Yeast

Yeast 2004; 21: 12891305.

Published online in Wiley InterScience (www.interscience.wiley.com). DOI: 10.1002/yea.1181
Research Article

pDUAL, a multipurpose, multicopy vector capable of

chromosomal integration in fission yeast
Akihisa Matsuyama1,2 *, Atsuko Shirai1,3 , Yoko Yashiroda1 , Ayako Kamata1,3 , Sueharu Horinouchi3
and Minoru Yoshida1,2
1 Chemical Genetics Laboratory, RIKEN, Saitama 351-0198, Japan
2 CREST, JST, Saitama 332-0012, Japan
3 Department of Biotechnology, Graduate School of Agriculture and Life Sciences, The University of Tokyo, Bunkyo-ku, Tokyo 113- 8657, Japan

*Correspondence to: Abstract

Akihisa Matsuyama, Chemical
Genetics Laboratory, RIKEN,
Saitama 351-0198, Japan.
E-mail: akihisa@riken.jp
Received: 6 July 2004
Accepted: 29 August 2004
A novel series of plasmid vectors named pDUAL have been developed. These
vectors enable one to introduce not only multicopies of genes with episomal
maintenance but also a single copy with chromosomal integration into the fission
yeast, Schizosaccharomyces pombe. The multicopy plasmids can be easily converted
to fragments for chromosomal integration by digestion of the plasmids with a
certain restriction endonuclease before transformation of the yeast cells. The resultant
fragments, lacking the autonomously replicating sequence, are designed for targeting
into the chromosomal leu1 locus by homologous recombination. Whether the
transformants are the results of episomal maintenance of the plasmid or homologous
gene targeting can be readily checked by their requirement for uracil or leucine,
or by the PCR diagnostic analysis. Furthermore, we propose the use of pDUAL
derivatives for PCR-based chromosomal tagging of a gene to introduce several tags
into 5
-terminus of a gene, employing a set of primers. Using these all-in-one vectors,
a suitable mode of expression of a cloned gene can be selected for individual analysis
without any complicated subcloning processes. Copyright 2004 John Wiley & Sons,
Ltd.
Keywords: Schizosaccharomyces pombe; vector; multicopy; integration

Introduction thiamine-repressible nmt1 promoter has been the

The ability of cloning vectors to express pro-
teins of interest under the desired conditions is
important for using them as tools for cell biol-
ogy and biochemistry in yeast. The fission yeast
Schizosaccharomyces pombe is a valuable model
eukaryotic cell for studying many biological pro-
cesses. A variety of cloning vectors in fission yeast
have become available during recent years (see
e.g. Cottarel et al., 1993; Maundrell, 1993; Moreno
et al., 2000). However, fission yeast vectors that
can be used for multiple purposes have been less
sufficiently developed, compared with those of the
budding yeast Saccharomyces cerevisiae.
The transcriptional levels are often very impor-
tant for expressing a cloned gene at the appropri-
ate level in cells. In fission yeast, the powerful
most widely used and modified (Maundrell, 1993).
In order to control varying levels of expression
of the genes, three versions of the nmt1 promoter
have been employed. Each version can drive the
expression of cloned genes at high and low levels,
depending upon the absence and presence, respec-
tively, of thiamine (vitamin B1 ) in the medium
(Basi et al., 1993). Moreover, levels of expression
can also be fine-tuned by varying the concentration
of thiamine added (02 M).
Since extrachromosomal multicopy plasmids can
make high levels of expression in cloned genes
in general, they are suitable for protein analy-
ses such as Western blotting and purification of
expressed proteins. However, the copy number of
plasmids in an individual cell is not uniform, which

Copyright 2004 John Wiley & Sons, Ltd.

1290
makes some analyses difficult. On the other hand,
chromosomal integration has some advantages,
especially for analyses such as observation of sub-
cellular localization of a protein and functional
complementation, although the expression levels of
cloned genes might be lower than those expressed
from multicopy plasmids. While direct tagging of
a gene by chromosomal integration using PCR has
become increasingly popular during recent years
(Bahler et al., 1998; Longtine et al., 1998; Tasto
et al., 2001; Werler et al., 2003), vectors for chro-
mosomal integration are not widely used in fission
yeast.
In this paper, we report on the construction
of two lines of new vectors named pDUAL
and pDUAL2, respectively, which enables one to
express cloned genes in either a single-copy or
a multicopy fashion. The multicopy version can
be easily converted to the single-copy integration
version by pretreating the plasmids with a certain
restriction enzyme before the transformation of Sz.
pombe cells. The usefulness of the plasmids will
greatly facilitate analysis of cloned genes in fission
yeast.
Materials and methods
Sz. pombe strains and media
Sz. pombe strains AM2 (h 90 leu1-32 ), AM5 (h 90
ura4-D18 ), JY3 (h 90 wild-type), and MK1 (h 90
leu1-32 ura4-D18 ) were used in this study. Com-
plete medium YE (0.5% yeast extract, 2% glu-
cose, 5 g/ml adenine) and minimal medium SD
(Sherman et al., 1986) were used for routine cul-
ture of Sz. pombe strains. Minimal medium MM
(Moreno et al., 1991) was used for expression of
genes driven by the nmt1 promoter.
Genetic methods and transformation of
Sz. pombe
General methods to handle fission yeast cells
were as described by Gutz et al. (1974). A high-
efficiency protocol for transformation of Sz. pombe
cells was described previously (Bahler et al., 1998;
Matsuyama et al., 2000). For chromosomal integra-
tion of pDUAL, pDUAL2, and their derivatives,
each DNA was digested with NotI or ApaI in
a volume of 1020 l, and 34 l of the resul- NotI-leu1 (5 )-R (TTGCATGCGGCCGCCAAAC-
tant solution was directly used. Transformants were
Copyright 2004 John Wiley & Sons, Ltd.
A. Matsuyama et al.
plated on an appropriate selective medium. For
gene induction, cells harbouring a testing plas-
mid or integrants were grown in the SD medium;
a part of this culture was subsequently inocu-
lated in MM medium and grown for 18 h to
the mid-log phase at 30 C. Cells were then har-
vested and subjected to the subsequent experi-
ments.
Fluorescence microscopy of GFP-tagged
proteins
A mutant version of GFP (with Ser65 substituted by
Cys) generated by site-directed mutagenesis (Chal-
fie et al., 1994; Matsuyama et al., 2000) was used
for the observation of subcellular localization of
Clc1 and Tub1 (Toda et al., 1984). GFP fluores-
cence in living cells was monitored by the Axio-
phot2 microscope (Carl Zeiss) with an appropriate
set of filters.
Cloning and sequencing of the leu1-32 allele
Identification of the mutated point of the leu1-
32 allele was carried out as follows. leu1-32 was
cloned from the leu1-32 strain AM2 with the Gate-
way system (Invitrogen) according to the manufac-
tures instructions, using a set of primers, leu1.Fd
(AAAAAGCAGGCTCTCATATGTGTGCAAAG-
AAAATCGT), and leu1.Rv (AGAAAGCTGGGT-
ACAAAATTTTTTCAAGTTCT), in which the ini-
tiation codon and a residue derived from the termi-
nation codon of the leu1 gene are indicated by bold
letters. The insert DNA cloned into the Escherichia
coli vector pDONR201 (Invitrogen) was sequenced
using the ABI310 sequencer (Applied Biosystems
Inc.).
Vector construction
Construction of pDUAL
A part of the leu1 gene whose 3 -terminus was
deleted was then amplified by PCR using the
genome DNA of the wild-type strain JY3 as a tem-
plate, and cloned into the E. coli vector pBluescript
II SK (Stratagene). To create the NotI recogni-
tion site within the leu1 ORF, the leu1 fragments
were amplified as two fragments using two sets
of primers, viz. SpeI-P-leu1-F (GGGTCGACTAG-
TAAGATGATTCTTTTATCGTCGATAACG) and
GAGCAATACGAGAAACTTC); and NotI-leu1 -
Yeast 2004; 21: 12891305.
Fission yeast multicopy and integration vectors
(3 )-F (TTGCATGCGGCCGCTTAGCTGAAAC-
TTCCAACCCTCC) and SacI-leu1 (
3)-R (GGT-
CTAGAGCTCGGGAGCGCTACCGTGAATGG-
GCTC), digested with SpeI and NotI, and NotI
and SacI, respectively, and ligated to the SpeI and
SacI sites of pBluescript II. At the same time,
the budding yeast ADH1 terminator was ampli-
fied using BamHI-Tadh-F (TTCCCGGGATCCG-
GCGCGCCACTTCTAAATAAGCG) and SpeI-
Tadh-R (GGGTCGACTAGTATATTACCCTGTT-
ATCCCTAGCGG) as primers, and pAG32 as a
template (Goldstein et al., 1999). The resultant
PCR fragment was digested with BamHI and SpeI,
and ligated into the BamHI and SacI sites of
pUC119 together with the above leu1 fragment
digested with SpeI and SacI. Thus, a plasmid
named pUC-Pleu1, comprising a part of the fis-
sion yeast leu1 gene and the budding yeast ADH1
terminator, was constructed.
The ars1-ura4 + fragment intervening the leu1
ORF was constructed as follows: pREP2
EV,
a derivative of pREP2 (Maundrell, 1993) whose
EcoRV restriction enzyme recognition site within
the ura4 marker was eliminated by site-directed
mutagenesis, was digested with SphI and SacI to
allow utilization of the enzyme in the polylinker
sequences, had its protruded ends filled with
Klenow fragment, and then self-ligated, resulting in
the generation of pREP2
SphI-SacI. Site-directed
mutagenesis was carried out with a QuickChange
site-directed mutagenesis kit (Stratagene) using two
primers, pURA4RV-F (GCGGTAGCGACATCAT-
CATTGTTGGTCG) and pURA4RV-R (CAAT-
GATGATGTCGCTACCGCAGTTTAC). Using
pREP2
SphI-SacI as a template, ars1-ura4 + was
amplified by PCR using NotI-ApaI-ars1-F (TTGC-
ATGCGGCCGCGGGCCCACTGGCTATATGT-
ATGC) and NotI-ApaI-ura4-R (TTGCAT-
GCGGCCGCGGGCCCAACACCAATGTTTAT-
AACC) as a primer set, digested with NotI, and
inserted into the leu1 fragment in the pUC-Pleu1
plasmid, resulting in the generation of pDUAL.
Successful vector construction without PCR errors
was confirmed by sequencing.
Construction of pDUAL2
The ura4 marker derived from pREP2
EV descri-
bed above was inserted at the HindIII site of
pUC119, resulting in the generation of pUC119-
ura4
EV. In parallel, part of the leu1 gene
Copyright 2004 John Wiley & Sons, Ltd.
1291
that lacks both 5 and 3 ends was amplified
by PCR using the genome DNA of the wild-
type strain JY3 as a template, and cloned into
the E. coli vector pBluescript II SK . Similarly
to pDUAL, the leu1 fragments were amplified
as two fragments to create the NotI recogni-
tion site within the leu1 ORF using two sets
of primers, viz. SpeI-leu1(
5 )-F (GGGTCGAC-
TAGTGCCTCTATTGATGCCTATGGAAC) and
NotI-leu1(5  )-R; and NotI-leu1(3  )-F and SacI-
leu1(
3 )-R: digested with SpeI and NotI, and NotI
and SacI, respectively, and ligated to the SpeI and
SacI sites of pBluescript II. The BamHI-SpeI frag-
ment of the ADH1 terminator was prepared as
described for the construction of pDUAL, ligated
to the BamHI and SacI site of pUC119-ura4
EV
together with the above leu1 fragment digested
with SpeI and SacI, resulting in the construction
of pUC119-T-leu1
53.
The ars1 element intervening leu1 in pUC119-
T-leu1
53 was amplified by PCR using NotI-
ApaI-ars1-F (TTGCATGCGGCCGCGGGCCCA-
ACCTTCCAATTCATTAAATCG) and NotI-ApaI-
ars1-R (TTGCATGCGGCCGCGGGCCCGAGTC-
TAACTCCTTAACCACTC) as primers, digested
with NotI, and inserted into leu1 in the plasmid,
resulting in the generation of pDUAL2.
Construction of the pDUAL and pDUAL2
derivatives
To construct all pDUAL- or pDUAL2-derived vec-
tors, we prepared two vectors comprising two
copies of the FLAG epitope and a six-histidine
residue (His6 ) tag. One is aimed to fuse the His6
tag followed by two copies of the FLAG epi-
tope (His6 -FLAG2 ) at the N-terminus of a gene
product, and the other is the FLAG2 -His6 tag at
the C-terminus. The polylinkers were designed
so that the gene could be cloned in-frame to
either upstream or downstream of the tags. Essen-
tially, DNA fragments comprising multicloning
sites, two FLAG epitope tags and the His6 tag were
generated by reciprocal annealing of the follow-
ing seven oligonucleotides partly complementary
to each other: for the N-terminal fusion, HFF-
F1 (CCCGTCGACAGGCCTGGATCCTATGCAT-
CACCACCATCATCACATG), HFF-F2 (GATTAT-
AATGATGATGACGATAAACCCATGGACTAC-
AAGGACGACGATG), HFF-F3 (ACAAAGGAT-
ATCTGAGATCTCGAGCCCGGGCGGCCGCTA-
Yeast 2004; 21: 12891305.
1292
ACTAACTAA), HFF-R1 (TTAGTTAGTTAGCG-
GCCGCCCGGGCTC), HFF-R2 (GAGATCTCA-
GATATCCTTTGTCATCGTCGTCCTTGTAGTC-
CATG), HFF-R3 (GGTTTATCGTCATCATCAT-
TATAATCCATGTGATGATGGTGGTG) and HFF-
R4 (ATGCATAGGATCCAGGCCTGTCGACGG),
and for the C-terminal fusion, FFH-F1 (CCCGTC-
GACAGGCCTGGATCCGGATATCATGGATTA-
TAATGATGATG), FFH-F2 (ACGATAAACCCA-
TGGACTACAAGGACGACGATGACAAACAT-
CACC), FFH-F3 (ACCATCACCACTGAGATCT-
CGAGCCCGGGCGGCCGCTAACTAACTAA),
FFH-R1 (TTAGTTAGTTAGCGGCCGCCCGGG-
CTC), FFH-R2 (GAGATCTCAGTGGTGATGGT-
GGTGATGTTTGTCATCGTCGTC), FFH-R3
(CTTGTAGTCCATGGGTTTATCGTCATCATC-
ATTATAATCCATG) and FFH-R4 (ATATCCG-
GATCCAGGCCTGTCGACGGG). After phospho-
rylation, the resulting two fragments annealed were
individually integrated into the SmaI site of the
pREP1 vector (Maundrell, 1993) whose NdeI site
was deleted, resulting in the generation of pHFF1
and pFFH1, respectively. Deletion of the NdeI
site in pREP1 was performed as follows. The
pREP1 plasmid was simultaneously digested with
two endonucleases, NdeI and Sal I. The resulting
protruded ends of the fragment were filled with the
Klenow fragment to generate blunt ends, and self-
ligation was then carried out. During this treatment
the Sal I site was regenerated and only the NdeI site
was removed from the original plasmid.
The coding region for GFP was amplified by
PCR using the following primer sets: pHFC-N-F
(GATAAACCCATGGGTAAAGGAGAAGAACT-
TTTCAC) and pHFC-N-R (GGCTCGAGATCT-
CATGATATCTTTGTATAGTTCATCCATGC) for
the N-terminal fusion; and pCFH-C-F (AGGC-
CTGGATCCGGATATCATGAGTAAAGGAGA-
AGAAC) and pCFH-C-R (GTAGTCCATGGGT-
TTGTATAGTTCATCCATGCC) for the C-terminal
fusion. The PCR product for the N-terminal fusion
was digested by NcoI and Bgl II and inserted
into the pHFF1 vector to replace one copy of
the FLAG tag. Similarly, the PCR product for
the C-terminal fusion was digested by BamHI
and NcoI, and then inserted into the pFFH1 vec-
tor.
The ccd B cassette was inserted into the EcoRV
site within the multiple cloning site (MCS) of each
vector, using the GATEWAY Vector Conversion
Copyright 2004 John Wiley & Sons, Ltd.
A. Matsuyama et al.
Reagent System (Invitrogen), according to the
manufacturers instructions.
The nmt1 promoter, MCS, the ccd B cassette,
and tag sequences were integrated into pDUAL
or pDUAL2 by digestion with SphI and XhoI,
and digestion of pDUAL or pDUAL2 with SphI
and Sal I, followed by ligation. These vectors were
designated as pDUAL-HFF1c, pDUAL-HFG1c,
pDUAL-FFH1c, pDUAL-GFH1c, pDUAL2-
HFF1c, pDUAL2-HFG1c, pDUAL2-FFH1c and
pDUAL2-GFH1c, respectively. In addition, a series
of vectors containing no ccd B cassette were
also constructed (designated as pDUAL-FFH1 for
example, i.e. a letter c is removed from the parent
plasmid).
The weakened versions of the nmt1 pro-
moter (Basi et al., 1993) were amplified by PCR
using SpeI-Sal I-Pnmt-R2 (CCACTAGTCGACGC-
TAGCTTTAACAAAGCGACTATAAG) and NotI-
ApaI-ura4-R as primers, and pREP41 or pREP81
(Maundrell, 1993) as a template, respectively,
digested with SphI and Sal I, and ligated for the
replacement of the nmt1 promoter of the pDUAL
or pDUAL2 derivatives.
Cloning and expression of the clc1 gene
The clc1 ORF was cloned from the wild-type
strain JY3 with the Gateway system using a set
of primers: SPBC9B6.08.Fd (AAAAAGCAGGCT-
CTCATATGTCTCAATTTCCGGCTTT) and SPB-
C9B6.08.Rv (AGAAAGCTGGGTAAGAA-
GAAGAGGATACAGTT). The insert cloned in
pDONR201 was transferred to pDUAL-GFH1c
and pDUAL-GFH41c by the LR recombination
reaction, according to the manufacturers instruc-
tions. The resultant plasmids, named pDUAL-
GFH1-clc1 and pDUAL-GFH41-clc1, respectively,
were introduced into the ura4-D18 leu1-32 strain
MK1 with or without NotI pretreatment. Trans-
formants harbouring plasmids and integrants were
selected on SD lacking uracil and leucine, respec-
tively.
Mid-log phase cells grown as described above
were collected in a tube by centrifugation, washed
with ice-cold STOP buffer (150 mM NaCl, 50 mM
NaF, 10 mM EDTA, pH 8.0, 1 mM NaN3 ), and
stored at 80 C. These were later thawed and sus-
pended in three volumes of TNE buffer (10 mM
Tris-Cl, pH 7.8, 150 mM NaCl, 1 mM EDTA,
Yeast 2004; 21: 12891305.
Fission yeast multicopy and integration vectors
1% NonidetP-40). The cells were lysed by vig-
orously vortexing the tubes with glass beads.
The SDS-PAGE sample buffer was directly added
to the lysate and boiled for 3 min. Proteins
were separated by SDS-PAGE using a 420%
gradient polyacrylamide gel and immunoblotted
with a monoclonal anti--tubulin antibody B-5-1-
2 (Sigma) and a polyclonal anti-His-tag antibody
(MBL). The blots were subsequently treated with
an Alexa680-labelled anti-mouse IgG antibody
(Molecular Probes) and an IRDye800-labelled anti-
rabbit IgG antibody (Rockland), followed by the
detection of proteins using the Infrared Imaging
System Odyssey (LI-COR).
Chromosomal tagging of a gene using
pDUAL2-HFG1c
Introduction of the His6 -FLAG-GFP tag into the
5 -terminus of the tub1 gene was carried out
using a protocol similar to that described by
Krawchuk and Wahls (1999). A gene-targeting
fragment was generated by two rounds of PCR
using two sets of primers, viz. tub1-pro-F (AAGC-
CGGAACAAGGCTAAGAAAC) and ura4-tub1-
pro-R (CATTGGTGTTGGAACAGAATAAATTG-
GTTTGTAGTGAAGTGCGGTG); and attR1-tub1-
MF (CACAAGTTTGTACAAAAAAGCTATGA-
GAGAGATCATTTCCATTC) and tub1-MR (CAT-
AAATGTACAGTCAGCAAGGTC). First-round
PCR was carried out in a volume of 20 l using
Pyrobest DNA Polymerase (TaKaRa). Genomic
template DNA (1 g) isolated from the wild-
type strain JY3 was used. Twenty-five cycles of
PCR were carried out (94 C for 15 s, 52 C for
15 s, and 72 C for 50 s). The PCR products
were gel-extracted, purified and dissolved in 15 l
water.
The second-round PCR was carried out in a vol-
ume of 20 l and contained 1 l each PCR product
from the first round of PCR, 0.25 M primers, viz.
tub1-pro-F and tub1-MR used in the first round of
PCR. pDUAL-HFG1c (50 ng), linearized by ApaI
digestion, was used as a template. Pyrobest DNA
Polymerase was also used in this reaction. Thirty-
five cycles of PCR were carried out (94 C for 15 s,
52 C for 15 s, and 72 C for 2 min 30 s). The final
72 C cycle was extended by 3 min. Amplification
of the desired products were checked by agarose
gel electrophoresis. PCR solution (4 l) was used
for transformation of Sz. pombe without purifica-
tion of the DNA.
Copyright 2004 John Wiley & Sons, Ltd.
1293
Results and discussion
Characterization of the leu1-32 mutation
In fission yeast genetics, leu1 (Kikuchi et al., 1988)
and ura4 (Grallert et al., 1993; Grimm et al., 1988)
have been widely used as selection markers. There-
fore, we chose leu1-32 for a selection marker
rescued by chromosomal integration of the new
vectors. Since the mutation point of the leu1-32
allele was still unknown, we first cloned the leu1-
32 allele by amplifying the DNA fragment corre-
sponding to the leu1 + ORF from the AM2 strain
containing leu1-32, and identified the mutation.
Sequencing of the fragment revealed a single base
substitution (G137 A) within the leu1 + ORF
(data not shown) leading to an amino acid substitu-
tion (G46 E), the position of which had previ-
ously been roughly predicted (Keeney and Boeke,
1994; Kikuchi et al., 1988).
Construction of a new vector, pDUAL
Considering the position of the leu1-32 mutation,
we selected a region suitable for the complementa-
tion of leu1-32 when the plasmid is integrated into
the genome by homologous recombination. Since
the native leu1 promoter is required for expression
of the recombinant leu1 gene, the region about 700
bp upstream from the first ATG codon of the leu1
ORF was included in this fragment. The 3 region
of the leu1 ORF was deleted, so that the leu1
gene expressed from the plasmid could not function
properly when this plasmid was maintained extra-
chromosomally in a cell. Furthermore, the restric-
tion endonuclease NotI recognition site was created
about 250 bp downstream of the mutation point in
the leu1-32 allele, to allow targeted integration at
the chromosomal leu1 locus when this plasmid is
linearized by endonuclease digestion followed by
the introduction into the cell. Integration of this
fragment into the chromosomal leu1 locus of the
leu1-32 mutant by homologous recombination was
expected to result in leucine prototrophy (Keeney
and Boeke, 1994).
In order to use this vector as a multicopy plas-
mid in fission yeast, we included the autonomous
replication element ars1 (Maundrell et al., 1988)
and the selection marker ura4 + in the plasmid.
Extrachromosomal maintenance of this plasmid
will cause uracil prototrophy, which allows dis-
crimination between integrants and transformants
Yeast 2004; 21: 12891305.
1294 A. Matsuyama et al.

harbouring the episomal plasmid. By inserting the
ars1-ura4 + fragment into leu1 in the plasmid,
the removal of ars1-ura4 + and linearization of
the plasmid at the leu1 segment can be carried
out simultaneously. To cut out the intervening
ars1-ura4 + fragment, the restriction endonucle-
ase recognition sites were created symmetrically at
both ends of the fragment. In addition to the NotI
recognition site, the SacII and ApaI sites were also
included, since Sz. pombe genes have relatively
fewer sequences recognized by these enzymes. The
database search showed that no genes containing
the recognition sites of all of these three enzymes
exist in fission yeast. The resulting plasmid, named
pDUAL, can be maintained extrachromosomally in
a cell due to the ars1 element (Figure 1A), whereas
it can be integrated into the chromosomal leu1
locus when linearized by the restriction enzyme
digestion before introduction into the cell, by which
the ars1-ura4 + fragment is eliminated (Figure 2).
Unless Sz. pombe cells possessing the leu1-
32 allele were transformed with the pDUAL
fragment digested with restriction endonucleases,
no Leu+ transformant was obtained as expected
(Figure 3A), indicating that the leu1 gene lack-
ing its 3 -terminus cloned into the pDUAL vec-
tor cannot function properly. On the other hand,
Leu+ transformants were effectively obtained from
cells in which the linearized fragment was intro-
duced at the leu1-32 locus. These results confirm
that the successful integration of the linear frag-
ment can complement the leu phenotype. How-
ever, the ura4-D18 cells transformed with the lin-
earized fragment also gave Ura+ colonies, as well
as cells transformed with the same plasmid without
endonuclease pretreatment (Figure 3A). It seems

Figure 1. Schematic representation of the construction of the plasmids pDUAL and pDUAL2. (A) The construction of
pDUAL. Restriction sites (NotI, ApaI and SacII) required for the elimination of the ars1-ura4+ fragment to allow targeted
integration are indicated by arrowheads. Unique restriction sites in the multiple cloning site (MCS) are also indicated.
(B) The construction of pDUAL2. Restriction sites (NotI, ApaI and SacII) are indicated by arrowheads, which are required
for the elimination of the ars1 element to generate the leu1-targeting fragment. Unique restriction sites in the MCS are also
indicated. Note that the 5 region of the leu1 gene in this plasmid does not contain the authentic leu1 promoter. (C) The
construction of pDUAL and pDUAL2 derivatives. Modules for fusion of His6 , FLAG, and GFP at each end of a cloned gene
are shown. Modules were cloned into the multiple cloning sites of pDUAL and pDUAL2 (see Materials and methods).
The name of each resultant plasmid is indicated on the left. The Sz. pombe nmt1 promoter with two attenuated versions
(Basi et al., 1993) is also available (designated as pDUAL-HFF41, pDUAL-HFF81, for example). R1, the attR1 recombination
site; R2, the attR2 recombination site; and ccdB, the E. coli ccdB gene that functions as a stuffer in the Gateway cloning
system (Hartley et al., 2000). (D) Sequence of the multiple cloning sites and tags of pDUAL and pDUAL2 series vectors.
Restriction sites within these regions are shown below the nucleotide sequences. Restriction sites written in parentheses
are not unique in these vectors. One copy of the FLAG epitope of each plasmid (indicated by FLAG*) was replaced by the
sequence encoding GFP in plasmids containing the GFP moiety, such as pDUAL-GFH1. The EcoRV site is unique only in
the pDUAL2 series vectors. The initiation and termination codons in the reading frame of the tags are indicated in bold

Copyright 2004 John Wiley & Sons, Ltd. Yeast 2004; 21: 12891305.
Fission yeast multicopy and integration vectors 1295

Figure 1. Continued

likely that the Ura+ transformants were obtained ura4 + ORF could strongly reduce the number of
with the digested fragment due to the illegitimate Ura+ colonies (data not shown).
integration of the ars1-ura4 + fragment, since treat- Illegitimate integration gives a disadvantage,
ment with the StuI endonuclease that cleaves the since it may cause random insertional mutations

Copyright 2004 John Wiley & Sons, Ltd. Yeast 2004; 21: 12891305.
1296
Figure 1. Continued
(Chua et al., 2000). If both fragments are simul-
taneously integrated into chromosomes of a cell,
removal of the ura4 + fragment from the intro-
duced DNA mixture before transformation of yeast
cells should be needed. To test this possibil-
ity, we checked whether or not Leu+ transfor-
mants also contained ura4 + . The leu1-32 ura4-
D18 strain MK1 was transformed with the pDUAL
fragment digested with NotI, and the transfor-
mants were divided into two groups and grown
on media depleted of leucine and uracil, respec-
tively (Figure 3B). This experiment demonstrated
that there was no Leu+ transformant that acquired
uracil prototrophy among more than 100 trans-
formants tested (Figure 3B and data not shown).
These results suggest that the integration of these
two fragments at once into the genome seldom
takes place and that the removal of the ars1-ura4 +
fragment from the DNA mixture before transfor-
mation is unnecessary.
Proper integration can be confirmed by PCR.
By choosing an appropriate set of primers, a
positive band can be obtained only when the
Copyright 2004 John Wiley & Sons, Ltd.
A. Matsuyama et al.
introduced fragment is integrated into the proper
locus (Figure 3E). A universal primer set for any
sequences to be cloned can be used for this con-
firmation, since the region required for check-
ing by PCR is completely independent of MCS
(Figure 2C).
Using these new vectors, we tested the expres-
sion of the putative clathrin light chain gene clc1
as an example in fission yeast. The clc1 gene was
Gateway-cloned and subcloned into both pDUAL-
GFH1c and pDUAL-GFH41c (see Materials and
methods), which differ only in their promoters
(Figure 1C). We introduced these plasmids into
yeast cells in two distinct modes, episomal main-
tenance and chromosomal integration, and exam-
ined the expression of the Clc1-GFP-FLAG-His6
fusion protein. As a control, we similarly checked
the expression of GFP-FLAG-His6 alone by intro-
duction of pDUAL-GFH1, pDUAL-GFH41 and
pDUAL-GFH81 into yeast cells. As expected, the
expression levels of the Clc1-fusion and GFP pro-
teins determined by immunoblotting using anti-
His-tag or anti-FLAG antibodies were altered
Yeast 2004; 21: 12891305.
Fission yeast multicopy and integration vectors 1297

Figure 2. Strategy for chromosomal integration of a cloned gene using pDUAL. Treatment of pDUAL with the NotI (ApaI
or SacII) restriction enzyme at the position indicated by arrowheads releases the ars1-ura4+ fragment from the plasmid,
resulting in generation of the leu1-targeting fragment (A). The resultant fragment introduced into yeast cells is expected to
be integrated into the chromosomal leu1 locus by the homologous recombination (B), which is expected to confer leucine
prototrophy on the leu1-32 mutants (C). Integration of the fragment at the proper locus can be confirmed by PCR using a
set of primers indicated by arrowheads (see also Figure 3E). The schematic diagrams are not to scale

depending on the promoter activity and the mode of
introduction (Figure 4A), which were repressed in
the presence of thiamine (data not shown). We also
analysed localization of each product expressed
under the control of the medium-strength nmt1 pro-
moter using fluorescence microscopy (Figure 4B).
This analysis clearly demonstrated that GFP fluo-
rescence observed in cells expressing each protein
in the integration mode was exclusively uniform,
while the fluorescence intensity varied probably
due to difference in the copy number of plasmids in
an individual cell when transgenes were expressed
from the multicopy plasmids. Similar patterns of
localization were obtained when each gene was
expressed under other versions of the nmt1 pro-
moter with different strength, although the expres-
sion levels of each gene were varied depending on
the strength of the promoter used. These results
indicated that while expression of a cloned gene
from a multicopy plasmid results in the high yields
of the product, expression from a chromosomal
locus may be suitable for experiments that require
stable, quantitative and reliable conditions. Thus,
a series of vectors developed in this study pro-
vide a powerful biological tool for introduction and
expression of a transgene in fission yeast, which
allows selection of a suitable mode of expression
for an individual analysis.
pDUAL2, another vector for chromosomal
integration
In order to use many strains as the host for
chromosomal integration, we developed another
vector named pDUAL2, which also allows both
extrachromosomal maintenance and chromosomal
integration in one plasmid (Figure 1B).
We took the inverse strategy designed for
pDUAL (Figure 5). In this case, proper integrants
can be selected as Ura+ leu cells, whereas inte-
grants derived from transformation with pDUAL
become Leu+ (i.e. ura4 is irrelevant). Taking this

Copyright 2004 John Wiley & Sons, Ltd. Yeast 2004; 21: 12891305.
1298 A. Matsuyama et al.

Copyright 2004 John Wiley & Sons, Ltd. Yeast 2004; 21: 12891305.
Fission yeast multicopy and integration vectors 1299

strategy, the pDUAL2 plasmid can be used for inte-
gration against Leu+ strains, although it requires
ura4-D18 as a host. To allow this selection, ars1
was positioned to intervene with the leu1 frag-
ment. Unlike pDUAL, the leu1 fragment was
incomplete at both 5 and 3 ends, which allowed
selection for proper integrants by leucine auxotro-
phy. Proper integrants cannot be selected directly
from Ura+ transformants, since the pDUAL2 inte-
grants become Ura+ as well as cells harbouring
the pDUAL2 plasmid (Figure 3C) in an episomal
fashion. This property may be a drawback in cases
where an integrated fragment loops out from the
chromosome. Therefore, checking for a leucine
requirement of a transformant would be needed to
select proper integrants (Figure 3D), since the leu1
gene may be separated in two fragments, both of
which are expected to lose their function by the
insertion of pDUAL2 (Figure 5C). Confirmation of
integration at the proper locus could also be carried
out by PCR (Figure 3E), as is the case for pDUAL.
Application of pDUAL2 to chromosomal
tagging
Recently, chromosomal tagging of genes has
become widely used in fission yeast as well as
in budding yeast (Bahler et al., 1998; Longtine
et al., 1998; Tasto et al., 2001; Werler et al., 2003).
Vectors used as a template for PCR have been
developed to fuse several tags at each end of
an ORF. Although tagging at the 3 -terminus of
a gene can be accomplished using a single set
of primers in the system developed by Bahler
et al. (1998), introduction of tags in combina-
tion with a promoter into the 5 -terminus of a
gene requires a specific set of primers according
to the tag to be fused. To overcome this disad-
vantage, we propose the use of pDUAL2 deriva-
tives as a PCR template for chromosomal tagging
(Figure 6). pDUAL2 has properties sufficient to
use as a template to introduce promoters and tags
upstream of an ORF. To make the vectors suit-
able for such a purpose, the nmt1 promoter and
tags, such as the His6 -FLAG2 tag, were introduced
into pDUAL2. In addition, derivatives comprised
of weakened versions of the nmt1 promoter (Basi
et al., 1993) were constructed and the His6 -FLAG-
GFP tag was used in concert (Figure 6C). To use
a universal set of primers for all versions of these
derivatives, we introduced the ccd B-Cmr cassette
downstream of the tag sequence. By inserting the
ccd B-Cmr cassette used in the Gateway system
(Hartley et al., 2000), these derivatives can also
be used for cloning a gene by the recombinase
reaction named the LR reaction. Since the ccd B-
Cmr cassette possesses the universal sequences
at each end, named attR1 and attR2 (Bushman
et al., 1985), respectively, the universal primer that
anneals to the attR1 sequence can be designed
(Figure 6E).
Using pDUAL2-HFG1c, one of the resulting
new vectors, as a template, we introduced the
His6 -FLAG-GFP tag into the 5 -terminus of the
-tubulin gene tub1 (Toda et al., 1984) as an exam-
ple. The tub1-targeting fragment containing ura4 + ,
the nmt1 promoter and the His6 -FLAG-GFP tag
was amplified by two-step PCR (Figure 6A, B).
The fission yeast cells lacking the ura4 gene were
transformed with this fragment, and the Ura+ trans-
formants were then selected. The integration of
the fragment at the chromosomal tub1 locus was
confirmed by PCR using an appropriate set of
primers (data not shown), and GFP fluorescence

Figure 3. Confirmation of successful integration of pDUAL and pDUAL2. (A) The leu1-32 ura4-D18 strain MK1 was
transformed with pDUAL with or without pretreatment by indicated restriction enzymes. Transformants were plated on
the SD medium lacking uracil or leucine. (B) Leu+ and Ura+ transformants initially selected on SD medium lacking leucine
or uracil were then streaked on SD medium lacking uracil or leucine, respectively, to check whether the simultaneous
integration of both fragments derived from pDUAL by enzyme digestion could occur in a cell. (C) The ura4-D18 strain
AM5 was transformed with pDUAL2 with or without NotI pretreatment. Transformants were then plated on SD medium
lacking uracil. (D) Ura+ transformants initially selected on SD medium lacking uracil were then streaked on SD medium in
the presence or absence of leucine. The upper four transformants of each panel were derived from the introduction of
pDUAL2, whereas the lower four were from the introduction of the pDUAL2 fragment pretreated with NotI. (E) Successful
integration of the fragments at the chromosomal leu1 locus was confirmed by PCR. Cells transformed with plasmids or
fragments (pDUAL or pDUAL2 with or without NotI pretreatment) were directly subjected to PCR using the universal
primers named ADHterm-F (CTCTTATTGACCACACCTCTACC) and leu1R (GGTCATAAAGTTGAACGGATGTCG).
The PCR products were seen only when the pDUAL or pDUAL2 fragments were successfully integrated into the
chromosomal leu1 locus. M, /EcoT14I marker

Copyright 2004 John Wiley & Sons, Ltd. Yeast 2004; 21: 12891305.
1300 A. Matsuyama et al.

Copyright 2004 John Wiley & Sons, Ltd. Yeast 2004; 21: 12891305.
Fission yeast multicopy and integration vectors 1301

Figure 5. Strategy for chromosomal integration of a cloned gene using pDUAL2. (A) The ars1 element can be cut out
of the plasmid by digestion with one of the indicated restriction enzymes, resulting in the generation of the leu1-targeting
fragment. The resulted fragment introduced in a yeast cell is expected to be integrated into the chromosomal leu1 locus
by homologous recombination (B). Unlike the case of pDUAL, transformants in which pDUAL2 was successfully integrated
should become leu (C). PCR primers for checking the successful integration are indicated by arrowheads. The schematic
diagrams are not to scale

was observed for checking whether or not the
microtubules are labelled with GFP. Microtubule-
like filamentous structures were clearly observed
in cells transformed with this fragment, suggesting
that pDUAL2 derivatives can be used as a template
sufficient for chromosomal tagging (Figure 6F).
Since we prepared a series of vectors comprised
of other versions of the nmt1 promoter and other
epitopes (Figure 1C), a gene in the genome can
be easily attached with different tags using the
same set of primers and expressed with different
strengths of promoter activity.
Importance of the amount of carrier DNA for
chromosomal integration
During this study, we noticed that the amount of
carrier DNA, such as salmon sperm DNA, used

Figure 4. Expression of epitope-tagged Clc1. (A) MK1 cells harbouring pDUAL, pDUAL-GFH1, pDUAL-GFH41,
pDUAL-GFH81, pDUAL-GFH1-clc1 or pDUAL-GFH41-clc1, and their integrants were grown in the MM medium.
The GFP-FLAG-His6 -tagged Clc1 protein and GFP were detected with an anti-His-tag antibody (left, upper panel) or an
anti-FLAG antibody (right, upper panel). The protein standard is indicated in kDa on the left. The amount of -tubulin
protein was determined as an internal control with an anti--tubulin antibody (lower panel). int, integration; mc, multicopy;
P1, the wild-type nmt1 promoter; P41, the medium-strength nmt1 promoter; and P81, the weakest version of the nmt1
promoter. (B) MK1 cells harbouring pDUAL-GFH41 or pDUAL-GFH41-clc1, and their integrants were cultured in the MM
medium. GFP fluorescence in living cells monitored using fluorescence microscopy and differential interference contrast
(DIC) images of the same areas were shown

Copyright 2004 John Wiley & Sons, Ltd. Yeast 2004; 21: 12891305.
1302 A. Matsuyama et al.

Figure 6. Chromosomal tagging of the tub1 gene using pDUAL2-HFG1c. Schematic representation of the strategy designed
for the chromosomal tagging of a gene using pDUAL2-derivatives as a template for PCR amplification of the gene-targeting
modules. Two successive PCR reactions were carried out as described in Materials and methods. The 5 - and 3 -PCR
products (A and B, respectively) were amplified using a gene-specific primer (F1 and R1, respectively) and a hybrid primer
containing both gene-specific and pDUAL2-derived DNA sequence, and gel-purified individually. Using these products,
the second-round PCR was carried out with pDUAL2-HFG1c and an excess amount of two outermost primers, namely
F1 and R1 (C), resulting in the generation of tub1-targeting fragment (D). The PCR products were directly used for the
transformation of the ura4-D18 strain MK1 to allow homologous recombination. The schematic diagrams are not to scale.
(E) Universal oligonucleotide sequences used in this system. For the primers in the second round PCR, F2 and R2 should
contain each sequence indicated at its 5 -terminus. NNN. . ...NNN indicates the oligonucleotide sequence (20 nt) specific
to each gene. (F) Fluorescence visualization of the GFP-Tub1 fusion protein. GFP fluorescence was monitored in cells
expressing the His6 -FLAG-GFP-tagged Tub1 protein grown on the MM medium at 30 C

Copyright 2004 John Wiley & Sons, Ltd. Yeast 2004; 21: 12891305.
Fission yeast multicopy and integration vectors 1303

Figure 7. Relation between transformation efficiency and the amount of carrier DNA used in the transformation of
Sz. pombe. (A) The leu1-32 ura4-D18 strain MK1 was transformed with pDUAL with or without NotI pretreatment. The
number of Leu+ integrants or transformants harbouring the plasmids (Ura+ ) transformed with the indicated amount of
carrier DNA was plotted. A ratio of integrated fragment to plasmid introduced into a cell (Leu+ : Ura+ ) was also shown
by the boxed bar. Data are the average of the scores obtained in two independent experiments. (B) Transformation
efficiencies using pDUAL (white) or pUC-Pleu1 (grey) with various amounts of carrier DNA are shown. Data are the
average of the scores obtained in two independent experiments. The error bar for each sample represents the deviation
of the two scores from the mean

in the transformation of fission yeast cells strongly
affects the integration efficiency of the linearized
pDUAL fragment. Therefore, we investigated the
relationship between the amount of carrier DNA,
efficiency of correct integration of the linearized
fragment and efficiency of the introduction of
plasmids into cells (Figure 7). The leu1-32 ura4-
D18 strain MK1 was transformed with pDUAL or
its linearized fragment in the presence of various
amounts of carrier DNA. Transformation efficiency
was estimated by counting the number of Ura+
cells, whereas integration efficiency was evaluated
by the number of Leu+ cells.
Both transformation and integration efficiencies
varied in a similar way, depending on the amount
of carrier DNA, and the best amount for the

Copyright 2004 John Wiley & Sons, Ltd. Yeast 2004; 21: 12891305.
1304
transformation and integration was determined to
be approximately 1 g/sample (Figure 7A). The
ratio of integration to plasmid introduction (Leu+ :
Ura+ ) was reduced when the amount of car-
rier DNA higher than 1 g/sample was used
(Figure 8A, boxed bar). On the other hand, the
Leu+ : Ura+ ratio was essentially unchanged as
the amount of carrier DNA decreased, even when
transformation efficiency was reduced due to the
absence of carrier DNA. It seemed possible that the
ars1-ura4 + fragment remaining in the DNA mix-
ture might function as the carrier in the absence
of salmon sperm DNA. To test this possibility,
we compared integration efficiency in the presence
or absence of the ars1-ura4 + fragment. The effi-
ciency of a plasmid pUC-Pleu1 that is identical
to pDUAL except for the lack of the ars1-ura4 +
element was examined for evaluating the contribu-
tion of the ars1-ura4 + fragment as carrier DNA.
No Leu+ integrant was obtained when cells were
transformed with pUC-Pleu1 linearized by NotI in
the absence of salmon sperm DNA, whereas a sig-
nificant number of Leu+ integrants were obtained
using pDUAL in the same conditions (Figure 7B),
strongly suggesting that the ars1-ura4 + fragment
generated by the restriction enzyme digestion func-
tions as the carrier. Thus, carrier DNA is unneces-
sary for chromosomal integration when the pDUAL
plasmid is used.
As Bahler et al. suggested, the use of the spe-
cific transformation protocol is important especially
for homologous recombination-related transforma-
tion events (Bahler et al., 1998). Although electro-
poration works well for the introduction of plas-
mids (Meilhoc et al., 1990; Suga and Hatakeyama,
2001), the protocol using lithium acetate was bet-
ter for gene disruption and chromosomal tagging
(A.M. and M.Y., unpublished results). This is prob-
ably because carrier DNA is absent in the electro-
poration protocol, although the reason why carrier
DNA is effective for chromosomal integration is
largely unknown.
In conclusion, the plasmids described here can
be used for the production of proteins encoded by
cloned genes with two modes of introduction of the
DNA into cells, viz. multicopy and chromosomal
integration. The multicopy plasmids can be read-
ily converted to the corresponding fragments for
chromosomal integration by a very simple process
of the plasmid digestion with a certain restriction
endonuclease before transformation of the yeast
Copyright 2004 John Wiley & Sons, Ltd.
A. Matsuyama et al.
cells. Combined with the nmt1 promoter system
commonly employed in fission yeast, these vectors
will serve as a valuable tool to achieve a wide range
of expressions of cloned genes, thereby facilitating
the progress of cell biology and biochemistry in
fission yeast.
Acknowledgements
We thank Dr J. H. McCusker for the pAG32 plasmid.
This work was supported in part by the CREST Research
Project, Japan Science and Technology Agency, and a
special grant for Advanced Research on Cancer, of the
Japanese Government.
References
Bahler J, Wu JQ, Longtine MS, et al. 1998. Heterologous modules
for efficient and versatile PCR-based gene targeting in
Schizosaccharomyces pombe. Yeast 14: 943951.
Basi G, Schmid E, Maundrell K. 1993. TATA box mutations in the
Schizosaccharomyces pombe nmt1 promoter affect transcription
efficiency but not the transcription start point or thiamine
repressibility. Gene 123: 131136.
Bushman W, Thompson JF, Vargas L, Landy A. 1985. Control
of directionality in lambda site-specific recombination. Science
230: 906911.
Chalfie M, Tu Y, Euskirchen G, Ward WW, Prasher DC. 1994.
Green fluorescent protein as a marker for gene expression.
Science 263: 802805.
Chua G, Taricani L, Stangle W, Young PG. 2000. Insertional
mutagenesis based on illegitimate recombination in Schizosac-
charomyces pombe. Nucleic Acids Res 28: E53.
Cottarel G, Beach D, Deuschle U. 1993. Two new multi-purpose
multicopy Schizosaccharomyces pombe shuttle vectors, pSP1
and pSP2. Curr Genet 23: 547548.
Goldstein AL, McCusker JH. 1999. Three new dominant drug
resistance cassettes for gene disruption in Saccharomyces
cerevisiae. Yeast 15: 15411553.
Grallert B, Nurse P, Patterson TE. 1993. A study of integrative
transformation in Schizosaccharomyces pombe. Mol Gen Genet
238: 2632.
Grimm C, Kohli J, Murray J, Maundrell K. 1988. Genetic
engineering of Schizosaccharomyces pombe: a system for gene
disruption and replacement using the ura4 gene as a selectable
marker. Mol Gen Genet 215: 8186.
Gutz H, Heslot H, Leupold U, Loprieno N. 1974. Schizosac-
charomyces pombe. In Handbook of Genetics, King R (ed.).
Plenum: New York.
Hartley JL, Temple GF, Brasch MA. 2000. DNA cloning
using in vitro site-specific recombination. Genome Res 10:
17881795.
Keeney JB, Boeke JD. 1994. Efficient targeted integration at leu1-
32 and ura4-294 in Schizosaccharomyces pombe. Genetics 136:
849856.
Kikuchi Y, Kitazawa Y, Shimatake H, Yamamoto M. 1988. The
primary structure of the leu1 + gene of Schizosaccharomyces
pombe. Curr Genet 14: 375379.
Yeast 2004; 21: 12891305.
Fission yeast multicopy and integration vectors
Krawchuk MD, Wahls WP. 1999. High-efficiency gene targeting
in Schizosaccharomyces pombe using a modular, PCR-based
approach with long tracts of flanking homology. Yeast 15:
14191427.
Longtine MS, McKenzie A III, Demarini DJ, et al. 1998.
Additional modules for versatile and economical PCR-based
gene deletion and modification in Saccharomyces cerevisiae.
Yeast 14: 953961.
Matsuyama A, Yabana N, Watanabe Y, Yamamoto M. 2000.
Schizosaccharomyces pombe Ste7p is required for both
promotion and withholding of the entry to meiosis. Genetics
155: 539549.
Maundrell K. 1993. Thiamine-repressible expression vectors pREP
and pRIP for fission yeast. Gene 123: 127130.
Maundrell K, Hutchison A, Shall S. 1988. Sequence analysis of
ARS elements in fission yeast. EMBO J 7: 22032209.
Meilhoc E, Masson JM, Teissie J. 1990. High efficiency transfor-
mation of intact yeast cells by electric field pulses. Biotechnol-
ogy (NY) 8: 223227.
Moreno MB, Duran A, Ribas JC. 2000. A family of multifunc-
tional thiamine-repressible expression vectors for fission yeast.
Yeast 16: 861872.
Copyright 2004 John Wiley & Sons, Ltd.
1305
Moreno S, Klar A, Nurse P. 1991. Molecular genetic analysis of
fission yeast Schizosaccharomyces pombe. Methods Enzymol
194: 795823.
Sherman F, Fink G, Hick J. 1986. Methods in Yeast Genetics:
Laboratory Course Manual. Cold Spring Harbor Laboratory
Press: New York.
Suga M, Hatakeyama T. 2001. High efficiency transformation of
Schizosaccharomyces pombe pretreated with thiol compounds
by electroporation. Yeast 18: 10151021.
Tasto JJ, Carnahan RH, McDonald WH, Gould KL. 2001. Vectors
and gene targeting modules for tandem affinity purification in
Schizosaccharomyces pombe. Yeast 18: 657662.
Toda T, Adachi Y, Hiraoka Y, Yanagida M. 1984. Identification
of the pleiotropic cell division cycle gene NDA2 as one of two
different -tubulin genes in Schizosaccharomyces pombe. Cell
37: 233242.
Werler PJ, Hartsuiker E, Carr AM. 2003. A simple Cre-loxP
method for chromosomal N-terminal tagging of essential and
non-essential Schizosaccharomyces pombe genes. Gene 304:
133141.
Yeast 2004; 21: 12891305.