lung and tissue.
in the presence of small amounts of hem- Hemoglobin consists of a heme group
agglutinin, hemagglutination has been and four polypeptide chains; two alpha-
widely used as an assay for the presence globin chains and two beta-globin chains.
of certain hemagglutinating viruses or
other antigens. hemolymph The fluid found in the
body cavity of insects that serves the
hemagglutination-inhibition assay An same gas-exchange functions as blood.
assay for the presence of a hemagglutinat-
ing virus or other antigen by observing the hemolysins A group of bacterial tox-
loss of the ability of a test sample to agglu- ins that cause hemolysis by attacking red
tinate red blood cells after being treated blood cell membranes.
with an antibody against the agglutinin
whose presence is suspected. hemolysis The lysis of red blood cells.

118
www.stemcell8.cn
Herpes
verso

hemolytic plaque assay An assay ious drugs, toxic agents, and autoimmune
based on the localized hemolysis of red reaction.
blood cells (RBCs) that appears as a
plaque when the RBCs are spread out in a hepatitis virus The viral agent, a small
layer of agar. The hemolytic plaque assay DNA virus, that causes the infectious
is used to demonstrate the secretion of form of hepatitis that infects a large frac-
specific antibodies by antibody-produc- tion of the individuals in certain areas of
ing cells that are mixed together with the the world. Hepatitis viruses fall into three
RBCs. subclasses, termed simply A, B, and C.

hemophilia A genetic disease based on heptad repeat A tandemly repeated


the inability of the affl icted individual to segment of seven amino acids in certain
make a critical component (factor VIII) proteins. The heptad repeat is a promi-
of the blood-clotting system. As a result, nent feature of intermediate fi lament pro-
even minor cuts or bruises may result in teins that are found in virtually all inter-
dangerous, uncontrolled internal hemor- mediate fi lament proteins throughout the
rhage or bleeding. animal kingdom.

hemopoiesis The generation of red herbicide A chemical agent that is toxic


to plants.
blood cells by cell division of certain stem
cells in the bone marrow.
Herceptin A monoclonal antibody
directed against the HER2 receptor pres-
Henderson-Hasselbalch equation A ent on some tumors. Herceptin is active
mathematical formulation that governs
in inhibiting the growth of breast tumors
the pH of a given buffer solution. If pK is that express HER2 by blocking access of
the negative logarithm of the equilibrium growth factors to the receptor. Herceptin
constant (Kd) for the ionization of the is only active against tumors that express
acid form of the compound that is used to high levels of HER2 (ca. 20 percent of all
buffer the solution for the reaction breast cancer patients) and whose growth
HA H +A
+
is therefore dependent on growth factors.
and
[HA] and [A] are the molar concentra- hereditary disease See genetic dis-
tions of the unionized and ionized forms ease.
of the buffer respectively,
then heredity The study of how physical
pH = pK + log ([A ]/[HA]). traits are transmitted from parent to
offspring: the study of inheritance. See
heparin A sulfated glycosaminoglycan Mendels law.
that is used medically to block blood clot-
ting. The anticoagulant activity of hepa- heregulin A protein that stimulates the
rin is based partly on the strong binding growth of breast cancer cells by binding
of the heparin molecule to antiprothrom- to, and activating, the HER2 and HER4
bin III, a blood protein that plays a criti- receptors that are present on the surface
cal role in the blood-clotting pathway. of the cancer cells. In the more advanced
stages of breast cancer, the HER recep-
hepatitis An inflammatory disease of tors are often overproduced and may
the liver characterized by severe, chronic therefore be more responsive to the
jaundice caused by accumulation of liver growth-promoting effects of heregulin.
by-products and general malaise. Most For this reason, heregulin is a target of
cases of acute hepatitis are due to viral therapeutic strategies employed in late-
infections that currently fall into six main stage breast cancer.
types: hepatitis A, B, C, D (but only with
B-type virus present), E, and G. Other Herpes A family of large DNA viruses
causes of hepatitis are alcohol abuse, var- that infect humans and produce both

119
www.stemcell8.cn
recto simplex virus
Herpes

acute infections such as chicken pox and cessed RNAs in the nucleus. The name
infections that result from persistent, derives from the great heterogeneity
latent infections, for example, shingles in size and type of RNA present in the
that results from the same virus, that is, nucleus before the RNAs are processed
Herpes zoster. The members of the her- and transported to the cytoplasm.
pes family of viruses are Herpes simplex,
Herpesvirus simiae, Varicella zoster, cyto- heterokaryon A multinucleated hybrid
megalovirus, and Epstein-Barr virus. cell created either from the fusion between
two or more cells or by cell division with-
Herpes simplex virus (HSV) A mem- out cytokinesis.
ber of the herpes family of viruses that
has been implicated as the causative agent heterolactic fermentation Heterofer-
in some cervical cancers. mentation.

Hershey-Chase experiment A classic heterologous gene expression The


experiment, conducted by Martha Hershey synthesis of foreign proteins in a host
and Alfred Chase in 1952, that demon- organism when that organism has been
strated that DNA was the hereditary mate- transformed with a vector carrying genes
rial. In their experiment, bacteriophages from a different organism. This can be a
containing 32P-DNA and 35S-protein were problem if DNA technology is to be used to
allowed to attach to host bacteria. When, produce proteins in bacterial hosts because
after several minutes, the attached bacte- some heterologous proteins are broken
riophages were stripped from the bacte- down by bacterial proteases, or are depos-
ria by strong mechanical agitation, it was ited into insoluble inclusion bodies, and/or
found that the 32P label and not the 35S do not fold properly. In addition, bacteria
cannot add sugar residues to those proteins
label had entered the host cells.
requiring glycosylation after synthesis.
heterochromatin A very condensed
heterotroph An organism, for example,
form of chromatin, seen in the nucleus
an auxotrophic mutant, that is defective
during interphase, that was found to be a
in the ability to synthesize essential com-
transcriptionally inactive form.
plex organic molecules. A heterotroph
therefore requires supplementation of the
heteroduplex Base pairing between growth medium, diet, and so on, with
nucleic acid strands from different either the essential compounds or certain
sources, for example, RNA and DNA or precursors that it can use to make them.
DNA from two different species.
heterozygote An individual who is het-
heteroduplex mapping A technique for erozygous for a particular gene.
the determination of the location of a par-
ticular sequence of nucleotide bases along heterozygous The state of containing
a segment of a nucleic acid by creating a two different alleles of a particular gene.
heteroduplex between the nucleic acid to be For example, a cell or an individual is
mapped and a reference nucleic acid strand. said to be heterozygous for the trait that
causes sickle cell anemia if both the nor-
heterofermentation (heterolactic fer- mal and the abnormal copies of the glo-
mentation) A type of fermentation bin gene is present.
characteristic of enteric bacteria (Enter-
bacteriaceae) in which only part of the hexose Any six-carbon sugar.
fermentation product is lactic acid; the
other part is formate and acetyl CoA. HGPRT Hypoxanthine-guanine phos-
phoribosyl transferase; an enzyme that
heterogeneous nuclear RNA (hnRNA) catalyzes a major step in the formation of
The general name given to all the unpro- ATP and GTP from guanine. This path-

120
www.stemcell8.cn
Hognessverso
box

way is the only means by which guanine histamine A substance stored in the
or other purine analogs can enter into granules of mast cells that is released dur-
nucleic acids. Thus, as is true for thymi- ing allergic response. Histamine release
dine kinase in the pyrimidine pathway, causes smooth muscle contraction, secre-
manipulation of this enzymatic step pro- tory activity in mucous epithelium, and
vides an important experimental tool for other symptoms of allergic reaction.
studying gene action by the incorporation
of modified bases into DNA. histidine An amino acid whose side
chain is
HGPRT marker A term that refers CH 2 C=CH
to the use of the gene that codes for the | |
HGPRT enzyme as a selectable marker. HN NH
Cells containing mutant HGPRT genes \ |
are resistant to purine derivatives that are CH
toxic because they become incorporated
into DNA via the HGPRT dependent histocompatability The state of simi-
pathway. See HGPRT. larity or dissimilarity between the pro-
teins of a grafted tissue and proteins of
high-frequency recombination strain the host on which the tissue is grafted.
Certain strains of donor-type bacte- The degree of histocompatibility is the
ria in which the bacterial genomes are major factor in determining whether a
observed to undergo much higher rates host will accept or reject a tissue graft.
of gene transfer and recombination
than other bacteria in the same culture.
histones A group of proteins that are
The high frequency of recombination is
tightly associated with DNA to form struc-
based on the presence of an F factor
tures known as nucleosomes. The histones
that has integrated into the genome,
fall into five subgroups: H2a, H2b, H3,
which allows mating to occur between
H4, and H1. They appear to play a role in
neighboring bacteria. See conjuga-
regulating the expression of genes.
tion, bacterial.

highly repetitive DNA A fraction of HIV See human immunodeficiency


virus.
the genomic DNA in eukarkyotic cells
that consists of short sequences that are
repeated thousands of times throughout HLA antigens The proteins of the
the genome and that has been found to be major histocompatibility locus in the hu-
equivalent to satellite DNA. man; an acronym for human leukocyte-
associated antigens.
high-mobility group protein A het-
erogeneous group of proteins of unknown hnRNA See heterogeneous nuclear
function that are part of the chromatin RNA.
but are not histones.
Hodgkins disease A type of cancer of
Hill reactions The light-energy har- the tissue of the lymphatic system, includ-
vesting reactions in photosynthesis in ing the lymph nodes, spleen, tonsils, and
which light energy is stored in the form of thymus gland. The disease is character-
high-energy electrons. The Hill reactions ized by fever, lymph node enlargement,
were discovered by Robert Hill in 1939. and weight loss.

Hind III A restriction enzyme whose Hogness box A sequence of TATAAA


recognition sequence is that defi nes the part of the promoter
5 AAGCTT 3 region where RNA polymerase will bind
3 TTCGAA 5 in eukaryotic organisms. It is located

121
www.stemcell8.cn
recto
Holliday junction

term is used to describe a group of bio-


adjacent chemical reactions that act together as a
double-
stranded system of checks and balances to prevent
DNAs overreaction on the part of any reaction.

cross-strand exchange homeotic genes A cluster of genes that


branch migration determines limb and appendage develop-
ment in the fruit fly, Drosophila melanogas-
ter. The homeotic genes have been defined
in terms of mutations at certain genetic loci
that may cause one type of appendage to
develop in place of another, for example,
an insect leg in place of an antenna. See
segments, segmentation.
Holliday junction
homeotic selector genes The genes of
the bithorax and the antennapedia com-
plexes taken together.

homofermentation (homolactic fer-


mentation) The type of fermentation
characteristic of lactic bacteria in which
Holliday junction sugar is oxidized by the fermentation
pathway to a single product: lactate.
about 30 bp upstream from the start of homogenate A crude slurry resulting
transcription. See TATA box. from the disruption of cell/tissue struc-
ture by mechanical means, for example,
Holliday junction The linkage of two
by grinding.
homologous double-stranded DNAs by
ligation of the broken end of one strand
with the broken end of the correspond-
homogeneously staining region (HSR)
ing strand on the homologous DNA. The A region of a chromosome that contains
Holliday junction is considered to be the multiple copies of a particular gene and
essential intermediate in the process of that can be identified as a segment that
recombination. stains homogeneously (as opposed to
showing a number of bands as is normally
holoenzyme The complete and func- true) with certain stains used to visualize
tional form of an enzyme; the polypeptide chromosomes under the microscope. The
portion of enzyme plus any other factors amplification of the dihydrofolate reduc-
necessary for normal enzymatic activity, tase gene (DHFR) in cells exposed to the
for example, coenzymes and cofactors. anticancer agent, methotrexate, is seen as
a homogeneously staining region of giant
homeobox Those DNA sequences that chromosomes.
are found in homeotic genes of the fruit
fly, Drosophila melanogaster, that are homolactic fermentation Homofer-
also found in amphibians and mammals. mentation.
The homeobox sequences are expressed
in early development and appear to play a homologous chromosomes Two chro-
role in limb/appendage development simi- mosomes, generally one from each par-
lar to the role of the homeotic genes. ent, that are identical in terms of the
genes they carry but which differ from
homeostasis The state of being in bal- each other in terms of the alleles of the
ance. As applied to biological systems, the genes they carry.

122
www.stemcell8.cn
host restriction-modification
verso

homologous recombination Recom- example, FSH, LH, or the steroid hor-


bination between two DNAs at certain mones, estrogen and testosterone.
sites where the two DNAs show sequence
homology to one another. hormone response elements (HREs)
Nucleotide sequences to which nuclear
homology In general meaning, simi- steroid hormone receptors bind to regu-
lar but not necessarily identical to some- late expression of a particular target
thing. In molecular biology, the term gene. the HREs are usually located in
homology is generally taken to mean the 5 upstream regulatory region of a
sequence homology. target gene and generally consist of two
hexameric core sequences separated by
homopolymer In general meaning, a spacer sequence to form the complete
any polymeric molecule containing a sin- binding site designated by the symbol
gle type of monomer. In molecular biol- RXR. The R sequences can be either
ogy, the term refers to a short nucleic acid inverted or direct repeats, and the spacer
segment that consists of a single type of sequence (X) generally varies between
nucleotide, for example, oligo dT. one and five base pairs.

homopolymer tailing The technique horse-radish peroxidase (HRP) An


of attaching a nucleic acid homopolymer enzyme that causes the breakdown of
to the end(s) of a piece of DNA gener- peroxides by catalyzing the transfer of
ally as an intermediate step in cloning. hydrogen atoms to an oxygen atom on
Homopolymer tailing has been widely the peroxide. The activity of the enzyme
exploited as a means of cloning cDNAs has been exploited as a technique for
by attaching homopolymer tails to the
labeling proteins and nucleic acids col-
ends of the cDNA that can then be easily
orimetrically instead of by radiolabeling.
annealed to complementary homopoly-
For this purpose, the molecule is attached
mer tails attached to the ends of a vector
to an HRP molecule that is then visual-
molecule.
ized using a substrate (S) that attains a
color when it is oxidized by HRP:
homoserine The precursor molecule
peroxidase
from which, in plants and bacteria, the
H2O2 + SubstrateH2 -->2H2O + Substrateox
amino acids, methionine, threonine, and
(uncolored) (colored)
isoleucine, are made.

homozygous The state in which the host cell Any cell that is infected by
genome contains two copies of the same a virus is referred to as the host cell for
allele of a particular gene. Organisms are that virus.
said to be homozygous for a gene.
host range The group of all cell types
Hoogsteen base pairs An unusual that are susceptible to infection by a par-
type of base pairing that occurs in triple ticular virus.
helical DNAs, a type of structure that is
formed under special conditions. In the host restriction-modification Restric-
triple helix, one of the bases is hydrogen tion enzyme systems that have been devel-
bonded to another base from each of the oped by bacteria that inactivate the DNA
other two strands to form the unusual of infecting bacteriophages by cleav-
base pairs, such as: T=A-T or C=G-C. ing them with restriction enzymes pro-
duced by the bacterial host, while at the
hormone Any molecule that is made same time protecting the host DNA from
and secreted by a specific tissue and cleavage by the same restriction enzyme
that causes or induces a specific action through another system that modifies the
or behavior in another (target) tissue, for host DNA usually by methylation.

123
www.stemcell8.cn
recto
host-vector system

host-vector system A combination of humoral antibody Secreted antibody


host cell and virus vector to be used for produced by B cells circulating in the
cloning. For example, a particular strain blood. Humoral antibodies mediate the
of the bacterium E. coli and a particular immune response to soluble antigens as
strain of bacteriophage lambda (vector) opposed to graft rejection.
that grows especially well in the host cell.
huntingtin The protein encoded by
hotspot A genetic locus particularly the gene responsible for Huntingtons
prone to spontaneous alteration or muta- disease, a genetic neurodegenerative
tion. disease. In the version of the gene that
causes the disease, there are multiple
housekeeping genes A vernacular repeats of a CAG triplet that leads to
term to describe the genes necessary for the insertion of an additional string
basic cell functions required by and, of glutamine residues. Huntingtin is a
therefore, expressed in all cells. cytoplasmic protein, but its function is
unknown. The mutant huntingtin forms
HOX genes Homologous genes in aggregates in nuclear inclusions in neu-
mammals to certain homeotic genes in rons. The gene for huntingtin is at gene
Drosophila. map locus 4p16.3. See Huntingtons
disease.
HPFH Hereditary persistence of fetal
hemoglobin; a genetic state in which the Huntingtons disease A genetic degen-
normal adult and hemoglobin genes erative disease of the nervous system
are absent, and so the fetal hemoglobin caused by a dominant gene. Symptoms
genes continue to be expressed past the that appear in midlife include involuntary
time when they would normally be turned movements of the face and limbs, mood
off. swings, and forgetfulness. Disease symp-
toms progress until death within 20 years.
HPLC High-performance liqid chro-
matography. A variation of liquid chro- hyaluronic acid (HA) A type of gly-
matography that uses small (three to 10 cosaminoglycan in which the repeating
m in diameter) silica beads to achieve disaccharide consists of the sugars gluc-
high-resolution separations. uronic acid and N-acetylglucosamine.
The linear polysaccharide is a component
of the extracellular matrix in vertebrates,
H-ras gene The human proto-oncogene
where it forms the core of proteoglycan
homologue of the ras oncogene carried by
aggregates. It is also found in synovial
the Harvey sarcoma virus.

HTLV A group of human retroviruses


that cause human T cell leukemias; an
CH2 O H
acronym for human T-cell leukemia virus.
O
H O
human growth hormone (somato- COO H
HO H
tropin) A polypeptide hormone pro- H
O
O H NH
duced by the anterior pituitary that
OH
stimulates the liver to produce somato- H C O
medin-1, which in turn causes growth of H OH CH3
muscle and bone.
glucuronic acid N-acetyl
(GlcA) glucosamine
human immunodeficiency virus (HIV) (GlcNAc) n
The retrovirus that causes acquired
immunodefieiency syndrome (AIDS). Hyaluronic acid
Hyaluronic acid

124
www.stemcell8.cn
hydrolysis
verso

fluid that lubricates joints and in the vit- tion probe and the target nucleic. Thus,
reous humor of the eye. the chemical and physical conditions
under which a hybridization occurs can
hybrid An organism that is the off- be adjusted so that the level of homol-
spring of parents of different genotypes. ogy between the probe and the target is
85 percent, 90 percent, and so on. Levels
hybrid-arrested translation An experi- of homology below about 70 percent are
mental technique that identifies a cDNA generally considered to be nonhomolo-
for a specific protein by making a hybrid gous, and so hybridization conditions
between a cDNA and mRNA. If the permitting duplex formation between
cDNA does hybridize to the putative nonhomologous nucleic acids are called
mRNA for the protein, then the mRNA nonstringent.
containing the hybrid will not be able to
be translated in an in vitro translation hybridoma An immortalized antibody-
system, which will be indicated by the secreting cell created by fusing a myeloma
absence of that protein in a protein gel of cell to lymphocytes from the spleen of
the protein products. an animal that has been immunized to
a particular antigen. Antibody-secreting
hybrid cell A cell that was produced by hybridomas are the source of monoclonal
cell fusion but that, after several cell divi- antibodies.
sions following fusion, now contains one
nucleus with chromosomal material from hybrid vigor The state in which an off-
the original parent cells. spring is genetically more robust and/or
better equipped for survival than either
hybrid dysgenesis The term that is parent as the result of heterozygosity,
applied to the inability of certain strains that is, receiving a beneficial combination
of the fruit fly, D. melanogaster, to inter- of traits from its parents.
breed because offspring resulting from
matings between the strains are sterile. hydrocarbon Any organic molecule
composed only of hydrogen and carbon.
hybridization The formation, in vitro, The most common hydrocarbons are
of a double-stranded nucleic acid segment those that are derived from a linear chain
by hydrogen bonding between two single of carbon atoms.
strands. Experimental use of hybridiza-
hydrogen bonds Electrostatic attrac-
tion is the basis of DNA probe technol-
tions between positively charged hydro-
ogy including Southern and northern blot
gen atoms and negatively charged atoms
analyses, primer annealing, and hetero-
on other parts of a molecule or on other
duplex analysis.
molecules. Hydrogen bonds are the
major forces that stabilize the structures
hybridization probe Any labeled nu- of many proteins and the DNA double
cleic acid segment that is used in any of helix.
a variety of assays based on hybridiza-
tion of the labeled nucleic acid to a target hydrolase The general class of enzymes
nucleic acid. that catalyze reactions involving hydro-
lysis.
hybridization stringency A term used
to describe the degree of mismatch tol- hydrolysate The product of the hydro-
erated by a specific set of hybridization lysis of a material, for example, a protein
conditions. Hybridization stringency is hydrolysate or a casein hydrolysate.
usually given in terms of the minimal per-
cent base match that will be required for hydrolysis The breakage of any cova-
duplex formation between the hybridiza- lent bond that involves the insertion of

125
www.stemcell8.cn
recto
hydronium ion

a water molecule across the bond; for hydrops fetalis A type of thalassemia in
example: which all four alpha-chains missing in the
C=O H 2O C=O NH hemaglobin molecule are missing as a result
\ -----------------> \ + \ of a defect in the DNA that codes for these
NH OH H proteins. Infants carrying the defect almost
In the above example, the carbon-nitrogen inevitably die at or before birth.
bond is said to have undergone hydroly-
sis. hydroxyapatite A form of calcium
phosphate (CaPO 4) that is used for sep-
hydronium ion A water molecule to aration of single- and double-stranded
which a hydrogen ion is attached: H+ + nucleic acids by column chromatogra-
H 2O ---> H3O+. Hydronium ions are the phy in which the double-stranded form
form in which hydrogen ions are nor- is preferentially retained on the hydroxy-
mally carried in aqueous solutions. apatite matrix.

hydropathy plot A graph showing the 5-hydroxymethylcytosine An unusu-


degree of hydrophobicity of each amino al derivative of cytosine that is used in
acid in a polypeptide as a function of its place of cytosine in the DNA of the bac-
location in the polypeptide. Hydropa- teriophage T4. This base protects the T4
thy plots are often used to visualize the DNA from nucleases, which the bacterio-
clustering of hydrophobic amino acids. If phage produces during its growth cycle.
such clustering is observed, it may indi-
cate that the polypeptide in question is a hydroxyproline A derivative of the
transmembrane protein, with the hydro- amino acid, proline, that is found in col-
phobic cluster representing a transmem- lagen and that helps to stabilize the mol-
brane domain. ecule. Because the formation of hydroxy-
proline is dependent on vitamin C, a
hydrophilic The property of an atom, deficiency of the vitamin is manifest by
a molecule, or a molecular group that a weakening of the collagen fibers, which
has an electrostatic attraction to water results in the skin lesions characteristic of
molecules. Hydrophilic groups tend to be the disease scurvy.
soluble in water.
hygromycin An aminocyclitol anti-
hydrophilic-signaling molecule A biotic produced by Streptomyces hygro-
large class of highly water-soluble mol- scopicus with activity against both pro-
ecules that, because of their solubil- karyotes and eukaryotes. Hygromycin B
ity, can diffuse easily across an aque- acts by causing aminoacyl-tRNAs to be
ous medium between a cell from which misread and also introduces errors into
they are secreted to a target cell where the ribosomal translocation process. The
they trigger some specific event. Various hygromycin B phosphotransferase (Hph)
growth factors and hormones are com- gene confers resistance to the antibiotic.
monly encountered by hydrophilic-signal- By including the Hph gene in tranfec-
ing molecules. tion vectors, hygromycin can be used to
select, from a large cell population, the
hydrophobic The property of an atom, subpopulation of cells containing a par-
a molecule, or a molecular group that has ticular transfected gene.
no or very little electrostatic attraction
to water molecules. Hydrophobic groups hyperchromicity, hypochromicity The
tend to be insoluble in water. change in the optical density of a solu-
tion of a nucleic acid upon denaturation
hydroponics The science of growing or renaturation. Denaturation of double-
plants in a synthetic, aqueous nutrient stranded DNA to the single-stranded
medium. state results in an increase in the opti-

126
www.stemcell8.cn
hypoxanthine
verso

cal density of the sample (hyperchromic


shift) at 260 nm, and a reduction in opti-
cal density (hypochromic shift) accompa-
nies renaturation of single strands to the
double-stranded form.

hyperimmune A state in which an


extreme immune response is provoked by
an antigen present in quantities that are
normally not effective in stimulating the Hypoxanthine
immune system.

hypermutable phenotype Bacterial hypervariable region A region of the


strains lacking the ability to remove ura- immunoglobulin gene that shows a high
cil molecules that aberrantly arise in the degree of variability in sequence from one
cell DNA in place of cytosine. The per- antibody to the next.
sistence of uracil results in high rates of
mutation in strains that carry this defi- hypha A long, branching fi lament of
ciency. connected cells in fungi. Hyphae may
be either segmented, in which individual
hyperproliferation A state in which nuclei are separated from one another by
cell division occurs at a greater-than- a cell wall, or nonsegmented, in which
normal rate. many nuclei share a common cytoplasm
(multinucleated).
hypersensitive site, DNase I A region
of the chromatin at which the DNA is hypoxanthine A purine intermediate
accessible to the enzyme DNase I. Exper- in the degradative pathway of adenosine.
imental evidence has shown that many of Hypoxanthine can also serve as a precur-
these sites are places where gene activity sor for nucleic acid synthesis by a series of
is regulated. reactions known as the salvage pathway.

127
www.stemcell8.cn

A
I

Ia antigen Proteins encoded by the I


locus of the mouse H-2 histocompatibil-
ity complex. p13.3
ICE Il-1 converting enzyme; an alter- p13.2
native name for caspase 1 that is derived
from the fact that it can convert pro IL-1 p13.1
to its active form by proteolytic cleavage.
p12
Ich-3 (caspase 5) A cysteine protease
member of the Ced3/ICE family. Ich-3 p11.2
is activated through cleavage by the ser- p11.1
ine protease, granzyme B, in cytotoxic T
cells, which leads to apoptosis in these q11.1
cells. Activating cleavage of Ich-3 gener-
ates the subunits p20 and p10, which q11.2
share a high degree of homology to other
caspases. q12.1
q12.2
ideogram A type of chromosome
map based on a pattern of chromosomal
q13
bands called G banding produced by q21
staining with Geimsa. Each homologous
chromosome pair will show a unique
pattern of G bands that can be depicted q22
by an internationally agreed upon sche-
matic.

idiotope An antigenic peptide sequence q23


located on the IgG antibody molecule
near the antigen binding site; a specific
idiotope is associated with a specific anti- q24
gen binding site so that the same number
of idiotopes exist as there are different
antibodies.

idiotype The set of idiotopes on an IgG


molecule. Chromosome 16Chromosome 16

i-gene The bacterial gene that codes for illegitimate recombination A rare
the lac operon repressor protein. event in which recombination occurs
between two DNAs at an apparently ran-
IgG See immunoglobulin. domly chosen site(s).

128
www.stemcell8.cn
immunoglobulin gene switching
verso

imaginal disk Disk-shaped structures antibodies to the antigen after the antigen
symmetrically located on either side of has been separated according to size and/
the embryos of fly larvae that give rise or charge by gel electrophoresis and then
to certain adult structures, for example, transferred to a membrane.
legs, eyes, and wings.
immunodeficiency The state of im-
immortalized cells Cells that continue pairment of the immune system result-
to divide indefi nitely in tissue culture. ing in the inability or lowered ability of
Immortalization is a defi ning property the immune system to mount an immune
of transformed cells; cells expressing the response to a cell or particular antigen.
properties of cancer cells (i.e., the trans-
formed phenotype). immunodiffusion A technique for
determining the presence of an antigen
immune response The proliferation of by allowing an antigen and an appropri-
specific antibodies or cells of the immune ate antibody to diffuse into a gel where
system, such as macrophages, T and B an immune precipitate forms at the point
lymphocytes, and so on, in response to a where antigen and antibody meet.
foreign antigen.
immunoelectrophoresis A variation
immune system The collection of all of the immunodiffusion technique in
the cells and tissues (thymus, spleen, lym- which the antigen is subjected to elec-
phocytes) that are involved in providing trophoresis in a gel that is then used for
an immune response. assay by immunodiffusion.

immunization The injection of an ani- immunofluorescence A technique for


mal with an immunogen sometimes in visualizing structures in a cell or a tissue
combination with an adjuvent to induce through the use of antibodies attached to
the production of antibodies that will spe- a fluorescing label that bind to antigens
cifically bind to the immunogen injected. in the target structures.
immunoadsorbant A solid matrix to
immunogen Any substance capable of
which antibodies are attached and that is
provoking an immune response.
used to purify the antigens from a biolog-
ical preparation by allowing the antigens
to bind to the matrix-bound antibodies. immunogenicity The property of
being an immunogen, that is, the prop-
immunoaffinity chromatography A erty of being capable of provoking an
technique for purifying antigens by pass- immune response.
ing a biological preparation or extract
over a column containing an immunoad- immunoglobulin Any of the globular
sorbent. serum proteins secreted by cells of the
immune system for the purpose of deal-
immunoassay Any technique for deter- ing with foreign antigens. Immunoglob-
mination of the quantity of an antigen ulins are divided into five classes: IgM,
based upon the binding of the antigen to IgG, IgA, IgD, and IgE.
its specific antibody. See complement-
fixation test, hemagglutination- immunoglobulin gene switching
inhibition assay, and radioimmunoas- Developmental changes in the class of
say. immunoglobulin (such as from IgM to
IgG) produced by a single lymphocyte as
immunoblotting A technique for the result of the expression of different
determination of the presence and prop- genes. Gene switching is accomplished
erties of an antigen by reaction of labeled by recombination and changes in the way

129
www.stemcell8.cn
recto
immunolabeling

resent. For example, if it is supposed that


the nucleosome-binding DNA sequence is
a unique sequence, then a probe may be
constructed from the end portion of this
sequence, and any DNA that is isolated
from a nucleosome should hydridize to
the probe. See nucleosome phasing.

inducer Any agent, chemical or physi-


cal, that brings about the expression of a
gene or gene cluster.

inducible enzyme An enzyme whose


expression requires the presence of a spe-
cific inducer.

Immunoglobulin
induction, gene Transcription of a
gene(s) brought about in the presence of
a specific agent that is referred to as the
RNA is spliced so that the products of inducer.
different portions of the immunoglobulin
genes are fused to one another in differ- induction, phage The production of lytic
ent arrangements. bacteriophage in bacteria that carries a lyso-
genic prophage, brought about by treatment
immunolabeling The technique of with some chemical of physical agent.
labeling molecules and/or biologic struc-
tures through the use of antibodies bound informative meiosis A mating that
to other molecules that serve as labels for generates a crossing over between two
the antibody-antigen complex. genetic markers so that linkage between
the two markers can be determined.
immunology The study of the immune Informative meioses have been used in
system. the genetic analyses of genetic disease
such as cystic fibrosis to establish linkage
between RFLPs known to be associated
impermeable junction A term used to
with the disease.
describe any cell-cell junctional complex
that connects cells together so that even
infrared spectroscopy An analytical
small molecules cannot diffuse between
technique for determination of the chemi-
the connected cells. Impermeable junc-
cal structure of an unknown by observing
tions are generally used as synonymous
how much light is absorbed by a sample
with tight junctions. of the unknown at different light wave-
lengths in the infrared spectrum (>1,000
inclusion bodies Clumps of material nm). The absorption of light in this region
that accumulate in the nucleus or cyto- of the spectrum reflects, and is analyzed
plasm of virus-infected cells. Inclusion in terms of, the presence of certain types
bodies consist of aggregates of viral struc- of chemical bonds, for example, C=O,
tural components such as virion proteins. COH, and CC, that produce charac-
teristic absorption patterns.
indirect end labeling A technique for
demonstrating the unique nature of a inhibitory postsynaptic potential A
DNA fragment by hybridizing the frag- membrane potential across the postsyn-
ment to a probe representing an end piece aptic membrane in a neuron that inhib-
of the sequence that it is proposed to rep- its the generation of an action potential

130
www.stemcell8.cn
inverso
situ

in that neuron. Inhibitory potentials are be an important step in the pathway


those in which the membrane is more by which cells respond to extracellular
polarized (hyperpolarized) than in the signals.
resting state.
insert In molecular biology, the term
initiation codon An AUG codon in insert refers to a piece of DNA ligated
messenger RNA that codes for the first into a specific site in a vector for molecu-
amino acid (methionine) in a polypep- lar cloning. The resulting recombinant
tide. All polypeptides in both prokary- molecule composed of vector and insert
otic and eukaryotic cells begin with is designed to allow replication of the
a methionine coded for by an initiat- recombinant in an appropriate host.
ing AUG codon during the process of
translation. insertional inactivation The loss of
gene activity as the result of insertion of
initiation factor (IF) Certain proteins a segment of DNA into a region critical
that catalyze the formation of the initia- to the expression of the gene. Insertional
tion complex between the mRNA and the inactivation of genes coding for resistance
ribosome in the process of translation. to an antibiotic by insertion of a cloned
DNA is often used as a means by which
INK4 A gene locus that codes for bacteria containing the recombinant plas-
a group of tumor suppressors des- mid are selected.
ignated INK4A (CDKN2A), INK4B
(CDKN2B), INK4C (CDKN2C), and insertion mutation A mutation caused
INK4D (CDKN2D). The INK4 pro- by the insertion of a nucleotide or oli-
teins act to inhibit the progression of gonucleotide sequence into the coding
cells into S phase by blocking the activ- region of a gene. Insertion of oligonucle-
ity of the cyclinD-cdk4/cdk6 complex. otide sequences containing any number of
Two of the INK4 tumor suppressors, nucleotides not evenly divisable by three
4A (p16 INK4A) and ARF (p19ARF ), are will result in a frame shift.
produced by alternative splicing of a
single transcript that acts upon differ- in situ In the natural setting or envi-
ent secondary tumor suppressors, Rb ronment; generally, the intact tissue as
and p53, respectively. p16 INK4A acts opposed to a biochemical extract or
directly to prevent phosphorylation of preparation.
Rb by the cdk4/cdk6 kinase complex,
while p19ARF is an antogonist of mdm2,
which in turn leads to enhancement of
p53 activity.

inosine The purine base in inosine


monophosphate (IMP), the nucleotide
from which the normal purine nucleo-
tides, adenosine monophosphate (AMP)
and guanosine monophosphate (GMP),
are synthesized biologically.

inositol A five-carbon sugar that is a


major constituent of the phospholipids
found in cell membranes. The release of
inositol in the cell membrane resulting
from the action of certain growth fac-
tors and other effectors of cell growth
and differentiation is now believed to Inosine

131
www.stemcell8.cn
recto
in situ hybridization

in situ hybridization Nucleic acid into the cell membrane; that is, it pen-
hybridization carried out on sections of etrates into the membrane lipid bilayer.
intact tissue or chromosomes. Most eukaryotic receptors (e.g., RTKs)
are integral membrane proteins.
insulin A polypeptide hormone secreted
by a part of the pancreas known as the integrant A cell in which a transfected
islets of Langerhans, which controls the gene has become stably integrated into the
entry of glucose into cells. A deficiency of genome of the recipient. See transfection.
insulin production is the underlying cause
of diabetes. integrase The enzyme that catalyzes
the site-specific recombination of lambda
int 1 gene An oncogene activated by bacteriophage DNA with the bacterial
the nearby integration of the mouse host DNA that results in integration of
mammary-tumor virus (MMTV) that the bacteriophage DNA.
produces mammary tumors in mice.
The int 1 gene homologue in Drosophila integration In molecular genetics, the
melanogaster has been shown to play a insertion of a foreign DNA into the genome
crucial role in wing development, suggest- of a recipient cell. The term is most often
ing that the mammalian int 1 gene may applied to the integration of viral DNA
play a regulatory role in development. into the genome of an infected host, for
example, integration of the prophage in a
intasome A complex between bacterio- bacterium infected by a bacteriophage.
phage DNA and two proteins (Int and IHF)
that is required for bacteriophage DNA to integrin-linked kinase (ILK) An
integrate into the bacterial host DNA when enzyme associated with the cytoplasmic
a bacteriophage enters into lysogeny. domains of integrins and also attached to
the actin cytoskeleton at regions of the cell
integral membrane protein (intrinsic membrane called focal adhesions (FAs).
protein) A protein that is integrated Integrin-linked kinases act to transduce

bacteriophage DNA

bacterial host DNA

specialized protein complex

intasome

integrated bacteriophage

Intasome

132
www.stemcell8.cn
interleukins
verso

signals from ligand-activated integrins by ing cytokine signaling, antiviral defense,


phosphorylation of other signal transduc- regulation of cell growth, and immune
tion components; for example, Akt and activation by inducing the transcription of
GSK-3. genes.

integrins A very large family of trans- interleukins (lymphokines) A sub-


membrane proteins that act as adhesion group of soluble proteins called cyto-
molecules in cell-cell and cell-extracel- kines. Interleukins act as signal molecules
lular matrix interactions. The integrins to control immunologic and inflam-
are dimeric glycoproteins comprised of matory responses. At present there are
one (16 identified) and one subunit at least 18 known interleukins, most of
(eight identified) to form at least 22 dif- which have only recently been discovered.
ferent integrins. The integrins can bind Most cytokines, with the exception of IL-
to a variety of extracellular matrix com- 1, transmit intracellular signals via the
ponents as ligands, particularly fibro- Jak-STAT signaling pathway. Interleu-
nectin and laminin. Integrins also func- kins are mostly secreted by white blood
tion as receptors in signal transduction, cells (leukocytes) and stimulate a variety
which, upon ligand binding, can stimu- of responses in other leukocytes, includ-
late signaling through a number of sig- ing stimulating proliferation, inducing or
naling pathways, involving activation of inhibiting the release of other cytokines,
integrin-associated kinases such as FAK and activating themselves. The cellular
(focal adhesion kinase) and MAPK targets of the known interleukins (IL-x)
kinase. and their actions are summarized below:

interbands Lightly staining regions in IL-1Macrophages stimulate secre-


polytene chromosomes. tion of IL-2 from T cells.
IL-2Helper T cells cause activated
intercalate In biochemistry, to fit a T cells and B cells to divide. Induces
molecule in between biomolecules that antibody synthesis
are part of an array. The term is com- IL-3T cells induce proliferation of
monly applied to certain dyes that stain other leukocytes; induce hematopoi-
nucleic acids by inserting themselves in etic stem cells to differentiate into leu-
between the purine and pyrimidine bases kocytes.
arrayed along the nucleic acid backbone.
See ethidium bromide. IL-4Helper T cells stimulate growth
of T cells and B cells. A factor in the
interferon(s) A group of small glycopro- production of IgE antibodies
teins produced by virus-infected cells that IL-5Helper T cells stimulate growth
act to inhibit viral infection. The interfer- of B cells and eosinophils. Induce pro-
ons are heterogeneous both with respect liferation of B cells that produce IgA
to structure and mode of action. The antibodies
genes for various interferons have been IL-6T cells and macrophages induce
cloned and have been tested as therapeu- B-cell differentiation together with
tic agents for various diseases, including alpha-interferon.
Kaposis sarcoma in HIV-infected individ-
IL-7Stromal cells induce differentia-
uals. Gamma interferon has been found to
tion of lymphoid stem cells into pro-
induce MHC class II antigens in B cells,
genitor T cells and B cells.
macrophages, and endothelial cells.
IL-8T cells and neutrophils help
interferon regulatory factors (IRFs) A to recruit these cells to the site of an
small group of transcription factors that are inflammation.
activated by interferons. Interferons mediate IL-9Helper T cells stimulate
the various functions of interferons, includ- growth.

133
www.stemcell8.cn
recto
internal guide sequence

IL-10Produced by T cells, B cells, interphase The period between mito-


monocytes; represses the production ses. The interphase is divided into the G1,
of gamma interferon, TNF-alpha, IL- S, and G2 phases of the cell cycle.
1, and IL-6
IL-11Plasmacytoma cells stimulate intracellular Within the cell.
growth.
IL-12Produced by macrophages and intramuscular Located in or directly
B cells; stimulates T cells and natural administered to muscle tissue.
killer cells to proliferate
intraperitoneal Located in or directly
IL-13Produced by T cells; induces administered to the cavity between the
B-cell differentiation and inhibits pro- internal organs of the abdomen and the
duction of inflammatory cytokines abdomen wall. Intraperitoneal inocu-
IL-14Produced by T cells; enhances lation of transformed cells into mice is
memory B-cell proliferation widely used to promote the growth
IL-15Stimulates T-cell proliferation of transformed cells or to derive large
quantities of substances they secrete, for
IL-16An adhesion molecule and example, monoclonal antibodies.
activator for T cells. Plays a role in
asthma and autoimmune diseases intravenous In a venous blood vessel
IL-17T cells activate neutrophils. (vein); for example, the route of an intra-
IL-18Stimulates the release of inter- venous injection.
teron gamma and Th1 cytokines
intrinsic factor A glycoprotein secreted
internal guide sequence A nucleotide by the parietal cells of the lining of the
sequence in group I introns that plays a intestines (the gastric mucosa) that plays a
key role in precisely localizing the 3 splice critical role in the absorption of vitamin
B12 (cobalamin) in the intestine. The inabil-
site during the process of RNA splicing.
ity to produce or utilize the intrinsic factor
The mechanism of splice-site localization
leads to the condition known as pernicious
involves base pairing between the inter-
anemia caused by vitamin B12 deficiency.
nal guide sequence and sequences at the 5
splice site.
intron The nucleotide sequences in
between the exons of a gene. Introns in
intermediary metabolism That part the genomic DNA are copied during tran-
of biochemistry that deals with how scription but are removed by the process
energy is derived from nutritive biomol- of splicing.
ecules and how that energy is used in the
metabolism of other biomolecules. inulin A long polysaccharide composed
largely of repeating fructose subunits.
intermediate fi laments A type of fi l- Because it is a large molecule and largely
ament that makes up one kind of cyto- inert, inulin is used experimentally to
skeleton in mammalian cells. Intermedi- control osmotic flow across membranes
ate fi laments are distinguished by virtue and as a diagnostic aid for kidney func-
of their size (approximately 810 nm in tion.
diameter), which places them in a range
intermediate between the actin and inversion The alteration of cellular
microtubule type cytoskeletal fi laments. DNA sequences in which the orientation
Intermediate fi laments are divided into of a DNA segment is reversed; placed
six classes: keratins, desmins, vimen- into an inverted orientation. Inversions
tins, glial fi laments, neurofi laments, and are frequently caused by the movement of
nuclear lamins. transposons, especially in cells carrying

134
www.stemcell8.cn
ionophore
verso

two copies of a transposons in opposite molecular components necessary to repro-


orientation to one another. duce the normal process of polypeptide
biosynthesis as it occurs in the intact cell.
invertase The enzyme -D-galactosi-
dase that catalyzes the cleavage of lactose in vitro transcription/translation The
into the monosaccharides, glucose, and synthesis of both mRNA and its encoded
galactose. The enzyme derives its name protein in an artificial mixture contain-
from the fact that action of the enzyme ing the appropriate DNA, ribosomes, and
causes the resulting sugars to undergo all the molecular components necessary to
conversion to the opposite optical iso- reproduce the normal processes of tran-
mer (i.e., from D form to L form). A lack scription and polypeptide biosynthesis as
of this enzyme is responsible for lactose they occur in the intact cell.
intolerance.
in vivo In the intact cell or tissue.
inverted terminal repeats Segments
of DNA at the ends of an insertion ele-
iododeoxyuridine (IUdR) A synthetic
ment, such as a transposon, that are
nucleoside that is an inducer of Epstein-
inversions of one another, for example,
Barr virus (EBV) gene expression in EBV-
AACGCTTCG and GCTTCGCAA.
infected cells that otherwise produce no
Inverted terminal repeats are essential
viral proteins.
for the transposability of the insertion
sequence.
ion-exchange chromatography A tech-
in vitro Biological material outside of nique for separating substances in a
the normal setting, for example, in cell or mixture, based on passing the mixture
tissue culture or in cell or tissue extracts. through a column containing a matrix
that binds the substances in the mixture
in vitro fertilization The process of according to their electric charge.
carrying out fertilization with egg and
sperm outside the body in a petri dish or ion-exchange resin A material used to
a similar vessel. Fertilization is observed separate substances in a mixture by ion
under the microscope, and the fertilized exchange chromatography. Ion-exchange
egg is then implanted in the uterus for resins are generally in the form of beads
normal fetal development and birth. In that are composed of an inert polymeric
vitro fertilization is a procedure widely substance, such as cellulose or sepharose,
used to acheive pregnancy in certain that is covalently attached to molecules
types of infertility. that are electrically charged.

in vitro mutagenesis Mutagenesis of ionizing radiation Any electromag-


cells in vitro, that is, by exposure of cells netic radiation that can knock electrons
in tissue culture to mutagenic agents. from molecules, thereby producing ions.
Alpha, beta, gamma radiation, and X-
in vitro packaging The formation of rays are all considered to be ionizing
the viral coat around a viral nucleic acid radiation.
using biological preparations or extracts
in an artificial environment, for example, ionophore Any of a number of rela-
a mixture containing biological extracts, tively small organic molecules that act
salts, and necessary biological molecules. to allow the osmotic passage of ions and
other molecules across cell membranes
in vitro protein synthesis The syn- that would otherwise be impermeable to
thesis of a polypeptide using mRNA that them. Ionophores have been widely used
codes for that polypeptide in an artificial experimentally to study the function of
mixture containing ribosomes and all the ion gradients across membranes, for

135
www.stemcell8.cn
recto
ion-selective electrode

example, the Na+ K+ gradients in neu- the individual subgroups) on a molecule


rons. is exactly zero.

ion-selective electrode An instrument isoleucine An amino acid whose side


for measuring the concentration of ions chain is
of one specific atom in a solution by mea- CH 2 CHCH 2 CH3
suring the current produced when a probe \
containing the oxidized or reduced form CH3
of the atoms to be tested is immersed in
the solution. isomerase Any of a class of enzymes
that catalyzes the rearrangement of atoms
IPTG Isopropyl- -D-thiogalactopy- in a molecule.
ranoside; a synthetic analog of naturally
occurring galactosides, for example, lac- isoprene An organic molecule that
tose. IPTG is widely used in place of lac- appears in polymeric form in a number
tose as a potent inducer of the lac operon of important molecules that act as inter-
and, unlike lactose, is not acted on by mediates in electron transfers in vari-
the enzyme, alpha-galactosidase, that it ous metabolic reactions in intermediary
induces. metabolism, for example, ubiquinone
(coenzyme Q) and chlorophyll. The struc-
islets of Langerhans Small clusters of ture of isoprene is
cells scattered throughout the pancreas
that produce the hormones insulin and CH 2 =CHC=CH 2
glucagon. Because loss of ability of the \
islet cells to produce sufficient quantities CH3
of insulin is a cause of one form of dia-
betes (insulin-dependent diabetes), intro- isoschizomer Any one of a group of
duction of insulin genes targeted to the different restriction enzymes that recog-
islet cells is a strategy being developed to nizes the same nucleotide sequence.
treat this disease through gene therapy.
isotonic point The point at which the
isoaccepting tRNAs Different tRNAs concentration of all solutes in a solution
that carry the same amino acid. See results in an osmotic pressure across a
adaptor molecule. membrane that is exactly the same as
the osmotic pressure of a reference solu-
isoantigen (alloantigen) An antigen tion. This term or synonyms for it are
that is produced by only some members frequently used to describe solutions
of a species but not others and that is that can be introduced into a biologi-
capable of eliciting an immune response cal system without causing osmotic lysis
in the individuals of the species that lack of the cells; for example, solutions that
the antigen. Blood group antigens are are injected into the bloodstream with-
examples of alloantigens. out causing hemolysis are called isotonic
solutions.
isoelectric focusing A variation of poly-
acrylamide gel electrophoresis in which isotope One of any alternative forms of
proteins in a mixture are separated on the an element that differ from one another
basis of their individual isoelectric points. in terms of the number of neutrons in the
nuclei of their atoms.
isoelectric point The pH at which the
net charge (the sum of the charges on all

136
www.stemcell8.cn

A
J

jagged 1 (JAG1) A gene that codes fi rst isolated from the brain tissue of a
for a protein called jagged 1. The jag- patient with progressive multifocal leuko-
ged 1 protein binds to notch proteins encephalopathy (PML), which the virus is
that are receptors on the surfaces of cer- believed to cause.
tain cells. The formation of the jagged
1notch complex sets in motion a series jnk Jun N-terminal kinase; the pro-
of signaling reactions that controls the tein is a member of the MAP kinase
development of various cell types in an family. MAP kinases act as an inte-
embryo, including the heart, liver, eyes, gration point for multiple biochemi-
ears, spinal column, and blood cells. cal signals and are involved in a wide
Certain mutations in JAG1 can cause variety of cellular processes, such as
Alagille syndrome, which is character- proliferation, differentiation, tran-
ized by missing or narrowed bile ducts scription regulation, and development.
in the liver, heart defects, and charac- This kinase is activated by various cell
teristic facial features. Other mutations stimuli and targets specifi c transcrip-
in JAG1 result in various other abnor- tion factors, and thus mediates imme-
malities, including a heart defect called diate-early gene expression in response
Tetralogy of Fallot, deafness, and a to cell stimuli. The activation of this
liver condition called extrahepatic bili- kinase by tumor-necrosis factor alpha
ary atresia (EHBA). The JAG1 gene is (TNF-alpha) is found to be required
located on chromosome 20 at gene map for TNF-alpha-induced apoptosis. This
locus p12.1-11.23. kinase is also involved in ultraviolet
radiationinduced apoptosis, which
is thought to be related to cytochrome
JAKs Janus kinases; tyrosine kinases c-mediated cell-death pathway. Studies
that are one of the two main components of the mouse counterpart of this gene
of the JAK/STAT signaling pathway. suggest that this kinase plays a key
JAKs are activated by certain receptors role in T-cell proliferation, apoptosis,
for cytokines, lymphokines, and growth and differentiation.
factors. Ligand binding causes dimeriza-
tion of the receptors, which then act to joining gene (j gene) A DNA seg-
phosphorylate, and activate, JAKs. The ment in the immunoglobulin gene clus-
activated JAKs in turn phosphorylate ter that joins the constant and variable
the cytoplasmic ends of the receptor, immuno globulin gene regions during B
which then serves as a docking site for cell maturation. During the maturation
STATS. Mutations in the genes for JAKs process, antibody diversity is gener-
are associated with several leukemias, ated by joining a constant region with
including polycythemia vera, thrombo- a large number of different variable
cythemia, and myeloid metaplasia. regions.

JC virus A human virus member of the jun An oncogene transduced by a


Papova group. JC virus, which is closely chicken retrovirus that causes fibrosar-
related to the monkey virus, SV40, was coma tumors. The jun proto-oncogene

137
www.stemcell8.cn
recto virus
junin

ligand

JAK JAK JAK JAK

P P
STAT
receptor

STAT P P
STAT STAT

P P
STAT STAT

nucleus

The JAK-STAT pathway

has been found to share identity with the junin virus A member of the taca-
transcription regulation factor, AP-1, and ribe subgroup of the arenaviruses. Junin
apparently exerts its oncogenic effects by virus, which causes hemorrhagic fever, is
inducing aberrant gene transcription. carried by bats and rodents.

138
www.stemcell8.cn

Kallmann syndrome protein The karyokenesis The division of the nucleus


protein implicated in causing Kallman during cell division.
syndrome, a congenital condition char-
acterized by anosmia, small genitalia, karyoplast The cell fraction containing
and sterile gonads. Kallman syndrome the nucleus surrounded by a small ring
results from the failure of gonadotropin- of cytoplasm in cells enucleated by treat-
releasing hormone-secreting neurons to ment with cytochalasin.
migrate into the brain from the olfac-
tory placode during development. The karyotype The characterization of
defect is due to mutations in a gene the chromosomes of a cell type normally
called KAL-1, which codes for a pro- including chromosome morphology, chro-
tein called anosmin-1. Sequence analysis mosome number, chromosome banding
predicts anosmin-1 to be a cell-adhesion patterns, and any abnormalities of these
protein that may mediate axon-axon characteristics.
adhesion. KAL-1 is at gene map locus
Xp22.3. keratin A type of intermediate fi lament
found almost exclusively in the epithe-
kanamycin A broad spectrum antibi- lial cells of mammals and the feathers of
otic active against both Gram-positive birds. The mammalian keratin proteins
and Gram-negative bacteria and a num- are a large and diverse family of proteins
ber of types of mycoplasma. Kanamycin of which more than 30 different polypep-
is an aminoglycoside derived from the soil tides are known, of which only a small
bacterium Streptomyces kanamyceticus. number is required for fi lament forma-
tion in any one epithelial cell subtype.
kappa light chains One of the two
types of light chains in IgG antibody keratinocyte Any mammalian epithe-
molecules. The lambda-type light chain lial cell.
is distinguished from the kappa-type
on the basis of antiserum to light chain keratinocyte growth factor (KGF) A
proteins; immunoreactivity of the light cytokine that stimulates the growth of
chains show that they are of either the epithelial cells (keratinocytes). Human
kappa or lambda type, but not both. KGF-1 (also called FGF-7) is produced by
Kappa and lambda light chains are recombinant DNA techniques (FGF-7) as
secreted by myeloma tumors and appear a polypeptide chain of 164 amino acids
in the urine of myeloma patients where and is considered to be one of a class of
they were originally called Bence-Jones synthetic drugs called biological response
proteins. This discovery helped to eluci- modifiers. KGF is being tested as treat-
date the structure of the IgG molecule. ment for mouth sores (oral mucositis)
See immunoglobulin. caused by radiation or chemotherapy.

karyogamy The fusion of two nuclei; ketone body Any of either acetone, ace-
for example the fusion of pronuclei that toacetate, or beta-hydroxybutyrate, pro-
occurs during fertilization of the egg. duced as the result of the accumulation

139
www.stemcell8.cn
ketose

of acetyl CoA as might be caused by kinetochore fibers The microtubules


blockage of normal glucose metabo- extending between the kinetochore of the
lism via the Krebs cycle, for example, as chromosome(s) and polar bodies that pull
occurs in diabetes. the chromosomes to the poles of a divid-
ing cell during mitosis.
ketose Any sugar containing a keto (as
opposed to an aldo) group: kininogen A factor in the intrinsic
R1 blood-coagulation (clotting) pathway. Ki-
\ nogen is one of two factors reqired for
C=O<--------- keto group activation of factor XII (Hageman factor).
/
R2 kinins (cytokinins) Plant hormones
that, in combination with auxins, stimulate
Khorana, Har Gobind (b. 1922) A cell division and differentiation in a variety
biochemist who carried out experiments of plant tissues. Chemically, the cytokinins
using synthetic oligoribonucleotides to are purines with terpenoid side chains.
program synthesis of peptides. The amino
acid composition of the resulting peptides kirromycin An antibiotic that acts by
allowed assignment of amino acids to spe- inhibiting protein synthesis on the bacte-
cific codons and thus the deciphering of rial ribosome. Kiromycin forms a com-
the genetic code. For this work he received plex with a tRNA that prevents the elon-
the Nobel Prize in medicine in 1968. gation of the growing polypeptide chain.

kilobase (kb) A measure of the length Kirsten sarcoma virus (Ki-MuSV) A


of a nucleic-acid-strand equivalent to retrovirus that infects rats and that pro-
1,000 nucleotides. duces sarcomas and erythroleukemia in
the infected host. Ki-MuSV carries the
kilodalton (kD) A measure of the Ki-ras oncogene.
size of large biomolecules, but generally
applied to proteins, that is equivalent KISS-1 (KISS-1 metastasis-suppressor)
to the molecular weight of the molecule A gene that has been shown to suppress che-
divided by 1,000. For example, a protein motaxis, invasion, and metastasis of cancer
of 125,000 molecular weight correspond cells in human melanoma and breast car-
to 125 kD. cinoma cells. The KISS-1 gene codes for a
peptide that binds to a G-protein-coupled
kinase A class of enzymes that catalyze receptor named hOT7T175. Lymph node
the transfer of a phosphate group from one metastasis is the most important predictor
substrate to another. Phosphorylation is a of prognosis in esophageal squamous-cell
means of regulating the activities of a num- carcinoma (ESCC). Recently, KISS-1 was
ber of other enzymes, and so kinases may cloned as a human metastasis suppressor
control a wide variety of biochemical path- gene, and an orphan G-protein-coupled
ways through a single phosphorylation. receptor (hOT7T175) was identified as the
endogenous receptor of the KISS-1 product.
kinesin A protein involved in the move- However, the clinical importance of KISS-1
ment of small vesicles along a microtu- and hOT7T175 gene expression in ESCC
bule in the axons of nerves and perhaps remains unclear.
in other cell types. Kinesin is an ATPase
that uses the energy released by ATP Kleibsiella An important nitrogen-
hydrolysis to induce movement. fi xing soil bacterium. See nitrogen fi xa-
tion.
kinetochore A dense structure in the
centromeric region of a chromosome to Klenow fragment, enzyme A sub-
which the spindle fibers are attached. fragment of DNA polymerase I produced

140
www.stemcell8.cn
KSS1, FUS3

by proteolytic cleavage of the 103 kD Arthur Kornberg. Originally believed to


enzyme by subtilisin. The Klenow frag- be responsible for the bulk of DNA syn-
ment is the larger (68 kD) of the two sub- thesis. This was later disproved.
fragments produced by subtilisin treat-
ment. This fragment retains the normal K-ras The oncogene carried by the
DNA polymerase and 35 exonuclease Kirsten sarcoma virus. K-ras is a member
activities but lacks the 53 exonuclease of the ras oncogene family that contains
of the intact enzyme. Ha-ras and N-ras. The family is defi ned
by base sequence homology of the mem-
Klett unit A unit of light absorbtion bers to one another.
used in measuring bacterial cell num-
ber in terms of the turbidity of bacterial Krebs cycle See tricarboxylic acid
liquid cultures. Klett units, measured at cycle.
wavelengths between 490 and 550 nm,
are approximately proportional to cell
KRPs kinesin-related proteins; a class
number during logarithmic growth.
of proteins related to kinesin and serv-
ing the same basic function, that is, pro-
Klinefelters syndrome A chromo-
viding the motor that moves cytosolic
somal aberration involving the sex chro-
mosomes in which cells contain two X structures along microtubules. However,
chromosomes and one Y chromosome. kinesin-related proteins differ from kine-
Affl icted individuals have the physical sins in that KRPs are involved in spin-
appearance of males but are infertile and dle assembly and chromosome segrega-
have underdeveloped testicles and other tion during mitosis, while kinesins are
physical abnormalities. involved in the movement of transport
vesicles.
Kornberg, Arthur (b. 1918) The dis-
coverer of DNA polymerase I, which he Kruppel gene One of the homeobox
isolated from E. coli bacteria in work gap genes identified in Drosophila mela-
dating from 1956. The discovery of the nogaster. In mutants of the Kruppel gene,
fi rst enzyme known to be responsible for abdominal segments are deleted from the
synthesis of DNA won him the Nobel larva.
Prize in physiology and medicine in 1959.
In 1967 Kornberg stunned the scientific KSS1, FUS3 Yeast MAP kinases that
community by creating a biologically function in the same way in a pheromone-
active virus X174 from isolated com- responsive signaling pathway that acti-
ponents, the fi rst time a virus had been vates functions required for mating. Fus3
produced in the laboratory. is activated by phosphorylation carried out
by Ste7p. Either KSS1 or Fus3 can acti-
Kornberg enzyme DNA polymerase vate Ste12, a transcription factor, through
I, the bacterial enzyme discovered by phosphorylation.

141
www.stemcell8.cn

lac operon (lactose operon) The lactate dehyrogenase The enzyme


operon that contains the three genes cod- responsible for catalyzing the conversion
ing for proteins that are involved in the of pyruvate, in the presence of NADH
metabolism of the sugar, lactose, and (the reduced form of NAD), to lactic acid.
other beta-galactosides: beta-galactosi-
dase, galactoside permease, and galacto- lactic acid The product formed from
side acetylase. pyruvate by lactate dehydrogenase when
sugars are oxidized under anaerobic
conditions such as occur in muscle tis-
lac repressor protein A protein (pro-
sue after prolonged exercise or in bacteria
duced by the i gene) that blocks transcription
that thrive in low-oxygen environments.
of the genes in the lac operon by binding to
See fermentation.
the operator region of the lac promoter.
lactic acid bacteria anaerobic bacteria
lactam antibiotics A class of antibiotics that generate lactic acid during the pro-
whose molecular structure is derived from cess of sugar oxidation. The production
the lactam ring, usually penicillin and its of acid by lactic acid bacteria is respon-
synthetic derivatives, for example, oxacillin, sible for the souring of milk and the sour
nafcillin, and benzyl penicillin (penicillin G). taste of sauerkraut.

lactamase An enzyme made by penicil- lactoperoxidase labeling A technique


lin-resistant bacteria that cleaves the bond for labeling proteins on the outside of cell
between NH and C=O in the lactam ring. membranes with radioactive isotopes of
iodine (e.g., 125I). Lactoperoxidase cata-
C=O lactamase COOH lyzes the transfer of iodine from iodo-
/ \ -------------------> / acetamide to the tyrosine residues of the
(CH 2)n NH (CH 2)n NH 2 protein to be labeled.

lactam ring Any molecule with the lacZ gene The gene that codes for the
general structure enzyme beta-galactosidase in the lac ope-
C=O ron of bacteria. The lacZ gene is incorpo-
/ \ rated into many cloning vectors as a means
(CH 2)n NH of determining whether recombinant vec-

Lac operon

142
www.stemcell8.cn
Lassa fever virus

tors have been stably introduced into a lamella A thin membrane or plate
recipient cell or clone of cells. In a popula- dividing certain biological compart-
tion of transfected cells, expression of the ments, for example, the region in between
lacZ gene in a transfectant(s) can be deter- the cell walls of opposing cells of certain
mined from the appearance of blue color plants (i.e., the middle lamella).
in the cells when they are exposed to the
synthetic galactoside X-gal (5-bromo-4- lamellipoda A cytoplasm-containing
chloro-3-indoyl--D-Galactopyranoside), protrusion or villus extending out of the
which is hydrolyzed by the enzyme to pro- leading edge of an animal cell during its
duce a visible blue precipitate. movement along some substrate and ori-
ented along the axis of movement.
Lafora disease Lafora disease is a form
of epilepsy caused by an autosomal reces- laminar flow A uniform, eddy-free flow
sive mutation(s) in the EPM2A gene car- of air or liquid. Laboratory work requir-
ried on chromosome 6q24. The EPM2A ing particular care to avoid chemical or
gene is believed to code for a protein microbial contamination is carried out in
tyrosine phosphatase. Lafora disease is specialized, laminar flow hoods that main-
a stimulus-sensitive myoclonic epilepsy tain a continuous stream of fi ltered air.
that falls into two subtypes: Unverricht
(earlier onset, more severe) and Lundborg laminin A protein component of the
(later onset, less severe). The disease is basement membrane that forms under-
associated with inclusion bodies in the neath epithelial cells where the cells
neurons of the brain (Lafora bodies); in adhere to the basement membrane or
particular in the cerebral and cerebel- other substrate.
lar cortex and in the brain stem. Lafora
bodies are mostly glucose, 8093 percent lampbrush chromosomes Enlarged
in (1->4) and (1->6), but also contain chromosomes seen in amphibian oocytes
protein (ca. 6 percent). during meiotic prophase. Lampbrush
chromosomes are characterized by large
lagging strand During DNA synthesis, protruding loops of transcriptionally
the DNA strand whose synthesis begins active DNA.
at the replication fork. Because the repli-
cation fork is continually moving, DNA lariat An intermediate stage in the splic-
synthesis on the lagging strand must be ing out of introns during the formation
of mRNA in the nucleus. In a lariat, the
continually reinitiated resulting in a series
intron of an mRNA precursor is cut at
of contiguous but not covalently joined
one end; the cut end then forms a covalent
fragments. See Okazaki fragments.
bond to a nucleotide in the interior of the
intron to form the lariat structure. (See
lag phase The period of slow growth figure on next page.)
between the time when a microorganism
is inoculated into a nutrient broth and the laser Light amplification by stimulated
time when those microorganisms enter emission of radiation; laser light is cre-
into logarithmic growth. ated by causing a group of atoms to emit
photons in synchrony. Lasers are used
lambda exonuclease An enzyme that in varous types of molecular biological
catalyzes the cleavage of single nucleo- analyses, for example, flow cytometry.
tides with 5 phosphate groups from the
5 ends of double-stranded DNA. Lassa fever virus An RNA-containing
virus member of the Arenavirus family.
lambda light chain One the two types First discovered in Nigeria, the virus is
of light chains in IgG antibody molecules; known to cause an acute infection char-
a Bence-Jones protein. See kappa light acterized by fever, malaise, throat lesions,
chain. and pneumonia.

143
www.stemcell8.cn
late genes

intron

UG A AU
5 splice site 3 splice site

A
OH
UG AU

A
G

U AU
lariat
structure

Lariat

late genes In viral infection, a set of the French discoverers of the virus at the
genes that are always expressed late in Pasteur Institute.
the life cycle of the virus. Generally, the
late genes code for proteins required for LD-50 The dose of a test drug that
packaging of the viral DNA that is repli- is fatal to 50 percent of test animals to
cated early in the viral life cycle. which it is administered.

lateral meristem Meristem tissue lining LDL receptor A transmembrane


the plant stem. Because the meristem is protein in liver cells that binds spe-
mitotically active, the lateral meristem is cifically to low-density lipoproteins
responsible for growth in diameter of the (LDLs), after which the LDLs are
plant stem. taken into the cells by endocytosis
and degraded. Uptake of LDLs by
LAV Lympho adenopathy virus; ano- this mechanism is one of the major
ther name for HIV, the virus that causes pathways for the metabolism of LDL-
AIDS. The designation LAV was used by associated cholesterol.

144
www.stemcell8.cn
leptin

leader peptidase An integral membrane covering the phenomenon of transduction


protein that catalyzes the cleavage of the by bacteriophage. He also introduced the
leader sequence during the insertion of technique of replica plating to study genetic
preproteins into their target membranes. linkage and recombination in bacteria. His
work led to the elucidation of the process
leader sequence In RNA transcripts by which various genes, especially those
for mRNAs, an RNA segment upstream responsible for conferring antibiotic resis-
from the part of the mRNA that encodes tance, are transferred between bacteria. He
the protein. This term is also used to refer was awarded the Nobel Prize in physiology
to a short segment at the beginning of a and medicine in 1958.
newly synthesized peptide that serves as
a signal that the peptide is to be trans- legume A member of the pea fam-
ported outside the cell, that is, secreted or ily of plants. The roots of leguminous
deposited on the outer surface of the cell plants maintain a symbiotic relationship
membrane. See signal sequence. with nitrogen fi xing bacteria so that the
legumes are a rich source of nitrogen
leading strand During DNA replica- stored in the form of nitrates.
tion, the strand that is synthesized con-
tinuously in the 53 direction. Lehninger, Albert (19171986) A bio-
chemist famous for his work on the process
leaky mutant A mutant microorganism of oxidative phosphorylation. Lehninger is
in which the normal properties continue best known for identifying the mitochon-
to be expressed at a low level or in which drion as the site at which the Krebs cycle,
the mutation is only partly expressed. fatty acid oxidation, and oxidative phos-
phorylation all take place. His classic
Lebers Hereditary Optic Neuropathy work on the subject was published in 1948
(LHON) A genetic disease carried in together with the noted biochemist Eugene
the mitochodrial genome characterized by Kennedy, who was then his graduate stu-
blindness resulting from degeneration of dent. The duo are also known for helping
the optic nerve. Because the genetic defects to perfect a technique for the isolation of
are carried in the mitochondria, the pat-
mitochondria, which made their discover-
tern of inheritance is always maternal.
ies possible. Lehninger made a number of
The vast majority of LHON cases carry
other contributions to the study of bioen-
point mutations in the region of the mito-
ergetics, including the elucidation of impor-
chondrial genome that codes for the ND1
tant differences in metabolism between
subunit of complex I of the electron chain
(NADH-ubiqinone oxidoreductase), and, normal and cancer cells.
for this reason, the disease is believed to
result from intracellular ATP deficiency. lentivirus Literally, slow virus. A type
of retrovirus that produces a chronic, gen-
lecithin The common name for the mem- erally subclinical infection, for example, a
brane phospholipid, phosphatidyl choline. visna virus that infects the brain cells of
Lecithin is believed by some to possess sheep. However, infection may invoke an
detergent properties capable of dissolving immune response that can result in demye-
cholesterol present in arterial plaques. lination of the nerve cells. It is believed that
some demyelinating diseases in humans
lectins Plant-derived proteins that bind may follow the same paradigm.
to specific polysaccharides. Lectins are
used to label the cell surfaces of, or to leptin A polypeptide protein hormone
agglutinate, cell types that bear the par- produced by adipose tissue that acts as
ticular polysaccharides. a signal to the brain in the regulation of
appetite and metabolism. Leptin binds
Lederberg, Joshua (b. 1925) A bac- to receptors in the hypothalamus, where
terial geneticist who is credited with dis- it inhibits the actions of neuropeptide Y

145
www.stemcell8.cn
Lesh-Nyhan syndrome

(NPY) and agouti-related peptide (AgRP) leukotrienes One of a class of hor-


and by enhancing the actions of alpha- monelike biochemicals called eicosanoids.
melanocortin stimulating hormone (- Leukotrienes cause a number of wide-
MSH). Binding of leptin to its receptor ranging effects on tissues distal from
alters gene expression by the JAK/STAT where they are produced, including the
signaling pathway, which is coupled to contraction of smooth muscle that lines
the receptor. As a natural regulator of the airways; overproduction of leukot-
appetite, leptin and/or components of riences leads to asthma attacks.
leptin action are potential targets of new
antiobesity drugs. levorotatory isomer One of the two
main classes of optical isomers. When polar-
Lesh-Nyhan syndrome A genetic dis- ized light is passed through a solution of a
ease characterized by mental retardation levorotatory isomer, the plane of polarized
and loss of coordination. The disease, light is rotated in a counterclockwise direc-
which becomes manifest by the age of two, tion from the point of view of the observer.
is due to the lack of the enzyme hypoxan-
thine-guanine phophoribosyltransferase library A large set of DNA sequences
(HGPRT) and was identified by Michael from some specified source, for example,
Lesch and William Nyhan in 1964. cDNAs or fragments of chromosomal
DNA derived from a certain tissue or cell
lethal locus A genetic locus where type. This term is also applied to pep-
mutations tend to prove lethal to organ- tides as in libraries created in automated
isms carrying the mutation(s). peptide synthesizers that contain a large
number of different peptides.
lethal mutation Any mutation whose
presence leads to the death of the organ- ligand Any molecule that is bound by a
ism in which the mutation is present. specific receptor for that molecule.

leucine The amino acid that contains ligand-gated channels Channels in


as a side chain: cell membranes that permit the passage
CH3 of ions through the membrane when, and
/ only when, a specific ligand is bound to
CH 2 CH its membrane receptor (ligand gating).
\ Ligand-gated channels are the means by
CH3 which nerve impulses are propagated
when a neurotransmitter produced by
leucine zipper A structural motif on one neuron binds to a receptor on the
DNA binding regulatory proteins. Leu- membrane of another neuron.
cine-zipper proteins are helices in which
hydrophobic amino acids are arrayed ligase A type of enzyme that catalyzes
along one side of the helix. In the active the formation of a covalent bond between
dimeric form, leucine residues at approxi- the free ends of two nucleic acids.
mately every seventh position are hydro-
phobically bonded to the leucine residues ligase, DNA Catalyzes the linkage
in a second helix so that the two helices between a 5 terminal phosphate group
are wound around each other in a coiled- at the end of one DNA and a 3 terminal
coil arrangement. hydroxyl group at the end of another.

leukemia A cancer of the blood char- ligation The chemical linking of the
acterized by the uncontrolled prolifera- free ends of two nucleic acids to form one
tion of white blood cells (leukocytes). larger strand out of two smaller ones.

leukocyte A white blood cell. The light chain Either of the two shorter
white blood cells are largely composed of peptides that make up an immunoglobulin
the cells of the immune system. molecule.

146
www.stemcell8.cn
linkage map

light-dependent reactions Those chem- peptides by blocking elongation of par-


ical reactions in photosynthesis that require tially synthesized peptide chains.
light. The so-called light reaction(s) involves
the capturing of light energy by pigments, LINEs Long interspersed elements; a
including chlorophyll, in the form of high- repeated sequence of intermediate redun-
energy electrons. The activated electrons dancy (~50,000 copies/genome in human
are derived from water that is split during cells) that acts as a mobile element using
the process to liberate free oxygen. a reverse transcription mechanism simi-
lar to retroposons. LINEs contain genes
light-harvesting complex (LHC) A encoding proteins similar to the reverse
complex of pigments associated with the transcriptases of retroviruses and may
photochemical reaction centers in chlo- contain other open reading frames as
roplasts that serve to collect the pho- well. LINEs also differ from retroposons
tons falling on an area of the thylakoid in that the coding regions are flanked by
disk. Then the photon energy is trans- short direct repeats rather than long ter-
ferred to a chlorophyll molecule in the minal repeats.
form of an excited electron whose energy
is then used to store the energy as ATP Lineweaver-Burk plot A plot of the
or NADPH (the reduced form of NADP). reciprocal of substrate concentration (1/
Light-harvesting complexes contain a S) versus the reciprocal of the reaction
variety of pigments that act as antenna velocity (1/Vo) for an enzyme catalyzed
molecules for collecting light. These pig- reaction; also called a double reciprocal
ments include carotenoids, phycobillins, plot. This type of plot is useful for graph-
phycoerythrins, and chlorophylls. ical determination of K m and Vmax for a
given enzymatic reaction.
light-independent reactions Those
chemical reactons in photosynthesis that linkage The degree to which any two
are carried out in the absence of light. genetic markers are associated with each
The so-called dark reactions are respon- other as determined by the frequency with
sible for the trapping of carbon dioxide which the two markers appear together in
and water to create sugars. the same individual during genetic trans-
mission (e.g., in offspring or in micro-
lignin A phenolic polymer that forms organisms in which the genetic markers
a matrix in which the cellulose fibers of have been transferred by transduction or
the plant cell wall are embedded. Lignin conjugation). Genetic linkage is related
forms the cement that holds the fibers to, but is not the same as, the physical
in place and also lends tensile strength to distance between the two markers.
the cell wall.
linkage disequilibrium A term to
limit digest The product of a degrada- indicate the tendency of some genes,
tive enzymatic reaction in which the sub- or genetic loci, to remain linked to one
strate has been digested to the maximal another; in other words to show patterns
extent possible. Limitation of the extent of inheritance that are statistically differ-
of digestion may be imposed by physical ent from what would be expected if the
constraints, for example, clumping of the genes recombined at random. If there is
substrate material or failure of the sub- no statistical deviation in the distribution
strate to enter into solution completely. of genes from what would be expected
from random recombination, the linkage
lincomycin (lincocin) An antibiotic disequilibrium would then be zero.
produced by Streptomyces lincolnensis.
The antimicrobial action of lincocin is linkage map A genetic map based
due to its binding to the large subunit of upon genetic linkage as opposed to actual
the ribosome that prevents synthesis of physical distances.

147
www.stemcell8.cn
linked genes

Lipid bilayer

linked genes Genes that are located mutations whose effect on the activity of
within close enough physical proximity a promoter is to be tested. The promoter
to one another that they appear together sequence that has been altered by inser-
in virtually all organisms to which one or tion of the linker is tested for activity in
the other is transmitted. vitro, for example, by CAT assay.

linker A synthetic molecule that serves linking number The number of com-
as a molecular bridge between two other plete helical turns in a circular DNA mol-
molecules, for example, a synthetic oligo- ecule. The linking number is related to
nucleotide that joins together two DNA the degree of supercoiling of the DNA.
fragments.
linking-number paradox In experi-
linker-scanner mutations The replace- mental determinations of the number of
ment of a segment of DNA with a synthetic winds of DNA around each nucleosome,
oligonucleotide (a linker) that contains the linking-number paradox refers to the

148
www.stemcell8.cn
LOD score

discrepancy between the values obtained


by different experimental methods. For
example, digestion of nucleosomes by
endonucleases gives about 1.8 DNA coils
per nucleosome, but measurements based
on supercoiling of DNA after the nucleo-
somes are removed give a value of about 1
coil per nucleosome. The discrepancy is of
theoretical significance for models of the
helical structure of the DNA molecule.

lipase Any of a variety of enzymes that


catalyzes the breakage of an ester link-
age in a lipid, thereby participating in the
breakdown of that lipid.

lipid Any of a variety of oily, highly


insoluble biomolecules associated with
cell membranes and fatty tissues. Lipids
are divided into six major classes: fatty
acids, triglycerides, phosphatides, spingo-
sines, waxes, and cholesterol derivatives.

lipid bilayer A thin fi lm of regular


thickness that, under certain conditions,
is spontaneously formed by amphipa- Liposomes
thic lipids when they are placed in water.
The plasma membranes of animal cells the cell plasma membrane, liposomes are
is formed, in large part, from naturally being studied as vehicles specifically to
occurring bilayers of phospholipids. introduce drugs or other bioactive chemi-
cals directly into target cells.
lipopolysaccharide Lipids that are
bound to polysaccharides. Lipopolysac- lipotropic agents Lipid solvents or
charides are found attached to the out- chemicals with hydrophobic properties
sides of many cell membranes, including that permit them to form nonpolar bonds
bacterial cell membranes. with lipid molecules. Certain lipotropic
agents have application as virus inactivat-
lipoprotein Complexes of lipids and ing drugs.
proteins. The most important and abun-
dant examples of lipoproteins are the lipo- locus The position occupied by a gene
proteins that function to transport fats in or a genetic marker on a chromosome.
the blood and that are classified mainly
in terms of their densities: high-density LOD score A numerical value used
lipoproteins (HDLs), intermediate-density to indicate genetic linkage between two
lipoproteins (IDLs), low-density lipopro- markers. The LOD score is defi ned as
teins (LDLs), and very-low-density lipo- LOD = log10 (Plinked /Punlinked)
proteins (VLDLs). where
Plinked is the probability that the fre-
liposome A synthetic structure com- quency with which two markers segrate
posed of a lipid bilayer that completely from one another in the offspring of a
encloses an interior cavity in which may mating could have occurred if the mark-
be carried various substances of interest. ers were linked.
Because the lipid bilayer of the liposome Punlinked is the probability that the fre-
can spontaneously fuse with the lipids of quency with which two markers segrate

149
www.stemcell8.cn
logarithmic [growth] phase

from one another in the offspring of a isms may not reproduce or give rise to
mating could have occurred if the mark- only one daughter during reproduction.
ers were unlinked from one another.
By convention, a LOD score of 3 is long QT syndrome (LQTS) An
considered the threshold value for declar- hereditary disorder, usually seen in chil-
ing that two markers are linked to one dren, that affects the hearts electrical
another. rhythm such that the interval between the
Q and T parts of the contraction wave
logarithmic [growth] phase The term (contraction-relaxation of the ventricles)
used to describe the growth of a culture of is abnormally long. This leads to a rapid
microorganisms under conditions where, heart rhythm (arrhythmia) called Torsade
on the average, one organism gives rise des pointes, which can cause fainting in
to two daughters at a consistent uniform a matter of seconds. The biological bases
rate. Logarithmic phase of growth fol- of LQTS are mutations in genes that code
lows lag phase during which some organ- for ion channels that cause the channels

reverse
transcriptase

RNA 5 R U5 gag pol ENV U3 R 3'

cDNA 3 R U5 gag pol 5'

5 R U5 gag pol ENV U3 R 3'

partial degradation
of 5 end of RNA template
R U5 gag pol
resulting in loss of R

U5 gag pol ENV U3 R 3'

head-to-tail alignment of
second viral RNA by base
pairing of R segments

extension of cDNA
by reverse transcriptase R U5 gag pol

5' R U5 gag pol ENV U3 R U5 gag pol ENV U3 R 3'

continue
reverse transcription
to end of template
LTR
ENV U3 R U5 gag pol

5' R U5 gag pol ENV U3 R U5 gag pol ENV U3 R 3'

Formation of long terminal repeats during reverse transcription

150
www.stemcell8.cn
luxury genes

to malfunction. At least five genes are characteristic light flashes. Luciferase


known to be involved in LQTS: 1. the catalyzes the decarboxylation of the sub-
KCNQ1 gene on chromosome 11 (encodes strate, luciferyl andenylate, to generate
a potassium channel), 2. the HERG gene light. This reaction has been exploited as
on chromosome 7 (encodes a potassium a nonradioactive means of labeling mol-
channel), 3. the SCN5A gene on chromo- ecules for analytical purposes.
some 3 (encodes a sodium channel), 4. the ATP luciferase
LQT5 gene (also called MinK, or KCNE1) luciferin > luciferyl adenylate > oxyluciferin
on chromosome 21 (encodes part of the +AMP oxygen +CO2
potassium channel together with the + AMP
KCNQ1 gene product; mutations of this + LIGHT
genelike those of KCNQ1produce the
LQT1 form of LQTS), and 5. the MiRP1 lucifer yellow A fluorescent dye used
gene on chromosome 21 (encodes part of as an intracellular tracer to visualize liv-
the potassium channel together with the ing cells. Lucifer yellow and other tracer
HERG gene product). dyes have much application in neurobiol-
ogy for discriminating individual nerve
long terminal repeat (LTR) Special- cells in a cluster.
ized sequences located at the 5 and 3
termini of the genome of retroviruses. luminometer A device for measuring
LTRs mediate the integration of the ret- emitted light. Luminometers have par-
rovirus into the host genome and regu- ticular application as an analytical tool
late the transcription of the retrovirus for determining the cellular content of
genes. Because many LTRs contain strong
ATP and other energy-containing nucleo-
enhancer elements, they are often used in
tide phosphates by utilizing biochemical
synthetic constructs for the purpose of
reactions that emit light, for example, the
expressing foreign or engineered genes in
ATP-luciferase reaction.
recipient cells.

loop, looped domains A single-


Luria, Salvador (19121991) A genet-
icist whose work with bacterial and bac-
stranded region in either RNA or sin-
gle-stranded DNA that forms a hairpin teriophage mutants led to the elucidation
structure. The sequence between inverted of gene structure. He carried out a famous
repeating sequences forms looped experiment in 1943 that demonstrated the
domains because of base pairing between inheritance of antibiotic resistance in bac-
the inverted repeated. teria and showed that the pattern of inheri-
tance followed Darwinian rather than Lar-
low-density lipoprotein (LDL) A marckian principles. Luria won the Nobel
class of lipoprotein particles that carry Prize in medicine in 1969.
cholesterol esters to cells that have spe-
cialized LDL receptors. Receptor-bound luteinizing hormone (LH) A glyco-
LDLs are taken up into the cell where the protein hormone released from the ante-
cholesterols are metabolized. rior pituitary. LH stimulates oocyte mat-
uration and ovulation and progesterone
L-phase variants Bacterial variants secretion in the ovary.
that lack a cell wall. L-phase variants are
produced under conditions in which cell- luxury genes A vernacular term to
wall synthesis is inhibited, for example, describe the genes that are not essential
the presence of penicillin. The L-phase for basic cell functions, but rather are
variants pass through fi lters that retain made by only a certain cell type and that
normal bacteria. perform a function necessary to the func-
tioning of the organism as a whole, for
luciferase An enzyme isolated from example, hemaglobin genes. See differ-
fi refl ies that is responsible for their entiation antigen.

151
www.stemcell8.cn
lymphocyte

lymphocyte The subclass of white lysogen A bacterial strain harboring a


blood cells responsible for carrying out lysogenic virus (bacteriophage). See pro-
the immune response. Lymphocytes are phage.
further subdivided into T and B lympho-
cytes and are found mostly in the thymus, lysogenic The property of certain bac-
lymph nodes, the spleen, and the appen- teriophage mutants to integrate into and
dix. remain dormant in the bacterial host
DNA. Although lysogenic bacteriophages
lymphokines (interleukins) Hormones do not immediately cause lysis, they may
secreted by certain antigen-processing be induced to do so by various chemical
cells of the immune system that cause T agents or by ultraviolet light.
cells specific for the antigen to proliferate.
lysogeny The state of being lysogenic.
Lyon effect The silencing of expression
of the genes on one of the two X chro- lysosome A cytoplasmic organelle in
mosomes in the cells in a female animal. eukaryotic cells in which digestion of
Silencing of the particular X chromosome particulate material brought into the cell
occurs at random and is maintained in all via endocytosis or phagocytosis occurs.
the progeny cells. Lysosomes are characterized by a highly
acidic internal environment and the pres-
lyophilization The removal of water ence of enzymes (acid hydrolases) that
from a frozen biological specimen by carry out the digestive process.
placing the specimen in a vacuum; often
referred to as freeze-drying.
lysozyme An enzyme that derives its
name from its ability to cause certain
lysate The resultant mixture of cell
bacteria to lyse. Lysozyme acts by cleav-
debris and soluble cytoplasmic substances
that results from mass cellular lysis of a ing polysaccharides in the bacterial cell
cell culture or tissue. wall. Lysozyme is used as a reagent in
preparing DNA from bacteria and in the
lyse (lysis) A breaking open of cells creation of protoplasts.
by damage to the cell membrane by
any mechanical, biological, or chemical lytic cycle The events in the growth
agent. cycle of a lytic virus. The term is usually
applied to bacteriophages.
lysine An amino acid with an amino
butyl side chain: (CH 2) 4 NH 2 . The lytic virus Any virus that as part of
amino group makes lysine a basic amino its life cycle, causes lysis of the host cells
acid. that it infects.

152
www.stemcell8.cn

Machado-Joseph disease protein A or size fractionation of large proteins or


neurological genetic disorder, also known substances such as viruses.
as spinocerebellar ataxia-3, that is trans-
mitted to offspring in an autosomal domi- magic spot nucleotides Nucleotides
nant. The disease is caused by degenera- with two or more phosphate groups on
tion of specific groups of neurons and is both the 3 and 5 carbon atoms that
characterized by spinocerebellar ataxia, accumulate in bacterial cells during the
limited eye movement and rigidity. The stringent response.
gene involved in Machado-Joseph dis-
ease (MJD) is MJD1 (ataxin 3), and the main band The band that corresponds
associated disease-causing mutation is to the bulk of DNA, as opposed to satel-
lite DNA, when a preparation of mam-
an expansion of CAG repeats in the cod-
malian genomic DNA is subjected to den-
ing region from the normal number of
sity gradient centrifugation analysis.
1336 to 6879. While the function of
the disease gene is unknown, it appears major facilitator superfamily (MFS) One
that pathogenesis is associated with mis- of the two largest families of membrane
folding and aggregation of the protein in transporters. The MFS is found in both
the nuclei of affected neurons. MJD1 is prokaryotes and eukaryotes and functions
located at gene map locus 14q24.3-q32.2. to transport a wide variety of ions, sug-
ars, amino acids, drugs, and other solutes.
macrolides A group of antibiotics with Members of the MFS are grouped together
a large aliphatic ring structure with many on the basis of sequence homology as a
hydroxyl and keto groups. Erythromycin result of sequence analyses of public data-
is the best-known member of this group bases completed in 1997. Phylogenetically,
of antibiotics. 17 distinct subfamilies can be delineated
within the MFS, each of which usually
macromolecule A large molecule made transports one type of compound. All 17
up of many individual units such as subfamilies contain 12 or 14 transmem-
amino acids in proteins, nucleotides in brane alpha-helices and show a highly con-
nucleic acids, and unit sugars in large served motif between transmembrane link-
carbohydrates. ing peptides 2 and 3. The MFS is believed
to have evolved from a common ancestral
macrophage A large phagocytic white gene through a process of gene duplication.
blood cell. Macrophages travel in the
blood but are capable of leaving the blood major histocompatability complex
to enter tissue. They function as a defense (MHC) A cluster of genes present in
by ingesting invading bacteria and other the genomes of most higher vertebrates
foreign cells as well as by removing par- that code for cell surface proteins that are
ticulate debris. recognized as the main transplantation
antigens when cells are transplanted to a
macroporous gels A chromatogra- foreign environment. The MHC proteins
phy matrix composed usually of cellu- are therefore the antigens mainly respon-
lose or agarose gels that are useful for sible for provoking graft rejection in ani-
ion exchange or affi nity chromatography mals receiving foreign tissue grafts.

153
www.stemcell8.cn
malaria

malaria A chronic disease character- MAP kinase A class of enzymes that


ized by periodic acute attacks of chills phosphorylate MAPs. Phosphorylation
and fever. The disease is the result of (and dephosphorylation) of MAPs regu-
infection by the sporozooite parasite, lates the polymerization of microtubules
plasmodium, that lives in red blood cells and therefore functions as a means to
and is transmitted to humans via the control the entry of cells into mitosis.
Anopheles mosquito. MAP kinases are activated by signal-
ing pathways, such as those mediated by
maltase The enzyme that catalyzes the receptor tyrosine kinases (RTKs). For
breakdown of the malt sugar, maltose this reason MAP kinase in the context
maltase of signaling pathways is an acronym for
maltose -----------------------> 2 glucose mitogen-activated protein kinase.

maltose-binding protein A protein MAPs See microtubule-associated


produced by the bacterium Escherichia proteins.
coli that is used to transport the disac-
charide sugar maltose across the bacterial MAR (SAR) Matrix attachment re-
plasma membrane. gions (Scaffold attachment regions); spe-
cific DNA sequences at which attachment
mammalian cell culture The main- to the nuclear scaffold network occurs.
tenance of mammalian cells outside the
body using synthetic media to meet the Marburg virus A virus discovered as
nutritional requirements normally sup- a contaminant of tissues from African
plied by the blood. green monkeys in Marburg and Frank-
fort, Germany, in 1967. The classification
mammalian expression systems The of Marburg virus is unclear. The disease
term for expression vectors that are specif- is characterized by fever, rash, gastroin-
ically designed to express cloned genes in testinal upset, and central nervous system
mammalian cells. See expression system. involvement and is potentially fatal.

mannose A sugar that is an optical iso- Marfan syndrome An inherited disor-


mer of the main energy-producing sugar, der of connective tissue that affects the
glucose. Because mannose differs from skeleton, lungs, eyes, heart, and blood
glucose at only one of the six carbons, vessels. The disease is characterized by
mannose is called an epimer of glucose unusually long limbs. Marfan syndrome is
and can be converted directly into glu- carried as an autosomal dominant linked
cose by enzymes. to mutations in the FBN1 gene on chro-
mosome 15q21.1, which encodes a gly-
Manton-Gaulin homogenizer An coprotein called fibrillin that is a major
apparatus used for large-scale breakage building block of microfibrils. Microfibrils
of cells to release their internal contents, are structural components of the support-
using the mechanism of liquid shear. See ing matrices of the tissue of the eye, aorta,
cell disruption. lung airways, and the dura of spinal col-
umn. Mutations in FBN1 produce abnor-
map distance A means of defi ning mal fibrillin-1 monomers that prevent
distance between two markers on a seg- microfibril formation. This is an example
ment of chromosomal DNA. In bacte- of a dominant-negative effect because the
rial systems, map distance is measured in mutant fibrillin-1 disrupts microfibril for-
terms of map units, defi ned as the recom- mation even with normal fibrillin is being
bination frequency between two genetic produced by the other allele.
markers and expressed as a percentage.
In eukaryotic chromosomes, map units marker Any genetic element that pro-
are given in centimorgans. duces a variation in expression of a trait

154
www.stemcell8.cn
MDM2

(e.g., hair color) and that resides at a par- haploid cells of opposite mating types.
ticular locus. The mating process converts yeast cells
from haploid asexual cells to diploid sex-
Marshall, Barry J. (19021992) One ually reproducing cells.
of the codiscoverers of the ulcer-
causing bacterium Helicobacter pylori. mating-type locus (MAT) A locus
This discovery earned him the Nobel containing master regulatory genes in
Prize in physiology or medicine in 2005, yeast that determine the male and female
which he shared with Robin Warren. mating types.
Marshall became well known for having
tested the ulcer-causing properties of the
maturing face [trans face (Golgi)] The
bacterium on himself.
outermost membrane in a Golgi stack.
The maturing face of the Golgi stack is
mass spectrometry An analytical
the place where proteins that have been
technique for determining the molecular
structure of an unknown compound by processed in the Golgi exit for various cel-
observing the paths that fragments of the lular destinations. See Golgi apparatus.
molecule take when they are forced to
migrate in a magnetic field. Maxam-Gilbert sequencing A tech-
nique for determining the sequence of a
mast cell A connective tissue cell located nucleic acid by chemical treatments that
near capillaries and most abundant in the cleave the nucleic acid strand at only one
lung, the skin, and the gastrointestinal of the four nucleotide bases (i.e., adenine,
tract. Mast cells possess receptors for IgE cytosine, guanine, or thymine), depend-
and release histamine when bound to IgE. ing on the chemicals used. The fragments
The release of histamine is responsible for produced by chemical cleavage are then
the runny nose, itchiness, and other respi- separated by electrophoresis, and the
ratory symptoms of allergy. sequence is determined from the size of
the different fragments.
master regulatory genes A cluster
of genes that governs the development MBP vector Maltose binding protein
of the major structural features during vector; an expression vector designed to
embryogeneis, for example, the bithorax facilitate the purification of the proteins
complex in Drosophila melanogaster that are expressed via the vector. In MBP
that is responsible for development of the vectors, the gene to be expressed is fused
abdominal and thoracic segments. to the gene coding for the maltose bind-
ing protein. The fusion protein expressed
maternal effect Characteristics con- by the vector can be purified by running
trolled by the mother and expressed in a cell extract over an amylose column.
the offspring. Usually, maternal effects
are caused by mRNA or a transcription
factor produced by the mother and passed McClintock, Barbara (19021992) A
into the egg. geneticist whose work on the cytogenet-
ics of maize led her to postulate the idea
maternal inheritance Inheritance of that genes could be transposable, both
genes of extrachromosomal factors such within a chromosome and between chro-
as the mitochondria that are transmitted mosomes. Her work on transposable ele-
through the egg cytoplasm. ments won her the Nobel Prize in medi-
cine in 1983.
mating type One of two alternative
states ( or a mating types) that the hap- MDM2 Murine double minute 2;
loid (budding) form of yeast can assume MDM2 is a nuclear phosphoprotein
for the purpose of mating. During mat- with an apparent molecular mass of
ing, diploid cells are formed by fusion of 90 kD that forms a complex with the

155
www.stemcell8.cn
mDNA

p53 tumor-suppressor protein. Human activates MEK. Activated MEK is a phos-


MDM2 was identified as a homolo- phorylase that phosphorylates a MAP
gous product of the murine double min- kinase, the next intermediate in the path-
ute 2 gene. The MDM2 gene enhances way. See signal transduction.
the tumorigenic potential of cells when
it is overexpressed and encodes a puta- melanin The brown, reddish, or black
tive transcription factor. Forming a tight pigment that, in mammals, gives skin and
complex with the p53 gene, the MDM2 hair their characteristic color(s). Melanin
oncogene can inhibit p53-mediated trans- is derived from the amino acid, tyrosine,
activation, and MDM2 also binds to p53 and is also found in parts of the brain and
protein. Inactivation of tumor-suppressor the eye, where its function is unknown.
genes leads to deregulated cell prolifera-
tion and is a key factor in human tumori- melanocyte A specialized cell type
genesis. p53 can be subjected to negative found beneath the epidermal layer of skin
regulation by the product of a single cel- that produces melanin for the purpose of
lular proto-oncogene. The interference of skin pigmentation. Melanin made in the
binding to p53 prevents the interaction melanocyte is passed on to the upper layers
of MDM2 and its regulation of the tran- of skin through dendritic cell processes.
scriptional activity of p53 in vivo. Direct
association of p53 with the cellular pro- melanoma A highly malignant skin
tein MDM2 results in ubiquitination and cancer originating in the melanocytes.
subsequent degradation of p53. MDM2
p53 complexes were preferentially found melting of DNA The breakage, by
in S/G2M phases of the cell cycle. The heating, of the hydrogen bonds that hold
MDM2 gene is alternatively spliced, pro- the double-stranded helical structure of
ducing five additional splice-variant tran- DNA together. On melting, DNA changes
scripts from the full-length MDM2 gene. from double stranded to single stranded.
The alternatively spliced transcripts tend
to be expressed in tumorigenic tissue, melting temperature Defi ned as the
whereas the full-length MDM2 transcript temperature at which 50 percent of the
is expressed in normal tissue. double-stranded DNA is turned into
single-stranded DNA.
mDNA The DNA that represents genes
that are expressed in a variety of tis- membrane In general a flexible sheet or
sues. The mDNA is presumed to repre- layered material that separates two chemi-
sent genes that are required for processes cally different environments. Biologically,
required in all cell types. membranes are made up primarily of lip-
ids and proteins and are the structures
medium The nutrient broth used to that defi ne the compartments of the cell,
grow cultures of cells, bacteria, or micro- the organelle, and the nucleus. Synthetic
organisms. membranes are used biochemically to
separate chemically different liquids and
meiosis The process of cell division that gases from one another for experimental
takes place in the reproductive tissue and purposes.
that produces gametes (sperm and egg in
animals). The meiotic process leaves each membrane filtration A method of
daughter cell that becomes a gamete with clarifying microbial cell extracts. The
half the number of chromosomes as are procedure may not be optimal because
found in other cell types in the body. microbial preparations can be gelatinous
and block the fi lter. To compensate for
MEK An intermediate in ras signal this problem, membranes with an asym-
transduction pathways. In these path- metric pore structure have been used
ways, phosphorylation of MEK by raf successfully in large-scale operations to

156
www.stemcell8.cn
metabolic disease

isolate certain enzymes from lysed micro- mercaptoethanol A widely used


organisms. reducing agent, particularly useful in bio-
chemical procedures where breakage of
membrane potential The electric disulfide bonds is desirable.
potential (voltage) created by the differ- SS --------------> SH HS
ence in ion concentration on different
sides of a membrane. Membrane poten- 6-mercaptopurine A purine analog
tials drive certain kinds of transport whose DNA-damaging effects particu-
systems through the membrane and are larly target the production of T lympho-
responsible for nerve impulses. See pro- cytes. For this reason, 6-mercaptopurine
ton gradient. is given as an immunosuppressant drug
to prevent graft rejection.
membrane ruffling A wavelike move-
ment observed at the leading edge of a cell meristem The mitotically active tissue
membrane during movement; the location in higher plants that, through cell divi-
of the ruffled portion of the membrane sion, forms new plant tissues. Meriste-
indicates the direction of cell movement. matic cells are found in the root (apical
meristem) and along the outside of the
memory, immunologic The ability of stem (lateral meristem).
the immune system to respond to antigens
to which it has previously been exposed; meristem culture A technique used
the maintenance of immunity to an anti- to produce pathogen-free plants. The
gen over long periods of time. meristem is a dome of actively dividing
cells that is resistant to contamination by
memory cells Small populations of B microbes. When the lab growth of meri-
cells and T cells of the immune system stems is combined with micropropagation
that produce antibodies or have receptors techniques, large numbers of disease-free
for an antigen that appears after an initial plants can be cultured.
exposure of the organism to that antigen.
merozygote The stage in bacterial con-
Mendel, Gregor (18221884) The jugation in which the recipient bacterium,
founder of the field of genetics. His prior to division, contains two bacterial
experiments on crossbreeding of peas led chromosomes.
to the fi rst formulation of the principles
of heredity based on the idea of indepen- Meselson, Matthew (b. 1930) A bio-
dent assortment of genetic units (chro- chemist who, in collaboration with Franklin
mosomes) that are still in use today. Stahl, carried out the critical experiments
that demonstrated the semiconservation
Mendelian genetics Genetics based nature of DNA replication in 1957.
on the concepts originally proposed by
mesophile Bacteria that grow in the
Gregor Mendel, that is, that genetic traits
narrow temperature range of the mam-
are contained on completely independent,
malian body; from about 37 C to 44 C.
randomly reassorting genetic elements
(i.e., chromosomes). Recombination is not messenger RNA (mRNA) A ribonu-
taken into account in classical Mendelian cleic acid strand that carries the genetic
genetics. code for a protein. The mRNA is copied
from DNA in the nucleus, is processed,
Mendels law The principle that genetic and is then transported to the cytoplasm
elements controlling individual traits can where its code is read on ribosomes and
reassort themselves independently of one translated into a polypeptide.
another during the reproductive process.
The postulated genetic elements were later metabolic disease A disease stemming
found to be based on physically discern- from a defect in an essential metabolic
ible structures: chromosomes. pathway.

157
www.stemcell8.cn
metabolic pathway

metabolic pathway A series of succes- metaphase The phase in mitosis in


sive biochemical steps in the metabolism which the chromosome pairs are aligned
of a nutrient molecule. In a metabolic along the axis of the cell just prior to telo-
pathway, the input molecule is progres- phase.
sively altered until a specific fi nal metab-
olite is produced. metastasis The spread of cancer cells
from a primary lesion to other parts of
metabolism The process of altering a the body.
nutrient molecule via a metabolic path-
way for the purpose of energy production methane The simplest hydrocarbon made
or the creation of important biomolecules, up of one carbon and four hydrogen atoms
for example, amino acids, hormones, and (CH4). Methane is a gas that is generated
nucleic acids. from carbon dioxide by certain bacteria
during the oxidation of fatty acids.
metabolite One of the intermediate
molecules generated during the metabo- methanogenic bacteria Bacteria that
lism of a nutrient. generate methane gas during metabolism.
metabolomics A recently formed subdi- methanol The alcohol of methane
vision of bioinformatics devoted to high (CH3 OH), also known as wood alcohol.
throughput analyses of metabolites accord-
ing to their physical and chemical proper- methanophile (methanotroph) Any
ties using various techniques, including of a class of bacteria that derives its
gas chromatography, high-pressure liquid energy from the metabolism of methane.
chromatography, capillary electrophore-
sis, and mass spectrometry. methicillin A synthetic derivative of
penicillin created by the addition of a
metalloenzyme An enzyme requiring dimethoxyphenyl group to the side chain
a metal atom(s) for normal activity. of penicillin. Because methicillin is not
susceptible to the action of penicillinase,
metallothionein Any of a class of metal
methicillin can be used in cases of infec-
binding proteins that play a role in pre-
tion by penicillin-resistant bacteria.
venting toxicity due to metal accumulation
in cells. Because metallothionein synthesis
is induced by the presence of metal ions, methionine One of the two sulfur-
the metallothionein promoter has been containing amino acids whose side chain
widely used to control the expression of is: CH 2 CH 2 SCH3. Methionine is an
essential amino acid that is important as
genetically engineered genes.
a methyl group donor.
metamerism A concept that usually
applies to arthropod development but methionine-enkephalin (met-enkephalin)
which refers to unique features on serially A short peptide with the structure: Tyr-
repeating segments; for example, the seg- Gly-Gly-Phe-Met. Met-enkephalin is one
ments of the embryo of Drosophila mela- of a class of pain inhibiting neuropeptides
nogaster, which are initially identical in known as endorphins that act by binding
appearance but later develop appendages to the opiod receptor in the brain.
associated with the head, thorax, and
abdomen. Metamerism is the result of the methotrexate An antibiotic and chemo-
action of various segmentation genes such therapeutic agent that blocks the enzyme
as the homeobox genes. dihydrofolate reductase (DHFR), which is
necessary for purine biosynthesis. Because
metamorphosis The maturational pro- certain cancer cells have a high require-
cess in amphibians and insects as exem- ment for this enzyme, methotrexate can
plified by the transition from tadpole to specifically target metabolism of these can-
adult frog. cer cells to inhibit their growth. Resistance

158
www.stemcell8.cn
Michaelis-Menten constant

to methotrexate arises when the DHFR enzyme that catalyzes this reaction is meth-
mutates to a form that no longer responds ylmalonyl-CoA mutase, encoded by a gene
to methotrexate. However, it has been located at gene map locus 6p21.
shown that when methotrexate is added to
certain cell lines, resistance arises due to methyl tetrahydrofolate A form of
the amplification of the gene for DHFR, the B vitamin folic acid that acts as a
thus producing more copies of the protein. coenzyme in methyl group transferring
This phenomenon has been exploited by reactions in the synthesis of purines.
biotechnologists, and methotrexate is used
to amplify genes or parts of chromosomes methyl transferases A set of enzymes
cloned near the gene for DHFR. that catalyzes the transfer of methyl
groups from S-adenosylmethionine (SAM)
methyl-accepting chemotaxis proteins to another substrate, particularly nucleic
(MCPs) A class of bacterial transmem- acids or nucleic acid precursors.
brane proteins involved in chemotaxis.
The portion of the MCPs that extend into methylcellulose An inert polymeric
the bacterial cytosol becomes methyl- substance used to increase the density
ated when the portion of the protein that of culture medium to maintain growing
extends outside the cell binds an attractant microorganisms in suspension.
substance. However, it becomes demethyl-
ated if a repellent substance is bound. 5-methylcytosine (5MeC) A modified
form of cytosine to which a methyl group
methylation of nucleic acids The has been added by a methylase. These
addition of methyl groups to nitrogen modified residues are found at specific sites
atoms on the bases in nucleic acids. Meth- along the DNA and provide hotspots for
ylation of nucleic acids is known to serve transition type mutations. They are readily
at least three functions: spontaneously deaminated, resulting in the
(1) Methylation of the bases in DNA is conversion of 5MeC to thymine, leaving a
believed to be a mechanism for control- mispaired G-T base pair. On subsequent
ling gene expression (methylated DNA is DNA replication, one newly synthesized
not expressed). strand will contain the A-T mutation.
(2) Methylation of the 5 terminal gua-
nine in mRNA is required for the mRNA MHC See major histocompatibility
to be functional. complex.
(3) Methylation of restriction enzyme
sites in the DNA of bacterial cells that micelle A more or less spherical struc-
make restriction enzymes as a defense ture that amphipathic lipids spontane-
against invading bacteriophage; meth- ously assume when mixed with water. In
ylation of the sites on the bacterial DNA a micelle, the polar portion of the lipid is
prevents cleavage of the DNA by its own oriented outward in contact with the water
restriction enzymes. molecules, but the hydrophobic portions of
the lipids are in the interior of the spheroid.
methylmalonic academia An autoso-
mal recessive genetic disorder of the metab- Michaelis-Menten constant (K M) A
olism of any of four amino acids (methio- reaction rate constant pertaining to
nine, threonine, isoleucine, and valine) in enzyme-catalyzed reactions:
which the blood and body tissues become k1 k2
acidic. The acute form is characterized by E + S <-------------------> ES -----------------> E + P
drowsiness, coma, and sometimes seizures. k1
Over the long term, mental retardation may where
be a consequence. The metabolic defect E = free enzyme
is the inability to convert methylmalonyl- S = substrate
CoA to succinyl-CoA, which leads to the ES = enzyme-substrate complex
accumulation of methylmalonic acid. The P = product of the reaction

159
www.stemcell8.cn
Michaelis-Menten equation

k1,k1, k 2 = reaction rate constants for microfibrils A bundle of fi ne cellulose


the individual reactions fibers that make up the plant cell wall.
K M is defi ned by K M = (k 2 + k1)/k1.
microfilament An actin-containing fila-
Michaelis-Menten equation Defi nes ment that makes up one type of cytoskel-
the relationship between K M , the reaction eton in mammalian cells. Microfi laments
rate velocity (v), the maximum reaction are believed to be the basis for movement
rate attainable at a given concentration of cells in culture.
of enzyme, and the concentration of sub-
strate [S] microglobulin A short peptide that is
v = Vmax[S]/([S] + K M ) noncovalently bound to the class I major
histocompatibility complex glycoprotein.
microaerophile A microorganism that is
neither aerobic or anaerobic but can grow microgram 0.000001, or 10 6 grams.
under conditions of very limited oxygen.
microheterogeneity Slight variation in
microarray, cDNA A tool for analysis the nucleotide sequences of a repeated
of patterns of gene expression in which unit of DNA. For example, the spacer
the levels of gene products of a large num- regions in the histone genes are copies of
ber of genes are assayed simultaneously. one another, but there is some slight vari-
Microarrays consist of cDNAs (cDNA ation in their restriction fragment profi les
microarrays), proteins, or antibodies to that is referred to as microheterogeneity.
proteins (antibody microarrays) that are
bonded to a solid substrate (such as glass, microinjection The injection of mate-
plastic, or nylon membranes) in a regu- rials directly into individual cells using a
lar array of spots. The arrays are reacted small glass micropipet.
with labeled probes representing the pro-
teins or RNAs present in a population of micromanipulator An instrument for
cells or tissues and scanned to quantitate guiding extremely small instruments,
the relative signal intensity corresponding for example, microinjection pipets and
to probe bound to each spot. Computer microelectrodes into individual target
analyses of signal intensities can generate cells under a microscope.
gene expression profiles that can be used
to characterize cellular responses to drugs, micron (m) 0.000001, or 106 meters.
genes expressed in disease states, or genes
involved in normal regulatory processes. microporous gels A chromatography
matrix made up of cross-linked dextrans
microbe A microorganism. Often used or polyacrylamide used to fractionate
as synonymous with germ. proteins.

microcapsule A very thin version of the micropropagation A technique used


in plant breeding to produce many genetic
capsule that covers the bacterial cell wall; a
clones of the same plant. Small pieces of a
gellike, largely polysaccharide matrix that
plant are taken from a shoot tip, leaf,
protects the bacterium from phagocytosis. lateral bud, stem, or root tissue and are
grown in culture medium. Subculturing
micrococcal nuclease An endonucle- of the buds or shoot is repeated many
ase isolated from Staphylococcus aureus times until many plants are produced, all
that cleaves DNA strands by breaking having the genetic characteristics of the
the deoxyribose-phosphate backbone of original plant.
DNA at the 5 carbon atom. Micrococ-
cal nuclease is sometimes used in place microsatellite markers A type of
of DNase I for mapping protein binding marker, used in DNA fi ngerprinting,
sites on DNA. See footprint. that is composed of short, repeat DNA

160
www.stemcell8.cn
milk agent

antigen and its corresponding antibody


bind to one another. The test is carried
out in a series of small wells in a plas-
tic tray (microtiter tray) in which a fi xed
endoplasmic amount of antigen (or antibody) is added
reticulum to wells containing dilutions of a sam-
ple of an unknown amount of the cor-
responding antibody (or antigen). Semi-
quantitative results are obtained as the
highest dilution at which a precipitate
mechanical disruption, can no longer be detected by eye.
e.g., sonication
microtome An instrument for creating
extremely thin slices (sections) of biological
specimens for microscopic examination.

microtubule Small tubules composed of


a protein called tubulin that are attached
to the centromeres of chromosomes and
are responsible for the segregating move-
ment of chromosomes during mitosis.

resealed ER fragments
microtubule-associated proteins (MAPs)
(microsomes) A large class of proteins that is believed
to stabilize microtubules by binding to
Microsomes their tubulin subunits. Because MAPs
can bind to several tubulin molecules
at once, MAPs also accelerate the rate
sequences interspersed throughout the at which microtubules are polymerized
genome. See DNA fi ngerprinting. from the tubulin subunits. MAPs are also
believed serve as a binding material that
microsomes An experimental prepa- glues microtubules to other proteins and
ration derived by fragmentation of the cellular structures such as the chromo-
endoplasmic reticulum (ER); the small, some centromere.
roughly spherical bodies consisting of bits
of ER membrane that form spontaneously microvillus A fingerlike projection that
when animal cells are broken. Micosomes is actually an actin filamentfilled out-
are categorized as either rough or smooth pocketing of the cell membrane. Because
microsomes depending on whether they microvilli are especially abundant on
are derived from rough or smooth ER. The absorptive cells such as intestinal epithelial
experimental significance of microsomes cells, microvilli are thought to function as
stems from the fact that, whereas the intact a mechanism for increasing the absorptive
ER itself is difficult to isolate, microsomes surface area of the cell membrane.
are not and thus provide a convenient
means of studying ER function. migration-inhibitory factor (MIF) A
factor(s) produced by certain T cells after
microspikes Very thin (0.1 m diam- stimulation by an antigen that inhibits the
eter 510 m long), actin-containing chemotactic response in macrophages.
projections that protrude out of the mem-
brane of cultured animal cells. mil The oncogene of the chicken sar-
coma virus. Mil is believed to function as
microtiter agglutination test A mi- a serine kinase.
croscale test for the presence of an anti-
body or an antigen that is based on the milk agent Mouse mammary tumor
presence of a precipitate formed when an virus (MMTV), a retrovirus that causes

161
www.stemcell8.cn
milligram

cancers in mice. It was fi rst identified as mismatch repair A type of excision


the agent that causes cancers in suck- repair process that targets any region
ling mice nursed by mothers carrying of DNA in which damage or mutation
the virus and was among the fi rst tumor has resulted in a region where nucleotide
causing viruses to be described. bases on complementary DNA strands
are improperly paired with one another.
milligram 0.001, or 10 3 grams. In the bacterium Escherichia coli, mis-
match repair involves the actions of the
Milstein, Cesar (19272002) The re- genes, mutH, mutL, mutS, and mutU. See
searcher who, together with Georges excision repair.
Kohler, developed the technique of cre-
ating hybridomas for the production of missense mutation A point mutation
monoclonal antibodies by fusion of mouse that results in the replacement of one
spleen lymphocytes with myeloma cells. amino acid with another in the protein
This work won him the Nobel Prize in that is coded for by the gene in which the
medicine in 1984.
mutation occurs.
minicells A daughter cell that is pro- mitochondrion A cytoplasmic organelle
duced by cell division of a certain type
that is responsible for the bulk of energy
of bacterial mutant that lacks a chromo-
production in eukaryotic cells. The mito-
some. Because minicells lack the bacterial
chondrion is the site at which the electron
chromosome, minicells that are found to
transport process and the Krebs cycle por-
contain DNA have been used to study
aberrations of DNA replication and the tions of sugar metabolism take place.
properties of nonchromosomal DNAs
mitogen Any agent, such as a growth
such as plasmids.
factor, that stimulates a cell to divide.
minichromosome The nucleosome-
bound form of polyoma or SV40 DNA
mitomycin C One of a class of anti-
that is found in the nuclei of the virus tumor antibiotics (the mitomycins) that
infected cells. is isolated from the soil bacterium Strep-
tomyces caispitosus. Mitomycin C exerts
minimal medium A bacterial medium its antibiotic effects as an inhibitor of
containing inorganic salts, inorganic DNA synthesis.
nitrogen, and a simple sugar; the minimal
requirements necessary to support bacte- mitosis The orderly parceling out of
rial growth. Minimal medium was clas- replicated chromosomes to daughter cells.
sically used for the detection of mutants See M phase.
that were unable to synthesize an essential
biochemical, for example, an amino acid mitotic apparatus A term used to
or nucleoside. See defi ned medium. describe the mitotic spindle apparatus
that consists of microtubule bundles
minisatellite DNA Tandem repeats of a attached at one end to the centromere
short core sequence. The number of repeats of the chromosome and at the other to
varies greatly between individuals, and the the centriole located at one of the two
lengths of the minisatellites have been used cell poles.
as a characteristic in DNA profiling.
mitotic index The percentage of cells
minisatellite variant repeat map- that are in mitosis at any given moment.
ping A technique used in DNA profi l-
ing in which not only the length of the mitotic recombination Crossing over
minisatellite is analyzed but also the of chromosomal segments between ho-
sequence variation, which may be only mologous chromosomes in a somatic cell.
one base difference between individuals Such recombination is a normal event in
that is examined. meiosis but occurs rarely in somatic cells;

162
www.stemcell8.cn
modafi nil

the recombined chromosomes are not percent of cases have mutations in MSH2
passed on to progeny. and about 60 percent of cases have muta-
tions in MLH1.
mitotic shake-off A method for ob-
taining a cell-cycle synchronized popula- MN blood group A group of red
tion of cells in tissue culture. The method blood cell surface glycoproteins (oligo-
depends on the fact that cells engaged saccharide derivatives of the protein gly-
in mitosis are not well attached to the cophorin) that form a blood group family,
bottom of the tissue culture vessel; there- distinguishable on the basis of naturally
fore, the subpopulation of cells that are occurring antibodies, which is distinct
easily detached by light shaking are, for from the ABO blood group.
the most part, those in mitosis. See syn-
chronous culture. mobile genetic element(s) Insertional
elements (IS).
mitotic spindle The microtubule part
of the mitotic apparatus. modafi nil A drug used to treat nar-
colepsy in which its activity is based on
MLH1, MSH2, and MSH6 Genes its ability to act as an agonist of recep-
involved in hereditary nonpolyposis tors for a class of neuropeptides known
colon cancer (HNPCC), a form of colon as orexins. Orexins stimulate wakeful-
cancer with an early age of onset that is ness and mood by binding to receptors
transmitted as an autosomal dominant. in a group of specialized neurons in the
There is a high frequency of association lateral hypothalamus. Modafi nil is also
with mutations in MLH1, MSH2, and currently being used to treat some of the
MSH6, three genes that code for proteins symptoms of Alzheimers disease and
involved in excision repairabout 35 depression.

Mitotic spindle

163
www.stemcell8.cn
molar

molar (M) The concentration of a solu- monoclonal antibody An antibody


tion given as moles of the solute per liter produced by the daughter cells derived
of solution. from a single antibody-producing cell.

mold The fi lamentous, multicellular monocotyledon A subclass of the


subfamily of the fungi. higher plants known as angiosperms,
characterized by the presence of a single,
mole A measure of the amount of a par- as opposed to a double, seed leaf.
ticular molecule such that 1 mole = 6.023
1023 molecules (Avagadros number). One monocyte A large leukocyte with pha-
mole of a substance has a weight, in grams, gocytic properties. It is distinguished
that is equal to its molecular weight. from other phagocytes by its size and the
presence of small cytoplasmic granules.
molecular evolution The field of study
devoted to establishing evolutionary monomer The single subunit of a poly-
relationships between species by analy- meric molecule.
sis of the relatedness (homology) of the
sequences of the nucleic acids or proteins
monosaccharide A single, or simple,
sugar. A term generally referring to a sub-
of different organisms.
unit of a polyasaccharide.
molecular genetics The study of the
Morgan, T. H. (18661945) A genet-
molecular basis of genetics; the structure
icist whose classic studies on the genetics
and function of the DNA sequences in
of the fruit fly, Drosophila melanogaster,
genes and control of gene transcription confirmed the Mendelian laws of transmis-
and expression. sion of traits from parent to offspring and
gave rise to the concept of the gene. He
molecular symmetries In a macromol- was awarded the Nobel Prize in medicine
ecule such as a protein consisting of iden- in 1933.
tical multimers, a term applied to differ-
ent arrangements of the subunits in such morphogenesis The developmental pro-
a way that the resulting structure can be cess by which an appendage, limb, or
divided into identical halves along an axis. organ comes to assume a specific form and
Multimeric proteins can display a number structure.
of different types of symmetry, including
rotational, helical, cyclic, dihedral, and morphogens Certain factors of mater-
icosohedral. nal origin that are present in an egg that
help to determine the location where
molecular weight A measure of the limbs and other structures of the mature
mass of a molecule based upon a system organism will appear in the developing
where the mass of the hydrogen atom is embryo.
taken as 1 and all other atoms are then
assigned a molecular weight relative to morphology The study of morphogen-
hydrogen. See dalton. esis.

molecule Any group of covalently mosaicism The property of a tissue


bonded atoms. being a mixture of clonal populations
of cells. By the Lyon effect, only one
molt In arthropods, a shedding of the X chromosome of the pair will be
outer covering (the exoskeleton) during expressed in any one cell lineage; there-
maturation to accommodate growth of fore, the presence of cells with different
the body. X chromosomes activated in a cell popu-
lation indicates that the cell population
monocistronic RNA A bacterial mRNA is a mixture of cell clones. Conversely,
that codes for a single protein. the presence of cells in which the same

164
www.stemcell8.cn
mutagen

X chromosome is always active indicates also the centrosome in most cells, serves
that the cell population is of clonal ori- as a nucleation center for the polymeriza-
gin. This type of analysis has been used tion of microtubules.
to demonstrate that most tumors prob-
ably derive from a single cell. MuD phage A variant of the bacterio-
phage, Mu that has been engineered as a
mos oncogene An oncogene that is vector to be used for the determination of
found in a retrovirus that causes sarcoma promoter activity using the beta-galacto-
tumors in mice. The name is an acronym sidase gene as a reporter gene.
derived from: moloney sarcoma virus.
multidrug-resistant gene Genes that
MPF Maturation-promoting factor; a confer resistance to the lethal effects
factor isolated from the cytoplasm of of certain drugs, particularly chemo-
progesterone-stimulated Xenopus laevis therapeutic agents, for example, metho-
oocytes that was shown to stimulate mei- trexate. Multidrug-resistant genes arise
otic cell division in unstimulated oocytes through massive amplification of a single
when microinjected into the cytoplasm. copy gene and are present in homog-
The maturation-stimulating factor in enously staining regions or double minute
MPF was later shown to consist of a chromosomes.
cyclin B-cdk complex.
multilocus probes (MLP) A tech-
M phase The period of the cell cycle nique used in DNA profi ling in which
covering mitosis. M phase is divided into the DNA from an individual, blotted to
five subphases: prophase, prometaphase, a membrane (see Southern blot), is
metaphase, anaphase, and telophase. mixed with a probe under conditions that
will allow it to bind not only to the target
M-phase promoting factor A protein but also to similar sequences as well.
factor isolated from eggs of the frog, Xen-
opus laevis, that forces cells at any stage
multinucleate Having more than one
in the cell cycle into mitosis (M phase).
nucleus within the same cytoplasm. See
msr, msd Loci that code for an unusual heterokaryon and syncitium.
RNA-DNA hybrid molecule in which
RNA transcribed from msr is covalently mung-bean nuclease An enzyme that
linked to msd DNA. This type of struc- catalyzes the breakdown of single-
ture was fi rst discovered in myxobacteria stranded DNA into single nucleotides and
but has also been discovered in the soil short oligonucleotides that have phos-
bacterium Stigmatella aurantiaca. phate groups on their 5 ends.

mtDNA Mitochondrial DNA. murine Of or pertaining to the genus


Mus, which includes mice, rats, and other
MTF-1 Metal-regulatory transcription rodents.
factor 1; a zinc finger transcription factor
that is activated by various heavy metals murine leukemia virus (MuLV) A
such as zinc, cadmium, and copper but retrovirus that causes leukemia in mice
also by stressors such as oxidative stress and that carries the abl oncogene.
and hypoxia. MTF-1 activates a number
of genes, including metallothionein genes murine sarcoma virus Also known as
and other target genes. the Moloney sarcoma virus, the retrovi-
rus that carries the mos oncogene.
MTOC Microtubule organizing center;
an amorphous mass to which microtu- mutagen Any chemical, physical, or
bules are found to be attached in a hub- biological agent that causes permanent,
and-spokelike structure in the cytosol heritable alterations in the sequence of
of interphase cells. The MTOC, which is bases in DNA.

165
www.stemcell8.cn
mutagenesis

mutagenesis The process of introducing required for hematopoietic cell prolifera-


mutations by exposing cells to a mutagen(s). tion. The human myb gene is located at
6q22-23.
mutagenesis, site-directed A tech-
nique for introducing specific changes myc The oncogene carried by the avian
in base sequence in a cloned segment of leukosis retrovirus that causes a type of
DNA, usually by replacing a portion with leukemia in birds. The human myc proto-
a synthetic oligonucleotide. oncogene encodes a nuclear transcrip-
tion factor. Activation of the myc gene by
mutagenesis in vitro Mutagenesis translocation to regions of chromosomes
of cells in culture that may differ from 2, 14, or 22 causes a type of leukemia
mutagenesis using the same mutagen in known as Burkitts lymphoma. The myc
the intact organism in terms of the type gene is located on chromosome 8q24.12-
q24.13.
and number of mutations.
mycelium A mass of hyphae.
mutations, somatic Mutations that
occur in the cells of the body as opposed mycobacteria A group of rod-shaped
to the germline, or reproductive cells. acidophilic bacteria that includes the bac-
Somatic mutations are not passed on to teria that cause leprosy and tuberculosis.
an organisms offspring, whereas germ-
line mutations are. mycology The study of molds (fungi).

mutator loci Genes whose function is mycoplasma The smallest indepen-


associated with the fidelity of DNA syn- dently growing organisms known. Myco-
thesis; for example, plasmas were isolated and characterized
mutD = subunit of DNA polymerase III on the basis of their role in causing a type
mutU = DNA helicase of pneumonia. Mycoplasmas are also
mutY = endonuclease that cleaves mis- known as PPLO (pleuropneumonia-like
matches between A and G organisms).

mutator phenotype A strong tendency mycotoxin Any toxic substance pro-


to undergo mutation. The mutator phe- duced by a fungus or mold. Among the
notype is expressed by any organism that mycotoxins that have been used in molec-
carries a mutation in a gene involved in ular biological research are muscarine,
maintaining the fidelity of DNA synthesis. phalloidin, ergotamine, and various anti-
biotics.
muteins Modified therapeutic proteins myelin A class of lipids that comprise
with improved or novel biological activi- the outer sheath that surrounds the axon
ties that have been produced by mutagen- of neurons. In this location, it serves as
esis in the lab. an electrical insulator without which
nerve impulses could not be propagated.
myasthenia gravis An autoimmune
disease of the nervous system charac- myelin basic protein (MBP) A small
terized by a progressive paralysis of the (20 kDa) protein that is the most abun-
motor nerves. The disease is caused by dant component of the myelin sheath of
the formation of antibodies to ones own the neurons of the central nervous sys-
neurotransmitter receptors that act at the tem. MBP is believed to play an important
neuromuscular junction. role(s) in assembly and stabilization of the
myelin sheath. There are at least six iso-
myb The oncogene carried by the avian forms of MBP: C1, C2, C3, C4, C5, and
myeloblastosis virus that causes myelo- C6. Tests that measure the level of MBP
blastic leukemia in chickens. The human in the cerebrospinal fluid (CSF) are used
proto-oncogene (c-myb) codes for a tran- as indications of disease states involving
scription factor that is believed to be breakdown of the myelin sheath.

166
www.stemcell8.cn
myxovirus

Actin and myosin filaments in muscle

myeloid cell The collective term for all myoD One of a family of proteins,
classes of blood cells, not including T and referred to as myogenic proteins, that
B lymphocytes; that is, all bone marrow induces cells to differentiate into muscle
derived blood cells. cells. myoD exhibits the helix-loop-helix
motif characteristic of certain transcrip-
myeloma A tumor of the antibody tion factors and is believed to act, at least
secreting lymphocyte cells. Also known in part, by inducing the transcription of
as plasmacytoma. another mygenic gene, myogenin.

myeloma proteins An antibody mole- myoglobin The protein that carries and
cule of the Ig class secreted by a myeloma exchanges oxygen for CO2 in muscle tis-
tumor. Each myeloma antibody repre- sue. Like hemaglobin, myoglobin carries
sents the specificity of a single antibody oxygen on a heme group attached to a sin-
cell (monoclonal antibody). gle polypeptide (globin), but, unlike hema-
globin, is present only as a monomer.
myoblast Embryonic cells that fuse
with one another to form mature muscle myosin One of the two contractile pro-
cells. teins of muscle. Myosin bundles interdigi-
tate with actin bundles, and muscle con-
myoclonic epilepsy and ragged-red traction is the result of the two proteins
fiber disease (MERRF) A maternally sliding over one another.
inherited disorder of muscle functioning
caused by a mutation in the gene that myxobacteria Bacteria that normally
encodes lysyl tRNA, which in turn leads live in the soil as individual cells but that,
to malfunctioning of a number of other under conditions where nutrients become
important proteins in mitochondria (mi- limiting, form multicellular aggregates sim-
tochondrial encephalomyopathy) that impair ilar to primitive multicellular organisms.
the functioning of the electron transport
chain. The disorder is characterized by myxovirus A class of viruses that was
myoclonic seizures, ataxia, speech dif- identified and characterized on the basis
ficulty (dysarthria), hearing loss, and of their role in causing influenza. Myxo-
dementia. Biopsies of muscle show viruses are divided into two families:
ragged-red fibers. orthomyxoviruses and paramyxoviruses.

167
www.stemcell8.cn

N
A

NAD, NAD(P) Nicotamide adenine National Center for Biotechnology


dinucleotide (phosphate). A cofactor for Information (NCBI) Created as a
enzymes involved in oxidoreductions and national resource for molecular biology
electron transfer in numerous biochemi- information, this center creates public
cal reactions, but particularly those databases and conducts research in com-
involved in the oxidative metabolism of putational biology.
sugars for energy production. NAD is
a combination of two nucleotides, one National Human Genome Research
of which is derived from the B vitamin Institute (NHGRI) An institute of
niacin. the National Institutes of Health created
to head up the Human Genome Project.
It supports not only large-scale sequenc-
ing and analysis of the human genome but
also comparative genome projects, genome
informatics, and programs that anticipate
and address the ethical, legal, and social
issues that arise as the result of human
genome research.

native conformation The three-


dimensional shape that a biomolecule
naturally assumes in its normal biological
environment.
NAD (nicotamide adenine dinucleotide)
natural killer cells A type of thy-
mocyte (T lymphocyte) found in the
nalidixic acid A synthetic antibiotic spleen that is responsible for a particular
that mimics the action of the natural immune response to various tumor cells.
antibiotic novobiocin.
N-CAM Neural cell adhesion mol-
ecule; a protein present on the surface of
NANA N-acetylneuraminic acid. The neurons that causes them to aggregate.
molecule attached to a glycoprotein N-CAM is expressed at specific times
that forms the red-blood-cell membrane during development suggesting that it
receptor for influenza virus that accounts plays a role in the development of neural
for the ability of the virus to cause hem- structures such as ganglia.
agglutination. Neuraminidase cleaves off
the NANA residue, thereby inactivating nebulin A large fi lamentous actin-
the receptor. binding protein in the muscle sarcomere
that is believed to maintain the actin fi l-
nanogram 0.000000001, or 109 grams. aments at a uniform distance from the
myosin containing thick fi laments and
nascent protein A polypeptide in the that also may help to determine the length
process of being synthesized on ribosomes. of the actin fi laments.

168
www.stemcell8.cn
neuropeptide
verso
Y

negative complementation The sup- causes selective outgrowth of sensory and


pression of a normal gene by a mutant of sympathetic neurons. NGF is essential for
that gene. proper growth and survival of these types
of neurons during development.
negative regulation (negative regulators)
A term applied to regulation of gene expres- nested deletion A deleted region of a
sion based on repression rather than stimu- nucleic acid that occurs within a region
lation of gene expression. In negative regu- covered by a second, larger deletion of the
lation, the target gene is normally expressed same nucleic acid. The smaller deletion is
to its maximal extent, and under appropri- said to be nested within the larger deletion.
ate environmental conditions, expression is
controlled by lowering its level of expres- neu oncogene An oncogene isolated
sion. See lac operon. from rat cells by transfection into 3T3
cells. neu is not carried by a retrovirus
negative selection The selection of and is apparently activated by a point
cells or organisms within a population mutation of the proto-oncogene form of
that expresses a desired trait by elimina- neu. The neu sequence is homologous to
tion of members of the population that do the erb-B oncogene.
not express the trait. Negative selection is
commonly used to select microorganisms neuraminidase A glycoprotein present
that express a gene such as resistance to as a spike on the outside of the influenza
an antibiotic that allows them to survive virus envelope. Neuraminidase acts to
in the presence of that antibiotic while break down an inhibitor of the influenza
other microorganisms that do not have, virus hemagglutinin (HA) protein.
or express, the gene are eliminated. See
HAT selection. neuroblastoma Cancerous growth of
the neuroblast cells, or the cells of the
neomycin A synthetic antibiotic derived developing embryo that go on to form the
from streptomycin. Neomycin and other nervous system.
related antibiotics act on the ribosome to
inhibit bacterial protein synthesis. neurofi lament proteins Three pro-
teins that are the subunits of the neuro-
neoplasia Any abnormal growth of an fi laments, a type of intermediate filament
adult tissue. found in neurons. The function of neuro-
fi laments is unknown.
Nernst equation An equation that
relates the free energy change for a given neuron The brain cell type that car-
reaction ries the nerve impulses involved in higher
R1+R 2+R 3+. . .+Rn-------> thought and movement.
P1+P 2+P3+. . .+Pn
(where R i represents a reactant and Pi neuropeptide Any of a class of short
represents a product) to the concentra- polypeptides that function as neurotrans-
tions of the reactants and products: mitters. Thyrotropin-releasing hormone
G = G + 2.303RT log([R1][R 2]. . . (TRH) and luteinizing hormonereleasing
[R n])/([P1][P 2]. . .[Pn]) hormone (LHRH), which act to trigger
and the release of hormones from the pituitary
R = universal gas constant gland are examples of neuropeptides.
T = temperature in degrees Kelvin
G = a constant for a given reaction neuropeptide Y (NPY) A small (36
amino acid) peptide neurotransmitter
nerve growth factor (NGF) A fac- that potentiates the effects of noradrener-
tor, originally isolated from a tumor gic neurons in causing vasoconstriction.
transplanted into a chicken embryo, that NPY binds to six classes of receptors, Y1,

169
www.stemcell8.cn
Neurospora
recto

Y2, Y3, Y4, Y5, and Y6. NPY binding aminobutyric acid (GABA; arousal relax-
to the Y3 receptor inhibits catecholamine ation), and serotonin (mood).
synthesis while the Y2 subtype causes
inhibition of catecholamine release. NPY neutral substitution A change in a
release stimulates appetite in a region nucleotide base in the coding region of
of the hypothalamus called the arcurate a gene that does not produce a change in
nucleus. The gene for NPY is located at the activity of the protein.
gene map locus 7p15.1.
neutrophil One of the three subclasses
Neurospora A genus of mold that has of white blood cells known as granulo-
been used as a tool in genetic experiments cytes, also known as polymorphonuclear
because it is normally haploid and because leucocytes (PMNs). Neutrophils contain
it forms a structure (the ascus) from which large multilobed nuclei and phagocytose
single-celled spores can be readily isolated. small invading organisms such as bacteria.
Neurospora crassa was the organism origi-
nally used to demonstrate that genes coded nick A gap in the sugar-phosphate
for individual proteins. backbone of a nucleic acid.

neurotransmitter A type of chemical, nick translation A technique for label-


usually a small organic molecule, released ing double-stranded DNA fragments to be
from the terminal button of an axon of used as hybridization probes. DNA poly-
one neuron that induces a nerve impulse merase is used in the presence of labeled
in an adjacent neuron when it binds to a deoxyribonucleotides to fi ll in nicks pro-
specific receptor in the dendritic membrane duced by treatment with low levels of the
of the second neuron. Different neurotrans- endonuclease DNase I.
mitters are associated with different neural
functions, e.g., dopamine (movement and nicotinic receptors One of the two
mood), acetylcholine (movement), gamma types of cholinergic receptors in brain

double-stranded
DNA

single-stranded nicks

Nick translation

170
www.stemcell8.cn
nondisjunction
verso

cells; named because of its sensitivity to a variety of biological materials, includ-


nicotine. ing proteins and nucleic acids. Because
of this property, nitrocellulose is widely
ninhydrin A chemical that forms a used as a binding material for carrying
purple pigment after reacting with amino out colony and plaque hybridizations and
groups. This reaction is used in the detec- Southern, northern, and western blots.
tion and quantitation of proteins.
nitrogen cycle The global process of
ninjurin Nerve injury-induced protein; nitrogen recycling. The nitrogen cycle
a protein that is upregulated after nerve involves the breakdown of organic mate-
injury in neurons of the dorsal root gan- rials with the liberation of ammonia
glion in Schwann cells. It has properties and other inorganic nitrogen-contain-
similar to other biomolecules that serve ing compounds. Ammonia is converted
as adhesion molecules and is believed to into nitrates and nitrites and then into
play a role in nerve regeneration. The gene nitrogen gas by soil bacteria. Atmo-
that encodes ninjurin is NINJ1, located spheric nitrogen is then converted back
at gene map locus 9q22. A second gene into ammonia by nitrogen-fi xing bacte-
that codes for the protein ninjurin-2 is a ria associated with the roots of certain
homologue of ninjurin that contains the plants, thereby completing the cycle.
same transmembrane region as ninjurin
but does not contain the same adhesion nitrogen fi xation The process by
motifs. Ninjurin-2 shows the same nerve which nitrifying bacteria convert nitro-
injury-induced upregulation as ninjurin. gen gas in the atmosphere into ammonia.
Nitrogen fi xation utilizes two systems: (1)
Nirenberg, Marshall (b. 1927) A the reductase that generates electrons and
biochemist who carried out the first exper- (2) the nitrogenase that uses the electrons
iments using synthetic oligoribonucleo- generated from the reductase to reduce
tides that ultimately led to the decipher- nitrogen (as N2) to ammonia (NH 3).
ing of the genetic code by others using
variations of the technique pioneered by NMDA receptor A specialized type of
Nirenberg (see Khorana, Har Gobind). glutamate receptor on the postsynaptic
He was awarded the Nobel Prize in physi- membrane of neurons that is known to
ology and medicine in 1968. mediate long-term potentiation, a process
involved in memory. NMDA is derived
nitrifying bacteria Bacteria that carry from N-methy-D-aspartate, a synthetic
out the process by which nitrogen gas in glutamate analog used to study this
the atmosphere becomes converted into receptor.
ammonia. This is the only means by which
nitrogen can become incorporated into bio- NMR See nuclear magnetic resonance.
logically useful molecules such as proteins
and nucleic acids. See nitrogen fixation. nonautonomous controlling ele-
ments Defective transposons that are
nitro-blue tetrazolium (NBT) A chem- unable to transpose but that can do so
ical that forms a blue precipitate when cer- when a normal transposon is also present.
tain substrates are acted upon by alkaline
phosphatase. For this reason, NBT is used noncompetitive inhibition Inhibition
as a colorimetric indicator in techniques of enzymatic activity by a substance that
that utilize alkaline phosphatase labels. acts at site on the enzyme different from
See alkaline phosphatase. the active site.

nitrocellulose fi lter A thin flexible nondisjunction An error of chromo-


membrane made of nitrocellulose, a mate- some segregation during cell division
rial that noncovalently binds tightly to (either meiosis or mitosis) in which the

171
www.stemcell8.cn
recto
nonessential amino acid

daughter chromosomes (sister chroma- TAG, or TGA). This type of mutation


tids) fail to move to opposite poles. causes premature termination of synthe-
sis of the protein in which it occurs.
nonessential amino acid An amino
acid that can be synthesized from other nonsense suppressor A mutant tRNA
amino acids or other precursors. For this that permits the placement of an amino
reason, the nonessential amino acids, in acid in a polypeptide when one of the
contrast to the essential amino acids, can nonsense codons is encountered during
be omitted from the diet without causing translation of an mRNA. Such tRNAs
death. can reverse the effects of nonsense muta-
tions (suppressor effects).
nonheme iron Iron atoms that are
found in iron-sulfur proteins as opposed nontranscribed spacer See spacer DNA.
to heme groups. The iron-sulfur proteins
are electron carriers in the process of noradrenaline (norepinephrine) A
electron transport. chemical that is both a neurotransmitter
and a hormone released by the adrenal
nonidet P40 (NP40) A nonionic deter- glands. As a neurotransmitter, noradren-
gent (octylphenyl-ethylene oxide) that aline acts on certain neurons of the sym-
selectively breaks open the plasma mem- pathetic nervous system. As a hormone,
brane in animal cells but not the nuclear noradrenaline acts on cells of the liver
membrane. For this reason, NP40 is often and muscle to stimulate both sugar mobi-
used for rapid isolation of nuclei and lization and storage.
cytoplasmic fractions of cells.

nonpermissive cell A host cell type


that can become infected by a particular
virus but does not support its replication.
For example, monkey cells are permissive
for SV40 virus but mouse cells are non-
permissive for SV40.

nonpolar group A small group of Noradrenaline (norepinephrine)


atoms held together by linkages where
electrons are more or less equally dis-
tributed among the constituent atoms so northern blot An analytical tech-
that the linkages have no polar character. nique in which RNA is run on an aga-
Such groups are important in biological rose gel, blotted onto a membrane where
systems because they are not soluble in it is hybridized to a specific probe. This
water. technique is particularly useful as a
means of detecting the expression of a
nonreciprocal recombinant chromo- particular mRNA. See hybridization
somes The result of recombination and blot.
between misaligned chromosomes such
that a gene on one chromosome receives NOS Nitric oxide synthase; a group of
a duplication of part of the gene, while enzymes that catalyze the formation of
the copy of that gene on the other chro- nitric oxide (NO) from L-arginine. NO
mosome suffers a deletion of the same acts as a neurotransmitter in the brain
material. and as a signaling molecule in endo-
thelial cells that induces vasodilation,
nonsense mutation A mutation that platelet aggregation, and cardiovascular
causes a normal codon to change into one homeostasis. NOS is designated bNOS
of the three termination codons (TAA, (brain) or nNOS (neuronal), and there

172
www.stemcell8.cn
nuclear membrane
verso

are two forms produced by endothelial genes involved in nitrogen metabolism


cells: eNOS, which is constitutive, and under conditions of nitrogen deficiency
an inducible form designated iNOS. The in bacteria. When nitrogen-containing
activity of NOS in both the brain and compounds in the bacterial medium drop
endothelium requires binding of the cal- to low levels, the NtrB protein becomes
cium/calmodulin complex and is regu- activated; the activated form of NtrB is
lated by calcium levels. responsible for phosphorylation of NtrC
protein that stimulates the gene transcrip-
notch protein A transmembrane sig- tion. See nitrogen fi xation.
nal transduction protein that functions in
development of the Drosophila nervous nuclear lamina A thin matrix com-
system. Binding of critical ligands to the posed of dense fi laments just beneath the
extracellular domain (receptor region) envelope that surrounds the cell nucleus.
of notch is believed to result in selection
of the cell carrying the bound ligand for nuclear lamins The intermediate fi la-
development as a sensory organ cell. ments that comprise the nuclear lamina.
novobiocin An antibiotic produced by nuclear localization signal (NLS) A
Streptomyces niveus. Novobiocin acts by sequence of amino acids in some pro-
preventing ATP binding to the enzyme teins that serves as a signal for their
DNA gyrase, thereby stopping DNA syn-
import into the nucleus. After synthesis
thesis in the infectious bacteria.
of a nuclear protein in the cytoplasm, it
NSAIDs Nonsteroidal anti-inflammatory is actively transported through nuclear
drugs; a class of anti-inflammatory drugs pore complexes through a process that
that block the formation of the pro- involves the Ran GTPase. Most of the
inflammatory prostaglandin hormones by NLSs are rich in basic amino acids (e.g.,
inhibiting a critical step in the synthesis of lysine or arginine).
prostaglandins that is mediated by activ-
ity of enzymes known as cyclooxygenases nuclear magnetic resonance (NMR)
(COXs). The popular NSAIDs aspirin, acet- A type of spectroscopy based on the mag-
aminophen, ibuprofen, celecoxib (Cele- netic properties of atoms. In this tech-
brex), rofecoxeb (Vioxx), and naproxen nique, a compound is placed in a magnetic
are all COX inhibitors. As suggested by field, and the energy (i.e., the electric cur-
their name, these agents provide an alter- rent required to create a certain magnetic
native to steroid anti-inflammatory drugs field) required to change the magnetic ori-
that often have debilitating side effects. entation of individual atoms, usually only
the hydrogen atoms, is measured. Because
NSF A tetrameric cytosolic protein that the electric environment of different atoms
mediates the fusion of a transport vesicle differs from one another depending upon
and a vesicle of the Golgi. the other atoms to which it is attached,
each compound gives a different fin-
NTG An acronym for neomycin, thy- gerprint (spectrum) of field strengths at
midine kinase, glucocerebroside. which individual atoms reorient in the
magnetic field. In biological preparations,
NTG vector A mammalian expres- the absorption characteristics of a mole-
sion vector that combines the enhancer/ cule is influenced by its three-dimensional
promoter activities of the long terminal structure and the biochemical environ-
repeats (LTRs) from the Moloney murine ment that can be revealed by the NMR
leukemia virus with the bacterial-derived spectrum of a biochemical sample.
neomycin resistance gene (neor) as a select-
able marker. See APH. nuclear membrane (nuclear envelope)
A double-walled membrane that forms the
NtrB, NtrC proteins Regulatory enclosure surrounding the nuclear com-
proteins in the control of expression of partment. The outer membrane is joined

173
www.stemcell8.cn
recto pore complex
nuclear

to and may actually be thought of as part numerous loops of chromatin-bound DNA


of the endoplasmic reticulum. that contains clusters of tandemly repeated
ribosomal RNA genes. The nucleolus is
nuclear pore complex An octagonal therefore the structure responsible for the
array of large protein granules that sur- production of rRNA and is continually
round pores that perforate the double-lay- engaged in high levels of synthesis of rRNA.
ered nuclear membrane at various points.
The nuclear pore complex is a special- nucleophilic group Any cluster of
ized channel through which nucleic acids covalently linked atoms that tends to
and other materials shuttle between the donate electrons in a chemical reaction.
nucleus and the cytoplasm. Nucleophilic groups often initiate impor-
tant biochemical reactions by attacking
nuclear scaffold A fibrous network electron-deficient carbon atoms that are
that extends from the inside of the nuclear attached to oxygen atoms.
membrane and is distributed all through-
out the nucleus and that is attached to the nucleoplasmin An acidic nonhistone
cellular DNA at specific sites. The nuclear protein that binds to histones H2A and
scaffold is seen by electron microscopy in H2B during histone assembly with free
isolated nuclei that are carefully treated DNA to form nucleosomes.
with nucleases and either salt or detergents
to remove histones, some nonhistone pro- nucleoprotein particles Complexes of
teins, and the free (i.e., unattached) DNA protein and RNA, primarily in the nucleus,
strands from the chromatin. The function that play a role in the processing of RNA.
of the nuclear scaffold is unknown but is
believed to play a role similar to the chro- nucleor organizer region A cluster
matin itself in control of gene expression. of rRNA genes on a DNA loop in the
nucleolus.
nuclear transplantation A technique
for removing the nucleus from one cell nucleoside A ribose or deoxyribose
and placing it into the foreign cytoplasm molecule that is attached to any purine or
of a second cell (i.e., an enucleated cell). pyrimidine base via the fi rst carbon atom
of the sugar. The common nucleosides
nuclease Any of a class of enzymes that are found in DNA and RNA are:
that catalyze the breakdown of a nucleic
(deoxy-) adenosine, (deoxy-) cytidine,
acid(s) by cleavage of the phosphodiester
(deoxy-) guanosine, thymidine (deoxy-
bonds of the sugar-phosphate backbone.
form only), and uridine.
nucleic acid A molecule of either DNA
or RNA. nucleoside antibiotic An antibiotic
that is a nucleoside containing an ana-
nucleohistone (histone) Any of the five log of a purine or pyrimidine base. These
different proteins that make up a nucleosome, antibiotics act by inhibiting the normal
designated: H2A, H2B, H3, H4, and H1. mechanisms of DNA and RNA synthesis
in rapidly growing microorganisms. The
nucleoid body The analog of the nucleoside antibiotics (e.g., cytosine ara-
nucleus in bacteria. The nucleoid body, binoside), unlike other types of antibiot-
which contains the bacterial genomic ics, are active against viral infections.
DNA, is not enclosed in a membrane, and
the DNA is not complexed with chromatin nucleosome An octameric structure
but is distinguishable as a large centrally that is complexed around a strand of
located mass that appears less dense than DNA. Nucleosomes are evenly spaced
the surrounding cytoplasm. along the DNA strand, forming a linker
(nonhistone-complexed) region of 142
nucleolus A large structure within the base pairs. Nucleosomes are composed of
nucleus of eukaryotic cells consisting of two each of the different H histones

174
www.stemcell8.cn
nystatin
verso

the third carbon of the ribose or deoxyri-


bose sugar.
Nucleosomes

nucleus The central, membrane-enclosed


H2A H2B structure that contains the cell DNA
x2
H3 H4
in the form of chromatin in eukaryotic
cells.
DNA strand histone
core
H2A H2B
null DNA The DNA that represents
H3 H4
genes that are only expressed in single cell
or tissue type. Null DNA is presumed to
represent genes for specialized proteins
that are unique to a specific cell type, for
linker DNA
example, hemoglobin genes in red blood
cells.

null mutation The result of a muta-


tional event that results in the complete
and are believed to play a role in regu- elimination of a gene.
lating the expression of the genes with
which they are complexed. nurse cell Accessory cells in the ovary
that surround an oocyte and supply a
nucleosome phasing A model of nucleo- variety of macromolecules and nutrients
some structure in which a certain DNA to the oocyte via cytoplasmic bridges.
sequence is always located at a certain posi- Ribosomes, mRNAs, and proteins are
tion on the nucleosome. If this can be shown passed to insect oocytes in this way.
to be true, it implies that some mechanism
exists for aligning nucleosomes with certain nystatin An antibiotic with a polyene
sequences on the DNA in the nucleosome structure (i.e., containing many carbon-
complex. carbon double bonds) that is active
against fungal infections. Nystatin is
nucleotide A nucleoside with a phos- active against Candida infections when
phate group attached either to the fi fth or applied topically.

175
www.stemcell8.cn

O-antigen A branched polysaccharide oligotrophic An environment in which


attached to a specific lipid (lipid A) on the nutrients are in low abundance.
outer surface of the cell envelope of the patho-
genic bacterium Salmonella typhimurium onc function The property acquired
and other Gram-negative bacteria. by a proto-oncogene of inducing a can-
cer or promoting tumorigenesis when it
obligate anaerobe Bacteria that have becomes an oncogene.
an absolute requirement for oxygen and
are not fermenting (e.g., tuberculosis). oncogene The activated form of a
proto-oncogene. Mechanisms by which
ochre codon The nonsense codon TAA proto-oncogenes become activated include
that is a signal for termination of poly- transduction by a retrovirus, mutation,
peptide synthesis. and chromosomal translocation whereby
the proto-oncogene is placed into a new
ochre mutation Any mutation that genetic environment.
produces an ochre codon in place of a
codon for an amino acid. oncogenic Pertaining to any agent
chemical, physical, or biologicalthat
ochre suppressor See ochre codon, causes cells to undergo changes charac-
ochre mutation, suppressor gene, sup- teristic of cancer cells.
presor mutation, suppressor tRNA.
oncogenic virus Any of a broad range
Okazaki fragment A short (1,000 of viruses that cause cells to undergo
2,000 bp) DNA fragment produced changes characteristic of cancer cells or
during DNA replication of the lagging to cause tumors in animals. See onco-
(5 terminating) strand of the template gene and RNA tumor virus.
DNA. Okazaki fragments are initiated by
a short RNA primer that is hybridized oncostatin M (OSM) A cytokine that
to the lagging strand and then destroyed regulates growth of both normal and
after synthesis of the Okazaki fragment is tumor cells although in a cell-type specific
complete. See lagging strand. manner. OSM is a glycoprotein about 28
kDa in size that was originally isolated on
oligonucleotide A short strand of either the basis of its ability to inhibit the growth
DNA or RNA with a length in the range of A375 melanoma and other tumor cells
of two to about 30 bases. The term gener- while stimulating the growth of normal
ally refers to synthetic polynucleotides. human fibroblasts. The oncostatin M
receptor (OSMR) is coupled to the JAK/
oligopeptide A polypeptide of any- STAT signal transduction pathway. The
where between approximately two and OSM gene is located on chromosome
10 amino acids. 22q12. OSM belongs to the same family
of cytokines as interleukin-11 (Il-11), leu-
oligosaccharide A chain of sugars con- kemia inhibitory factor (LIF), interleukin-6
taining anywhere between approximately (Il-6), ciliary neurotrophic factor (CNTF),
two and 10 monosaccharide subunits. and cardiotrophin-1 (CT-1).

176
www.stemcell8.cn
orthophosphate

ontogenetic Of or pertaining to ontog- optical density The property of ab-


eny, the complete life cycle or process of sorption of light by a solution of any
development of an organism. given substance. The decrease in intensity
of a light beam at a certain wavelength
oocyte The diploid germ cells of the as it passes through a solution over a cer-
female that generate gametes (eggs) by tain distance is proportional to the molar
meiotic division. concentration of the solution. See Beer-
Lambert law.
oogamy The union of gametes to pro-
duce an embryogenic cell, as in fertiliza- organelle Any subcellular, membrane-
tion of an egg by fusion with sperm. enclosed structure in the cytoplasm of a
eukaryotic cell that carries out a specific
oogenesis The process by which cellular function, for example, mitochon-
the mature egg(s) is generated from an dria, chloroplasts, endoplasmic reticu-
oocyte. lum, and Golgi.
oogonium (oogonia, pl.) The female ornithine An intermediate in the urea
reproductive organ in which the eggs are
cycle, the series of reactions in which
formed in thallophyte plants.
nitrogen in the form of urea is formed.
Ornithine is derived from the amino acid
ooplasm The cytoplasm of an egg cell, arginine through the loss of urea.
or oocyte.
orotic acid A pyrimidine base, derived
open reading frame (ORF) Any from carbamoyl phosphate and aspartate,
nucleic acid segment whose codons spec- that is the common precursor of CTP
ify a continuous polypeptide; a nucleic and UTP, the triphosphate nucleotides of
acid sequence with a start codon. cytosine and uracil.
operator A portion of the promoter Orphan Drug Act An act of Con-
in an operon that acts as a regulator
gress directed toward rare human dis-
of expression of the operon by serving
eases (defi ned as having a prevalence of
as a site for the binding of a repressor
protein. less than 200,000 cases) that grants, as
an incentive, a seven-year period of mar-
operon A cluster of contiguous bacte- keting exclusivity to the developer(s) of
rial genes all under the control of a single therapeutic drugs.
promoter. The genes in an operon gener-
ally code for enzymes that catalyze steps orphons Genes that are members of a
in one biosynthetic pathway, for example, gene family but are in distant locations.
the synthesis of an amino acid.
ortholog Genes in different species that
opiate Any of the chemical derivatives were all derived from a common ancestral
of opium. gene. Normally, orthologs retain the same
function in the course of evolution. For
opines Unusual amino acids synthe- this reason identification of an unknown
sized in plants infected by the T DNA gene as an ortholog of one whose func-
portion of the Ti plasmid of the parasitic tion is known is an important means of
bacterium Agrobacterium tumefaciens. prediction of gene function.
The opines include octopine, nopaline,
and mannopine. orthophosphate Any salt of orthophos-
phoric acid (H3PO4); the name given to
opsonization The process by which an phosphoric acid that has been stripped of
antibody is taken up by a phagocyte in one or more of its hydrogen atoms as the
the presence of complement. result of its being placed in aqueous solu-

177
www.stemcell8.cn
osmolality

loose joints, bruising, hearing loss (caused


by problems with the bones of the middle
ear), and scoliosis. The affected genes are
the collagen genes COL1A1 and COL1A2.
The mutations in the COL1A1 gene tend to
reduce the amount of collagen produced,
Orthophosphate while, less commonly, mutations in either
COL1A1 or COL1A2 alter the structure
of the collagen proteins making the colla-
tion. Orthophosphate is the form of phos-
gen fibers weaker. The genes are located on
phorous that is present in most important
human chromosome 17 at gene map loci
phosphorous-containing biomolecules, for
17q21.31-q22, 7q22.1.
example, nucleic acids.
oubain A toxic glycoside that specifi-
osmolality The concentration differ-
cally inhibits the Na+ K+ ATPase. The
ence between osmotic compartments as
use of this inhibitor provided important
measured by molality; a 1-molal solution
information that helped elucidate the
is defi ned when one mole of the solute is
functioning of the ionic pump.
dissolved in 1,000 grams of the solvent.

osmosis The spontaneous diffusion oxic Referring to an aerobic microbial


of a substance from a compartment of habitat.
relatively high concentration to a com-
partment of relatively low concentration oxidative phosphorylation The for-
where, generally, the two compartments mation of ATP from ADP (+ phosphate)
are separated from one another by a semi- using the energy of the electron transport
permeable membrane. Many nutrients and process to drive the reaction.
other substances of biochemical impor-
tance enter into or pass out of cells by oxidizing agent Any chemical agent
osmosis. that takes electrons, either as electrons
or as electron-rich atoms, from another
osmotic pressure A pressure produced chemical with which it reacts.
on the side of a membrane with a higher
solute concentration caused by the pas- oxidoreductase The class of enzymes that
sage of water across the membrane by carry out electron transfers between two
osmosis. substrates. Oxidoreductases are the enzymes
that are responsible for many of the electron
osteoblast The cells that initiate the transfers that occur in the electron transport
formation of bone by secretion of the chain in which energy from the electrons
bone matrix, a material composed largely derived from the metabolism of sugars is
of collagen that is hardened into bony used for oxidative phosphorylation.
bone by the deposition of calcium phos-
phate crystals. oxygenases A group of enzymes that
add oxygen across double bonds of the
osteogenesis imperfecta A genetic dis- substrate molecule. This type of reaction
ease caused by mutations in collagen genes is an essential step in the energy-producing
that results in bone fragility, making them metabolism of certain molecules, for exam-
prone to fracture. Other symptoms include ple, fatty acids.

178
www.stemcell8.cn

p19ARF See INK4. missing in every other segment. See seg-


ments, segmentation.
p53 A human phosphoprotein of 53
kilodaltons in size, originally discovered palindrome A nucleic acid-base sequence
in studies of SV40 T antigen to which it that is a mirror image of itself; for example,
is tightly bound. It was at fi rst thought the base sequence GTGGCCGGTG is a pal-
to represent the product of an oncogene indrome because it consists of the sequence
but is now known to possess antionco- GTGGC and its reflection, CGGTG. The
genic, or tumor-suppressing activity. p53 recognition sequences of most restriction
normally functions as a gatekeeper to endonuclease enzymes are palindromes.
block cells that contain potentially muta-
genic DNA damage in the G1 phase of the pandemic A worldwide epidemic.
cell cycle. Human cancers often contain
mutations in p53, and the frequency of papilloma virus A member of the
occurrence of such mutations in tumors papova group of DNA viruses that pro-
is much higher than is true for any other duces generally benign tumors (papillomas)
known tumor suppressor. of the epithelial cell layer in rabbits, cattle,
and humans. Recently discovered members
packing ratio The length of a certain of the subclass representing human papil-
DNA divided by the length of the com- loma viruses (HPV) are now believed to
partment into which it is packaged by cause some malignant genital cancers.
folding. For example, if the DNA in the
smallest human chromosome is 14 mm par A partioning, functioning gene of
(4.6 x 107 bp) and the length of the chro- some plasmids that ensures the proper
mosome is 2 m then the packing ratio is: segregation of plasmids into cells during
14,000 m/2 m = 7,000. cell division.

paired-box homeotic gene (PAX5) A paralog Genes related to one another


member of the paired-box (PAX) family by duplication of an ancestral gene
of transcription factors that are impor- within a certain genome. Paralogs tend to
tant as regulators of genes involved in develop new functions as the organisms
development; the gene family named for that contain them evolve.
a highly conserved DNA binding motif
called the paired box. The PAX5 gene paranemic joint A side-by-side non-
encodes the B-cell lineage specific activa- helical arrangement of DNA strands
tor protein (BSAP) that is involved in dif- (as opposed to the usual plectonemic
ferentiation of B cells but is also believed relationship) that occurs when a single-
to play important roles in neural devel- stranded circular DNA undergoes recA-
opment and spermatogenesis. The PAX5 mediated recombination with a linear
gene map locus is 9p13. double-stranded DNA.

pair-rule mutants Mutants of the fruit parasegments An alternative scheme


fly, Drosophila melanogaster, in which for labeling the segments of the fruit fly,
features of normal development are Drosophila melanogaster; each paraseg-

179
www.stemcell8.cn
parasexual

ment begins in the middle of a segment. ther by injection of blood components,


This scheme gains its utility from the fact for example, blood serum or cells.
that some mutants of Drosophila are more
easily visualized in terms of parasegments. passive transport Movement of a sub-
See segments, segmentation. stance across a membrane from one side
where the substance is at a relatively high
parasexual The recombination of gen- concentration to the other side where the
etic material from different individuals concentration is relatively low. See osmosis.
that differs from sexual reproduction in
that the genetic material is not derived Pasteur, Louis (18221895) French
from specialized meiotic cell types, for chemist who demonstrated the principle
example, sperm and egg. Parasexual of sterilization, thereby destroying the idea
reproduction is characteristic of yeast. that life could arise spontaneously from
nonliving organic material (called sponta-
p-arm The short arm of the human neous generation).
chromosome.
Pasteur effect The observation that
parthenogenesis The process of reproduc- when a microorganism living under
ing without fertilization, that is, asexually. anaerobic (oxygen-free) conditions is sud-
denly exposed to oxygen, sugar consump-
particle bombardment A technique tion as well as accumulation of the sugar
breakdown product, lactate, drops.
used to transfer DNA into cells that are
resistant to other methods of DNA trans-
formation. This method has been used for
pasteurization The process of destroy-
ing disease-causing microorganisms by
certain plants and consists in coating the
heat. See sterilization.
DNA with tungsten or gold particles and
then projecting the DNA into the cells by patch clamp A technique for measur-
an apparatus. ing electric current flow across a neural
membrane. In the patch-clamp technique,
partition coefficient For some particu- two electrodes, one inside and one outside
lar substance that is dissolved in two dif- the cell are used to record the voltage;
ferent solvents but that do not mix with simultaneously, a third electrode, usually
each other, the partition coefficient is the inside the cell, is used to supply what-
ratio of the amount of the substance that ever current is needed to hold the mem-
remains dissolved in one solvent to the brane potential constant. The amount of
amount of the substance that remains dis- current required to maintain a constant
solved in the other solvent when the two voltage provides a measure of the current
solutions are mixed and then allowed to passing through the membrane.
separate from each other.
patent A document certifying an inven-
passive hemagglutination A test in tor or inventors to exclusive rights to an
which the presence (or absence) of an anti- invention and any profits that may be
body is detected by the ability of the anti- derived from its use, sale, or license.
body to cause red blood cells to clump
together (hemagglutination). Passive hemag- pathogen Any microorganism that causes
glutination differs from the usual hemagglu- disease or produces a pathological condition.
tination test because the surface of the red
blood cells must be artificially modified by pathway A series of biochemical reac-
chemical linkage of a protein (the antigen) tions occurring in a specified sequence by
for the hemagglutination to take place. which a particular molecule (the precur-
sor) is modified to become another; usu-
passive immunity Immunity that is ally for purposes of synthesizing essential
transferred from one individual to ano- biochemicals or for degrading them.

180
www.stemcell8.cn
pentose

pattern formation Generation of a par- P element(s) A type of transposable ele-


ticular three-dimensional body or structure ment found in the fruit fly, Drosophila.
during development of the embryo by the
coordination of cell division, cell determi- pellet The sediment portion of a bio-
nation, and cell differentiation. logical extract after the extract is sub-
jected to centrifugal force.
Pauling, Linus (19011994) Ameri-
can chemist who studied the behavior of pendred syndrome (PDS) An autoso-
electrons in chemical bonds. He won the mal recessive disorder that is characterized
Nobel Prize in chemistry in 1954 for his by deafness and thyroid goiter. The syn-
studies on the nature of structure of bonds drome is caused by mutations in the PDS
in proteins (the peptide bond). Linus Paul- gene that encodes pendrin, an anion trans-
ing is also known for a wide variety of porter localized at the apical membrane of
other contributions to the field of chem- thyroid follicular cells. Pendrin is believed
istry, including discoveries in the nature to mediate iodide transport into the lumen
of quantum levels in chemical bonds, Van of the follicle. There are at least 50 muta-
der Waals forces, electron resonance, and tions in pendrin associated with PDS. The
many others. Paulings The Nature of the gene for pendrin is located at gene map
Chemical Bond is thought by many sci- locus 7q31.
entists to be one of the most influential
scientific books of the 20th century. penicillinase An enzyme that inactivates
penicillin by breaking a key bond in the pen-
pBR322 A commonly used plasmid for
icillin molecule by the process of hydrolysis.
cloning recombinant DNAs in the bacte-
rium E. coli.
penicillins Products of the Penicil-
PCNA Proliferating cell nuclear anti- lium molds that act as an antibiotic by
gen; a protein that functions during DNA destroying bacteria by interfering with
replication in eukaryotes. PCNA binds the cross-linking of proteins in the bac-
DNA polymerase during synthesis of the terial cell wall, causing the bacterium
leading strand and increases processivity to break open, or lyse. The penicillins
of the polymerase. are all derived from a common chemi-
cal backbone (the lactam ring) by sub-
PCR See polymerase chain reaction. stituting various chemical groups (by
convention the position of the substitu-
pectin A jellylike substance released by ent groups are given the general desig-
plants. Pectin is made up of chains of the nation R in diagrams) at a certain posi-
sugar derivative, galacturonic acid. tion on the ring. See 6-aminopenicillic
acid and lactam antibiotics.
pectinase An enzyme that degrades
pectin by breaking the links between the pentose Any sugar with a five-carbon-
sugar units in pectin. atom backbone.

The penicillin backbone

181
www.stemcell8.cn
peptidases

Peptide

peptidases A class of enzymes that peptone The water-soluble portion of


breaks down proteins by cleaving the a protein that has been partially broken
peptide bonds between the individual down (i.e., hydrolyzed) such as by boil-
amino acids that make up the protein, for ing. See hydrolysate.
example, the digestive enzymes, chymo-
trypsin, trypsin, and pepsin. The break- perfusion culture A culture in which
ing of peptide bonds by peptidases occurs there is a continual inflow of fluid that
by a process known as hydrolysis. carries nutrients or other substances.

peptide A group of amino acids cova- pericentriolar material Material of


lently linked by peptide bonds in a linear unknown composition surrounding the
chain. centriole of the chromosome. This mate-
rial serves as the anchor points for the
peptide antibiotic A short peptide microtubules that pull the chromosomes
with antimicrobial properties, for exam- apart during mitosis.
ple, gramicidin A.
perinuclear space The space between
peptide bond A covalent linkage the inner and outer nuclear membranes.
between the NH 2 group of one amino
acid and the COOH group of another
amino acid. This type of linkage is
periodicity In a structure that has a
known as an amide bond when applied regularly repeating subunit, periodicity
to links between molecules that are not refers to the distance that represents one
amino acids. complete subunit.

peptide hormone A short peptide periplasmic space The area between


secreted into the bloodstream that induces the cell membrane and cell wall of Gram-
biological activity in a distant target negative (see Gram stain) bacteria, such
gland or organ; for example, the pituitary as Escherichia coli.
hormonesthe growth hormone (GH),
the thyroid stimulating hormone (TSH), PERL Practical extraction and report
and the adrenocorticotropic hormone language; a high-level, open-source com-
(ACTH). puter language that was released in 1987.
PERL is optimized for scanning and
peptidoglycan A peptide covalently extracting information from arbitrary text
attached to chains of sugars or sugar deriv- files and, for this reason, is often used in
atives. Peptidoglycans are structural com- bioinformatics. PERL is also optimized
ponents of bacterial cell walls. In Gram- for ease of use and combines features of
positive bacteria, the peptidoglycan portion other popular languages such as PASCAL,
of the cell wall is present in many layers. C++, and BASIC.
The peptidoglycans are the targets of the
penicillin antibiotics that are incorporated permissive host A cell that, when
into the bacterial peptidoglycan, where infected by a virus, allows the expression
they prevent critical peptide cross links that of a particular viral function(s), usually
weaken the bacterial cell wall. replication of the virus.

182
www.stemcell8.cn
phagocytic index

peroxidase An enzyme that acts to pro- PFGE See pulsed field-gel electro-
mote the breakdown of hydrogen peroxide phoresis.
(H2O2) into water according to the reaction
peroxidase pH A measure of the acidity of an aque-
H2O2 + substrateH2 ---> 2H2O + substrateox ous solution; if the pH value of a solution
is below 7, the solution is considered acid;
peroxidase labeling The attachment solutions with a pH value above 7 are
of a peroxidase enzyme (e.g., horseradish considered alkaline.
peroxidase) to a probe so that the pres-
ence of the probe can be visualized by a phage Short form of bacteriophage (lit-
colorimetric reaction based on the activ- erally meaning bacteria eater), a virus
ity of the enzyme. that infects and then usually destroys the
bacterium that it infects. The destruction
peroxisome Small, self-replicating cyto- of the infected bacterium (the host) with
plasmic organelles that contain no DNA the release of progeny viral particles is
but are composed largely of the peroxi- the last step in the virus life cycle.
dase enzyme, catalase.
phage display A technique used to
peroxisome proliferator-activated re- search for proteins or peptides that will
ceptors (PPARs) PPARs are transcrip- interact with a target protein. A microtiter
tion factors that are activated by receptor- plate is bait-coated, or coated with target
mediated signaling pathways that activate protein. A library of possible interacting
COX enzymes. Three different PPAR iso- proteins or peptides is prepared by cloning
types are known: , and . The gene for DNA, which may encode those sequences
PPAR- codes for a product that regulates into a vector that places the DNA in a
the development of fat cells (adipocytes). gene for a phage head structure. When
The PPARs also function as receptors for the phage is grown, millions of phage par-
two classes of drugs: the hypolipidemic ticles will be produced, each displaying
fibrates and the thiazolidinediones. a different fusion product on its surface.
These phages are then portioned out into
PEST motif A sequence of amino the microtiter plate wells. When the plates
acids (Pro-Glu-Ser-Thr), discovered in are repeatedly washed the phages display-
the Notch protein but also present in ing an interacting peptide to the bait will
other developmentally important pro- stick to the well, and all other phages will
teins, that functions as signal for rapid be washed away. The phages can then be
proteolytic degradation. A number of eluted from the well and grown up to iso-
developmental processes are believed to late the peptide of interest.
be regulated in part by the destruction
of regulatory proteins at critical times in phagemid A cloning vector con-
development. structed with components from plasmids
and bacteriophages so that it can repli-
petite mutant A microorganism (espe- cate either as a plasmid or phage.
cially yeast and euglena) lacking mito-
chondria. In yeast, such mutants form phagocyte Any cell that normally carries
tiny colonies when grown on a nutrient out phagocytosis; usually applied to cer-
source low in sugar. tain white blood cells, for example, macro-
phages that carry out phagocytosis as part
P factors DNA sequences carried on of their function in the immune system.
various chromosomes in the male fruit
fly that bring about hybrid dysgenesis in phagocytic index An assay for the
matings with females of certain strains detection of phagocytic activity in a
(referred to M strains for maternal con- blood specimen. Among the tests used
tributing). See hybrid dysgenesis. for this purpose are staining by the dye

183
www.stemcell8.cn
phagocytosis

nitro-blue tetrazolium (NBT) that turns by the three letter code Phe or by the
blue when particles containing the dye single letter code F. Phenylalanine is also
are phagocytized or uptake of latex beads used in the body to make the neurotrans-
by phagocytic cells. mitter dopamine as well as adrenaline.

phagocytosis The process by which phenylketonuria (PKU) A genetic dis-


a particle or cell becomes engulfed and ease based on an inability to convert the
ultimately devoured by another for pur- amino acid phenylalanine into the amino
poses of sustenance or defense. acid tyrosine. This results in the accumula-
tion of a toxic substance (phenylpyruvate)
phagosome Following phagocytosis the that causes severe mental retardation if the
engulfed particle is found in a membrane- condition, which is manifest in newborns,
enclosed vesicle in the cytoplasm of the is not treated by adherence to a diet low in
phagocyte referred to as a phagosome. phenylalanine. Because the disease has been
traced to a deficiency of a particular enzyme
phalloidin An alkaloid derived from (phenylalanine hydroxylase), prevention of
the toadstool Amanita phalloides that the disease in susceptible individuals is a
binds to the actin fi laments in a cell, goal of modern genetic engineering.
thereby preventing cell movement.
pheromone A chemical signal secreted
pharmacology The study of the action by an animal that brings about a specific
of drugs, particularly as it relates to their behavior (e.g., mating) in an animal of
therapeutic uses. the same species.
phase-contrast microscopy A type pheromone-responsive element (PRE) A
of microscopy in which the image of the
nucleotide sequence in the promoters of cer-
specimen being viewed is enhanced by a
tain yeast genes that binds the transcription
technique involving manipulation of the
factor STE12 in response to the binding of
light that is deflected by the specimen. In
mating factors (pheromones) to specific cell-
normal microscopy, only the light passing
surface receptors. It is believed that genes
straight through the specimen is used to
required for mating are, in this way, acti-
create the image of the specimen.
vated by pheromones.
phase variation A mechanism of gene
regulation in which a gene is switched on Philadelphia chromosome A type of
in response to an environmental condition reciprocal translocation between chro-
in some of the cells in a population lead- mosomes 9 and 22 that is seen in patients
ing to a mixture of expressing (phase ON) with chronic myelogenous leukemia
and non-expressing (phase OFF) cells. (CML).
An example of this type of regulation is
seen in the expression of type 1 fimbriae phloem A type of plant vascular tis-
(an adhesin) in E. coli. Transcription of a sue surrounding the xylem that makes
group of genes (fim genes) is controlled by up the vessels that conduct fluids down-
a short invertible element in the promoter. ward along the stem or trunk of the plant
Expression of the gene cluster is either ON toward the root.
or OFF, depending upon the orientation
of the invertible element. PHO5 The gene for acid phosphatase.
The promoter for this gene has been incor-
phenotype The set of characteristics porated in expression vectors for eukary-
that make a living organism distinct from otic (see eukaryote) genes. The advantage
others. of this promoter is that it can be regulated
because it is induced by the removal of
phenylalanine One of the 20 amino phosphate from the culture medium. Many
acids that make up proteins; designated cloned genes are toxic to the host cell pro-

184
www.stemcell8.cn
phospholipid

ducing them and can only be expressed phosphodiesterase An enzyme that cata-
when the cells have reached a maximum lyzes the breakage of phosphodiester bonds.
biomass. Thus regulation allows the cells
to grow to the maxiumum density before phosphodiester bond A covalent bond
the toxic protein is expressed. that attaches a phosphate group to any
other group by an oxygen-atom bridge.
phorbol esters A class of compounds Phosphodiester bonds are the linkages
that act as tumor promoters. See TPA. that join the sugar molecules to one
another in the backbone of nucleic acids.

(deoxy)ribose
|
(deoxy)riboseOP=O
|
O

phosphoglycerate kinase (PGK) An


enzyme used in the process of glycolysis,
or the breakdown of glucose, to form
energy in the cell. Because the gene for
PGK is highly expressed, the promoter for
this gene has been incorporated in many
phorbol myristate acetate expression vectors for eukaryotic genes.

phospholipase Any of a class of en-


Phorbol esters
zymes that acts to break down phospha-
tides by breaking the bonds between the
glycerol portion of the phosphatide and
phosphatide A type of phospholipid
the attached fatty acid(s) or the bonds
made up mainly of glycerol, fatty acids,
between the glycerol portion and the
and phosphate. Phosphatides are the
phosphate. Phospholipases are the major
type of lipid that make up the bulk of
mediators of phosphatide turnover in the
the phospholipids found in cell mem- membrane. Phospholipases also play a
branes. role in membrane signaling by liberating
membrane molecules used in the synthe-
phosphatidylethanolamine (PE) A sis of eicosanoids and PIP3 signaling.
type of phospholipid common to many
cell membranes. PE is also a common phospholipase A2 An enzyme that
constituent of many artificial mem- catalyzes the hydrolysis of the fatty acid
branes, such as those used to construct ester linkage at the second carbon of the
liposomes. glycerol backbone of membrane phos-
phatides, thereby releasing the esteri-
phosphatidyl inositol kinase (P13 fied fatty acid as a free molecule. Phos-
kinase) An enzyme that adds phos- pholipase A2 is the enzyme responsible
phate groups onto the inositol portion of for releasing arachidonic acid from the
the membrane phospholipid, phospha- plasma membrane for subsequent eico-
tidyl inositol using ATP. The product, sanoid synthesis.
phosphatidylinositol- 4,5-biphosphate,
is an important intermediate in a sig- phospholipid The general class of lipids
nal transduction pathway in which the that are made up of fatty acids and phos-
phosphoinositol group is cleaved from phate and that are the main component
the phospholipid and is released into the of all cell membranes. Phosphatides and
cytoplasm, where it acts as a second mes- sphingosines are the two major phospho-
senger. lipid subclasses.

185
www.stemcell8.cn
phosphomycin

phosphomycin A phosphate-containing
antibiotic produced by streptomyces.

phosphoramidite A chemically modified


nucleotide used in the synthesis of oligo-
nucleotides that contain an activated phos-
phoester group at the 3 carbon and a dmt
blocking group at the 5 carbon.

Phosphorylation

to the process of sugar oxidation (i.e.,


breakdown) in animal cells.
substrate levelgeneration of ATP
that occurs as part of the oxidation of
sugars but does not require oxygen.
Phosphoramidite
phosphotyrosine A form of the amino
acid tyrosine in which the OH group on
phosphoribosyltransferase An enzyme the side chain is covalently attached to a
that is necessary to make nucleotides from phosphate group. Phosphotyrosine resi-
free purine and pyrimidine bases. The dues in proteins are of significance because
action of this enzyme is responsible for signal-transduction pathways that effect
a variety of important biomedical and cell growth regulation and oncogenesis
research applications, for example, the involve phosphorylation of specific tyro-
labeling of nucleic acids or the killing of sine residues by protein kinases.
cancer cells with lethal analogs of the nor-
mal purines and pyrimidines. phosphotyrosine-binding domain (PTB
domain) A region on certain signal trans-
phosphoric acid See orthophosphate. duction proteins that binds to a portion of
the cytosolic regions of receptor tyrosine
phosphorylation Any of a variety of kinases (RTKs) that contain phosphorylated
biochemical processes by which a phos- tyrosine residues. While the PTB binds the
phate group is added to an organic mol- RTK, a second domain on the same pro-
ecule. However, the term usually applies tein, called the src homology (SH2) domain,
to the phosphorylation of nucleosides, binds to another protein in the signal trans-
particularly adenosine, resulting in the duction chain. These PTB-containing pro-
formation of adenosine mono-, di-, and teins are components of signaling pathways
tri- phosphates (AMP, ADP, and ATP, often involved in regulating cell growth from
respectively). Phosphorylation resulting ligand-activated receptors.
in ATP formation is the major means of
storing energy for all forms of biological photoaffi nity labeling The use of light
activity. ATP formation produced dur- to activate certain light-sensitive mol-
ing photosynthesis that is therefore light ecules so that they spontaneously bond to
requiring: a protein, a nucleic acid, or another type
oxidative phosphorylationoxygen- of molecule. This is a technique for label-
dependent formation of ATP; this ing biologically important substances if
means of generating ATP is coupled the activated molecule provides a highly

186
www.stemcell8.cn
phytochrome

visible color or generates some other type repeated a number of times to amplify the
of signal with high detectability. initial photocurrent so that extremely low
levels of light can be detected.
photoautotroph A photosynthetic or-
gan ism capable of living on only minimal photon The unit of light that represents
nutrients, that is, capable of making all one discrete packet of light energy.
its necessary biomolecules from simple
organic molecues. photophosphorylation The process in
which sunlight is used to produce ATP.
photoheterotroph A photosynthetic or-
ganism that is deficient in the ability to photoreactivating enzyme See DNA
make one or more of its essential biomol- photolyase.
ecules and therefore requires nutritional
supplements in its growth medium. photorespiration A salvage process that
occurs in plants under conditions of high
photolithography An automated tech- O2 and low CO2 concentrations, where the
enzyme responsible for fixing CO2 instead
nique for synthesizing oligonucleotides
takes up O2 and releases CO2.
at specific locations (spots) on a micro-
array. In photolithography individual
photosynthesis The process by which
nucleotides are added one at a time to
plants utilize light energy to create sugars
preexisting nucleotide chains by shining
and produce oxygen from carbon dioxide
light through a screen. The light activates
and water.
special light-sensitive nucleotides, caus-
ing them to form a covalent bond with
photosystem A cluster of chlorophylls
the free end of the nucleotide chain(s). An and other pigments that functions to cap-
ordered sequence of screens and activated ture the light energy that is used to carry
nucleotides programmed by computer out photosynthesis.
can generate thousands of oligonucle-
otides with defi ned sequences at specific phototaxis Movement toward light.
locations on the microarray.
phototroph An organism that is wholly
photolyases A group of light-activated, dependent upon light for nourishment via
direct DNA repair enzymes that catalyzes photosynthesis.
the repair of pyrimidine dimmers result-
ing from ultraviolet radiation. Photoly- phragmoplast The enlarged football-
ases use FADH 2 and a folate derivative shaped spindle that is seen toward the
(MTHFpolyGlu; methenyltetrahydrofolyl- end of mitosis in plant cells; the structure
polyglutamate) as coenzymes to repair in which the cell plate forms.
the dimers by reducing the pyrimidine-
pyrimidine bonds. phycomycetes A class of primitive
fungi that shares many features in com-
photomultiplier A photosensitive device mon with fungi.
that makes use of the phenomenon of pho-
toemission and secondary electron emis- phylogeny The construction of evo-
sion to detect low levels of light. Electrons lutionary trees based on relatedness of
emitted from a photosensitive material by organisms. DNA sequencing and the field
incident light are accelerated and focused of bioinformatics are making large con-
onto a secondary-emission surface (called tributions to the understanding of the
a dynode). Several electrons are emitted evolution of genes and organisms.
from the dynode for each primary electron
produced. The secondary electrons are phytochrome A pigment-protein that
then directed onto a second dynode where is believed to play a role in the initiation
more electrons are released. This process is of plant development when activated by

187
www.stemcell8.cn
phytohemagglutinin

light in the red or near-red part of the secretes a number of important polypep-
spectrum. tide hormones including follicle stimulat-
ing hormone (FSH), leutinizing hormone
phytohemagglutinin A class of pro- (LH), and prolactin, all of which play a
teins that causes clumping of red blood role in stimulation of the female repro-
cells (hemagglutination) by binding to ductive organs. The pituitary gland also
certain sugar chains on the cell surface; produces adrenocorticotropic hormone
also referred to as lectins. Examples are (ACTH), somatotropin, and thyrotropin.
concanavalin A and ricin.
pK, pKa Terms that represent the
phytotoxin Any of a number of highly strength of a chemical reaction; the
poisonous substances produced by plants. degree to which some reaction will pro-
ceed in the direction written, for example,
picogram 10 12 or 0.000000000001 A + B C + D. The negative logarithm of
grams. the equilibrium constant (log[K], where
K = [C][D]/[A][B]) for the chemical reac-
picornaviruses A class of RNA vi- tion.
ruses originally termed enteroviruses be-
cause they were initially discovered in plankton The small floating plant and
the intestinal tract. Currently, the picor- animal life in a body of water.
naviruses are classified into two sub-
classes: the enteroviruses (poliovirus, plaque A clear area in an immobilized
coxsackievirus, echovirus, and enterovi- carpet of bacteria that is produced by
rus) and the rhinoviruses (rhinovirus). local destruction of the bacteria in that
The name is derived from pico- (small) area by bacteriophages.
and rna to denote RNA.
plaque assay A means of determining
pilus A hairlike structure, found on the number of bacteriophage in a suspen-
donor type Escherichia coli, that is used sion by counting the number of plaques
in the attachment of donor-type cells (F+ produced in a certain amount of the sus-
and Hfr) to recipient cells (F ) to mediate pension. The results are usually expressed
the transfer of DNA during mating. Also as plaque forming units per milliliter of
called the sex pilus. suspension (PFU/ml).

pinocytosis A variation of phagocyto- plaque hybridization A process in


sis in which the engulfed particle is taken which a labeled probe is annealed to the
into the cell in small vacuoles represent- DNA from bacteriophages in a plaque.
ing pinched-off pieces of the original par- Plaque hybridization is used to iden-
ticle. tify plaques containing bacteriophage-
carrying recombinant DNA.
piperidine A chemical that causes
breakage of the sugar-phosphate back- plasma The liquid portion of blood.
bone in nucleic acids at any point along a
nucleic acid strand at which the purine or plasma cell An antibody-secreting white
pyrimidine rings have been partially oxi- blood cell.
dized or completely removed. Piperidine
treatment is used to create subfragments plasma gel The protoplasm of a proto-
of a larger nucleic acid in the Maxam- zoan that is in the gel form, for example,
Gilbert procedure for sequencing nucleic the protoplasm in the pseudopodium of
acids. Amoeba proteus.

pituitary gland A small endocrine plasma membrane The membrane


gland located at the base of the brain that surrounding the cytoplasm of a eukary-

188
www.stemcell8.cn
polarity

otic cell. The plasma membrane is similar plectonemic supercoiling A term used
in structure to the cell membranes of pro- to describe a type of supercoiling in which
karyotes and consists of a phospholipid the DNA supercoils are folded over them-
bilayer and an overlying extracellular selves to form branches. This type of struc-
layer of glycoproteins. ture is believed to represent a mechanism
by which DNA is compacted. In plectone-
plasma sol The protoplasm of a proto- mically supercoiled DNA, the length of the
zoan that is not in gel form. DNA mass is approximately 40 percent of
the length of the uncompacted DNA.
plasmid A piece of DNA in the cyto-
sol of bacteria that replicates indepen- pleiotropic Any agent, such as a hor-
dently from the bacterial chromosome. mone, having more than one effect or
Naturally occurring plasmids have been having an effect on more than one target.
found to carry a number of genes; per-
haps most important are the genes that pleomorphic Having variable form,
confer resistance to a number of anti- for example, variations in shape, behav-
biotics. Genetically engineered plasmids ior, or other characteristics of organisms
are important vectors for carrying re- of the same species.
combinant DNAs.
point mutation A change in a single
plasminogen activator An enzyme that nucleotide in a gene resulting in loss of
derives its name from the ability to catalyze function or altered functioning of that
the conversion of plasminogen to plasmin, gene.
which then catalyzes the breakdown of
fibrin, a major component of blood clots.
pol One of the three major genes of
The secretion of plasminogen activator is
retroviruses. The pol gene encodes the
a marker of cell transformation to a can-
protein for the viral enzyme reverse tran-
cerous or precancerous state. Plasminogen
scriptase.
activator is used as a therapeutic agent to
dissolve blood clots associated with block-
polar body A small cell that is pro-
age of the coronary arteries.
duced as a result of uneven separation of
plastid An organelle found in plant cytoplasm during meiois when an oocyte
cells that contain its own genome; chloro- is produced; the larger of the daughter
plasts are a type of plastid. cells becomes the oocyte.

platelet A subcellular particle in blood polar group A small group of atoms


that is actually a fragment of a mega- held together by dipole-dipole linkages.
karyocyte cell that is formed in the bone
marrow. Platelets bound to fibrinogen polarimeter An instrument for deter-
initiate the formation of a blood clot at mining the percentage of polarized light
the site of a wound. in a beam of light. A polarimeter is also
used to determine whether polarized light
platelet-derived growth factor (PDGF) is rotated after passage through crystals
A growth factor that is present in the of a given compound.
granules of platelets and that probably
plays a role in wound healing. PDGF con- polarity 1. As applied to a molecular
sists of two subunits, one of which was bond between two atoms, the term polar-
found to represent a slightly changed ver- ity refers to a state in which the electrons
sion of the sis oncogene. in the bond are localized more to one
atom than the other, giving that atom a
plectonemic Pertaining to the standard partial negative charge (the other atom is
double helical arrangement of double- partially positively charged). The presence
stranded DNA. See double helix. of polar bonds confers a number of impor-

189
www.stemcell8.cn
polar microtubules

tant chemical properties to the compound polyadenylation The addition of long


that contains them, including solubility in tracts of adenosine polymers to the tail
water. ends (i.e., the 3 ends) of messenger RNAs
2. As applied to cell microanatomy, in eukaryotic cells.
polarity refers to specialization of the cell adenosine adenosine adenosine
architecture at different parts of the cell, | | |
for example, the presence of cilia and phosphateribosephosphateribosephosphateribose
secretory vesicles located at the apical, as
opposed to the basal, end of the epithelial polyadenylation signals Certain sequen-
cells lining the gut and respiratory tracts. ces of bases in an RNA molecule that are
3. As applied to nucleic-acid strands, the required for polyadenylation to-occur; for
term refers to the fact that the two ends example, the sequence AAUAAA located
of any nucleic-acid strand are distinguish- in a region 1130 nucleotides from the
able from one another by whether the end end of an mRNA molecule.
is 5 or 3. This gives the strand a direc-
tionality or polarity. polyamine Molecules formed from re-
peating hydrocarbon chains separated by
polar microtubules The microtubules amino groups. The chain is always termi-
extending between the polar bodies that nated at each end by a positively charged
have the apparent function of pushing amino group. Because of their positive
the poles of a dividing cell apart during charge, the polyamines function to stabi-
mitosis. lize nucleic acids by neutralizing the strong
negative charge of the nucleic acid phos-
polar mutation A nonsense mutation phate backbone. Putrescine, spermidine,
that causes early termination of normal and spermine are the common polyamines.
transcription in a gene and that therefore
also prevents transcription of any subse- poly-A polymerase The enzyme
quent genes in a polycistronic unit. responsible for polyadenlylation of an
RNA strand.
poliovirus A picornavirus that infects
individuals via ingestion but then attacks polycistronic A region of a nucleic
the central nervous system, resulting in acid that contains sequences representing
varying degrees of paralysis. multiple genes (cistrons) in an end-to-end
tandem arrangement.
polyacrylamide A polymer of acryl-
amide: polycistronic mRNA The messenger
NH 2 RNA transcribed from a polycistronic DNA.
|
CH 2 =CHC=O polyclonal antibody A set of antibod-
ies that is secreted by a corresponding set
of antibody-producing white blood cells.
A gel is formed to which the polyacryl-
Although each of the antibodies carries a
amide strands are cross linked. Polyacryl-
unique specificity, the set of antibodies as
amide gels are used for electrophoresis of
a whole reacts with a variety of antigenic
proteins and nucleic acids.
molecules.
polyacrylamide-gel electrophoresis
polyelectrolyte A large molecule that
Separation of nucleic acids or proteins
is highly charged under biological condi-
from a heterogeneous mixture on the
tions.
basis of size or charge by placing the
mixture in a polyacrylamide gel and then polyethylene glycol (PEG) A long
subjecting it to an electric field.
OH
polymer of C| groups. PEG is used in
polyadenylated The general term for
nucleic acids that have undergone poly- inducing cell fusion, precipitating micro-
adenylation. scopic particles, dehydrating samples of

190
www.stemcell8.cn
polymerase chain reaction

Polymerase chain reaction

biological materials, and stabilizing cer- polymer A chain composed of a single


tain enzymes. molecule or small number of similar mol-
ecules that are linked together.
polylinker A synthetic polynucleotide
containing the sequences representing polymerase chain reaction (PCR) A
the restriction sites of certain specified technique for rapid amplification of
restriction enzymes. extremely small amounts of DNA, using

191
www.stemcell8.cn
polymerases

the heat-stable Taq I DNA polymerase polyribosome (polysome) A number


enzyme. PCR has found wide application of ribosomes attached to the same mes-
in forensic medicine because analyzable senger RNA.
quantities of nucleic acid can be obtained
even from microscopic tissue samples. polysaccharide A chain of sugar mol-
ecules linked together end-to-end.
polymerases A class of enzymes that
catalyze the formation of long nucleo- polyspermy Fertilization of a single
tide polymers, particularly as a means of egg by more than one sperm.
making template-driven copies of nucleic
polytene chromosomes Giant chro-
acids. See DNA and RNA polymerases.
mosomes found in insect salivary gland
cells. They are actually made up of thou-
polymorphism A naturally occurring sands of copies of the DNA normally
variation in the normal nucleotide sequence found in one chromosome.
within the individuals in a population.
polyteny The state of a cell containing
polymyxin A group of antibiotics polytene chromosomes.
derived from the bacterium Bacillus poly-
myxa, with activity primarily against poly U Poly uridylic acid; a polymer of
Gram-negative bacteria. uridine of undefi ned length.

polynucleotide A polymer consisting P/O ratio The amount of phosphate


of a long chain of nucleotides. incorporated into ATP divided by the
amount of O2 taken up by the mitocho-
drion during the process of respiration;
polynucleotide kinase (polynucleo-
generally taken as a measure of the effi-
tide phosphorylase) An enzyme that
ciency of energy production when sugars
catalyzes the transfer of a phosphate
are oxidized.
group from ATP to the free 3 end of a
polynucleotide. porins Protein channels in the lipopoly-
saccharide layer of Gram-negative (see
polynucleotide ligase An enzyme that Gram stain) bacteria that serve as por-
links two polynucleotides together. The tals for the flow of small molecules.
enzyme catalyzes the formation of a cova-
lent bond between a phosphate group on porphyrin An organic molecule made
the 5 end of one polynucleotide and the up of four nitrogen-containing rings
free 3 hydroxyl group at the end of the called pyrrolles. Modified porphyrins are
other polynucleotide. the basic constituents of the active sites
of hemaglobin, myoglobin, chlorophylls,
polyoma A member of the papova and cytochromes.
group of viruses, which normally infects
rodent cells. position effect The influence of the
position of gene on its activity such as
is seen when a gene that is moved (e.g.,
polypeptide A polymer of amino acids;
by translocation) to a new chromosomal
the term usually applies to a peptide chain
location becomes inactive.
of fewer than 100 amino acids.
posttranscriptional processing Cer-
polyploid Having more than the nor- tain specific changes in the RNA that
mal diploid number of chromosomes. occur before the RNA leaves the cell
nucleus in mature form. Polyadenylation,
polyploidy The state of being poly- capping, and splicing are examples of
ploid. posttranscriptional processing.

192
www.stemcell8.cn
presenilins

posttranslational import A process PWS was the first human disease based on
by which a certain class of proteins is the phenomenon of genomic imprinting in
brought into the interior of the endo- which genes are differentially expressed
plasmic reticulum (ER) either following depending upon the parent from which
or during its synthesis on ribosomes that the disease originated. DNA methylation
are bound to the ER; polypeptides that at cytosine bases may be the mechanism of
are to be imported are recognized on the this type of imprinting.
basis of the fact that they contain a small
sequence of amino acids known as a sig- precursor A substance from which
nal peptide at one end. another substance is made by a series of
sequential changes in molecular struc-
posttranslational modification Some ture.
alteration in the structure of a polypeptide,
for example, addition of a polysaccharide prednisone A synthetic steroid hor-
chain (glycolsylation), after it is synthe- mone used to reduce chronic inflamma-
sized and usually after it is imported into tion such as occurs in arthritis.
the interior of the endoplasmic reticulum.
Such modification is required for the poly- pre-mRNA The general term given
peptide to take on its biological activity. to that subclass of RNAs present in the
nucleus that will be processed to become
posttranslational processing Removal mature messenger RNA (mRNA) but that
of a specific end piece of a polypeptide has not yet undergone that processing.
known as the signal peptide, following its See posttranscriptional processing.
synthesis on ribosomes; one part of the
process of posttranslational import. preproinsulin A precursor of insulin.
Proinsulin, which is the immediate precu-
sor of insulin, is produced from preproin-
posttranslational transfer The import sulin by cleavage of preproinsulin, result-
of a polypeptide into the membrane of the
ing in the removal of a short polypeptide
endoplasmic reticulum or an organelle
portion.
after synthesis of the polypeptide (i.e.,
translation) is completed.
preprotein The polypeptide precursor
of a membrane-bound protein prior to
poxvirus A class of DNA viruses that its actual insertion into a membrane. Be-
produces transient infl ammatory skin cause the leader sequences of membrane-
lesions, for example, chicken pox and bound proteins are removed on insertion
smallpox. into the membrane, preproteins have
leader sequences.
Prader-Willi syndrome (PWS) A dis-
order caused by chromosomal deletion prenatal diagnosis The diagnosis
and/or disomy involving genes on the that a disease exists in a developing fetus
proximal arm of chromosome 15. The made on the basis of examination of cell
syndrome is characterized by obesity, or tissue samples taken from the fetus in
hypotonia, mental retardation, short stat- the womb.
ure, hypogonadotropic hypogonadism,
and strabismus. About 70 percent of the presenilins Two proteins (PS1 and PS2)
PWS cases show a deletion in the chro- found on the surface of neurons that have
mosome 15 region, 15q11.2-q13. Several been found to be involved in the develop-
genes possibly involved in the disorder ment of familial Alzheimers disease. The
have been mapped to this region, including presenilins act together with another pro-
a small ribonucleoprotein gene (SNRPN), tein (gamma-secretase) to cleave the amy-
type II oculocutaneous albinism (P gene), loid precursor protein that leads to the
and a ubiquitin-protein ligase (UBE3A). accumulation of amyloid plaques, causing

193
www.stemcell8.cn
Pribnow box

rapid deterioration of the central nervous prion A type of protein particle that is
system at an early age (<60 years). responsible for a number of neurodegenera-
tive diseases in humans and animals called
Pribnow box A sequence of bases in the transmissible spongiform encephalopa-
DNA that makes up part of the promoter thies (TSEs). The TSEs caused by prions
of a prokaryotic gene. The Pribnow box includes scrapie (in sheep), kuru (afflicting
occurs at 10 base pairs from the site at the cannibalistic For tribe in Papua New
which transcription starts and consists of Guinea), Creutzfeldt-Jakob disease (CJD),
the sequence TATAAT or a close variation. Chronic Wasting Disease, Fatal Familial
Insomnia (FFI), Gerstmann-Strussler-
primary culture The cell culture that Scheinker syndrome (GSS), and bovine
arises from a tissue specimen when it is spongiform encephalopathy (mad cow dis-
fi rst placed into culture. ease). The name prion is derived from the
descriptor proteinaceous infectious parti-
primary response The elicitation of an cle. Prions are unique as infectious agents
immune response to a foreign antigen after because they contain no nucleic acids.
an animal is first exposed to the antigen. The fi rst prion protein was discovered by
Stanley B. Prusiner, who was awarded the
primary stucture The sequence of Nobel Prize in physiology or medicine in
amino acids that make up a polypeptide. 1997. The infectious agent was named PrP
(prion-related protein) and it is believed
primase The enzyme that catalyzes the that the disease is caused by a change in
formation of short RNA primers that are shape of this protein (the altered version of
required to copy the DNA strand, start- the protein was called PrPSc) and that the
ing from the 5 end. misshapen protein can be transmitted
by inducing the same change in shape to
other nearby normal protein molecules.
primeosome A complex of prepriming
proteins and DnaG primase with a hairpin
fold of single-stranded DNA in the bac-
probe Any oligonucleotide that con-
tains a chemical label allows the oligo-
teriophage X174. This complex is the
nucleotide to be traced when the oligo-
structure in which synthesis of the RNA
nucleotide is annealed by hybridization
primers in Okazaki fragments occurs.
to some target nucleic acid. To a lesser
extent, any biomolecule including a pro-
primer A short oligonucleotide that tein, lipid, or polysaccharide that binds
anneals to a specific region on a DNA or to some target molecule and that bears
RNA strand and is used by a polymerase a chemical label that can be traced after
as a place to begin synthesis of a comple- binding has occurred.
mentary nucleotide strand.
processed pseudogenes Pseudogenes
primer extension A technique of map- that show a close similarity in nucleotide
ping genes in which a primer is annealed sequence to the mRNA for their active
to a DNA or RNA fragment and then counterparts. The existence of processed
extended, using an RNA or DNA poly- pseudogenes has been taken as evidence
merase (e.g., the Klenow fragment of that some pseudogenes were somehow
DNA polymerase I) and the four nucleo- originally derived from mRNAs.
side triphosphates to copy the nucleic acid
to which the primer is annealed. Primer pro-dynorphin/pro-enkephalin/pro-
extension is most commonly used to opiomelanocortin Precursor molecules
detect mRNAs that contain the primer that give rise to various opioid peptides by
sequence. proteolytic processing:

priming The process of annealing a Pro-opiomelanocortin is processed into


primer. -MSH, adrenocorticotropic hormone

194
www.stemcell8.cn
prokaryote

(ACTH) and -lipotropin. The latter progeria A rare disease characterized


two peptides are further processed by a collection of symptoms that give the
into -MSH and CLIP (from ACTH) appearance of premature aging, includ-
and -lipotropin, -endorphin. ing baldness, prominent scalp veins, thin
-MSH and met-enkephalin (from - limbs with prominent joints, short stat-
ure, joint stiffness, hip dislocations, and
lipotropin)
heart and artery disease. At least two
Pro-enkephalin A gives rise to met- forms of the condition are known: Wer-
enkephalin and leu-enkephalin and ner syndrome and Hutchinson-Gilford
some other larger peptides. Pro- progeria. Hutchinson-Gilford progeria,
enkephalin A contains four copies the more severe form, occurs in children
of met-enkephalin, one copy of leu- at a frequency of about one in 8 million
enkephalin, a heptapeptide (met-enk- and is caused by a point mutation in the
arg-phe), and an octapeptide (met-enk- gene for a nuclear lamin, known as lamin
arg-gly-leu). A (LMNA; gene map locus 1q21.2). Wer-
Pro-dynorphin (pro-enkephalin B) ner syndrome is caused by mutations in a
gene called Wrn, which is a homologue of
gives rise to dynorphin A, dynorphin
the E. coli helicase RecQ and is located
B, and -neoendorphin as well as the
on chromosome 8 at gene map locus
smaller peptides dynorphin A1-8 and
8p12-p11.2.
leu-enkephalins, three of which are
contained within the pro-dynorphin progesterone A steroid hormone pro-
peptide. duced by the ovary that prepares the
uterus for reception of the fertilized egg.
profilin A protein that complexes with
actin proteins, preventing the polymeriza- prokaryote A term for the family of all
tion of these proteins into actin filaments. primitive organisms, for example, bac-

pro-opiomelanocortin

signal peptide

-MSH ACTH -lipotropin

-MSH CLIP -lipotropin -endorphin

-MSH met-enkephalin

Opioid peptides

195
www.stemcell8.cn
recto
prolactin

teria, in which the cellular DNA is not prostaglandins A class of hormonelike


enclosed in a nucleus. chemicals derived from fatty acids. There
are more than 16 prostaglandins that are
prolactin A hormone that stimulates classified into nine different groups. Stim-
the production of milk by the mammary ulation of muscle contraction and inflam-
glands following pregnancy. mation are believed to be caused by pros-
taglandins. The anti-inflamatory effects of
proline-rich activation domain A
characteristic region in a certain class aspirin are related to inhibition of prosta-
of transcriptional activator proteins that glandin synthesis.
contains a large number of proline resi-
dues. Transcriptional activators that con- prostate-specific antigen (PSA) A
tain proline-rich activation domains can glycoprotein originally isolated from
stimulate transcription by binding to semen that is now used as an indica-
sequences that are either close to, or far tor of the presence of prostate cancer.
away from, the TATA box unlike the The PSA glycoprotein is a protease of
glutamine-rich or acidic activators that 33 kDa called Kallikrein 3 (KLK3) that
tend to stimulate transcription from loca- is believed to function to keep semen in
tions either very close to (glutamine-rich a state of liquefaction. KLK3 is located
activators) or far away from (acidic acti- on chromosome 19q13. As a diagnos-
vators) the TATA box. Examples of tran- tic indicator, PSA levels in blood are
scription factors containing proline-rich reported in terms of ng/milliliter of
domains are AP-2 and CTF/NF1. blood: 02.5 ng/ml is low, 2.610 ng/ml
is considered slightly to moderately ele-
promoter A sequence of bases in a vated, 1019.9 ng/ml is considered mod-
nucleic-acid strand that serves as a signal for erately elevated, and 20 ng/ml or more is
the start of transcription of a given gene.
significantly elevated.
prometaphase The stage preceding
prosthetic group An organic mol-
metaphase in which chromosomes that
ecule often containing metal atoms that is
have newly formed in the cytoplasm begin
tightly bound to an enzyme and which is
to migrate to the center of the cell where
homologous chromosomes will pair with required for the enzyme function.
one another during metaphase.
protease The class of enzymes that
proofreading The ability of the DNA catalyze the cleavage of a polypeptide or
polymerase to remove a mismatched base protein into smaller polypeptides.
in the replicated strand with an exonucle-
ase that cuts 35 and then to reinsert protein Any polypeptide or cluster of
the correct base in the new strand with polypeptides that has a defi ned biological
its polymerase activity. Organisms that function.
lack this activity through mutation show
a high rate of mutagenesis. protein chip A protein microarray.
In a protein chip, many individual pro-
prophage The genome of a bacterio- teins of a certain type are spotted onto a
phage that has become integrated into the solid substrate such as a glass slide for the
chromosome of the host bacterium. purpose of determining whether cells are
producing factors that interact with the
prophase The first phase of mitosis proteins on the chip. For example, some
characterized by the appearance of chro- protein chips contain arrays of transcrip-
mosomes from the amorphous chromatin. tion factors, and these chips can be used
to test particular cells for the presence
prophylactic The treatment with a of proteins that interact with particular
therapeutic agent to protect an individual transcription factors. In this example the
from future disease. proteins in a cell lysate could be labeled

196
www.stemcell8.cn
protoplast fusion
verso

with a fluorescent molecule, and the pres- proteome A bioinformatics term used
ence of a protein that interacts with a to describe the proteins produced by all
certain transcription factor would then genes in a genome. The human genome is
be determined by a fluorescent signal at currently thought to contain a proteome
certain spot(s) on the chip. of ca. 30,000 proteins.

protein hydrolyzate The partial break- proteomics The field of study devoted
down product produced by heating a pro- to the study of the proteins that are
tein mixture or subjecting it to treatment expressed in different cell types. A major
with acid or proteases. technique employed in proteomics is the
comparative analyses of two-dimensional
protein kinase The class of enzymes that protein gels from different cell types or
catalyzes the transfer of a phosphate group from variants of a single cell type.
from one compound onto a protein.
prothrombin A blood protein that is
protein kinase C A protein kinase acted on to form thrombin.
embedded in the cell membrane that acts
as a signaling molecule by virtue of its prothymocytes Immature T cells that
ability to phosphorylate certain cytosolic are formed from stem cells in the bone
proteins on serine and threonine residues. marrow prior to the time they enter the
Protein kinase C is activated by ca++ ions thymus. Prothymocytes are recogniz-
together with diacylglycerol and tumor able by the presence of an incomplete
promoters such as phorbol esters. Acti- set of T-cell receptor proteins on the
vated protein kinase C is then believed to cell surface.
cause transformation to a cancerous state
by phosphorylation of as yet unidentified
proton gradient An uneven distribu-
protein(s).
tion of protons caused by the accumula-
tion of protons on one side of a membrane.
protein synthesis The process by Proton gradients are a means of storing
which amino acids are assembled into
energy for synthesis of ATP in mitochon-
peptides on ribosomes using the informa-
dria and chloroplasts.
tion supplied by a messenger RNA. Pro-
teins and nucleic acids are held together
by bonds that are susceptible to hydroly-
proton-motive force The amount of
sis, and their assembly is accomplished by energy stored in a proton gradient.
a reversal of the hydrolytic reaction. See
translation. proton pump A cluster of membrane-
embedded proteins that transports protons
proteoglycan A large aggregate of pro- from one side of membrane to the other.
tein that forms the core, and long poly-
meric saccharide chains that constitute proto-oncogene A normal cellular gene
the bulk. Hyaluronic acid, chondroitin that, when altered in a particular fashion
sulfate, heparan sulfate, dermatan sulfate, (activation), acts to induce a cancerous
and keratan sulfate are polysaccharides state.
commonly found in proteoglycans. Pro-
teoglycans are major components of the protoplast A plant cell or bacte-
extracellular matrix and other extracellu- rial cell in which the cell wall has been
lar structural components such as carti- removed, for example, by treatment with
lage. See GAG. lysozyme.

proteolysis Breakdown of proteins by protoplast fusion A technique for


cleaving the bonds between amino acids by introducing foreign or genetically engi-
the process of hydrolysis. See protease. neered DNA into a cell by fusion of that

197
www.stemcell8.cn
recto
prototroph

cell with a protoplast carrying the DNA


of interest.

prototroph An organism with the


same nutritional requirements as the par-
ent organisms from which it was derived.

protozoa A phylum of single-celled


organismsfor example, Paramecium
caudatum or Amoeba proteusrepre-
senting the most primitive animals (from
proto = fi rst and zoan = animal).

provirus The name given to DNA rep-


resenting the genome of a virus that has Purine ribonucleosides
become integrated into the DNA of the
host that it infects.
cin interacts with an elongation factor
pseudogene A version of a gene that (EFTu) and prevents the formation of an
has become inactive over time as a result essential complex between GTP and an
of accumulated mutations. aminoacyl tRNA.

pseudouridine An unusual form of purine A nitrogen-containing, double-


uridine found only in transfer RNAs ringed organic molecule that is the par-
(tRNA). ent compound for the purines found in
nucleic acids.
psoralens A type of organic molecule
that spontaneously forms a variety of purine bases in nucleic acids The
covalent bonds with nucleic acids in the purine derived molecules adenine and
presence of ultraviolet light. guanine. In nucleic acids, these molecules
are attached to the sugar ribose or deoxy-
psychrophile An organism thriving at ribose in the nucleic acid backbone.
low temperatures.
puromycin An aminonucleoside anti-
psychrotroph An organism that requires biotic, derived from the soil bacterium
low temperature for normal growth. Streptomyces alboniger, that acts by
disrupting the process of protein synthe-
Ptashne, Mark (b. 1940) Discoverer of sis. One part of the puromycin molecule
the lambda bacteriophage cI repressor pro- resembles the 3 end of a tRNA and binds
tein function. Ptashne was a cofounder of to the ribosome during protein synthesis
one of the first biotechnology companies, and then blocks the translocation step of
the Genetics Institute, and was a recipient protein synthesis. Puromycin inhibits the
of the prestigious Lasker Award. growth of Gram-positive bacteria and
some animal and insect cells. The Pac
pulsed field-gel electrophoresis A va- gene which codes for a puromycin N-
riation of agarose gel electrophoresis that acetyl-transferase confers resistance to the
allows the separation of extremely large antibiotic.
(several thousand kilobases in length) DNA
fragments by agarose gel electrophoresis. purple bacteria A type of bacterium that
is capable of carrying out photosynthesis.
pulvomycin An antibiotic that acts by
blocking the elongation of a polypeptide pyogenic The ability of a substance to
chain as it is being synthesized. Pulvomy- induce the formation of pus and abscesses.

198
www.stemcell8.cn
pyrogen
verso

ent compound for the pyrimidines found in


nucleic acids.

pyrimidine bases, in nucleic acids


The pyrimidine-derived molecules thy-
mine, uracil, and cytosine. Like the purine
bases in nucleic acids, these molecules are
attached to the sugar ribose or deoxyribose
in the nucleic acid backbone.

pyrogen Any of a number of toxic, fever-


causing agents that are usually of bacterial
origin, such as endotoxins. The presence of
pyrogens is a main concern when prepar-
ing solutions for injection because steriliza-
tion may destroy live bacteria but not their
residual pyrogens.

Purine and pyrinidine bases found in nucleic


acids

pyridine An organic molecule that con-


tains five carbon atoms and one nitrogen
atom in a ring. Used to dissolve otherwise
difficult-to-solubilize biological materials. Pyrimidine ribonucleosides

pyrimidine A six-membered, nitrogen-


containing, ringed molecule that is the par-

199
www.stemcell8.cn

Qa locus One of the genetic subloci queuosine An unusual purine base


within the mouse major histocompatibil- found only in transfer RNA. Queuosine
ity locus (H2). Qa codes for an antigen is formed by adding a pentenyl ring to 7-
that is only found on a subset of blood methylguanosine.
cells, and so it is considered to be a dif-
ferentiation antigen. quinacrine A synthetic antimalarial
compound that is also used as a fluores-
q-arm The long arm of the human chro- cent stain for chromosomes.
mosome.
quinine An alkaloid drug derived from
the bark of the cinchona tree that is found
q banding The technique of staining in South America and Indonesia. Quinine
chromosomes using quinacrine. This
is an antimalarial drug that is also used
technique produces a unique pattern of
to relieve fever and pain in other diseases.
chromosomal bands that can be used At one time, quinine was the only drug
clinically for chromosome identifica- available for treatment of malaria, but it
tion. has been replaced to a large extent by syn-
thetic drugs, such as quinacrine.
quadroma An antibody-producing cell
that secretes antibodies made up of the quinone A class of cyclic organic com-
random association of heavy and light pounds such as phylloquinone, plastoqui-
chains from two different antibodies. none, and ubiquinone that is widely used
This is an intermediate in the formation to carry hydrogen atoms in certain critical
of a bispecific antibody, in which the two steps in the process of energy production
binding sites recognize different antigens. in both plants and animals. Chemically,
The quadroma is formed by the fusion quinones are characterized by the presence
of two monoclonal antibody-producing of two ketone groups (C=O) on the same
cells. hydrocarbon ring.

200
www.stemcell8.cn

R1 particle An intermediate stage in the RAG2) that catalyze the cleavage of DNA
formation of the 30S ribosomal subunit. segments within the immunoglobulin genes
An R1 particle is formed from a strand of that is the first step in immunoglobulin gene
16S RNA and 15 ribosomal proteins. rearrangements whereby different V (vari-
able) segments are linked with different J
racemate A mixture of two different forms (joining) segments to create a large spectrum
of a molecule that do not differ from each of immunoglobulin molecules with many
other chemically but that have a different different specificities. The RAG proteins
physical arrangement of atoms that can be dis- generate double-strand breaks at sites called
tinguished by methods using polarized light. recombination signal sequences (RSS) that
are present in both the V and J segments.
radial immunodiffusion An immuno-
logical test based on the reaction of an anti- Ramachandran plot For a given pep-
body with a protein that has been allowed tide, a graph that plots the angle of rota-
to seep out of a central well into a slab of tion around the bond between the alpha
agar where the reaction takes place. carbon and the carbonyl carbon () ver-
sus the angle of rotation around the bond
radioimmunoassay A sensitive test for between the alpha carbon and the amide
a particular protein, based on the reac- nitrogen (). This type of plot is used to
tion of that protein with an antibody give an idea of the combinations of bond
specific for it, where one of the reacting angles that occur in the peptide. This
agents is radioactively labeled. information can be used to help deter-
mine how the peptide is folded.
raf A protein intermediate in the signal-
transduction-cascade pathway initiated Raman spectroscopy A type of spec-
by receptor tyrosine kinase activation. In troscopy that measures the wavelength of
this pathway a ras-GTP complex binds inelastically scattered photons (i.e., scat-
to the N terminal end of cytosolic raf, tered photons whose wavelength is differ-
whose C terminal end has serine/threo- ent from that of the incident photons). The
nine kinase activity that acts to phos- scattering of light occurs at wavelengths
phorylate and thereby activate MEK, a that are shifted from those of the incident
MAP-kinase kinase (MAPKK). light by the energies of molecular vibrations
(bond stretching). Like infrared spectroscopy,
raf oncogene An oncogene that is Raman spectroscopy gives information about
found in murine sarcoma virus and that the type of bonds present in a compound but
is associated with fibrosarcoma tumors is different from infrared spectroscopy by
in both rodents and humans. The normal being able to see signals from bonds that are
homologue of the raf oncogene encodes perfectly symmetrical and therefore have no
the protein raf. raf is an acronym derived dipole. Raman spectroscopy is used in mak-
from rat fibrosarcoma. ing structure determinations of biomolecules.

RAG proteins Recombination activat- random primer labeling A technique


ing gene proteins; two proteins (RAG1 and for labeling DNA that is based on the

201
www.stemcell8.cn
ras oncogene

molecular weight that is coded for by the


gene associated with the familial form of
retinoblastoma. (See figure at left.)

R banding A characteristic pattern of


bands produced when chromosomes are
stained by various dyes, for example,
olivomycin. The basis of the pattern of
R bands is the abundance of DNA rich in
guanine-cytosine (G-C) base pairs.

reactive oxygen species (ROS) Any


E2F transcription factors induce the expres-
of a group of small molecules containing
sion of genes required for cell-cycle progres-
a highly active form of oxygen, including
sion, but these transcription factors are main- superoxide (O2-), hydroxyl radical (OH .),
tained in an inactive state in a complex with hydroxyl ion (OH-), or peroxides R-O-O-
the retinoblastoma tumor suppressor, Rb, and R. ROS are produced as a consequence
an Rb-related protein, p107. E2F is released in of ionizing radiation such as X-rays and
active form from the complex in late G1 after gamma rays but are also produced natu-
phosphorylation of Rb by cdk2-cyclin A. Inacti- rally as a consequence of enzymes pres-
vation of Rb by phosphorylation begins in late ent in neutrophils and macrophages
G1 and continues throughout the S phase. or normal respiratory chain reactions,
especially those involving ubiquinone.
Because of their reactivity, ROS are dam-
aging to biomolecules, particularly DNA,
annealing of a mixture of short primers and unrepaired DNA damage can lead to
with randomly determined sequences to cancer-causing mutations. ROS are inac-
the DNA strand. Labeling takes place tivated by antioxidants such as vitamin
by extension of the primers (see primer C and also by certain enzymes such as
extension) using labeled nucleotides. superoxide dismutase (SOD) and cata-
lase.
ras oncogene The oncogene that is
found in rat sarcoma virus and that is reading frame Any one of the three
associated with sarcomas in rodents and possible ways of reading a sequence of
carcinomas in human. The name is an amino acids from a nucleic acid using the
acronym derived from rat sarcoma. In genetic code; the three different reading
mammals the ras proto-oncogene has a frames are determined by which base in
GTP binding activity that is believed to be any group of three consecutive bases is
homologous to the action of G proteins. chosen as the start point.

Rb An abbreviation for the anti- reassociation kinetics A technique


oncogene protein product of 110,000 for estimating the number of copies of a

Reading frame

202
www.stemcell8.cn
recombination

particular nucleic-acid base sequence in sensor, the ATHK1 osomo-sensor, and in


a sample by measuring the rate at which the bacterial chemotaxis system mediated
denatured nucleic acid in the unknown by the histidine kinase CheA.
sample anneals to strands of a known
nucleic acid with the same or similar receptor-mediated endocytosis The
sequence to that being determined. process by which many ligands that bind
to receptors on the cell surface enter
reassociation of DNA Reannealing of into the cytosol. During receptor-medi-
the complementary strands of DNA after ated endocytosis, the plasma membrane
the paired strands have been separated by undergoes invagination in the region
heat or strong acid or alkalai. surrounding a receptor that has bound
a ligand to form a vesicle (an endosome)
RecA A bacterial protein that is respon- that eventually separates from the plasma
sible for the major steps in recombination membrane and migrates into the cytosol.
following the introduction of strand nicks
by RecBCD: strand invasion, branch recessive A form of a gene whose
migration, and formation of the Holliday effect on the phenotype of an organism is
structure. The RecA protein also plays a masked by an alternate (dominant) form
role in DNA repair by regulation of the of the gene.
SOS response following DNA damage.
recessive allele The term for a reces-
RecBCD A bacterial enzyme that medi- sive gene on a chromosome.
ates certain critical events in the process
of recombination including DNA strand reciprocal translocation An exchange
unwinding (helicase activity) and the cre- of material between chromosomes, usu-
ation of single-stranded nicks at special-
ally by breakage of each of the partici-
ized sites (chi sequences).
pating chromosomes at a specific site.
A translocation involves movement of a
receptor A specialized cell surface mol- physical portion of a whole chromosome.
ecule or complex of molecules that serves
as a site of attachment for a specific effec-
tor molecule (the ligand), for example, a
recombinant DNA A DNA that has
hormone. The receptor may also function become joined to another unrelated or
to produce a biological response in the foreign segment of DNA.
cell to which the ligand is bound via its
receptor. recombinant proteins Proteins produced
by cloning technology, usually by splicing the
receptor His kinase A type of signal- DNA sequence for the protein into a vector,
transduction system found in plants transferring that vector into a host organism,
and bacteria that transmits signals from usually a bacterium or a yeast, and harvest-
membrane receptors by causing a phos- ing the protein after growth of the host.
phate group to be transferred to a histi-
dine residue on a transduction protein. recombinase An enzyme that catalyzes
In these systems the phosphate is usually the joining of immunoglobulin gene seg-
rapidly transferred from the histidine to ments during the recombination event
an aspartate residue on another protein involved in immunoglobulin gene switching.
(his-to-asp phosphorelay). This type of
signaling is involved in the sensing of recombination The process by which
certain environmental stimuli such as the DNA from a gene on a large genetic unit;
presence of phytohormones, in Arabidop- for example, a chromosome becomes
sis thaliana. Histidine kinase signaling exchanged with the corresponding DNA
is also involved in the ETR1 family of on a complementary genetic unit such as
ethylene receptors, the CKI1 cytokinin- another chromosome that is an allele.

203
www.stemcell8.cn
recombinational repair

by the symbol Eo, a number that represents


the extent to which the atom or molecule in
question donates or accepts electrons to or
from hydrogen as a standard reference.

redundancy Existing in more than one


copy, for example, in repetitive DNA.

refractory phase A period of time


required after emission of a nerve impulse
for regeneration of the ability of a neuron
to emit a new nerve impulse.

Refsum disease An autosomal reces-


sive genetic disease that is one of the
Recombination leukodystrophies, characterized by dam-
age to the white matter of the brain and
impaired movement. The disease is caused
recombinational repair A mechanism by a lack of the enzyme that breaks down
for repairing thymine dimers based on phytanic acid, which as a result causes
recombining an undamaged piece of DNA toxic levels of phytanic acid to build up in
from the undamaged strand into the dam- the brain, blood, and other tissues. The
aged region during DNA replication. symptoms include increasing night blind-
ness, loss of the sense of smell (anosmia),
reconstituted viral envelopes (RVEs) and over time, deafness, ataxia, periph-
Viral envelopes whose contents have eral neuropathy, and cardiac arrhythmias.
been removed or replaced with other sub- Refsum disease can result from mutations
stances. RVEs are made by a two-step in any of three genes: phytanoyl-CoA
process in which the whole virus is fi rst hydroxylase (PAHX or PHYH, chromo-
completely disassembled and then the somal location 10pter-p11.2) or the gene-
components of the envelope portion are encoding peroxisome biogenesis factor,
allowed to reassemble. RVEs are used to peroxin-7 (PEX7, gene map locus 6q22-
deliver substances of biological interest to q24).
various types of animal cells. See deliv-
ery system and fusogenic vesicles. regeneration The ability to grow an
organ, a structure, or a whole organism
recoverin A small (23 kDa) calcium- from one or a few cells.
binding protein found mainly in the pho-
toreceptors of the vertebrate retina. Recov- regulatory enzyme An enzyme that is
erin plays a role in regulating the process part of a biochemical pathway, usually
of phototransduction by binding to rho- the fi rst enzyme in the series, and that
dopsin kinase (GRK1), which prevents serves as a regulator of the chemical reac-
the inhibition of rhodopsin through phos- tions in the pathway by either speeding
phorylation. This in turn prolongs the light up or slowing down the chemical reaction
response. There is one mammalian gene it controls in response to some environ-
(rcv1; gene map locus 17p13.1) and there mental condition(s).
are orthologues of recoverin present in the
photoreceptors of most vertebrate species, regulatory gene A gene whose product
beginning with amphibians. controls the expression of another gene
or genes. The repressor proteins of the lac
redox potential A measure of the affin- operon and the lambda bacteriophage cI
ity that an atom or a molecule has for elec- regions are examples of regulatory gene
trons. The redox potential is usually given products. See lac repressor protein.

204
www.stemcell8.cn
replication eye

regulatory sequence A nucleic-acid including tumor necrosis factor, interleukin


sequence that serves as a site at which 1, T-cell activation signals, bacterial endo-
the protein product of a regulatory gene toxins, viral-transforming proteins, growth
attaches; attachment of a regulatory factors, and reactive oxygen species induce
protein to a regulatory sequence is the phosphorylation of NFkB, which leads to
mechanism by which a regulatory gene its translocation into the nucleus where IkB
controls the expression of another gene. is degraded. In the nucleus NFkB acts as a
See enhancers and silencers. transcription factor for genes encoding cyto-
kines, cytokine receptors, cell adhesion mol-
regulon A set of spatially separated ecules, proteins involved in coagulation, and
genes under the control of a single repres- genes involved in cell growth control. NFkB
sor-operator system. See operator. is also believed to be an important transcrip-
tional regulator for HIV. rel is located on
relaxed The state of a large molecule, chromosome 2p13-p12.
for example, a long DNA molecule or a
protein, being in a loose conformation or renaturation The process of a molecule
loosely folded over on itself. Change in assuming its native shape or conforma-
biological activity is often related to the tion after disruption of the native state,
degree of twisting, folding, or compres- for example, the reassociation of DNA.
sion of a molecule.
reovirus A group of RNA containing
relaxin A peptide hormone produced by viruses that infect both the gut and respira-
the corpora lutea of ovaries during preg- tory tracts, usually without causing observ-
nancy. The hormone causes softening of able disease. The name is an acronym
the cervix and plays a role in regulating derived from respiratory enteric orphan.
contractions during the birth process. The
relaxin family is a member of the insulin repair synthesis Synthesis of new DNA
superfamily and contains seven peptides: to replace a defective segment that has
relaxins 1, 2, and 3, and the insulin-like been removed; repair synthesis usually
(INSL) peptides INSL3, INSL4, INSL5, involves creating a complementary DNA
and INSL6. The relaxins are now believed strand from the remaining, nondefective
to be involved in a variety of functions DNA strand. See excision repair.
other than parturition. These putative
functions include regulation of pituitary repetitive DNA A class of eukaryotic
hormone secretion, renal vasodilatation, DNA sequences that are present in many,
enhancement of coronary flow, and pro- sometimes thousands or millions, of copies
motion of nitric oxide biosynthesis that throughout the genome. See Alu elements.
may affect smooth muscle function.
replacement sites DNA nucleotide bases
release factor A protein that causes the that, when changed, for example, by
process of translation to terminate when a mutation, result in a change(s) in the
termination signal on the mRNA is present. amino acid(s) that the DNA codes for.

rel oncogene The oncogene product car- replica plating A procedure by which
ried by the avian reticuloendotheliosis virus bacterial colonies growing on one bac-
strain T (v-rel); the cellular product relA is terial plate are reproduced on a second
the p65 subunit of the NF-kappa B tran- bacterial plate in the exact relative posi-
scription factor, a member of the rel/NF- tions to one another as they were in the
kappa B family of transcription factors; original plate.
these transcription factors are critical media-
tors of immune and inflammatory responses. replication eye The opening cre-
In most cells NFkB is associated with IkB, ated between DNA strands as a result of
an inhibitory protein. A number of stimuli, unwinding of the DNA helix during the

205
www.stemcell8.cn

rel oncogene

membrane

cytoplasm
rel
(p65) IkB

p65-p50 dimer

nucleus

phophorylation of IkB
releases p65-p50 dimer

IkB P

translocation
of p65-p50
dimer to nucleus

activation of
transcription

nucleus

206
www.stemcell8.cn
response coefficient

replisome includes DNA polymerase, pri-


mase, DNA ligase, DNA helicase, single-
strand binding (SSB) protein, and topoi-
somerase.

reporter gene A gene whose expres-


sion is linked to the expression of another
gene or biochemical process.

repressible enzyme An enzyme whose


expression is governed by repression of
gene transcription.

repressor protein A regulatory protein


that exerts control over gene expression
by binding to a regulatory sequence and
thereby preventing transcription of the
gene.

reptation The process by which a


Replication fork nucleic acid strand is threaded through
the pores in an agarose gel matrix in a
process of DNA replication (replication headfi rst fashion during pulsed field-
forks). gel electrophoresis.

replication fork The portion of the resolvase An enzyme that catalyzes


partially replicated DNA consisting of the the site-specific recombination event that
separated DNA strands plus the newly syn- results in the integration of some trans-
thesized copies. See antiparallel, lag- posable elements. Resolvase is coded for
ging strand, and Okazaki fragment. by a gene on a transposable element.
replication of DNA The process in resorufin--D-galactopyranoside (RG)
which DNA is copied by using each A synthetic substrate for the enzyme, beta-
of the strands as a template for a new galactosidase, the product of the lacZ
strand. Because with each round of DNA gene that produces a fluorescent pro-
synthesis the new DNA consists of one duct in the presence of the enzyme. RG is
newly synthesized strand and one paren- used to detect the expression of the lacZ
tal strand, the process of DNA replica- gene in individual cells by fluorescence-
tion is called semiconservative. See DNA activated cell sort-ing (FACS).
polymerase(s).

replication origin A sequence of nu- respiration The oxygen-dependent pro-


cleotide bases that provides a signal for cess of generating energy in the form of ATP
the start of DNA replication. from sugars. See electron transport.

replicon The exact site on the DNA at response coefficient A number that
which replication is actively taking place. gives a measure of how the rate of flow th-
See replication origin. rough a given biochemical pathway chan-
ges as a result of some outside influence
replicon fusion The meeting of two such as a hormone or change in the con-
replicons approaching each other from centration of an ion. The response coef-
opposite ends of replicating DNA. ficient (R) is made up of two components:
the sensitivity of the pathway to the en-
replisome The complex of factors that zyme (C) and the sensitivity of the enzyme
are active at a DNA replication fork. The to the outside influence (), R = C. If

207
www.stemcell8.cn
resting potential

response coefficients are known for each foreign antibody-agglutinated antigens


enzyme in the pathway, then it is possible from the bloodstream.
to predict how the rate of flow through
the pathway will be affected by a particu- retinoblastoma A cancer of the cells
lar outside influence. of the retina that occurs in small chil-
dren. Retinoblastoma was one of the fi rst
resting potential The electrical poten- cancers that was shown to run in families
tial across the membrane of a neuron in (familial retinoblastoma) and was there-
between nerve impulses. fore genetic in origin. See Rb.

restriction endonuclease (restriction retinoic acid receptors (RAR, RXR)


enzyme) An enzyme, produced by bac- Transcription factors that are activated
teria, that cleaves DNA at a place defined by binding to retinoids in the cytosol.
by a specific sequence of nucleotide bases. The activated factors are responsible for
inducing the expression of genes seen in
restriction fragments The DNA frag- retinoid-treated cells. There are two types
ments that are produced by cleavage of of retinoid receptors, RAR and RXR,
DNA by a restriction endonuclease. which bind the trans form of retinoic acid
and the cis form, respectively; each type of
restriction mapping A technique of receptor has , , and isoforms. Because
mapping DNA by determining the location they serve a function in the nucleus (tran-
of sites for different restriction enzymes. scription), RAR and RXR are referred to
as nuclear receptors similar to receptors
restriction site The nucleotide base for thyroid hormone, vitamin D3, and
sequence on DNA that specifies the site steroids. Retinoic acid receptors play an
where a given restriction endonuclease important role in the growth and differen-
will cleave. tiation of epithelial tissues, the generation
of new blood cells (hematopoiesis), and in
reticulo-endothelial system (RES) All central nervous system development. The
the phagocytic cells of the body except the RAR gene is a common target in chro-
circulating leukocytes. Cells of the RES mosomal translocations in acute promy-
remove particulate matter, for example, elocytic leukemia (APL).

Computer-generated restriction map

208
www.stemcell8.cn
reverse transcriptase

retrograde transport The process by acronym derived from reverse transcriptase


which materials move from the plasma = retravirus, which later became retrovirus.
membrane to lysosomes or to the Golgi
apparatus and then to the endoplasmic retrovirus vector A genetically engi-
reticulum; the direction of transport is neered DNA for cloning recombinant
opposite from that taken by newly syn- DNA that utilizes certain control ele-
thesized membrane proteins (anterograde ments from retroviruses.
transport). Retrograde transport is part
of the process by which worn-out mem- reverse genetics The term used to
brane components are recycled. This pro- describe the type of genetic analysis in
cess is particularly evident in nerve cells, which the structure of a gene is deter-
where parts of membranes from synaptic mined from the protein that it codes for.
vessels move along the axon toward the In the more common type of analysis, the
cell body for lysosomal degradation and protein structure is determined from the
recycling. Various toxins, such as ricin, structure of its corresponding gene.
pertussis toxin, and tetanus toxin, make
use of the retrograde transport system for reverse mutation A mutation that reverses
their delivery to intracellular targets. the effects of a previous mutation. The reverse
mutation may or may not be localized near
retroposon A type of transposon that has or at the site of the mutation whose effects it
suppresses. See suppressor mutation.
a structure similar to a retroviral genome in
that it contains LTR-like sequences flank- reverse transcriptase The enzyme,
ing a coding region and it replicates via made and used by retroviruses during
an RNA intermediate that is reverse tran- their life cycle, that catalyzes the synthesis
scribed into a double-stranded form that of DNA copied from an RNA template.
integrates into the genomic DNA. The enzyme is widely used in genetic engi-
neering and molecular biology to make so-
retrovirus A class of viruses characterized called complementary DNA (cDNA) from
by having an RNA genome and carrying various RNAs so that base sequences in
the enzyme reverse transcriptase within the RNA can be cloned and manipulated by
virus capsid. The name was originally an recombinant DNA technology.

Retrovirus

209
www.stemcell8.cn
recto transcription
reverse

Retrovirus life cycle

reverse transcription The term that The presence of the Rh factor in a fetus
describes the action of the enzyme, whose mother is Rh may provoke a life-
reverse transcriptase. threatening agglutination of the fetal blood
cells. The term is named for the rhesus
rhesus blood groups Classification of monkey, the organism that was used to
blood cells according to whether or not demonstrate the presence of the antigen.
they react with antibodies to the blood There are at least 30 distinct subtypes of
cells of rhesus monkeys. Rh factor.

rheumatoid factors Certain antibod- rhinovirus A picornavirus that infects


ies (IgM) present in the blood of some the nasal cavity and causes many of the
individuals with rheumatoid arthritis that symptoms of the common cold, particu-
react against other antibodies. Since it was larly the nasal symptomatology.
discovered that different rheumatoid fac-
tors are specific for only certain subgroups rhizobium A leguminous plant that is
of antibodies, rheumatoid factors became a rich source of nitrogen-fi xing bacteria
a means of classifying an individuals anti- that live in large nodules attached to the
bodies into subclasses (allotypes). plant roots.

Rh factor An antigenic substance on rho factor A small bacterial protein


the surface of the blood cells of any indi- that is responsible for causing tran-
vidual that carries the Rh trait (Rh+). scription to terminate when a ribosome

210
www.stemcell8.cn
rifampicin
verso

encounters an appropriate termination ribosome A small organelle in the cyto-


signal on the mRNA. plasm that is the site where protein syn-
thesis takes place. Ribosomes are made
riboflavin Vitamin B2; an important up of two subunits. The subunits are
cofactor for enzymes involved in the assembled together with a strand of mes-
metabolism of sugars for ATP produc- senger RNA to begin protein synthesis.
tion. Riboflavin acts to transport elec-
trons derived from the oxidation of sug- ribozyme An RNA with enzymatic
ars in energy production. properties. The idea that RNAs could
function as enzymes was fi rst suggested
by Carl Woese, Francis Crick, and Leslie
ribonuclease A class of enzymes that Orgel in 1967. Thomas Cech described
breaks down RNA by breaking the bonds the fi rst ribozyme, a self-splicing RNA
between the phosphate and the ribose in Tetrahymena thermophila. The bacte-
molecules in the RNA backbone. rial 23S ribosomal RNA has also been
shown to be a ribozyme that catalyzes the
ribonucleic acid See RNA. peptidyl transferase step in the process
of protein synthesis. Synthetic ribozymes
ribonucleotide A molecule consisting are being studied as possibly better alter-
of ribose that is bound to phosphate and natives to protein enzymes. In 1989 the
with a purine or pyrimidine base attached Nobel Prize in chemistry was awarded to
to the ribose molecule. Ribonucleotides Thomas R. Cech and Sydney Altman for
are the building blocks of ribonucleic acid their discovery of catalytic RNAs.
(RNA).
ricin A potent, poisonous protein de-
ribose A five-carbon sugar normally in rived from the beans of the castor plant,
a ring conformation; the sugar used in R. communis, from which castor oil is
ribonucleotides. See carbohydrate. derived. Its lethality and ease of extrac-
tion make ricin an attractive choice as a
ribosomal protein Any one of many biological warfare agent. Ricin is com-
proteins that, together with a strand of posed of two hemagglutinins and two
RNA, form a ribosomal subunit. toxins (RCL III and RCL IV) that are
dimers of approximately 66 kDa. The
ribosomal RNA (rRNA) A long toxins are composed of an A and B chain.
strand of RNA that, together with ribo- The B chain mediates entry of the toxins
somal proteins, is a component of a ribo- into the cells after binding to the cell sur-
somal subunit. In eukaryotic cells there face glycoproteins. The A chain acts to
are two rRNAs denoted as 18s (found block protein synthesis by attaching to
in the small ribosome subunit) and 28s the 60S ribosomal subunit and blocking
(found in the large subunit). rRNA plays the binding of elongation factor-2, which
a role in binding mRNA in the process of results in cell death.
translation.
Rickettsia Small bacteria which, unlike
most other bacteria, are obligate parasites
that live within, instead of outside of, the
cells of the infected host. Rickettsia are
the agents that cause typhus fever and
Rocky Mountain spotted fever.

rifampicin An antibiotic that blocks


transcription by inhibiting the action of
RNA polymerase in bacteria, specifically
by inhibiting the initiation of the process
Ribose of transciption.

211
www.stemcell8.cn
recto
R loops

siRNA

dicer
enzyme

double-stranded RNA

small degraded
RNA fragments

RISC silencing complex

mRNA with homologous segment

degraded mRNA

R loops R loops are the segments of RNA Ribonucleic acid. A polymer of


DNA-representing introns that are seen ribonucleotides, the purine and pyrimi-
as single-stranded loops in electron dine base sequence that generally is
micrographs of heteroduplexes between a complementary to a DNA base sequence.
eukaryotic mRNA and the genomic DNA There are four major classes of RNA that
from which the mRNA was transcribed. perform different functions in the pro-

212
www.stemcell8.cn
rRNA
verso

cess of protein synthesis: messenger RNA strands that are shortened into functional
(mRNA), transfer RNA (tRNA), ribo- tRNAs.
somal RNA (rRNA), and small nuclear
RNA (snRNA). RNase H An enzyme that cuts RNA
chains from within the chain, creating
RNA-DNA hybrid(s) A double- nicks in the phosphodiester backbone.
stranded hybrid molecule in which RNA This enzyme is used during production
is based paired with a complementary of cDNA. After the fi rst strand of DNA is
strand of DNA. made from the RNA template, Rnase H is
used to nick the template to create primer
RNA interference (RNAi) An experi- ends for second DNA strand synthesis.
mental technique for silencing expression
of a specific gene(s) through the use of RNA tumor virus A subclass of retro-
small double-stranded RNA (dsRNA) to viruses that produces cancers by activa-
specifically target an homologous mRNA. tion of oncogenes.
In this technique dsRNA, which is intro-
duced into a cell, is cleaved into small (ca. RNP Ribonucleoprotein.
23 bp) fragments by an enzyme called
Dicer. The small RNAs (called short ros oncogene An oncogene that is
interfering RNAs; siRNAs) are trig- found in a stain of avian sarcoma virus
ger molecules for the siRNA-Dicer com- and that is associated with sarcoma
plex to recruit other factors to form an tumors in birds. The name is an acronym
RNA-induced silencing complex (RISC). derived from Rochester 2 sarcoma virus.
The siRNAs in the RISC can base pair
with mRNAs that have complementary Rot In the annealing of RNA to DNA, a
sequences which are then also cleaved variable equal to the molar concentration
and degraded by RISC. of the RNA multiplied by time allowed
for RNA-DNA annealing. Rot values are
RNA maturase An enzyme involved generally used in plots of the annealing of
in the splicing of transcripts in the yeast RNA to complementary DNA sequences.
mitochodial cytochrome b gene. The See Cot value.
RNA maturase gene is unusual in that
part of the gene is found in an intron of rotavirus A class of RNA-containing
the cytochrome b gene itself. viruses that infects the intestinal tract
and is responsible for epidemic gastroen-
RNA polymerases The class of enzymes teritis and infantile diarrhea.
that catalyzes the synthesis of a strand of
RNA using DNA as a template to guide rough ER Endoplasmic reticulum cov-
the assembly of ribonucleotides so that the ered with attached ribosomes. Proteins
order of the purine and pyrimidine bases synthesized by the ribosomes on the
in the DNA template is precisely copied, in rough ER are destined to be transported
complementary fashion, in the newly syn- out of the cell via vesicles that are derived
thesized RNA. from the endoplasmic reticulum.

RNA secondary structure The hairpin Rous sarcoma virus (RSV) A retro-
folding of an RNA molecule caused by virus that produces sarcoma tumors in
internal base pairing of complementary chickens. RSV, discovered and named for
stretches of purine and pyrimidine bases. Peyton Rous, was the fi rst RNA tumor
virus discovered.
RNase D An exonuclease that removes
nucleotides from the 3 end of an RNA rRNA Abbreviation for ribosomal RNA,
in one-at-a-time fashion. RNase D is the RNA strands that are, together with
involved in the maturation of tRNAs the ribosomal proteins, the basic compo-
that are synthesized in large precursor nents of ribosomes. In eukaryotic cells

213
www.stemcell8.cn
recto
RTK

RTK

there are two major rRNAs denoted as rubella An RNA-containing virus (toga-
18s (found in the small ribosome subunit) virus) responsible for German measles.
and 28s (found in the large subunit).
rumen bacteria Bacteria that live in
RTK Receptor tyrosine kinase; a class the rumen of ruminant animals such as
of transmembrane proteins whose extra- cows. The rumen bacteria utilize urea
cellular domain functions as a cell sur- that would otherwise be excreted to make
face receptor; the cytosolic domain acts amino acids, that are then returned to the
as a tyrosine kinase. Binding of a ligand circulatory system of the animal.
to the receptor domain initiates the pro-
cess of signal transduction by activating Runting syndrome A pathological
the tyrosine kinase domain that, in turn, condition, characterized by skin lesions,
brings about a cascade of subsequent pro- diarrhea, and death, that results when the
tein phosphorylations, ultimately lead- lymphocytes from a mature animal are
ing to induction of transcription of genes placed in and then attack the tissues of a
involved in cell-growth regulation. newborn.

214
www.stemcell8.cn

A
S

S1 nuclease An enzyme that catalyzes for typhoid fever and a number of wide-
the breakdown of any single-stranded (or ranging intestinal disorders.
single-stranded region of a) nucleic acid.
saltatory movement The directed
S1 nuclease mapping A technique of movements of organelles in the cell cyto-
determining where, on a segment of DNA, plasm. This type of movement is thought
the precise location of the sequences from to be controlled by microtubules.
which a given RNA is transcribed.
saltatory replication Replication of a
S-100 (calgranulin) Pro-inflammatory DNA sequence that produce extra copies of
cytokines expressed by types of leukocytes the sequence along the same DNA strand.
called monocytes and granulocytes under This type of process is believed to have been
conditions of chronic inflammation; ele- responsible for the highly repeated, tandemly
vated levels of calgranulins are found in arrayed sequences seen in satellite DNA.
patients with cystic fibrosis. The calgranu-
lins are calcium-binding proteins that con- salting out The phenomenon of causing
sist of at least two different polypeptides, dissolved proteins or nucleic acids to precip-
designated A and B, coded for by genes itate out of solution by the addition of salts.
on human chromosome 1q12-q21. A cell-
surface receptor for S100A12, known salt stabilization A phenomenon whereby
as RAGE, interacts with a factor called slow denaturation of proteins and nucleic
ENRAGE (extracellular newly identified acids in aqueous solution is prevented by the
RAGE-binding protein) in endothelium, addition of salts.
mononuclear phagocytes, and lympho-
cytes and triggers the generation of key Sanger, Frederick (b. 1918) Discov-
pro-inflammatory mediators. erer of the first means by which the amino
acid sequence of a polypeptide could by
saccharide The biochemical term for a determined. Sanger is famous for the dis-
sugar. covery of the amino acid sequence of insu-
lin in 1954; he was awarded the Nobel
Saccharomyces cerevisiae A yeast Prize in chemistry in 1956.
that is widely used as a vehicle for cloning
extremely large segments of foreign DNA Sanger method A method for deter-
(see yeast artificial chromosome) mining the sequence of a polypeptide
and for molecular studies on many ani- based on determination of the identity of
mal genes that have homologues in yeast. the terminal amino acids of small sub-
fragments of the original polypeptide.
saline A solution of sodium chloride at
a concentration exactly equivalent (eight Sanger (dideoxy) sequencing A tech-
grams per liter; 0.8 percent) to that found nique for determining the sequence of a seg-
in bodily fluids. ment of DNA that utilizes synthetic nucleo-
tides (dideoxy nucleotides) to create small
Salmonella A group of Gram-negative, polynucleotides representing small subfrag-
rod-shaped bacteria that is responsible ments of the DNA that are to be sequenced

215
www.stemcell8.cn
recto
saprotroph

but that can be made to terminate specifi- of the trematode worms of the genus
cally at any one of the four purine or pyrim- Schistosoma. Schistosomaiasis is endemic
idine bases. See dideoxy sequencing. in the populations of Africa, the Middle
East, and South America.
saprotroph An organism that obtains
nourishment from nonliving matter. schizonte A subgroup of protozoa (spo-
rozoa) that reproduces asexually. Plasmo-
sarcoma-derived growth factor (SGF) dium is a schizonte that causes malaria.
A growth factor secreted by cells infected
with murine sarcoma virus, an RNA Schwann cells A type of brain cell
tumor virus. Because noninfected cells that encompasses the axon of a neu-
treated with SGF undergo changes gener- ron, thereby forming a sheath of myelin
ally characteristic of cells transformed into around the axon. The myelin sheath is
a cancerous state, sarcoma derived growth essential for proper transmission of nerve
factor is now referred to as transforming impulses between neurons. Multiple
growth factor (TGF). sclerosis is an example of a disease that
induces loss of muscle control by causing
sarcoplasmic reticulum A membranous demyelination of the axon.
structure that surrounds the myofibrils in
muscle tissue. The sarcoplasmic contains scintillation counter A sensitive device
calcium pumps that regulate the level of for detecting single emissions of particles
calcium ion (Ca++) in muscle tissue. produced by radioactive decay.
sarcosine A component of the antibiotic, screen A method developed to detect and/
actinomycin D, an inhibitor of transcription. or select a recombinant protein, mutant, inter-
Chemically, sarcosine is N-methyl glycine. acting protein, drug, hybridoma, and so on.
satellite DNA A type of DNA made up SDS Sodium dodecyl sulfate; a detergent
mostly of repeated sequences that are not widely used to dissociate biological mate-
transcribed into RNA and that are found rials into their component molecules.
near the chromosome centromere.
SDS-polyacrylamide-gel electropho-
satellite RNAs See virusoids. resis (PAGE) A variation of the poly-
acrylamide-gel electrophoresis technique
scanning electron microscopy (SEM) A
in which SDS is dissolved in the poly-
variation of electron microscopy in which the
acrylamide gel. This type of gel is widely
specimen is given a thin coat of metal so that
the electron beam can be used to visualize used to separate proteins in mixture from
details of the cell surface as opposed to inter- one another on the basis of size.
nal structures.
secondary culture The cell culture that
scatter plot A graph that shows the is derived from the original outgrowth of
relationship between two variables as a cells derived directly from a tissue speci-
set of data points. men (i.e., the primary culture).

Schiffs reagent A chemical (fuchsin secondary structure The manner in


leucosulfonate) used in the periodic-acid which a linear polypeptide is folded, tw-
Schiff (PAS) stain that is used to identify isted, or otherwise bent. The most common
the presence of certain infecting microor- types of secondary structure are the alpha-
ganisms; for example, fungi. helix and the pleated-sheet structures.

schistosomiasis A group of diseases second-order kinetics (bimolecular


whose symptoms range from dermatitis kinetics) A term describing the rate at
to cirrhosis of the liver. The symptoms which a chemical reaction involving two
are caused by parasitic infection by one reacting molecules occurs.

216
www.stemcell8.cn
Sendai verso
virus

secretion The ability of the host cells that ture of oligonucleotides is passed through
produce recombinant proteins products to a column containing a matrix to which
release the products extracellularly. Large- the target molecule (for example, ATP)
scale production of recombinant proteins is attached. Oligonucleotides that bind to
requires the secretion of the product into the target will be retained on the column,
the culture medium for easy harvesting. while nonbonding oligonucleotides will
Vectors have been developed that fuse wash through the column. The retained
recombinant DNA protein products with oligonucleotides can be eluted and ampli-
sequences that will direct the proteins to the fied and passed through the column again
surface of the host cells. In addition, bacte- in order to select oligonucleotides with
rial hosts are being developed that more stronger binding affi nities to the target.
This is repeated multiple times to select a
easily secrete proteins than E. coli hosts.
few candidate oligonucleotides with very
high binding affi nities to the target.
segment polarity mutants Mutants of
the fruit fly, Drosophila melanogaster, in
which one of the halves of each segment self-assembly The spontaneous, unas-
(the P compartment) is replaced by the sisted assembly of the components of a
other half (the A compartment) so that complex structure, for example, the pro-
each segment contains two mirror images tein viral coat of tobacco mosaic virus.
of one of the normal halves.
self-protein Any protein that, as the
segments, segmentation A pattern result of immunological screening in early
that develops in the embryo of the fruit life, is determined to be self and there-
fly, Drosophila melanogaster, which is fore not recognized as a foreign antigen that
defi ned by indentations giving the embryo would be attacked by the immune system.
the appearance of stacked disks with Certain illnesses, referred to as autoimmune
each disk representing a segment. Vari- diseases, result from a failure of the immune
ous structures of the adult such as legs, system to recognize self-proteins.
antennae, wings, and eyes develop from
specific segments. Each segment consists self-tolerance The lack of an immune
of two halves: the A (anterior) compart- response to a self-protein.
ment and the P (posterior) compartment.
semiconservative replication The mode
selection The ability to detect a recom- of DNA replication in which each of
binant protein, mutant, interacting protein, the original parental DNA strands is
hybridoma, and so on. Selection techniques based paired with one newly synthesized
may make use of selective medium or spe- daughter strand. Experiments performed
cific markers on cells to be detected. by Matthew Meselson and Franklin
Stahl in the mid-1950s demonstrated that
selective medium A growth medium DNA replication was semiconservative as
that, either by the inclusion of a toxic opposed to conservative. This fi nding laid
substance or by the lack of an essential the foundation for future experiments
nutrient, promotes the growth of only cer- that ultimately elucidated the molecular
tain variant organisms in a population, for details of the process of DNA replication.
example, the growth of penicillin-resistant
bacteria on a nutrient agar that contains semidiscontinuous replication DNA
penicillin. See synthetic medium. replication involving the synthesis of many
small fragments that occurs on the lagging
SELEX Systematic evolution of ligands strand of double-stranded DNA in the
by exponential enrichment; an iterative form of Okazaki fragments.
technique for selecting oligonucleotides
that bind to certain target molecules Sendai virus A member of the para-
from a mixture of random oligonucle- myxoviruses that is used to induce cell
otides. In the SELEX technique, a mix- fusion, a technique for creating hybrid

217
www.stemcell8.cn
recto
sensitization

cells (heterokaryons) for the study of matography. This composite improves


genetics in cultured cells. on the traditional gel fi ltration materials
based upon cross-linked dextran (see Sep-
sensitization A lowering of the thresh- hadex) or polyacrylamide (see biogel),
old for a nerve impulse to be generated as a in that it is a more rigid gel type, which
result of strong and repeated stimulation of allows for higher flow rates and is better
a neuron by another neuron. Sensitization suited to large-scale chromatography.
results from the tendency of some neurons
to trigger an action potential if stimulated Sephadex A polysaccharide-derived gel
by weaker-than-normal nerve impulses or (formed by cross-linking of dextran
with shorter-than-normal refractory phases strands). Filtration of mixtures of biologi-
if action potentials have been triggered in cal molecules through Sephadex gels in
that neuron in the recent past. columns is a widely used procedure for
separation of molecules based on size. See
Sephacryl A composite matrix of poly- gel-exclusion chromatography and
acrylamide and dextran for column chro- gel filtration.

Sequencing by the dideoxy technique

218
www.stemcell8.cn
serotonin
verso

Sepharose A form of agarose as small serine proteases A family of proteo-


beads used in column chromatography for lytic enzymes named for the fact that they
size separation of biomolecules similar to always employ a serine residue in the cata-
Sephadex and also a matrix for attaching lytic site that is involved in the cleavage
antibodies and other ligands for various of a peptide bond at a specific site in a
types of affi nity chromatography. polypeptide or protein. In mammals ser-
ine proteases are particularly important in
sequenator A device for carrying out digestion, blood clotting, and the activa-
the automated sequencing of peptides by tion of factors in the complement system.
the Edman procedure.

sequence A term for the linear or end-to- serodiagnostics A diagnosis based on


end arrangement of biomolecules in a long the indirect evidence provided by serol-
polymeric molecule. Most often used to ogy indicative of a disease state or that
denote the order of purine and pyrimidine an individual has been previously exposed
bases along the length of a nucleic acid, for to a pathogenic organism, for example,
example, AAGCTTCG . . . , where A=aden- tuberculosis.
ine, C=cytosine, G=guanine, T=thymine.
serologic reactions Any of several
sequence conservation The tendency reactions based on the presence of spe-
of certain DNA sequences to resist change cific antibodies in the blood serum. These
in the course of evolution and therefore to reactions generally fall into three cat-
be similar in dissimilar organisms. egories: bacteriolysis, precipitation, and
agglutination.
sequence homology The degree of
similarity between two nucleic acids as
serology A type of laboratory analysis
represented by the percentage of bases on
based on the presence or absence of spe-
one nucleic acid strand that match bases
cific antibodies in the blood serum.
on the other nucleic acid strand when the
two are aligned.
seropositive (seronegative) The fi nd-
sequencing The process of determin- ing, in a diagnostic test, that reactive
ing the sequence of a polymeric biomol- antibodies to a given agent are (seroposi-
ecule, for example, a nucleic acid or the tive) or are not (seronegative) present in a
amino acid sequence in a polypeptide, the sample of blood serum.
sequence of sugars in a polysacharride,
and so on. See dideoxy sequencing. serotonin A monoamine neurotrans-
mitter made from the amino acid tryp-
SERCA pumps Sarcoplasmic and endo- tophan that regulates mood. A number
plasmic reticulum calcium ATPase; special- of antidepressant drugs such as Prozac,
ized pumps that transport Ca++ ions from Paxil, and Zoloft (selective serotonin
the cytosol into the lumens of the endoplas- reuptake inhibitors; SSRIs) act by inhibit-
mic reticulum and sarcoplasmic reticulum. ing the reuptake of serotonin released at
In skeletal muscle sequestration of calcium the synapse, which enhances the stimula-
is a mechanism for regulating muscle con- tory effects of serotonin on mood.
traction; high cytosolic levels of calcium
stimulate muscle contraction while low lev-
els result in relaxation. In humans there are
three SERCA genes that code for as many
as 10 isoforms by alternative splicing.

serine An amino acid that, because it


contains an hydroxyl group, can serve as
a site for phosphorylation when serine is
part of a protein. Serotonin
219
www.stemcell8.cn
recto
serum

serum The liquid part of blood from (TDF), which initiates sex determination in
which the blood cells have been removed males. Mutations in SRY give rise to XY
by clotting. females with a condition called gonadal
dysgenesis (Swyer syndrome), in which
serum albumin One of the most abun- there is gonadal degeneration leaving only
dant proteins in blood (albumin con- streak gonads of fibrous tissue and ovar-
stiutes about 50 percent of the plasma ian stroma. In these patients there is no
protein). Albumin has at least two main development of secondary sexual character-
functions: (1) to regulate water content istics at puberty. Part of the Y chromosome
of the tissues and (2) as a carrier of fatty containing SRY can also translocate to the
acids in the blood stream. X chromosome, which causes a condition
known as XX male syndrome.
serum globulins A group of abundant
blood proteins with wide-ranging func- SH2, SH3 domains Domains of
tions. The globulins are divided into the GRB2 protein that function to
three categories: alpha, beta, and gamma. mediate binding reactions of the signal-
Gamma globulins are the category that transduction protein, GRB2. The SH2
includes all the serum antibodies; the domain of GRB2 binds to the phosphory-
alpha and beta globulins form essen- latred tyrosine residues on the cytoplas-
tial complexes with various substances, mic domains of receptor tyrosine kinases
for example, lipids (these complexes are and the SH3 domains bind to the protein,
known as lipoproteins), carbohydrates SOS. The SH prefi x stands for Src Homol-
(mucoproteins and glycoproteins), iron ogy because of their homology to the src
(transferrin), and copper (ceruloplasmin). oncoprotein of rous sarcoma virus.
severe combined immunodeficiency shadowing The process of coating
(SCID) A group of inherited disorders a specimen with a thin layer of metal,
in which an individual lacks an immune
such as platinum or palladium, by heat
response due to a lack of infection-fighting
evaporation under a vacuum. Shadowing
lymphocytes. SCID is known in the pop-
is necessary to view surface detail of the
ular media as the bubble boy disease,
specimen under an electron microscope.
for David Vetter, a boy with SCID who
lived in a germ-free plastic bubble in the
1970s. There are several forms of SCID.
shaker mutation A mutation in a K+
channel in Drosophila that causes fl ies
One form is X-linked and so is most com-
carrying the mutation to shake uncontrol-
mon in males. In another form the condi-
lably under anesthesia. The K+ channel
tion is caused by a deficiency of the enzyme
adenosine deaminase (ADA). SCID mice was cloned from shaker mutants, and this
are widely used in research to carry tissue allowed critical experiments to be carried
xenografts from other animals, including out on how K+ channels function in the
humans, because their weakened immune generation of action potentials.
systems allow the tissue to grow without
being rejected. In this way the tissue can shikimate pathway A major biochem-
be studied while it is growing in an animal. ical pathway by which all the aromatic
See ADA. amino acids (tyrosine, phenylalanine, and
tryptophan) are synthesized from one
sex chromosome See X chromosome. parent chemical, shikimate.

sex-determining region Y (SRY) A Shine-Delgarno sequences Special


region on the Y chromosome (gene map sequences present on the 5 region of
locus Yp11.3) that is responsible for devel- each gene in a prokaryotic cell that are
opment of the testis. SRY encodes a tran- rich in the bases adenine and guanine and
scription factor of the high mobility group that help to align the ribosome on the
(HMG)-box family of DNA-binding pro- mRNA so that translation can begin at
teins called the testis-determining factor the proper start site.

220
www.stemcell8.cn
silencers
verso

short-tandem repeat (STR) Sequences sigma factor A small protein that


of DNA consisting of a core repeat of forms a complex with the RNA poly-
three to four bases, with an overall length merase enzyme in prokaryotic cells. The
of a few hundred bases. Such STR are formation of sigma factorRNA poly-
used as markers in DNA profi ling tech- merase is essential for the accurate intia-
niques because they are easily amplifi- tion of transcription in bacteria.
able, and STRs that differ from each
other by one repeat unit can be easily signal peptidase An enzyme that
resolved from each other on high-resolu- catalyzes the cleavage of the signal pep-
tion sequencing gels. tide immediately after the polypeptide is
inserted into the endoplasmic reticulum.
shotgun-cloning method A technique
of cloning a DNA sequence of interest signal-recognition particle (SRP) A
based on mass ligation of a heterogeneous ribonucleoprotein comprised of six poly-
mixture of DNA fragments into a vector; peptides and a small (7S) RNA molecule
the vector carrying the DNA of interest that mediates the binding of a signal
is then selected from mixture of cloned sequence on a preprotein to its appropri-
DNA fragments. This technique is useful ate membrane receptor.
when the DNA of interest is represented
in low abundance or is difficult to purify. signal sequence A special sequence of
amino acids on the amino terminal end
shuttle vector A vector genetically of polypeptides that are destined to be
engineered to permit the growth and/or exported from a eukaryotic cell. If the
expression of recombinant DNAs in both signal sequence is present, then the pro-
prokaryotic and eukaryotic cells tein bearing that sequence is transferred
into the endoplasmic reticulum where it
sialic acid A modified sugar found in is further processed for export.
the lipids of the membranes of neural
cells that are part of the receptor for neu- signal transduction A process in which
rotransmitters. a substance binds to a receptor on the out-
side of a cell that then transmits a signal to
sialophorin (SPN) A major sialoglyco- induce a metabolic reaction. The chemical
protein found on the surface of human T that acts as the signal is called a second
lymphocytes, monocytes, granulocytes, and messenger, the first messenger being the
some B lymphocytes that is important for substance that bound to the receptor but
immune function. Sialophorin is a compo- cannot itself enter the cell to induce the
nent of a receptor-ligand complex involved metabolism. (See figure on next page.)
in activation of T cells. The sialophorin
gene is at gene map locus 16p11.2. signature sequence A segment of a par-
ticular protein, generally between 10 and
sickle-cell anemia A genetic condition 50 amino acid residues, that is found only
involving a point mutation in the beta chain in one taxonomic group of organisms and
of the hemoglobin protein that results in not in others. For example, the elongation
a loss of ability to carry oxygen from the factor EF-Tu contains a 12 amino acid
lungs to the tissues of the body. The dis- sequence near the amino terminal end that
ease derives its name from the fact that red is found in archaebacteria and eukaryotes
blood cells carrying the mutant hemoglobin but not in other types of bacteria. Signa-
assume an elongated sickle shape. ture sequences have been subcategorized
as superfamily signatures and motifs.
sickle-cell disease The pathological
condition caused by sickle-cell anemia silencers Certain nucleotide sequences
that is characterized by an inability to that act to suppress the activity of a pro-
handle exertion. moter. Silencers may act at distances

221
www.stemcell8.cn
recto mutation
silent

Schematic representation of the ras-dependent signal-transduction pathway. A membrane-bound


receptor tyrosinase (TRK) becomes activated by ligand binding to its extracellular domain,
and tyrosine residues on the cytosolic side of the membrane undergo autophosphorylation. An
activated ras bound to GTP then binds to cytosolic raf, which then becomes activated. The raf
C terminus is a protein kinase with dual specificity (serine/threonine) that acts to phosphorylate
and thereby activate MEK, a MAP-kinase kinase (MAPKK). MEK, which is itself a dual-specificity
kinase, activates MAP kinase (MAPK) via phosphorylation. Activation of MAPK leads to phos-
phorylation of a variety of transcription factors, including the AP1/jun complex, fos, and others,
which results in gene transcription.

greater than one kilobase away from the or because the effect of the mutation is
promoter sequences on which they act. masked.

silent mutation A mutation whose silent sites DNA nucleotide bases that,
effect is not manifest either because it when changed (for example, by muta-
occurs in a nonessential region of DNA tion), do not result in any change in the

222
www.stemcell8.cn
Smads
verso

amino acids in the polypeptide coded for site-specific drug delivery A tech-
by the DNA. nique for targeting drugs to certain tis-
sues. Various strategies may be employed
simian virus 40 A small DNA virus to accomplish this, for example, chemical
accidentally discovered as a contaminant linkage of antibodies to the drug mol-
in cultured African green monkey kidney ecule or attachment of the drug molecule
cells that are used to grow polio virus for to a ligand that is specific for a cell sur-
vaccine development. The virus was later face receptor. See fusogenic vesicles.
found to be oncogenic in mice although
not in humans or in its natural host. site-specific recombination Recombi-
nation between two DNAs that occurs at
simple sequence DNA DNA sequences a specific site on each DNA. Site-specific
that are extremely highly repeated th- recombination is exemplified by integra-
roughout the genome of an organism. tion of lambda bacteriophage DNA in
These highly repeated sequences that are which recombination takes place at a site
generally very short in length are referred designated as attP on the bacteriophage
to as simple sequences. DNA and the corresponding site (desig-
nated attB) on the bacterial host DNA.
sindbis virus A member of the family of
RNA-containing togaviruses (alphavirus
Skatchard analysis (plot) A math-
ematical method for estimating both the
group). Infection in humans and other
number of receptors for a certain ligand
mammals is via mosquitoes where varying
and the affi nity of the ligand for its recep-
degrees of encephalopathy are produced.
tor from a plot of the amount of unbound
ligand versus (bound ligand)/(free ligand).
single-locus probes (SLP) A tech-
nique used in DNA profi ling in which
skeletal muscle The relatively more-
the DNA from an individual, blotted to a
striated muscle tissue associated with
membrane (see Southern blot hybrid-
voluntary movement, for example, in the
ization) is mixed with a probe in a series
movement of the limbs.
of sequential tests that will detect a single
sequence. Usually, only two bands are
ski oncogene The oncogene carried by
detected at each stage of the test.
a strain of avian sarcoma virus, it derives
it name from Sloan-Kettering Institute,
sis oncogene An oncogene that is where it was discovered. The oncogene
found in simian sarcoma virus and that is was identified on the basis of its ability to
associated with sarcoma tumors in both transform cultured cells to a cancer-like
monkeys and cats. The name is an acro- state. ski has subsequently been shown to
nym derived from simian sarcoma. The cause non-muscle cells to differentiate into
sis oncogene protein is virtually identical skeletal muscle. The proteins encoded
to one of the subunits of platelet-derived by ski regulate transcription of genes by
growth factor (PDGF). forming complexes with various tran-
scription factors, including NF-I, Smad2,
sister-chromatid exchange The ex- and Smad3. The ski proto-oncogene
change of material between the two (c-ski) gene map locus is 1q22-q24.
daughter strands of a replicated chromo-
some (i.e., chromatids) during meiosis; Smads Signal transduction elements
recombination occurring at the chromo- associated with signaling by TGF recep-
somal level. tors. Binding of members of the TGF fam-
ily of growth factors to their receptors
site-directed mutagenesis The tech- causes Smads on the cytosolic side of the
nique by which specific bases on a seg- membrane to become activated by phos-
ment of DNA are experimentally altered. phorylation. Activated Smads form dimers

223
www.stemcell8.cn
recto proteins
SMC

that migrate into the cell nucleus, where fusion of a transport vesicle with the
they activate transcription of certain tar- Golgi.
get genes. Smads fall into classes: R-Smads
(those activated by phosphorylation by SNARES A family of proteins that
the kinase domains of receptors), I-Smads mediate the fusion of synaptic vesicles
(inhibitory), and Co-Smads. The R-Smads with the synaptic membrane during the
are comprised of Smads 1, 2, 3, 5, and 8. process of neurotransmitter release. The
Smads 2 and 3 are involved in signaling SNARES present on the surface of the
via the TGF- family, and Smads 1, 5, and synaptic vesicle are called v-SNARES, and
8 respond signaling via the BMP subfam- those on the cell membrane are called t-
ily of growth factors. Smad4 is a co-Smad.
SNARES. During synaptic fusion, the
The R-Smads and Co-Smads contain
v-SNARES and t-SNARES bind to one
two conserved structural domains: MH1
another together with a protein called
(MAD Homology domain) and MH2.
SNAP25 to initiate the fusion process that
Phosphorylated R-Smads form complexes
with the Co-Smad, Smad4. The MH1 releases neurotransmitter. The SNARE-
domain of the R-Smads is responsible for SNAP25 complex is targeted by the toxin
the DNA-binding activity of the complex, of the bacterium Clostridium botulinum.
while the MH2 domain is involved in
interaction with the receptor. snRNA Small nuclear RNA; a very short
piece of RNA that complexes with a set
SMC proteins Structural maintenance of proteins (snRNPs) to form a structure
of chromosomes; a family of proteins that whose function is to clip out loops in other
are involved in chromosome condensation, RNAs, particularly for splicing of RNAs
sister-chromatid cohesion, DNA repair, that are destined to become mRNAs
and recombination. There are six core
SMCs in eukaryotes (SMC1SMC6) that sodium-potassium pump A special-
form functional complexes with other pro- ized transmembrane protein that pumps
teins. The cohesin complex contains SMC1 sodium ions out of the interior of the
and SMC3 (together with cohesin proteins cell and at the same time pumps potas-
Scc1 and Scc3), which is needed for sister- sium ions into the cell. Although sodium-
chromatid cohesion during mitosis. The potassium pumps are found in a variety
SMC1 and SMC3 also forms a complex of cell types, they especially abundant in
with DNA polymerase and ligase III that nerve cells where they serve to establish
mediate recombination. SMC2 and SMC4 an electric potential across the membrane
are components of the condensin complex, that is the basis of nerve impulse transmis-
which functions in the process of chromo- sion.
some condensation during mitosis. The func-
tions of SMC5 and SMC6 are not known,
although SMC is believed to be involved in soma A term for the entire body of an
recombination-based DNA repair processes. organism without reproductive cells.

smooth ER The endoplasmic reticulum somatic cell A nonreproductive cell; any


that is not bound to ribosomes. cell that does not generate either sperm or
egg.
smooth muscle The relatively less stri-
ated (i.e, smooth) muscle associated with somatic cell hybrid The product
involutary movement, for example, the formed by somatic cell hybridization.
heart muscle.
somatic cell hybridization Combin-
SNAP Soluble NSF attachment pro- ing the genetic material of two cells by
teins; cytosolic proteins that are required cell fusion, such as that induced by Sen-
for NSF to bind the membrane of a Golgi dai virus or polyethylene glycol (PEG).
vesicle and are therefore necessary for See cell fusion.

224
www.stemcell8.cn
spectrin
verso

somatic cell therapy A gene therapy Southern blot hybridization In a


based on the introduction of new genetic complex mixture of DNA fragments
material or the alteration of existing separated by size on an agarose gel, a
genetic material in cells other than those technique for identification of a DNA
that give rise to either sperm or egg, for fragment(s) by fi rst transferring the DNA
example, the introduction of insulin fragments from the agarose gel to a spe-
genes into pancreatic cells. cial membrane and then hybridizing the
DNA fragments to a specific probe.
somatic mutation Any mutation not
affecting the reproductive cells. This type spacer DNA Stretches of nontranscribed
of mutation usually affects a particular DNA that separate transcribed regions of
tissue type and is not passed down to DNA and that code for ribosomal RNAs.
offspring in the form of a transmissible
genetic defect.
species Different forms of an organism
among the members of a genus that are
somatomedin A polypeptide hormone,
incapable of producing offspring by inter-
produced in the liver, that induces growth
breeding.
of bone and muscle.

somatostatin A polypeptide hormone, specific activity The activity of a sub-


produced by the hypothalamus, that helps stance that is present in some given amount
to regulate to blood sugar levels by inhib- of that substance, as defi ned for that sub-
iting the release of glucogon and insulin stance by convention. For example:
by the pancreas. units of enzyme activity per micro-
gram of protein
somatotropin A polypeptide hormone, units of hormone activity per milliliter
produced in the anterior pituitary, that sim- of solution
ulates the liver to secrete somatomedin-1. disintegrations per minute per mole of
radiolabeled amino acid
sorbitol An alcohol derived from glu-
cose. In diabetes, sorbitol accumulates in specificity factors Proteins that act to
the eye, the kidney, and the other tissues; alter the specificity of RNA polymerase to
this leads to osmotic swelling and even- recognize a given promoter or a set of pro-
tual damage of critical cells such as the moters, by making it more or less likely
optic nerve. for the polymerase to bind to them. For
example, vaccinia virus contains a protein
SOS repair system A system of at least that causes RNA polymerase to recognize
15 different proteins that work to repair the viral promoter and begin transcription
severe DNA damage in bacteria; the system of the viral genes.
appears to be induced by the presence of an
excessive amount of single-stranded DNA
spectrin A filamentous protein that
as might be generated by DNA damage.
comprises a cytoskeletal network that is
SOS response In bacteria, the induc- attached to the cytosolic side of the plasma
tion of various proteins involved in DNA membrane in erythrocytes. The spectrin
repair (such as the UvrA and UvrB pro- cytoskeleton largely accounts for the mem-
teins) and DNA synthesis (DNA poly- brane rigidity that prevents deformity of
merase III, UmuC, UmuD, and RecA) in red blood cells during their passage through
response to the presence of high levels of the small vascular openings of capillaries.
DNA damage as might occur following Spectrin also functions to anchor certain
exposure to a mutagenic agent. membrane-associated structural elements
such as glyophorin and the membrane
Southern, E. M. (b. 1918) The discoverer channel for chloride-bicarbonate exchange.
of the Southern-DNA-blot-hybridization
technique.

225
www.stemcell8.cn
recto
spermatids

spermatids Immature sperm cells hav- SMA type III (Kugelberg-Welander


ing the haploid number of chromosomes disease), onset of symptoms between
but lacking the morphological features of two and 17 years of age
sperm, for example, the elongated acro-
some-bearing head and the tail assembly The disease is caused by mutations in two
that make spermi motile. genes located on chromosome 5q13, SMN1
and SMN2 (SMN stands for survival of
spermatocytes Cells representing stages motor neuron). These genes code for pro-
in the formation of sperm: Primary sper- teins involved in RNA splicing. Over 90
matocytes are cells containing the diploid percent of SMA cases lack part of, or all of,
number of chromosomes but which, after both copies of SMN1. A small percentage
dividing, form secondary spermatocytes of SMA patients are missing one copy of
that contain the haploid number of chro- the SMN1 gene and have small mutations
mosomes. The secondary spermatocytes in the remaining copy.
differentiate to form spermatids.
spindle apparatus The bundles of
sperm cells (spermatozoa) The mature microtubules that are attached at one end
cells derived from the male reproductive to the centromere of chromosome and at
cells (gametes) that is produced by meiosis. the other to the centriole and are respon-
sible for the movements that lead to seg-
SPF S-phase promoting factor; in yeast, regation of the chromosomes during cell
a family of complexes between the cyclin- division. See mitotic apparatus.
dependent kinase, cdc28, and G1 cyclins
spleen A large, ductless organ in the
that mediate the transit through the S
upper-left portion of the stomach; it plays
phase of the cell cycle.
a role in the maturation and differentia-
tion of the antibody-forming blood cells.
S phase A part of the cell cycle dur-
ing which the total complement of a cells splice, splicing A joining together of
DNA is replicated. separated sections of an RNA molecule
to generate new RNAs. In the process
sphingolipid A type of membrane by which mRNAs are created from long
lipid derived from the compound, sphin- RNA precursors in the nucleus, sections of
gosine. Sphingolipids are subdivided RNA that represent introns are spliced out
into sphingomyelins, gangliosides, and so that segments representing exons are
cerebrosides, all of which are important joined together. Splicing is part of the pro-
components of the brain cell membranes. cess of RNA processing that takes place in
Altered metabolism of sphingolipids is the nucleus. See spliceosome and splic-
the cause of the genetic syndrome, Tay- ing junction.
Sachs disease.
spliceosome A complex that mediates
spinal muscular atrophy (SMA) A the splicing of an RNA molecule during
genetic neurodegenerative disease affect- mRNA formation. The spliceosome con-
ing motor neurons and characterized by tains the RNA precursor in which the ends
wasting of the skeletal muscles. SMA is of the regions that will be joined together
caused by progressive degeneration of the are held in place by small ribonucleopro-
anterior horns of the spinal cord. There tein particles (snRNPs).
are several types of SMA:
splicing junction The site on a spliced
RNA where the ends of the spliced RNA
SMA type I (Werdnig-Hoffmann
segments meet.
disease) manifest in utero or in neo-
nates spontaneous mutation A change in a
SMA type II, onset of symptoms nucleotide base in the DNA that occurs
between three and 15 months of age during the normal process of DNA rep-

226
www.stemcell8.cn

RNA transcript splicing

Spliceosome

227
www.stemcell8.cn
recto
src

lication and without the action of muta- START A point in the G1 phase of the
genic agents. yeast cell cycle that represents the com-
mitment of the cell to transit into S phase.
src The oncogene that is carried by the See CLN1, CLN2, CLN3.
Rous sarcoma virus that produces sarco-
mas in birds. The product of the src gene STAT Signal transducers and activators
is a phosphorylated protein denoted as of transcription; a class of transcription fac-
pp60. The src protein is a tyrosine kinase tors that constitute one of the main compo-
and is believed to cause transformation nents of the JAK/STAT signaling pathway.
as a result of its ability to carry out phos- STATS are activated by phosphorylation
phorylation of critical proteins. catalyzed by JAKs. Once activated, STATS
dimerize and move into the nucleus, where
SSCP Single strand conformation poly- they bind to specific sequences in the pro-
morphism; an analytical technique for moters of target genes whose transcription
determining the presence of changes in is subsequently induced.
nucleic acid primary structure by observ-
ing the rate of migration of nucleic acid statins A class of drugs that lower the
fragments in a gel where the nucleic acids levels of cholesterol in the blood by inhib-
are kept in a denatured state by chemicals iting the pathway by which cholesterol is
such as urea or formamide. This technique synthesized in the liver. The statins have
is highly sensitive to changes in nucleotide structures similar to mevolonate, the nor-
sequence and is frequently used to analyze mal substrate of the enzyme HMG-CoA
genes for the presence of small mutations. reductase, which controls the key step
in cholesterol biosynthesis. The statins
staggered cut A term applied to the type therefore inhibit cholesterol biosynthe-
of cleavage of DNA molecules produced sis by serving as competitive inhibitors of
by most restriction enzymes in which one HMG-CoA reductase. Zocor, Pravacol,
end (usually the 5 end) protrudes past the Mevacor and other pharmaceutical statins
cut end of the other strand. are chemically modified versions of statins
that were originally derived from fungi.
standard deviation A statistical value
given by the square root of the variance of stationary phase The point at which,
a set of experimental values. This quantity in a bacterial culture, the cells become
is a measure of the average amount each so numerous that the nutrient sup-
experimental value or observation in a ply is exhausted and growth ceases. See
series differs from the mean of that series. growth phases.

standard transformed constants The


physical constants that, by international HO
convention, are used in biochemical cal- CCO
culations to represent standard con-
OH
ditions in biological systems. The main O
standard transformed constants are: HC
3
[H+]=10 -7 M (pH 7.0), T=298K (25C),
1 mM Mg++, 55.5M H 2O, 1 atmosphere
O
pressure, and 1M concentrations of all
other products and reactants. HC
3
starch A complex polysaccharide used
by plants as a means of storing glucose.
Starch consists of long polymers of glu- CH 3
cose that are joined to one another to
form a compact, branched macromol-
ecule similar to glycogen. Zocor

228
www.stemcell8.cn
stereoisomer
verso

STE genes A family of genes whose potent, that is, have the capability to give
products function as part of a signal- rise to all the different cell types character-
transduction cascade to mediate mating in istic of the different body tissues. Modern
yeast; the STE designation is derived from stem-cell research focuses on identifying
the word sterile to indicate the fact that the signals that can cause stem cells to dif-
mutations in these genes result in sterility ferentiate into a particular cell type. If such
in yeast. STE2 and STE3 are receptors for signals can be found, it is believed that
mating pheromones in the and a mating stem cells can then be used to replace dam-
types, respectively. Other STE proteins are aged tissues seen in a number of conditions
components of G proteins or function as such as Alzheimers disease, Parkinsons
protein kinases. STE12 is a transcription disease, spinal cord injuries, and others.
factor. See KSS1, FUS3.
stem-loop structure A structure form-
stem cell Any cell that, in a tissue, is ed by nucleic acids, but particularly
itself immature but gives rise, through cell RNAs, in which a segment of the
division, to cells that become the mature nucleic acid strand base pairs with a dis-
form of the cells that characterize the tant complementary sequence; the base-
tissue. The marrow in bone is a classic paired sequences form the stem and the
example of stem cells that give rise to the sequences intervening between the base-
mature differentiated blood cells, includ- paired regions form the loop.
ing red blood cells, macrophages, and the
antibody-producing cells of the immune stereoisomer A form of a molecule
system. However, only the completely involving different arrangements of atoms
undifferentiated stem cells derived from or molecules around a central atom, usually
embryos (embryonic stem cells) are toti- carbon in biomolecules. Stereoisomers are

Stereoisomer

229
www.stemcell8.cn
recto
sterile

also referred to as optical isomers because effects of the nerve impulse from another
crystals of stereoisomers cause polarized neuron.
light to slant in ways that are characteristic
for each stereoisomer. See dextrorota- stock culture A culture of cells that
tory isomer and levorotatory isomer. serves as a common source of cells for
experimental purposes.
sterile Completely free of living material.
stop codon A sequence of three nucle-
sterilization The process by which otide bases that do not represent the code
objects or liquids are made sterile, usu- for an amino acid but serve as signals for
ally for the purpose of preventing disease, the termination of translation by the ribo-
infection, or contamination. Common some. There are three RNA stop codons:
methods of sterilization include heating UAA, UGA, and UAG.
to temperatures above 125C and pro-
longed exposure to ultraviolet light.
stop-transfer signal For preproteins
that are to be inserted into, but not com-
steroid A class of potent hormones pletely through, a membrane, a stop-
derived from cholesterol. Cortisone and transfer signal is a group of amino acids
the sex hormones, estrogen and testoster- on the polypeptide that serves as a signal
one, are examples of steroid hormones. to stop its movement at a time when the
polypeptide is properly positioned in the
sticky ends The single-stranded ends of membrane.
any two nucleic acids whose nucleotide
base sequences are complementary to one strand displacement A variant of the
another. normal mechanism of DNA replication
in which replication of one of the DNA
stimulatory neuron A neuron that, strands proceeds from opposite ends of a
when stimulated, functions to enhance the linear DNA molecule.

Strand displacement

230
www.stemcell8.cn
stress-activated kinases
verso

cellular
stress

MEKK1

SEK1 or MKK7

SAPK

jnk
nuclear
translocation

jnk
c-jun
(gene transcription)

Stress-activated kinases

streptolydigin An antibiotic that inhibits 90 percent of the clinically useful antibi-


the action of bacterial RNA polymerase. otics.
Streptolydigin binds to the beta-subunit of
the polymerase and stops chain elongation streptomycin An antibiotic derived from
after the addition of three or four nucleo- molds that exerts its antibacterial effect by
tides. causing bacterial ribosomes to misread the
codons on the mRNA, particularly with
streptomycetes A funguslike bacte- respect to the pyrimidines U and C where
rium found in soil. In addition to strepto- one is usually mistaken for the other.
mycin, various isolates of streptomycetes
have yielded more than 500 compounds stress-activated kinases (SAPKs) A
of therapeutic value, including more than family of protein kinases involved in sig-

231
www.stemcell8.cn
recto fibers
stress

naling that are activated by a variety of stroma 1. The space between the grana
environmental stressors such as ultravio- and the chloroplast membrane that con-
let irradiation, toxic chemicals, oxida- tains some of the enzymes of the dark
tive conditions, hypoxia and anoxia, heat reaction in photosynthesis as well as the
shock, inhibitors of protein synthesis, chloroplast RNA and DNA.
and inflammatory cytokines. Activated 2. The connective tissue underlying the epi-
SAPKs bind to, and phosphorylate, the thelial cell layer, for example, in skin, the
N-terminal domain of the c-jun transcrip- digestive tract, and the airways in lung.
tion factor, which subsequently translo-
cates to the nucleus, where it upregulates
structural gene A gene in an operon
the expression of genes involved in vari-
that codes for the functional protein that
ous stress responses. The SAPKs are acti-
is essential to the metabolism of the bacte-
vated by the upstream factors SEK1 and
rial cell, for example, an enzyme, as dis-
MKK7. There are three SAPK genes: ,
, and that code for 810 isoforms by tinguished from the genes for a repressor
alternative splicing mechanisms. protein that controls the expression of a
structural gene.
stress fibers The fibrillar arrays that are
seen on the surface of a cell that is ori- STS Sequence tagged site; a means of
ented parallel to the direction in which a cataloguing sequence data by record-
cell is moving. Stress fibers appear to be ing only that part of the whole sequence
directly related to cell movement in that necessary to create primers that can be
they are known to coincide with the actin used to amplify the entire sequence from
filaments. a DNA sample by the polymerase chain
reaction (PCR).
stress proteins Proteins encoded by
heat-shock genes and expressed when the stuffer region That part of the lambda
cell undergoes stress conditions, such as phage that can be replaced by foreign
a rise in temperature or exposure to cer- DNA and still reproduce so that the
tain chemicals. Many of these proteins phage can be used as a cloning vector.
are chaperons that aid in maintaining the
structure of the protein under conditions subcutaneous Just underneath the skin;
of denaturation. as in subcutaneous injections.
stringency The conditions of tem- substrate Any one of the reacting chem-
perature and ionic strength used dur-
icals in an enzyme-catalyzed reaction.
ing nucleic acid hybridization methods,
for example, northerns or Southerns, to
ensure proper binding of the probe to its substrate analogue A chemical that is
target. Low stringency conditions allows similar in form to a particular substrate
for the probe to bind with less specific- but that does not participate in the chem-
ity to targets; high stringency conditions ical reaction of the substrate. Substrate
only will permit very specific binding of analogues used for various purposes such
probe to its target. as inhibition of certain enzyme systems
or for studying the mechanism of enzyme
stringent response A bacterial response action. See competitive inhibition.
to conditions of nutritional deprivation in
which expression of nonessential genes is substrate channeling The direct trans-
shut down. A stringent response involves fer of intermediates from one enzyme
a rapid downregulating of certain bacte- to the next in multienzyme complexes. For
rial biosynthetic pathways (e.g., synthesis example, the pyruvate dehydrogenase com-
of ribosomal and transfer RNAs) when plex processes pyruvate into acetyl CoA by
the amino acid supply becomes limited. a series of enzymatic reactions catalyzed by
See alarmones. five separate enzymes in a large complex.

232
www.stemcell8.cn
sugar
verso

The products of each reaction become sub- sucrose-density centrifugation A tech-


strates for the next, and these products/ nique that separates molecules in a mix-
substrates are passed through the complex ture according to their density by using
by substrate channeling. sufficiently high centrifugal force to cause
the molecules to migrate through a solu-
subtilisin An proteolytic enzyme (pro- tion of sucrose. In density-gradient separa-
tease) produced by the soil bacterium tion, the sucrose solution increases in den-
Bacillus amyloliquefaciens. sity the farther the molecules travel.
subunit One part of a complex biologi-
cal molecule such as an enzyme or ribo-
sudden-correction model The model
some. The subunits combined together that proposes that in gene clusters in which
constitute the biologically active molecule. there are multiple copies of a gene (e.g.,
the genes coding for ribosomal RNA),
subunit vaccine A vaccine created in the the entire gene cluster is replaced every
lab using recombinant DNA technology, so often by a process that replicates the
in which a portion of the entire virus or entire gene cluster from just one or a few
bacterium is presented as an epitope. This copies. The sudden-correction model is
method was used in the production of a vac- actually an error-correcting mechanism
cine against hepatitis B virus (HBV), a virus that accounts for why mutational errors in
that cannot be cultured in the laboratory. some of the gene copies do not accumulate
over time.
sucrose A disaccharide consisting of
one molecule of fructose linked to one sugar Any compound that conforms to
molecule of glucose. Common table sugar the general molecular formula Cn.(H2O)n,
is sucrose. where n is any number between 3 and 7

Sugar

233
www.stemcell8.cn
recto
supercoiled DNA

nucleic acids vary with secondary structure,


single-strand temperature, and salt concentration.
nicks
SW1/SNF A large complex of 10 pro-
teins that acts as a transcriptional acti-
vator by indirect mechanism involving
chromatin remodeling. The SW1/SNF
complex uses energy from ATP derived
Supercoiled DNA from the ATPase activity of SW12 sub-
unit to produce changes in chroma-
tin structure, which include changes in
and where the carbon atoms are linked
nucleosome structure and positioning
together in a chain. See carbohydrate.
such that transcriptional activators that
act by binding to DNA can have access to
supercoiled DNA A circular double- their recognition sequences.
stranded DNA molecule is itself twisted into
a compact knot. This is the replicative form
symbiosis A state of two or more or-
of many viral DNAs in their host cells.
ganisms living in permanent close proxim-
ity for the mutual purpose of supplying
suppressor gene Any gene that acts to
some essential nutrient or life function to
suppress the effects of mutation.
one another.
suppressor mutation Any mutation that
suppresses the effects of a previous muta- synapse The specialized junction be-
tion; for example, a mutation that sup- tween the tip of the axon from a neuron
presses the effects of frame shift mutation and the dendrite of an adjacent neuron.
by reinstating the proper reading frame. The transmission of nerve impulses from
one neuron to the next is carried out by
suppressor T cell A type of T lympho- neurotransmitters that cross the synapse.
cyte that suppresses the antigenic response
of antibody-forming B cells; that is, it synapsis A stage in the recombina-
inhibits the formation of antibody to a tion process mediated by the RecA pro-
particular antigen. tein in which the RecA protein forms
a complex with the single-stranded and
suppressor tRNA A mutation in a double-stranded DNAs that will then
transfer RNA that suppresses the effect align with each other before undergoing
of a previous mutation in a gene. The sup- recombination.
pressor mutation allows the suppressor
tRNA to read the fi rst mutation correctly, synaptic cleft The space intervening
thereby ensuring the process of transla- between the axon and dendrite mem-
tion. See amber suppressor. branes in a synapse.

surfactant Any agent that lowers the synaptic vesicle A membrane-enclosed


surface tension of water. Soaps and deter- vesicle that carries the neurotrans-
gents are the most common surfactants. mitters to the synapse where they are
released by fusion of the synaptic vesi-
SV40 Simian virus 40. cle membrane with the membrane at the
axon terminus.
Svedberg unit A measure of molecular
size based on the rate of sedimentation of a synaptonemal complex The struc-
molecule in a centrifugal field. The Svedberg ture that joins chromosome pairs when
unit is designated as s and is not directly homologous chromosomes align during
proportional to size; for example s values of the process of meiosis.

234
www.stemcell8.cn

neurotransmitter
vesicles

v-SNARE

SNAP25
t-SNARE

synaptic membrane

complex of v-SNARE,
t-SNARE, and SNAP25

membrane fusion

Synaptic vesicle fusion

235
www.stemcell8.cn
recto
synaptophysin

synaptophysin A polypeptide located present on one chromosome are said to


in a transmembrane fashion in the mem- be syntenic. The concept of synteny has
brane of a synaptic vesicle that is thought been extended to include the organiza-
to mediate the fusion process between tion of the genetic loci on a chromosome,
the synaptic vesicle membrane and the and this has been used to create synteny
plasma membrane at the axon terminal. maps that compare the arrangements of
homologous genes on chromosomes from
synchronous culture A cell culture different species.
in which all cells are simultaneously at
the same phase of the cell cycle. Experi- synthesis The process of creating a new
mentally, synchronization of cells can be substance from precursor molecules. Bio-
achieved by techniques that transiently synthesis is the process by which living
but specifically block in one phase of the cells create new biomolecules, whereas
cell cycle, for example, mitosis leading to the term synthesis is generally applied to
accumulation of cells at the block; syn- processes used in the laboratory for cre-
chronous growth ensues when the block ating biomolecules.
is released.
synthetic medium Solutions of nutri-
syncitium A multinucleated cytoplasm ents are created for the purposes of grow-
such as occurs when cells are fused by ing cells of various types in culture. Most
treatment with polyethylene glycol or Sen- synthetic media formulations attempt to
dai virus. recapitulate the natural nutrient environ-
ment for the cell type being cultured as
syndrome A set of characteristics that nearly as possible.
are usually associated with the same
cause. For example, genetic diseases synthetic peptides The creation of
caused by a single mutation can result in peptides in the laboratory, using tech-
a number of different phenotypes. niques of organic chemistry to link
amino acids together according to some
synergism Facilitation of a response by prescribed sequence so that a peptide
multiple stimuli such that the magnitude of of any given primary structure can be
the response is greater than the sum of the synthesized.
individual stimuli. The principle of syner-
gism is often exemplified by the facilitation syntrophism Cross-feeding by organ-
of a nerve impulse when a single neuron is isms sharing a common growth medium,
stimulated by several excitatory neurons. for example, bacterial colonies whose
growth is dependent on a factor or fac-
syntaxin A transmembrane protein tors secreted by a neighboring bacterial
located in the active zone of the plasma colony on a common agar plate.
membrane at the axon terminal that is
believed to mediate the docking process syphilis A venereal disease caused by
between the synaptic vesicle and the the spirochete Treponema pallidum. If left
plasma membrane. The docking process untreated, the disease may cause blindness
involves anchoring the synaptic vesicle and neuological symptoms, including a
in close enough proximity to the plasma syndrome characterized by a loss of motor
membrane to allow fusion to occur. Dur- control known as general paresis.
ing this process, syntaxin is thought to
bind to synaptobrevin, a transmembrane systemic lupus erythematosis An
protein located in the synaptic vesicle autoimmune disease of the connective tis-
membrane. sue that is characterized by a reddish skin
rash (erythema) and a wide variety of
synteny The state of two or more conditions related to internal organ mal-
genetic loci being present on the same function. Antibodies to a wide variety of
chromosome. All the genetic loci that are self antigens are seen.

236
www.stemcell8.cn

A
T

T4 RNA ligase An enzyme, isolated tamoxifen An anticancer drug specific


from bacterial cells infected with the for breast cancer that acts as an antagonist
bacteriophage, T4, that catalyzes the for- of the estrogen receptor in low-grade can-
mation of a covalent bond between the cers whose growth is estrogen-dependent.
phosphate group on the 5 end of either
single-stranded DNA or RNA and the 3
hydroxyl end of either single-stranded
DNA or RNA. CH3
T7 promoter A sequence that forms N
the promoter for transcription of the CH3 O
genes of the T7 bacteriophage. The T7
promoter is widely used in synthetic clon-
ing vectors where expression of recombi-
nant DNAs is desired.

tachykinin A group of biologically active


amidated neuropeptides that excite neurons
and are potent vasodilatators and cause
contraction of many smooth muscles. The
tachykinins are found in both vertebrates
and invertebrates. There are three tachyki- CH3
nins in humans that are encoded by two
genes. They are made in the form of pre-
cursor peptides that are enzymatically con- Tamoxifen
verted to their mature forms, all of which
are between 10 and 12 residues long and
share a common carboxy-terminal sequence: tandem In general a group of objects
Phe-X-Gly-Leu-Met-NH2. One of the pre- arrayed in a line, one next to the other.
cursor peptides contains both substance P As applied to molecular genetics, the
and neurokinin A, while the other encodes a term refers to genes arranged in tan-
precursor that contains only neurokinin B. dem along a stretch of DNA. A number
of viral and cellular genes (e.g., rRNA
TAFs TBP associated factors; a set of at genes) that undergo amplifi cation are
least eight proteins that assembles onto the tandemly arrayed.
DNA-bound TATA Binding Protein (TBP)
to form the general transcription factor T antigen(s) The products of the early
TFIID. TFIID binding to the TATA box genes of the papova viruses. In normal
in eukaryotic promoters is the first event hosts, the T antigen(s) function to stimu-
required for subsequent assembly of other late viral DNA replication and to regulate
transcription factors and RNA polymerase expression of the viral genes. However, in
II to form the fully functional transcription host cells that do not support virus rep-
complex that initiates transcription. lication, the T antigens are known to be

237
www.stemcell8.cn
rectopolymerase
Taq

responsible for transformation of the cells for so-called cell-mediated immunity, the
to a cancerous phenotype. immune function directed toward detect-
ing and destroying foreign cells rather
Taq polymerase A DNA polymerase than foreign proteins.
isolated from the thermophilic bacterium
Thermus acquaticus. T-DNA A term for the Ti plasmid car-
ried by Agrobacterium, a parasite that
tariquidar (XR9576) An experimen- induces various plant tumors. The tumors
tal drug used to inhibit the ability of are a direct result of expression of the
cancer cells to become resistant to che- genes carried by Ti in the plant cells.
motherapeutic agents (multidrug resis-
tance). Tariquidar acts by binding to a teichoic acid A long polymer of glyc-
membrane glycoprotein known as P-gp erol or ribitol molecules linked together by
(P-glycoprotein pump), a transmembrane phosphate groups. Teichoic acid is a struc-
protein that acts to pump administered tural component of the outer cell wall of
anticancer drugs out of the tumor cell. Gram-positive bacteria. See Gram stain.
The binding of tariquidar blocks the
ability of P-gp to act as a pump, thereby telomere(s) Special tandemly arranged,
allowing the chemotherapeutic agent to guanine-rich, repeated sequences that
be retained in the cell. prevent loss of DNA at the end of a DNA
strand during chromosome replication
tastin A cytoplasmic cell-adhesion mol- and so are required for faithful replica-
ecule that, in combination with bystin, tion of the DNA in a chromosome.
forms part of the machinery that medi-
ates the process by which the embryo telomeric sequences Special sequences
attaches to the wall of the uterus. on the ends of DNA strands that are
required for synthesis of the terminal seg-
TATA box Another name for the Prib- ments of the lagging strand. Telomeric
now box. sequences are present on the ends of chro-
mosomes (the telomeric region) and are
tautomerism The rapid and continual used in the construction of yeast artificial
transition between different forms of a mole- chromosomes (YACs).
cule based on delocalization of an electron(s)
on different atoms of the molecule. telophase The stage of mitosis in which
the new cell membrane that divides the
taxol A plant alkaloid that stabilizes daughter cells forms (the cell plate) and chro-
microtubules, thereby freezing cells in mosomes reform into diffuse chromatin.
mitosis. Because cancer cells are rapidly
dividing cells, taxol is currently being temperate phage A bacteriophage that
used as a chemotherapeutic agent. is capable of establishing lysogeny in a
host rather than undergoing a normal
taxonomy The science of classification. lytic cycle.

Tay-Sachs disease A hereditary dis- temperature-sensitive mutant (Ts


ease in which accumulation of a certain mutant) Any organism that expresses a
type of sphingolipid accumulates in the function with a temperature dependence, for
brain and the spleen, leading to degenera- example, bacteriophages that establish lysog-
tion of the nervous system and death at eny at one temperature but not at another.
an early age.
template In general a pattern for cre-
T cell A lymphocyte named for the thy- ating a copy of something; nucleic acid
mus (i.e., thymus cell) where the majority strand whose sequence is used to create a
of T cells mature. T cells are responsible complementary nucleic acid copy.

238
www.stemcell8.cn
verso
TGF

Terminal redundancy

teratoma A type of tumor derived from ternary initiation complex A three-


a developing embryo. part complex that is necessary to start
the process of translation. The ternary
terminal redundancy During the replica- initiation complex consists of met-
tion of bacteriophage T4, slighty more than tRNA, GTP, and an initiation factor
one genome equivalent is cut from a long, (eIF2).
linear DNA that represents T4 genomes
repeated in an end-to-end head-to-tail tertiary structure The overall, three-
fashion. This leads to the packaging of T4 dimensional folding of a polypeptide; the
genomes in which the ends are repeated. folding, twisting, or conformation of the
secondary structure of the polypeptide.
terminal transferase An enzyme that
catalyzes the addition of an unspecified testosterone The steroid hormone pro-
number of deoxyribonucleotides from duced by the testes that regulates sperm
deoxyribonucleotide triphosphates (dNTPs) production and male sexual behavior.
to a free 3 hydroxyl end of double- or
single-stranded DNA: tetanus A syndrome caused by infec-
terminal tion by the anaerobic bacterium, Clos-
transferase tridium tetani. The disease symptoms
+dNTPs (uncontrollable muscle spasms) are due to
3OH5 -------> NNNNNNNNNNN5 the presence of a potent neurotoxin pro-
Terminal transferase catalyzes the addi- duced by the bacterium.
tion of long polymeric chains of whichever
nucleotide whose triphosphate (dATP, tetracycline A broad spectrum (both
dCTP, dGTP, or TTP) is used as a sub- Gram-positive and Gram-negative) antibi-
strate. The addition of long nucleotide tails otic produced by Streptomyces venezuelae.
to DNA fragments is a tool for cloning
DNA fragments into vectors for which no TGF See transforming growth
convenient restriction enzyme sites exist. factor.

239
www.stemcell8.cn
recto
thalassemia

thalassemia A disease that results from term is usually applied to genes and/or
a mutation, often a deletion of DNA their products whose activity is rapidly
within the gene, that causes a reduction increased when the temperature rises by
or complete loss of expression of one or several degrees higher than optimal for
both of the globin proteins (alpha or beta), the growth of the organism.
resulting in gross defects in hemoglobin
function that may be fatal. The thalas- thermophile An organism that thrives
semias are examples of genetic disease at high temperature.
brought about by uneven crossing over.
theta structure The term used to
thalassemia, A type of thalassemia describe the structure formed when a cir-
cular, double-stranded DNA molecule is
affecting the biosynthesis of the globin
engaged in replication proceeding in both
chain of hemoglobin. Some thalasse-
clockwise and counterclockwise direc-
mias have been found to be due to defects
tions from the same starting point.
in gene regulation such as RNA process-
ing in the nucleus and so have provided thiamine Also known as vitamin B1.
important insights into mechanisms of An important cofactor for the reactions
the control of gene expression. involved in the O2 dependent oxidation
of sugars (respiration) in energy (ATP)
thermogenin (uncoupling protein) A production.
protein that forms a channel in the inner
mitochondrial membrane for the passage thiazolidinediones A class of drugs
of protons from the cytosolic side of the that lowers the levels of fatty acids in the
membrane into the mitochondrial matrix. blood. Thiazolidinediones act by binding
Because the path of proton flow using to and activating PPAR, which, in fat tis-
this channel bypasses the FoF1 ATPase, sue, leads to the induction of the enzyme
energy from the oxidation of fats and phosphoenolpyruvate carboxykinase. This
sugars is released in the form of heat that in turn diverts pyruvate away from fatty
is used to raise body temperature. acid synthesis.

thermo-inducible Stimulated by heat. thin-layer chomatography A sensitive


In the context of molecular genetics, the analytical technique for separating mol-

Theta structure

240
www.stemcell8.cn
thymosin
verso

ecules on the basis of their differing solu- light-reacting pigments and other compo-
bility in various solvents. The sensitivity nents of the light reaction in photosyn-
of the technique derives from running the thesis; these components are contained in
sample on a thin, inert matrix to maintain the membrane of the thylakoid disk.
the sample in a concentrated form.
thymectomy Removal of the thymus by
thiol The sulfur containing analog of surgery. A procedure frequently performed
an alcohol (OH) group. for the purpose of rendering an animal
unable to mount an immune response to
thiostrepton An antibiotic that acts by foreign cells, for example, tissue grafts or
blocking a critical step (translocation) in lymphocytes from another animal.
protein synthesis (i.e., translation) by bind-
ing to the large subunit of the ribosome. thymic nurse cells (TNC) Cells that
engulf developing T lymphocyes to edu-
6-thioguanine A purine derivative cate the lymphocytes. Once the T cells
that is acted on by the enzyme hypoxan- are released from the TNC, they possess
thine-guanine phosphoribosyl transfer- the appropriate receptors to interact with
ase (HGPRT) to form a toxic compound. foreign cells that invade the body.
For this reason, 6-thioguanine is used
to select cells that contain low levels of thymidine A pyrimidine base attached
HGPRT. See HAT selection. to the deoxyribose sugar in deoxyribo-
nucleotides.
1-thiouridine An unusual pyrimi-
dine base that is found only in tRNA. thymidine kinase An enzyme that
Thiouridine is derived from uridine by catalyzes the major step in the formation
the replacement of an oxygen atom with of TTP from thymine. Because this path-
sulfur. See transfer RNA. way is the only means by which thymine
or thymine analogs can enter into nucleic
threonine An amino acid that, like serine acids, manipulation of this enzymatic
and tyrosine, contains an OH group on its step provides an important experimental
side chain. For this reason, threonine serves tool for studying gene action by the incor-
as a site of phosphorylation in proteins. poration of modified bases into DNA.

thrombin In the blood-clotting path- thymidine triphosphate (TTP) The


way, the enzyme that produces fibrin thymine-containing nucleotide precursor
from fibrinogen by cleavage of a portion of DNA.
of the fibrinogen molecule. Fibrin polym-
erizes to form a clot. thymine One of the nitrogenous bases
found in nucleic acids. Thymine is a
thromboxanes A class of eicosanoids pyrimidine that forms hydrogen bonds
produced in platelets that cause platelet with the purine adenine.
aggregation during blood clotting and help
reduce blood flow at the site of a clot. thymine dimers A type of muta-
tion in which adjacent thymine bases in
Thy 1 A protein on the surface of T a DNA strand are covalently linked to
cells with homology to a portion of the one another, causing the two bases to be
Fc region of immunoglobulins. Like other read as a single base during DNA replica-
such T-cell membrane proteins, Thy-1 is tion or transcription. Thymine dimers are
believed to play a role in the recognition largely caused by exposure of tissue to
of foreign antigens. ultraviolet light. See ultraviolet repair.

thylakoid disk A membrane-enclosed, thymosin A mixture of small natu-


coin-shaped structure that contains the rally occurring peptides that acts to

241
www.stemcell8.cn
recto
thymus

promote the appearance of the T-cell tissue plasminogen activator (tPA) An


surface proteins that are seen in mature enzyme that catalyzes the cleavage of the
T cells, for example, Thy 1. Thymosin blood protein plasminogen to the active
is thought to mimic the effects of the form of the blood-clotting protein, plas-
hormone(s) that normally induce matu- min. tPA has recently been used as a thera-
ration of prothymocytes. peutic agent for destroying blood clots in
the blood vessels. The tPA gene has been
thymus A structure comprised of lym- cloned, and the protein has been synthe-
phatic tissue located in the upper portion sized in large quantities using recombinant
of the chest cavity in mammals. Some of DNA techniques so that it may find wide-
the immature lymphocytes from the bone spread therapeutic use as a preventative
marrow migrate to the thymus where they agent for heart attack and stroke.
develop into the mature lymphocytes that
are responsible for cellular immunity. In titer The concentration of live virus in a
mammals, the thymus is present in young fluid; the number of plaque-forming units
animals but decreases in size or disap- (PFU) or focus-forming units (FFU) per
pears in adults. unit volume of fluid, for example, PFU
per milliliter.
thyroxine (T4) One of two major hor-
mones secreted by the thyroid gland in titration The process of determining the
response to thyrotropin, a pituitary hor- concentrations of substances experimen-
mone. Thyroxine is made from iodinated tally by adding known amounts of chemical
tyrosine and has the effect of raising the antagonists to the solution until the effects
basal metabolic rate, an indicator of the of the target substance are neutralized.
oxygen-dependent oxidation of sugars.
T-loop 1. A specialized structure for
tight junction A structure in which protecting the single-stranded 3 end of
the cell membranes of neighboring epi- telomeres. In a T-loop the end of the telo-
thelial cells are brought into extremely mere is folded back so that the single-
close contact, preventing the seepage of stranded end is base paired with com-
even small molecules through the space plementary sequences in the preceding
between cells. Tight junctions are partic- double-stranded region. The loop is held
ularly evident between the epithelial cells in place by the proteins TRF1 and TRF2.
lining the gut where they function as a 2. A control region of the cyclin depen-
barrier against unregulated diffusion of dent kinase cdk7, where phosphorylation
substances into the bloodstream from the of critical serine and threonine residues
digestive tract. occurs. After activation of cdk7 as a
result of the phosphorylation, the kinase
Ti plasmid See Agrobacterium and forms a complex with cyclin H.
crown gall plasmid.
Tn5 A type of insertion sequence that
tissue culture The general technique carries the gene for resistance to the anti-
of keeping tissues and/or cells derived biotic kanamycin. See transposon.
from tissues alive outside the organism
from which they were derived by creating Tn10 A type of insertion sequence that
an artificial environment that provides carries the gene for resistance to the anti-
the essential aspects of the natural set- biotic tetracycline. See transposon.
ting. The development of sophisticated
tissue culture systems has been a major tobacco mosaic virus (TMV) A
factor in recent advances in biomedicine large, fi lamentous, RNA-containing plant
because tissue culture permits organ-spe- virus. TMV was one of the fi rst viruses to
cific cells to be studied and manipulated be studied in detail; among the fi ndings
in an experimental environment. derived from studies on TMV was the

242
www.stemcell8.cn
verso
trans

spontaneous assembly of the viral coat cin, campothecin (topoisomerase I inhibi-


from its component subunits. tors), aurintricarboxylatic acid (ATA),
amsacrine hydrochloride, chromomycin,
Tonegawa, Susumu (b. 1939) An ellipticine, etoposide, novobiocin, sobu-
immunologist who discovered the process zoxane (topoisomerase II), and netropsin
by which antibody-producing cells of the (topoisonerases I and II).
immune system rearrange segments of the
antibody genes (translocation of the vari- topoisomers Alternative forms of a cir-
able and constant regions of the immuno- cular DNA that differ from one another
globulin genes) to create novel antibody- only in terms of linking number. Changes
encoding genes. This discovery showed how in linking number result from the action
the wide range of antibodies present in the of topoisomerase enzymes.
adult immune system were derived during
the process of immune cell differentiation. totipotent The concept that a particu-
lar cell (e.g., the fertilized egg) has the
tonofi lament A fi lament type that is capability to generate or differentiate into
characteristic of epithelial cells. Tonofi la- any cell type in the body of an organism.
ments are approximately 810 nanome- Because the DNA in all cells of the body
ters in diameter by transmission electron was believed to be essentially equivalent,
microscopy and terminate as fi lament the concept of totipotency was originally
bundles at cell junctions that are char- thought to apply even to specialized cells
acteristic of epithelial cells known as of a highly differentiated structure such
desmosomes. Tonofi laments have been as the eye, but modern understanding of
shown to be identical to keratin fi laments the fluidity of the genome now suggests
that, in many cases, differentiation is
that make up the intermediate fi lament
accompanied by alterations in the DNA.
network that is characteristic of epithelial
cells. See intermediate filament.
toxin A chemical poison secreted by one
organism for purposes of defense against
topoisomerase A class of enzymes
a competing organism. Because toxins
that catalyzes the relaxation of super-
normally target highly specific cell/organ
coiled DNA by creating transient nicks
systems, many toxins have been used
in the DNA strands that permit tightly to gain insight into normal biochemical
wound DNA to uncoil. Type I topoisom- mechanisms; for example, tetrodotoxin,
erases cause breaks in only one of the a toxin secreted by the puffer fish, spe-
DNA strands, while type II topoisomer- cifically paralyzes the sodium transport
ases (also known as DNA gyrase) nick channel in nerves and has been used to
both strands. DNA gyrases are involved study ion transport in the neural system.
in the process of DNA replication, which
requires the unwinding of the DNA helix. TPA A plant-derived phorbol ester (12-
O-tetradecanoylphorbol-13-acetate) that is
topoisomerase inhibitors A class of a potent tumor promoter. TPA appears to
drugs that acts as anticancer agents by exert its tumor promoting activity by activat-
inhibiting the activity of topoisomerase ing protein kinase C in the cell membrane.
enzymes. The inhibition of topoisomer-
ase activity blocks DNA replication and trans In general, on the opposite side of
the ability to cause cell-cycle arrest at or across from. In organic chemistry, the
the G2/M interface, which is lethal to term refers to a molecular configuration
actively dividing cells. Two isoforms of where groups are on the opposite side of
topoisomerases exist, I and II, and anti- a chemical bond from one another. In
cancer drugs that act as topoisomerase molecular genetics, the term is used to
inhibitors are classified according to the indicate changes in expression of a par-
isoform that they inhibit. Some examples ticular gene that are caused by an agent
include apigenin, kaempferol, rebeccamy- located on different DNA molecules, such

243
www.stemcell8.cn
recto acting
trans

as changes in gene expression caused by therefore, proteins to enter into the same
an agent acting on the gene from a dis- biochemical pathway by which sugars are
tance (e.g., a hormone). oxidized for energy (i.e., ATP) produc-
tion. See transaminase.
trans acting Pertaining to a genetic
element exerting an effect on a target transcellular transport A mechanism
that is located on a physically separate for carrying certain substances from one
unit. For example, a gene coding for a side of a cell to the other. This type of
regulatory protein is said to be trans transport is the means by which sub-
acting with respect to the genes it con- stances (for example, glucose) move
trols because the target genes may be across the epithelial cells that line the
located on DNA strands or even chro- intestinal tract to the bloodstream.
mosomes at some distance from the reg-
ulatory gene. transcription The process of making
an RNA complementary to a strand of
transamination A type of biochemi- DNA. In transcription, an RNA poly-
cal reaction that allows amino acids and, merase, using the order of nucleotide

Initiation of transcription in eukaryotics

DNA TATA

TFIIA TFIID TBP

TFIIB
TFIIF

RNA polymerase

TFIIE

TFIIH

TFIID
TFIIF
TFIIA TFIIB
TBP RNA polymerase

TFIIH TFIIE

244
www.stemcell8.cn
transforming growth factor
verso

bases present in the DNA template as a of methyl groups from one molecule to
guide, assembles nucleotides from the another.
four ribonucleotides (ATP, CTP, GTP,
and UTP) to create the RNA strand. transferrin A plasma protein that car-
ries iron in the blood. Transferrin trans-
transcription factor A protein or hor- fers the bound iron to the appropriate
mone that binds to a certain sequence cells via a special cell surface receptor.
on the regulatory region of a gene at the
promoter or the enhancer and either transfer RNA (tRNA) A type of
turns on transcription, enhances tran- RNA that recognizes the codon on the
scription (up-regulation), or inhibits tran- mRNA during the process of transla-
scription (down-regulation). tion and brings the proper amino acid
(attached to it) into close proximity to
transducin An alternative term for G the end of the peptide chain being synthe-
protein. sized so that the amino acid can be added
to the peptide chain. The tRNA molecule
transducing phage A bacteriophage is folded so that a group of three nucleo-
tides complementary to the codon in the
that, during its normal replicative cycle,
middle of the molecule (the anticodon)
occasionally packages some of the DNA
is exposed, while the end of the tRNA
from the host into the bacteriophage head,
is used for attachment of the amino acid
along with the normal bacteriophage
that corresponds to the codon. See adap-
DNA. The DNA so packaged can then be
tor molecules.
carried from the previous host and intro-
duced into a new host that is infected by
transformation, cancerous or neo-
the transducing bacteriophage.
plastic The process by which a normal
cell comes to attain the characteristics
transduction The term for the process of a cancerous cell. Because the actual
of carrying sections of DNA from one
transformation process cannot be direct-
bacterial cell to another by a transducing ly observed, steps in the process are
bacteriophage. inferred by the expression of certain
properties that cells taken from tumors
transfection The technique of intro- exhibit when grown in culture (e.g., the
ducing DNA into eukaryotic cells. ability to grow without being attached to
Transfection is the process homologous a solid surface and lowered dependence
to transformation in bacteria. Trans- of growth on serum).
fection encompasses a number of tech-
niques that utilize different principles transformation, DNA The process of
to introduce the DNA including electro- introducing foreign DNA into bacteria.
poration and precipitation by calcium See competence.
phosphate.
transforming growth factor (TGF)
transfer factor An as yet unidentified Any of a group of proteins secreted by
factor extracted from living T cells that, transformed cells that can stimulate the
when taken from one human and injected growth of normal cells. Transforming
into another, induces some of the cell- growth factor alpha (TGF or TGF-A)
mediated immunity that was present in binds the epidermal growth factor recep-
the donor. tor (EGFR) and stimulates the growth
of endothelial cells. TGF is produced
transferase A class of enzymes that by macrophages and keratinocytes and
catalyzes the transfer of a chemical is secreted at high levels by some human
group from one substrate to another, for tumors. Transforming growth factor beta
example, methyl transferases for transfer (TGF or TGF-B) has two subtypes 1 and

245
www.stemcell8.cn
recto
transgenic animal

2 and is found in hematopoietic (blood- family. Overexpression of TGF can bring


forming) tissue and initiates a signaling about renal fibrosis, leading to end-stage
pathway that suppresses the early develop- renal disease as well as diabetes. Certain
ment of cancer cells. Bone morphogenetic types of TGF beta-receptor antagonists
proteins (BMP) are members of the TGF have been found to be effective in halt-
ing renal fibrosis. See sarcoma growth
factor.

TGF transgenic animal A animal, typically


a goat, a pig, a cow, or a horse, that has
been modified by introduction of a for-
type II eign gene into its germline so that some
receptor specific aspect of phenotype, such as pro-
duction of a human protein in the milk or
phophorylation
of type I resistance to disease, is conferred on the
receptor offspring.

transit peptide A preprotein destined


for insertion into a mitochondrion.
P
translation The process of assembling
amino acids together to form a polypep-
tide; the sequence of amino acids is speci-
fied by the codons on the mRNA being
used as the template. Translation is car-
ried out on ribosomes that carry sites for
tRNAs carrying the appropriate amino
P acids.

translational domain One of the two


P major classes of binding sites on the ribo-
Smad1 some. The factors that bind within the
translational domain are directly involved
Smad4 in the translation of mRNA into proteins.
The translational domain contains bind-
ing sites for peptidyl transferase, mRNA,
P EF-TU, EF-G, and 5S RNA. See elonga-
tion factors.

translocation 1. During translation


the process of moving the tRNA carrying
activation of the growing polypeptide chain from one
transcription site on the ribosome to another to make
room for an incoming tRNA carrying a
P new amino acid.
2. In biochemistry the process of actively
transporting a molecule across a mem-
brane.
nucleus 3. The breakage of a chromosome fol-
lowed by subsequent rejoining of one of
the pieces to another chromosome. See
Transforming growth factor reciprocal translocation.

246
www.stemcell8.cn
transposon
verso

transmembrane protein A protein that recombinant by conventional restriction


is inserted into and spans the cell membrane enzyme technology.
so that one end of the protein protrudes out
of the cell (the extracellular domain) while transplant The removal of a tissue or
the other end (the internal domain) remains portion of a tissue from its natural loca-
in the interior of the cell. The two major tion and its placement in a new location,
functions of transmembrane proteins are: either in the same organism or in some
(1) to serve as channels for or transport- other organism.
ers of specific molecules and (2) as devices
for transmembane signaling. See integral transplantation antigens Certain pro-
membrane protein. teins produced by the major histocompat-
ibility locus that are found on the surface
transmembrane signaling A signal of all cells in the animal and that are
mechanism in which the binding of a spe- responsible for provoking rejection of tis-
cific molecule (the ligand) to the extra- sue grafts. See major histocompatibil-
cellular domain of a transmembrane ity complex.
protein (the ligand-binding domain)
causes a physical change in the inter- transport In biochemistry the process
nal domain; this then sets in motion a of moving a molecule from one location
series of chemical reactions, for example, to another, usually across a membrane.
phosphorylation(s) of certain proteins The term implicitly indicates that expen-
that then produces specific changes in diture of energy is required for the trans-
the cell behavior. This is called signaling port. See active transport.
because the ligand never actually enters
the cell. See G protein(s). transport protein A transmembrane
protein that mediates the transport of a
molecule across a membrane. Transport
transmission electron microscope proteins are often in the form of a chan-
(TEM) A device that is similar in prin- nel spanning the membrane that allows
ciple to a conventional microscope but
molecules to pass through. See integral
that uses an electron beam instead of membrane protein.
light, and a magnetic field instead of a
glass lens to focus the beam on the speci- transposase An enzyme encoded by
men. The image of the specimen is seen genes on a type of transposon, called an
as a pattern of greater or less electron insertion sequence, that recognizes the
intensity in the beam that emerges from terminal inverted repeat sequences and
the specimen. The great advantage of catalyzes the events in the transposition.
the electron microscope over the conven-
tional light microcope is that, because transposition immunity A term used
electrons have a much shorter wavelength to describe the observation that plasmids
than photons, resolution of much fi ner containing one copy of a transposon
detail is possible. (such as Tn3) are resistant to insertion by
another copy of the transposon.
transplacement vector A vector that
is designed to transfer a defi ned segment transposon A mobile genetic element
of DNA of interest to another vector found primarily in prokayotic cells that
by recombination. Transplacement vec- carries genetic information from one
tors are useful in situations where one site in the genome to another. Trans-
wishes to introduce a DNA segment into posons may carry a variety of genes or
a particularly large vector (e.g., baculo- other genetic units, but they always carry
virus or a yeast artifi cial chromosome) the information needed to carry out the
or another vector in which it is diffi cult transfer function, for example, short ter-
to engineer a unique site for making the minal-inverted repeat sequences that are

247
www.stemcell8.cn
recto
transvection

Transposon

needed for insertion of the transposon trigger factor A bacterial protein


into their target sites in the genome. which, by forming a complex with a pre-
protein, holds the polypeptide in a spe-
transvection The influence of the cific conformation necessary for its inser-
synapsing of paired chromosomes on tion into the bacterial cell membrane.
the expression of genes in the region of
the synapse. The phenomenon was fi rst triglyceride A type of lipid formed from
described in Drosophila melanogaster glycerol and fatty acids. Triglycerides are
within the bithorax complex (BX-C). the major form of storage for fatty acids
Transvection usually involves enhancers and are the main constituents of body fat.
acting on genes on the opposite chromo-
some (i.e., in trans) but can also involve trimethoprim A folate antagonist anti-
silencers acting in trans. biotic with activity against both bacterial
and parasitic infections. Trimethoprim
trehalose A disaccharide of the sugar blocks the synthesis of folate, an essen-
glucose. Trehalose is mainly found in tial nutrient, from para-amino benzoic
insects where it is used as a source of acid (PABA). The effectiveness of trime-
energy. thoprim depends upon the fact that mam-
mals can obtain folate from food whereas
tricarboxylic acid cycle A series of bacteria and lower eukaryotes must syn-
reactions beginning with the formation thesize it de novo.
of citric acid (also known as the citric
acid cycle or Krebs cycle) by which the triplet In general any group of three.
majority of the energy from the oxygen- In molecular genetics, the term generally
dependent oxidation of glucose is derived. refers to the triplet of nucleotide bases
The cycle consists of a critical series of that makes up the genetic code for an
reactions in the oxidation of sugars in amino acid. See codon and wobble
which CO2 and H 2O and electrons to be hypothesis.
used in electron transport are produced
from the intermediate, acetyl-CoA. The triploidy The state of having one
majority of CO2 produced in the body extra haploid set of chromosomes, that
from muscular activity is generated via is, 3n, where n = the haploid chromo-
this pathway. some number.

248
www.stemcell8.cn
tunicamycin
verso

triskelion A subunit of the clathrin are critical regulators of cell growth that
coat of coated pits. The triskelion is are believed to act as negative regulators
named for its tripartite structure consist- of S6 kinase 1 (S6K1) and eukaryotic
ing of three light and three heavy poly- initiation factor 4E binding protein 1
peptide chains. (4E-BP1).

Triton X-100 A nonionic detergent tubulins Two proteins (alpha and beta)
used for the biochemical isolation of cell of about 55,000 daltons each that consti-
membranes and nuclei. tute the subunit proteins of microtubules.

troponins A class of proteins that reg- tumor An abnormal growth of a tis-


ulate muscle contraction by binding to sue. In benign tumors, the tissue growth
tropomyosin and inhibiting of the inter- eventually stops and the tumor remains
action between the actin and myosin fi la- confi ned to the site at which it began;
ments. There are three troponin subunits in malignant tumors, growth is unlimited
in the troponin complex that assembles and may take place at sites distal from
onto tropomyosin fi laments: inhibitory the site of origin, known as metastases.
(I), tropomyosin binding (T), and calcium
binding (C). The inhibition of muscle tumorigenesis The process of tumor
contraction by the I subunit is relieved by formation. Tumorigenesis is the end point
calcium binding to the C subunit. in the process of transformation.
trypsin A protease that cleaves poly- tumor necrosis factor (TNF) A factor
peptides specifically after the amino acids
originally isolated from serum and found
arginine or lysine.
to be produced by certain leukocytes (for
example, macrophages) that appear to be
tryptophan An amino acid containing selectively toxic to tumor cells. The gene
an indole group in its side chain. Trypto-
for TNF has been cloned and expressed
phan is the precursor of the neurotrans-
in quantities that are sufficient for ongo-
mitter, serotinin, in animals and the plant
ing clinical studies of its effectiveness as
hormone, indole acetic acid (IAA).
an anticancer agent.
TSH-releasing hormone (TRH) A
short (three amino acids) polypeptide tumor promoter A chemical that, by
hormone produced in the hypothalamus itself, does not cause tumors but that
that stimulates the anterior portion of will induce the formation of tumors after
the pituitary gland to secrete thyroid- exposure of a tissue to any of a class of
stimulating hormone (TSH). other agents called tumor initiators.

tuberous sclerosis complex (TSC) tumor virus Any virus that induces the
An inherited genetic disease of organ sys- formation of a tumor in the tissue that it
tems, particularly the brain, skin, heart, infects.
lungs, and kidneys. This can result in
epilepsy, learning and behavioral dif- tunicamycin An antibiotic isolated from
ficulties, skin and renal lesions; kidney Streptomyces lysosuperfi cus that inhibits
complications can include cysts, polycys- the synthesis of N-linked glycoproteins.
tic renal disease, and renal carcinoma. Tunicamycin is a structural analog of
Tuberous sclerosis complex is caused UDP-N-acetylglucosamine (UDP-GlcNAc)
by mutations in the tumor suppressors that acts as a competitive inhibitor of the
hamartin (located on chromosome 9q34) critical reaction between UDP-GlcNAc
and tuberin (located on chromosome and Dolichol phosphate, the fi rst step in
16p13.3) that are encoded by the genes the process of N-glycosylation. Tunica-
TSC1 and TSC2. Hamartin and tuberin mycin is widely used as a research tool

249
www.stemcell8.cn
recto
turgor/turgor pressure

for studying the process of protein glyco- Tween 80 A nonionic detergent used
sylation. for isolation of cell membranes and to
reduce background signal interference in
turgor/turgor pressure Water pres- immunoblotting.
sure resulting from the diffusion of water
into cells. The term is usually applied twin sectors If the process of transpo-
to the rigidity of plant structures, for sition carried out by a transposon occurs
example, leaves and stems resulting from just at the time of cell division such that
osmotic pressure. only one daughter cell carries the trans-
position, then the descendants of such
Turners syndrome A genetic defect genotypically different daughter cells are
in which the cells of the afflicted indi- called twin sectors.
vidual contain one X chromosome but
no Y chromosome. Although such indi- twisting number For a given double
viduals have the outward appearance of helical DNA, a number representing the
females, the sexual organs are incomplete total number of helical turns. The twist-
or undeveloped. ing number is calculated as the total
number of base pairs in the DNA under
turnover number For an enzyme- consideration divided by the number of
catalyzed reaction, the number of sub- base pairs per turn.
strate molecules undergoing reaction per
unit time. For example, in the reaction Ty 1 elements A type of transposon in
catalyzed by carbonic anhydrase, yeast; Ty is an acronym for transposon
CO2 + H 2O H 2CO3, yeast. The Ty elements are about 6.3 kb
the enzyme has a turnover number of long and contain genes similar to the gag
600,000 molecules of CO2 per second. and pol genes of retroviruses.

T vector A specialized vector, usually tyrosine An amino acid with a pheno-


a plasmid, for cloning PCR products. lic group in its side chain. Tyrosine is a
Because the polymerases used in the poly- precursor of adrenaline and the skin pig-
merase chain reaction also possess ter- ment melanin.
minal transferase activity, PCR products
contain overhanging chains of polyadenyl- tyrosine kinase A type of enzyme
ate residues on their 5 termini. T vectors that catalyzes the transfer of a phosphate
are linearized DNAs that contain comple- group (phosphorylation) to a tyrosine
mentary thymidylate residues on their 5 amino acid in a protein. The oncogenes
termini that permit base pairing between activated by a number of retroviruses
the T vector and the PCR product to be have been shown to be tyrosine kinases.
cloned. See kinase.

250
www.stemcell8.cn

ubiquitin A protein originally discov- then recopies the region using the remain-
ered in the nucleosomes of the fruit fly, ing strand as a template. See excision
Drosophila melanogaster, whose binding repair.
to A- and B-type mitotic cyclins leads to
their destruction at the end of mitosis. unequal crossing over A form of
Ubiquitin binding to the cyclin allows it recombination in which a segment of
to be proteolytically degraded by a multi- DNA from one chromosome is trans-
protein proteosome complex. ferred to a position adjacent to its own
allele on the homologous chromosome:
ultracentrifugation Centrifugation at -+ ----------------- +-
speeds great enough to produce forces of X allele
greater than 300,000 times the force of -+ ----------------- +-
gravity. The forces produced by ultracen- X allele
trifugation are capable of separating mol-
ecules of different sizes from one another.
The ultracentrafuge was invented by the
Swedish physical chemist Theodor Sved- X allele X allele
berg in 1923. -+ ------- + ------- +-

ultrafi ltration A technique using gas unicellular Composed of a single cell;


pressure to drive samples through an for example, protozoa are unicellular
ultrafi ne meshed fi lter for the fi ltration of organisms.
particles smaller than bacteria.
upstream activator sequences DNA
sequences found in yeast that are similar
ultrastructure Features of cell archi-
to enhancer sequences in higher organ-
tecture discerned in an electron micro-
isms in that they can stimulate the tran-
scope.
scription of a gene from a long distance
but only when they are located upstream
ultraviolet radiation Light with a (i.e., in the 5 direction) from the gene.
wavelength in the range of about 200
400 nanometers. Ultraviolet light is read- uracil A pyrimidine base used instead
ily absorbed by tissue that is exposed to of thymine in ribonucleotides and RNA.
it, for example, skin. Ultraviolet radia-
tion produces numerous alterations in urea A compound derived from ammo-
biomolecules, including mutations in nia and carbon dioxide. Ammonia pro-
DNA, that are linked to tumorigenesis. duced from the breakdown of amino
See thymine dimers. acids is excreted as urea in the urine.

ultraviolet repair A system used by uric acid A purine-like molecule formed


bacteria to repair regions of DNA dam- as a degradative product of the purine
aged by exposure to ultraviolet light. The nucleotides. Because uric acid is relatively
ultraviolet repair system removes altered insoluble in body fluids, overproduction
nucleotides (e.g., thymine dimers) and of uric acid produces a condition known

251
www.stemcell8.cn
uridine

as gout, the accumulation of uric acid


crystals in joints. Uric acid is the main
vehicle for the elimination of ammonia
by birds and reptiles.

uridine The nucleoside derivative of


uracil, that is, uracil bonded to ribose.

uridine triphosphate (UTP) The


triphosphate derivative of uridine; the
uracil-containing molecule used in the
synthesis of RNA. See nucleotide.

urokinase A protease, found in urine


and blood, that has the same activity
as plasminogen activator; urokinase is
therefore used therapeutically to dissolve
blood clots that may accumulate in the
coronary arteries. Uridine

urotensin II See GPR14.

252
www.stemcell8.cn

vaccination The capacity of a vaccine vanadate (HVO4 -2) A compound of


to induce an immune response to a patho- vanadium that, in biological systems,
genic organism in an individual usually functions as an analog of phosphate,
by multiple, direct injection of the vac- which inhibits the action of transporters
cine at a body site favorable for exposure known as P-type ATPases.
to the immune system. Vaccination is a
prophylactic procedure that is generally Van der Waals forces Weak electro-
ineffective in treating disease after onset. static forces between nonpolar hydrocar-
bon molecules such as those that make
vaccine A preparation, derived from up paraffi ns and the lipids in membranes.
inactivated or attenuated pathogenic Van der Waals forces are primarily
organisms, that is used for vaccination. responsible for the aggregation of waxy,
oily, or fatty substances in water.
vaccinia virus A member of the poxvi-
ruses that causes cytopathic destruction of variable region The terminal portion
epithelial cells (pocks); vaccinia is the agent of an antibody molecule that contains the
responsible for cowpox. Vaccinia virus is site that binds the antigen that the immu-
closely related to variola virus that causes noglobulin carries specificity for. The
smallpox in humans. Vaccinia is easily variable nature of this region is a reflec-
grown in tissue-cultured cells for purposes of tion of the large number of antigens for
creating vaccines. For this reason, vaccinia is which specific antibodies can be made.
being researched as a vector for expressing
recombinant DNA for other pathogens with variable surface glycoprotein (VSG)
a view toward using this as a system for cre- The major component of the cell surface
ating vaccines to other agents. of the trypanosome parasite, such as the
sleeping-sickness-producing parasites that
vacuole A membrane-enclosed cyto- are carried by the tsetse fly. The VSGs,
plasmic organelle generally arising from which are the only antigenic molecule on
phagocytosis and often containing en- the trypanosome surface, change through-
zymes involved in degradation of biologic out the development of the organism.
material, for example, proteases. These rapid changes in the VSG allows
the organism to evade the immune system
valine An amino acid with an isopropyl of the host. The VSGs are coded for by
group as its side chain; valine belongs to a large family of genes, and the expres-
the group of nonpolar amino acids. sion of different VSGs at various stages
of development is due to the activation of
valinomycin An antibiotic composed different VSG genes from this gene family.
of lactate, hydroxyisovalerate, and the
amino acid, valine, joined together in a vascular endothelial growth factor
ring configuration that carries a potassium (VEGF) A family of growth factors pro-
ion in its center. In this way, valinomycin duced by cells at the site of a wound and
acts as a vehicle for transporting potas- by some tumors that stimulates the process
sium through the cell membrane, thereby of angiogenesis. The mammalian VEGF
destroying the delicately balanced ion con- family consists of five membersVEGF,
centration in the cell. See ionophore. VEGF-B, VEGF-C, VEGF-D, and placenta

253
www.stemcell8.cn
vasoactive intestinal peptide

growth factor (PlGF)that are all encoded cells that line the gut and the discharge of
by separate genes. New anticancer drugs, neurotransmitters into the synaptic cleft.
such as Avastin, target VEGF or its receptor
as a means of starving tumors by depriv- Venter, J. Craig (b. 1946) Founder of
ing them of blood supply from new blood The Institute for Genomic Research (TIGR)
vessel growth induced by tumor-derived who, backed by venture capital, competed
VEGF. with the NIH-backed Human Genome
Project in sequencing the entire human
vasoactive intestinal peptide (VIP) A genome. Venter is known for employing
neuropeptide hormone that is found an innovative shotgun approach that uti-
to have effects on the immune system, lized robotic sequencing of short genomic
including anti-inflammatory effects, inhi- fragments and advanced computer algo-
bition of cytokine production, and inhi- rithms to assemble the sequence data.
bition of macrophage functions such as
chemotaxis and phagocytosis. VIP has veratridine A powerful neurotoxin,
been found to exert some of these effects derived from the lily Schoenocaulon offi -
via a cAMP-mediated signal transduction cinalis, that is used to study nerve func-
system. tion. Veratridine interferes with the action
of sodium channels such that sodium ions
vasopressin A polypeptide hormone, can pass freely into the neuron.
produced by the posterior part of the
pituitary gland, that causes an increase very short patch repair (VSPR) The
in blood pressure but also decreases the type of excision repair that involves mis-
flow of urine. Previously known as antid- matches between single bases.
iuretic hormone.
vimentin A protein comprising one of
vav-1 oncogene A rho-type guanine the subclasses of intermediate filaments
nucleotide exchange factor (GEF) of the that make up a tissue-specific cytoskeleton
Dbl family. vav-1 plays a role in develop- in mammalian cells. Vimentin fi laments
ment and activation of T and B cells. vav- are characteristically found in cells of
1 is the binding partner of the HIV-1 nef mesenchymal origin such as fibroblasts.
proteins. The vav-1/nef complex causes
cytoskeletal rearrangements, activates the vinblastine An antitumor drug isolated
JNK/SAPK signaling cascade, and upreg- from the Madagascar periwinkle plant
ulates HIV transcription and replication. (Vinca rosea). Vinblastine acts to cause
The vav gene map locus is 19p13.2 depolymerization of microtubules by
binding to the tubulin protein subunits.
vector Any DNA that can propagate
itself rapidly in a host and can also main- vincristine An antitumor drug isolated
tain this capability after insertion of from the Madagascar periwinkle plant
foreign DNA into the vector. Although (Vinca rosea); a chemical variant of vin-
there are many types of vectors, the most blastine that acts to cause depolymeriza-
common ones are derived from bacterial tion in the same manner as vinblastine.
plasmids or the DNAs of both bacterial See vinblastine.
and animal viruses. Most vectors in use
today have been subjected to genetic engi- vinculin A component of the adhesion
neering for specific purposes such as the plaque that, together with alpha-actinin,
expression of foreign proteins in bacteria attaches to both the terminus of a stress
or animal cells (expression vectors). fiber and a transmembrane integrin mol-
ecule to form an adapter complex that
vectorial discharge Secretion of a sub- connects the integrin to the stress fiber.
stance by a cell at only one location or The phosphorylation of tyrosine residues
area on the cell surface. Examples of vec- in vinculin in transformed cells is believed
torial discharge include the secretion of to play a role in the altered cell-substrate
mucin at the apical surface of epithelial interactions that is seen in transformed

254
www.stemcell8.cn
von Willebrand disease

cells grown in tissue culture. See extra- ment, visual purple, and also has profound
cellular matrix. effects on the differentiation of epithelial
including anticancer effects. Derivatives of
viomycin An antibiotic that acts by vitamin A have been used as therapeutic
blocking a critical step in protein synthesis agents for a variety of skin conditions such
(translocation), thereby causing the synthe- as icthyosis, acne, and wrinkling.
sis of a polypeptide to be blocked before
completion. Viomycin is itself a peptide vitamin B12 A ring-shaped, cobalt-con-
that binds to either the large or the small taining molecule also known as cobala-
ribosomal subunit to block translocation. mine. Vitamin B12 is an essential cofac-
tor for the entry of certain amino acids
virion A complete virus particle that and fatty acids into the tricarboxylic acid
includes the viral nucleic acid (either RNA cycle (Krebs cycle).
or DNA) and, in some cases, enzyme mol-
ecules enclosed in a protein capsid. vitamin B6 Any of various derivatives
of pyridoxine (e.g., pyridoxal phosphate)
viroid An unusual infectious agent that used as a cofactor in the transamination
produces diseases in plants and consists reaction, the critical step by which amino
only of a naked, circular strand of RNA. acids enter into the tricarboxylic acid
cycle (Krebs cycle).
virulent, virulence The property of
rapid spread of a pathogenic agent (e.g., voltage-gated channel A specialized
a virus or bacteria) through a susceptible type of transmembrane channel that opens
population. only when there is an electrical potential
of a certain value across the plasma mem-
virus An agent that infects single cells brane (the threshold). Voltage-gated chan-
but consists only of the components of the nels for ions are present on a variety of
virion and does not possess the cellular cell types but are especially characteristic
machinery required for its own replica- of neurons where they are responsible for
tion. For this reason, viruses are, of neces- the generation of an action potential.
sity, intracellular parasites that are not
clearly classifiable as living organisms. von Willebrand disease (vWD) An
inherited disorder in which blood fails to
virusoids One of two classes of small clot properly. Symptoms of vWD include
infectious RNA molecules in plants. bleeding from the gums, nose, and intes-
Virusoids do not contain genes for their tinal lining and prolonged or excessive
own replication or packaging but require bleeding from small cuts. vWD is caused
a second, helper virus to accomplish these by mutations in a gene coding for a sub-
functions. Virusoids are also referred to stance known as von Willebrand factor,
as satellite RNAs. which causes platelets to stick to damaged
blood vessels and which carries a clotting
viscosity The property of resistance to factor, called factor VIII. There are three
flow exhibited by a substance in a fluid, types of von Willebrand disease:
semisolid state. In biochemical solutions,
viscosity is an indicator of a solution con- type 1, in which lower levels than nor-
taining large macromolecules. mal of von Willebrand factor are pres-
ent in the blood
vitamin An essential nutrient in the
diets of mammals; any of a number of type 2, in which a defective von Wil-
organic molecules that generally function lebrand factor is made
as cofactors for specific enzyme-catalyzed type 3, in which von Willebrand fac-
reactions involved in energy production. tor is virtually absent and there are
very low levels of factor VIII
vitamin A Any of the various chemical
relatives of retinol (e.g., retinoic acid). Vita- The gene map locus for von Willebrand
min A is the precursor of the visual pig- factor is 12p13.3.

255
www.stemcell8.cn

Waldenstrims macroglobulinemia western blot A technique for identi-


A tumor of the lymphatic system charac- fying polypeptides that have been sepa-
terized by oversecretion of IgM immuno- rated by polyacrylamide gel electropho-
globins. Immunoglobulins derived from resis based on the reaction of specific
this tumor were used to derive the pen- antibodies to the proteins after they are
tameric structure of IgM-type immuno- transferred from the gel to an artificial
globulins. membrane.

Warren, Robin J. (b. 1937) A path- Williams syndrome A rare congenital


ologist who, in collaboration with Dr. disorder characterized by an elfinlike
Barry Marshall, a gastroenterologist facial appearance, cardiovascular and
at the Royal Perth Hospital, discovered blood vessel problems, dental and kidney
the bacterium Helicobacter pylori and abnormalities, and musculoskeletal prob-
showed that the microbe was the main lems. Individuals with Williams syndrome
cause of peptic ulcers. This stood in con- may show good language, music, and
trast to prevailing dogma of the time that interpersonal skills, but their IQs are usu-
ulcers were caused by stress. The discov- ally low. The genetic basis for the disease
is a deletion on a segment of chromo-
ery of the bacterium eventually led to a
some 7 that includes the gene that codes
cure for ulcers and earned Warren and
for elastin and the enzyme LIM kinase.
Marshall the Nobel Prize in physiology
Elastin is a key component of connec-
or medicine in 2005.
tive tissue and the loss of elastin leads to
the vascular disease seen in Williams syn-
Watson, James D. (b. 1928) Along drome. LIM kinase is strongly expressed
with Francis Crick, he demonstrated the in the brain, and its absence is believed
double helical structure of DNA using the to account for neurodevelopmental brain
technique of X-ray crystallography. This abnormalities.
discovery showed that DNA had the req-
uisite characteristics of a macromolecule Wilsons disease A rare autosomal
that could serve as the genetic material. recessive disorder affecting the transport
Watson and Crick were awarded the of copper that results in toxic accumula-
Nobel Prize in medicine in 1962. tion of copper in the liver and brain. In
children liver disease is the most promi-
Wernicke-Korsakoff syndrome A nent symptom, while neurological disease
genetic disease caused by mutations in the is seen mostly in young adults. Wilsons
gene coding for the enzyme transketolase, disease is caused by mutations in a gene
which is critical for the metabolism of pen- called ATP7B, a P-type ATPase trans-
toses (five-carbon sugars). The disorder is porter located in the Golgi network. The
characterized by severe memory loss, con- gene map locus for ATP7B is 13q14.3.
fusion, and partial paralysis. The disease-
causing mutations result in lowered affin- white matter That portion of the brain
ity of the enzyme for thiamine, which is a consisting of myelinated nerve fibers
coenzyme for transketolases. (axons) serving to carry nerve impulses

256
www.stemcell8.cn
writhing number

from the gray matter of the brain that give triplets but that the second and third posi-
it a characteristic white color. tions of the triplets will vary or wobble,
with the third base of the triplet exhibiting
wild-type gene The normal, nonmu- the most wobble. See codon.
tated version of a gene.
writhing number (W) A number
wobble hypothesis The idea that, for representing the turning of the axis of a
an amino acid for which there is more than supercoiled DNA: W = L T, where L =
one triplet in the genetic code, the first base the linking number and T = the twisting
will always be the same in the different number.

257
www.stemcell8.cn

A
X

xanthine-guanine phosphoribosyl tr- inserted into the gene (thereby inactivat-


ansferase (gpt) gene See HGPRT. ing the gene) by cloning can be detected
by the color of the colony they produce.
X chromosome One of the two sex See insertional inactivation.
chromosomes. The sex of the fetus is
determined from the sex chromosomes X-linked diseases Genetic diseases
present in the fertilized egg: Two X chro- that are carried on one of the sex chro-
mosomes in the fertilized egg will produce mosomes.
a female, and one X chromosome and one
Y chromosome will produce a male. X-ray crystallography A technique
for deducing the physical dimensions of
xenograft A graft from a foreign a molecule (sizes of the atoms, lengths of
donor, for example, human skin grafted the bonds between them) by examining
onto a mouse. how the path of an X-ray beam is altered
as it passes through a crystallized sample
xeroderma pigmentosum (XP) A of the molecule of interest. See X-ray
family of autosomal recessive genetic diffraction.
diseases in which excision-repair mecha-
nisms are faulty. This illness results in X-ray diffraction A technique for
increased sensitivity to sunlight and, in determining distances between atoms in
particular, a much higher incidence of a molecule by analyzing the diffraction
sunlight-induced cancers. At present nine pattern produced when an X-ray beam
XP-related genetic loci all involved in the passes through molecules in a crystal-
process of excision repair of pyrimidine lized form.
dimers and other bulky groups have been
identified. XRCC1 X-ray Repair Cross Comple-
menting; a protein that plays a role in
X-gal A synthetic substrate for the excision repair of DNA following ion-
enzyme beta-galactosidase that produces izing irradiation. The C-terminal end of
a blue product when acted upon by the XRCC1 binds DNA ligase III and the N-
enzyme. In vectors that carry the gene terminal end binds DNA polymerase
for beta galactosidase, growth of bacteria to form a repair complex after damaged
that contain a recombinant DNA that is DNA is excised.

258
www.stemcell8.cn

A
Y

YAC See yeast artificial chromo- yeast two-hybrid system A method


some. for determining whether two proteins
form a complex in vivo using genetically
Yalow, Rosalyn (b. 1921) Inventor of engineered DNAs. In this technique, two
the radioimmunoassy (RIA) technique for DNA constructs (hybrids) are created:
detection of minute quantities of protein (1) DNA coding for the DNA-binding
using a specific radiolabeled antibody. By domain of a particular transcription fac-
applying this technique to insulin she was tor fused to a DNA segment coding for
able to demonstrate the existence of dia- one of the test proteins and (2) DNA cod-
betic states that did not result from insulin ing for the activation domain of a partic-
insufficiency. She was awarded the Nobel ular transcription factor fused to a DNA
Prize in physiology and medicine for this segment coding for the other test protein.
work in 1977. When the two constructs are transfected
together into yeast cells, an active tran-
Yanofsky, Charles (b. 1925) A bio- scription factor will be formed if, and
chemist who studied the regulation of the only if, the two test proteins bind to one
bacterial operon that governs the synthesis another; that is, a complex will be formed
of the amino acid, tryptophan. His findings that contains both the DNA-binding
showed that the trp operon is regulated in domain and the activation domain. If the
at least two ways: (1) via a special regula-
promoter that is normally activated by
tory protein termed the trp repressor and
the transcription factor is itself fused to a
(2) by a unique mechanism termed attenu-
reporter gene, expression of the reporter
ation. These were among the pioneering
indicates that the test proteins do interact
discoveries in the field of gene regulation.
(i.e., bind to one another) in vivo.
yeast(s) A subclass of fungi whose mem-
bers are single-celled. Yeasts display the yes oncogene A non-receptor cyto-
major characteristics of higher cells including plasmic protein tyrosine kinase that is
chromosomes, an endoplasmic reticulum, a member of the src family of tyrosine
and sexual mating. Because they are among kinases. The human gene is the cellular
the simplest eukaryotic cells with these char- homologue of the oncogene carried by
acteristics, they are used as convenient and the Y73 avian sarcoma virus (Yamagu-
easily manipulable model systems to study chi sarcoma virus) and is a proto-onco-
the molecular genetics of eukaryotic cells. gene located on chromosome 18p11.32.
c-yes is highly expressed in neurons,
yeast artificial chromosome A type of spermatozoa, platelets, and epithelial
vector that is used for cloning extremely cells and is believed to have a general
large DNA fragments in yeast. The vec- role in growth control. Oncostatin M
tor is constructed by combining those utilizes a signal transduction pathway
elements of the yeast chromosome nec- in human endothelial cells involving the
essary for chromosome replication with activation of the yes tyrosine kinase. yes
the foreign DNA. The recombinant DNA also becomes activated after binding of
created in this way can then be grown in colony stimulating factor (CSF) to its
a yeast host for many generations. receptor.

259
www.stemcell8.cn

A
Z

z-DNA A form of DNA in which the bacteriophages that became an important


two strands are twisted around each tool in the mapping of bacterial genes.
other in a left-handed helix as opposed to
the right-handed helix found in the more zoo blot A Southern blot in which a
common form (i.e., B-DNA). probe from a DNA that is suspected to
represent a gene in one species is tested for
Zellweger syndrome A rare, autoso- its relatedness to sequences in other spe-
cies. If the probe is found to hybridize to
mal recessive disorder that begins in utero
DNAs from other species, then, because
and is characterized by defective myelina-
genes tend to be conserved in other spe-
tion of nerve tracts, mental and growth
cies, this suggests that the probe represents
retardation, craniofacial malformations,
a gene. See hydridization stringency
glaucoma, seizures, cataracts, kidney cysts, and Southern blot hybridization.
and cardiac complications. The disease is
caused by a reduction in, or an absence zygotic-effect genes Genes that effect
of, perioxisomes in the liver, kidney, and the segmentation pattern of the embryo of
brain. Zellweger syndrome is caused by the fruit fly, Drosophila melanogaster, that
mutations in any of several different genes are derived from both the maternal and
whose products are needed for peroxi- paternal parent as opposed to those that
some formation, for example, peroxin-1 are active in the egg even before fertilization
(PEX1), peroxin-2 (PEX2), peroxin-3 and so are referred to as maternal-effect
(PEX3), peroxin-5 (PEX5), peroxin-6 genes. See segments, segmentation.
(PEX6), peroxin-12 (PEX12), peroxin-
14 (PEX14), and peroxin-26 (PEX26). zymogen An inactive form of a proteo-
The genetic loci map to chromosomes 1 lytic enzyme. The active enzyme is gen-
(PEX14), 7q21 (PEX1), 8q (PEX2), 6q23 erated by the action of other proteolytic
(PEX3), 12 (PEX5), and 6p (PEX6). enzymes via cleavage of the zymogen pep-
tide at specific sites. The term is derived
from the phrase: enzyme generating. For
zinc fi nger A feature of many DNA
example, the zymogen, chymotrypsino-
binding transcription regulatory proteins
gen, is cleaved by the protease, trypsin, to
(transcription factors) in which a zinc
generate the active enzyme, chymotrypsin.
atom is bonded to four amino acids (gen-
erally cysteine and histidine residues) so zyxin (ZYX) A component of adhesion
as to hold the polypeptide in a loop which plaques that functions both as a regula-
has been termed a fi nger. The fi nger is tor of actin filament assembly and as a
necessary for the DNA-binding proper- component of the mitotic regulatory appa-
ties of the protein. ratus. During mitosis cytoplasmic zyxin
forms a complex with a factor called h-
Zinder, Norton (b. 1928) A geneti- warts/LATS1 (the human homologue of a
cist who studied recombination in bacteria Drosophila melanogaster tumor suppres-
and bacteriophages. As a graduate student sor) on the mitotic apparatus. Complex
in the laboratory of Joshua Lederberg, he formation between zyxin and h-warts/
carried out the critical experiments involv- LATS1 is regulated by phosphorylation of
ing mutants of the Salmonella bacterium zyxin h-warts/LATS1 by Cdc2 kinase. The
that led to the discovery of transduction by zyxin gene map locus is 7q34-q35.

260
www.stemcell8.cn
verso

Appendixes

I. Acronyms (and Other Abbreviations)

II. The Chemical Elements

III. Periodic Table

IV. The Genetic Code

V. Purine and Pyrimidine Bases Found in Nucleic Acids

VI. Side Chains (R Groups) for Individual Amino Acids

VII. Bioinformatics Web Sites

VIII. Enzymes Used in Gene Cloning

261
www.stemcell8.cn
Appendixes

I. Acronyms (and Other Abbreviations)

A
ACP
adenine A
acyl carrier protein
ACTH adrenocorticotrophic hormone
ADP adenosine diphosphate
AIDS acquired immunodeficiency syndrome
AMP adenosine monophosphate
APC adenomatous polyposis coli
APH aminoglycoside-3-phosphotransferase
araA arabinosyladenine
araC arabinosylcytosine
ARC AIDS-related complex
ARS autonomously replicating sequences
ATP adenosine triphosphate
AZT 3-azido-3-deoxythymidine
BAP benzylaminopurine
BOD biochemical oxygen demand
bp base pair
5-BU 5-Bromuracil
C cytosine
cAMP cyclic AMP
CAP catabolite activator protein
CAT chloramphenical acetyl transferase
ccc DNA covalently closed circular DNA
Ccrit critical dissolved oxygen concentration
cdc cell-division cycle
cDNA complementary DNA
CF complement-fixation
CFT cystic fibrosis transmembrane conductance
CFTR cystic fibrosis transmembrane conductance regulator
CFU colony-forming unit
cM centimorgan
CML chronic myelogenous leukemia
CMP cytidine monophosphate
CNBr cyanogen bromide
CoA/CoASH coenzyme A
con A concanavalin A
CRP catabolite repression protein
CsCl cesium chloride
ctDNA chloroplast DNA
CTP cytidine triphosphate
d deoxy
DAG diacylglycerol
dATP deoxyadenosine triphosphate
dCTP deoxycytidine triphosphate
dd dideoxy
ddNTP dideoxyribonucleotide triphosphate
dGTP deoxyguanosine triphosphate
DHFR dihydrofolate reductase
DMSO dimethyl sulfoxide

262
www.stemcell8.cn
Appendixes
verso

DMT dimethoxytrityl
DNA deoxyribonucleic acid (See also ctDNA, mtDNA.)
DNase deoxyribonuclease
dNTP deoxyribonucleotide triphosphate
DP docking protein
EBV Epstein-Barr virus
ECM extracellular matrix
E. coli Escherichia coli
EDTA ethylenediaminetetraacetate
EF elongation factor
EGF epidermal growth factor
ELC expression-linked copy
ELISA enzyme-linked immunoabsorbent assay
EMBL European Molecular Biology Lab
EMS ethylmethane sulfonate
ER endoplasmic reticulum
erb erythroblastosis
ERK extracellular receptor tyrosine kinase
EST expressed sequence tags
FACS flourescence-activated cell sorter
f-actin filamentous actin
FAD flavin adenine dinucleotide
FBJ Finkel, Biskis, and Jinkins (discoverers of the FBJ murine
osteosarcoma virus)
FCS fetal calf serum
fes feline sarcoma
FFU focus-forming unit
FGP fluorescent green protein
FISH fluoresence in situ hybridization
5-FU 5-fluorouracil
FMN flavin mononucleotide
FRA fos-related antigens
FRAP fluorescence recovery after photobleaching
FSH follicle-stimulating hormone
FSV feline sarcoma virus
ftz fushi tarazu
G guanine
G actin globular actin
GABA gamma amino butyric acid
GAG glycosaminoglycan
gal galactosidase
GALT gut-associated lymphatic tissue
GAP GTPase-activating proteins
GC gas chromatography
GDP guanosine diphosphate
GEF guanine nucleotide exchange factor
GFAP glial fibrillary acidic protein
GH growth hormone
GLC gas-liquid chromatography
GMP guanosine monophosphate
gpt guanine phosphoribosyl transferase
GST Glutathione S-transferases
GTP guanosine triphosphate

263
www.stemcell8.cn
recto
Appendixes

HAT hypoxanthine-aminopterin-thymine
HCG human chorionic gonadotropin
HDL high-density lipoproteins
Hfr high-frequency recombination strain
HGPRT hypoxanthine-guanine phosphoribosyl transferase
HIV human immunodeficiency virus
HLA human leukocyte-associated antigens
HLTV human T-cell leukemia virus
HMG high-mobility group
HN hemagglutinin-neuraminadase
hnRNA heterogeneous nuclear RNA
HPFH hereditary persistence of fetal hemoglobin
HPLC high-performance liquid chromatography
HPV human papilloma virus
HRP horseradish peroxidase
HSE heat-shock response element
hsp heat-shock protein
HSR homogeneously staining region
HSV herpes simplex virus
IAA indole acetic acid
IDL intermediate-density lipoprotein
IF initiation factor
IL interleukin
IMP inosine monophosphate
IPTG isopropyl--D-thiogalactopyranoside
IR infrared
IS insertion sequence
IUdR iododeoxyuridine
j gene-joining gene
KD diffusion coefficient/constant
Ki-MuSV Kirsten sarcoma virus
kM Michaelis-Menten constant
LAV lympho adenopathy virus
LDL low-density lipoprotein
LH lutinizing hormone
LINES long-period interspersed sequences
LTR long terminal repeat
MAPS microtubule-associated proteins
MAR matrix attachment regions
MAT mating-type locus
MBP maltose binding protein
MCP methyl-accepting chemotaxis protein
mdr multidrug resistance
5MeC 5-methylcytosine
MHC major histocompatibility complex
MIF migration-inhibitory factor
MMTV mouse mammary tumor virus
MPF M-phase promoting factor
mRNA messenger RNA
mtDNA mitochondrial DNA
MTOC microtubule organizing center
MuLV murine leukemia virus
MVR minisatellite variant repeat

264
www.stemcell8.cn
Appendixes
verso

myb myeloblastosis
myc myelocytomatosis
NAD nicotamide adenine dinucleotide
NADP nicotamide adenine dinucleotide phosphate
NANA N-acetylneuraminic acid
NBT nitro-blue tetrazolium
N-CAM neural cell adhesion molecule
NCBI National Center for Biotechnology Information
NGF nerve growth factor
NHGRI National Human Genome Research Institute
NK cells natural killer cells
NMR nuclear magnetic resonance
NP40 nonidet P40
NTG neomycin, thymidine kinase, glucocerebroside
oc open circle
PAGE polyacrylamide gel electrophoresis
PaPoVa papilloma, polyoma, and vacuolating viruses
PAS periodic acid-Schiff stain
PCR polymerase chain reaction
PDGF platelet-derived growth factor
PE phosphatidylethanolamine
PEG polyethylene glycol
PEP phosphoenol pyruvate
PFU plaque-forming unit
PITC phenyl isothiocyanate
PKU phenylketonuria
PML progressive multifocal leukoencephalopathy
PMU polymorphonuclear leukocyte
poly U polyuridylic acid
PPLO pleuropneumonialike organisms
PVP polyvinylpyrrolidone
raf rat fibrosarcoma
ras rat sarcoma
RBC red blood cell
RER rough endoplasmic reticulum
RES reticuloendothelial system
RFLP restriction fragment-length polymorphism
RG resorufin--D-galactopyranoside
RNA ribonucleic acid (See also hnRNA, mRNA, rRNA,
snRNA, tRNA.)
RNP ribonucleoprotein
ros Rochester 2 sarcoma
rRNA ribosomal RNA
RSV Rous sarcoma virus
RTK receptor tyrosine kinase
RVE reconstituted viral envelope
SAM S-adenosylmethionine
SAR scaffold attachment regions
SDGF sarcoma-derived growth factor
SDS sodium dodecyl sulfate
SEM scanning electron microscopy
sis simian sarcoma
snRNA small nuclear RNA

265
www.stemcell8.cn
recto
Appendixes

SPF S-phase promoting factor


SRP signal-recognition particle
STR short tandem repeat
STS sequence tagged site
SV40 simian virus 40
T thymine, twisting number
Taq Thermus aquaticus
TB tuberculosis
Tc cytoxic T cell
TCA tricarboylic acid
TEM transmission electron microscope
TGF transforming growth factor
TI tumor inducing
TMV tobacco mosaic virus
TNF tumor necrosis factor
tPA tissue plasminogen activator
TPA 12-O-tetradecanoylphorbol-13-acetate
TRH TSH-releasing hormone
tRNA transfer RNA
TSH thyroid stimulating hormone
Ts mutant temperature-sensitive mutant
TTP thymidine triphosphate
Ty transposon yeast
U uracil
UTP uridine triphosphate
UV ultraviolet
VLDL very low-density lipoprotein
VSG variable-surface glycoprotein
VSPR very short patch repair
W writhing number
XP xeroderma pigmentosum
YAC yeast artificial chromosome

266
The Chemical Elements
element symbol a.n. element symbol a.n. element symbol a.n. element symbol a.n.
actinium Ac 89 erbium Er 68 molybdenum Mo 42 selenium Se 34
aluminum Al 13 europium Eu 63 neodymium Nd 60 silicon Si 14
americium Am 95 fermium Fm 100 neon Ne 10 silver Ag 47
antimony Sb 51 fluorine F 9 neptunium Np 93 sodium Na 11
argon Ar 18 francium Fr 87 nickel Ni 28 strontium Sr 38
arsenic As 33 gadolinium Gd 64 niobium Nb 41 sulfur S 16
astatine At 85 gallium Ga 31 nitrogen N 7 tantalum Ta 73
barium Ba 56 germanium Ge 32 nobelium No 102 technetium Tc 43
berkelium Bk 97 gold Au 79 osmium Os 76 tellurium Te 52
beryllium Be 4 hafnium Hf 72 oxygen O 8 terbium Tb 65
bismuth Bi 83 hassium Hs 108 palladium Pd 46 thallium Tl 81
bohrium Bh 107 helium He 2 phosphorus P 15 thorium Th 90
boron B 5 holmium Ho 67 platinum Pt 78 thulium Tm 69
bromine Br 35 hydrogen H 1 plutonium Pu 94 tin Sn 50

267
cadmium Cd 48 indium In 49 polonium Po 84 titanium Ti 22
calcium Ca 20 iodine I 53 potassium K 19 tungsten W 74
californium Cf 98 iridium Ir 77 praseodymium Pr 59 ununbium Uub 112
carbon C 6 iron Fe 26 promethium Pm 61 ununpentium Uup 115
cerium Ce 58 krypton Kr 36 protactinium Pa 91 ununquadium Uuq 114
cesium Cs 55 lanthanum La 57 radium Ra 88 ununtrium Uut 113
chlorine Cl 17 lawrencium Lr 103 radon Rn 86 unununium Uuu 111
www.stemcell8.cn

II. The Chemical Elements

chromium Cr 24 lead Pb 82 rhenium Re 75 uranium U 92


cobalt Co 27 lithium Li 3 rhodium Rh 45 vanadium V 23
copper Cu 29 lutetium Lu 71 rubidium Rb 37 xenon Xe 54
curium Cm 96 magnesium Mg 12 ruthenium Ru 44 ytterbium Yb 70
darmstadtium Ds 110 manganese Mn 25 rutherfordium Rf 104 yttrium Y 39
dubnium Db 105 meitnerium Mt 109 samarium Sm 62 zinc Zn 30
dysprosium Dy 66 mendelevium Md 101 scandium Sc 21 zirconium Zr 40
einsteinium Es 99 mercury Hg 80 seaborgium Sg 106
a.n. = atomic number
verso
Appendixes
recto

Periodic Table of Elements


1 2
H He
Appendixes

1.008 1 atomic number 4.003


3 4 H symbol 5 6 7 8 9 10
Li Be 1.008 atomic weight B C N O F Ne
6.941 9.012 10.81 12.01 14.01 16.00 19.00 20.18
11 12 13 14 15 16 17 18
Numbers in parentheses are the
Na Mg atomic mass numbers of radioactive isotopes. Al Si P S Cl Ar
22.99 24.31 26.98 28.09 30.97 32.07 35.45 39.95
19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36
K Ca Sc Ti V Cr Mn Fe Co Ni Cu Zn Ga Ge As Se Br Kr
39.10 40.08 44.96 47.88 50.94 52.00 54.94 55.85 58.93 58.69 63.55 65.39 69.72 72.59 74.92 78.96 79.90 83.80
37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54
Rb Sr Y Zr Nb Mo Tc Ru Rh Pd Ag Cd In Sn Sb Te I Xe
85.47 87.62 88.91 91.22 92.91 95.94 (98) 101.1 102.9 106.4 107.9 112.4 114.8 118.7 121.8 127.6 126.9 131.3

268
55 56 57-71* 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86
Cs Ba Hf Ta W Re Os Ir Pt Au Hg Tl Pb Bi Po At Rn
132.9 137.3 178.5 180.9 183.9 186.2 190.2 192.2 195.1 197.0 200.6 204.4 207.2 209.0 (210) (210) (222)
87 88 89-103 104 105 106 107 108 109 110 111 112 113 114 115
III. Periodic Table

Fr Ra Rf Db Sg Bh Hs Mt Ds Uuu Uub Uut Uuq Uup


(223) (226) (261) (262) (263) (262) (265) (266) (271) (272) (285) (284) (289) (288)
www.stemcell8.cn

57 58 59 60 61 62 63 64 65 66 67 68 69 70 71
*lanthanide La Ce Pr Nd Pm Sm Eu Gd Tb Dy Ho Er Tm Yb Lu
series 138.9 140.1 140.9 144.2 (145) 150.4 152.0 157.3 158.9 162.5 164.9 167.3 168.9 173.0 175.0
89 90 91 92 93 94 95 96 97 98 99 100 101 102 103
actinide Ac Th Pa U Np Pu Am Cm Bk Cf Es Fm Md No Lr
series (227) 232.0 231.0 238.0 (237) (244) (243) (247) (247) (251) (252) (257) (258) (259) (260)

The periodic table as it looks today.


www.stemcell8.cn
Appendixes
verso

IV. The Genetic Code

269
www.stemcell8.cn
recto
Appendixes

V. Purine and Pyrimidine Bases Found in Nucleic Acids

Purines Pyrimidines

270
www.stemcell8.cn
Appendixes
verso

VI. Side Chains (R Groups) for Individual Amino Acids

271
www.stemcell8.cn
Appendixes

VII. Bioinformatics Web Sites

AlignACE Mitomap
A Web site for identifying motifs by align- A database of variant human mitochon-
ments of multiple sequences. The AlignACE drial genomes detailing known polymor-
software can be downloaded. http://atlas. phisms and mutations and literature refer-
med.harvard.edu/cgi-bin/alignace.pl. ences. http://www.mitomap.org. Accessed
Accessed on September 12, 2005. on September 12, 2005.

The European Bioinformatics Institute National Center for Biotechnology Infor-


Access to the EMBL nucleotide sequence, mation (NCBI)
PDB protein, and microarray databases. A major bioinformatics Web site main-
Searches of Medline literature database tained by the National Institutes of
and patent abstracts. ClustalW for mul- Health. The NCBI is the repository of
tiple sequence alignment and tools for the GenBank nucleotide and protein
depicting protein three-dimensional struc- sequence database. This Web site also
ture. http://www.ebi.ac.uk. Accessed on provides BLAST for alignment searches
September 12, 2005. of the databases. There is a wide variety
of useful tools for data analysis, such as
ExPASy Proteomics Server ORF finder, Entrez Gene, Model Maker,
The ExPASy (Expert Protein Analysis Sys- CD Search, Open Mass Spectrometry
tem) proteomics server of the Swiss Insti- Search Algorithm, ProtEST, Cn3D, VAST
tute of Bioinformatics (SIB) is devoted to Search, and CD Search. The NCBI also
the analysis of protein sequences and pro- provides access to the PubMed database
tein structure. This Web site also has tools of biomedical literature. http://www.
for analysis of two-dimensional polyacryl- ncbi.nlm.nih.gov. Accessed on September
aminde protein gels. Tools are available 12, 2005
for primary, secondary, and tertiary struc-
ture analysis, including protein subfrag- National Human Genome Research Insti-
ment mass prediction, and programs for tute
modeling structures. Access to the Swiss Basic information on topics related to the
Protein database. http://www.expasy.org. Human Genome Project, including eth-
Accessed on September 12, 2005. ics and legal issues. Links to all major
sequence databases. http://www.genome.
The GENSCAN Web Server at MIT gov. Accessed on September 12, 2005.
Scans large nucleotide sequences for vari-
ous gene features such as exons and splice Online Analysis Tools
sites in genomic DNA. http://genes.mit. This Web site contains a variety of tools
edu/GENSCAN.html. Accessed on Sep- for carrying out sequence manipulations
tember 12, 2005. and analyses, including alignments, DNA
motifs, PCR primer design, phylogenetic
MEME trees, restriction mapping, and open read-
On the MEME Web site, searches of pro- ing frames and motifs. http://molbiol-tools.
tein or DNA sequences can be carried ca/Restriction_endonuclease.htm. Accessed
out for motifs that are present in differ- on September 12, 2005.
ent sequences. MEME will analyze mul-
tiple sequences for similarities among Pfam
them. http://meme.sdsc.edu/meme/website/ A database of protein families derived
meme.html. Accessed on September 12, from multiple sequence alignments. In
2005. the Pfam Web site, known protein struc-

272
www.stemcell8.cn
Appendixes
verso

tures and domain architectures can be http://repeatmasker.genome.washington.


viewed. Distribution of protein domains edu. Accessed on September 12, 2005.
among species. Links to other databases.
http://www.sanger.ac.uk/Software/Pfam. REPFIND
Accessed on September 12, 2005. REPFIND finds clustered, exact repeats
in nucleotide sequences. Output is in the
Regulatory Sequence Analysis Tools form of a graphical display of the repeats
Algorithms to scan genomes from vari- found. http://zlab.bu.edu/repfind. Accessed
ous organisms for nucleotide pattern rep- on September 12, 2005.
resenting putative regulatory sequences.
http://rsat.ulb.ac.be/rsat. Accessed on Sep- Wadsworth Center
tember 12, 2005. Run by the New York State Department
of Health, the Wadsworth Center pro-
The Repeat Masker Server at the Univer- vides news and information on health and
sity of Washington. health-related research. Image analysis
Web-based utility that scans DNA using SPIDER (System for Processing Image
sequences for interspersed repeats (such as Data in Electron Microscopy and Related
Alu and L1 elements) and low-complexity Fields). http://sfold.wadsworth.org/index.pl.
short repeats (such as dinucleotide repeats). Accessed on September 12, 2005.

273
www.stemcell8.cn
Appendixes

VIII. Enzymes Used in Gene Cloning

Enzyme Activity Applications

alkaline phosphatase removes 5 terminal phos- dephosphorylation of vec-


phates from the single- tors cleaved with a restric-
stranded end of a DNA tion enzyme, to prevent
strand ligation of the ends of
the vector with itself, to
increase the recovery of
vectors with inserts

deoxyribonuclease I cleaves double or single nick translation


(DNase I) DNA strands by breaking Dnase I footprinting
phosphodiester bonds of
the DNA backbone

DNA polymerase I copies a template DNA preparation of labeled


strand from an annealed DNA probes by nick
primer translation
site-directed mutagenesis

exonuclease III cleavage of single nucleo- creation of nested dele-


tides one at a time from the tions for sequencing
5 end of double-stranded
DNA, which has a non-
phosphorylated 3 end

Klenow enzyme a subfragment of DNA creation of blunt ends


polymerase I lacking the for blunt-end cloning of
53 exonuclease of the restriction fragments
intact enzyme

polynucleotide kinase catalyzes the transfer of a end labeling of oligonu-


the terminal phosphate cleatides to be used as
group from ATP to the free probes
3 end of a polynucleotide

Restriction enzyme(s) cleaves double-stranded standard sticky end


DNA at sites defined by cloning for creation of
specific palindromic nucle- recombinant DNAs
otide sequences leaving
sticky single-stranded ends

reverse transcriptase catalyzes the synthesis cDNA cloning


of DNA copied from an generation of cDNA
RNA template probes for microarray
analyses
reverse transcription
polymerase chain reac-
tions (RT-PCR)
274
www.stemcell8.cn
Appendixes

Enzymes Used in Gene Cloning, con'd

Enzyme Activity Applications

T4 DNA ligase catalyzes the formation joining of vector and


of a phosphodiester bond insert in most cloning pro-
between 5-phosphate cedures
and 3-hydroxyl ends of site-directed mutagenesis
two termini in double-
stranded DNA

Taq polymerase a class of thermostabile polymerase chain reaction


DNA polymerase(s)

terminal deoxynucleotide catalyzes the addition cloning of cDNAs and


transferase of deoxyribonucleotides blunt-ended DNA frag-
from deoxyribonucleotide ments
triphophates (dNTPs) to
a free 3 hydroxyl end of
double- or single-stranded
DNA

275
www.stemcell8.cn

Вам также может понравиться