Available online at www.sciencedirect.
com
ScienceDirect
A genomic view of short tandem repeats
Melissa Gymrek1,2
Short tandem repeats (STRs) are some of the fastest mutating
loci in the genome. Tools for accurately profiling STRs from
high-throughput sequencing data have enabled genome-wide
interrogation of more than a million STRs across hundreds of
individuals. These catalogs have revealed that STRs are highly
multiallelic and may contribute more de novo mutations than
any other variant class. Recent studies have leveraged these
catalogs to show that STRs play a widespread role in regulating
gene expression and other molecular phenotypes. These
analyses suggest that STRs are an underappreciated but rich
reservoir of variation that likely make significant contributions to
Mendelian diseases, complex traits, and cancer.
Addresses
1
Department of Medicine, University of California San Diego, La Jolla,
CA 92093, USA
2
Department of Computer Science and Engineering, University of
California San Diego, La Jolla, CA 92093, USA
Corresponding author: Gymrek, Melissa (mgymrek@ucsd.edu)
Current Opinion in Genetics & Development 2017, 44:916
This review comes from a themed issue on Molecular and genetic
bases of disease
Edited by Nancy Bonini, Edward Lee and Wilma Wasco
http://dx.doi.org/10.1016/j.gde.2017.01.012
0959-437X/ 2017 Elsevier Ltd. All rights reserved.
Introduction
Short tandem repeats (STRs), also known as microsatel-
lites, consist of repeating motifs of 16 base pairs (bp) and
comprise about 3% of the human genome [1]. Their
repetitive nature induces slippage events during DNA
replication that result in frequent mutations in the num-
ber of repeats. As a result, STRs exhibit mutation rates
that are orders of magnitude higher than other types of
variation [2], and thus contribute a large fraction of human
genetic variation.
A role for STRs in human disease was established over
two decades ago, with independent discoveries of trinu-
cleotide expansions resulting in Fragile X Syndrome [3,4]
and spinal and bulbar muscular atrophy [5]. Since then,
STR expansions have been implicated in dozens of dis-
orders [6]. Further work has shown that these expansions
www.sciencedirect.com
induce a variety of pathogenic effects (Figure 1), includ-
ing polyglutamine aggregation [6], hypermethylation [7],
RNA toxicity [8], and repeat associated non-ATG (RAN)
translation [9]. Smaller pathogenic repeats have also been
shown to affect RNA splicing (cystic fibrosis [10]) or
regulate gene expression (progressive myoclonus epi-
lepsy [11] and Gilbert syndrome [12]). Many of these
mechanisms are present across multiple loci, indicating
that they likely represent genome-wide phenomena.
The majority of repeat disorders identified so far follow
autosomal dominant inheritance patterns that were read-
ily identified using linkage analysis in pedigrees. How-
ever, STRs may contribute to a variety of inheritance
modes not amenable to traditional linkage techniques.
For instance, STRs are predicted to contribute a higher
number of de novo mutations per generation than any
other type of variation [13], but the role of de novo STRs in
spontaneous conditions such as autism and neurodeve-
lopmental disorders has so far not been interrogated.
Furthermore, STRs are often highly multi-allelic, and
thus may generate complex inheritance patterns not well
captured by linkage or analysis of bi-allelic single nucle-
otide polymorphisms (SNPs).
Despite the clear implication of STRs in disease, they
have been notably missing from medical sequencing
studies. Next-generation sequencing (NGS) has the
potential to profile more than a million STRs, but geno-
typing STRs from NGS has proven challenging. Thus,
STRs are often filtered from sequencing pipelines due to
their low quality calls [14,15], and even known patho-
genic STR mutations cannot be detected in most cases
[16]. The intronic GGGGCC repeat implicated in FTD
and ALS [8,17] identified via a combination of linkage
and NGS is the only exception known to the author.
Notably, this repeat was not identified through repeat-
aware genotyping methods, but rather through anoma-
lies in coverage and a cluster of erroneous SNPs result-
ing from poor sequence alignment at the expanded
repeat.
New bioinformatics tools and advances in sequencing
technologies are beginning to overcome these challenges
and are providing the first genome-wide portrait of STR
variation at a population scale. Here, I review advances
over the last several years in STR profiling and how these
are leading to an improved understanding of the role of
STRs in human traits. Finally, I comment on remaining
challenges in analyzing low complexity regions of the
genome and prospects of emerging long read technologies
to help overcome these hurdles.
Current Opinion in Genetics & Development 2017, 44:916
10 Molecular and genetic bases of disease

Figure 1

GENE REGULATION
Transcription factor binding Unusual DNA secondary structure

TF TF me3 me3 me3

TA TA TA TA A A A A AC AC AC CCG CCG CCG

Regulatory element spacing DNA hypermethylation/Heterochromatinization

TRANSCRIBED AND TRANSLATED REPEATS

Alternative splicing RNA/protein aggregates

TG TG TG AC AC AC ...CAGCAGCAG...
...GTCGTCGTC...
? Transcription
?
HnRNP L
CAGn CUGn

? RAN Translation
CAG-polyGln CUG-polyLeu
RNA hairpin AGC-polySer UGC-polyCys
GCA-polyAla GCU-polyAla
Toxic RNA and protein aggregates
Current Opinion in Genetics & Development

Mechanisms by which STRs affect phenotypes.

A schematic view of known and proposed mechanisms by which STRs might regulate gene expression and function. Top: from left to right, STRs
may form transcription factor binding sites [12,36], affect spacing between regulatory elements [38], induce unusual DNA secondary structures
such as Z-DNA [61], or modulate epigenetic properties such as DNA methylation [62] and heterochromatinzation [63]. Bottom: from left to right,
STRs may mediate effects at the RNA and protein level by modulating alternative splicing through RNA secondary structure [10], affecting RNA
protein binding sites [64], or forming toxic RNA and protein aggregates [9]. (Purple boxes = genes; black lines = DNA; red boxes = STRs; blue
circles = DNA/RNA binding proteins; gray circles = amino acids; green circles = DNA modifications).

Genotyping STRs from high-throughput
sequencing data
STRs are challenging to genotype from NGS (Figure 2).
First, short reads often do not span entire repeats, effec-
tively reducing the number of informative reads. Second,
STR variations present as large insertions or deletions
that may be difficult to align to a reference genome, and
thus introduce significant mapping bias toward shorter
alleles. Finally, PCR amplification during library prepa-
ration often introduces stutter noise in the number of
repeats at STRs.
A variety of bioinformatic methods have been developed
to overcome these challenges, many of which are sum-
marized in Table 1. Some use custom alignment tech-
niques to avoid mapping biases imposed by standard
short read aligners. One example, lobSTR, [18] rapidly
detects reads with a repetitive signature using an entropy
metric. It then aligns only non-repetitive flanking
regions of the read to the reference genome and employs
a model of STR stutter errors to determine the maxi-
mum likelihood genotype at each locus. STR-FM [19]
uses a similar technique, with an improved detection
method based on string matching that shows higher
sensitivity to pick up shorter repeats and homopolymer
runs.
Other tools, such as Repeatseq [20], save substantial run
time by using pre-existing alignments from indel-tolerant
aligners such as BWA [21]. This approach is often more
sensitive, but is highly affected by the quality of the
upstream alignments and may be strongly biased toward
shorter alleles if the aligner cannot identify large inser-
tions or deletions. The updated BWA-MEM [22] algo-
rithm exhibits higher sensitivity to larger indels, elimi-
nating much of this bias. A new generation of STR
genotyping tools uses BWA-MEM alignments as input
combined with improved error models to obtain greater
genotyping accuracy. popSTR [23] uses population
information to train locus and individual-specific error
profiles. HipSTR [24] uses a repeat-aware Hidden Mar-
kov Model to realign reads, trains locus-specific stutter
models, and uses flanking SNPs to physically phase
STRs. These methods are more computationally expen-
sive, but show more than 97% accuracy on high coverage
data against gold standard techniques.

Current Opinion in Genetics & Development 2017, 44:916 www.sciencedirect.com

 A genomic view of short tandem repeats Gymrek 11

Figure 2 genome sequencing datasets. An initial population-scale

(a)
True allele ACTACGATCACACACACAC----TGTGATCGAT
ACTACGATCACACACACAC----TGTGATCGAT
Observed ACTACGATCACACACACACAC--TGTGATCGAT
(with PCR)
ACTACGATCACACACACACACACTGTGATCGAT
ACTACGATCACACACAC------TGTGATCGAT
ACTACGATCACACACACAC----TGTGATCGAT
Observed ACTACGATCACACACACAC----TGTGATCGAT
(PCR free) ACTACGATCACACACACAC----TGTGATCGAT
ACTACGATCACACACACAC----TGTGATCGAT
(b)
Reference ACTACGATCACACACTCTCTCTCTGTGATCGAT
ACTACGATCACAC--TCTCTC--TGTGATCGAT
Input ACTACGATCACAC----TCTCTCTGTGATCGAT
alignments ACTACGATCACAC--TCTCTC--TGTGATCGAT
ACTACGATC--ACACTCTCTC--TGTGATCGAT
Repeat ACTACGATC----ACACTCTCTCTGTGATCGAT
aware ACTACGATC----ACACTCTCTCTGTGATCGAT
alignment
ACTACGATC----ACACTCTCTCTGTGATCGAT
ACTACGATC----ACACTCTCTCTGTGATCGAT
panel of STR variation profiled exonic repeats in more
than 500 exome sequencing datasets [28]. This study
found that more than 94% of repeat variants were missed
by standard variant calling pipelines. Subsequently, a
genome-wide study profiled more than 700 000 loci in
over 1000 individuals from the 1000 Genomes Project
sequenced to low coverage [29]. The combination of
higher coverage and PCR-free NGS datasets with con-
tinued advances in short read alignment and STR geno-
typing tools has led to significant improvements over
these initial catalogs. A recent study of 300 individuals
sequenced by the Simons Genome Diversity Project [30]
characterized more than a million STR loci with 92%
accuracy compared to several hundred STRs genotyped
by capillary electrophoresis. These catalogs have revealed
that STRs often exhibit more than a dozen common
alleles per locus and that each individual harbors tens
of thousands of STR variants compared to the reference
genome.

(c) Genome-wide STR catalogs will provide an important

Reference CAG100
Short reads
(e.g. Illumina)
Long reads
(e.g. PacBio)
Current Opinion in Genetics & Development
Challenges and solutions for genotyping STRs from sequencing data.
(a) PCR amplification introduces stutter errors in the number of
repeats. The first box shows example reads observed in traditional
sequencing protocols, with frequent PCR errors. The bottom shows
example reads from PCR-free data, showing greatly reduced stutter
noise. (b) Local sequence alignment is challenging at complex
repeats. The first box shows example reads aligned with a repeat
agnostic aligner. Multiple best alignments are possible, and thus
inconsistent alignments are returned. The bottom box shows example
reads realigned using a repeat-aware technique such as that used in
HipSTR [24], which aligns repeat-containing reads simultaneously and
consistently. (c) Long repeats cannot be spanned by short reads. The
first box shows example Illumina reads mapped to an STR locus with
100 copies of a CAG motif. The bottom box shows example long
reads (e.g., PacBio), which can span thousands of base pairs with a
single read. In all figures, red represents the STR and black represents
non-repetitive flanking regions. Plots do not represent real data.
Surveying STR variation at scale
Until recently, most studies of STR variation focused on
only several thousand of the more than 1 million genomic
STRs. The advent of NGS and novel STR genotyping
tools described above have allowed the first genome-wide
characterization of STR variation. These studies have
grown steadily in size, with early studies surveying just
two [25] or several [26,27] genomes, and the most recent
panels investigating hundreds to thousands of whole
resource for future medical genetics studies. First, they
provide a framework in which to interpret the relevance
of specific STR alleles observed in disease contexts.
Population-specific per-locus allele frequencies serve as
a valuable reference point for prioritizing and filtering
candidate variants, as has been successfully demonstrated
in the case of SNPs or short indels [31]. Furthermore, data
for hundreds of thousands of loci allows estimation of the
effects of sequence features on STR variability [29,30]
and accurate estimation of per-locus mutation rates as has
recently been demonstrated on the Y chromosome [13].
Thus, it is now possible to determine the significance of a
de novo mutation based on predictions of the underlying
mutation rate. Second, large STR catalogs are allowing
the first genome-wide association studies of the contri-
butions of STRs to complex traits, as described below.
Overall, these new resources will pave the way toward
including STRs in standard NGS pipelines in medical
genetics applications.
An emerging role for STRs in complex traits
Genome-wide association studies (GWAS) based on SNP
genotyping have made tremendous progress in identify-
ing genomic loci associated with disease. However, in
almost all cases, genome-wide significant hits fail to
explain a majority of trait heritability [32]. One potential
source of missing heritability lies in variants such as
STRs that are not accessible from traditional SNP arrays,
as has been hypothesized by a growing number of groups
[33,34]. Concrete examples of this phenomenon are
now being discovered. For instance, systematic dissection
of the strongest schizophrenia association signal revealed
a recurrent copy number variation (CNV) not in strong
LD with any single SNP to be the causal variant [35].

www.sciencedirect.com Current Opinion in Genetics & Development 2017, 44:916

12 Molecular and genetic bases of disease

Table 1

Tools for genome-wide profiling of short tandem repeats

Method description Language/ STR Multi Models Uses

platform ref sample PCR existing
errors alignment
STR-specific tools
lobSTR [18] Genotypes 16 bp STRs using flank-mapping and maximum C++ Y Y Y Ya
likelihood-based genotyping.
RepeatSeq [20] Genotypes 16 bp STRs using existing alignments followed C++ Y N Y Y
by Bayesian model selection.
STR-FM [19] Genotypes 16 bp STRs using flank-mapping and maximum Python/ Y N Y N
likelihood-based genotyping. Galaxy
TSSV [65] Targeted profiling of complex allelic variants in pure and Python Yb N N N
mixed genomes
popSTR [23] Genotypes 26 bp STRs using existing alignments and trains C++ Y Y Y Y
individual-specific error models
HipSTR [24] Genotypes 16 bp STRs using repeat aware realignment and C++ Y Y Y Y
learns locus-specific error models. Phases STRs onto SNP
haplotypes
TRhist [60] Detects expanded 26 bp STRs using hybrid short and long Java N N N N
read approach
VNTRseek [56] Detects minisatellites (7 bp) C Y N Y N
STR profiling in cancer
MSIseq [66] MSI decision tree classifier using existing genotype calls for R Y NA N Yc
tumor samples
MSIsensor [67] Identifies changes in length distributions of STRs in paired C++ Y NA N Y
tumor/normal samples
mSINGS [68] Identifies changes in fraction of unstable STRs for tumor vs. a Python Y NA N Y
control population
a
lobSTR has a custom alignment module, but can also genotype using alignments created from other tools.
b
TSSV reference consists of flanking sequences and a regular expression describing the target locus.
c
Uses existing genotype calls, not sequence alignments.

While most well-studied STRs lie in or near protein
coding regions, it is becoming increasingly clear that
STRs located in non-coding regions play an important
regulatory role. Dozens of single gene studies have iden-
tified STRs that control expression of nearby genes
[11,3639] via a variety of mechanisms, summarized in
Figure 1. Furthermore, genome-wide analyses revealed
that STRs are enriched in human promoter and enhancer
regions [40,41] and are a hallmark of enhancers in
Drosophila [41]. Population-scale STR catalogs com-
bined with large genomics datasets have allowed the first
systematic identification of STRs linearly associated with
gene expression and DNA methylation on a genome-
wide scale [34,42]. STRs were shown to contribute a
median of 1015% of cis heritability of gene expression
mediated by all common variants in lymphoblastoid cell
lines [34]. Taken together, these studies point to an
important regulatory role of STRs, strongly supporting
the hypothesis that they will contribute to complex traits
in humans.
Despite growing evidence that STRs contribute to the
genetic architecture of complex traits, several barriers
have prevented the integration of STRs into standard
GWAS pipelines. Because of their high mutation rates
and frequent recurrent mutations, STRs have diminished
LD with nearby SNPs [29], limiting the power of SNP-
based GWAS to detect underlying STR associations
(Figure 3) and so far precluding accurate phasing and
imputation into SNP datasets. Furthermore, high error
rates reduce power to detect associations, even when full
sequence data is available [34]. An added challenge is
determining the correct statistic to test for association
[33]. Traditional GWAS techniques assume bi-allelic
variants, and test for statistical associations between the
number of reference alleles (0, 1, or 2) and the trait of
interest. STRs often exhibit complex allelic spectra with
many common alleles, and will require different regres-
sion approaches. Future development of STR-aware
imputation and association techniques are likely to
increase our understanding of the contribution of STRs
to complex traits.
A genomic portrait of STR variability in cancer
Beyond inherited disorders, STRs have been shown to
play a critical role in certain cancers. Microsatellite insta-
bility (MSI) is a tumor phenotype seen in colorectal [43]
and other cancers [4446] in which defects in the mis-
match repair system lead to hypermutability at STR loci.
MSI has significant prognostic value [47], and may in
some cases be an actionable target [48]. It is traditionally
diagnosed based on a handful of STR markers (e.g., the
Promega Corp. or Bethesda Panel [49]). However, these
panels offer only a limited view of genomic features of

Current Opinion in Genetics & Development 2017, 44:916 www.sciencedirect.com

 A genomic view of short tandem repeats Gymrek 13

Figure 3

(a) (b)
4.0
A/G (AC)n 3.0

Phenotype
2.0
1.0 1.0
0.0
-1.0
0.8 -2.0
-3.0
-4.0
0.6
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
Power

(c) 4.0 # AC Repeats

3.0
0.4

Phenotype
2.0
1.0
0.2 0.0
-1.0
-2.0
0.0 -3.0
0.0 0.02 0.04 0.06 0.08 0.1 -4.0
AA AG GG
Effect size
SNP Genotype
Current Opinion in Genetics & Development

SNP-based GWAS is underpowered for detecting underlying STR associations.

(a) Power of a causal STR (red) vs. a linked SNP (black) to detect an underlying STR association. An STR with a mutation rate of 10 4 mutations
per generation was simulated on a SNP haplotype background. A quantitative phenotype was simulated using an additive model in which the
phenotype depends on the sum of the two STR alleles at a locus. The plot shows the power of the STR and strongest linked SNP (r2 = 0.37) to
detect an association, showing that a single SNP is often underpowered to detect STR associations. (b) and (c) show example relationships
between the causal STR (b) and the strongest linked SNP (c) and phenotype. Gray dashed lines denote the average value of the phenotype. See
Supplementary Note for simulation details.

MSI and thus suffer from limited accuracy and
resolution.
NGS now enables profiling MSI on a genome-wide scale.
Besides the STR-specific tools described above, a variety
of tools have been designed specifically to detect MSI by
comparing NGS from normal and tumor samples
(Table 1). The availability of large cancer NGS datasets
such as TCGA (http://cancergenome.nih.gov/) have pro-
vided the first genome-wide portraits of MSI in a variety
of cancer types [50,51]. These studies find that MSI
exhibits tumor type-specific mutation patterns that were
only revealed from genome-wide analyses, and show that
NGS provides highly accurate diagnoses of MSI
phenotypes.
Genome-wide STR genotyping has the potential to trans-
form applications in cancer research beyond the study of
classical MSI. For instance, STR genotyping from NGS
has proven effective for reconstructing cancer cell
lineages from single cells [52], which provides an in depth
view of a cancers evolution over time. In another exam-
ple, the fusion protein EWS-FLI1 in Ewing Sarcoma has
been shown to bind specifically to GGAA repeats [53] to
establish an oncogenic regulatory program [54]. A recent
study found a common variant disrupting a GGAA repeat
may contribute to Ewing Sarcoma susceptibility [55].
Finally, I envision repeats will soon be added to the
repertoire of variation profiled in cancer NGS studies,
potentially shedding light on an uncharacterized set of
driver mutations.
Conclusions
A recent proliferation of tools now allow fast and accurate
profiling of STRs from NGS, and are approaching quality
obtained for other variant types. These methods have led
to the generation of population-wide and genome-wide
catalogs of STR variation that are now enabling the first
large-scale studies of STRs in a variety of medical genet-
ics applications, including complex traits, Mendelian
diseases, and cancer.
Despite recent progress, important challenges remain.
STR genotyping still requires separate pipelines beyond
standard SNP and indel calling approaches, and integrat-
ing call sets across multiple variant types is challenging.
Additionally, long or complex repeats, such as those
involved in most characterized trinucleotide expansion
disorders, are still called incorrectly in most cases. Fur-
thermore, repeats with longer motif sizes (>6 bp) are
almost completely ignored by NGS algorithms [56].
Finally, most statistical genetics techniques have been
built assuming bi-allelic variants. Thus, standard statisti-
cal genetics approaches must be modified to accommo-
date variants with complex allelic spectra.

www.sciencedirect.com Current Opinion in Genetics & Development 2017, 44:916

14 Molecular and genetic bases of disease
New sequencing technologies have the potential to over-
come many of these challenges. Long-read technologies
can now sequence reads dozens of kilobases long, thus
spanning most known STR expansions [57] as well as
repeats with longer motifs. These methods as well as
synthetic long read platforms, such as 10X Genomics
[58], can also provide long-range phasing information for
reconstruction of phased haplotypes of STRs and nearby
variants that may be used for downstream imputation.
Hybrid approaches combining short and long read data
have shown promising results in accurately resolving long
and complex regions [59,60] while maintaining the per-
base accuracy afforded by short reads. As methods for
STR genotyping mature, including STRs and other
repeats in standard sequencing pipelines will add a valu-
able layer of information that will likely provide a new
reservoir of yet undiscovered disease variants.
Conflict of interest
The author has no conflict of interest to disclose.
Appendix A. Supplementary data
Supplementary data associated with this article can be
found, in the online version, at http://dx.doi.org/10.1016/j.
gde.2017.01.012.
Acknowledgements
I apologize to those whose work could not be discussed due to space
limitations. I thank Thomas Willems, Joe Gleeson, Jonathan Sebat, and
Alon Goren for helpful discussions and comments on the manuscript.
References and recommended reading
Papers of particular interest, published within the period of review,
have been highlighted as:
 of special interest
 of outstanding interest
1. Lander ES, Linton LM, Birren B, Nusbaum C, Zody MC, Baldwin J,
Devon K, Dewar K, Doyle M, FitzHugh W et al.: Initial sequencing
and analysis of the human genome. Nature 2001, 409:860-921.
2. Sun JX, Helgason A, Masson G, Ebenesersdottir SS, Li H,
Mallick S, Gnerre S, Patterson N, Kong A, Reich D et al.: A direct
characterization of human mutation based on microsatellites.
Nat Genet 2012, 44:1161-1165.
3. Kremer EJ, Pritchard M, Lynch M, Yu S, Holman K, Baker E,
Warren ST, Schlessinger D, Sutherland GR, Richards RI: Mapping
of DNA instability at the fragile X to a trinucleotide repeat
sequence p(CCG)n. Science 1991, 252:1711-1714.
4. Verkerk AJ, Pieretti M, Sutcliffe JS, Fu YH, Kuhl DP, Pizzuti A,
Reiner O, Richards S, Victoria MF, Zhang FP: Identification of a
gene (FMR-1) containing a CGG repeat coincident with a
breakpoint cluster region exhibiting length variation in fragile
X syndrome. Cell 1991, 65:905-914.
5. La Spada AR, Wilson EM, Lubahn DB, Harding AE, Fischbeck KH:
Androgen receptor gene mutations in X-linked spinal and
bulbar muscular atrophy. Nature 1991, 352:77-79.
6. Mirkin SM: Expandable DNA repeats and human disease.
Nature 2007, 447:932-940.
7. Sutcliffe JS, Nelson DL, Zhang F, Pieretti M, Caskey CT, Saxe D,
Warren ST: DNA methylation represses FMR-1 transcription in
fragile X syndrome. Hum Mol Genet 1992, 1:397-400.
Current Opinion in Genetics & Development 2017, 44:916
8. DeJesus-Hernandez M, Mackenzie IR, Boeve BF, Boxer AL,
Baker M, Rutherford NJ, Nicholson AM, Finch NA, Flynn H,
Adamson J et al.: Expanded GGGGCC hexanucleotide repeat in
noncoding region of C9ORF72 causes chromosome 9p-linked
FTD and ALS. Neuron 2011, 72:245-256.
9. Pearson CE: Repeat associated non-ATG translation initiation:
one DNA, two transcripts, seven reading frames, potentially
nine toxic entities! PLoS Genet 2011, 7:e1002018.
10. Hefferon TW, Groman JD, Yurk CE, Cutting GR: A variable
dinucleotide repeat in the CFTR gene contributes to
phenotype diversity by forming RNA secondary structures that
alter splicing. Proc Natl Acad Sci U S A 2004, 101:3504-3509.
11. Borel C, Migliavacca E, Letourneau A, Gagnebin M, Bena F,
Sailani MR, Dermitzakis ET, Sharp AJ, Antonarakis SE: Tandem
repeat sequence variation as causative cis-eQTLs for protein-
coding gene expression variation: the case of CSTB. Hum
Mutat 2012, 33:1302-1309.
12. Hsieh T-Y, Shiu T-Y, Huang S-M, Lin H-H, Lee T-C, Chen P-J,
Chu H-C, Chang W-K, Jeng K-S, Lai MMC et al.: Molecular
pathogenesis of Gilberts syndrome: decreased TATA-binding
protein binding affinity of UGT1A1 gene promoter.
Pharmacogenet Genom 2007, 17:229-236.
13. Willems T, Gymrek M, Poznik GD, Tyler-Smith C, 1000 Genomes
Project Chromosome Y Group, Erlich Y: Population-scale
sequencing data enable precise estimates of Y-STR mutation
rates. Am J Hum Genet 2016, 98:919-933.
14. Kirby A, Gnirke A, Jaffe DB, Bareova V, Pochet N, Blumenstiel B,
Ye C, Aird D, Stevens C, Robinson JT et al.: Mutations causing
medullary cystic kidney disease type 1 lie in a large VNTR in
MUC1 missed by massively parallel sequencing. Nat Genet
2013, 45:299-303.
15. Li H: Toward better understanding of artifacts in variant calling
from high-coverage samples. Bioinformatics 2014, 30:2843-
2851.
16. Keogh MJ, Chinnery PF: Next generation sequencing for
neurological diseases: new hope or new hype? Clin Neurol
Neurosurg 2013, 115:948-953.
17. Renton AE, Majounie E, Waite A, Simon-Sanchez J, Rollinson S,
Gibbs JR, Schymick JC, Laaksovirta H, van Swieten JC,
Myllykangas L et al.: A hexanucleotide repeat expansion in
C9ORF72 is the cause of chromosome 9p21-linked ALS-FTD.
Neuron 2011, 72:257-268.
18. Gymrek M, Golan D, Rosset S, Erlich Y: lobSTR: a short tandem
repeat profiler for personal genomes. Genome Res 2012,
22:1154-1162.
19. Fungtammasan A, Ananda G, Hile SE, Su MS-W, Sun C, Harris R,
Medvedev P, Eckert K, Makova KD: Accurate typing of short
tandem repeats from genome-wide sequencing data and its
applications. Genome Res 2015, 25:736-749.
20. Highnam G, Franck C, Martin A, Stephens C, Puthige A,
Mittelman D: Accurate human microsatellite genotypes from
high-throughput resequencing data using informed error
profiles. Nucleic Acids Res 2013, 41:e32.
21. Li H, Durbin R: Fast and accurate short read alignment with
Burrows-Wheeler transform. Bioinformatics 2009, 25:1754-
1760.
22. Li H: Aligning sequence reads, clone sequences and assembly
contigs with BWA-MEM. arXiv [q-bio.GN] 2013. [no volume].
23. Kristmundsdottir S, Sigurpalsdottir BD, Kehr B, Halldorsson BV:
 popSTR: population-scale detection of STR variants.
Bioinformatics 2016 http://dx.doi.org/10.1093/bioinformatics/
btw568 https://www.ncbi.nlm.nih.gov/pubmed/27591079.
This study develops a method for genotyping STRs called popSTR that
builds locus- and individual-specific error profiles by leveraging popula-
tion information. It relies on previously generated alignments, reducing
total analysis time compared to previous tools that realign raw reads.
24. Willems T, Zielinski D, Gordon A, Gymrek M, Erlich Y: Genome-
 wide profiling of heritable and de novo STR variations. bioRxiv
2016 http://dx.doi.org/10.1101/077727 http://www.biorxiv.org/
content/early/2016/09/27/077727.
www.sciencedirect.com

This paper introduces a haplotype-based tool called HipSTR for geno-
typing, phasing, and calling de novo STR variants from whole genome
sequencing data. HipSTR infers both the sequence and length of STR
alleles with 99% accuracy, far greater than previous tools.
25. Payseur BA, Jing P, Haasl RJ: A genomic portrait of human
microsatellite variation. Mol Biol Evol 2011, 28:303-312.
26. McIver LJ, Fondon JW 3rd, Skinner MA, Garner HR: Evaluation of
microsatellite variation in the 1000 Genomes Project pilot
studies is indicative of the quality and utility of the raw data
and alignments. Genomics 2011, 97:193-199.
27. ODushlaine CT, Shields DC: Marked variation in predicted and
observed variability of tandem repeat loci across the human
genome. BMC Genom 2008, 9:175.
28. McIver LJ, McCormick JF, Martin A, Fondon JW 3rd, Garner HR:
Population-scale analysis of human microsatellites reveals
novel sources of exonic variation. Gene 2013, 516:328-334.
29. Willems T, Gymrek M, Highnam G, 1000 Genomes Project
 Consortium, Mittelman D, Erlich Y: The landscape of human STR
variation. Genome Res 2014, 24:1894-1904.
This study generated the first population- and genome-wide catalog of
STR variation by profiling STRs in the 1000 Genomes Project. The catalog
provides the first genome-wide portrait of allele frequency spectra across
STRs, linkage disequilibrium between STRs and SNPs, and sequence
determinants of STR variability.
30. Mallick S, Li H, Lipson M, Mathieson I, Gymrek M, Racimo F,
 Zhao M, Chennagiri N, Nordenfelt S, Tandon A et al.: The Simons
Genome Diversity Project: 300 genomes from 142 diverse
populations. Nature 2016, 538(7624):201-206 http://dx.doi.org/
10.1038/nature18964 https://www.ncbi.nlm.nih.gov/pubmed/
27654912.
This study reports high coverage PCR-free whole genomes for 300 indi-
viduals. Supplemental Chapter 6 builds on Ref. [29] to build a deep
genome-wide catalog of STR variation with accurate individual genotypes
and including homopolymers. The catalog shows that STRs provide
detailed information about population structure.
31. Lek M, Karczewski KJ, Minikel EV, Samocha KE, Banks E,
Fennell T, ODonnell-Luria AH, Ware JS, Hill AJ, Cummings BB
et al.: Analysis of protein-coding genetic variation in 60,706
humans. Nature 2016, 536:285-291.
32. Yang J, Benyamin B, McEvoy BP, Gordon S, Henders AK,
Nyholt DR, Madden PA, Heath AC, Martin NG, Montgomery GW
et al.: Common SNPs explain a large proportion of the
heritability for human height. Nat Genet 2010, 42:565-569.
33. Press MO, Carlson KD, Queitsch C: The overdue promise of
 short tandem repeat variation for heritability. Trends Genet
2014, 30:504-512.
This paper reviews arguments that STRs likely contribute to complex trait
heritability and outlines challenges in incorporating STRs into genotype-
phenotype maps.
34. Gymrek M, Willems T, Guilmatre A, Zeng H, Markus B, Georgiev S,
 Daly MJ, Price AL, Pritchard JK, Sharp AJ et al.: Abundant
contribution of short tandem repeats to gene expression
variation in humans. Nat Genet 2016, 48:22-29.
This study performed the first genome-wide quantification of the con-
tribution of STRs to gene expression variation in humans. It found 2,060
expression associated STRs and showed that these account for 1015%
of heritability mediated by all cis variants. This and Ref. [42] show that
STRs are likely to play an important role in regulating gene expression in
cis.
35. Sekar A, Bialas AR, de Rivera H, Davis A, Hammond TR,
Kamitaki N, Tooley K, Presumey J, Baum M, Van Doren V et al.:
Schizophrenia risk from complex variation of complement
component 4. Nature 2016, 530:177-183.
36. Contente A, Dittmer A, Koch MC, Roth J, Dobbelstein M: A
polymorphic microsatellite that mediates induction of PIG3 by
p53. Nat Genet 2002, 30:315-320.
37. Gebhardt F, Zanker KS, Brandt B: Modulation of epidermal
growth factor receptor gene transcription by a polymorphic
dinucleotide repeat in intron 1. J Biol Chem 1999, 274:13176-
13180.
www.sciencedirect.com
A genomic view of short tandem repeats Gymrek 15
38. Rockman MV, Wray GA: Abundant raw material for cis-
regulatory evolution in humans. Mol Biol Evol 2002, 19:1991-
2004.
39. Shimajiri S, Arima N, Tanimoto A, Murata Y, Hamada T, Wang KY,
Sasaguri Y: Shortened microsatellite d(CA)21 sequence down-
regulates promoter activity of matrix metalloproteinase
9 gene. FEBS Lett 1999, 455:70-74.
40. Sawaya S, Bagshaw A, Buschiazzo E, Kumar P, Chowdhury S,
Black MA, Gemmell N: Microsatellite tandem repeats are
abundant in human promoters and are associated with
regulatory elements. PLoS One 2013, 8:e54710.
41. Yanez-Cuna JO, Arnold CD, Stampfel G, Boryn  LM, Gerlach D,
 Rath M, Stark A: Dissection of thousands of cell type-specific
enhancers identifies dinucleotide repeat motifs as general
enhancer features. Genome Res 2014, 24:1147-1156.
This study revealed that dinucleotide repeat motifs are highly-enriched in
enhancers in Drosophila, particularly in enhancers that are broadly active
across cell types. Initial analyses show these motifs are also enriched in
human regulatory regions, further suggesting a role of STRs in gene
regulation.
42. Quilez J, Guilmatre A, Garg P, Highnam G, Gymrek M, Erlich Y,
 Joshi RS, Mittelman D, Sharp AJ: Polymorphic tandem repeats
within gene promoters act as modifiers of gene expression
and DNA methylation in humans. Nucleic Acids Res 2016,
44:3750-3762.
This study detected associations between more than 100 STRs and
expression or DNA methylation of nearby genes. This and Ref. [34]
show that STRs are likely to play an important role in regulating gene
expression in cis.
43. Vilar E, Gruber SB: Microsatellite instability in colorectal
cancer-the stable evidence. Nat Rev Clin Oncol 2010, 7:153-162.
44. Meyer LA, Broaddus RR, Lu KH: Endometrial cancer and Lynch
syndrome: clinical and pathologic considerations. Cancer
Control 2009, 16:14-22.
45. Singer G, Kallinowski T, Hartmann A, Dietmaier W, Wild PJ,
Schraml P, Sauter G, Mihatsch MJ, Moch H: Different types of
microsatellite instability in ovarian carcinoma. Int J Cancer
2004, 112:643-646.
46. Pritchard CC, Morrissey C, Kumar A, Zhang X, Smith C, Coleman I,
Salipante SJ, Milbank J, Yu M, Grady WM et al.: Complex MSH2
and MSH6 mutations in hypermutated microsatellite unstable
advanced prostate cancer. Nat Commun 2014, 5:4988.
47. Onda M, Nakamura I, Suzuki S, Takenoshita S, Brogren CH,
Stampanoni S, Li D, Rampino N: Microsatellite instability in
thyroid cancer: hot spots, clinicopathological implications,
and prognostic significance. Clin Cancer Res 2001, 7:3444-
3449.
48. Le DT, Uram JN, Wang H, Bartlett BR, Kemberling H, Eyring AD,
Skora AD, Luber BS, Azad NS, Laheru D et al.: PD-1 blockade in
tumors with mismatch-repair deficiency. N Engl J Med 2015,
372:2509-2520.
49. Murphy KM, Zhang S, Geiger T, Hafez MJ, Bacher J, Berg KD,
Eshleman JR: Comparison of the microsatellite instability
analysis system and the Bethesda panel for the determination
of microsatellite instability in colorectal cancers. J Mol Diagn
2006, 8:305-311.
50. Kim T-M, Laird PW, Park PJ: The landscape of microsatellite
instability in colorectal and endometrial cancer genomes. Cell
2013, 155:858-868.
51. Hause RJ, Pritchard CC, Shendure J, Salipante SJ: Classification
 and characterization of microsatellite instability across
18 cancer types. Nat Med 2016, 22(11):1342-1350 http://dx.doi.
org/10.1038/nm.4191 https://www.ncbi.nlm.nih.gov/pubmed/
27694933.
This study explores the genome-wide landscape of MSI in cancer. They
find specific tumor-type specific MSI signatures, show evidence that MSI
is a continuous phenotype correlated with survival, and develop a highly
accurate MSI classifier based on whole genome sequencing data.
52. Biezuner T, Spiro A, Raz O, Amir S, Milo L, Adar R, Chapal-Ilani N,
Berman V, Fried Y, Ainbinder E et al.: A generic, cost-effective
and scalable cell lineage analysis platform. Genome Res 2016,
Current Opinion in Genetics & Development 2017, 44:916
16 Molecular and genetic bases of disease
26(11):1588-1599 http://dx.doi.org/10.1101/gr.202903.115
https://www.ncbi.nlm.nih.gov/pubmed/27558250.
53. Guillon N, Tirode F, Boeva V, Zynovyev A, Barillot E, Delattre O:
The oncogenic EWS-FLI1 protein binds in vivo GGAA
microsatellite sequences with potential transcriptional
activation function. PLoS One 2009, 4:e4932.
54. Riggi N, Knoechel B, Gillespie SM, Rheinbay E, Boulay G,
Suva ML, Rossetti NE, Boonseng WE, Oksuz O, Cook EB et al.:
EWS-FLI1 utilizes divergent chromatin remodeling
mechanisms to directly activate or repress enhancer elements
in Ewing sarcoma. Cancer Cell 2014, 26:668-681.
55. Grunewald TGP, Bernard V, Gilardi-Hebenstreit P, Raynal V,
Surdez D, Aynaud M-M, Mirabeau O, Cidre-Aranaz F, Tirode F,
Zaidi S et al.: Chimeric EWSR1-FLI1 regulates the Ewing
sarcoma susceptibility gene EGR2 via a GGAA microsatellite.
Nat Genet 2015, 47:1073-1078.
56. Gelfand Y, Hernandez Y, Loving J, Benson G: VNTRseek-a
computational tool to detect tandem repeat variants in high-
throughput sequencing data. Nucleic Acids Res 2014, 42:8884-
8894.
57. Loomis EW, Eid JS, Peluso P, Yin J, Hickey L, Rank D,
McCalmon S, Hagerman RJ, Tassone F, Hagerman PJ:
Sequencing the unsequenceable: expanded CGG-repeat
alleles of the fragile X gene. Genome Res 2013, 23:121-128.
58. Zheng GXY, Lau BT, Schnall-Levin M, Jarosz M, Bell JM,
Hindson CM, Kyriazopoulou-Panagiotopoulou S, Masquelier DA,
Merrill L, Terry JM et al.: Haplotyping germline and cancer
genomes with high-throughput linked-read sequencing. Nat
Biotechnol 2016, 34:303-311.
59. Mostovoy Y, Levy-Sakin M, Lam J, Lam ET, Hastie AR, Marks P,
Lee J, Chu C, Lin C, Dakula et al.: A hybrid approach for de novo
human genome sequence assembly and phasing. Nat Methods
2016, 13:587-590.
Current Opinion in Genetics & Development 2017, 44:916
60. Doi K, Monjo T, Hoang PH, Yoshimura J, Yurino H, Mitsui J,
Ishiura H, Takahashi Y, Ichikawa Y, Goto J et al.: Rapid detection
of expanded short tandem repeats in personal genomics using
hybrid sequencing. Bioinformatics 2014, 30:815-822.
61. Rothenburg S, Koch-Nolte F, Rich A, Haag F: A polymorphic
dinucleotide repeat in the rat nucleolin gene forms Z-DNA and
inhibits promoter activity. Proc Natl Acad Sci U S A 2001,
98:8985-8990.
62. Stoger R, Kajimura TM, Brown WT, Laird CD: Epigenetic variation
illustrated by DNA methylation patterns of the Fragile-X gene
FMR1. Hum Mol Genet 1997, 6:1791-1801.
63. Kumari D, Usdin K: Chromatin remodeling in the noncoding
repeat expansion diseases. J Biol Chem 2009, 284:7413-7417.
64. Hui J, Hung L-H, Heiner M, Schreiner S, Neumuller N, Reither G,
Haas SA, Bindereif A: Intronic CA-repeat and CA-rich elements:
a new class of regulators of mammalian alternative splicing.
EMBO J 2005, 24:1988-1998.
65. Anvar SY, van der Gaag KJ, van der Heijden JWF, Veltrop MHAM,
Vossen RHAM, de Leeuw RH, Breukel C, Buermans HPJ,
Verbeek JS, de Knijff P et al.: TSSV: a tool for characterization of
complex allelic variants in pure and mixed genomes.
Bioinformatics 2014, 30:1651-1659.
66. Huang MN, McPherson JR, Cutcutache I, Teh BT, Tan P,
Rozen SG: MSIseq: software for assessing microsatellite
instability from catalogs of somatic mutations. Sci Rep 2015,
5:13321.
67. Niu B, Ye K, Zhang Q, Lu C, Xie M, McLellan MD, Wendl MC,
Ding L: MSIsensor: microsatellite instability detection using
paired tumor-normal sequence data. Bioinformatics 2014,
30:1015-1016.
68. Salipante SJ, Scroggins SM, Hampel HL, Turner EH, Pritchard CC:
Microsatellite instability detection by next generation
sequencing. Clin Chem 2014, 60:1192-1199.
www.sciencedirect.com