Вы находитесь на странице: 1из 229

DR.JOHNF.

ASHTON

EVOLUCION
IMPASIBLE

DOCE RAZONES POR LAS QUE LA EVOLUCIN NO PUEDE


EXPLICAR EL ORIGEN DE LA VIDA SOBRE L A TIERRA
EVOLUCION
IMPOSIBLE
VOLUCION
DOCE RAZONES POR LAS QUE LA EVOLUCIN NU I V i l >1
EXPLICAR EL ORIGEN DE LA VIDA SOBRE LA 7 ILRIA

DR. JOHN F. ASHTON

Adven tus
Editorial Universitaria Iberoamericana

Asociacin
Casa Editora Av, San Martn 4555, B1604CDG Florida Oeste
Sudamericana Buenos Aires, Repblica Argentina
Evolucin imposible
12 razones por las que la Evolucin no puede explicar el origen de la vida sobre
la Tierra
John F. Ashton

Ttulo del original: Evolution Impossible: 12 Reasons Why Evolution Cannot


Explain The Origin o f Life on Earth. Publicado por New Leaf Publishing Group,
Inc., P. O. Box 726, Green Forest, Arkansas 76238, U.S.A., 2012.

Director: Gabriela S. Pepe


Traduccin: Nstor Rivera
Diseo del interior y de la tapa: Romina Genski
Ilustracin de la tapa: Shutterstock

Libro de edicin argentina


IMPRESO EN LA ARGENTINA - Printed in Argentina

Primera edicin
MMXV- 5M

Es propiedad. 2012 John F. Ashton y New Leaf Publishing Group.


2015 ACES. 2015ADVENTUS. Primera edicin en espaol con autorizacin
de los propietarios del copyright.
Queda hecho el depsito que marca la ley 11.723.

ISBN 978-987-701-443-3

Ashton, John F.
Evolucin imposible : 12 razones por las que la Evolucin no puede explicar el origen de la vida
sobre la Tierra / John F. Ashton / Dirigido por Gabriela S. Pepe. - 1a ed. - Florida : Asociacin
Casa Editora Sudamericana, 2015.
228 p. ; 21 x 14 cm.

Traduccin de: Nstor Rivera.

ISBN 978-987-701 -443-3

1. Ciencia. 2. Religin. I. Pepe, Gabriela S., dir. II. Rivera, Nstor, trad. III. Ttulo.
CDD 261.55

Se termin de imprimir el 10 de diciembre de 2015 en talleres propios (Av. San


Martn 4555, B1604CDG Florida Oeste, Buenos Aires).

Prohibida la reproduccin total o parcial de esta publicacin (texto, imgenes


y diseo), su manipulacin informtica y transmisin ya sea electrnica,
mecnica, por fotocopia u otros medios, sin permiso previo dei editor.

-10753 7-
PRLOGO........................................................................................... 7

INTRODUCCIN................................................................................ 9

CAPTUL01
LA EVOLUCIN
ES UN HECHO?.............................................................................................................. 13

CAPTULO 2
TEORA DE LA EVOLUCIN DE DARWIN ....................................................................23

CAPTULO 3
CLULAS: CASUALIDAD IMPOSIBLE
POR QU UNA CELULA VIVA NO PUEDE APARECER POR CASUALIDAD........35

CAPTULO 4
MUTACIONES ALEATORIAS?
POR QU NO PUEDEN EVOLUCIONAR NUEVOS TIPOS DE ORGANISMOS POR
MEDIO DE MUTACIONES ALEATORIAS.................................................................. SO

CAPTULO 5
EL REGISTRO FSIL
EVIDENCIA DE EXTINCION, NO DE EVOLUCION......................................................70

CAPTULO 6
INTERMEDIARIOS EVOLUTIVOS AUSENTES
EVIDENCIAS DE QUE LA EVOLUCION NUNCA TUVO LUGAR.............................93

CAPTULO 7
DILUVIO UNIVERSAL: EVIDENCIAS GEOLGICAS.......... ..............109
CAPTULO 8
DILUVIO UNIVERSAL: EVIDENCIAS HISTRICAS

CAPTULO 9
FALENCIAS DE LA DATACIN RADIOMTRICA - I
; : ' :. : V; \
o: Ai ,.7> v . A ...

CAPTULO 10
FALENCIAS DE LA DATACIN RADIOM TRICA - II
' a a ,-; ; : d a tac :: . :. o va . e. . o:o , ; r o a .
r m ;,a .,v. j r - . T [-.-s c a r a s o. en: - t -' : - re ;...
c e a este v - s o o ce :

CAPTULO 11
LA TEORA DEL BIG BANG
NG E SA RESPALDADA DR luS L A OS OBSERVADOS................................173

CAPTUL012
CIENTFICOS NO EVOLUCIONISTAS
CIENTFICOS ALTAMENTE CALIFICADOS RECHAZAN i. A TEORIA DE LA EVOLU
CIN............................................................................................................................... 18?

CAPTULO 13
EVIDENCIAS DE LA EXISTENCIA DE DIOS
UN DIOS QUE INTERVIENE EN LA HISTORIA E INTERACTA CON LA ESPECIE
HUM ANA........................................................................................................................3 0 9

CAPTULO 14
RESUMEN
DOCE OREO LES BASADAS E E ATENDIAS LroN i pL-tct HARA RbCHAZAR LA
EVO LO O ON ...........................................220

APNDICE 227
l objetivo de la investigacin cientfica es descubrir la ver

E dad, y los cientficos, de todas las personas, deberan tener


la m ente abierta y estar dispuestos a considerar todas las
evidencias. Sin embargo, la historia nos ha demostrado que una
vez que una idea se ha arraigado, incluso los cientficos encuen
tran difcil aceptar algo que se aparte de ella. Esto es lo que ocu
rre actualmente con la Teora de la Evolucin. Esta teora se ha
convertido en un dogma o, para citar al profesor Bernard David,
en la Ley de Darwin; y cuestionarla es ignorancia y descaro
(Prof. C. D. D arlington).1
A pesar de esto, algunos cientficos tienen una actitud abierta
y, aunque adhieren a la Teora de la Evolucin, estn dispuestos
a adm itir que presenta dificultades. El Dr. John Ashton ha re
saltado estas dificultades en su libro. Debido a la infinitamente
pequea probabilidad de que la vida se forme espontneamente,
y de que las formas de vida simples den lugar a otras ms com
plejas por medio de procesos naturales de m utacin y seleccin,
ninguna persona libre de prejuicios puede, con plena concien
cia, elevar la Teora de la Evolucin a la categora de ley, o criti
car a quienes se atrevan a cuestionar el proceso evolutivo.
Si uno acepta que el proceso evolutivo presenta dificultades,
debera estar dispuesto a considerar otras interpretaciones. En
este libro, el Dr. Ashton propone explicaciones alternativas para
los datos del m undo natural que com nm ente se interpretan
dentro del marco de la Teora de la Evolucin. Lamentablemen
te, muchas personas mirarn el ttulo del libro y lo desestimarn *

Hugh Montefiore, The Probability ofGod (London: SCM Press Ltd., 1985), p. 75.
sin siquiera abrirlo. Y es que esta obra no es para quienes tengan
una m entalidad estrecha, sino para aquellos que exhiben una
m ente abierta y estn dispuestos a examinar sin prejuicios dis
tintas posibilidades en su bsqueda de la verdad. Es a este tipo
de personas a quienes recomiendo el libro del Dr. Ashton.

Profesor Em rito Warren Grubb, PhD


Facultad de Ciencias Biomdicas, Universidad de Curtin,
Perth, Australia Occidental.
ace algn tiempo, tuve una reunin con varios pro leso res tic

H una universidad australiana muy respetada. Estaban invesii-


gando sobre cruzamiento y seleccin de cultivos, y exista la
posibilidad de colaborar con ellos en un proyecto para integrar ras
gos de resistencia a enfermedades en un nuevo tipo de cereal recin
desarrollado. Las tcnicas de mejora incluan tratar las semillas con
productos qumicos que daaban su ADN. Las semillas imitantes
se germinaban, y se estudiaban en busca de cualquier rasgo benefi
cioso que pudiera haber resultado de los cambios.
El nuevo tipo de cereal, del que estbamos hablando, posea una
disparidad favorable causada por la destruccin de parte de un gen.
Esta prdida de material gentico haca que la nueva planta pro
dujera un grano con almidn menos digerible, que al ser incor
porado en la elaboracin de alimentos poda, potencialmente, ser
beneficioso para la prevencin y el control de la diabetes tipo II.
Durante el almuerzo, estuve pensando en el papel de las m u
taciones en relacin con la Teora de la Evolucin. Para que una
nueva especie evolucione a partir de un antepasado comn, debe
surgir informacin gentica nueva, presumiblemente a partir de
algn tipo de mutacin favorable. As que, mientras estbamos
sentados alrededor de la mesa, pregunt al investigador en jefe
del proyecto: Alguna vez las mutaciones han originado nueva
informacin gentica significativa?
Su respuesta fue inmediata: Por supuesto que s!
Podra darme un ejemplo?, le ped a continuacin.
Pens por un momento y respondi alargando las palabras:
Hm m m... No puedo recordar ahora mismo ningn ejemplo espe
cfico, pero pregntele a nuestro genetista... l ser capaz de darle
un ejemplo.
Horas despus, esa tarde, me encontr con el investigador su
perior de Gentica del D epartam ento de Produccin Vegetal de
la Universidad, y le plante la misma pregunta.
Su respuesta fue tan rpida como la anterior, pero completa
m ente opuesta: Nunca!
Sorprendido, continu presionando. Me explic que las m u
taciones siempre causan daos en el A D N , lo que generalmente
resulta en una prdida de informacin gentica. Dijo que no
conoca ningn caso de una m utacin, natural o provocada, que
hubiera dado lugar a nueva informacin gentica significativa.
Pens en las dos respuestas. El cientfico de ms edad y ex
periencia crea efectivamente que las m utaciones pueden pro
ducir inform acin gentica nueva. Ya que ninguno corrigi su
respuesta, me atrevera a afirmar que los dems investigadores
presentes en el almuerzo, biologos especialistas en diferentes
campos, ciclan exactamente lo mismo. Ms an, es m uy pro
bable que la mayora de los cientficos actuales que defienden
la validez de la Peora de la Evolucin piensen tam bin que
las m utaciones pueden producir nueva inform acin gentica,
que dar lugar a nuevos rasgos, de entre los cuales la seleccin
natural escoger los ms favorables para crear nuevas especies.
Pero si el genetista estuviera en lo cierto y las m utaciones no
pudieran producir nueva inform acin gentica significativa, la
evolucin sera imposible y no podra haber ocurrido.
Cuando pens en esto, decid comenzar a investigar y escribir
este libro.
Desde principios de los aos '70, cuando era investigador en el
Departamento de Qumica de la Universidad de Tasmania, he estado
estudiando las evidencias a favor y en contra de la evolucin. En aque
lla poca, un amigo mo estaba terminando su doctorado en Geoqu
mica. Un da me mostr los resultados de una datacin radiomtrica
hecha con la prueba del carbono 14, relacionada con la investigacin
de un fragmento de madera de una pala europea, parcialmente fosili
zada, encontrada en una vieja mina de oro. Los resultados del anlisis
de laboratorio estimaron una edad de 6.600 aos. Sin embargo, la
actividad minera de la zona databa de fines del siglo XIX y era im
probable que el mango de la pala estuviese hecho de una madera que
tuviera ms de unos pocos cientos de aos.
Este resultado, aparentemente incorrecto, estimul mi inters
por los mtodos de datacin radiomtrica, y por las implicaciones
asociadas para la datacin de la columna geolgica y la evolucin.
A medida que continuaba mi investigacin, me convenc de que la
Teora de la Evolucin presentaba problemas obvios, que estaban
siendo percibidos por prominentes cientficos como Sir Fred Hoyle,
un reconocido astrnomo britnico,1y el profesor E. H. Andrews,
Jefe del Departamento de Materiales en la Universidad de Londres.12
A finales de los aos '90, despus de un seminario sobre evi
dencias a favor de la Creacin, dictado en la Universidad de Ma-
cquarie, en Sdney, Australia, decid ponerme en contacto con
cientficos que defendan una visin creacionista de los orgenes y
preguntarles por qu elegan aceptar la Creacin, en oposicin a la
evolucin. Encontr sus argumentos tan reveladores y convincen
tes que edit algunas de las respuestas, y estas se convirtieron en el
libro In Six Days: 50 Scientists Explain Why They Believe in Creation
[En seis das: Cincuenta cientficos explican por qu creen en la
Creacin],3 publicado originalmente en 1999. Desde entonces, la
obra ha sido reimpresa numerosas veces, incluyendo ediciones en
alemn, italiano, espaol y coreano; adems, es citado frecuente
mente en Internet, en el contexto del debate creacin/evolucin.4
La creacin es un acto de Dios -l es la Inteligencia suprema
y, por eso, decid escribir tambin a profesores s de universida

1 Fred Hoyle y Chandra Wickramasinghe, Evolution from Space (London: J.M. Dent &
Sons, 1981), pp. 23-33.

2E. H. Andrews, God, Science and Evolution (Homebush West, New South Wales: AN-
ZEABooks, 1981).

3 John F. Ashton, ed., In Six Days: 50 Scientists Explain Why They Believe in Creation
(Oreen Forest, AR: Master Books, 2001).

4 Ver referencias a In Six Days... en, por ej.: C. Graves, The Science of Culture. Being
Human: Science, Culture and Fear, The Royal Society of New Zealand, Miscellaneous
Series, N 63 (2003); E.C. Scott y G. Branch, Antievolutionism: Changes and Continui-
ties, BioScience, vol. 53, N 3 (2003), pp. 282-285.
des seculares que se autodefinan como creyentes, pidindoles que
me explicaran por qu crean en Dios, en los milagros y en las
respuestas a las oraciones. Estos acadmicos me proporcionaron
abundantes evidencias de un Dios personal que interacta con su
creacin. Una vez ms, edit algunas de las respuestas que recib,
y el conjunto se public en 2001 bajo el ttulo The God Factor:
5 0 Scientists and Academics Explain Why They Believe in God [El
factor divino: 50 cientficos y acadmicos explican por qu creen
en Dios].5 Tambin esta obra ha sido reimpresa varias veces.
El presente libro es una continuacin de los anteriores, In Six
Days y The God Factor, y resume las evidencias cientficas en con
tra de la evolucin como mecanismo responsable de la diversidad
de la vida en la 1ierra. En l se detallan las evidencias que apoyan la
afirmacin de aquel genetista sobre la incapacidad de las mutacio
nes para producir nueva informacin gentica significativa, junto
con datos de muchas otras investigaciones que tambin se oponen
a las explicaciones clsicas de la Teora de la Evolucin. Muchos lee-
totes encontrarn esta perspectiva nueva y desafiante; no obstante,
espero que sirva, al menos, para estimular un debate mejor informa
do sobre el tema de los orgenes.

5 John F. Ashton, ed., The God Factor: 50 Scientists and Academics Explain Why They
Believe in God (Australia: HarperCollins Publishers, 2001).
LA EVOLUCION

:-: : : r e ir"

uando empiece a leer este libro, usted probablemente reac

C cionar de la misma manera que muchos otros lo han hecho


antes: Yo pensaba que estaba bien establecido cientficamen
te que toda vida sobre la Tierra, incluyendo a los seres humanos,
evolucion a partir de clulas primitivas muy simples, a lo largo de
cientos de millones de aos. Eso es lo que me ensearon en las clases
de Biologa. Cmo un cientfico en ejercicio, profesor universita
rio, puede escribir ahora un libro que afirme que existen evidencias
de que la Teora de la Evolucin es imposible?
Esta es una pregunta vlida, y trae a colacin los temas abor
dados en este libro. La mayora de los cientficos y educadores
creen que la evolucin es un hecho, simplemente porque eso es
lo que les fue enseado en todos los niveles del sistema educati
vo. La mayora de los libros de texto, las academias de ciencias,
los museos y los autores de divulgacin cientfica afirman, sin
vacilar, que la evolucin es un hecho demostrado por la ciencia.
Por ejemplo, en un libro de texto universitario sobre evolucin
ampliamente utilizado en 2007, puede leerse el siguiente enca
bezamiento destacado en negrita: La teora evolutiva explica el
hecho de la evolucin.1Los autores van an ms all, y afirman
que actualmente los cientficos comprenden el funcionamiento
de todos los procesos evolutivos y, en muchos casos, los meca
nismos por los cuales estos procesos han generado adaptacin y
divergencia en las especies.
Ln una declaracin de postura sobre la evolucin publica
da en el ao 2008, la Academia Nacional de Ciencias de Esta
dos Unidos afirm que la evolucin se considera un hecho. La
Academia sostiene que la Teora de la Evolucin est respaldada
por tantos experimentos y observaciones que los cientficos es
tn convencidos de que los componentes fundamentales de la
teora no sern refutados por nuevas evidencias cientficas.12 La
Sociedad Geolgica de Londres afirma que ha quedado estable
cido ms all de toda duda que nuestro planeta tiene, aproxi
madamente, 4.560 millones de aos, y sostiene que la vida ha
evolucionado hasta su forma actual durante un perodo de miles
de millones de aos, a causa de la variacin gentica combinada
con la seleccin natural.3
La Academia de Ciencias Australiana public un punto de vista
similar, afirmando que existe un vasto cuerpo de conocimientos
factuales (basados sobre hechos) que respalda la teora de que
los procesos naturales de la evolucin han inducido la compleji

1N. H. Barton, D. E. G. Briggs, J. A. Eisen y N. H. Patel, Evolution (Coid Spring Harbour,


NY: Coid Spring Harbour Laboratory Press, 2007), p. 81.

2 Science, Evolution and Creationism, National Academy of Sciences and Institute of Me


dicine (Washington, DC: National Academy Press, 2008), p. 11. En lnea: www.nap.edu/
catalog.php?record_id=l 1876.

3 Young Earth Creationism, Creation Science and Intelligent Design . Declaracin


de la Sociedad Geolgica de Londres (11 de abril de 2008). En lnea: www.geolsoc.org.
uk/creationism.
dad biolgica que encontramos hoy sobre la Tierra.4 De hecho,
la mayora de las academias de ciencias del m undo adhieren fir
memente a la Teora de la Evolucin. El Interacademy Panel, o
IAP, red global de academias de ciencia, public en 2006 una de
claracin sobre la enseanza de la evolucin firmada por 67 de
las academias miembros, afirmando que mltiples observaciones
y experimentos independientes han establecido como ciertos los
siguientes hechos sobre la evolucin de la vida en la Tierra:

Que la vida apareci en la Tierra hace, al menos, 2.500 millones


de aos;
Que la vida ha continuado evolucionando desde que apareci
por primera vez, lo cual est confirmado por la Paleontologa,
la Biologa y la Bioqumica modernas;
Que la estructura del cdigo gentico de todos los seres vivos
indica su origen primigenio comn.5

En esta misma lnea, la mayora de los museos de historia natural


del mundo, en sus exhibiciones, presentan la evolucin como un
hecho de la ciencia. Por ejemplo, el Instituto Smithsonian, en su
exposicin de 2009 Desde Darwin: La evolucin de la evolucin,
declaraba lo siguiente: La evolucin de los seres vivos ha estado
ocurriendo durante miles de millones de aos, y es responsable de la
deslumbrante diversidad de la vida sobre la Tierra. Eso es un hecho
(nfasis aadido).6
Cuando la institucin cientfica ms preeminente del m undo
afirma rotundam ente que la evolucin es un hecho, es razonable
que los visitantes y los medios de comunicacin lo crean. Ex

4Australian Academy of Science, Intelligent Design Is Not Science. Carta publicada en


los principales peridicos australianos (21 de octubre de 2005). En lnea: www.noanswer-
singenesis.org.au/id_archer_et_al_aust.htm.

5The Interacademy Panel on International Issues, IAP Statement on the Teaching of Evo-
lution (2006). En lnea: www.interacademies.net/File.aspx?id=6150.

6Ver: www.mnh.si.edu/exhibits/darwin/evolution.html.
pertos evolucionistas bien conocidos reafirman esta posicin. El
eminente paleontlogo Stephen J. Gould, de la Universidad de
Harvard, escribi que no negaba el hecho de la evolucin,7 y el
profesor Richard Dawkins, de la Universidad de Oxford, afirma
que el propsito de su libro sobre evolucin, publicado en 2009,
es mostrar que esta es un hecho ineludible.8
No obstante, cuando revisamos ms atentamente estas decla
raciones acerca de la evolucin, descubrimos que muchas de ellas
son meras afirmaciones hechas sin citar evidencias demostradas.
Incluso cuando se citan evidencias, estas no confirman realmente
la aseveracin. Por ejemplo, se afirma que la vida apareci espon
tneamente sobre la Tierra hace muchos millones de aos, pero
no he encontrado ningn artculo cientfico acreditado que expli
que un mecanismo plausible por el cual una clula podra surgir
de manera natural a partir de sus molculas constituyentes (un
proceso llamado abiognesis). Sin embargo, s he encontrado
muchos hallazgos cientficos que demuestran que la abiognesis
no puede ocurrir, segn explico detalladamente en el captulo 3.
O tra afirmacin comn es que toda la vida evolucion a partir
de organismos primitivos por medio de pequeos cambios acu
mulativos sometidos a la accin de la seleccin natural. Cuando
Charles Darwin propuso esta teora hace ms de 150 aos, los
cientficos de la poca conocan muy poco acerca de la extraor
dinariamente compleja maquinaria bioqumica que existe dentro
de los organismos vivos; de hecho, la bioqumica celular no ha
ba sido descubierta todava. Casi un siglo de estudios cientficos
adicionales fue necesario antes de que se descubriera el AD N , la
molcula qumica que codifica la estructura y el funcionamiento
de los innumerables tipos de clulas distintas que constituyen los
millones de organismos diferentes que habitan nuestro planeta. El

7Science and Creationism: A View jrom the National Academy o f Sciences, National Aca-
demy of Sciences (Washington, DC: National Academy Press, 1999), p. 28.

8 Richard Dawkins, The Greatest Show on Earth: The Evidence fo r Evolution (London:
Bantam Press, 2009), p. 18.
reciente desarrollo, en particular durante las ltimas tres dcadas,
de sofisticados equipos cientficos y nuevas metodologas, ha per
mitido la exploracin exhaustiva de los organismos vivientes y sus
clulas. En la actualidad, conocemos con un alto nivel de detalle la
enorme complejidad de las estructuras celulares y su bioqumica,
igual que de la informacin gentica que las codifica.
Sin embargo, no he encontrado hasta la fecha ningn artculo
publicado en una revista acreditada que proponga un mecanismo
plausible para la aparicin por azar de esa inmensa cantidad de infor
macin gentica compleja. Tampoco ningn artculo que informe de
la observacin de nueva informacin gentica significativa que haya
aparecido por azar. En otras palabras, no he podido encontrar ni una
sola publicacin cientfica en que se reporten las evidencias necesarias
para respaldar el requisito fundamental de la evolucin: que puede
surgir nueva informacin gentica significativa por medio de proce
sos aleatorios. Al contrario, existen numerosos datos publicados que
muestran que es imposible que nueva informacin gentica signifi
cativa, de alguna trascendencia para la evolucin, pueda surgir alea
toriamente. Estas evidencias se presentan en detalle en el captulo 4.
El descubrimiento de que no solamente no est demostrado
el extensamente aclamado hecho de la evolucin, sino adems
existen numerosos artculos publicados en la literatura cientfica
que lo refutan, puede ser una sorpresa para muchos lectores. Al
gunos, incluso, dudarn de que mis observaciones sean correc
tas. Despus de todo, no acabo de sealar que la mayora de los
cientficos de todo el m undo consideran que la evolucin ocurri
realmente? Cmo puedo decir ahora que ha sido refutada por es
tudios cientficos? Si es as, por qu otros cientficos no rechazan
la teora de Darwin? La respuesta es que algunos cientficos, a me
dida que han ido descubriendo las evidencias ms recientes con
respecto a la bioqumica de los organismos vivos, s estn empe
zando a cuestionar la evolucin. Sin embargo, no es fcil para los
cientficos rechazar pblicamente la evolucin, debido a la presin
que ejercen sus colegas para desacreditarlos, e incluso destituirlos,
de puestos de influencia. Un ejemplo reciente es el caso del direc
tor cientfico del Ministerio de Educacin Israel, Dr. Gavriel Avi
tal, quien fue expulsado por cuestionar la validez de la evolucin.9
El documental Expelled, No Intelligence Allowed [Expulsado, no
se admite inteligencia], producido hace unos aos, expone varios
ejemplos de persecucin y marginacin de cientficos que se han
atrevido a cuestionar las evidencias en favor de la evolucin.101
Las dudas con base cientfica sobre la Teora de la Evolucin no
son nuevas. A mediados de los aos '60, un grupo de matemti
cos desafi la credibilidad de la evolucin desde la probabilstica.
Los estudios matemticos resultantes culminaron en un simposio
sobre el anlisis de las probabilidades de que la evolucin hubiese
podido ocurrir, que fue celebrado en el Instituto Wistar, respetado
centro de investigacin biomcdica de Filadelfia, Estados Unidos.
Las presentaciones del simposio se publicaron en un documento
que fue ampliamente criticado por los bilogos.11 Estos insistieron
en que los matemticos no comprendan el funcionamiento de la
evolucin, pero no aportaron ninguna respuesta cuantitativa a los
desafos presentados por los estudios de probabilsticas.
Tambin en los aos '70, la palentologa Dra. Barbara J. Stahl,
graduada en la Universidad de Harvard, llam la atencin sobre
algunos defectos graves en las evidencias fsiles a favor de la evolu
cin.12 A mediados de los aos '80, el bilogo molecular Dr. Mi-
chael Dentn, graduado del Kings College de Londres, destac la
enorme complejidad de los sistemas biolgicos a nivel molecular, y
la ineptitud de la Teora tic la Evolucin para explicar el origen de
estos sistemas.13

9 O. Kashti, Saar Dismisses Chief Scientist for Questioning Evolution, Haaretz (5 de


octubre de 2010). Ver: www.haaretz.com.

10Ben Stein, Expelled: No Intelligence Allowed. Documental para DVD (Premise Media
Corporation, 2008). Ver: www.expelledthemovie.com.

11P. S. Moorhead y M. M. Kaplan, ed., Mathematical Challenges to the Neo-Darwinian


Interpretation of Evolution, The Wistar Institute Symposium Monograph, N 5 (Philadel-
phia, PA: Wistar Institute Press, 1967).

12 Barbara J. Stahl, Vertebrte History: Problems in Evolution (New York: McGraw-Hill,


1973).

13Michael Dentn, Evolution: A Theory in Crisis (Bethesda, MD: Adler & Adler, 1986).
En los aos '90, se aplic la recin popularizada Teora de la
Informacin al anlisis de molculas orgnicas altamente infor
mativas, y eso plante el desafo de encontrar un origen natural
para la inmensa cantidad de informacin especfica contenida en
ellas. El genoma es el plano de A D N de los seres vivos. Las cade
nas de A D N estn conformadas por pequeas piezas, llamadas
nucletidos, que deben estar colocadas en un orden especfico
para codificar correctamente las caractersticas de cada organis
mo. Las protenas, por su parte, son molculas altamente varia
bles, inrrincadamente complejas, y especficas en estructura y en
funcin. Cualquier pequea alteracin en la disposicin de los
aminocidos que las componen afecta su forma, la manera en que
estn plegadas y su funcin. El orden de sus componentes dota
al A D N y a las protenas de informacin biolgica especfica. La
informacin presente en el A D N se relaciona con la contenida en
las protenas, por medio de un cdigo altamente sofisticado. 1)e la
misma manera en que los dgitos en un cdigo de barras, el orden
debe ser el indicado o el sistema fallar. Pero de dnde provino
toda esta informacin? De un antepasado no es una respuesta
til, ya que no explica el origen ltimo de la informacin. El fra
caso de la Teora de la Evolucin al no poder explicar la fuente de
la informacin biolgica ha sido sealado por algunos tericos de
la informacin, como el Prof. Werner G itt,14 del Instituto Federal
Alemn de Fsica, y el fsico graduado en el Instituto Tecnolgico
de Massachusetts, Dr. Lee Spetner.15
En un intento por llenar esta notoria brecha en la explicacin
evolutiva de cmo los animales y las plantas desarrollaron su
asombrosa variedad y complejidad, el profesor de Biologa de la
Escuela de Medicina de Harvard, Dr. Marc W. Kirschner, y el
profesor de Biologa Celular y del Desarrollo, de la Universidad de
California, en Berkeley, John C. Gerhart, elaboraron una nueva

14Wemer Gitt, In the Beginning Was Information (Green Forest, AR: Master Books, 2006).

15Lee M. Spetner, Not By Chance: Shattering the Modern Theory ofEvolution (New York:
Judaica Press, 1997).
teora, relacionada con el moderno campo de la Epigentica, a la
que llamaron variacin facilitada. Los detalles de esta teora se
describen en el libro The Plausibility o f Life: Resolving Darwins
Dilemma [La credibilidad de la vida: Resolviendo el dilema de
Darwin], publicado por Yale University Press, en 2005.16 Estos
autores sugieren que los procesos centrales, codificados en el
A D N de un organismo y responsables de su estructura bsica, son
tan estables que son inmunes a los cambios causados por las m uta
ciones a pequea escala. Sin embargo, las mutaciones acumuladas
en el tiempo pueden ser activadas por cambios ambientales poste
riores y dar lugar a unos procesos centrales totalmente nuevos,
y a una nueva configuracin de parte del organismo. En caso de
que se demostrara que esta teora explica adecuadamente algunos
cambios en los sistemas biolgicos, aun quedara por determinar
de dnde procede la informacin gentica de los procesos centra
les originales. Los mismos autores admiten, en la conclusin del
libro, que su teora plantea numerosas preguntas sobre el origen
de los procesos centrales altamente conservados.
Otros problemas de la teora evolutiva fueron sealados por el
filsofo de la Universidad Rutgers, Dr. Jerry Fodor, quien presen
ta, en un extraordinario artculo titulado W hy Pigs D ont Have
Wings [Por qu los cerdos no tienen alas], poderosos argumentos
que afirman la incapacidad de la seleccin natural darwiniana de
ser un m otor eficaz para la evolucin de las especies.17 El artculo
del Dr. Fodor atrajo muchos comentarios de otros cientficos, por
lo que decidi continuar desarrollando sus argumentos en un li
bro ms reciente, coescrito con el Dr. Masimo Piattelli-Palmarini,
profesor de Ciencia Cognitiva de la Universidad de Arizona, titu
lado W hatD arw in Got Wrong [En lo que Darwin se equivoc].18

16 Marc W. Kirschner y John C. Gerhart, The Plausibility ofLife: Resolving Darwins Di


lemma (New Haven, CT: Yale University Press, 2005).

17Jerry Fodor, Why Pigs Don't Have Wings, London Review o f Books, vol. 29, N 20
(2007), pp. 19-22. En lnea: www.lrb.co.uk/v29/n20/jerry-fodor/why-pigs-dont-have-wings.

18 Jerry Fodor y Masimo Piattelli-Palmarini, What Darwin Got Wrong (New York: Farrar,
Straus and Giroux, 2010).
Debido a que la seleccin natural es el ncleo esencial de la teora
de Darwin, la publicacin de Fodor represent un serio desafo a la
integridad cientfica de la evolucin. Por consiguiente, en julio de
2008, 16 de los principales cientficos evolucionistas del mundo se
reunieron en el Instituto Konrad Lorenz, para investigar sobre la
evolucin y la cognicin, con la finalidad de discutir acerca de esta
seria amenaza a la ciencia evolutiva. La cobertura de la conferencia
estuvo a cargo de la periodista cientfica Suzan Mazur,19 quien en
trevist tanto a los asistentes como a otros expertos mundiales en
el campo de la Biologa Evolutiva. De entre los comentarios reco
gidos, destaca la creciente comprensin por parte de los cientficos
de que si la seleccin natural fuera rechazada y perdiera su posicin
como puntal de la evolucin, la teora de Darwin estara muerta.
Mazur cita al Dr. Jerry Fodor, diciendo: Bsicamente, no creo que
nadie sepa cmo funciona la evolucin.20
Esta declaracin se aleja bastante de las rotundas afirmaciones
de libros de texto de Biologa y de las exposiciones de los museos.
En realidad, nadie sabe cmo trabaja la evolucin porque nun
ca nadie la ha observado; la evolucin nunca ha sido observada,
ni en condiciones naturales ni en el laboratorio. Nadie ha sido
capaz de disear un experimento y conseguir que cierto tipo de
organismo evolucione en otro nuevo tipo de organismo (a menos
que deliberadamente se elimine informacin gentica o se inser
te informacin gentica procedente de otro organismo, opciones
de las cuales ninguna sera verdadera evolucin). N o disponer de
mecanismos plausibles ni de ninguna evidencia experimental para
explicar cmo ocurre la evolucin, la deja bien lejos de poder ser
considerada un hecho cientfico.
Los cientficos expertos en evolucin se enfrentan actualmente
con un grave dilema. Qu teora podra reemplazar al neo-Darwi-
nismo? Nadie lo sabe. Los evolucionistas estn buscando, a tientas,

19 Suzan Mazur, The Altenberg 16: An Expos o f the Evolution Industry (Berkeley, CA:
North Atlantic Books, 2010). En lnea: www.books.google.com/books.

20Ibd.,p. 34.
mecanismos crebles que puedan explicar la multitud y la diversidad
de formas de vida presentes en nuestra biosfera. Las entrevistas re
portadas por Susan Mazur presentan una vivida imagen de las in
certidumbres y los vehementes desacuerdos de estos cientficos, que
continan aferrndose incondicionalmente a su fe en que la evolu
cin es un hecho incuestionable de la historia. Pero, los mecanismos
internos propuestos para la evolucin se han manifestado extraor
dinariamente ineficaces, frente a los recientes descubrimientos de la
biologa molecular como los que presenta el Dr. Stephen C. Meyer,
filsofo graduado en la Universidad de Cambridge, en su recien
te libro Signature in the Cell: DNA and the Evidence fo r Intelligent
Design [La firma en la clula: el A D N y las evidencias del diseo
inteligente].21
El actual debate cientfico sobre los mecanismos de la evolucin
demuestra que la evolucin no es un hecho demostrado de la
ciencia, sino su deseo, extravagante a la luz de las evidencias
abrumadoras en contra, de que se descubrir, en algn momen
to, un proceso mecnico natural capaz de explicar cmo apareci
la vida. Segn algunos comentaristas sociales, Darwin estableci
una concepcin mecnica de la vicia orgnica en la era de las m
quinas justo tras la primera exposicin mundial de Londres en
1851, cuando la mquina devino en la principal preocupacin
de la poca.22 Esta obsesin con la cosmovisin mecnica ha
seguido dominando la ciencia hasta el da de hoy, desarrollndose
especialmente en la controversia acerca de la evolucin.
Antes de considerar ms evidencias en contra de la evolucin,
repasaremos la Teora de la Evolucin de Darwin en el prximo
captulo.

21Stephen C. Meyer, Signature in the Cell: DNA and the Evidence fo r Intelligent Design
(New York: HarperOne, 2009).

22 Geoffrey West, Charles Darwin: A Portrait (New Haven, CT: Yate University Press,
1938), p. 334. Ver tambin: A. Sandow, Social Factors in the Origin of Darwinism, The
Quarterly Review ofBioIogy, vol. 13 (1938), pp. 315-326; John C. Greene, Science, Ideo-
logy and World View (Berkeley, CA: University of California Press, 1981).
TEORIA DE LA
EVOLUCIN DE
DARWIN

1ao 2009 vio el 150 aniversario de la publicacin del libro


de Charles Darwin The Origin o f Species by Means o f Natural
Selection or The Preservation ofFavoured Races in the Struggle
fo r Life [El origen de las especies por medio de la seleccin natural,
o la preservacin de las razas favorecidas en la lucha por la vida].
En su obra, Darwin registr sus observaciones respecto de la lucha
por la supervivencia de muchas especies. Propuso que haba un
principio en la naturaleza:

Cuanto ms diversificados estn los descendientes de cual


quier especie en cuanto a estructura, constitucin y hbitos, m a
yor ventaja tendrn en la lucha por la existencia.1

1Charles Darwin, The Origin o f Species by Means o f Natural Selection or the Preservation
o f Favoured Races in the Struggle fo r Life (London: John Murray, 1859), p. 156.
En otras palabras, cuanta ms variedades de gramneas haya, ma
yor ser la cantidad de ellas que podr sobrevivir a variaciones en las
condiciones ambientales, como las precipitaciones, la temperatura
y el tipo de suelo; al haber ms probabilidades de que algunas de
ellas sobrevivan, mayor ser la probabilidad de que aumenten en
nmero y perpeten la especie. Darwin qued impresionado por la
enorme variedad de especies que existen en la naturaleza. Por ejem
plo, describi sus observaciones de una pequea rea de 90 por 120
centmetros de terreno. All, pudo identificar 20 especies de plantas,
de 18 gneros diferentes, que pertenecan a 8 rdenes. Todas ellas
estaban luchando por sobrevivir en el mismo ambiente.2
Darwin propuso la hiptesis de que las diferentes especies y
gneros surgieron de un antepasado en comn, como parte del
mecanismo de diversificacin para la supervivencia, e ilustr su
idea con el diagrama de un rbol cuyas ramas de dividen sucesi
vamente en ramas ms pequeas. 3
La parte inferior del rbol correspondera a una especie pertene
ciente a un gnero extenso. A medida que la especie se reproduce
durante generaciones, se producen diferencias sumamente leves, re
presentadas en lneas divergentes desde un punto comn. Despus
de mil generaciones (segn el mismo Darwin, diez mil generaciones
podra ser una mejor estimacin), las diferencias acumuladas entre
las dos lneas principales de la bifurcacin son suficientes como para
ser consideradas dos especies distintas. Durante las siguientes mil
generaciones, estas dos especies vuelven a bifurcarse. Despus de
miles de generaciones, el resultado es una gran cantidad de especies
divergentes. Algunas ramas se detienen sin bifurcarse, lo que repre
senta la extincin de esa variedad particular. Despus de diez niveles
de bifurcacin en este rbol hipottico de la vida (es decir, despus
de diez mil generaciones), tres nuevas especies habrn surgido, evo

2Ibd., p. 157.

3 lbd., pp. 160, 161. Ver tambin: Graham Lawton, Uprooting Darwins Tree, New
Scientist, N 2.692 (21 de enero de 2009), p. 34. En Enea: www.thedivineconspiracy.org/
Z5221S, pdf.
lucionado y llegado a ser significativamente diferentes del ancestro
original. Darwin sugiri que, despus de catorce mil generaciones,
las diferencias entre las especies seran tan importantes como para
constituir nuevos gneros.
Este concepto darwiniano de un rbol de la vida que representa
grficamente el modo en que surgieron las diferentes especies, hizo
que la idea fuese relativamente fcil de comprender. Darwin argu
ment, con xito, que las evidencias en favor de tal rbol eran obvias
en la naturaleza. Seal, por ejemplo, que todas las flores tienen
spalos, ptalos, estambres y pistilos, lo que sugiere la existencia de
un patrn original, que posteriormente se modific y diversific
para adaptarse a las necesidades de cada especie. De forma semejan
te, las extremidades anteriores de los seres humanos, los topos, los
caballos, los defines y los murcilagos estn construidas siguiendo
el mismo patrn seo, aunque el tamao y la forma de los huesos
varen de acuerdo con las distintas formas de locomocin. Asimis
mo, a pesar de la diferencia de longitud, el nmero de vrtebras del
cuello de los elefantes y de las jirafas es idntico.4
Com o explicacin para este hecho de la naturaleza, Darwin
propuso el mecanismo de la seleccin natural a travs de la su
pervivencia del ms apto. Cada nueva especie en el rbol de la
vida sera el resultado de pequeas mutaciones sucesivas que ha
bran proporcionado, a los seres que las poseen, ventajas para
sobrevivir en su entorno especfico.
El descubrimiento de un gran nmero de especies de escarabajos
sin alas en las islas de Madeira, cerca de la costa oeste de frica del
Norte, intrig a Darwin. De las 550 clases de escarabajos de las
islas, 200 carecan de alas. La proporcin de estos escarabajos era
superior en las regiones de las islas expuestas al viento, mientras que
en las reas no expuestas abundaban los escarabajos alados. Darwin
propuso que esto era un ejemplo claro de la seleccin natural en ple
no funcionamiento. Durante miles de generaciones, los escarabajos
de alas ms pequeas eran menos propensos a ser arrastrados mar

4/Wtf.,pp. 418,415,451.
adentro por el viento y, por lo tanto, sobrevivan para reproducirse.
Poco a poco, el rasgo responsable por las alas pequeas o dbiles
fue aumentando su presencia en las zonas ms expuestas al viento.5
Con el tiempo, sucesivas mutaciones exitosas, heredadas generacin
tras generacin, fueron reduciendo progresivamente el tamao de
las alas de los escarabajos, hasta dar lugar a una nueva especie. Los
escarabajos sin alas corresponderan, siguiendo la ilustracin de
Darwin, a una nueva rama en el rbol de la vida.
Mientras viajaba a bordo del H M S Beagle, Darwin ley el libro
de Charles Lyell: Principies o f Geology [Principios de Geologa],
en el que Lyell propona que los continentes se haban estado for
mando durante millones de aos mediante lentos cambios. Esta
hiptesis geolgica provea del marco de tiempo necesario para
la evolucin. Darwin, entonces, pas a aplicar su concepto del
rbol de la vida al registro fsil, argumentando que la sucesin de
fsiles mostraba la divergencia de las diferentes especies a partir
de sus antepasados comunes. Plante que el diagrama del rbol
poda explicar de que manera los gneros representados en la par
te inferior del rbol, correspondientes a fsiles de la era Silrica,
evolucionaron hasta dar lugar a nuevos gneros, representados en
la parte ms alta, algunos de los cuales han permanecido hasta la
actualidad.6
Darwin lleg a la conclusin de que toda forma de vida haba
evolucionado, por medio del mecanismo de la seleccin natural,
a partir de un nico organismo original y a lo largo de eones de
tiempo. En sus propias palabras:

Por lo tanto, debo deducir de la analoga que, probablemen


te, todos los seres orgnicos que alguna vez han vivido en esta
Tierra descienden de una nica forma primigenia, en la que la
vida vio la luz por primera vez. 7

5 Ibd., pp. 176, 177.

6 Ibd., pp. 404,405.

7 Ibd., p. 455.
Darwin propuso una teora cientfica para explicar el origen
de la diversidad biolgica, basada sobre pequeos cambios he
redables, que se habran ido acumulando hasta dar lugar a una
inmensa variedad de organismos nuevos. El hecho de que los
nuevos organismos fueran similares a sus antepasados, en forma
y en funcin, permitira que la va evolutiva pudiera ser rastrea
da en el registro fsil. Esta hiptesis, modificada posteriormente
con la incorporacin de conocimientos de gentica m oderna y
otras disciplinas, es conocida como la Teora de la Evolucin.
A lo largo de los ltimos cien aos, los bilogos han dedicado una
parte importante de sus actividades de investigacin a identificar vas
evolutivas y a completar los detalles de este rbol de la vida, desde la
supuesta forma de vida primigenia hasta las actuales. En los casos en
que una especie se ha extinguido, la rama simplemente termina sin
bifurcarse. Ejemplos particulares de ramas del rbol, tal como la va
evolutiva propuesta para la evolucin de los vertebrados, se pueden
encontrar fcilmente en los libros de texto de Biologa.
Hasta los aos '90, los avances en la investigacin sobre el r
bol de la vida se basaron, principalmente, sobre descubrimientos
vinculados con el registro fsil. Los fsiles provenientes de los es
tratos superiores se postulaban como descendientes de aquellos
encontrados en los estratos inferiores, ms antiguos. Las relacio
nes entre ambos se establecan sobre la base de semejanzas es
quelticas y fisiolgicas, conocidas como homologas, siguiendo
las lneas originalmente propuestas por Darwin.8
Desde la dcada de los 90 en adelante, la estructura del rbol
ha ido cambiando considerablemente a medida que los bilogos
reasignan sus ramas, apoyndose en datos procedentes del an
lisis gentico de organismos modernos. Los rasgos hereditarios
que constituyen las bases para establecer las relaciones evolutivas,
estn codificados en el A D N de cada organismo. Identificando
fragmentos comunes de A D N en especies diferentes, los bilo
gos intentan vincular esos organismos con un antepasado co

8 Linda R. Berg, Diana W. Martin y Eldra P. Solomon, Biology, 7 ed. (Belmont, CA:
Thomson, Brooks/Cole, 2005), pp. 341, 343, 344.
m n, y representan la conexin terica empleando un diagrama
tipo rbol. Estos diagramas son llamados rboles filogenticos.
Representaciones recientes del rbol filogentico muestran las
primeras formas de vida, de naturaleza desconocida, teniendo su
origen en el ltimo antepasado comn universal (LUCA, siglas
en ingles de Last Universal Common Ancestor), cuya naturaleza
tambin se desconoce. Del LUCA surgen, entonces, tres tipos de
organismos unicelulares: bacterias (procariotas), arqueas (sim ilares
a las bacterias) y eucariotas (clulas ms complejas, cuyo material
gentico est empaquetado en un compartimento llamado ncleo).
Se afirma que, aproximadamente 3.000 millones de aos despus
de que los primeros seres vivos se formaran, las clulas eucariotas
comenzaron a evolucionar y generaron organismos multicelulares.
Durante los siguientes 600 a 1.100 millones de aos, surgieron los
protozoos y las plantas, seguidos por amebas y hongos; posterior
mente, aparecieron los animales invertebrados, tales como gusanos,
moluscos e insectos; seguidos por los animales vertebrados, como
tiburones, peces y anfibios. A partir de estos, la ltima bifurcacin
dio lugar a reptiles y a aves en una rama, y a mamferos, incluyendo
los seres humanos, en otra.910En la pgina web del Museo Nacional
de Historia Natural del Instituto Smithsonian, se puede encontrar
un diagrama moderno del rbol de la vida que muestra la supuesta
relacin evolutiva de los seres humanos con los perros, las sangui
juelas, los hongos y la bacteria Escherichia coli.w
El concepto de que los seres hum anos descienden de otras es
pecies de primates fue explcitamente argumentado por Tilomas
H . Huxley en su libro Evidence as to M ans Place in Nature [Evi
dencias de la posicin del hom bre en la naturaleza], publicado
en 1863. Ocho aos despus, Darwin ampli estos argumentos
en su obra The Descent ofM an, and Selection in Relation to Sex
[La descendencia del hom bre, y la seleccin en relacin con el
sexo], en la que propuso, sobre la base de semejanzas anatm i

9 Lawton, ibd., pp. 34-39.

10En lnea: www.mnh.si.edu/exhibits/darwin/treeoflife.html.


cas, que el hom bre descenda de chimpancs y gorilas. Darwin
predijo que los fsiles de los antepasados ms antiguos de los
seres hum anos se encontraran en Africa, donde todava viven
estos primates. La idea de que los seres hum anos evolucionaron
a partir de los primates contina siendo un tema dom inante
en el panoram a cientfico actual. Varias investigaciones en curso
continan intentando establecer los detalles de la lnea evolutiva
que une a los grandes simios con los hum anos.11
En el mbito no cientfico, esta idea se ha popularizado gra
cias a documentales y a artculos de divulgacin que muestran
representaciones artsticas de la evolucin desde los simios hasta
los seres humanos, y a la exhibicin en los museos de ciencias na
turales de reconstrucciones con apariencia claramente humana de
supuestos eslabones perdidos, como la famosa Lucy. Lucy es
el nombre popular con que se conoce a los restos fosilizados de un
espcimen de Australopithecus afarensis, descubierto en Etiopia en
1974. En este caso concreto, estudios posteriores han demostrado
que Lucy era, en realidad, muy similar al chimpanc pigmeo o
bonobo.1112 De hecho, el Australopithecus se diferencia ms de los
simios y los humanos que los simios de los hum anos.13
Para muchos bilogos, la relacin evolutiva entre los grandes
simios y los humanos ha sido confirmada por las semejanzas
entre el A D N de ambos. En 2005 se public la secuencia com
pleta del genoma del chimpanc, y se compar con el genoma
hum ano.14 Se afirm que la similitud entre ambos era de aproxi
m adamente un 96%; este porcentaje ha resultado ser exagerado.
Es, adems, necesario clarificar el significado de sim ilitud para
no llegar a conclusiones engaosas. Por ejemplo, examinar di

11 K. Wong, The Human Pedigree, Scientific American (enero de 2009), pp. 46-48.

12A. Zihlman, Pygmy Chimps, people and the pundits, New Scientist, vol. 104, N 1.430
(15 de noviembre de 1984), pp. 39, 40.

13 C. E. Oxnard, The place of the australopithecines in human evolution: grounds for


doubt?", Natnre, vol. 258 (1975), pp. 389-395.

14The Chimpanzee Sequencing and Analysis Consortium, Initial Sequence of the Chimpan-
zee Genome and Comparison with the Human Genome, Nature, vol. 437 (2005), pp. 69-87.
rectamente el A D N no ayuda mucho. Las primeros cien pares
de bases del A D N m itocondrial del chimpac son:
gtttatgtagcttaccccctcaaagcaatacactgaaaatgtttcgacgggtttacatcacccc
ataaacaaacaggtttggtcctagcctttctattag...

Y los cien primeros pares de bases del A D N mitocondrial h u


m ano son:
gatcacaggtctatcaccctattaaccactcacgggagctctccatgcatttggtattttcgtc
tggggggtgtgcacgcgatagcattgcgagacgctg...

Teniendo en cuenta que el genoma hum ano y el del chim


panc estn ambos constituidos por ms de tres mil m il lo n e s
de pares de bases, resulta evidente la dificultad que entraa,
simplemente, el hecho de compararlos para evaluar la similitud.
El Dr. Ebersberger, junto con sus colaboradores del Centro de
Bioinformtica Intcgradora de Viena, llev a cabo un anlisis
detallado de ambos genomas, y lleg a la conclusin de que la
similitud entre humanos y chimpancs era sustancialmente infe
rior al 96%. En sus propias palabras: En aproximadamente un
23% de nuestro genoma no existe evidencia alguna de que com
partamos ascendencia gentica inmediata con nuestro pariente
vivo ms cercano, el chimpanc.15 El Dr. JeffreyTomkins, gene
tista de la Universidad Clemson, y su colega, el bilogo Dr. Je-
rry Bergman, tambin revisaron las estimaciones de la s i m i l i tu d
entre los genomas y concluyeron que es inferior al 86% .16
La similitud entre el A D N de humanos y chimpancs puede
igualmente interpretarse como una prueba de que ambas especies
fueron creadas por el mismo Diseador inteligente. Este provey
a ambas con una gran cantidad de informacin similar, necesaria

151- Ebersberger. P. Galgoczy, S. Taudien, et al., Mapping human genetic ancestry, M o


lecular Biology and Evolution, vol. 24 (2007), pp. 2.266-2.276.

16 Ver: www.creation.com/human-chimp-dna-similarity-re-evaluated. Para una revisin


ms reciente de la literatura que sugiere que la similitud real se sita alrededor de un 70%,
ver: www.creation.com/human-chimp-dna-similarity-literature
para las numerosas estructuras y funciones comunes; pero tambin
con suficiente informacin especfica (un 14% es una diferencia
importante) para otorgarles sus caractersticas nicas. A modo de
ejemplo, podemos citar las numerosas similitudes que existan entre
los primeros modelos escarabajo de Volkswagen y los automviles
Porsche. Ambos vehculos tenan motores traseros de cuatro cilin
dros opuestos horizontalmente y refrigerados por aire, dos puertas,
maletero en la parte delantera, etc., no porque evolucionaron de
un ancestro comn, sino porque ambos fueron diseados por el
mismo equipo: Ferdinand y su hijo Ferdinand Ferry Porsche. La
misma explicacin puede aplicarse a otros ejemplos de homologas
usados con frecuencia como apoyo a la Teora de la Evolucin. La
presencia de un patrn comn en las extremidades de los vertebra
dos podra tener su origen en la accin de un Diseador inteligente,
que ha adaptado una estructura bsica multifuncional a las necesi
dades especficas de cada grupo de animales.
Otras supuestas evidencias de que los humanos han evoluciona
do proceden de un concepto que predomin durante largo tiempo
en el campo de la Embriologa: la nocin de que, durante el desa
rrollo embrionario de un animal, se recapitula la historia evolutiva
de la especie. Darwin lo expres as en E l origen de las especies:

As como el desarrollo embrionario de cada especie y grupo de


especies nos muestra parcialmente la estructura de sus progenitores
ancestrales menos modificados, podemos ver claramente por qu
las antiguas formas de vidas ya extintas deberan ser similares a los
embriones de sus descendientes, es decir, a las especies actuales.17
Darwin continu diciendo:

La embriologa resulta m ucho ms interesante, cuando m i


ramos as al embrin, como una imagen ms o menos oscure
cida de la forma ancestral com n de cada grupo de animales.18

17Darwin, ibd., p. 427.

18Ibd., p. 428.
La idea de que la ontogenia (desarrollo de un organismo) re
capitula la filogenia (historia evolutiva de la especie) fue popula
rizada por el zologo alemn Ernst Haeckel. Poco despus de la
publicacin del libro de Darwin, Haeckel public, a su vez, unas
ilustraciones que comparaban los supuestos embriones de un pez,
una salamandra, una tortuga, un pollo y un ser humano. En un
determinado estadio del desarrollo, todos los embriones aparecan
representados con hendiduras branquiales similares a las de los
peces. Esto pareca indicar que todos los animales vertebrados,
incluidos los seres humanos, pasaban por un estado similar a un
pez antes de diferenciarse y adquirir las caractersticas propias de
su especie. Sugera, por lo tanto, que los peces eran los antepasa
dos del resto de los grupos. Durante ms de un siglo los dibujos
de Haeckel se utilizaron como evidencia de la evolucin, y hasta la
dcada de los aos '90 los libros de Biologa contenan ilustracio
nes de embriones humanos con hendiduras branquiales y cola.19
A mediados de los aos '90, el embrilogo Michael Richardson
recolect y fotografi los mismos tipos de embriones que Haeckel
haba dibujado. Los resultados -q u e fueron publicados en 1997
en las revistas cientficas Anatomy and Embriology y Science de
mostraban que los embriones reales eran m uy diferentes de las
ilustraciones de Haeckel. Los embriones humanos no tenan es
tructuras similares a branquias en ninguna etapa de su desarrollo.20
Aunque la teora de la recapitulacin ha quedado desacreditada
en su versin literal, y la comunidad cientfica reconoce que las ilus
traciones de Haeckel eran fraudulentas, la idea de que el desarrollo
embrionario de los vertebrados prueba de algn modo la evolucin
sigue apareciendo en algunos textos cientficos actuales. Un libro de

19 Ver, por ej.: L. R. Berg, D. W. Martn, E. P. Solomon y CJaude Villee, Biology, 3 ed.
(New York: Saunders College Publisbing, 1993), p. 402.

20M. K. Richardson, et al., There Is No Highly Conserved Embryonic Stage in the Ver
tebrales: Implications for Cuirent Theories of Evolution and Development, Anatomy and
Embryology, vol. 196 (1997), pp. 91-106; E. Pennisi, Haeckels Embryos: Fraud Redisco-
vered, Science, vol. 277 (5 de septiembre de 1997), pp. 1.435; M. K. Richardson, Haec-
kels Embryos, Continued, carta a Science, vol. 281 (28 de agosto de 1998), pp. 1.285.
texto de Biologa, publicado en 2005 y ampliamente usado en el ni
vel universitario, sostiene que los patrones del desarrollo embriol
gico demuestran que los vertebrados comparten un antepasado co
mn, y afirma que todos los embriones de los vertebrados tienen
estructuras branquiales y otras caractersticas propias de los peces. 21
En este captulo hemos analizado varias de las evidencias que se
han utilizado con el propsito de apoyar la Teora de la Evolucin
de Darwin. Hemos argumentado que las homologas pueden igual
mente explicarse como resultado de un Diseo inteligente. En el caso
de los restos fsiles utilizados para respaldar la evolucin humana,
la mayora de ellos han resultado ser claramente humanos o cla
ramente simios. Esto demuestra que las representaciones iniciales
de hombres-mono, que exageraban las caractersticas intermedias,
eran interpretaciones sesgadas con la finalidad de favorecer una ex
plicacin evolutiva. Finalmente, las ilustraciones de I laeckel son un
claro ejemplo de una importante evidencia en favor de la evolucin
que ha resultado falsa y que, sin embargo, se ha perpetuado en los
textos cientficos.
Sin embargo, la afirmacin principal de la teora de Darwin
es que, en la lucha de los seres vivos por la supervivencia, la
acumulacin de pequeos cambios hereditarios, guiada por la
seleccin natural durante un largo perodo de tiempo, puede
producir tipos de vida totalm ente nuevos. Darwin escribi, en
la conclusin de su obra:

Por lo tanto, de la guerra de la naturaleza, de la ham bruna


y la muerte, se obtiene directamente el mejor resultado que po
dramos imaginar, la produccin de animales superiores. 22

Pero ocurre esto realmente? Produce, o ha producido, algu


na vez la guerra de la naturaleza nuevos organismos superiores?
Revisaremos atentamente esta declaracin en el captulo 4. Pero

21 Berg, Martin y Solomon, Biology, 7" ed., p. 347.

22Darwin, ibd., p. 457.


antes tenemos que examinar otra afirmacin de Darwin: que to
dos los seres vivos surgieron a partir de un nico organismo prim i
genio. Si la Teora de la Evolucin no incluye ningn elemento de
creacin sobrenatural, este organismo tuvo que formarse y cobrar
vida a partir de materia inanimada y de procesos qumicos natura
les. Es posible que la vida surgiera de combinaciones aleatorias de
compuestos qumicos naturales; es decir, que estas combinaciones
hayan dado lugar al primer organismo viviente? Revisaremos la
ciencia detrs de esta quimera en el prximo captulo.
CELULAS:
CASUALIDAD
IMPOSIBLE

e qu modo comenz la vida contina siendo uno de los

D interrogantes fundamentales de la ciencia moderna. Sin


embargo, comprender cmo la primera clula viviente se
desarroll a travs de procesos fsicos y qumicos naturales hace
mucho, mucho tiempo es fundamental para la Teora de la Evolu
cin. Aunque nadie ha presentado todava una explicacin satis
factoria de cmo pudo formarse la primera clula viva, se asume
comnmente que simplemente ocurri. Tanto la abiognesis
(aparicin espontnea de la vida) como la diversificacin de la
vida por la evolucin darwiniana, se consideran actualmente he
chos comprobados, a pesar de que ninguno de los dos procesos
ha sido demostrado cientficamente. Algunos cientficos llegan,
incluso, a incluir la evolucin en la definicin de vida. Por ejem
plo, la NASA (Administracin Nacional Aeronutica y Espacial
de los Estados Unidos) define la vida como un sistema qumi
co autosostenible capaz de experimentar evolucin Darwiniana.
Esta definicin implica directamente que la evolucin es un he
cho de la ciencia tanto como lo es la vida.1 Sin embargo, si se
pudiera demostrar que es completamente imposible que un ser
vivo se forme a partir de materia inanimada nicamente a travs
de procesos naturales, la seleccin natural se quedara sin materia
prima sobre la cual actuar, y la Teora de la Evolucin por s sola
resultara incapaz de ofrecer una explicacin mecnico-naturalista
completa de cmo llegamos aqu. En este captulo estudiaremos
ms atentamente los hallazgos cientficos que demuestran que una
clula viva no puede surgir por casualidad.
La mayora de los artculos cientficos acerca de los orgenes em
piezan con la confiada aseveracin de que las clulas vivas se for
maron a s mismas hace miles de millones de aos. Por ejemplo, el
profesor de gentica de la Universidad Harvard, Jack Szostak, y su
coinvestigador, Alonso Ricardo, afirman que la primera vida surgi
de la materia no viva hace alrededor de 3.700 millones de aos.22
De forma semejante, el profesor emrito de Qumica Inorgnica de
la Universidad de Nueva Gales del Sur, Stanley Livingstone, escribe:
Parece que hace aproximadamente 3.850 millones de aos [...] las
primeras formas de vida aparecieron en los ocanos.*23Afirmaciones
similares se repiten en la mayora de los libros de ciencia. El popular
texto universitario de bioqumica de McKee y McKee sostiene: La
Tierra se form de una nube de gas y polvo csmico condensando
hace unos 4.500 millones de aos. Poco despus, la vida apareci.4

Alonso Ricardo y Jack W. Szostak, Origin of Life on Earth, Scientific American, vol.
301 (septiembre de 2009), pp. 38-45.

2Ibd.

3Stanley Livingstone. Thoughts on the Chemical Origin of life, Chemistry in Australia,


vol. 78 (diciembre 2008/enero 2009), pp. 10-12.

4Trudy McKee y James R. McKee, Biochemistry: The Molecular Basis ofLife, 3o ed. (New
York: McGraw Hill Publishers, 2003), p. 58.
Cabe preguntarse sobre qu evidencias basan estos eminentes
profesores tales afirmaciones. Analicemos sus declaraciones ms
atentamente:
De dnde proviene el clculo de estos perodos de tiempo como
unos 3.700 millones de aos atrs o hace unos 3.850 millones
de aos, en los que supuestamente tuvo lugar el origen de la vida?
Los perodos de tiempo que se remontan tan atrs se calculan
por medio de datacin radiomtrica. Esta consiste en utilizar las
tasas a las que los elementos radioactivos de ciertas rocas se trans
forman de un elemento qumico a otro, para calcular la edad de la
roca en cuestin. El clculo requiere hacer un anlisis qumico de
la roca en el presente y compararlo con la presunta composicin
de la roca en el pasado. Ntese el uso de la palabra presunta; no
hay ninguna manera de saber con certeza cul era la composicin
real de la roca en un pasado tan lejano. En realidad, no es posible
validar estos mtodos de datacin para fechas prehistricas y, por
consiguiente, los clculos derivados de la datacin radiomtrica
deben ser considerados con suma cautela. La incertidumbre aso
ciada con este mtodo se discute con mayor detalle en un captulo
posterior, pero la idea que se destaca en este punto es que los pe
rodos de tiempo de miles de millones de aos, de las afirmaciones
anteriores, son en realidad estimaciones que, a su vez, estn basa
das sobre suposiciones indemostrables.
Profundizando un poco ms, podemos sealar que los mtodos
radiomtricos referidos anteriormente corresponden a rocas volcni
cas, no a restos de seres vivos. Entonces, de qu modo pueden los
cientficos utilizar estos mtodos de modo de establecer la fecha del
origen de la vida? Lo hacen sobre la base de ms suposiciones, esta vez
referidas a los fsiles.
Los fsiles son restos conservados de organismos que vivieron
en el pasado, moldes de estos, huellas, madrigueras, deposiciones y
otras seales de actividad. Se encuentran casi siempre en lo que se
conoce como rocas sedimentarias, es decir, rocas formadas a partir
de sedimentos procedentes de otras rocas. En la deposicin de los
materiales que constituirn rocas sedimentarias suele estar involu
crada el agua, y en el caso de rocas que contienen fsiles, se requie
re que el entierro sea rpido para que el organismo se mantenga a
salvo de la descomposicin. Las rocas sedimentarias se encuentran
por todo el mundo, normalmente, en forma de capas llamadas
estratos. Dichos estratos se diferencian en su contenido fsil por
abundancia y en composicin, ya que ciertos tipos de fsiles solo
aparecen en determinadas capas, o son ms abundantes en unas ca
pas que en otras. El Gran Can del Colorado, en Atizona, Estados
Unidos, es un famoso lugar donde se pueden observar expuestos
numerosos estratos sucesivos de rocas sedimentarias.
Los gelogos asumen, a menos que haya evidencias de in
versin, que las rocas inferiores o ms profundas son las ms
antiguas. Al conjunto ordenado de los estratos presente en todo
el m undo, junto con sus fsiles caractersticos, se lo llama co
lum na geolgica. Las rocas de la parte inferior de la columna
corresponden a un perodo que los cientficos han llamado el
Precmbrico. Segn la datacin convencional, el Precmbrico
tuvo lugar entre 600 y 4.500 millones de aos atrs.
Segn se explicar en detalle ms adelante, generalmente las
rocas sedimentarias no se pueden datar por mtodos radiom-
tricos, as que, su antigedad suele calcularse a partir de la edad
estimada para las rocas volcnicas subyacentes y suprayacentes.
Sin embargo, lo ms comn es que una vez establecida la corre
lacin entre determinadas rocas sedimentarias, los fsiles que es
tas contienen y su antigedad estimada, rocas similares de otros
lugares, se daten simplemente a partir de su contenido fsil.
La bsqueda de las primeras formas de vida por parte de los
cientficos evolucionistas se ha concentrado en las capas inter
medias de las rocas Precmbricas, correspondientes al en Ar-
queano o Arcaico. A mediados de los aos '80, importantes re
vistas cientficas Science y N atur publicaron el descubrimiento

5 J. W. Schopf y B. M. Packer, Early Archean (3.3-Billion to 3.5-Billion-Year-Old) Mi-


crofossils from Warrawoona Group, Australia, Science, vol. 237 (1987), pp. 70-73; J. W.
Schopf. Microfossils of the Early Archean Apex Chert: New Evidence of the Antiquity
of Life , Science, vol. 260 (1993), pp. 640-646; M. M. Walsh y D. R. Lowe. Filamentous
Microfossils from the 3,500-Million-Year-Old Onverwacht Group, Barberton Mountain
Land, South Africa, Nature, vol. 314 (1985), pp. 530-532.
de fsiles filamentosos microscpicos en rocas sedimentarias de
esa poca, con una edad estimada de 3.500 millones de aos. A
pesar de que se catalogaron como las primeras formas de vida
conocidas, los cientficos afirman que los primeros organismos
vivos debieron aparecer m ucho antes: hace unos 3.700 o 3.850
millones de aos. En realidad, estas fechas son meras conjeturas,
que responden a la necesidad de perodos de tiem po suficiente
mente largos para que la Teora de la Evolucin parezca plausi
ble.
Pero colocar el origen de la vida en una era fechada hace miles
de millones de aos no explica cmo pudo empezar la vida a partir
de la materia inanimada. Existe alguna prueba cientfica que sugie
ra que la vida comenz con la formacin aleatoria de un organismo
vivo a partir de compuestos qumicos no vivos? Lo cierto es que
despus de ms de cincuenta aos de investigacin y experimen
tacin, los cientficos todava no tienen una explicacin factible ni
experimentalmente viable de cmo pudo empezar la vida. Algunos
cientficos famosos han sugerido, incluso, que la vida debi haber
llegado a la Tierra desde el espacio. Esta teora, llamada Panspermia,
fue divulgada hace unos aos por el astrnomo de la Universidad
de Cambridge, Sir Fred Hoyle; en su libro Evolution From Space
[Evolucin desde el espacio],6 reconoci la imposibilidad de que
la vida apareciera espontneamente. En fechas ms recientes, Ri
chard Dawkins, elocuente defensor de la evolucin y profesor de la
Universidad de Oxford, al ser presionado por su entrevistador, Ben
Stein, para que explicara cmo pudo haber comenzado la vida, no
pudo ofrecer ninguna explicacin mecanicista y reconoci la posi
bilidad de que la primera forma de vida llegara a nuestro planeta
procedente de algn otro lugar en el espacio.7
Podemos afirmar con seguridad que es imposible que una c
lula viva aparezca espontneamente? La respuesta es evidente, si

6Fred Hoye y Chandra Wickramasinghe, Evolution from Space (London: J.M. Dent and
Sons, 1981).

7 Ben Stein, Expelled: No Intelligence Allowed. Documental para DVD (Premise Media
Corporation, 2008). Ver: www.expelledthemovie.com.
consideramos que incluso la clula ms simple es una maravilla de
ingeniera mucho ms compleja que cualquier maquina inventada
jamas por la mente humana. Consideremos los componentes de la
bacteria Escherichia coli, un organismo unicelular que se encuentra
en el tracto gastrointestinal humano y ha sido estudiado en detalle
por los cientficos. En 1996 se public un juego de artculos en
dos tomos, con un total de 2.800 pginas, que resuma los cono
cimientos biolgicos y bioqumicos sobre este organismo hasta la
fecha. Usando estos datos, George Javor, profesor de Bioqumica
de la Universidad de Loma Linda, calcul las siguientes estadsticas:
Una sola E. coli contiene millones de molculas orgnicas (mo
lculas caractersticas de los seres vivos que no se encuentran en la
materia inerte), incluyendo 4.000 tipos de protenas, 660 tipos de
cidos nucleicos, tres tipos de polisacridos, y entre 50 y 100 tipos
de lpidos. Estas molculas funcionan de manera coordinada con
aproximadamente 800 tipos distintos de intermediarios metab-
licos y 30 tipos de minerales, que deben encontrarse en la con
centracin apropiada porque, de lo contrario, la clula morira.8
Todos estos componentes representan el 30% de la clula que,
en condiciones normales, tambin posee unos 24.000 millones
de molculas de agua. La proporcin adecuada de compuestos
orgnicos, componentes inorgnicos y agua garantiza un entorno
adecuado para las reacciones qumicas que tienen lugar dentro de
las estructuras de la clula.
Si descontamos el agua, ms del 90% de los componentes celu
lares estn formados por biopolmeros, largas molculas orgnicas
formadas a base de bloques bsicos ms pequeos. Las protenas
son largas cadenas de aminocidos, los cidos nucleicos son largas
cadenas de nucletidos y los polisacridos son largas cadenas de
molculas de azcar. Los lpidos son las molculas que forman
las grasas; aunque no son biopolmeros verdaderos, desde una

8 Clculo realizado por George T. Javor, profesor de Bioqumica de la Universidad de


Loma Linda (California, EE.UU.). Datos tomados de F. C. Neidhardt, ed., Escherichia
coli and Sdlmonella (Washington, DC: ASM Press, 1996), p. 14. Ven www.grisda.org/
origins/25002.htm.
perspectiva bioqumica pueden agregarse para formar estructuras
complejas tales como las membranas celulares. Un rasgo comn
de los biopolmeros es que los enlaces que mantienen unidos los
bloques bsicos se forman por deshidratacin, es decir, retiran
do una molcula de agua. Esta caracterstica supone un desafo
para la Teora de la Evolucin qumica, que asume el origen d
la vida en un ambiente acuoso. Aun si los bloques individuales
de los biopolmeros hubieran estado presentes, es necesario expli
car cmo pudieron formarse los enlaces qumicos necesarios para
dar lugar a cadenas mayores, si cada nuevo enlace requera perder
agua. Es extraordinariamente difcil formar nuevos enlaces qumi
cos eliminando agua en un ambiente acuoso.9
El problema de crear una clula viva va mucho ms all de la
formacin de enlaces. La funcionalidad de los biopolmeros de
pende de que los bloques se ensamblen en un orden determinado,
ya que la secuencia especfica de los bloques contiene informacin
que rige las reacciones qumicas responsables de la existencia de la
clula. Por ejemplo, la secuencia de aminocidos determina el tipo
de actividad qumica de cada protena. Hay un tipo especial de
protena llamada enzima, cuya funcin principal es servir como
catalizador de las reacciones qumicas celulares, y controlan que
estas reacciones ocurran en el momento y el lugar apropiados, y a
la velocidad necesaria; adems, al mismo tiempo, previenen otras
reacciones qumicas colaterales indeseables.
La secuencia de nucletidos en un cido nucleico, tal como el
cido desoxirribonucleico (ADN), constituye la informacin gen
tica. Esta informacin est codificada de manera tal que el A D N
contiene instrucciones precisas para la fabricacin de las protenas
que conforman las estructuras celulares, as como de los enzimas
responsables por su funcionamiento y reproduccin. El A D N est
formado por centenares de fragmentos llamados genes, respon
sables de los rasgos particulares de cada organismo. Un gen es
una cadena de miles de nucletidos, situados en un orden preciso.

9Ricardo y Szostak, ibd., pp. 41,42.


Cada nucletido est formado por una molcula de azcar, un
grupo fosfato y una base nitrogenada. Las bases nitrogenadas pre
sentes en el A D N son cuatro: adenina, guanina, citosina y timina,
comnmente conocidas por sus iniciales: A, G, C yT. En el cido
ribonucleico (ARN), en vez de la base timina, encontramos una
base similar, llamada uracilo, a la que se le asigna la letra U. Los
genes son una especie de bibliotecas celulares, donde se encuentra
la informacin necesaria para fabricar las protenas y las enzimas
celulares. Mediante el llamado cdigo gentico, la secuencia de
bases nitrogenadas de cada gencodifica una o ms protenas espe
cficas, e informa al aparato celular de construccin de protenas
sobre la secuencia precisa de aminocidos que debe ensamblarse.
El A D N de E. coli contiene 4.288 genes.10 Las funciones de
algunos de estos genes han sido identificadas del modo que se
presenta en el C uadro 1.

I I ; : ;
IMetabolismo de aminocidos 131
Biosntesis de cofactores, etc. 103
Envoltura celular 195 1
Procesos celulares 188
Metabolismo intermediario central 188
Metabolismo energtico 243
i Metabolismo de cidos grasos y lpidos 48
i Nucletidos y molculas relacionadas 58
| Funciones reguladoras 45
Reproduccin 115
Transcripcin 55
Traduccin 182
C uadro 1: funciones de algunos genes de A D N de escherichia coli.

Frederick R. Blattner, Guy Plunkett III, Craig A. Bloch, et al., The Complete Genome
Sequence of Escherichia coli K-12, Science, vol. 277 (1997), pp. 1.453-1.474.
El C uadro 1 contiene nicamente las funciones de 1.551 genes
de un total de 4.288, porque en el m om ento de la publicacin
de la secuencia gentica de E.coli, la funcin de los restantes
2.737 no haba sido identificada.
La supervivencia de un organismo unicelular tan simple como
la E. coli requiere cerca de 4.750 tipos de biopolmeros asom
brosamente complejos, que realizan aproximadamente 800 reac
ciones qumicas diferentes en forma simultnea. Cada detalle del
metabolismo y la infraestructura del organismo est codificado en
su genoma, que consta de 4,6 millones de pares de ncleotidos,
controlados indirectamente a travs de la accin de las protenas.
Puede imaginar un sistema de tal complejidad que aparezca por
casualidad y funcionando de manera correcta? Por supuesto, la /:'.
coli no es la clula ms simple conocida. La bacteria Mycoplasrna
genitalium, que vive en el tracto genital humano, tiene solamente
471 genes.11 No obstante, contina siendo imposible que su ge
noma se haya formado por casualidad; y en el caso de que haya
ocurrido milagrosamente, eso no garantizara que la clula resul
tante estuviera, de hecho, viva. Es decir:
Para que la vida hubiese podido surgir a partir de materia inani
mada, deberan haberse sintetizado en grandes cantidades miles de
molculas complejas especializadas, a partir de pequeas molculas
inorgnicas. Estas molculas inorgnicas tendran que haber interac
tuado una y otra vez al azar, hasta que, de algn modo, se formara
una estructura similar a una clula. Sin embargo, esta extraordinaria
y compleja estructura todava no estara viva. Para cobrar vida, ten
dran que iniciarse en su interior cientos de reacciones metablicas,
con los intermediarios metablicos precisos en concentraciones y
lugares exactos, para que las reacciones se dieran en forma correcta.
El sentido comn nos dice que este tipo de reacciones no ocu
rren por casualidad; adems, ni siquiera intencionadamente es
posible hacer que ocurran. Esta ltima situacin sera el equiva-1

11C. M. Fraser, J. D. Gocayne, O. White, et al., The Minimal Gene Complemenl ol My-
coplasma Genitalium, Science, vol. 270 (1995), pp. 397-403.
lente a una clula de E. coli a la que se haya eliminado reciente
mente con una gota de tolueno. Los 4.750 tipos de biopolmeros
se encontraran en su lugar y todas las rutas metablicas estaran
establecidas, pero la clula est ahora muerta a causa de la rotura
de su membrana citoplasmtica por el disolvente qumico tolue
no. Una membrana celular intacta permite a) mantener distintas
concentraciones de determinadas sustancias a uno y a otro lado de
ella; b) crear gradientes elctricos que la clula utiliza para generar
energa. La rotura de la membrana interrumpe la produccin de
energa celular y, como resultado, las reacciones celulares regresan
al equilibrio qumico, cosa que en la prctica significa la muerte
celular. Tericamente, para hacer que la compleja maquinaria ce
lular se pusiera en marcha otra vez solo tendramos que cambiar
simultneamente la concentracin de los intermediarios metab-
licos para devolverlos a las concentraciones de la fase de desequili
brio. Sabemos qu habra que hacer, pero no es posible lograrlo ni
con la mejor tecnologa; es, simplemente, imposible. Una vez que
un organismo, incluso el ms simple, est muerto, no se le puede
devolver la vida, lista es una observacin cientfica evidente.
La evolucin, sin embargo, no equivale solamente a traer a la vida a
un organismo muerto, hn primer lugar, el organismo y sus complejos
componentes y sistemas de informacin deben haberse fo rm a d o por
procesos aleatorios. Despus de esto, tendra que haber cobrado vida
rpidamente, para evitar que se empiece a descomponer o daarse
por causa de las sustancias qumicas y las radiaciones ambientales.
Resumiendo: Para dar validez cientfica a su propuesta, los defensores
de la evolucin qumica tendran que demostrar que, bajo las condi
ciones que supuestamente existan en una Tierra primigenia, tendra
que haber sido posible que:

...se formaran los biomonmeros (bloques bsicos, como ami


nocidos o nucletidos).
...se formaran los biopolmeros (protenas, cidos, nucleicos,
polisacridos) a partir de los biomonmeros.
...apareciesen las rutas metablicas interdependientes que re-
guian la produccin de los biopolmeros y la funcin celular.
...apareciese una clula completamente formada, en la que las re
acciones qumicas tuvieran lugar en la direccin apropiada, man
teniendo la clula en un estado estable de no equilibrio (viva).

Hasta el momento, los cientficos han sido capaces de repetir en


el laboratorio la mayora de las reacciones requeridas para el paso 1.
No obstante, se han encontrado con graves dificultades para lograr
reproducir el paso 2. Es cierto que se ha conseguido sintetizar algu
nos biopolmeros pequeos, pero solamente trabajando bajo con
diciones ideales y utilizando versiones de nucletidos modificadas
para aumentar su reactividad qumica. Los molculas as formadas
tenan un tamao muy inferior al de los equivalentes celulares, y su
secuencia era totalmente aleatoria y afuncional, lo que las sita muy
lejos de las complejas molculas gigantes con informacin codificada
que se requieren para la vida.12
En estos experimentos, tampoco se abord el problema del
origen de la informacin gentica. El paso 2 requiere no solo la
formacin de biopolmeros, sino tambin que dichos biopolme
ros contengan informacin codificada especfica, que les permita
interconectar las diferentes rutas metablicas y permitir a la clula
funcionar como un todo coordinado (paso 3). El modelo evolu
tivo requiere que la informacin haya sido codificada, a causa de
procesos aleatorios no dirigidos.
La probabilidad de la aparicin aleatoria de secuencias de pro
tenas o genes con informacin codificada especfica puede ser cal
culada matemticamente. Sin embargo, a fin de que estos clculos
sean significativos, tenemos que establecer cun improbable es un
evento para considerarlo imposible en la prctica. Esta pregunta ha
sido respondida por William A. Dembski, matemtico de la Uni
versidad de Chicago y autor de The Design Inference: Eliminating
Chance Through SmallProbabilities [La inferencia del diseo: Elimi
nando el azar a travs de pequeas probabilidades]. Dembski ha de

l2Ricardo y Szostak, ibd., pp. 38-45.


mostrado matemticamente que el azar puede ser eliminado como
explicacin plausible para un sistema especificado, cuando excede
los recursos probabilsticos disponibles.13 Para el universo conocido,
se ha calculado que esto ocurre cuando nos encontramos con una
oportunidad en 10.150 veces. Este nmero corresponde a un 1 se
guido por 150 ceros. (Ntese que un milln es 106, es decir, un 1
seguido por 6 ceros, o 1.000.000; y un billn es 1012, es decir, un
1 seguido por 12 ceros, o 1.000.000.000.000.)
Utilizando este punto de referencia, podemos calcular la probabi
lidad de autoformacin de una secuencia especfica de aminocidos
en una protema o una secuencia especfica de bases en un gen. Si
la probabilidad resultante es menor que 1 en 10.150, concluiremos
que esa protena o ese gen especfico no pudieron aparecer por azar.
Consideremos, por ejemplo, una molcula corta una protena
de 100 aminocidos de longitud-, y la probabilidad de que haya
surgido por casualidad a partir de sus componentes bsicos. Para
dar lugar a una cadena proteica funcional, los aminocidos deben
unirse entre s por medio de un tipo especfico de enlace qumico
conocido como enlace peptdico. No obstante, es posible, y de he
cho ocurre, que los aminocidos se enlacen de otra manera, con una
probabilidad aproximadamente igual. Segn esto, la probabilidad
de que se forme un enlace peptdico en cualquier punto particular
de la cadena en crecimiento es una de cada dos, o Vi. Por tanto, la
probabilidad de tener cuatro enlaces peptdicos en una cadena de
cuatro enlaces es Vi x Vi x Vi x Vi = 0/2)4 = 1/16, o 1 oportunidad
de cada 16. La probabilidad de construir una cadena de 100 ami
nocidos que presente nicamente enlaces peptdicos es de 0/2)99,
lo que representa aproximadamente 1 oportunidad de cada 1.030.
Los aminocidos en la naturaleza pueden aparecer en dos formas
distintas, en la que una es la imagen especular de la otra, del mismo
modo en que la mano izquierda es el reflejo de la mano derecha. La
sntesis aleatoria de aminocidos produce ambas formas con una
frecuencia similar, pero las protenas funcionales de las clulas solo

13William A. Dembski, The Design Inference: Eliminating Chance Through Small Proba-
bilities (Cambridge, MA: Cambridge University Press, 1998), pp. 175-223.
utilizan una de ellas, la llamada forma L, y nunca la otra, llamada
forma D. Si ambas formas se encontraran en la misma proporcin
en el ambiente, la probabilidad de incorporar una forma L a una
cadena proteica sera de 1/2, y la probabilidad de incorporar 100
aminocidos, todos ellos de forma L, sera de (Vi2) 100. Igual que an
tes, esto representa una oportunidad de 1.030. Teniendo en cuenta
ambos requisitos, la probabilidad de tener 100 aminocidos L for
mando una cadena con solamente enlaces peptdicos es 1/1060.
Hasta aqu solo hemos considerado aspectos estructurales, pero
an no hemos tenido en cuenta el requisito de la informacin.
Para obtener una protena funcional que contenga informacin
significativa, los aminocidos tienen que incorporarse siguiendo
una secuencia especfica, igual que las letras del alfabeto deben
estar organizadas de cierta secuencia para producir una frase con
sentido. Por ejemplo, considere el dicho: De tal palo tal astilla .
En este mensaje hay un total de 23 caracteres, que son 19 letras y
cuatro espacios, con diez tipos diferentes: 9 letras ms el espacio.
Imaginemos que queremos generar este mensaje aleatoriamente,
con un programa de ordenador que asignara un carcter al azar
(de entre los diez posibles) a cada una de las 23 posiciones del
mensaje. La probabilidad de que la primera letra sea una ti ser
de 1/10, lo mismo para que la segunda sea una e, y as sucesiva
mente. La probabilidad de obtener la frase completa es de una en
10 x 10 x 10 x 10 x 10 x l O x l O x 10 x 10 x 10 x 10 x 10 x 10 x
10 x 10 x 10 x 10 x 10 x 10 x 10 x 10 x 10 x 10 intentos, esto es 1/
100.000.000.000.000.000.000.000 o 1/1023.
Los sistemas biolgicos contienen 20 aminocidos diferen
tes, que pueden ser considerados como las letras empleadas para
escribir un mensaje. A menos que los aminocidos estn en la
secuencia correcta, el mensaje no transmitir la informacin ne
cesaria y la clula no funcionar correctamente. La probabilidad
de colocar el aminocido correcto en el sitio correcto es de 1 vez
cada 20 oportunidades. Por lo tanto, la probabilidad de formar
por casualidad una protena especfica de 100 aminocidos de
longitud sera (1/20)100, lo que corresponde, aproximadamen
te, a 1 vez cada 10.130. Pero todos estos aminocidos necesitan
ser aminocidos L y tienen que estar conectados entre s por
enlaces peptdicos. As, pues, la probabilidad de que se cumplan
las tres condiciones a la vez es de 1 vez cada 10.130 x 10.30
x 10.30 veces, o 1/10190. Este nmero es m ucho ms grande
que 10.150 (cuarenta ceros ms a la derecha) y, segn Dembsky,
define el mximo lmite de probabilidad de que un evento de
term inado haya ocurrido en alguna parte del universo durante
el tiempo de existencia del universo.
El clculo mostrado anteriormente no tiene en cuenta que hay
otras secuencias con el mismo nmero de aminocidos que po
dran contener informacin alternativa y ser, por lo tanto, vli
das. Por otro lado, tampoco tiene en cuenta el hecho de que hay
aminocidos en la naturaleza que no forman protenas, lo que
reducira an ms las probabilidades de formar una protena co
rrecta. Adems, el clculo est basado sobre una protena relati
vamente pequea. Una protena biolgica tpica consta de unos
300 aminocidos, y algunas son mucho ms largas. Bioqumicos
de la Universidad de Cambridge y del Instituto de Tecnologa de
Massachusetts han publicado clculos ms detallados, y la pro
babilidad de que una secuencia funcional de aminocidos haya
surgido por casualidad resulta equivalente a encontrar un tomo
particular en todo el universo!14
Si en lugar de una protena consideramos el caso de un gen,
que puede comprender miles, e incluso millones, de bases nitro
genadas, las probabilidades de obtener una secuencia aleatoria que
contenga informacin significativa son nfimas. Y, por supuesto,
se requerira mucho ms que un solo gen. A partir de estudios con
organismos unicelulares, los cientficos han calculado que el ser
vivo ms simple posible requerira un genoma mnimo de 250 a

14J. Reidhaar-Olson y R. Sauer, Functionally Acceptable Solutions in Two Alpha-Helical Re-


gions of Lambda Repressor, PROTEINS: Structure, Function, and Genetics, vol. 7 (1990), pp.
306-310. Ver tambin: D. D. Axe, Biological Function Places Unexpectedly Tight Constraints
on Protein Sequences, Journal o f Molecular Biology, vol. 301, N 3 (2000), pp. 585-596.
400 genes.15 Es evidente que la probabilidad de que la vida haya
aparecido por casualidad, aun en su forma ms simple, es m uy in
ferior a 1 oportunidad en 10.150, lo que nos permite concluir que
la abiognesis es imposible:16 un organismo vivo no puede surgir de
la materia inanimada por medio de procesos aleatorios.
Cuando se examina atentam ente la literatura evolucionista
desde sus inicios hasta la actualidad, descubrimos que todava
no se ha propuesto ninguna explicacin mecnica o naturalista
plausible sobre el modo en que comenz la vida. Los defensores
de la evolucin qumica estn apoyando y enseando un modelo
no corroborado desde hace ms de 80 aos, ignorando mltiples
evidencias de que la abiognesis no es posible.

15 E. Pennisi, Seeking Lifes Bare Genetic Necessities, Science, vol. 272 (1996), pp.
1.098-1.099. Ver tambin: A. Mushegian y E. Koonin, A Minimal Gene Set for Cellular
Life Derived by Comparison of Complete Bacterial Genomes, Proceedings ofthe Natio
nal Academy o f Sciences ofthe USA, vol. 93 (1996), pp. 10.268-10.273.

16 Puede encontrarse una discusin detallada del clculo de las probabilidades con refe
rencias a literatura de apoyo en: S. C. Meyer, DNA and the Origin of Life: Informa
tion, Speciation, and Explanation, Darwinism, Design, and Public Education (Michigan:
Michigan State University Press, 2003). Extracto disponible en lnea: www.discovery.or-
g/a/2184.
MUTACIONES
ALEATORIAS?
POR Q l Jl M J ! -I II. I )| .N I VOLUCIONAR NUEVOS TIPOS DE
OAiANIDM ) - 1' ( HI MI: DIO DE MUTACIONES ALEATORIAS

1 concepto de evolucin forma parte de la enseanza de la Bio-


logia en muchos pases. Pelculas documentales, como la serie
de la BBC The Genius o f Charles Darwin [El genio de Charles
Darwin], presentan la evolucin a las grandes audiencias, y su mensa
je expresa que la evolucin es un hecho cientfico. En 2009, el presen
tador de ese programa, profesor Richard Dawkins, de la Universidad
de Oxford, public un libro incluyendo lo que para l es una gran
acumulacin de evidencias a favor de la evolucin. En las primeras
pginas, Dawkins afirma: En el resto de este libro, demostrar que
la evolucin es un hecho ineludible.1 Pero lo es verdaderamente?

1 Richard Dawkins, The Greatest Show on Earth: The Evidence fo r Evolution (London:
Bantam Press, 2009), p. IB.
En este captulo revisaremos con cuidado las evidencias propuestas
con el fin de apoyar la piedra angular de la Teora de la Evolucin:
la afirmacin de que las mutaciones aleatorias, filtradas por la selec
cin natural, pueden dar lugar a formas de vida totalmente nuevas, en
forma gradual. Empecemos por comprobar si las mutaciones, junto
con la seleccin natural, son capaces de producir toda la informacin
gentica necesaria de modo de generar la diversidad de la vida pasada
y la actual en la Tierra.
La informacin gentica es responsable por la forma y la fun
cin de un organismo, y est codificada en su AD N . Incluye la
informacin para producir todos los componentes fsicos de un
espcimen: piel o corteza, y pelaje; rganos internos y externos;
huesos; concha o caparazn; races y hojas; color; sistemas diges
tivo, nervioso, reproductor, ptico, inmunitario; forma fsica; ce
rebro, etc. Tambin codifica miles de enzimas y otras protenas;
y hormonas y molculas especficas, como las toxinas de defensa.
La evolucin requiere que la informacin gentica especfica de
cada tipo de animal, planta, hongo o bacteria haya surgido por
medio de mutaciones aleatorias. Y posteriormente, a causa de los
depredadores y otras presiones ambientales, la informacin ge
ntica menos ventajosa habra sido eliminada, quedando nica
mente aquella que beneficia a los organismos que la contienen.
Dawkins afirma:

En el caso del A D N , comprendemos bastante bien cmo la


informacin contenida aum enta durante el tiempo geolgico.
Darwin lo llam seleccin natural.2

A partir de los conocimientos bioqumicos actuales sobre el


A D N , pretendo demostrar que las mutaciones aleatorias y la se
leccin natural son incapaces de producir la informacin gen
tica requerida para la evolucin de los millones de especies dife
rentes de seres vivos. Para ello, revisaremos las evidencias reales,

2Ibcl., p. 405.
tal como las observamos hoy, y las contrastaremos con algunos
conceptos tericos del pasado.
Dentro de las ciencias naturales, el trmino evolucin se uti
liza para describir los cambios graduales que pueden ocurrir en
una poblacin en un tiempo ms o menos largo. Muchos cambios
morfolgicos y fisiolgicos son el resultado de cambios en la infor
macin gentica codificada en el A D N . Los cambios en el A D N
se llaman mutaciones. Las mutaciones pueden ser espontneas
o provocadas, y tienen el potencial de provocar significativos cam
bios visibles en los organismos. La induccin de mutaciones en
animales de laboratorio es una tcnica comn en investigacin
mdica, y tambin se utiliza para la modificacin de variedades
vegetales y animales de granja.
En teora, hay tres maneras distintas de cambiar la informa
cin gentica del A D N por medio de mutaciones, de manera
que estas puedan contribuir a la evolucin de los organismos.
Para facilitar la comparacin entre ellas, vamos a describirlas
como Evolucin tipo 1, tipo 2 y tipo 3.
Evolucin tipo 1: Consiste en la prdida de informacin ge
ntica preexistente. Supongamos que una poblacin de ratones con
formada por ratones de pelaje claro y de pelaje oscuro se traslada a
un rea arenosa de color claro. En esa zona, los depredadores vern y
atraparn con mayor facilidad a los ratones oscuros y, despus de un
tiempo, pueden llegar a eliminarlos completamente. Si el color del
pelaje es un rasgo gentico y el gen para pelaje oscuro desapareciera
de la poblacin, se habr producido un cambio permanente causado
por seleccin natural. Esta situacin, sin embargo, es infrecuente en
la naturaleza. Muchas veces, los genes que suponen una desventaja
permanecen en la poblacin en proporciones bajas, porque algunos
individuos siguen portando la informacin en sus genes aunque esta
no siempre se manifieste. En el ejemplo de los ratones, algunos indivi
duos podran todava mantener la informacin para pelaje oscuro en
su A D N y producir, de vez en cuando, cras de pelaje oscuro. Si en el
futuro algunos ratones migraran a otra zona donde los ratones claros
se vieran desfavorecidos, los ratones oscuros aumentaran en nmero
en la nueva poblacin. En este ejemplo, no se crea informacin gen-
NUTACIONES ALEAl'ORIAG?

cica nueva; se observan cambios evolutivos causados por seleccin na


tural, que favorece la supervivencia en un nuevo ambiente por medio
de la eliminacin de informacin gentica no favorable.
Este mismo mecanismo explica algunos de los ejemplos tpicos
utilizados para apoyar la evolucin, como el hecho de que los guppys
machos desarrollen colores ms brillantes cuando son liberados en
arroyos donde hay pocos depredadores.3 En corrientes con una alta
densidad de depredadores, los guppys macho ms fciles de ver son
comidos antes de que puedan reproducirse, as que, se reproducen
principalmente los peces de coloracin menos vistosa. No obstante,
algunos de los guppys supervivientes de color apagado portan todava
los genes de los colores brillantes, por lo que de vez en cuando aparece
algn macho llamativo; que suele ser devorado enseguida. Si algunos
de los guppys de colores apagados se liberaran en una laguna con po
cos depredadores, los machos de colores intensos que nazcan podran
sobrevivir hasta la edad adulta. Como estos atraen ms a las hembras,
se reproducen de manera ms efectiva y producen ms descendencia
de colores brillantes. Por lo tanto, la reaparicin de peces de colores
vivos y la evolucin de la poblacin hacia una mayor abundancia de
estos no implica nueva informacin gentica.
O tro punto para destacar es que, en estos ejemplos y otros
similares que aparecen en los libros de texto de Biologa, los su
puestos cambios evolutivos involucran a un nico tipo de orga
nismo.4 Los ratones son ratones antes y despus de los cambios,
los guppys siguen siendo guppys; las polillas, polillas; y las ra
nas, ranas. N o hay ningn ejemplo de polilla que evolucione en
mosca, o viceversa. En otras palabras, la prdida de informacin
gentica no resulta en un nuevo tipo de organismo, sino solo en
una variante de este.
La seleccin natural puede actuar de diferentes maneras sobre la
informacin, sin necesidad de eliminarla por completo. Los efectos

3Ibd., pp. 133-139. Ver tambin: Linda R. Berg, Diana W. Martin y Eldra P. Solomon,
Biology, 7 ed. (Belmont, CA: Thomson, Brooks/Cole, 2005), pp. 349, 350.

4Berg, Martin y Solomon, Biology, 7a ed., caps. 17-19.


ambientales pueden provocar cambios en los organismos activando
(o desactivando) la actividad de genes presentes en el ADN. La ac
tivacin de un gen implica que la informacin contenida est dis
ponible para ser expresada en el organismo. La desactivacin de un
gen supone que aunque la informacin est presente, no ser leda
ni estar disponible para ser utilizada. En el caso de los guppys,
la presin ambiental, en forma de estrs por depredacin, podra
desactivar los genes responsables por la produccin de color, de ma
nera que machos vistosos apareceran como apagados. Cuando los
depredadores son eliminados de la ecuacin, la disminucin de la
presin ambiental causara la reactivacin de la informacin genti
ca existente para la produccin de colores vivos.
Los genes pueden ser activados o desactivados por otros genes o
por compuestos qumicos en el entorno de la clula. Por ejemplo,
un gen X en particular puede ralentar o incluso apagar un gen Y.
Si un factor ambiental, como una sustancia qumica o algn tipo
de radiacin, afectara al gen X y le impidiera realizar su funcin de
apagar al gen Y, el gen Y se activara y su informacin gentica po
dra expresarse en forma de un nuevo rasgo, como un color distinto.
Por ejemplo, considere un editor leyendo este informe:
LA MAYORA D E LOS C IEN TFIC O S N O CREE EN
LA E V O L U C I N .
Por consiguiente, la editorial no publica ningn libro sobre
evolucin.
Si con un blanqueador qumico borramos la palabra N O , la
informacin destruida por nuestro blanqueador cambiar la in
formacin (el mensaje) codificada en la oracin. Por consiguien
te, se enva este nuevo informe al editor:
LA MAYORA D E LOS C IE N T FIC O S CREE EN LA
E V O L U C I N .
Nuestra m utacin ha resultado en una prdida de infor
macin, pero todava tiene sentido. La editorial lee el informe
m utado y empieza a publicar libros sobre evolucin. El mensaje
m utado ha activado una accin preexistente, pero aletargada.
La tcnica de destruir informacin gentica para producir rasgos
nuevos ha sido usada para la mejora de variedades de cultivo durante
. / A j I a u NES AL.EATORiAS?

muchas dcadas. Por esta tcnica, miles de semillas son expuestas a ra


diacin ionizante o a productos qumicos que daan las molculas de
ADN; luego, esas semillas son germinadas. Despus, toda semilla que
logre crecer es examinada, para buscar posibles rasgos beneficiosos
como resistencia a la sequa, un menor ndice glucmico, etc. Pode
mos mencionar el caso de los compuestos qumicos que desactivan o
destruyen los genes que codifican la protena-1 del grnulo de almi
dn (SGP-1), responsable por la sntesis de las cadenas ramificadas de
almidn en las semillas. La descendencia de estas plantas producir
un grano, por ejemplo, de maz, con almidn menos ramificado y,
por lo tanto, con un menor ndice glucmico que el maz comn,
lo cual supone una ventaja para el consumo por personas diabticas.
Para la mejora de variedades de cultivo, los especialistas suelen escoger
semillas de ubicaciones silvestres que no hayan estado sometidas a
demasiada seleccin, porque es probable que estas semillas contengan
una mayor diversidad gentica, comparada con las variedades doms
ticas. Destruir genes en especies silvestres incrementa la posibilidad de
producir un rasgo beneficioso en su descendencia. No obstante, de
bemos recordar que, en todos estos casos, los nuevos rasgos se deben
a la prdida de informacin; no se ha creado ninguna informacin
gentica nueva.
Los cambios en el entorno fsico de la clula que ejercen presin fsica
sobre el propio ADN tambin pueden afectar la actividad de la infor
macin gentica. En las bacterias, los cambios ambientales provocan
variaciones en la forma en que se pliega y empaqueta la extensa molcu
la circular de ADN, y estos cambios afectan la activacin o la desactiva
cin de determinados genes. Esta es una estrategia de las bacterias para
sobrevivir a cambios repentinos en su ambiente, pero esta capacidad
tambin utiliza informacin gentica preexistente. No se crea ninguna
informacin nueva.5

5C. J. Dormn, DNA Topology and the Global Control of Bacterial Gene Expression: Im-
plications for the Regulation of Virulence Gene Expression", Micmbiology, vol. 141 (1995),
pp. 1.271-1.280. Ver tambin: G. W. Hatfield y C. J. Benham, DNA Topology-mediated
Control of Global Gene Expression in Escherichia coli, Animal Review ofGenetics, vol. 36
(2002), pp. 175-203.
Los cambios en el A D N que producen desactivacin o destruc
cin de genes tambin pueden darse a causa de errores durante
la replicacin del A D N previo a la reproduccin celular, con lo
que las nuevas clulas poseern un A D N ligeramente modificado.
Como los errores de copia se producen al azar, lo ms probable es
que el gen o los genes afectados por el cambio sufran de alguna
alteracin en su funcionalidad, o incluso queden inutilizados por
completo, lo que resultar en una prdida de informacin y una
posible evolucin de tipo 1.
En la primera parte del documental E l genio de Charles Darwin,
el profesor Richard Dawkins afirma que las mujeres de Nairobi
resistentes al V IH son evidencia de la imparable fuerza de la se
leccin natural.6 Este es, sin embargo, un claro ejemplo de una
mutacin que comprende prdida de informacin gentica. La
resistencia observada resulta de una mutacin del gen CCR5 en
las mujeres, causada por la eliminacin de 32 pares de bases de in
formacin. Como resultado, el receptor celular que el V IH utiliza
para entrar en las clulas es defectuoso y no es funcional, lo que
provoca que la enfermedad se detenga o, al menos, se ralentice.7
Aunque esta mutacin tiene un efecto beneficioso indiscutible
para las mujeres que la poseen, es atribuible a la prdida de la in
formacin gentica preexistente, y no sirve como ejemplo de que
la evolucin podra producir la informacin gentica necesaria
para la evolucin de nuevos rganos, como un ojo o una pierna;
por no decir de un nuevo tipo de organismo. Este problema se
repite en cada uno de los ejemplos citados en los libros de texto y
en los documentales a favor de la evolucin. Todos ellos son sim
plemente casos de evolucin tipo 1, donde las especies implicadas
han perdido informacin gentica.

6Dawkins, The Genius o f Charles Darwin, parte 1. Documental para televisin (exhibido
el 4 de agosto de 2008, en el Canal 4, Reino Unido).

7S. Venkatesan, A. Petrovic, D. L. Van Ryk, et a l, Reduced Cell Surface Expression


of CCR5 in CCR5Delta 32 Heterozygotes Is Mediated by Gene Dosage, Rather Than
by Receptor Sequestration, Journal o f Biolgica! Chemistiy, vol. 277, N 3 (2002), pp.
2.287-2.301.
MU iA l' iUN ES ALEA \ j RiASE

En la mayora de los casos, las mutaciones son en realidad


perjudiciales,8 y muchas son responsables por enfermedades ge
nticas o heredadas.9 Muchos cnceres y tumores malignos que
afectan a animales y a seres hum anos pueden relacionarse con
mutaciones de tipo l . 10*Incluso la m utacin CC5 Delta 32, ci
tada por el profesor Dawkins como ejemplo de m utacin bene
ficiosa en relacin con la transmisin del V IH , ha sido reciente
m ente relacionada con un incremento del riesgo de contraer una
grave enfermedad heptica.11
Resumiendo, la evolucin tipo 1 es la ms comn, y se co
rresponde con el tipo de evolucin implicado en los ejemplos
que se usan normalmente como evidencias de que la evolucin
es un hecho.12 Sin embargo, este tipo de evolucin no puede
crear nuevos rganos ni nuevas clases de organismos y, por lo
tanto, no puede ser un mecanismo para explicar la existencia
de los millones de clases de animales y de plantas que han sido
descubiertos.
Evolucin tipo 2: Comprende la transferencia de informa-
cion gentica de un ser vivo a otro, pudiendo ambos pertenecer a
especies distintas. La informacin gentica adicional puede incor
porarse al A D N de un organismo a travs de virus, de protenas
que se comportan de manera similar a los virus, o de plsmidos
que pueden portar genes especficos. Por ejemplo, el plsmido
R100, que est formado por 90.000 pares de bases, porta genes
para la resistencia frente a la sulfonamida, la estreptomicina y al
gunos otros antibiticos. Este plsmido puede transferirse desde
una inofensiva bacteria Escherichia a bacterias patgenas, como la

8A. Orr, Testing Natural Selection, Srentific American (enero de 2009), pp. 30-36.

9 S. E. Antonarakis, M. Krawezak y D. N. Cooper, Disease Causing Mutations in the


Human Genome, European Journal ofPediatrics, vol. 159, supl. 3 (2000), S173- S178.

10L. A. Loeb, J. H. Bielas y R. A. Beckman, Cancers Exhibit a Mutator Phenotype: Clini-


cal Implications, Cncer Research, vol. 68, N 10 (2008), pp. 3.551-3.557.

R. Eri, J. R. Jonsson, D. M. Pandeya, et ah, CCR5-.32 Mutation Is Strongly Associated


with Primary Sclerosing Cholangitis, Genes and Immunity, vol. 5 (2004), pp. 444-450.
12 Orr, ibd., pp. 30-36.
i iMPOSK

Salmonella. La insercin de estos genes resulta en la evolucin de


una nueva especie de la Salmonella resistente a los antibiticos. De
forma semejante, la cepa potencialmente letal de la Escherichia coli
que se conoce con el cdigo 0 1 5 7 :H 7 pudo haber evolucionado
a partir de una bacteria E. coli no patognica, por transferencia
de genes codificadores de toxinas de alguna otra bacteria. De he
cho, se cree que muchas de las bacterias responsables por intoxi
caciones alimenticias, que tanto preocupan a los procesadores de
alimentos, pudieron haberse desarrollado en los ltimos 50 aos
como consecuencia de la transferencia entre bacterias de genes
codificadores de toxinas y genes de resistencia a los cidos.13
La evolucin tipo 2 tampoco implica la creacin de infor
macin gentica totalmente nueva; solo la transferencia de un
organismo a otro de informacin gentica preexistente. Puede
producir una nueva cepa de un organismo, pero no un nuevo
tipo de organismo.
Es interesante notar que todas las especies poseen mecanis
mos responsables por m antener su integridad. Algunos de estos
mecanismos impiden que dos especies diferentes se apareen en
tre s y produzcan un nuevo tipo de ser vivo. Este es un ejemplo
de mecanismo antievolutivo que se puede observar en la naturale
za. Por ejemplo, en la reproduccin sexual que incluye un vulo
y un espermatozoide, la superficie del vulo contiene protenas
especficas que se unen solamente a molculas complementa
rias especficas de los espermatozoides de la misma especie. Esto
impide, normalmente, la formacin de embriones hbridos. En
caso de que estos se formen, son generalmente abortados o se
transforman en adultos estriles. Las plantas poseen un sistema
de reconocimiento molecular similar, de manera que los granos
de polen no suelen germinar sobre el estigma (la parte femeni
na de una flor) de una especie diferente de planta.14 Podramos

13K. A. Bettelheim, Enterohaemorrhagic Escherichia coli: A New Problem, an Od Group


of Organisms, Australian Veterinary Journal, vol. 73, N1 (1996), pp. 20-26.

14Berg, Martin y Solomon, ibd., p. 130.


decir que los hbridos naturales, cuando raramente se producen,
son ejemplos de evolucin tipo 2, ya que combinan informacin
gentica procedente de dos organismos de distinta especie.
Evolucin tipo 3: Com prende la generacin de informa
cin gentica til totalm ente nueva dentro del A D N de un
organismo, que resulta en una estructura, rgano o funcin
que no exista anteriormente. Un ejemplo hipottico sera un
gusano que desarrollara patas articuladas junto con un nuevo
tipo de locomocin, o que desarrollara ojos y la percepcin sen
sorial asociada a ellos. La aparicin de un nuevo tipo de patas
requerira cantidades masivas de informacin gentica para co
dificar las distintas partes: exoesqueleto, articulaciones, m scu
los, estructuras sensoriales, etc.; sus mecanismos de control; y
la programacin del cerebro para usarlas. De forma semejante,
la formacin del primer ojo implicara la aparicin simultnea,
en el A D N , de la informacin necesaria para el desarrollo y el
funcionamiento de todos sus componentes: las lentes, los me
canismos de enfoque, el nervio ptico, las vas de suministro
de sangre, etc. El biofsico Dr. Lee Spetner, profesor de las uni
versidades de Harvard y Johns Hopkins, seala que la evolu
cin de tipo 3 nunca ha sido observada.15 En realidad, no hay
ningn mecanismo conocido que pueda explicar la formacin
de las grandes cantidades de informacin gentica que requiere
la aparicin de miembros articulados durante la evolucin de
los artrpodos (crustceos, insectos y araas), o la formacin de
ojos, incluso los ms sencillos, a partir de ancestros que no los
poseen. Explicar la aparicin de novedades evolutivas, estructu
ras u rganos totalm ente nuevos es un desafo im portante para
la Biologa evolutiva. Segn un libro de Biologa ampliamente
utilizado: Una preocupacin de la macroevolucin es explicar
las novedades evolutivas, que son grandes cambios fenotpicos
[...] La macroevolucin tam bin trata de descubrir y de explicar

15Lee M. Spetner, Not by Chance! Shattering the Mdem Tlieoiy ofEvolution (New York:
Judaica Press, Inc., 1997), p. 107. Ver tambin: A. Mclntosh, Just Add Energy, 2007. En
lnea: www.apologetics.org/JUSTADDENERGY/tabid/82/Default.aspx.
cambios importantes en la diversidad de las especies a lo largo
del tiem po.16
Un sitio web educativo de prestigio lo expone de forma mucho
ms franca: Los bilogos no discuten sobre esta conclusin [que la
vida sobre la Tierra ha evolucionado]. Pero estn tratando de ima
ginarse cmo ocurri la evolucin, y ese no es un trabajo fcil.17
Hasta la fecha, los evolucionistas no han encontrado ningn
mecanismo capaz de generar estas novedades evolutivas. Sin em
bargo, la evolucin de tipo 3 se acepta como un hecho porque es
necesaria para generar nuevas clases de organismos cada vez ms
complejos, tal como propone la Teora de la Evolucin darwiniana.
Uno de los libros recientes que argumentan a favor de la Teora
de la Evolucin con supuestas evidencias es The Greatest Show on
Earth: The Evidence jb r Evolution [El espectculo ms grande de
la Tierra: Evidencias de la evolucin], del profesor Richard Daw-
kins. En esta obra, de 470 pginas, se cita un nico ejemplo de
evolucin de tipo 3: los experimentos realizados por el bacteri
logo Richard Lcnski y sus colegas de la Universidad del Estado de
M ichigan.18 Examinaremos en detalle esta importante afirmacin.
El Dr. Richard Lenski y un equipo de investigadores del Depar
tamento de Microbiologa y Gentica Molecular investigaron las
mutaciones producidas en 12 poblaciones inicialmente idnticas
de la bacteria Escherichia coli a lo largo de ms de tres dcadas.
Durante este tiempo, las bacterias produjeron decenas de miles de
generaciones y experimentaron miles de millones de mutaciones.
El nmero total de mutaciones era superior al nmero total de
bases del A D N de E. coli, as que, podemos decir que cada uno
de los 4,6 millones de pares de bases tuvo la oportunidad de mu-
tar al menos una vez a lo largo del experimento. Sin embargo, el
nico cambio evolutivo importante, despus de ms de 3E500

16Berg, Martin y Solomon, ibd., p. 377.

17Evolution 101!, The Big Issues. En lnea: www.evolution.berkeley.edu/evosite/evol01/


VIIBigissues.shtml.

18 Dawkins, ibd., p. 131.


>c-aeraciones, fue el hecho de que una de las poblaciones adquiri
la capacidad de utilizar el in qumico citrato como fuente de ali
mento, cosa que la mayora de las bacterias E. coli no puede hacer.
En realidad, cualquier E. coli tiene el metabolismo interno ne
cesario para utilizar citrato, pero las cepas no m utantes carecen
de una molcula transportadora especfica para este compuesto
qumico. La cepa m utante, capaz de utilizar citrato, posee una
molcula transportadora funcional. El Dr. Lenski y sus colegas
no estn seguros del mecanismo exacto implicado en la m uta
cin. U na explicacin sugerida es que el gen transportador es
taba presente pero inactivado por mutaciones anteriores, y fue
reactivado en la cepa m utante. O tra posibilidad, que consideran
ms probable, es que un transportador especifico de otra sus
tancia ha sido cooptado para el transporte de citrato.|,J (En bio
loga, coopcin es la adquisicin de una nueva funcin por parte
de una estructura preexistente.) En cualquiera de los dos casos,
la informacin gentica para el transporte ya estaba presente en
el organismo, por lo que no nos encontramos ante un ejem
plo real de evolucin tipo 3, sino de evolucin tipo 1. El nico
ejemplo presentado por Dawkins de que el binomio mutaciones
aleatorias-seleccin natural puede producir informacin genti
ca novedosa ha resultado no ser vlido.
El Dr. Lenski y sus colegas informaron tam bin de otros cam
bios evolutivos durante sus estudios. Por ejemplo, en todas las
poblaciones, las generaciones sucesivas crecieron ms rpido
y crearon clulas de tamao mayor que sus antepasados. Diez
poblaciones desarrollaron cambios en el empaquetamiento de
su A D N , lo que, como es sabido, afecta la expresin gentica.
Aparecieron, tambin, diferencias en los niveles de salud entre
las poblaciones. Cuatro de las poblaciones, esto es, un tercio del
total, desarrollaron defectos en sus mecanismos de reparacin
del A D N , lo que conduce a tasas de m utacin ms altas.19

19 Z. D. Blount, C. Z. Borland y R. E. Lenski, Historical Contingency and the Evolution of


a Key Innovation in an Experimental Population of Escherichia coli, Proceedings o f the
National Academy o f Sciences, vol. 105, N 23 (2008), pp. 7.899-7.906.
e -q J{:;5 k v p o s ? - , ;'

An as, despus de millones y millones de mutaciones indivi


duales ocurridas durante ms de 44.000 generaciones, todas las
bacterias E. coli del experimento del Dr. Lenski eran todava bac
terias E. coli-, no evolucionaron para transformarse en otro tipo de
bacterias. No se convirtieron en bacterias anaerobias gram-nega-
tivas, como la Shigella o la Salmonella. No desarrollaron ncleo.
El resultado evolutivo ms importante fue la produccin de una
nueva molcula transportadora, que probablemente ya estaba
codificada de forma latente dentro del A D N del organismo. En
otras palabras, ninguna de las miles de millones de mutaciones fue
capaz de producir informacin gentica nueva.
Los estudios divulgados en 2008 por el Dr. Lenski y sus coin
vestigadores han servido tambin para demostrar que la seleccin
natural es, en realidad, un mecanismo m uy pobre para optimizar
las tasas de mutacin en escenarios de tipo m undo real, donde la
adecuacin a la supervivencia en el medio ambiente es compleja.20
La evolucin de tipo 3 requiere que se produzca abundante
cantidad de informacin gentica nueva para poder seleccionar la
ms apta para la supervivencia. Pongamos por caso la evolucin
de un organismo similar a la levadura comn, la Saccharomyces
cerevisiae, a partir de una bacteria unicelular tipo la E. coli. En pri
mer lugar, necesitaramos aumentar el nmero de pares de bases
del A D N , de 4,6 millones a 12,1 millones. Las levaduras tienen
aproximadamente 6.000 genes, casi 50% ms que las bacterias,
y estos son mucho ms grandes, es decir, contienen mucha ms
informacin gentica. Si las bacterias evolucionaron para conver
tirse en levaduras, miles de nuevos genes tuvieron que formarse
por mutaciones aleatorias. Y una levadura contina siendo un
organismo unicelular! La evolucin de un organismo multicelular
requerira la creacin de una cantidad mucho mayor de informa
cin gentica nueva. La informacin codificada en un parsito as
cride (Ascaris lumbricoides) est contenida en un A D N de 97 mi-

20J. Clune, D. Misevic, C. Ofria, et al, Natural Selection Fails to Optimise Mutation Rates
for Long-Term Adaptation on Rugged Fitness Landscapes, PLoS Comput Biology, vol. 4,
N 9 (2008): el000187. En lnea: http://www.oMa.com/pubs/2008bCluneEtAl.pdf.
; MU :0 NES ALEATORIAS?

llones de pares de bases, repartidos en aproximadamente 19.000


genes. La evolucin de una levadura a uno de estos gusanos reque
rira la creacin de 13.000 genes adicionales de informacin gen
tica nueva, formados por mutaciones aleatorias; y estos genes son
mucho ms largos y complejos que los genes de las levaduras.21
Si siguiramos subiendo en el rbol evolutivo, y calculramos la
informacin gentica nueva requerida para la aparicin de nuevos
organismos de nivel superior, veramos que la cantidad es enorme
en cada paso. De acuerdo con la Teora de la Evolucin, toda esta
informacin gentica surgi por casualidad como consecuencia
de sucesivas mutaciones aleatorias.
Es importante enfatizar que se requiere informacin gentica to
talmente nueva para que la Teora de la Evolucin funcione. La in
formacin gentica necesaria para crear una levadura en un m un
do de bacterias no se asemejara a nada que hubiese existido antes.
La levadura, aunque unicelular, tiene una estructura gentica muy
distinta de la de una bacteria, pues su A D N se encuentra concen
trado en el ncleo. Adems, la levadura Saccharomyces cerevisiae
presenta un tipo de reproduccin particular. Existen dos tipos
celulares distintos, A y B, que solo se aparean entre s. Adems
de la informacin necesaria para los nuevos procesos de repro
duccin no presentes en las bacterias, tambin se habran tenido
que desarrollar, por medio de mutaciones aleatorias no dirigidas,
complejos sistemas de reconocimiento celular. Los experimentos
del Dr. Lenski, junto con los clculos de probabilidad desarrolla
dos en el captulo anterior, sugieren que la probabilidad de que la
informacin gentica necesaria para crear una levadura a partir de
una bacteria es tan baja que es imposible en la prctica. Si esto es
as cuando nos referimos a organismos muy sencillos que se repro
ducen a gran velocidad y tienen un gran potencial para sufrir m u
taciones, la posibilidad de una evolucin tipo 3 se complica con
siderablemente, cuando consideramos cambios entre organismos

21 Human Genome Project Information, Functional and Comparative Genomics Fact Sheet,
modificado por ltima vez el 19 de septiembre de 2008. Vase http://www.oml.gov/sci/
techresources/HumanJjenome/faq/compgen.shtml.
V

pluricelulares situados ms arriba en el rbol evolutivo de Darwin.


Los animales y las plantas no solo presentan una complejidad ge
ntica infinitamente superior, sino tambin requieren mucho ms
tiempo para alcanzar la edad reproductiva. La mayora de las bac
terias se duplican en un lapso de entre una y tres horas, y en el
laboratorio, la E. coli puede producir una nueva generacin cada
media hora. Para muchos mamferos y reptiles, una nueva genera
cin puede demorar meses o aos hasta alcanzar la edad en la que
pueden reproducirse. Por lo tanto, se requerira un tiempo miles
de veces ms largo a fin de que las mutaciones aleatorias puedan
acumularse en las clulas reproductoras hasta dar lugar a nueva
informacin gentica significativa. Los animales tienen un A D N
complejo. El A D N de un ratn tiene cerca de 2.600 millones de
pares de bases y 25.000 genes, con un tamao medio de 100.000
bases.22 Pero el ratn es solo uno de 5.487 mamferos, cada uno
de los cuales tiene informacin gentica diferente. Es decir, un ri
noceronte tiene genes especficos de rinoceronte en su AD N , una
vaca tiene los suyos, al igual que un oso; y cada tipo de oso tiene
un A D N distinto, con genes singulares. Cada uno de estos genes
tuvo que aparecer, segn la Teora de la Evolucin, por medio
de mutaciones aleatorias. Y no hemos considerado aun los genes
especficos de las 9.990 especies de aves, de cada una de las 8.734
especies de reptiles, o de cada una de las 31.153 especies de peces.
Si pasamos a los invertebrados, hay genes especficos que caracte
rizan a cada una de las 100.000 especies diferentes de insectos. En
total, son miles de millones de genes distintos, cada uno formado
por miles de pares de bases ordenadas en una secuencia especifi
ca con sentido, los que determinan las caractersticas particulares
cada una de las 1.700.000 especies del planeta. Y aun quedara
por mencionar los miles de millones de genes diferentes que exis
tan en el pasado y que se han perdido debido a la extincin.
Literalmente, no ha habido tiempo suficiente, en los supuestos
cuatro mil millones de aos de historia de la vida en la Tierra, para

~Ibd.
que toda la informacin gentica presente en los genomas de los
millones de especies de bacterias, hongos, plantas y animales evo
lucionara por medio de mutaciones aleatorias a partir del genoma
de un supuesto organismo primitivo; lo que, como vimos en un
captulo anterior, es en s mismo estadsticamente imposible. El
I )r. Lee Spetner, quien ense durante aos Teora de la Informa
cin en la Universidad Johns Hopkins, ha publicado numerosos
ejemplos de clculos probabilsticos que demuestran cun invero
smil es la evolucin de organismos superiores por medio de m u
taciones aleatorias. Spetner muestra que la generacin aleatoria de
informacin gentica indita, necesaria para producir una nueva
especie, es estadsticamente imposible. Y basndose sobre la teora
de las probabilidades y la teora de la informacin, afirma que
la mayora de los cambios provocados por mutaciones aleatorias
son perjudiciales para el organismo, ya que inutilizan parte de la
secuencia del A D N .23 Esto es exactamente lo que se observa en el
laboratorio. Segn puntualiz H . Alien Orr, profesor de Biologa
de la Universidad de Rochester, una abrumadora mayora de las
mutaciones aleatorias son perjudiciales, es decir, reducen la apti
tud; solamente una pequea minora es beneficiosa e incrementa
la aptitud.24 Mltiples enfermedades, desde la fibrosis qustica
hasta la enfermedad de H untington y la tendencia familiar a tener
colesterol alto, estn relacionadas con secciones faltantes en los ge
nes y errores en la duplicacin del AD N . Listas de ms de 10.000
ejemplos de mutaciones o supresiones de genes sospechosas de
causar enfermedades genticas humanas estn compiladas en la
pgina web Mendelian Inheritance in M an [Herencia mendeliana
en el hombre], de la Universidad Johns Hopkins.25
La investigacin del cncer ha demostrado que los tumores malig
nos estn relacionados con las mutaciones, y que la tasa de mutacin

23Spetner, ibd., pp. 85-160.

24Orr, ibd., pp. 30-36.

25 En lnea: www.ncbi.nlm.nih.gov/Omim/mimstats.html. Ver tambin: www.hugo-inter-


national.org.
es mucho mayor en clulas cancergenas que en el resto. Mantener la
integridad de su ADN es una prioridad para los organismos. De he
cho, la mayora de las especies poseen diversos mecanismos de protec
cin contra las mutaciones, as como de reparacin del AD N errneo
o daado, con el propsito de minimizar las mutaciones. Cuando
estos mecanismos no funcionan porque la actividad de los genes de
reparacin del AD N queda suprimida por alguna razn, el riesgo de
cncer y de otras enfermedades se incrementa considerablemente.26
La suposicin de que las mutaciones son el mtodo de la naturaleza
para maximizar la diversidad y as asegurar la supervivencia -lo que
constituye la plataforma terica de la Teora de la Evolucin- est
muy lejos de la realidad. Los organismos intentan disminuir al mxi
mo el nmero de mutaciones, y cuando estas ocurren, suelen resultar
en enfermedades, o incluso la muerte, del individuo. Tal como apun
ta Spetner, en teora, las mutaciones aleatorias no pueden constituir
la base de la evolucin.27
Un ejemplo ms de la incapacidad de las mutaciones para gene
rar diversidad biolgica til es el llamado efecto cuello de botella.
En poblaciones relativamente pequeas, por ejemplo, de unos 100
individuos, las mutaciones se acumulan como consecuencia de la
endogamia. La salud de los individuos se ve afectada por la presencia
de A D N daado en sus genomas, lo que disminuye la capacidad
reproductora o la supervivencia. La acumulacin de mutaciones no
propicia la evolucin de una nueva especie, sino que favorece la
extincin de la poblacin. Por esta razn, reducir la acumulacin
de mutaciones es un factor clave para salvar de la extincin a espe
cies amenazadas.28 La solucin para liberar el cuello de botella es
introducir informacin gentica nueva incorporando, al conjunto,
individuos reproductores procedentes de otra poblacin.
La desaparicin de plantas y de animales por causas antropogni-

26 Loeb, Bielas y Beckman, ibd., pp. 3.551-3.557.

27 Spetner. ibd., p. 120.

28 J. Sanford, J. Baumgardner, W. Brewer, et al., Mendels Accoimtant: A Biologically


Realistic Forward-time Population Genetics Program, Scalable Computing: Practice and
Experience, vol. 8, N 2 (2007), pp. 147-165.
cas ha alcanzado proporciones realmente preocupantes en los l timos
tiempos; pero la extincin de especies no es un problema nuevo en
la historia de la tierra. Utilizando datos del registro fsil, se ha esti
mado que alrededor del 98% de todas las especies que alguna vez
han existido estn ahora extintas.29 En total, estaramos hablando de
100 a 200 millones de formas de vida diferentes que, de acuerdo con
los defensores de la evolucin, evolucionaron en su mayora durante
los ltimos 600 millones de aos.30 De ser cierto, esto equivale, en
promedio, a la aparicin de una nueva especie cada tres o cinco aos.
Teniendo en cuenta los millones de especies que existen actualmente,
si las novedades evolutivas siguieran apareciendo hoy al mismo ritmo,
no debera ser difcil observar alguna de ellas, sobre todo consideran
do los exhaustivos esfuerzos que los cientficos han realizado durante
los ltimos 50 aos para demostrar la evolucin. Sin embargo, no se
ha reportado en la literatura ni un solo ejemplo de un rgano nuevo
o mejorado, ni de un sistema nuevo de locomocin, ni de un ojo
superior ms eficiente, ni algn ejemplo de evolucin que inclu
ya informacin gentica totalmente nueva. Cada ao, se describen
aproximadamente 18.000 nuevas especies en la literatura cientfica,
pero son especies preexistentes, completamente formadas, que se des
cubren principalmente en regiones remotas del planeta.31 En ningn
caso son evidencia de nueva informacin gentica en desarrollo. Por
el contrario, lo que los cientficos constatan es la prdida ininterrum
pida de informacin gentica, a medida que se extinguen ms y ms
especies. El eminente bilogo E. O. Wilson ha estimado que la Tierra
est perdiendo anualmente cerca del 0,25% de las especies que que
dan.32 Los datos recopilados por la IUCN, International Unionforthe

29Evolution 101!, Patterns in Macroevolution. En lnea: www.evolution.berkeley.edu/


evosite/evolOl/VIBPatterns.shtml.

30Graham Lawton, Uprooting Darwin's Tree, New Scientist (24 de enero de 2009), pp. 34-39.

31A.D. Chapman, Numbers ofLiving Species in Australia and the World (Canberra, Austra
lia: Department of the Environment, Water. Heritage and the Arts, 2009), p. 3.

32Citado en: J. C. Avise, S. P. Hubbell y F. J. Ayala, In the Light of Evolution II: Biodiversity
and Extinction, Proceedings o f the National Academy o f Sciences, vol. 105, supl. 1 (12 de
agosto de 2008). En lnea: www.pnas.org/content/105/Supplement_l/! 1453.full.pdf
Comervation o f Nature and Natural Resources [Unin internacional
para la conservacin de la naturaleza y los recursos naturales],33 corro
bora esta tendencia a la extincin, junto con las evidencias fsiles de
las numerosas extinciones del pasado, y lo supone masivas prdidas
de informacin gentica a lo largo del tiempo. El director del ACAD,
Australian CenterforAncientD N A [Centro Australiano de A D N An
tiguo], Alan Cooper, refirindose a la prdida de la diversidad genti
ca al final de la ltima Edad de Hielo, dijo: Los estudios de A D N an
tiguo han revelado que la prdida de la diversidad gentica en muchas
especies supervivientes parece haber sido extremadamente grave.34
En otras palabras, evidencias cientficas en muchos mbitos diferen
tes no apoyan el incremento de informacin gentica, con el consi
guiente aumento de la diversidad y la complejidad, requerido por la
Teora de la Evolucin; estas evidencias, por el contrario, apuntan a la
prdida continua y progresiva de informacin gentica preexistente.
En este captulo he intentado ofrecer una visin general de la evi
dencia disponible actualmente respecto de los supuestos motores de
la evolucin darwiniana: mutaciones aleatorias y seleccin natural. A
continuacin, se resumen las principales conclusiones:

No se ha observado ni reportado en la literatura cientfica


ningn ejemplo confirmado de evolucin tipo 3 (creacin de
informacin gentica totalm ente nueva).
Actualmente, no existe ningn mecanismo conocido capaz de
producir este tipo de evolucin. Los cientficos no han encontrado
todava una explicacin plausible de cmo se produjo la cantidad
masiva de informacin gentica que observamos a nuestro alrededor.
Clculos matemticos y estadsticos demuestran que las m u
taciones no pueden producir la informacin gentica nueva re
querida para la evolucin tipo 3.
Los organismos poseen diversos mecanismos para reducir las

33En lnea: www.iucnredlist.org.

34Universidad de Adelaida, Australia. Comunicado de prensa (10 de diciembre de 2009).


Ver: www.adelaide.edu.au/news/news37301.html.
tasas de mutaciones y reparar el A D N . Tambin, existen meca
nismos establecidos para prevenir la reproduccin entre especies
diferentes. En otras palabras, los seres vivos tienden a minimizar
los cambios evolutivos.
Aun los ms simples organismos unicelulares contienen infor
macin gentica extremadamente compleja.
Los millones de especies distintas que han habitado la Tierra en
el pasado contenan una inmensa cantidad de informacin gentica
diversa, la mayor parte de la cual se ha perdido permanentemente.
Los cientficos continan observando, en la actualidad, una
tendencia a la prdida de informacin gentica en la naturaleza.

La Teora de la Evolucin propone que, en el pasado, hubo


poblaciones de organismos unicelulares simples, que evolucio
naron hacia seres ms complejos como resultado de adquirir in
formacin gentica compleja a travs de mutaciones aleatorias.
Este proceso nunca ha sido observado y, sobre la base de nuestros
conocimientos actuales de bioqumica y los clculos probabils-
ticos apropiados, podemos concluir que esto es completamente
imposible. Nuevas especies de organismos caracterizados por
novedades evolutivas (nuevos rganos, estructuras o mecanis
mos fisiolgicos) no pueden evolucionar por medio de m utacio
nes aleatorias. El registro fsil corrobora esta conclusin, dado
que en el pasado exista una mayor diversidad biolgica que en
el presente. Lo que se observa en el registro fsil es extincin,
no evolucin. Las evidencias sobre este punto se analizarn con
mayor detalle en el prximo captulo.
/

EL REGISTRO FOSIL

na de las razones principales por la que muchos cientfi

U cos confan en la evolucin es la existencia de fsiles de


animales y plantas cuyas dataciones indicaran millones
de aos de antigedad. En este captulo, revisaremos aspectos
relacionados con el registro fsil, con el fin de comprobar si real
m ente suministra evidencias en favor de la evolucin.
Los fsiles son los restos, marcas o moldes de plantas o de anima
les fallecidos hace mucho tiempo; estos fsiles se encuentran con
servados de alguna manera, generalmente en rocas, mbar, alqui
trn, o en condiciones por debajo de la temperatura de congelacin.
A veces, los animales han sido sepultados en lava. En una corriente
de lava sobre Blue Lake, en el Estado de Washington, hay un molde
detallado del cuerpo de un rinoceronte; tan detallado que incluso
pueden reconocerse los pliegues de la piel y los ojos. La mayora de
los fsiles, sin embargo, se encuentra en rocas sedimentarias como
lodolita, caliza, arenisca, esquisto y carbn. Este tipo de rocas se
forman por medio de procesos que involucran la accin del agua.
Existen distintos procesos de formacin de fsiles, pero en todos los
casos se requiere un entierro rpido, para impedir que las plantas
o los animales se descompongan, o sean devorados por carroe-
ros. Cuando los materiales que rodean al organismo se endurecen,
este generalmente se descompone, se disuelve y desaparece, pero
deja su forma impresa en la roca. Haciendo un molde de yeso de la
impresin en la roca, los paleontlogos pueden conocer cmo era
el animal original, su concha o sus huesos. Para la preservacin de
pisadas, rastros y madrigueras en superficies blandas, como arena o
barro, es necesario que el material se endurezca rpidamente, para
evitar que el viento u otros procesos climticos alteren las marcas.
Algunas veces, las conchas, la madera o los huesos enterrados se
transforman literalmente en piedra cuando minerales como el s
lice se filtran en el organismo y llenan vacos microscpicos en el
hueso o la madera, o reemplazan las estructuras celulares molcula
a molcula. Bajo ciertas condiciones, los tejidos orgnicos como la
carne o la celulosa, que estn compuestos en gran parte de carbono,
hidrgeno y oxgeno, se descomponen y dejan solo un residuo de
carbono en la superficie de la roca, que dibuja la silueta original del
animal o la planta. En contadas ocasiones los fsiles contienen res
tos prcticamente inalterados, con una preservacin extraordinaria.
Se puede citar ejemplares completos de mamferos extintos, como
el m amut lanudo, encontrados en el hielo del Artico. El m am ut de
Beresovka, hallado en Siberia oriental en 1901, tena en la boca ali
mento todava sin tragar y sangre coagulada en el pecho. Tambin
se han encontrado cadveres enteros del extinto rinoceronte lanudo
en yacimientos de petrleo en Polonia.1
El uso de fsiles con el propsito de calcular la edad de las rocas
fue desarrollado durante los siglos XVII al XIX, como parte del
avance de la ciencia estratigrfica. En 1669, un doctor dans de1

1 C. O. Dunbar, Fossil, McGraw-Hill Encyclopedia o f Science and Technology (New


York: McGraw-Hill Book Company, 1960), t. 5, p. 473. Ver tambin: I.P. Tolmachoff,
The Carcasses of the Mammoth and Rhinoceros Found in the Frozen Ground of Siberia,
Transactions o f the American Philosophical Society, vol. 23 (1929), pp. 11-74.
nombre Niels Stensen (o Nicolaus Steno) propuso que los estratos,
o capas de roca, se depositan horizontalmente de manera secuen-
cial, de manera que en una sucesin sedimentaria no alterada, r^da
estrato de roca es anterior al estrato superior. Esta secuencia puede
ser alterada, e incluso invertida, por movimientos del terreno pos
teriores a su deposicin; entonces, los estratos aparecen inclinados
o incluso perpendiculares respecto del horizonte. Si una formacin
rocosa, como una intrusin de material magmtico o una disconti
nuidad, como una falla, corta o atraviesa un grupo de estratos, esta
tiene que haberse formado despus de la deposicin en dichos estra
tos. Utilizando estas leyes estratigrficas, los gelogos pueden deter
minar las edades relativas de las capas de roca de una formacin ro
cosa, igual que los eventos geolgicos que han tenido lugar durante
su historia. En 1799, un gelogo britnico llamado William Smith
propuso que las secuencias de estratos podran estar correlacionadas
entre un rea y otra. Por ejemplo, al comparar los fsiles de cada a
capa, las secuencias de estratos en Inglaterra podan correlacionarse
con las de branda. Smith haba estado trabajando con una larga
secuencia de formaciones ricas en fsiles que alternaban calizas y es
quistos en el sur de Inglaterra. Despus de recolectar muchas mues
tras de roca, percibi que cada uno de los estratos tena un conjunto
nico de fsiles que poda ser usado para reconocer dicho estrato
particular en otros afloramientos rocosos. Lo que Smith descubri
se conoce como el Principio de sucesin faunstica. Combinando
este principio con la ley de superposicin de estratos de Steno, se
llega a la conclusin de que los fsiles de los estratos inferiores son
ms antiguos que los fsiles de los estratos superiores.
En 1785, unos pocos aos antes de que Smith propusiera el
principio de sucesin faunstica, el gelogo escocs James Hut-
ton public su trabajo Theory o fth e Earth [Teora de la Tierra],
en el que presento su Principio del uniformitarianismo. Este
principio sent los cimientos para el establecimiento de un nuevo
paradigma que cambiara por completo la geologa de la poca,
y cuyos resultados perduran hasta la actualidad. H utton propu
so que las leyes naturales y los procesos geolgicos que han ido
moldeando la Tierra a lo largo de perodos muy largos de tiempo
en el pasado son exactamente los mismos que actan hoy, y que
seguirn hacindolo en el futuro de la misma manera y a la misma
velocidad. Por lo tanto, los procesos geolgicos observados actual
mente pueden ser usados no solo para explicar los que ocurrieron
en el pasado, sino tambin para calcular cundo ocurrieron.
Tres dcadas despus, Charles Lyell, otro gelogo britnico, es
tudi los fsiles de los Alpes europeos y concibi la idea de divi
dir el sistema de estratos rocosos en grupos, segn la proporcin
entre conchas marinas de especies recientes y de especies extintas
presentes. Lyell haba notado que los fsiles de las capas ms al
tas, y por lo tanto las ms recientes, parecan ms complejos que
los fsiles de los estratos inferiores, ms antiguos. Esto le sugiri
que el tipo de fsiles poda ser usado para establecer el orden de
deposicin de los grupos de estratos y para relacionar formaciones
de distintas localidades. Lyell propuso nombres para estos grupos,
que posteriormente fueron asumidos universalmente por los ge
logos: Eoceno, que significa Nuevo amanecer; Mioceno, Menos
reciente; y Plioceno, Ms reciente. Tambin public una tabla
de las conchas correspondientes a la clasificacin. La idea de Lye
ll de correlacionar el contenido fsil de los estratos rocosos y el
tiempo geolgico apareci por primera vez su el trabajo The Prin
cipies ofGeology [Principios de la Geologa], entre los aos 1830 y
1833. Promovi el concepto de columna geolgica, que fue de
sarrollado durante las dcadas siguientes por l mismo, junto con
otros gelogos. Dado que Lyell haba asumido el punto de vista
del uniformitarianismo de H utton, propuso que la formacin
de las capas fue consecuencia de los procesos de compresin y el
aumento de temperatura que sufren los sedimentos arrastrados
por los agentes geolgicos tras acumularse lentamente en deltas
de ros, en lagos y mares. Lyell realiz sus propias observaciones
para calcular las tasas extremadamente lentas a las que se produ
cen los procesos geolgicos en la actualidad, y las utiliz para es
timar largas edades para las formaciones geolgicas. Una de las
estimaciones ms influyentes de Lyell fue su clculo de la edad del
desfiladero de las Cataratas del Nigara, que fue utilizado poste
riormente para demoler la creencia cientfica en el diluvio bblico.
sv u u lk k ?;?5 S Ei

En tiempos de Lyell, la Universidad de Oxford todava inclua en


la enseanza de la geologa el diluvio bblico universal, como un
evento histrico que ocurri hace aproximadamente 4.500 aos.2
El arzobispo James Ussher haba calculado, a partir del registro
bblico y las fechas estimadas para el reinado del rey Salomn, que
el diluvio global ocurri alrededor del ao 2349 a.C.3 Cuando
Lyell visit las cataratas en 1841, un habitante local le cont que
las cataratas retrocedan alrededor de 90 centmetros cada ao.
Lyell supuso que esta era una afirmacin exagerada, y estim que
una velocidad de recesin ms probable era, aproximadamente,
30 centmetros al ao.4 A partir de la longitud del desfiladero,
de un poco ms de 10.500 metros, Lyell calcul una antigedad
aproximada de 35.000 aos. Esta cifra fue ampliamente aceptada
y sirvi de prueba, en las mentes de muchos cientficos, de que
el m undo deba ser mucho ms viejo que las fechas calculadas
segn el registro bblico. Es revelador notar que la velocidad de
30 centmetros al ao estaba basada sobre una conjetura personal
de Lyell, y no en una medicin cientfica; pero, aun as, tuvo un
efecto profundo sobre la cosmovisin de la comunidad cientfica
en relacin con la aceptabilidad de largas edades de las rocas y el
registro fsil. Mediciones posteriores mostraron que la velocidad
de erosin era, de hecho, mucho ms rpida: alrededor de 120 a
150 centmetros al ao.6 Si Lyell hubiera realizado su clculo uti
lizando la erosin real, habra determinado la edad del can en
unos 7.000 aos, fecha bastante ms prxima a las estimaciones
propuestas para el diluvio. Si prescindimos del uniformitarianis-
mo y suponemos que la velocidad de erosin pudo ser ms rpida

21. T. Taylor, In the Minds ofM en (Toronto, Caada: TFE Publishing, 1984), p. 66.

3James Ussher, The Aunis ofthe World (1658). Revisado y actualizado por L. Pierce y M.
Pierce (Green Forest, AR: Master Books, 2003), p. 22.

4C. Lyell, Principies ofGeology, 10 ed. (London: John Muiray, 1867), t. 1, p. 361.
5Taylor, ibd., pp. 82, 83.

6W.M. Tovell, The Niagara River (Toronto, Caada: Royal Ontario Museum Publication
1979), p. 16.
en el pasado, por ejemplo, durante la retirada masiva de las aguas
del diluvio, la antigedad se acortara y sera perfectamente com
patible con el relato bblico. Dado que en realidad no sabemos
con certeza cul era la velocidad de recesin antes del siglo XVIII,
no es posible determinar la edad del can por este mtodo. La
posicin oficial del gobierno de Ontario sobre la edad de las ca
taratas es que tienen 12.500 aos. Sin embargo, esta cifra no est
calculada a partir de las tasas de erosin, sino que proviene de esti
maciones generales, basadas sobre teoras de actividad glacial en el
rea durante la pasada edad de hielo, que tambin sugieren que la
circulacin de agua en las cataratas ha variado considerablemente
con el tiempo.7
Aunque Lyell no tena evidencias cientficas demostradas para
sus largas edades, sus teoras sobre la edad de las rocas tuvieron
una amplia aceptacin. A partir de las tasas de erosin de las
rocas y de acumulacin de sedimentos aluviales en la actualidad,
Lyell estim la velocidad de formacin de los diferentes estratos.
M idiendo el grosor de los estratos, poda calcularse el perodo
de tiempo que corresponda a cada estrato. Dado que Lyell ha
ba observado que haba estratos sedimentarios de miles de me
tros de espesor que contenan millones de capas finas, lleg a
la conclusin de que los estratos inferiores, as como los fsiles
que contienen, deban tener millones de aos de antigedad.
Esta metodologa permiti calcular los perodos de tiempo in
dividuales correspondientes a diferentes estratos de la columna
geolgica. Sumando estos perodos de tiempo, se calcul la edad
total de las rocas de las diferentes secciones. Una vez establecida
la antigedad de cada estrato y grupos de estratos, sus conteni
dos fsiles fueron asignados a perodos de tiempo especficos y
empezaron a usarse para datar rocas con esa combinacin con
creta de fsiles.
Ninguna regin del m undo contiene un registro completo del
tiempo geolgico; aunque algunos afloramientos, como el Gran

7Ver: www.magaraparks.com/media/geology-facts-figures.htmI.
Can del Colorado, muestran estratos de roca que, en trminos
de tiempo geolgico convencional, corresponderan a cientos de
millones de aos. No obstante, diferentes partes del registro apare
cen en distintas regiones, y la existencia de secuencias parcialmente
solapadas ha permitido establecer correspondencias entre distintas
regiones. Por ejemplo, cuando se observa el mismo patrn de capas
alternas de caliza y de esquisto con fsiles similares en dos regiones
diferentes, se asume que estas tienen la misma antigedad. Si en
una de las regiones las capas de caliza y de esquisto se encuentran
en la parte inferior del afloramiento, y en la otra se encuentran en la
parte superior, los datos procedentes de ambas regiones se pueden
unir para reconstruir una secuencia ms extensa. As pues, la co
lumna geolgica que aparece en los libros de texto no se encuentra
tal cual en ningn afloramiento, sino que es un constructo terico
creado a partir de secuencias observadas en diferentes lugares, con
la colaboracin de gelogos de todo el mundo.
La escala de tiempo geolgico correspondiente a la columna
geolgica se calcul a partir del grosor de los estratos, consideran
do tasas constantes de erosin y de sedimentacin. Siguiendo la
idea del uniformitarianismo, se asumi que estas tasas haban per
manecido esencialmente constantes durante cientos de millones
de aos. Hasta el desarrollo de la datacin radiomtrica (que se
discutir en mayor profundidad en un captulo posterior), las es
timaciones de tiempo geolgico variaban hasta en un factor diez.8
La escala de tiempo geolgico convencional, aceptada actual
m ente por la com unidad cientfica, asigna a la Tierra 4.500 m i
llones de aos de antigedad, y divide este perodo de tiempo en
eones, eras, perodos y pocas.
El en Precmbrico abarca desde hace 4.500 millones de
aos (MA) hasta hace 542 MA.

El en Fanerozoico abarca desde hace 542 M A hasta el


presente, y se divide en tres eras:

8 J. L. Kulp, Geological Time Scale, McGraw-Hill Encyclopedia o f Science and Tech


nology, t. 6, p. 135.
EL K t.L rf KO rU'oL

La era Paleozoica, que abarca desde hace 542 M A hasta hace


251 MA, y se divide en siete perodos:
Cmbrico: 542-488 MA.
Ordovcico: 488-444 MA.
Silrico: 444-416 MA.
Devnico: 416-359 MA.
Misisipiense: 359-318 ALA.
Pensilvano: 318-299 MA.
Prmico: 299-251 MA.

La era Mesozoica, que abarca desde hace 251 M A hasta hace


65,5 MA, con tres perodos:
Trisico: 251-199,6 MA.
Jursico: 199,6-145,5 MA.
Cretcico: 145,5-65,5 MA.

Y la era Cenozoica, que abarca desde hace 65,5 millones de


aos hasta el presente, y se divide en dos perodos:
Terciario: abarca desde hace 65,5 M A hasta hace 1,8 MA. Se
divide en cinco pocas: Paleoceno, Eoceno, Oligoceno, Mioce
no y Plioceno.
Cuaternario: abarca desde hace 1,8 ALA. hasta el presente. Se
divide en dos pocas: Pleistoceno y Holoceno.9

Hasta aqu, hemos descrito las bases histricas por las cua
les el registro fsil ha llegado a ser considerado una prueba de
la evolucin. Clculos de tasas de erosin y deposicin basadas
sobre el uniformitarianismo dieron lugar a estimaciones de lar
gas edades para los estratos de la columna geolgica, que fue
ron ampliamente aceptados sin discusin porque establecan el
marco temporal necesario para la evolucin biolgica. La ob
servacin, generalmente cierta, de que los fsiles aum entan en
complejidad a medida que se asciende en la columna, junto con

9E. J. Tarbuck y F. K. Lutgens, Earth Science, 12 ed. (Upper Saddle River, NJ: Pearson
Education, International, 2009), pp. 10, 328.
datos posteriores procedentes de dataciones radiomtricas, su
pusieron apoyo adicional para este paradigma geolgico, que ha
perdurado hasta la actualidad. As pues, la mayora de los textos
universitarios en uso citan el registro fsil como evidencia de la
evolucin.10 Cabe preguntarse, sin embargo, si un cambio de pa
radigma con distintas asunciones de base perm itira interpretar
la evidencia del registro fsil de otra manera, y alcanzar conclu
siones cientficamente validas aunque completamente diferen
tes. Dedicaremos el resto del captulo a resolver esta cuestin.
En prim er lugar, es im portante notar que prcticamente
todos los fsiles se encuentran en rocas sedimentarias; es decir,
en rocas que se han formado bajo el agua.
En segundo lugar, las rocas sedimentarias que contienen
fsiles se encuentran en todo el m undo. Esto significa que la de
posicin de los sedimentos que dieron lugar a estas rocas abarc
grandes extensiones y enterr a millones de organismos durante,
supuestamente, millones de aos.
En tercer lugar, el proceso de fosilizacin requiere que plan
tas y animales sean enterrados rpidamente, de manera que no se
descompongan, sean ingeridos por otros animales o se degraden
a causa de los agentes ambientales. Muchos de los animales que
encontramos fosilizados, como las ballenas y los dinosaurios,
son de gran tamao; por lo tanto, fueron necesarios grandes vo
lmenes de sedimentos para su enterramiento. Esto sugiere que
algunos fsiles solo podran formarse bajo lo que llamaramos
condiciones catastrficas. De hecho, es m uy difcil que inclu
so los fsiles ms pequeos se hayan formado en condiciones
lentas de sedimentacin como las actuales, donde en muchos
ambientes solo se depositan unos pocos milmetros de sedimen
to al ao. El uniformitarianismo asume que las condiciones del
pasado fueron iguales a las del presente, pero en la actualidad no
se observan plantas ni animales en proceso de f o s iliz a c i n
En cuarto lugar, el registro fsil muestra un gran nm ero de

10Ver, por ej.: Linda R. Berg, Diana W. Martin y Eldra P. Solomon, Biology, T ed. (Bel-
mont, CA: Thomson, Brooks/Cole, 2005), pp. 389-401.
especies de plantas y animales del pasado que hoy ya no existen.
Ya hemos mencionado que se calcula que entre un 98% y un
99% de las diferentes especies que habitaron el planeta estn ex
tintas. El registro fsil puede considerarse, entonces, una prueba
clara de la extincin de mltiples formas de vida.
A lo largo de los ltimos 2.000 aos, se ha registrado todo tipo de
observaciones cientficas, cuya cantidad se ha ido incrementando,
especialmente en los ltimos tres siglos. Sin embargo, no se ha ob
servado que se fosilicen las huellas dejadas en playas arenosas; tam
poco se ha descubierto en nuestras costas o en los deltas de los ros
evidencias de fosilizaciones recientes de estrellas de mar, cangrejos,
algas o aves marinas. Las recientes inundaciones en Queensland,
Australia, acabaron con la vida de miles de canguros, lagartos y
otros animales, pero no se ha observado que los restos de estos orga
nismos se encuentren ni siquiera en las primeras fases del proceso de
fosilizacin. Los peridicos no informan de ningn evento natural
que haya causado la fosilizacin de miles de pinginos, osos polares,
ballenas, langostas, peces o conejos. Ni siquiera la caza indiscrimi
nada de bisontes en las praderas de los Estados Unidos durante el
siglo XIX, que llev a la especie al borde de la extincin, result en la
acumulacin de grandes cantidades de fsiles de bisontes. En otras
palabras, bajo las condiciones que producen los depsitos aluviales
en la actualidad, y que fueron utilizadas por Lyell en sus clculos
de la antigedad de las formaciones rocosas, no se observa la for
macin de fsiles; y no parece que esta sea posible. La existencia
de lechos de fsiles que contienen grandes cantidades de restos o
de especmenes de gran tamao indica que estos fsiles se forma
ron debido a procesos catastrficos ocurridos en el pasado, y por lo
tanto, que las suposiciones del uniformitarianismo no se cumplen.
La presencia de millones de organismos fosilizados en lechos fsiles
de miles de metros de espesor sugiere la accin de procesos geol
gicos masivos a una escala mucho mayor que cualquier cosa que
haya ocurrido en la Tierra durante los ltimos miles de aos. Si el
uniformitarianismo no es aplicable a la formacin de los fsiles, este
hecho invalida las estimaciones de la edad de las rocas sedimenta
rias, de los fsiles que contienen y de la vida sobre la Tierra que se
han calculado siguiendo este principio. El gelogo investigador Dr.
Andrew Snelling, de la Universidad de Sidney, describe ejemplos de
grandes cementerios de fsiles que ilustran la escala y la magnitud
de los procesos de fosilizacin del pasado.*11 La Formacin Morrison
y otras equivalentes incluyen extensos cementerios de fsiles que
se extienden desde Nuevo Mxico hasta Canad, cubriendo una
superficie de 1,5 millones de kilmetros cuadrados. Esta formacin
consta de capas de piedra caliza, lodolita, limolita y arenisca, con
capas superiores de conglomerado que contienen abundantes restos
de dinosaurios, incluyendo segmentos esquelticos semiarticulados
relativamente intactos. Se ha descubierto restos de muchos tipos
diferentes de dinosaurios, entre los que se encuentran los famosos
estegosaurios y los saurpodos, dinosaurios gigantes que alcanzaban
30 metros de longitud. Imagine las proporciones catastrficas de
un evento capaz de arrastrar y enterrar a estos grandes animales.
Junto con los restos de dinosaurios, se encuentran fsiles de peces,
ranas, salamandras, lagartijas, cocodrilos, tortugas, cangrejos de ro
y almejas, as como pterosaurios, los lagartos voladores conocidos
como pterodctilos. Esto sugiere que las mismas especies de anima
les que existen hoy existan tambin en el pasado, conviviendo con
animales como los dinosaurios, que estn ahora extintos. Un punto
para destacar con respecto a este cementerio es que tanto los dino
saurios terrestres como los animales acuticos fueron enterrados en
una enorme formacin de arenisca conglomerada, que se deposit
a partir de agua movindose a gran velocidad.12
O tro cementerio espectacular de dinosaurios se ha encontrado
en la Cuenca de Nemgt, en Mongolia, donde cientos de esquele
tos articulados bien conservados de estos animales se hallan ente
rrados junto a esqueletos de mamferos, lagartijas y aves. Muchos
de los crneos estn prcticamente completos, con las mandbulas
inferiores en su lugar, incluso con partes de las orejas conservadas.

11A. A. Snelling, Earths Catastrophic Past (Dallas TX: Institute for Creation Research,
2009), t. 2, pp. 487-577.

llIbd p. 571.
En las montaas de Cedarberg, en Sudfrica, la formacin
Soom Shale contiene miles de fsiles excepcionalmente bien
conservados de braquipodos, nautiloideos, artrpodos y co-
nodontos, en diferentes localizaciones distribuidas a lo largo
de cientos de kilmetros. La preservacin de estos fsiles es tan
extraordinaria que se aprecia en todo su detalle los rganos sen
soriales, los apndices locomotores, las masas musculares fibro
sas y aun las branquias de los artrpodos, igual que los tractos
digestivos de los conodontos.
En la formacin de esquistos Cow Branch, situada en la fron
tera entre Virginia y Carolina del Norte, en Estados Unidos, se
han conservado abundantes fsiles de insectos completos. Asi
mismo, hay fsiles de vertebrados de los que se preservaron las
partes blandas, y tambin muchos especmenes articulados de
reptiles acuticos, cuya fosilizacin es tan perfecta que se aprecia
hasta la silueta de los msculos de la cola y los ligamentos de
las patas palmeadas traseras. Esta formacin contiene una gran
cantidad de organismos terrestres, marinos y de agua dulce en
terrados y fosilizados juntos, en un estado de excelente conserva
cin. Segn seala el Dr. Snelling, estos depsitos sugieren una
deposicin y un enterramiento catastrficos.13
Uno de los ejemplos ms espectaculares de las condiciones catas
trficas que prevalecieron en la Tierra y cuyo resultado fue la vasta
destruccin de la vida, y su subsiguiente enterramiento y fosiliza
cin, son los lechos cretcicos de creta, como los famosos acantilados
blancos de Dover, en la costa sureste de Gran Bretaa. Estos lechos
se extienden a travs de Europa, desde Irlanda hasta Turqua, Egipto
e Israel, y tambin se encuentran en partes de Estados Unidos y en
la costa de Australia Occidental. Se trata de una distribucin global
de lechos uniformes de creta de hasta 100 metros de espesor, for
mados por caparazones de carbonato clcico de criaturas marinas
microscpicas. Tambin contienen fsiles de animales marinos de
mayor tamao, como gasterpodos, ammonites y belemnites.

13Ibd., pp. 543, 544.


El eminente gelogo y paleontlogo Dr. W illiam A. Cobban
afirma que la deposicin de enormes yacimientos de creta a lo
largo del m undo se corresponde con la poca de mayor inunda
cin de la superficie terrestre, y que el cierre de este perodo fue
marcado por la extincin de los dinosaurios, los reptiles vola
dores y los grandes reptiles marinos, as como de los ammonites
y algunos otros grupos de moluscos marinos.14 Segn podemos
ver, el registro fsil es un registro continuo de extinciones masi
vas en un ambiente marino.
El Dr. John Avise y sus colegas del Departamento de Ecolo
ga y Biologa Evolutiva de la Universidad de California, sealan
extinciones masivas registradas al final del perodo Ordovcico, y
durante los perodos Devnico, Prmico, Trisico y Cretcico.15
Los estratos que corresponden a estos perodos geolgicos mues
tran un enterramiento de animales tan catastrfico que elimin
permanentemente a muchas especies. La extincin del final del
Ordovcico result en la desaparicin de un tercio de todas las
familias de braquipodos y briozoos, igual que de numerosos gru
pos de conodontos, trilobites y graptolites. En total, ms de 100
familias de invertebrados marinos, y gran parte de la fauna cons
tructora de arrecifes, fueron destruidas. La extincin de la ltima
parte del perodo Devnico afect al 70% de los invertebrados
marinos, incluyendo organismos constructores de arrecifes, bra
quipodos, trilobites, conodontos, agnatos y placodermos. La ex
tincin en masa del Prmico es la ms evidente del registro fsil,
con un total de 90% al 95% de especies marinas eliminadas. La
fauna desaparecida est comprendida por foraminferos fusuli-
nidos, trilobites, varios tipos de corales, blastoideos, acantodios,
placodermos y pelicosaurios. Otros grupos de organismos que

,4W. A. Cobban, Cretaceous, McGraw-Hill Encyclopedici o f Science and Technology,


t. 3,p. 542.

15J. C. Avise, S. P. Hubbell y F. J. Ayala, In the Light of Evolution II: Biodiversity andEx-
tinction, Proceedings o f the National Academy o f Sciences, vol. 105, supl. 1 (12 de agosto
de 2008), pp. 11.453-11.457. En lnea: www.pnas.org/content/105/Supplement_l/11453.
full.pdf
perdieron cantidades sustanciales de especies contienen briozoos,
braquipodos, ammonoideos, tiburones, peces seos, crinoideos,
euriptridos, ostrcodos y equinodermos. A pesar de ser la segun
da en importancia, la extincin que tuvo lugar al final de Cretci
co genera un mayor inters entre el pblico porque incluye la des
aparicin de los dinosaurios. Otros tipos de organismos barridos
en este m omento fueron los pterosaurios, la gran mayora de las
aves, los belemnoideos, los ammonoideos, los rudistas bivalvos,
reptiles marinos y muchas especies de plantas. Ms informacin
sobre los efectos de estas extinciones se puede encontrar en el sitio
web del Centro de Geociencias de Ottawa-Carleton.16
Las dataciones convencionales asignan largos perodos de tiempo
a cada una de estas extinciones y las sitan, en el tiempo geolgico,
separadas por millones de aos. Curiosamente, en todos los casos
se trata de eventos de extensin mundial que implican condiciones
marinas catastrficas: entierros en masa y grandes cantidades de agua
en movimiento. Una interpretacin alternativa sera considerar que
las formaciones rocosas correspondientes a las grandes extinciones
se crearon sucesivamente durante un evento catastrfico global, por
lo que cada una de ellas requiri un perodo corto de tiempo (das o
semanas). Un ejemplo de la velocidad a la que pueden formarse los
estratos durante eventos geolgicos extraordinarios es lo que ocurri
durante y despus de la erupcin del monte St. Helens, el 18 de
mayo de 1980. Flujos de gas caliente y fragmentos de piedra p
mez, movindose a una velocidad estimada de 150 kilmetros por
hora, produjeron estratos laminados en unas pocas horas; estratos
que, de haber sido datados a partir de las tasas normales de deposi
cin, habran correspondido a miles de aos. A las pocas semanas,
el 12 de junio de 1980, un grueso lecho de 20 metros de espesor
conformado por mltiples estratos fue depositado durante una sola
tarde. Dos aos despus, el 19 de marzo de 1982, una pequea
erupcin derriti la nieve del interior del crter y desplaz el agua,
creando una poderosa corriente de lodo de 32 kilmetros, que cor

16Ver: www.park.org/Canada/Museum/extinction/extincmenu.html.
t un can de 43 metros de profundidad a travs de roca slida.
Los gelogos pudieron constatar la formacin de un Gran Can
en miniatura en un da, bajo condiciones catastrficas.17 A partir
de estas situaciones recientes, podramos interpretar el registro fsil
como evidencia de grandes catstrofes martimas y volcnicas en
todo el mundo. Y, teniendo en cuenta que las formaciones creadas
tras la erupcin del monte St. Helens demuestran que el principio
del uniformitarianismo no puede aplicarse para calcular las edades
de las rocas, podramos tambin interpretar que todas las extincio
nes registradas ocurrieron en realidad durante un nico evento de
inundacin universal, y no en media docena de grandes inundacio
nes separadas por millones de aos, o miles de inundaciones locales
a lo largo de miles de millones de aos. Si conseguimos escapar del
paradigma del uniformitarianismo, el registro fsil puede interpre
tarse claramente como una evidencia de un diluvio global catas
trfico que extermin la flora y la fauna que exista sobre la Tierra
hace apenas unos pocos miles de aos. Examinemos ms evidencias
cientficas que apuntan en esta direccin.
En la ciudad de Zhucheng, en China, se ha descubierto ms de
3.000 huellas fsiles de seis especies diferentes de dinosaurio, inclu
yendo tiranosaurios, celurosaurios y hadrosaurios. Todas las huellas
tienen la misma orientacin, lo que sugiere enrgicamente que estos
animales estaban huyendo de alguna catstrofe.18 Otros fsiles ex
puestos en museos, como el de un ictiosauro dando a luz (Museo
de Historia Natural de Stuttgart) o un pez percha comindose un
arenque (Museo de Historia Natural de Princeton), son claros indi
cadores de un entierro y una fosilizacin muy rpidos.19
En 2005, la Dra. Mary Schweitzer, profesora asociada de Cien
cias Atmosfricas, Marinas y Terrestres de la Universidad Estatal de
Carolina del Norte, y sus compaeros de trabajo, comunicaron el

17John Morris y Steven A. Austin, Footprints in the Ash: The Explosive Story o f Mount St.
Helens (Green Forest, AR: Master Books, 2005), pp. 52, 53, 62,74-76.

18Ver: news.bbc.co.uk72/hi/science/nature/8502076.stm.

191. T. Taylor, In the Minds ofM en (Toronto, Caada: TFE Publishing, 1984), pp. 88, 89.
descubrimiento en la Argentina de cscaras de huevo de dinosaurios
saurpodos excepcionalmente bien conservadas. Debido a que el
tejido blando de los embriones se degrada rpidamente despus de
su muerte, los investigadores afirman que la velocidad de minera-
lizacin debi haber sido prcticamente instantnea, para que se
hayan podido conservar y fosilizar los tejidos blandos.20
La interpretacin de una edad relativamente reciente para los
fsiles ha quedado respaldada por el hallazgo de protenas, A D N
y tejido blando en fsiles de dinosaurio. Estas biomolculas se
degradan con rapidez y no pueden sobrevivir durante millones
de aos. Se calcula que si la tem peratura media de las rocas fuera
de 10 C, el A D N desaparecera completamente de los restos
fsiles despus de 20.000 aos. A una tem peratura media de
20 C, el A D N se habra descompuesto totalm ente y no sera
detectable despus de aproximadamente 2.500 aos.21 Sin em
bargo, cientficos de la Universidad de California informaron
en 1990 que haban extrado A D N de muestras de hojas fsiles
procedentes de los yacimientos de fsiles de Clarkia, en Idaho,
lo cual fue confirmado posteriormente por otros equipos cien
tficos.22 De acuerdo con la datacin convencional, estos yaci
mientos pertenecen al M ioceno, con lo que se les asignan edades
de entre 17 y 20 millones de aos.23 N o obstante, la existen
cia de fragmentos de A D N que pueden ser recuperados sugiere
que la antigedad de las hojas fsiles de Clarkia es solamente
de unos miles de aos. En 1991, los cientficos de la Divisin

20 M. H. Schweitzer, L. Chiappe, A. C. Garrido, et al., Molecular Preservation in Late


Cretaceous Sauropod Dinosaur Eggshells, Proceedings ofthe Royal Society B: Biological
Sciences, vol. 272 (2005), pp. 775-784.

21 C. Nielsen-Marsch, Biomolecules in Fossil Remains, Multidisciplinary Approach to


Endurance, The Biochemist (junio de 2002), pp. 12-14.

22S. Kim, D. E. Soltis, P. S. Soltis y Y. Suh, DNA Sequences from Miocene Fossils: An
NDHF Sequence and an RBCL Sequence of Persea Pseudocarolinesis (Lauraceae), Ame
rican Journal ofBotany, vol. 9 (2004), pp. 615-620.

23E. M. Golenberg, D. E. Giannasi, M. T. Clegg, et al.,Letters to Nature, vol. 344 (22 de


abril de 1990), pp. 656-658.
de Ciencias Naturales del Laboratorio Nacional de Los lamos,
de Nuevo Mxico, extrajeron protenas de las vrtebras de un
fsil de dinosaurio saurpodo (seismosaurio) procedente de la
formacin M orrison de Nuevo Mxico, con una antigedad es
tim ada de 150 millones de aos.24 Seis aos ms tarde, la Dra.
M ary Schweitzer y sus compaeros de la Universidad Estatal de
M ontana comunicaron el descubrimiento de un fragmento de
hueso de Tyrannosaurus rex que contena glbulos rojos con he
moglobina,25 hallazgo que provoc controversia y escepticismo
en la com unidad cientfica. A pesar de la polmica, Schweitzer y
sus colegas continuaron buscando ejemplos de tejido blando en
muestras de dinosaurio, y descubrieron tejidos elsticos flexibles
(matriz sea, vasos sanguneos y clulas) en el interior del miem
bro trasero de otro esqueleto de Tyrannosaurus rex. Los investi
gadores llegaron a la conclusin de que se haba demostrado,
sin duda, la existencia de restos de tejido blando no fosilizados
en extremidades de dinosaurio.26 Otros investigadores empe
zaron tambin a buscar evidencias de tejido blando en restos
de dinosaurios, y encontraron un material de tipo proteico en
huesos del dinosaurio Iguanodon, cuya edad estimada es de 120
millones de aos, alrededor del doble de la edad estimada para
los restos de Tyrannosaurus rex. El material orgnico recuperado
todava era capaz de inducir una respuesta inmunolgica.27

24L. R. Gurley, J. G. Valdez, W. D. Spall, el al., Proteins in the Fossil Bone of the Dino-
saur, Seismosaurus, Journal ofProtein Chemistry, vol. 10 (febrero de 1991), pp. 75-90.

25M. H. Schweitzer, M. Marshall, K. Carrn, et al., Heme Compounds in Dinosaur Trabe-


cular Bone, Proceedings ofthe National Academy o f Sciences ofthe USA, vol. 94 (1997),
pp. 6.291-6.296.

26 M. H. Schweitzer, J. L. Wittmeyer, J. R. Homer y J. K. Toporski, Soft-Tissue Vesse-


ls and Cellular Preservation in Tyrannosaurus rex, Science, vol. 307 (2005), pp. 1.952-
1.955; M. H. Schweitzer, J. L. Wittmeyer y J. R. Homer, Soft Tissue and Cellular Preser
vation in Vertbrate Skeletal Elements from the Cretaceous to the Present, Proceedings of
the Royal Society B: Biological Sciences, vol. 274 (2007), pp. 183-197.

27G. Embery, A. C. Milner, R. J. Waddington, et al., Identification of Proteinaceous Ma


terial in the Bone of the Dinosaur Iguanodon, Connect Tissue Res, vol. 44, supl. 1 (2003),
El descubrimiento de tejidos blandos conservados en fsiles arroja
serias dudas sobre sus supuestas edades de decenas de millones de
aos. El conocimiento experimental que tenemos sobre la estabilidad
de los materiales biolgicos indica que no es posible que dichos teji
dos sobrevivan durante millones de aos sin descomponerse. Algunos
cientficos han intentado refutar estos hallazgos, pero su veracidad ha
quedado confirmada recientemente por un artculo publicado en la
revista Science, en mayo de 2009. En este artculo, cientficos de la
Universidad Estatal de Carolina del Norte informaban de la recupe
racin de un fmur del dinosaurio pico de pato, Brachyhphosaurus
canadensis, encontrado bajo 7 metros de arenisca en la Formacin del
Ro Judith, en Montana oriental. El anlisis del hueso revel tejidos
blandos y materia sea, de donde se aislaron protenas de colgeno
y clulas seas, y se identificaron partes de la secuencia de ADN.
Dado que los trabajos publicados anteriormente informando sobre
la presencia de tejidos blandos en fsiles de Tyrannosaurus rex haban
sido polmicos, todos los resultados de este estudio fueron verificados
independientemente por investigadores del Beth Israel Deaconess
Medical Center, de la Universidad de Harvard y de la Universidad
del Estado en Montana.28 El indiscutible descubrimiento de tejido
blando en fsiles de dinosaurio es una evidencia a favor de edades
cortas para las especies fsiles, y en contra de la evolucin.
Otras evidencias en contra de la evolucin gradual a lo largo de
millones de aos es la aparicin repentina de nuevas especies de
animales en el registro fsil, sin que se hubiesen encontrado los
supuestos intermedios evolutivos. En la mayora de las rocas del
Precmbrico, nombre asignado a la primera y ms larga etapa de la
historia de la Tierra, encontramos muy pocos tipos de organismos;
hay solo un puado de fsiles de lo que se cree que eran bacterias y
algas primitivas. Sin embargo, al llegar a las rocas del Precmbrico
tardo, cuya antigedad se estima entre 600 y 540 millones de aos,
aparecen repentinamente fsiles de medusas, corales y anmonas,

28M. H. Schweitzer, W. Zheng, C. L. Organ, et a l, Bioraolecular Characterisation and


Protein Sequences of the Campanian Hadrosaur B. Canadensis, Science, vol. 324 ( I o de
mayo de 2009), pp. 626-631.
' i.T

similares a las especies actuales. La informacin gentica de estos


animales es muy diferente de la de las bacterias y las algas, y si evo
lucionaron a partir de ellas deberamos encontrar organismos con
caractersticas intermedias en las rocas que los separan. Aun as, no
se ha encontrado ninguna evidencia de ese proceso de evolucin.
Incluso ms sorprendente es la aparicin repentina de un pequeo
animal segmentado de siete centmetros de longitud, llamado sprig-
gina, con cabeza y patas, que se encuentra en rocas del Precmbrico
tardo de Australia, de Africa y de Rusia.29 La cantidad de informa
cin gentica necesaria para codificar la cabeza, la cola y mltiples
segmentos corporales es enorme. No existen evidencias fsiles de
organismos intermedios con cuerpos en proceso de desarrollo o en
las primeras fases de formacin de una cabeza. Tampoco hay una
explicacin plausible de cmo pudieron aparecer cantidades tan
grandes de nueva informacin gentica en un perodo relativamen
te breve de tiempo geolgico.
Justo encima de la frontera con el Precmbrico tardo, se en
cuentran las rocas del Cmbrico, que contienen fsiles comple
tamente formados de animales genticamente muy diversos; de
nuevo, sin fsiles intermedios. En las rocas del Cmbrico encon
tramos fsiles de gusanos segmentados, caracoles, mariscos, erizos
de mar, conodontos, nautilos y trilobites. Los trilobites, fsiles
m uy comunes en las rocas cmbricas,30 tienen ojos y patas seg
mentadas. La cantidad de nueva informacin gentica necesaria
para producir ojos con todos sus detalles, componentes y mecanis
mos de enfoque, as como patas con todas sus partes mecnicas y
nerviosas, es enorme; pero tampoco se han encontrado evidencias
fsiles de animales con patas u ojos parcialmente desarrollados.
De acuerdo con la Teora de la Evolucin, los animales alta
m ente complejos, tales como trilobites y nautiloideos, evolucio
naron durante perodos de tiempo m uy largos. Si esto es cierto,

29C. Walker y D. Ward, Smithsonian Handbooks: Fossils (New York: Dorling Kindersley,
2002), pp. 44.

mIbd., pp. 56-65.


su evolucin debera haber quedado reflejada en el registro fsil;
con todo, no encontramos evidencia alguna de que esto haya
ocurrido. Si examinamos los estratos por debajo de los trilobi-
tes del Cmbrico inferior de Noruega, encontramos 1.200 me
tros de estratos que no contienen ningn fsil. En Marruecos,
encontramos 900 metros que contienen fsiles de organismos
constructores de arrecifes, llamados arqueociatos, y bajo estos,
3.000 metros de piedra caliza que contienen solamente estro-
matolitos, es decir, fsiles de algas. En las montaas Inyo de
California, hay una formacin de ms de 4.200 metros de gro
sor que contiene fsiles de trilobites y arqueociatos, sobre 2.100
metros de estratos no fosilferos. El Profesor W. Charles Bell, ex
profesor de Geologa en la Universidad de Texas, seala que esta
misma estructura de estratos no fosilferos de miles de metros
de grosor que subyacen inmediatamente a las formaciones de
trilobites del Cmbrico, tam bin se observa en Australia y en
Asia Oriental.31 El Profesor Bell seala, adems, que el registro
fsil del Cmbrico contiene representantes de los principales fi
los de animales invertebrados, que aparecieron repentinam ente
sin evidencia fsil de evolucin.32
La aparicin sbita de formas de vida en las capas del Cm
brico muestra un aumento repentino de diversidad biolgica tal,
que los cientficos lo han llamado la explosin del Cmbrico.
Este aumento en la diversidad implica un importante incremento
en la cantidad y la complejidad de la informacin gentica con
tenida en estos animales, ,y responsable por sus caractersticas.
Consideremos, por ejemplo, los nautiloideos del Cmbrico. Estos
animales pertenecen al grupo de los cefalpodos, moluscos depre
dadores inteligentes como los calamares, los pulpos y las sepias.
Los paleontlogos del Museo Sueco de Historia Natural han en
contrado nautiloideos en rocas del Cmbrico, con un sistema de

31W. C. Bell, Cambrian, McGraw-Hill Encyclopedia o f Science and Technology, t. 2,


p. 425.

,2lbd p. 426.
propulsin a chorro ms sofisticado y eficiente que otras especies
encontradas en rocas de perodos posteriores, consideradas millo
nes de aos ms recientes.33 El registro fsil, pues, revela formas de
vida completamente desarrolladas y muy sofisticadas, incluso en
las rocas ms profundas. Es tambin significativo que las especies
de nautilos todava existen hoy, como sucede con muchos otros
grupos de animales encontrados en el registro fsil. Las plumas
de mar, cuyos fsiles fueron encontrados en rocas del Precmbri
co, son prcticamente idnticas a las que viven hoy en los fondos
marinos; los fsiles Cretcicos de celacanto son iguales que los
celacantos que hoy se encuentran en el Ocano Indico. Asimis
mo, son extremadamente similares a sus homlogos modernos
muchos de los fsiles de estrellas de mar, langostinos y langostas,
cangrejos, liblulas y otros insectos, peces, rayas, distintos tipos
diferentes de tiburones, salamandras, ranas, caimanes, cocodrilos,
lagartijas, tortugas, aves, y mamferos que aparecen en los mismos
estratos de roca en los que se encontraron fsiles de dinosaurios.34
En la actualidad, observamos especies que se extinguen mien
tras otras sobreviven; y aquellas que sobreviven no se transforman
en especies nuevas sino que, mientras duran, continan produ
ciendo el mismo tipo de descendencia. El registro fsil cuenta la
misma historia, y no muestra evidencia alguna de evolucin.
Com o comentamos en un captulo anterior, estudios de A D N
antiguo han demostrado que la diversidad gentica era mayor en
el pasado. El profesor Alan Cooper, del Centro Australiano de
A D N Antiguo, estudi huesos de especies antiguas de la fami
lia del caballo, y descubri que la extinta cebra gigante llamada
Cape era solo una variante grande de la m oderna cebra de las lla
nuras. Este tipo de descubrimientos sugiere que la informacin
gentica contenida en las especies antiguas era mayor y ms rica,

13H. Mutvei, Y-B. Zhang y E. Dunca, Late Cambrian Plectronocerid Nautiloids and Their
Role in Cephalopod Evolution, Palaeontology, vol. 50, N 6 (2007), pp. 1.327-1.333.

34Cari Wemer, Living Fossils ~ Evolution: The Grand Experiment (Oreen Forest, AR: New
Leaf Press, 2008), t. 2. Esta obra contiene una extensa coleccin de fotografas de fsiles
de la era de los dinosaurios, junto con sus formas vivientes.
lo que perm iti una mayor variacin dentro de cada especie.
Segn Cooper, hemos subestimado cunto puede variar una
especie en el tiempo y el espacio, y hemos asumido equivocada
mente una mayor diversidad entre las especies extintas de mega-
fauna.35 En otras palabras, algunas de las especies extintas que
son similares a especies actuales, pero presentan diferencias en
cuanto a tam ao, color, grosor del pelaje y otros detalles simila
res, podran corresponder en realidad a variedades de la misma
especie. La especie original contara con un patrim onio gentico
rico, que le perm itira dar lugar a diferentes variedades adap
tadas a diferentes condiciones ambientales, siempre dentro de
los lmites de la especie: una cebra grande contina siendo una
cebra y no va a dar lugar a descendientes con alas o con cuernos.
C on el paso del tiempo, estas especies originales habran ido per
diendo parte de su informacin gentica, y con ella, la variabili
dad dentro de la especie y parte de su capacidad de adaptacin.
En este captulo hemos analizado el registro fsil, y conclui
mos que no representa una evidencia directa para la evolucin.
Por el contrario, los fsiles, y las capas sedimentarias que los
contienen, pueden interpretarse como evidencias a favor de una
inundacin catastrfica m undial que produjo la desaparicin
de la vida preexistente. Hemos argumentado que el principio
del uniformitarianismo no es adecuado para calcular las edades
de los fsiles, y presentamos descubrimientos cientficos, como
la presencia de biomolculas y tejidos blandos en fsiles de di
nosaurio, que cuestionan las largas edades convencionales.36 Es
cierto que no hemos comentado los mtodos de datacin ra-
diomtrica, cuyos resultados de millones de aos parecen respal
dar el modelo evolutivo. Estos mtodos y sus deficiencias sern

35 Universidad de Adelaida, Australia. Comunicado de prensa (10 de diciembre, 2009). Ver:


www.adelaide.edu.au/news/news37301.html.

36 Para ampliar, ver: J. Lindgren, P. Uvdal, A. Engdahl, A.H. Lee , C. Alwmark, et al.,
Microspectroscopic Evidence of Cretaceous Bone Proteins, PLoS ONE, vol. 6, N 4
(2011): el9445. doi:10.1371/joumal.pone.0019445. En lnea: http://lup.lub.lu.se/luur/
download?func=downloadFile&recordOId=1972940&fileOId=1975834. Ver tambin:
www.creation.com/dino-dna-bone-cells.
analizados en detalle en un captulo posterior. Tambin mostra
mos que, en el registro fsil, las especies aparecen completamen
te formadas, sin intermediarios evolutivos que muestren la ad
quisicin gradual de nuevos rganos o estructuras. La aparicin
sbita de una elevada diversidad biolgica en ciertos lugares del
registro fsil, como al inicio del Cmbrico, tampoco apoya el
modelo evolutivo convencional. El registro fsil muestra que la
diversidad biolgica, y la informacin gentica asociada a esta,
han sido m ucho mayores en el pasado; de igual modo, muestra
evidencias claras de destruccin y enterramiento catastrficos de
miles de organismos en todo el m undo, lo que sugiere movi
mientos de agua a gran escala.
En el prximo captulo trataremos en mayor profundidad el
problema de los intermediarios evolutivos en el registro fsil.
Posteriormente, analizaremos las pruebas geolgicas, histricas
y culturales que respaldan el relato bblico de un diluvio catas
trfico universal.
INTERMEDIARIOS
EVOLUTIVOS
AUSENTES
EVIDCVSDEQE L^'e VOLUCI n 'NUNCA TUVO.LUGAR

egn los defensores de la evolucin, el registro fsil pro

S porciona evidencias directas y extensivas que docum entan


la veracidad de la evolucin.1 Se afirma que existen restos
de organismos con caractersticas intermedias que demuestran
cmo las sencillas formas de vida primitivas evolucionaron gra
dualmente, para dar lugar a una gran diversidad de seres vivos1

1L. R. Berg, D. W. Martin y E. P. Solomony, Biology, 7a ed. (Belmont, CA: Thomson


Brooks/Cole, 2005), p. 339. Ver tambin: National Academy of Sciences and Institute
of Medicine, Science, Evolution and Creationism (Washington, DC: National Academy
Press, 2008), pp. 22-25.
complejos. El Dr. Richard Dawkins, en su libro ms reciente
sobre las evidencias de la evolucin, describe un escenario evo
lutivo en el cual toda la vida se origin en el mar. Posteriormen
te, algunas criaturas marinas evolucionaron, en etapas sucesivas
,hasta convertirse en criaturas terrestres, y acabaron dando lugar
a los reptiles, los insectos, las aves y los mamferos que cono
cemos hoy. Dawkins escribe: Afortunadamente, las etapas de
transicin de nuestro xodo, como peces que emergieron a tie
rra, estn documentadas con gran elegancia en el registro fsil.2
Pero lo estn verdaderamente? Consideremos con m ucha aten
cin las evidencias reales tras esta rotunda afirmacin.
Para que un pez con branquias y aletas evolucione hasta con
vertirse en un vertebrado terrestre capaz de caminar y de respirar
en tierra, no solo se requiere la formacin de pulmones. Adems,
debe haber una transformacin radical del sistema esqueltico, que
incluya la formacin de dedos; la rotacin de las extremidades y su
fortalecimiento, de manera que puedan soportar el peso corporal; la
separacin de los hombros del crneo, que en los peces se encuen
tran fusionados; y la unin de la pelvis con la columna vertebral.
Todos estos cambios suponen una gran cantidad de nueva informa
cin gentica, que debi surgir de mutaciones aleatorias. En otras
palabras, en un momento determinado de la historia evolutiva de
los anfibios, cuando los gametos masculino y femenino de dos pe
ces se combinaron para formar un nuevo embrin, este contena
una pequea modificacin fortuita en su ADN, con informacin
gentica para comenzar a generar pulmones, lo que confiri a este
nuevo individuo una ventaja para sobrevivir y reproducirse. Este
proceso se repiti mltiples veces, formando y desarrollando to
das las nuevas estructuras que hemos citado, hasta dar lugar a los
anfibios modernos. El problema principal con esta explicacin es
que, como hemos argumentado en captulos anteriores, no existe
ningn mecanismo conocido capaz de producir nueva informacin
gentica significativa.

2 Richard Dawkins, The Greatest Show on Earth: The Evidence fo r Evolution (London:
Bantam Press, 2009), p. 161.
INTERMEDIARIOS EVOLUTIVOS AUSENTAS

La sola evolucin de branquias a pulmones implica una enor


me cantidad de informacin gentica nueva, en forma de miles de
bases que tienen que aparecer y acumularse en la secuencia correc
ta para dar lugar al primer pulmn activo. Estas bases tienen que
codificar no solo las nuevas estructuras del sistema respiratorio
propiamente dicho, sino tambin la musculatura, los controles
del sistema nervioso, y una nueva qumica sangunea con sus mo
lculas asociadas y las rutas enzimticas necesarias. Se supone que
esto ocurri lentamente, basndose sobre pequeos cambios acu
mulativos. Sin embargo, se trata de un proceso gentico tan com
plejo que los cientficos no pueden reproducirlo, ni siquiera sobre
el papel. No hay nadie que pueda, partiendo del genoma de un
pez sin pulmones, enumerar las mutaciones genticas necesarias
para convertirlo en un pez pulmonado. Pese a esto, mucha gente
acepta sin discusin que el proceso ocurri, y que se dio por azar.
Simultnea o posteriormente a la formacin de los pulmones, la
existencia de criaturas capaces de sobrevivir lucra del agua implica
tambin la evolucin de una estructura plvica y de extremidades
capaces de soportar el peso del cuerpo. Esto requiere mucha ms in
formacin gentica nueva procedente de mutaciones aleatorias, que
progresivamente tuvo que dar lugar a estructuras seas, articulacio
nes, msculos, tendones, ligamentos, vasos sanguneos y rutas ner
viosas capaces de controlar el movimiento de los nuevos apndices.
La explicacin evolutiva tradicional indica que los peces que po
dan usar sus aletas para arrastrarse de un pantano a otro sobrevi
van mejor a las sequas.3 Una serie de mutaciones sucesivas en las
aletas permiti el desplazamiento en tierra firme, y con el tiempo,
mutaciones adicionales produjeron modificaciones en el tamao,
la forma y la posicin de los huesos, de manera que las extremida
des pudieron sostener el cuerpo y mejorar la locomocin terrestre.
Otros cientficos han propuesto que el desarrollo de extremidades
capaces de caminar se produjo antes de que los peces abandonaran
el medio acutico, y que las utilizaban para desplazarse sobre el fon

3 Dawkins, ibd., p. 165.


do.4 En cualquier caso, dados los profundos cambios anatmicos y
fisiolgicos implicados en la evolucin de pez a anfibio, y suponien
do que los cambios tuvieron lugar en pequeos pasos a lo largo de
millones de aos, cabra esperar encontrar cantidad de evidencias de
este proceso en forma de fsiles de transicin.
Las formas de transicin son extremadamente escasas en el
registro fsil, pero los evolucionistas afirman que, en el caso de
la evolucin de peces a anfibios, la secuencia detallada est bien
documentada. Proponen que los anfibios evolucionaron durante
el Devnico, a partir de un tipo de peces con aletas lobuladas
(sarcopterigios), y presentan como evidencia una serie de fsiles
de edades sucesivas, cuyos elementos esquelticos parecen cam
biar progresivamente para adaptarse a la locomocin en tierra.
Los fsiles que forman dicha secuencia son los siguientes:
Eusthenopterom Fsil que se considera que es el ms antiguo
y, por tanto, ancestral en esta lnea evolutiva. Este pez de aletas
lobuladas, que poda medir hasta 1,8 metro, presentaba algunas
caractersticas comunes con anfibios fsiles del Devnico, como
el patrn de huesos del crneo, el tipo de dientes y los orificios
nasales. Adems, los huesos de sus aletas eran similares a los de
los tetrpodos (animales terrestres de cuatro patas), y se puede
distinguir el hmero, el radio y el cubito en la aleta delantera, y
el fmur, la tibia y la fbula en la aleta trasera. El Eusthenopteron
era un animal completamente acutico, con forma y locomocin
tpica de los peces. Tena aletas dorsales y se propulsaba con mo
vimientos de la cola. Las aletas no le servan para caminar porque
los hombros estaban fusionados con el crneo, y los huesos de las
aletas traseras estaban separados de la columna vertebral.
Panderichthys: Es otro pez de aletas lobuladas, similar al Eus
thenopteron pero sin aletas dorsales. Ambos fsiles han sido da
tados con una antigedad de entre 380 y 385 millones de aos
(MA).
Tiktaalik. Siguiente fsil de la secuencia, descubierto en 2006,

4James L. Edwards Two perspectives on the evolution of the tetrapod limb, American
Zoologist, vol. 29, N 1 (1989), pp. 235-254.
y con una antigedad estimada de 375 MA. Igual que los anterio
res, el Tiktaalik era un pez de aletas lobuladas, pero tena caracte
rsticas especiales que lo acercan a los animales terrestres. La cabeza
del Tiktaalik era similar a la de un cocodrilo, y algunos detalles del
esqueleto del cuello y de las extremidades sugieren que poda sujetar
el peso de su cuerpo sobre las aletas, en aguas poco profundas.
Acanthostega e Ichthyostega-. Dos de los ms conocidos que co
rresponden ya a anfibios verdaderos. Son los ltimos fsiles que
vamos a comentar aqu. Medan, aproximadamente, un metro de
largo y tenan patas con dedos diferenciados; cuello mvil; cintura
escapular (hombros) separada del crneo; y cintura plvica unida a
la columna vertebral. Estas dos ltimas caractersticas permitan la
locomocin en cuatro patas, tpica de los tetrpodos. Estos fsiles
han sido datados con antigedades de alrededor de 365 MA.
Esta secuencia de fsiles de transicin se puede encontrar, con
pequeas variaciones, en libros de texto, libros de divulgacin
sobre evolucin y artculos cientficos. A prim era vista, puede
dar la impresin de que realmente muestra la evolucin progre
siva de peces a anfibios por medio de la adquisicin de las adap
taciones necesarias para la vida fuera del agua. Sin embargo, un
anlisis ms profundo puede llevarnos a una conclusin distinta.
En prim er lugar, esta secuencia evolutiva no explica una de
las adquisiciones evolutivas ms importantes y difciles para el
paso del medio acutico al medio terrestre: la aparicin de los
pulmones. Se considera que el Eusthenopteron, prim er eslabn
de la secuencia, ya posea, adems de branquias, pulmones fun
cionales similares a los de los peces pulmonados actuales.
En segundo lugar, los fsiles que forman la secuencia, espe
cialmente el Tiktaalik, muestran una mezcla de caractersticas de
distintos grupos animales, pero eso no los convierte autom tica
m ente en formas de transicin.5 En la actualidad, tenemos ejem
plos de animales, como el ornitorrinco, que a pesar de presentar
una extraa combinacin de caractersticas (es un mamfero con

5P. Garner, Tiktaalik, the Fishopod from the Canadian Artic, Origins, vol. 48 (2008),
pp. 12-14.
pelo que amam anta a sus cras, pero pone huevos y tiene pico de
ave), no se considera una forma interm edia entre aves y mamfe
ros, en proceso de evolucin. El hecho de que los peces sarcop-
terigios del Devnico y los anfibios del mismo perodo tengan
algunas caractersticas similares podra explicarse debido a que
habitaban ambientes similares y tenan necesidades comunes.
En tercer lugar, ninguno de los fsiles de la secuencia muestra
estructuras parcialmente desarrolladas, como cabra esperar en un
verdadero fsil de transicin. Por ejemplo, todos ellos tienen un pa
trn sim ila r en los huesos de las patas, pero los tres primeros (peces
verdaderos) no tienen dedos, mientras que los dos ltimos (anfibios
verdaderos) tienen dedos perfectamente desarrollados. En ningn
momento se aprecia el desarrollo gradual de los dedos. Lo mismo
ocurre con la supuesta separacin incremental de la articulacin del
hombro respecto de la cabeza, pues no hay evidencias fsiles de ello.6
Por ltimo, un reciente hallazgo, publicado en la revista Na-
ture en 2010, ha puesto en duda la veracidad de esta secuencia
evolutiva, o al menos su datacin. Un equipo de investigacin
dirigido por Grzegorz Niedzwiedzki descubri, en una forma
cin rocosa datada con 397 MA de antigedad, huellas fsiles de
un tetrpodo, similar al Ichthyostega, con dedos diferenciados.7
Segn este descubrimiento, los anfibios verdaderos seran ante
riores a los peces de aletas lobuladas, como el Eusthenopteron o el
Panderichthys, que se supone que son sus ancestros.
Segn es posible notar, las supuestas etapas de transicin de
nuestro xodo como peces que emergieron a tierra no estn tan
documentadas como algunos afirman. Los datos muestran un
conjunto de fsiles claramente separados en dos grupos: peces de
aletas lobuladas y anfibios, con algunas caractersticas comunes
(gran tamao, crneo aplanado, huesos de las aletas, etc.), que

6Gamer, The Fossil Record of Early Tetrapods: Evidence of a Major Evolutionary Tran-
sition?, Journal ofCreation, vol. 17, N 2 (2003), pp. 111-117. Ver tambin: www.crea-
tion.com/tetrapod.
7Janvier, Philippe y Gael Clment, Palaeontology: muddy tetrapod origins, Nature, vol.
463 (2010), pp. 40,41.
pueden interpretarse de maneras distintas. No se encuentran ver
daderas formas de transicin con nuevas estructuras parcialmente
desarrolladas, y no se explica la aparicin de los pulmones, que
debieron surgir anteriormente, en un antepasado de los peces sar-
copterigios. Estos peces, de aletas lobuladas, son muy diferentes
de los actinopterigios, grupo que incluye a la mayora de los peces
que conocemos, cuyas aletas contienen espinas seas. Ambos gru
pos, sarcopterigios y actinopterigios, pertenecen a la clase Ostei-
chthyes (peces con esqueleto seo). Si retrocedemos en el registro
fsil buscando las formas de transicin que llevaron al desarrollo
de los pulmones en los peces sarcopterigios, o la secuencia que
demuestre cmo los dos grupos se separaron a partir de un an
cestro comn, no las encontramos. Tambin estn ausentes los
ancestros de los peces osteictios. El Dr. Rccvc M. Bailcy, profesor
de Zoologa de la Universidad de Michigan, seala que los fsiles
de este grupo aparecen repentinamente, completamente forma
dos, en los estratos del Devnico Medio. Segn l: Parece claro,
entonces, que la historia [la ascendencia evolutiva] del grupo se
extiende ms atrs en el pasado de lo que el registro fsil revela
hasta ahora.8
En realidad, la aparicin repentina de especies completamente
constituidas, sin antepasados evolutivos evidentes ni especies inter
medias, es lo habitual en el registro fsil, y este hecho lo reconocen
los propios cientficos evolucionistas. El Dr. David M. Raup, con
servador de Geologa del Museo de Historia Natural de Chicago,
y antiguo presidente de la Sociedad Paleontolgica, declara que los
gelogos no observan en el registro geolgico el desarrollo gradual
de la vida. En su lugar, encuentran especies que aparecen repentina
mente en las secuencias geolgicas, muestran poco o ningn cam
bio a lo largo de su existencia y luego desaparecen completamente.9

8 R. M. Bailey, Osteichthyes, McGraw-Hill Encyclopedia o f Science and Technology


(New York: McGraw-Hill Book Company, 1960), t. 9, p. 442.

9D. M. Raup, Conflicts between Darwin and Palaeontology, Field Museum of Natural His-
tory, Boletn 50,1979, pp. 22-29; citado en: A. A. Rotb, Origins: Linking Science and Scrip-
twe (Hagerstown, MD: Review and Herald Publisfaing Association, 1998), pp. 182,183.
El Dr. Raup seala que la mayora de los fsiles no muestran
los cambios esperados a medida que se asciende en las capas de
roca. En realidad, muchos especmenes fsiles que supuestamente
tienen millones de aos son prcticamente idnticos a especies
actuales. Es cierto que hay algunos ejemplos de cambio gradual
en el registro fsil, pero se trata de cambios leves en la forma o el
tamao de estructuras preexistentes. Un ejemplo es la diatomea
Rhizosolenia, un alga unicelular microscpica que forma parte del
plancton. En el registro fsil de Rhizosolenia, se observa un cam
bio gradual en la forma de la capsula silcea del alga, e incluso
un evento de especiacin: dos especies muy similares que surgen
a partir de una sola.101Lo importante es que al final del proceso
seguimos teniendo el mismo tipo de organismo: diatomeas Rhi
zosolenia. Se trata de un fenmeno similar a lo que tratamos en el
captulo 4, al explicar los tpicos ejemplos de evolucin de los li
bros de texto: polillas o guppys que cambian de color, pero siguen
siendo sin duda polillas y guppys, respectivamente.
Las observaciones del Dr. Raup han sido percibidas tambin
por otros cientficos. Por ejemplo, los seres voladores se dividen
en cuatro grupos principales: insectos, reptiles voladores (ptero-
saurios, ahora extintos), aves y murcilagos. Volar es una funcin
m uy especializada, que adems de alas requiere muchas caracte
rsticas; por lo tanto, es de esperar que la evolucin gradual del
vuelo haya dejado evidencias en el registro fsil. No obstante,
la autoridad en insectos Dr. Robn W ootton, de la Universidad
de Exeter, explica que cuando los insectos fsiles aparecen en
la columna geolgica por prim era vez, el vuelo ya est comple
tam ente desarrollado.11 Una vez ms, este hecho supone miles
y miles de bases de A D N que contengan toda la informacin
necesaria para codificar las estructuras y las funciones respon
sables del vuelo, aparezcan por azar en el genoma de insectos

l0Michae! J. Benton y Paul N. Pearson, Speciation in the fossil record, Trends in ecology
& evolution, vol. 16, N 7 (2001), pp. 405-411.

11R. J. Wootton, 'Flight: Arthropods, en D. E. G. Briggs y P. R. Crowther, eds., Palaeobio-


logy: A Synthesis (Oxford: Blackwell Scientific Publications, 1990), pp. 72-75.
no voladores, y los convierta en voladores en tan corto tiempo
que no dejen ninguna evidencia fsil de evolucin gradual. El
zologo Dr. Ariel Roth, graduado de la Universidad de M ichi
gan y editor de la revista Origins por ms de veinte aos, seala
que los pterosaurios voladores, las aves y los murcilagos tam
bin aparecen repentinamente en los estratos fsiles como cria
turas voladoras desarrolladas por completo.12 El vuelo requiere
cambios anatmicos m uy importantes. Las aves poseen huesos
huecos reforzados con tirantes entrecruzados, que reducen el
peso conservado la fortaleza estructural. En las aves, el sistema
respiratorio incorpora estructuras nicas: los sacos areos. Estos
sacos almacenan aire y actan como fuelles, lo que mantiene
un volumen fijo de aire fresco, que circula por los pulmones y
aum enta la eficiencia del intercambio gaseoso, para satisfacer la
alta demanda de oxgeno del vuelo. Igual que en los ejemplos
anteriores, la cantidad de informacin gentica nueva necesaria
para todos estos cambios es enorme. Si, como afirma la 'Icorta
de la Evolucin, esta nueva informacin es fruto de mutaciones
aleatorias que se fueron acumulando poco a poco, deberamos
encontrar numerosas evidencias fsiles de la evolucin gradual
de las aves; pero estas evidencias no aparecen en el registro fsil.
Las plumas, que caracterizan a todas las aves, ilustran an mejor
este punto. Si bien se supone que las plumas de las aves evoluciona
ron a partir de las escamas de un reptil ancestral,13 tienen estructuras
complejas muy diferentes de las escamas conocidas. Las plumas son
resistentes al viento, debido a un ingenioso sistema de lengetas y
barbas (protuberancias y ganchos), que actan como un velero, pero
permiten el deslizamiento. Asimismo, para que el sistema funcione,
es necesaria una correcta lubricacin que impida que la delicada es
tructura de enrejado de la pluma se deshiladle. El aceite lubricante
procede de la glndula uropigial, o glndula del acicalado, que tam
bin proporciona impermeabilidad al plumaje, y permite a las aves

12Roth, ibd., p. 185.

a Ibd.
volar bajo la lluvia y sumergirse en el agua sin mojarse. La evolucin
de plumas funcionales a partir de escamas requiere la aparicin, de
manera simultnea, de informacin gentica nueva que codifique las
intrincadas estructuras que forman las plumas y la informacin ne
cesaria para crear la glndula del acicalado. No hay evidencias en el
registro fsil de criaturas con escamas transformndose en plumas.14
En vez de ello, encontramos fsiles de criaturas con plumas completa
mente desarrolladas, como el famoso reptil-ave. Archaeopteryx.15
O tro grupo cuya evolucin carece totalmente de intermedia
rios en el registro fsil es el de las tortugas. El plan corporal
de las tortugas es nico entre los vertebrados. El caparazn se
forma a partir de placas de hueso y supone una modificacin
drstica de la caja torcica. Tal como seala el Dr. Roth, cabra
esperar encontrar numerosos fsiles de etapas intermedias en la
evolucin de las tortugas, pero no se ha encontrado ninguna. El
registro fsil contiene muchos ejemplares de tortugas, pero to
dos aparecen completamente formados.16 Un ejemplo similar es
el de los dinosaurios con cuernos. Se han hallado miles de fsiles
de dinosaurios con cuernos y sin ellos, mas no se encontraron
evidencias de un desarrollo progresivo de estos.17
En el caso de las plantas, la ausencia de evidencias fsiles para
una evolucin progresiva es an ms pronunciada. Las plantas
con flores (Angiospermas) aparecen sbitamente, formadas por
completo y en abundancia.18
Si revisamos los estratos de la columna geolgica, empezando

14A. H. Brush, On the Origin of Feathers, Journal ofEvolutionary Biology, vol. 9 (1996),
p. 133. Ver tambin: Barbara J. Stahl, Vertbrate History, Problems in Evolution (New
York: Dover Publications, 1985), pp. 349, 350.

15A. J. Charig, F. Greenaway, A. C. Milner, C. A. Walker y P. J. Whybrow, Archaeopteryx


Is Not a Forgery, Science, vol. 232 (1986), pp. 622-626.

16Roth, ibd., p. 182.

17Duane T. Gish, Evolution: The Challenge o f the Fossil Record (El Cajn, CA: Crea-
tion-Life Publishers, 1986), p. 124.

18A. H. Knoll y G. W. Rothwell, Palaeobotany: Perspectives in 1980, Palaeobiology, vol.


7, N 1 (1981), pp. 7-35.
por la base y prestando atencin a cmo y a cundo aparecen
los distintos fsiles, el mismo patrn se hace evidente una y otra
vez. En los estratos inferiores, pertenecientes al Precmbrico,
los fsiles son bastante infrecuentes y corresponden principal
m ente a algas, bacterias, y unos pocos organismos marinos de
pequeo tamao. Por el contrario, al llegar a los estratos del
Cmbrico, encontramos grandes cantidades de fsiles de ani
males diversos totalm ente desarrollados. U n ejemplo de la ele
vada diversidad presente en los estratos cmbricos se aprecia en
los fsiles procedentes del yacimiento de Burgess Shale, en las
Rocosas Canadienses, famoso por la excelente preservacin de
criaturas de cuerpo blando.19 En los aos 90, los investigadores
extrajeron ms de 73.000 especmenes de esta formacin rocosa,
en la mayora de los cuales se aprecian estructuras corporales y
detalles anatmicos tan bien conservados que han proporciona
do informacin m uy valiosa sobre el modo de vida de estos or
ganismos. Algunos casos curiosos de artrpodos procedentes de
Burgess Shale son los Waptia fieldenis, un animal parecido a un
langostino, y la Marrella splendens, una criatura multisegmen-
tada con muchas extremidades, por entero distinta a cualquier
especie conocida de la actualidad. En las rocas del Cmbrico
inferior, tam bin encontramos fsiles de trilobites completa
m ente desarrollados, con su tpico exoesqueleto trilobular, pa
tas articuladas y ojos compuestos.20 Los ojos de los trilobites
presentaban una gran complejidad; estaban conformados por
mltiples facetas colocadas en diferentes direcciones, con len
tes individuales capaces de enfocar la luz desde cualquier dis
tancia.21 A pesar de la abundancia de fsiles de trilobites, no se
han descubierto en el registro fsil evidencias de su evolucin:

19D. E. G. Briggs, D. H. Erwin y F. J. Collier, The Fossils oftlie Burgess Shale (Washing
ton, DC: Smithsonian Institution Press, 1994).

20W. C. Bell, Cambrian, McGraw-Hill Encyclopedia o f Science and Technology, t. 2,


pp. 424-427.

21K. Towe, Trilobite Eyes: Calcified Lenses, Science, vol. 179 (9 de marzo de 1973),
pp. 1.007-1.011.
-VLJaN

sus complejas estructuras corporales aparecen de manera repen


tina, plenamente formadas y funcionales. Otros seres hallados
en las rocas del Cmbrico inferior incluyen esponjas, medusas,
corales, anmonas, gusanos, cangrejos herradura, caracoles, bra-
quipodos y erizos de mar, por nom brar algunas de las especies
ms conocidas.22 Los nautiloideos, cefalpodos similares a los
calamares, son abundantes. 23Estas criaturas eran m uy similares
a los nautilos actuales, cazadores inteligentes y agresivos, con so
fisticados sistemas de propulsin a chorro.24 Se han encontrado,
incluso, fsiles de vertebrados en forma de peces cartilaginosos,
lo que implica que estos animales existan en la poca en la que
las rocas del Cmbrico inferior fueron depositadas.25 Com o se
indic anteriormente, los paleontlogos han llamado explosin
del Cm brico a la aparicin repentina de tal abundancia y di
versidad de especies.
La explosin del Cmbrico supone un problema para la Teora
de la Evolucin. La ausencia de intermediarios no puede ser expli
cada alegando que faltan estratos, ya que hay multitud de ejemplos
en que cientos ele metros de estratos precmbricos no fosilferos, sin
evidencias de erosin o interrupcin geolgica entre las capas, yacen
bajo rocas cmbricas ricas en fsiles de trilobites.26 Para explicar la
explosin del Cmbrico dentro del marco convencional de la Teora
de la Evolucin, es preciso aceptar que un gran nmero de muta
ciones aleatorias sucesivas produjeron, a partir del A D N de unos
pocos organismos sencillos del Precmbrico, toda la informacin
gentica necesaria para construir los miles de organismos diferentes

22 Roth, ibd., pp. 164, 165.

23 Berg, Martin y Solomon, ibd., pp. 393-395.

24J. B. Wood, Fossil Cephalopods, Bermuda Institute ofOcean Sciences, 2010. En lnea:
www.thecephalopodpage.org/FosCephs.php. Ver tambin: www.ucmp.berkeley.edu/taxa/
inverts/mollusca/cephalopoda.php.

25 X. G. Zhang y X. G. Hou, Evidence for a Single Median Fin-fold and Tail in the Lower
Cambrian Vertbrate, Haikouichthys Ercaicunensis, Journal o f Evolutionary Biology, vol.
17 (2004), pp. 1162-1166.

26 Bell, ibd., p. 425.


que aparecen en las rocas del Cmbrico, en un perodo de tiempo
lo suficientemente corto como para que no aparezcan en el registro
fsil. Como ya hemos argumentado en captulos anteriores, las m u
taciones raramente son beneficiosas,27 y no son capaces de generar
informacin gentica nueva. Una vez ms, llegamos a la conclusin
de que no existe una explicacin conocida ni evidencias fsiles de
cmo la evolucin pudo dar lugar a tal diversidad biolgica por
medio de mutaciones aleatorias y seleccin natural.
Por el contrario, en el registro fsil s encontramos numerosas
evidencias de que las especies se m antienen en el tiempo sin
grandes cambios. Entre otros, podemos citar el caso de los cela-
cantos vivos, capturados en Sudfrica en 1938, que eran prcti
camente idnticos a los celacantos fsiles.28
El Dr. Cari Werner, bilogo y mdico de la Universidad de Mis
souri, y su esposa, Debbie, diplomada en Ciencias, desarrollaron
un ambicioso proyecto que consista en fotografiar decenas de es
pecmenes fsiles expuestos en museos y hacer una comparacin
con fotografas de animales actuales. Su trabajo ha sido publicado
en dos obras ilustradas de 260 pginas cada una, con fotografas a
color de alta calidad, bajo los ttulos Evolution: The Grand Experi-
ment [Evolucin: El gran experimento] y Living Fossils, Evolution:
The Grand Experiment [Fsiles vivientes. Evolucin: El gran expe
rimento].29 Tal como su nombre indica, esta ltima obra provee de
evidencias fotogrficas de que muchas especies han permanecido
esencialmente inalteradas desde las formas fsiles hasta las formas
vivientes del presente. Los libros del matrimonio Werner presen
tan fotografas de fsiles encontrados en los mismos estratos que
los dinosaurios, junto a sus homlogos existentes en la actualidad.
Estos incluyen estrellas de mar, ofiuras, erizos de mar, pepinos de

27 D. H. Erwin y J. W. Valentine, Hopeful Monsters, Transposons and Metazoan Radia-


tion, Proceedings ofthe National Academy o f Sciences, vol. 81 (1984), pp. 5.482, 5.483.

28 Dawkins, ibd., p. 163.

29 Cari Werner, The Questfor an Answer, Evolution: The Grand Experiment (Green Forest,
AR: New Leaf Press, 2009), 1.1; Werner, Living Fossils, Evolution: The Grand Experiment
(Green Forest, AR: New Leaf Press, 2009), t. 2.
mar, crinoideos, langostinos, langostas, cangrejos de ro, cangrejos,
cangrejos de herradura, nidos de termita, liblulas, saltamontes, in
sectos acuticos, avispones, escarabajos, moscas escorpin, efme
ras, grillos, cucarachas, vieiras, almejas, mejillones, ostras, caracoles,
nautilos, escafpodos, braquipodos, quitones, lombrices de tierra,
gusanos tubcolas, esponjas, corales, esturiones, celacantos, peces
pulmonados, peces aguja, Amia calva, anguilas, arenques, tiburones
ngel, rayas, mixinos, salamandras, caimanes, cocodrilos, serpien
tes, boa constrictor, lagartijas, tortugas, avoceta (un ave de hoy en
da fosilizada junto a un Tyrannosaurus rex y a un Triceratops en Hell
Creek, Montana), mamferos varios, conos de semillas y ramas de
secuoya, pifias de Cook, cicadas, ginkgos, helchos, equisetos, mus
gos, rododendros, lirios, sasafrs, lamos, y otros rboles y plantas.
Los ejemplos que Cari y Debbie Werner han coleccionado no
son exhaustivos, pero sirven para mostrar que muchas especies de
animales y de plantas que conocemos hoy vivieron al mismo tiem
po que los dinosaurios, y que las especies supervivientes son simi
lares a las fsiles, sin signos de evolucin. El Dr. Werner afirma
en su libro que entre 100 y 200 millones de fsiles se encuentran
conservados en museos en todo el m undo.30
Durante el curso de su investigacin y la filmacin de la serie
Evolution: The Great Fxperiment [Evolucin: El gran experimen
to], Werner entrevist a muchos conservadores de museos, a los
cuales pregunt acerca de los fsiles de sus colecciones, muchos
de los cuales no se encuentran expuestos para la exhibicin pbli
ca, sino que estn en los depsitos de los museos. Puede ser que
los lectores desconozcan que los paleontlogos han encontrado
ms de 430 especies de mamferos fosilizados junto con los dino
saurios, lo que demuestra que estos animales fueron contempor
neos.31 No obstante, el Dr. Werner reporta que no vio expuesto
un solo esqueleto completo de mamfero, de los encontrados en

30Werner, The Q uestfor anAnswer, Evolution: The Grand Experimenta t. 1, p. 77.

31 Z. Kielan-Jaworowska, R. L. Cifelli, y Z. X. Luo, Mammalsfrom the Age o f Dinosaurs:


Origins, Evolution, and Structure (New York: Columbia University Press, 2004).
los estratos de dinosaurios, en ningunos de los 60 museos que vi
sit. W erner afirma que los estratos ricos en fsiles de dinosaurios
contienen fsiles representativos de los principales filos animales,
incluyendo a las aves, que supuestamente evolucionaron a partir
de estos. Tambin hay fsiles de los principales grupos de plantas.
De su estudio exhaustivo de los fsiles de los museos y su com
paracin con plantas y animales actuales, Werner concluye que el
registro fsil no proporciona evidencias de que la evolucin haya
tenido lugar.32
Empezamos este captulo comentando que muchos libros de
texto afirman que los fsiles constituyen una prueba directa de
la evolucin, y que populares cientficos como Richard Dawkins
defienden que hay abundantes evidencias de esta en el registro
fsil. Aun as, un anlisis detallado parece indicar ms bien lo
contrario. La carencia de pruebas fsiles de la evolucin ha sido
reconocida desde hace algn tiempo. Stephen J. Gould, famo
so paleontlogo de la Universidad de Harvard, admiti la au
sencia de evidencias para las etapas intermedias requeridas en
las principales transiciones evolutivas. Tambin destac que el
desarrollo incompleto de una estructura nueva carecera de uti
lidad para el organismo y, por lo tanto, no podra ser objetivo
de la seleccin natural. En sus propias palabras: Qu posible
uso podra tener para un reptil el dos por ciento de un ala?33
La eminente palentologa Barbara J. Stahl, diplomada por la
Universidad de Harvard, tam bin ha sealado los defectos de
las supuestas evidencias fsiles de la evolucin,34 y ya hemos co
mentado anteriormente que el Dr. Raup, conservador de Geo
loga en el Museo Field de Historia Natural de Chicago, sostiene
que los gelogos no encuentran evidencias de evolucin en el

32Werner, Living Fossils, Evolution: The Grand Experiment, t. 2, pp. 241-243.

33 Stephen Gould, Is a New and General Theory of Evolution Emerging?, en M. Ruse,


ed., But Is It Science? (Buffalo, NY: Prometheus Books, 1988), cap. p. 12, 177-194; citado
en: Colin Mitchell, The Case for Creationism (Alma Park, Grantham: Autumn House Li
mited, 1994), p. 129.

34 Stahl, ibd.
registro fsil. El Dr. Roth concluye su libro de 380 pginas sobre
los orgenes con esta frase: Me sorprende que el concepto de
evolucin persista, en vista de la escasez de pruebas slidas que
lo respalden.35
A pesar de ser reconocida por muchos paleontlogos, la au
sencia de evidencias de la evolucin en el registro fsil no se en
sea a los estudiantes de Biologa, ni se divulga entre el pblico
general. De hecho, los libros de texto de referencia sobre Biolo
ga y Evolucin continan om itiendo toda discusin relativa a
las actuales objeciones a la teora. Segn Stephen J. Gould, los
rboles evolutivos que adornan nuestros libros de texto estn ba
sados principalmente sobre inferencias, y no evidencias fsiles.36

35Roth, ibd., p. 362.

36Stephen J. Gould, The Panda s Thumb: More Reflections in Natural History (New York:
W. W. Norton and Co., 1980), p. 181.
DILUVIO
UNIVERSAL:
EVIDENCIAS
GEOLGICAS

ran parte de la superficie de nuestro planeta est cubier

G ta por estratos de roca que se formaron bajo el agua. Esta


observacin no es rebatida por los gelogos. Las rocas sedi
mentarias, cuyos materiales son depositados principalmente por la
accin del agua, cubren aproximadamente el 75% de la superficie
terrestre, siendo esquistos, areniscas y calizas las ms abundantes.
El resto de la superficie terrestre est cubierta por rocas metamr-
ficas, como el mrmol, y rocas magmticas, como el granito y el
basalto. Las rocas magmticas se conforman por solidificacin de
materiales fundidos procedentes del interior de la Tierra, como la
lava de los volcanes. Las metamrficas proceden de otras rocas que
se modifican por accin de la temperatura y la presin. A pesar de
su amplia distribucin, las rocas sedimentarias solo representan
un 5% del volumen de la corteza terrestre. Segn estas cifras, los
sedimentos constituyen una capa extensa, pero relativamente fina,
sobre la superficie de la Tierra.1 Cabe preguntarse si dicha capa de
sedimentos se deposit a lo largo de cientos de millones de aos
de eventos locales repetitivos (inundaciones, ascenso y disminu
cin de los niveles del mar, alteraciones en mares y lagos debidas
a terremotos y erupciones volcnicas, etc.) o, por el contrario, se
form en un perodo de tiempo relativamente breve, a causa de un
gran evento de inundacin global. La existencia de formaciones
geolgicas -com o los casi dos kilmetros de profundidad de estra
tos depositados por agua en el Gran Can del Colorado, en Es
tado Unidos, de inmensos lechos de caliza depositados por agua,
o de los cementerios masivos de fsiles que hemos comentado en
captulos anteriores, resulta significativa a la hora de decantarse
por una u otra respuesta. Es de destacar que el desarrollo de teoras
para explicar estos y miles de otros depsitos masivos contina
siendo un importante campo de estudio para los gelogos.
El reconocimiento del papel de las catstrofes a gran escala
en el modelado de la superficie terrestre ha crecido en pocas
recientes. Entre otros, el eminente gelogo Derek Ager, del C o
legio Universitario de Swansea, sostiene que los estratos de roca
de todo el m undo indican que ha habido perodos de cambio
gradual lento (conocido como gradualismo en el modelo del
uniformitarianismo), puntuado por inmensos desastres natura
les ocasionales.12 Una de las observaciones im portantes del profe
sor Ager es que, muchas veces, la misma combinacin de estra
tos sedimentarios se encuentra en diferentes partes del mundo.
En Gran Bretaa, en Groenlandia, en las Rocosas Canadienses
y en Australia, los estratos fosilferos del Cmbrico inferior se
encuentran sobre estratos de un tipo especial de arenisca llama

1R. Siever, Sedimentary Rocks, McGraw-Hi Encyclopedia o f Science and Technology


(New York: McGraw-Hill Book Company, 1960), t. 12, pp. 129-135; J.H. Zumberge, Ele-
ments o f Geology, 2o ed. (New York: John Wiley and Sons, 1963), p. 44.

2Derek V. Ager, The New Catastrophism: The Imprtame ofthe Rare Event in Geolgica!
History (Cambridge, UK: Cambridge University Press, 1995). Ver tambin: Derek V. Ager,
The Nature ofthe Stratigraphic Record, 3o ed. (Chichester, NY: John Wiley and Sons, 1992).
do cuarcita, que no contiene fsiles. Ambos grupos de estratos
estn separados por lo que en estratigrafa se llama paraconfor
m idad, una lnea paralela a los estratos en la que no se apre
cian seales de erosin. Por debajo de la cuarcita, se encuentra
una gran variedad de rocas precmbricas, pero en este caso, s se
aprecian seales de erosin en la superficie de separacin. El pro
fesor Ager seala que esta capa de cuarcita tiene una distribucin
global, y se encuentra asociada con una combinacin de estratos
fcilmente identificables, como un conglomerado basal de guija
rros y materiales redondeados cementados con arenisca, seguido
de esquistos marinos y de calizas finas.3 Esto significa lo siguien
te: los estratos del Cmbrico inferior, que contienen fsiles de
muchos tipos de organismos, fueron depositados por la accin
del agua sobre otras capas de rocas sedimentarias, siguiendo el
mismo patrn de deposicin en todo el planeta. La semejan
za del patrn estratigrfico sugiere que las mismas condiciones
ambientales prevalecieron alrededor del m undo, estando todo o
gran parte de este cubierto por agua. Es difcil imaginar cmo
una serie de eventos locales, en diferentes lugares separados entre
s por cientos, miles o incluso millones de aos, podra haber
dado lugar al mismo patrn de deposicin. Si tal fuera el caso,
esperaramos adems encontrar evidencias de erosin entre las
series de estratos, causada por los agentes climticos que actua
ron sobre la superficie de la Tierra durante todo ese tiempo.
Segn la interpretacin convencional de la columna geolgica,
las extinciones masivas se han sucedido a lo largo de la historia de
la Tierra. En el Captulo 5 citamos los grandes depsitos de creta
en todo el mundo, que se formaron durante un perodo de inun
dacin de la superficie terrestre, y coincidente con la extincin de
los dinosaurios, los grandes reptiles marinos, los reptiles voladores y
muchos otros organismos marinos.4Tericamente, pasaron ms de

3Ager, ibd., p. 11.

4W. A. Cobban, Cretaceous, McGraw-Hill Encyclopedia o f Science and Technology


(New York: McGraw-Hill Book Company, 1960), t. 3, p. 542.
E y - C f L c ? -m

400 millones de aos entre la inundacin mundial del Cmbrico


y la inundacin mundial del Cretcico, pero el registro fsil indica
que hubo varias extinciones masivas ms en el perodo de tiempo
intermedio. Evidencias de estas extinciones se observan en estratos
correspondientes al final del Ordovcico, y durante el Devnico,
el Prmico y el Trisico;5 lo que implica inundaciones peridicas
separadas por decenas o cientos de millones de aos. La pregun
ta permanece: si consideramos el conjunto de los datos geolgicos
y paleontolgicos, apuntan estos a una sucesin de inundaciones
locales distribuidas a lo largo de cientos de millones de aos, o su
gieren ms bien un gran evento de inundacin global ms reciente?
Una de las primeras pistas que encontramos a favor de una inun
dacin global es la existencia de extensos depsitos sedimentarios
que contienen fsiles de organismos terrestres. Por ejemplo, en el
parque nacional Zion, en Utah, pueden verse afloramientos del
conglomerado Shinarump, una roca sedimentaria que contiene
guijarros, arenisca y madera fosilizada. Esta capa, que generalmente
tiene menos de 30 metros de espesor, se extiende de manera casi
uniforme sobre una extensin de 250.000 kilmetros cuadrados.6
Para quedar distribuido de manera casi ininterrumpida en una zona
tan extensa, el material de este depsito tuvo que ser transportado y
dispersado por una enorme masa de agua, con gran fuerza. Y el con
glomerado Shinarump es solo un integrante de la formacin Chin-
le, un grupo de rocas sedimentarias que estn dispersas sobre un
area estimada de 800.000 a 2,3 millones de kilmetros cuadrados.7

J. C. Avise, S. P. Hubbell y F. J. Ayala, In the Light of Evolution II: Biodiversity and


Extinction, Proceedings o f the National Academy o f Sciences o f the USA, supl. 1 (12
de agosto de 2008), pp. 11453-11457. En lnea: www.pnas.org/content/105/Supple-
m ent_l/l 1453.full.pdf. Ver tambin: R. K. Bambach, Phanerozoic Biodiversity Mass
Extinctions, Animal Review ofEarth and Planetary Sciences, vol. 34 (2006), pp. 127-155.

6 H. E. Gregory, Geology and Geography of the Zion Park Regin, Utah and Arizona,
U.S., GeologicalSurvey ProfessionalPaper, N 220, p. 65.

7 S. G. Lucas, The Chinle Group: Revised Stratigraphy and Biochronology of Upper


Triassic Non-marine Strata in the Western United States, en M. Morales, ed., Aspects
of Mesozoic Geology and Paleontology of the Colorado Plateau, Unseum o f Northern
Arizona Bulletin, No. 59 (1993), pp. 27-50.
O tro caso de roca que contiene fsiles de animales terrestres
es la famosa formacin Morrison, rica en fsiles de dinosaurio.
Esta formacin se encuentra en el oeste de los Estados Unidos,
y se extiende sobre aproximadamente 1,5 millones de kilme
tros cuadrados, desde Texas a Canad, y tiene un grosor medio
de tan solo 100 metros.8 Esto representa otro flujo masivo de
sedimentos sobre una vasta rea, que enterr a miles de anim a
les terrestres. Tales depsitos de rocas sedimentarias sumamente
extensos, pero relativamente finos, son ms consistentes con la
deposicin por un diluvio catastrfico que con una formacin
lenta y gradual de los estratos sedimentarios.
La formacin de arenisca de Coconino, expuesta en el Gran
Can, es otro ejemplo. Este depsito, con una profundidad me
dia de 150 metros, cubre una extensin de 520.000 kilmetros
cuadrados, incluyendo sus areniscas asociadas.9 La mitad inferior
de la arenisca de Coconino contiene cientos de rastros fosilizados
de pisadas de anfibios y reptiles. El estudio de estas huellas ha
demostrado que, en casi todos los casos, los rastros se dirigen cues
ta arriba.101Adems, aunque se supone que esta formacin es de
origen elico, estudios experimentales sugieren que las huellas en
contradas no fueron impresas en dunas secas, sino bajo el agua.11
En la misma lnea, la deposicin cruzada presente indica que fue
agua que flua rpidamente lo que produjo dunas submarinas en
la formacin Coconino. A partir de la forma y el tamao de las

8 L. F. Hintze, Geologic History of Utah, Brigham Young University, Geology Studies


Special Publication, N7 (1988), p. 51.

9 A. A. Sneing, Earths Catastrophic Past (Dallas, TX: Institute for Creation Research,
2009), t. 2, p. 509.
10 C. W. Gilmore, Fossil Footprints from the Grand Canyon: Second Contribution, Smi-
thsonian Miscellaneous Collections, vol. 80, N 3 (1927), pp. 1-78; citado en: A. A. Roth,
Origins: Linking Science and Scripture (Hagerstown, MD: Review and Herald Publishing
Association, 1998), p. 221.
11 L. R. Brand y T. Tang, Fossil Vertbrate Footprints in the Coconino Sandstone (Per-
mian) of Northern Arizona: Evidence for Underwater Origin, Geology, vol. 19 (1991),
pp. 1.201-1.204. Ver tambin: R. Monastersky, Wading Newts May Explain Enigmatic
Tracks, Science News, vol. 141 (1992), p. 5.
hvs

dunas, se ha estimado que se generaron por corrientes de agua


que circularon aproximadamente a 1,5 metros por segundo. Esta
velocidad es caracterstica de las corrientes ocenicas profundas
que observamos hoy, o de las corrientes generadas por eventos
de tipo tsunami.12 El cuadro general que obtenemos al estudiar
esta formacin rocosa es una imagen de animales que se movan
cuesta arriba, en el interior de una corriente de agua que flua a
gran velocidad. Dicha corriente transportaba una cantidad masiva
de arena que, al depositarse rpidamente sobre un rea inmensa
de miles de kilmetros cuadrados, enterr las huellas de los ani
males y permiti su fosilizacin. El volumen de arena presente
en esta formacin de arenisca se estima en el orden de 42.000
kilmetros cbicos.13 Sin embargo, no existe ninguna fuente cer
cana pata esta aiena, por lo que tuvo que haber sido arrastrada
desde algn lugar en el norte, a lo largo de cientos y cientos de
kilmetros, por enormes corrientes de agua en rpido movimien
to. Evidencias similares de deposicin cruzada puede observarse
en las formaciones de arenisca del grupo Supai expuestas en el
Gran Can, situadas varios estratos por debajo de la formacin
Coconino. En este caso, tampoco existe ninguna fuente cercana
para estos enormes depsitos de arena, por lo que los sedimentos
tienen que haber sido transportados desde largas distancias por
inmensos flujos de agua.14
La formacin de arenisca Navajo, en el sur de Utah, presenta
un escenario similar, de una masiva formacin de arena deposi
tada por agua, sin una fuente cercana conocida. Sin embargo, en
este caso, las partculas de arena contienen pequeas cantidades
de zircon con inclusiones de uranio, que permite identificar su
origen. A partir de sus caractersticas minerales, los cientficos

'-R . C. Blakey y R. Knepp, Pennsylvanian and Permian Geology of Arizona, en J. P.


Jenney y S. J. Reynolds, ed., Geologic Evolution of Arizona, Arizona Geolgica! Society
Digest, vol. 17 (1989), pp. 313-347. Ver tambin: Snelling, ibd, pp. 505-510.
13Ibd.

14J. S. Shelton, Geology Illustrated (San Francisco, CA: W.H. Freeman, 1966), p. 280.

1
JViO UNIVERS videncias geolga

han sugerido que los sedimentos depositados en la arenisca N a


vajo proceden, probablemente, de rocas de las M ontaas Apala
ches de Pensilvania y de Nueva York, e incluso de antiguas m on
taas de Canad.15 Si esta hiptesis es correcta, significa que los
inmensos volmenes de arena que constituyen esta formacin
fueron transportados a lo largo de ms de 2.000 kilmetros, a
travs de lo que actualmente es Amrica del Norte.
Segn la interpretacin geolgica convencional, estos dep
sitos se formaron lentamente a lo largo de millones de aos.
Pero no existen procesos geolgicos graduales conocidos capaces
de transportar y depositar volmenes tan grandes de material a
tales distancias. Por el contrario, todas las evidencias anteriores
apuntan a movimientos catastrficos de agua a una escala nunca
registrada en los ltimos 3.000 o 4.000 aos.
Un segundo aspecto que resulta problemtico para el modelo
del uniformitarianismo es la ausencia de caones, desfiladeros,
valles y hondonadas preservados en los estratos. Si los depsitos
sedimentarios alrededor del m undo se estuvieron formando du
rante cientos de millones de aos, esperaramos descubrir num e
rosas evidencias de erosin en la columna geolgica, en forma
de superficies irregulares entre los estratos. En nuestro m undo
m oderno, la superficie del terreno es m uy irregular, ya que est
constantem ente afectada por la lluvia, el viento, las corrientes de
agua y los cambios de temperatura. Si la deposicin de las capas
de sedimentos se produca en la antigedad de una manera simi
lar al modo en que ocurre en la actualidad, los estratos deberan
m ostrar las mismas irregularidades. No obstante, las superficies
de erosin son escasas en la columna geolgica. Esto puede com
probarse en muchos lugares donde las capas quedan expuestas
a la vista, como en los cortes verticales artificiales junto a carre

15 J. M. Rahl, P.W. Reiners, I. H. Campbell, et a l, Combined Single-Grain (U-Th)/He


and U/Pb Dating of Detrital Zircons from the Navajo Sandstone, Utah, Geology, vol. 31,
N 9 (2003), pp. 761-764. Ver tambin: S. R. Dickinson y G. E. Gehrels, U-Pb Ages of
Detrital Zircons from Permian and Jurassic Eolian Sandstones of the Colorado Plateau,
USA: Paleogeographic Implications", Sedimentary Geology, vol. 163 (2003), pp. 29-66.
7 ; ' V \

teras y autopistas, en los acantilados costeros o en los desfila


deros de los ros. En la mayora de los casos, existe m uy poca o
ninguna evidencia de erosin entre las capas. Muchos lectores
habrn visto fotografas de las gruesas pilas de estratos horizon
tales paralelos que conforman las paredes del Gran Can. En la
pared del extremo oriental, hay un acantilado de 1.200 metros,
formado por estratos horizontales donde se observa una capa
sobre otra sin seales significativas de erosin. Esta secuencia de
estratos, que empieza con la arenisca cmbrica Tapeats y conti
na hasta la caliza Kaibab del Prmico tardo, cubre un perodo
de casi 300 millones de aos. Cmo es posible evitar la erosin
durante semejante perodo de tiempo?
Si cabe, la ausencia de seales de erosin es aun ms problemtica
cuando consideramos los estratos geolgicos ausentes. A lo largo de
la secuencia del Gran Can encontramos un hiato donde deberan
estar las capas del Ordovcico y del Silrico. Aunque faltan estratos
correspondientes a 100 millones de aos, aproximadamente, las ca
pas inferior y superior son paralelas entre s, y no hay prcticamente
seal alguna de irregularidad.16 En otra parte de la secuencia, existe
un hiato de 14 millones de aos, otra vez sin seales importantes de
erosin.17 El Gran Can no es el nico lugar donde encontramos
capas sedimentarias paralelas horizontales, supuestamente deposita
das con millones de aos de diferencia sin seales significativas de
erosin en la superficie de separacin de los estratos. Si recordamos
que la deposicin de los sedimentos implica normalmente corrien
tes de agua de gran caudal, es muy difcil imaginar cmo pudieron
dichas corrientes no afectar a las capas subyacentes. Resulta ms
lgico pensar que los estratos fueron depositados al mismo tiempo,
o en una sucesin relativamente breve a lo largo de das o meses,
sin tiempo suficiente para que haya erosin. Los gelogos conocen
la existencia de estas brechas, o hiatos, desde hace mucho tiempo.*1

16S. S. Beus, Temple Butte Formation, en S. S. Beus y M. Morales, ed., Granel Canyon
Geology (Oxford and New York: Oxford University Press, 1990), pp. 107-117.

11R. C. Blakey, Supai Group and Hermit Formation, en Beus y Morales, ibd., pp. 147-182.

11b
_UVIO UNIVER; bVIUhNC OLOG P A Q

El Dr. Ariel Roth, quien dirigi el Instituto de Investigacin de


Geociencia de la Universidad de Loma Linda, en California, cita
varios ejemplos de hiatos encontrados en diferentes partes del m un
do. Comenta cmo los hiatos que se hallaron en los depsitos de
carbn australianos y en los Alpes europeos son difciles de explicar
dentro del modelo de largas edades, y se adecan mejor al modelo
de un diluvio universal reciente.18
Otro indicio que apoya la idea de que gran parte de los estratos
que forman la columna geolgica y los fsiles que contienen fueron
depositados simultneamente durante un evento catastrfico glo
bal, son los mltiples casos en los que los estratos aparecen en un
orden distinto al que deberan. Existen varios ejemplos destacados
de este fenmeno en diferentes lugares del mundo. En Lochseite,
Suiza, encontramos rocas del Jursico, con una antigedad estima
da de 180 millones de aos, situadas sobre rocas del Eoceno, que
en teora tienen 60 millones de aos. La explicacin convencional
para que los estratos aparezcan en orden invertido es el llamado
cabalgamiento, una estructura geolgica causada por fuerzas de
compresin que provocan la rotura de un bloque de estratos y el
desplazamiento relativo de una de las partes sobre la otra, de ma
nera que capas antiguas que estaban en la parte inferior acaban
encima de otras ms recientes. Esta explicacin es aplicable en m u
chos casos, pero dudosa en este escenario particular. En el cabal
gamiento del Glarus, nombre que recibe esta secuencia anmala
de estratos, las rocas habran tenido que desplazarse 34 kilmetros
desde su posicin original para llegar al lugar donde se encuentran
hoy; pero no se observa evidencia alguna de dicho desplazamiento,
ya que los estratos supuestamente ms antiguos se sitan paralela
mente sobre los ms recientes, separados por una paraconformidad
(superficie de separacin sin irregularidades ni seales de erosin,
idntica a la que separa dos estratos que se han depositado sucesi-

18A. A. Roth, Those Gaps in the Sedimentary Layers, Origins (GRI), vol. 15 (1988), pp.
75-92. Ver tambin, A. A. Roth, Implications of Paraconformities, Geoscience Reports,
vol. 36 (2003), pp. 1-5.
E V O L U C I N &

vamente uno sobre otro).19 Que un bloque gigantesco de roca se


haya desplazado semejante distancia y haya terminado asentndose
sobre una secuencia de estratos ms reciente, sin provocar erosin
masiva, rotura ni plegamiento de los estratos subyacentes, no pare
ce razonable. De hecho, hace unos aos se report en la literatura
geolgica que los cabalgamientos de ms de media m illa (casi un
kilmetro) son poco defendibles. La razn es que la enorme ten
sin requerida para empujar bloques de estratos a distancias supe
riores a media milla sera tan grande que se aliviara automtica
mente por medio de rupturas sucesivas y deslizamiento de bloques
ms pequeos unos sobre otros. Como resultado, se observara una
estructura repetitiva formada por bloques menores imbricados, en
lugar de una gran losa de estratos desplazada a gran distancia y
depositada sobre un bloque subyacente pasivo.20 La ausencia de
imbricacin en el cabalgamiento del Glarus sugiere que la enorme
friccin se redujo de algn modo. Un diluvio universal catastrfico
proporcionara una explicacin razonable pues, en ese escenario,
se produciran fuerzas hidrulicas de gran magnitud y suficiente
lubricacin para impulsar el deslizamiento de los grandes bloques
de roca implicados en esta formacin.
Analicemos algunos ejemplos ms de formaciones donde los es
tratos aparecen en un orden que no concuerda con su edad estimada:
En las montaas Franklin, cerca de El Paso, Texas, las calizas
del Ordovcico Superior (450 MA) recubren estratos del Cretci
co Inferior (130 MA). Nuestros conocimientos actuales sobre las
tasas de erosin indican que es m uy difcil que estratos ordovcicos
relativamente blandos hayan resistido la erosin durante cientos
de millones de aos, y hayan permanecido en su lugar hasta que
ser empujados y colocados sobre rocas mucho ms recientes.
E n el Parque Nacional de los Glaciares, al sur de Alberta y las
montaas Chief, en Montana, que se extiende aproximadamente

l9Colin Mitchell, The Casefor Creationism (Alma Park. England: Autumn House Limited,
1994), p. 100.

20A. D. Lawson, Folded Mountains and Isostasy, Bulletin o f the Geolgica1 Society o f
America, vol. 38 (1927), pp. 253-273.
800 kilmetros a lo largo de las Montaas Rocosas, hay un rea de
varios miles de kilmetros cuadrados donde el orden de fsiles no
sigue el patrn evolutivo convencional. En este zona, encontra
mos calizas precmbricas (600 MA), cmbricas (500 MA, aproxi
madamente), y otros sedimentos paleozoicos que yacen sobre es
quistos cretcicos que contienen fsiles de dinosaurios (100 MA),
separados una vez ms por una paraconformidad. Los gelogos
han intentado explicar el orden anmalo de los fsiles teorizando
sobre un cabalgamiento gigantesco, conocido como el cabalga
miento de Lewis, que habra desplazado las rocas entre 50 y 100
kilmetros, deslizndolas de Oeste a Este sobre los estratos ms
recientes. El problema es que no se observan siquiera evidencias
de superposicin o de ruptura.21 Este tipo de estructuras sugieren,
una vez ms, la existencia de fuerzas hidrulicas de gran enverga
dura, que facilitaron dicho movimiento.
Resulta poco creble que miles de kilmetros cuadrados de
estratos sedimentarios, depositados con 400 millones de aos
de antelacin, puedan ser desplazados sobre otra capa sin de
jar seales de ruptura o de los efectos de la friccin. Adems,
como veremos en un captulo posterior, durante el perodo de
400 millones de aos que supuestamente separa los dos tipos de
rocas, las prdidas de material por erosin habran sido suficien
tes para eliminar completamente las M ontaas Rocosas varias
veces. Cuando consideramos el conjunto de evidencias relacio
nadas con los cabalgamientos, incluyendo la falta de seales de
erosin entre los estratos, la escala convencional de millones de
aos debe ser cuestionada seriamente. Teniendo en cuenta la ne
cesidad de contrarrestar fricciones descomunales, la explicacin
ms razonable para la formacin de los cabalgamientos es que
las capas implicadas se depositaron y desplazaron durante un
diluvio masivo, y que los organismos fosilizados en las capas del
Cmbrico y del Cretcico existieron simultneamente, o con
m uy poca diferencia temporal.

21Mitchell, ibd., p. 100.


iG U S a M iM P D u X lu :

-E n Arizona, las rocas prmicas de la montaa Empire, cuya da-


tacin indica ms de 200 millones de aos, recubren sedimentos
cretcicos de alrededor de 100 millones de aos. En este caso, la
superficie de separacin entre ambos es muy irregular, de manera
que los depsitos del Prmico se incrustan en hondos surcos presen
tes en material cretcico subyacente. La forma de esta superficie de
contacto se ha comparado con engranajes formados por ruedas den
tadas.22 Resulta sumamente difcil imaginar cmo podra formarse
este tipo de estructura si los estratos ms antiguos hubieran sido
empujados lateralmente sobre los ms recientes. Aun si la superfi
cie original de las capas del Cretcico hubiera estado erosionada en
forma de grandes surcos antes del cabalgamiento, el deslizamiento
lateral de las rocas prmicas sobre ella debera haber destruido los
relieves, o al menos haber dejado marcas visibles como superficies
pulidas, seales de raspado o materiales arrancados.
Todos estos casos de estratos aparentemente desordenados su
gieren que la visin convencional que implica el transcurso de
millones de aos para la deposicin de las capas de la columna
geolgica es errnea.
O tro problema que enfrenta el modelo geolgico de largas
edades, relativo a la tasa de formacin de los depsitos sedimen
tarios, es la presencia de rboles fosilizados en posicin vertical
que atraviesan un gran nmero de estratos. En los despeaderos
de Joggins, en Nueva Escocia, se encuentra una gran cantidad
de estos fsiles, as como en la ladera de Specimen Ridge, en el
Parque Nacional Yellowstone, Estados Unidos. Ya en el siglo XIX,
los gelogos C. Lyell y J. W Dawson estudiaron los rboles fsiles
verticales de Joggins, e informaron sobre restos de animales fosi
lizados dentro de algunos de ellos.23 Investigaciones recientes han
confirmado la presencia de troncos fosilizados de hasta 5 metros
de alto y 75 centmetros de dimetro, con cerca de 100 espec-

22Ibd.

23J. W. Dawson, On the Results of Recent Explorations of Erect Trees Containing Animal
Remains in the Coal-formation of Nova Scotia, Phosophical Transactions ofthe Royal
Society ofLondon, vol. 173, N 2 (1882), pp. 621-654.
DILUVIO i.JNIVEF )C r. LAS

menes en su interior, incluyendo numerosos invertebrados y 11


tipos diferentes de vertebrados.24 Tambin se han hallado restos
fosilizados de reptiles y anfibios en los estratos adyacentes, en la
parte exterior de los rboles. Muchos de los troncos estn huecos y
rellenos de sedimentos que, probablemente, fueron transportados
hasta all por una corriente de agua a gran velocidad, que atrap a
los diferentes animales que se encuentran fosilizados. La presencia
de estratificacin cruzada en areniscas del interior de los troncos
tambin confirma la circulacin rpida de corrientes de agua.25 El
conjunto de datos sugiere que estos grandes rboles en posicin
vertical fueron enterrados rpidamente por corrientes de agua,
que se movan a velocidad vertiginosa y arrastraban a su paso seres
vivos y enormes cantidades de sedimento.
Los informes de rboles fsiles casi verticales que atraviesan
mltiples estratos se encuentran con frecuencia en la literatura,
particularmente en asociacin con depsitos de carbn de di
ferentes partes del m undo, incluyendo la Antrtida.26 N o lejos
de donde vivo, al norte de Sdney, se encuentra Newcastle Coal
Measures, una famosa formacin rica en carbn. El investigador
Dr. Andrew Snelling, diplomado por la Universidad de Sdney,
explica que estas capas de carbn presentan una estructura re
petitiva y contienen troncos de rboles fosilizados en posicin
vertical. Yo mismo he visto algunos de estos fsiles cerca del M ar
de Swan. Algunos de los rboles se asientan sobre una veta de
carbn, atraviesan los estratos superiores y alcanzan la siguiente
veta. El Dr. Snelling seala que, segn los mineros, algunos de
los troncos m iden hasta 9 metros de longitud y atraviesan varias

24A. C. Scott y J. H. Calder, Carboniferous Fossil Forests, Geology Today, vol. 10, N 6
(1994), pp. 213-217.
25 C. F. K. Diessel, Coal-bearing Depositional Systems (Berln: Springer-Verlag, 1992),
p. 390.
26 D. I. M. Macdonald y J. E. Francis, The Potential for Cretaceous Coal in Antartica, en
P. J. McCabe y J. T. Parrish, ed., Controls on the Distribution and Quality o f Cretaceous
Coals, The Geological Society of America Inc. (Boulder, Colorado, 1992), pp. 385-393.
ev ucin iMpesiaii:

vetas de carbn, adems de estratos de arenisca y otros sedimen


tos.27
Una de las caractersticas comunes de estos fsiles es que, ge
neralmente, carecen de sistema radicular y no suele haber evi
dencias de la superficie en la que originalmente crecieron. Segn
el Dr. Snelling, a pesar de que algunos de estos troncos tienen
varios metros de largo, las copas de los rboles no se encuentran
conservadas con ellos. En todos los casos, la parte superior del
tronco est rota y, con frecuencia, tam bin falta la parte inferior;
esto sugiere que, en la mayora de los casos, los rboles fueron
arrancados de su lugar de origen y transportados a una nueva
ubicacin, donde quedaron enterrados rpidamente. En la ma
yora de los casos, este proceso violento habra causado la prdi
da de las copas de los rboles, y tam bin de las races y de la parte
inferior del tronco. Evidencias concluyentes de que los rboles
fosilizados en posicin vertical no tienen por qu encontrarse en
su ubicacin original, se obtuvieron tras la erupcin del m onte
St. Helens, en 1980, cuando miles de rboles flotaron en posi
cin vertical hasta el lago Spirit, en el Estado de W ashington.28
Derek Ager, profesor emrito de Geologa en la Universidad de
Swansea, en Gales, considera que los rboles fsiles en posicin
vertical son evidencia de sedimentacin m uy rpida en el pasa
do.29 Eso es exactamente lo que ocurri durante la erupcin del
m onte St. Helens: se formaron capas estratificadas de hasta 130
metros de espesor, a causa de las avalanchas de lodo y la preci
pitacin de ceniza volcnica. Uno de estos depsitos, de ms de
30 metros de espesor, se form en un solo da: el 12 de junio
de 1980. Dicho depsito contena un estrato de 8 metros, com
puesto por ms de 100 capas finas, y estaba ubicado entre un de
psito de corriente de lodo de 5 metros y una capa de ceniza de

27 Snelling, ibd., t. 2, pp. 566, 567.

28 H. G. Coffin, Erect Floating Slumps in Spirit Lake, Washington, Geology, vol. 11


(1983), pp. 298, 299.

29 Derek V. Ager, The New Catastrophism (Cambridge, UK: Cambridge University Press,
1993), p. 49.
UiLUV UNIVERSAL UC . N l .i r

8 metros. La formacin de este tipo de depsitos multicapa se ha


visto tam bin tras la actividad de huracanes y torm entas.30 Estas
observaciones nos perm iten afirmar que en un escenario como el
diluvio universal, cuyas condiciones catastrficas podran incluir
no solo movimientos masivos de agua, sino tam bin una intensa
actividad ssmica y volcnica, incluso las formaciones geolgi
cas de mayor envergadura podran haberse desarrollado en un
perodo de tiempo relativamente breve. Sin embargo, si estas
formaciones se dataran a partir de las tasas de sedimentacin ac
tuales siguiendo el modelo del uniformitarianismo, aparentaran
tener una edad m ucho mayor.
Hemos descrito numerosos datos, procedentes de la estrati
grafa y de la paleontologa, que han demostrado ser ms com
patibles con el modelo de un diluvio universal catastrfico que
con el modelo convencional de largas edades. A continuacin,
analizaremos evidencias geolgicas de cmo ha cambiado el cli
m a a lo largo de la historia de la Tierra, y nos preguntaremos
hacia dnde apuntan dichas evidencias.
Se ha descubierto antiguos cursos de ros, tan grandes como
el Nilo, bajo las arenas del desierto de Sahara, y tam bin fsiles
de cocodrilos e hipoptamos, y evidencias de presencia humana,
como anzuelos y arpones. Esto sugiere que esa rea fue mucho
ms hm eda en la antigedad.31 Tambin sabemos que, en el pa
sado, muchos lagos eran ms grandes que en la actualidad. Por
ejemplo, el Gran Lago Salado de Utah era, aproximadamente,
17 veces mayor. El lago Chad, en frica, tena casi 1.000 kilo-
metros de largo, con una entrada de agua 16 veces superior a la
actual; y el Manly, un lago de 180 metros de profundidad, cu-

30 Steven A. Austin, ed., Granel Canyon, Monument to Catastrophe (Santee, CA: Institute
for Creation Research, 1994), pp. 37, 38.
31H. J. Pachur y S. Kropelin, Wadi Howar: Paleoclimatic Evidence from an Extinct River
System in the Southeastern Sahara, Science, vol. 237 (1987), pp. 298-300; B. D. Shaw,
Climate, Environment and Prehistory in the Sahara, World Archaeology, vol. 8. N 2
(1976), p. 142.
fiWAUjeiMSNi <

bra parte del Valle de la Muerte, en California.32 Estos son indi


cadores de una hum edad elevada. Por otro lado, existen tambin
abundantes evidencias de extensa glaciacin y vastas llanuras de
hielo, que se formaron en el pasado coincidentemente con la
extincin de grandes animales, como los m am uts lanudos.
Condiciones climticas de hum edad alta y temperaturas cli
das, seguidas por la Edad de Hielo y un calentamiento gradual
posterior, son exactamente el escenario propuesto por el meteo
rlogo Michael O ard dentro de su modelo de diluvio universal.33
A pesar de esto, los glacilogos que adhieren al modelo de lar
gas edades han datado las capas de hielo de las regiones rtica y
antrtica por mtodos convencionales, y han obtenido fechas que
se remontan a cientos de miles de aos en el pasado. Su conclu
sin es que la Tierra ha pasado, al menos, por 30 edades de hielo
sucesivas. Los cambios climticos cclicos necesarios para explicar
repetidas edades de hielo se han explicado por medio de la teora
astronmica propuesta por el astrofsico serbio M ilutin Milanko-
vitch. Segn Milankovitch, debido a las influencias gravitatorias
de los dems planetas del Sistema Solar, los parmetros astron
micos del movimiento de la Tierra varan cclicamente a lo largo
de los milenios. La forma de la rbita de la Tierra, la distancia al
Sol en el momento de los solsticios y los equinoccios, y la inclina
cin del eje de la Tierra cambian peridicamente, y se combinan
de forma compleja en los llamados ciclos de Milankovitch. El
resultado de estos ciclos son variaciones peridicas leves en la can
tidad de radiacin solar recibida en la Tierra, lo que habra provo
cado mltiples edades de hielo a lo largo de la historia del planeta.
Esta teora presenta problemas importantes. En prim er lugar,
los cambios en los niveles de radiacin son demasiado pequeos

32R. L. Hooke, Lake Manly Shorelines in the Eastem Mojave Desert, California, Qua-
temary Research, vol. 52 (1999), pp. 328-336; A. J. Sutcliffe, On the Track o f Ice Age
Mammals (Cambridge, MA: Harvard University Press, 1985), p. 22.

33 Michael J. Oard, An Ice Age Cansed by the Gnesis Flood (El Cajn, CA: Institute for
Creation Research, 1990), p. 97. Ver tambin: Michael Oard, Frozen in Time (Green Fo-
rest, AR: Master Books Inc., 2004).
10 UNIVERSAL: EVIDENCIAS GEOL

como para provocar una Edad de Hielo.34 En segundo lugar, las


dataciones de los ncleos de hielo indican que hubo una Edad
de Hielo cada 100.000 aos, pero los ciclos de M ilankovitch no
se corresponden con esa periodicidad.35 Y en tercer lugar, datos
procedentes de los ncleos de hielo de Groenlandia indican una
nica Edad de Hielo.36 Una crtica detallada de la teora de M i
lankovitch y de las interpretaciones convencionales de los datos
procedentes de los ncleos de hielo, ha sido recopilada por el
meteorlogo Michael Oard, jubilado del Servicio Climtico del
gobierno estadounidense.37
El modelo de diluvio universal ofrece explicaciones razona
bles para la deposicin de hielo en los polos durante un periodo
de tiempo relativamente breve, y para la extincin de la mega-
fauna. Tambin propone que los desiertos que hoy encontramos
alrededor de los 30 grados de latitud eran ambientes hmedos
y exuberantes durante la Edad de Hielo, lo que coincide con los
datos observados.38 De hecho, se ha argumentado que el modelo
de edad de hielo posdiluviana es el nico modelo cientfico que
ha sido capaz de explicar con xito el desarrollo de las llanuras
de hielo donde sabemos que una vez existieron.39
La Tierra est llena de evidencias a favor del diluvio univer
sal, que no podemos comentar aqu en detalle. Por ejemplo, los

34I. louzel, J. R. Petit y D. Raynaud, Palaeoclimatic Information from Ice Cores: the Vostok
Records, Transactions ofthe Royal Society ofEdinburgh, vol. 81 (1990), pp. 349-355.

35 D. Paillard, Glacial Cycles: Toward a New Paradigm, Reviews ofGeophysics, vol. 39,
N 3 (2001), pp. 325-346.
36W. Dansgaard, H, B. Clausen, N. Gundestrup, et a l , Dating and Climatic Interpretation
of Two Deep Greenland Ice Cores, American Geophysical Union, Greenland lee Core:
Geophysics, Geochemistry, and the Environment, Geophysical Monograph, N 33 (1985),
pp. 71-76.
37Michael J. Oard, The Frozen Record (Santee, CA: Institute for Creation Research, 2005).

38 M. Oard, Frozen in Time (Oreen Forest, AR: Master Books Inc 2004), pp. 33-46,69-106.

39 L. Vardiman, An Analytic Young-earth Flow Model of Ice Sheet Formation During the
Ice Age , Proceedings ofthe Third International Conference on Creationism, Creation
Science Fellowship (Pittsburgh, PA, 1994), pp. 561-568.
S V tU C I N IM P G

ros que atraviesan cordilleras, como el Gordon River Splits, en


Tasmania, sugieren que la elevacin de las cordilleras se produjo
de manera subsiguiente a la inundacin. El lector puede encon
trar una evaluacin extensiva de las evidencias geolgicas a favor
de un diluvio global catastrfico en los dos volmenes recien
tem ente publicados de la coleccin Earths Catastrophic Past [El
pasado catastrfico de la tierra] .40
En el presente captulo, he intentado demostrar que el cuadro
geolgico general de la superficie fue moldeado por un diluvio
universal catastrfico, y no por millones de aos de deposicin
lenta de sedimentos y cambios graduales. Finas capas de sedi
mentos que se extienden sobre continentes enteros, fsiles fuera
de orden, rboles en posicin vertical y datos paleoclimticos
sugieren una gran inundacin catastrfica, acompaada por
tormentas y actividad volcnica a nivel planetario, como el es
cenario ms probable para la deposicin de la colum na geol
gica. Adems de las evidencias geolgicas, existe una cantidad
sustancial de evidencias histricas de que este diluvio universal
catastrfico ocurri y que fue relativamente reciente. Trataremos
este tema en el prximo captulo.

* A. A. Snelling, bd. (Dallas, TX: Institute for Creation Research, 2009), t. 1,2.
DILUVIO UNIVERSAL:
EVIDENCIAS
HISTRICAS

comienzos del siglo XIX, en universidades como Oxford y

A Harvard, la interpretacin geolgica de los estratos de roca


se enseaba en el contexto del diluvio de Noe. Este rela
to de un diluvio universal se conserva en el Gnesis, un antiguo
libro hebreo cuyo presunto autor, Moiss, era un hebreo que fue
adoptado por la familia del faran y heredero del trono egipcio,
y que vivi entre 1526 y 1406 a.C., aproximadamente. Su relato
describe cmo, alrededor de 2303 a.C.,i23 las fuentes de las pro-

i tan T. Taylor, In the Minds o f Men (Toronto, Caada: TFE Publishing, 1984), pp. 66,
110, 350.
2T. D. Alexander, Introduction to Gnesis, ESV Study Bible (Wheaton, IL: Crossway Bibles,
2008), pp. 39-48; John Ashton y David Down, Unwrapping the Pharaohs: How EgyptianAr-
chaeology Confiris the Biblical Timeline (Green Forest, AR: Master Books, 2007), pp. 89-95.

3Para detalles del modo de calcular estas fechas a partir de registros histricos, y una com
paracin con la fecha calculada por James Ussher en 1650 d.C., ver el Apndice.
ELUCIN sMPKS <1*

fundidades de la Tierra se abrieron y empezaron a arrojar aguas


torrenciales, en forma simultnea con un evento global de lluvias,
que dur 40 das. El nivel del agua se elev hasta cubrir totalmen
te la Tierra, y destruy toda la vida sobre la superficie. Un hombre
llamado No, su mujer y sus tres hijos con sus esposas (ocho per
sonas en total), y dos ejemplares de cada especie animal fueron sal
vados en el interior de un barco de madera gigantesco, conocido
como el Arca de No (Gnesis 6:9-8:18). El relato del Gnesis est
escrito de una manera considerablemente factual e histrica, con
innumerables detalles. Informa del da y el mes en que empez el
diluvio, dice que el agua cubri la Tierra durante 150 das y que
luego baj lentamente durante los siguientes 150. Describe cmo
se sec laTierra, y cmo la familia de No y los animales abando
naron el arca unos 70 das despus (Gnesis 7:24-8:13).
El relato del Gnesis registra que No fue advertido por Dios de
que se aproximaba un diluvio que destruira laTierra, e indica que
Dios dio a No instrucciones precisas a fin de construir la nave
que salvara a su familia y a los animales. Debido a la naturaleza
milagrosa del relato, el Diluvio de No es considerado, a m enu
do, un mito religioso. Por consiguiente, la mayora de los gelogos
y los cientficos actuales descarta la idea de un diluvio universal
reciente como hecho histrico o cientfico. Sin embargo, si revisa
mos la informacin disponible en estos momentos, encontramos
una cantidad asombrosamente grande de evidencias histricas y
cientficas que respaldan la idea de que el diluvio universal ocurri
realmente en un pasado no m uy lejano. Pido la indulgencia del
lector para revisar tales evidencias en el resto de este captulo.
En primer lugar, las tradiciones de muchos pueblos antiguos de
todas partes del mundo incluyen, de una manera u otra, el relato
de un diluvio universal, del que solamente se salvaron unas pocas
personas. El arquelogo y profesor Andr Parrot, quien fue direc
tor jefe de los Museos Nacionales de Francia, explica que existen
mltiples relatos legendarios sobre el diluvio, como la Epopeya de
Gilgamesh.Tambin hay breves referencias al diluvio como hecho
histrico, como la que aparece en la lista de los reyes del prisma
DILUVIO UNIVERSAL i DONO

de Weld-Blundell.45En la narrativa sumeria del diluvio, se explica


que los dioses decidieron enviar un diluvio para destruir a la raza
humana, pero que el rey Ziusudra fue salvado en una embarcacin
gigante que construy, siguiendo las instrucciones de un dios que
tuvo compasin de l. Un fragmento de este relato, que data del
siglo XIX a.C., se encontr en Nippur (Babilonia). La versin asiria
se encontr en unas tablillas cuneiformes de la biblioteca de Ashur-
banipal, que vivi en Nnive en el siglo VII a.C. En este caso, un
hroe de nombre Gilgamesh va en busca de Utnapisbtim, quien
sobrevivi al diluvio. Utnapishtim relata a Gilgamesh cmo el dios
Ea le advirti que construyera una nave y que entrara en ella con su
familia, sus artesanos y sus animales. Se desencaden una tormenta,
y un diluvio sumergi por completo al m undo y destruy a la hu
manidad. Despus, la nave se asent en una montaa. Se enviaron
algunas aves al exterior. Cuando una de las aves, un cuervo, no re
gres, los supervivientes salieron del arca.
La literatura griega antigua tambin describe el diluvio. Pindar,
que vivi en el siglo V a.C., lo menciona explcitamente, y una ver
sin completa se puede encontrar en el compendio griego de mitos y
leyendas heroicas Bibliotheca (Pseudo-Apollodorus)? En el relato grie
go, el dios Zeus decide destruir a la raza humana, pero Prometeo
aconseja a su hijo, el rey Deucalin, que construya un arca en la que
l y su esposa pudieran sobrevivir. La lluvia inunda la Tierra y, despus
de flotar durante nueve das, el arca se asienta en una montaa.
Una versin romana es registrada por Ovid en Metamorphoses Li
bro 1. Una vez ms, los dioses deciden destruir a la humanidad, que
se ha corrompido, enviando un gran diluvio. Solamente Deucalin
y Pirra se salvan en un barco, de manera que se convierten en los
nuevos padres de la humanidad.6

4 Andr Parrot, Flood (in Religin and Myth), Encyclopaedia Britannica (Chicago, IL:
William Benton Publisher, 1967), t. 9, pp. 455, 456.

5Apollodorus y R. Hard, trad., The Library ofGreek Mythology (Oxford Worlds Casses)
(New York: Oxford University Press, 2008).

6 D. A. Leeming y M. A. Leeming, A Dictionary o f Creation Myths (New York: Oxford


University Press, 1994), p. 236.
gvnrjJCJN m p c s ik

El diluvio se m enciona tam bin en el snscrito Shatapatha


Brahmana del siglo VI. Esta historia de la antigua India habla
de M anu, quien fue advertido por un pez sobre un diluvio, que
se aproximaba y destruira a toda la hum anidad. Se le dijo que
construyera un barco y, durante el diluvio, el pez remolco el
barco a un lugar de descanso sobre una cumbre.7
El pueblo Mande de Mal, en el centro de frica Occidental,
tiene un mito de la creacin sobre un arca que atrac en una mon
taa. El arca contena a los ocho antepasados originales de los seres
humanos, y a todos los primeros animales y plantas.89Los aborge
nes Aranda, del norte de Australia, poseen un relato mtico en el
que la creacin sali mal y fue eliminada por un diluvio.0 Los indios
Arikara, de las llanuras estadounidenses, cuentan una historia de
gigantes que no sentan respeto por su Creador y fueron destruidos
por un gran diluvio. Solo se salvaron unos pocos gigantes buenos.10*
David Leeming y Margaret Leeming, de la Universidad de Ca
lifornia en Santa Brbara, han descrito muchas otras narraciones
sobre el diluvio, presentes en las tradiciones de los pueblos del con
tinente americano, incluyendo a los esquimales; al pueblo Netsilik,
de Groenlandia; a los nativos americanos Cheyenne de las llanuras;
a los Navajos del suroeste de Estados Unidos; a los indgenas Yuma
y Pima, de Atizona; a los indgenas Pomo y Salina, de California; al
pueblo Ipurina, de Brasil; a los antiguos Myscas, de Per; y los ma
yas Quich, de Guatemala, cuya civilizacin se remonta al menos al
300 d.C.n La pgina web del Museo Ashmolean de Arte y Arqueo
loga (en la Universidad de Oxford), tambin seala que los relatos
de un diluvio universal que ocurri en la antigedad se extienden
alrededor del mundo, tanto en fuentes orales como escritas.12

7 Parrot, ibd.
8 Leeming y Leeming, ibd., pp. 180, 181.

9 Ibd., 14.

10Ibd., 16.
"Ibd., 47, 86, 145, 186, 200, 204,209, 230, 239, 302.
12Ver: www.ashmolean.org/ash/faqs/q001007.php.
Muchas de las narraciones comparten detalles con el relato del
Gnesis: incluyen animales, mencionan el arco iris, se envan aves al
exterior tras finalizar la lluvia, una nave que atraca en una montaa,
etc., y explican que el diluvio fue decretado por los dioses debido a
la perversidad de la humanidad en aquel tiempo. Algunas versiones
mencionan, especficamente, que fueron ocho las personas salvadas.
El profesor Parrot ha listado historias del diluvio procedentes
de regiones de todo el m undo: China, sur de Asia, Sumatra,
Borneo, Australia, Nueva Guinea, Polinesia, Melanesia, Rusia
oriental, Rumania, Lituania y Gales. Parrot seala que, en la ma
yora de las historias, hay caractersticas comunes, como la sal
vacin de un pequeo grupo de personas en una embarcacin.11
El Dr. Robert Young, LL.D., quien compil una concordancia
de la Biblia en 1879, coment que a No se le llama Yao o Fo-Hi
(Fu Hsi) en la literatura china antigua, y Deucalin, Xisuthrus,
etc., en otras narraciones.1314
Evidencias adicionales de la exactitud histrica del registro del
Gnesis se conservan en los smbolos pictogrficos de un anti
guo manuscrito chino. El historiador de arte chino Dr. Ginger T.
Chock, diplomado por la Universidad de Stanford, y sus coautores
comentan estos smbolos en el contexto de varias narraciones anti
guas, y llegan a la conclusin de que apoyan el relato de Gnesis,
incluyendo el diluvio y el nombre de No.15
De todos los relatos del diluvio, probablemente, el de Gnesis
sera visto por la mayora de los eruditos como el mas creble
e histricamente exacto. Por ejemplo, los manuscritos antiguos
se refieren a Egipto como la tierra de Egipto , es decir, la re
gin donde se estableci una persona llamada Egipto; a veces,
tambin, se la llama la tierra de Cam (Salmo 105:23, 27). En
realidad, Egipto recibe su nom bre del nieto de No, Mizraim;

13Parrot, ibd.
14 Robert Young, Analytical Concordance to the Holy Bible, 8o ed. (London: Lutterworth
Press, 1966), p. 698.
15 E. R. Nelson, R. E. Broadberry y G. T. Chock, God's Promise to the Chnese (Dunlap,
TN: ReadBooks, 1997), p. 105-119.
iV iM a m im m j !

y Mizraim era el hijo de Cam, hijo m enor de No. El nombre


Egipto que usamos hoy es la versin griega m oderna de M i
zraim. En los mapas, Egipto aparece a m enudo como Misr, que
es el nom bre egipcio nacional16 Esta es una evidencia slida de
que Egipto (Mizraim) y Cam eran personas reales, ya que en la
antigedad los pueblos y los pases eran nombrados segn las
personas que los fundaron.
El relato del Gnesis tam bin fue corroborado por un his
toriador egipcio de nombre M anetn, que fue sacerdote en el
templo en ficlipolis durante la era griega, alrededor del ao
270 a.C. De acuerdo con Herodoto, los Heliopolitanos eran los
ms eruditos entre los egipcios.17 M anetn registr la historia
de Egipto y escribi que, despus del diluvio, Cam, el hijo de
No, engendr a Aegyptus, o Mestraim. Este fue el primero
en asentarse en el rea que actualmente ocupa Egipto, cuando
las tribus empezaron a dispersarse.18 En una de las otras obras
de M anetn, el Libro de Sothis, se especifica que esta disper
sin tuvo lugar cinco aos despus del nacimiento de Peleg, que
era hijo del tataranieto de No, nacido 101 aos despus del
diluvio.19 Segn estos datos, las tribus empezaron a separarse,
aproximadamente 106 aos despus del diluvio, ms o menos
alrededor de 2195 a.C.
Es revelador que el Lemprires Classical Dictionary [El diccio
nario clsico de Lemprire] afirme: De acuerdo con los clculos
de Constantino Manass, el reino de Egipto dur 1.663 aos des
de su origen bajo Mizraim, hijo de Cam, en 2188 a.C., hasta la

16 The World Book Great Geographical Atlas (Sydney, Australia: World Book Australia
Pty.Ltd., 1984), p. 181.
17 Manetho, Manethos History of Egypt, en Manetho, traduccin al ingls de W. G.
Waddell (Cambridge, MA: Harvard University Press. 1964), p. xi.

18/f ,p . 7.
19 Manetho, Book of Sothis App. IV, en Manetho, traduccin al ingls de W. G. Waddell,
p. 239. Ver tambin: James Ussher, The Annals ofthe World (1658), secc. 1657 AM-1762
AM. En lnea: www.archive.org/details/AnnalsOfTheWorld.
conquista de Cambyses, en 525 a.C.,20 Manass era un cronista
bizantino que vivi en el siglo XII d.C., y que tambin atribuye
la fundacin de Egipto al nieto de No, justo despus de la dis
persin. Su fecha de 2188 a.C. est en estrecha concordancia con
las fechas que se calculan a partir de las genealogas listadas en los
manuscritos hebreos antiguos, usando la fecha del cuarto ao del
reinado del Rey Salomn como punto de referencia histrico.
Las cronologas de otras civilizaciones antiguas tam bin coin
ciden en asignar fechas similares a la dispersin de las tribus
que previamente se ubicaban cerca de la localidad de Babilonia
(Gnesis 11:8, 9). Este es el caso de Tilomas M aurice, A.M .,
que fue asistente de bibliotecario en el Museo de Londres a co
mienzos del siglo XIX, y public el siguiente informe despus
de visitar las ruinas de Babilonia: Cuando Alejandro conquist
Babilonia, los sacerdotes caldeos informaron a Calstenes que te
nan observaciones astronmicas grabadas en ladrillos cocidos al
horno, las cuales se rem ontaban 1.903 aos antes del perodo en
que se logr la conquista (330 a.C .).21 Esto nos rem onta al ao
2233 a.C., lo que concuerda perfectamente con la fecha para el
comienzo de la dispersin de las tribus desde los alrededores de
Babilonia, aproximadamente, 40 aos despus.
El historiador del siglo cuarto Eusebio de Cesrea registr que
Egialeo, un rey griego, empez su reinado en 2089 a.C., 1.313
aos antes de la primera Olimpada de 776 a.C.22 Esta parece
ser la fecha cronolgica ms antigua atribuida a un reino griego.
Corresponde a tan solo 100 aos despus de la dispersin, y
es una fecha razonable, dada la distancia que la tribu tuvo que

20 J. Lamprire, Aegyptus, A Classical Dictionary: Containing a Copious Account o f All


the Proper ames Mentioned in Ancient Authors, 8a ed. (London: T. Cadell and W. Davies
Publishers, 1812), p. AEL.

21 Thomas Maurice, Maurices Observations on the Ruins of Babylon, London Review


and Literary Journal (agosto de 1817), p. 145. Ntese que la cifra de 1.903 aos tambin
puede encontrarse en la traduccin latina medieval de Guillermo de Moerbeke (a.d. 1215-
1286) de un manuscrito en griego de Simplicio.

22 Eusebius, Chronici Cnones (London: Humphredum Milford, 1923), pp. 1-14.


V?LCM IM PO StiX

recorrer desde Babilonia. A los griegos se los identifica como


los hijos de Javn, quien fue otro nieto de No a travs de su
segundo hijo, Jafet (Joel 3:6; Gnesis 5:32; 10:1; Isaas 66:19).
Javn es tam bin el nom bre hebreo para Grecia, y se usa para
hacer referencia a los descendientes de Javn y sus naciones, a
saber, Jonia, Macedonia, Grecia y Siria.23
El Dr. Young seala que Jafet es, probablemente, el original
de Japetus o Iapetus (Jpeto), a quien los griegos consideran el
antepasado de la raza hum ana.24 El historiador romano Josefo
tambin enumera muchas de las tribus de Europa, incluyendo
a Grecia, como descendientes de Jafet, habiendo sido nom bra
das muchas localidades geogrficas y pueblos en honor de sus
hijos y nietos.25 Por ejemplo, Charles. J. F. Dowsett, de la Es
cuela de Estudios Orientales y Africanos, en la Universidad de
Londres, seala que los antiguos escritores armenios llaman a
su pueblo descendientes de Togarma o Askenaz, los hijos de
Gomer, quien a su vez tam bin era hijo de Jafet.26 Jafet tena
otro hijo llamado Magog. Josefo seala que los griegos lla m a b a n
escitas a los magogitas,27 que eran un pueblo que habitaba el rea
correspondiente a Rusia septentrional y a Ucrania. O tro de los
hijos de Jafet, y nieto de No, fue M adai (Gnesis 10:2), padre
de los Madeanos, a quienes los griegos llamaban Medos y que,
de acuerdo con Josefo, vivieron en la regin sur del M ar Caspio.
Todos estos datos procedentes de distintas fuentes de reco
nocida validez vinculan a numerosos pueblos de Europa con los
nietos de No, lo que da ms credibilidad al Gnesis y sugiere
que es posible considerar el relato del diluvio desde una perspec

23 R. Young, Analytical Concordance to the Holy Bible, 8o ed. (London: Lutterworth Press,
1966), pp. 437, 534.

24 Ibd., p. 533.

25 Josephus, The Antiquities of the Jews, 1.6.1, en W. Whiston, trad., The Complete Wor
ks o f Flavius Josephus (Green Forest, AR: Master Books, 2008), p. 41.

26 C. J. F. Dowsett, Armenia, Encyclopaedia Britannica (Chicago, IL: William Benton


Publisher, 1967), t. 2, p. 422.

27 Josephus, ibd., p. 41.


DILUVIO UNIVERSAL: EVIDENC

tiva histrica. Otros autores han analizado en detalle este asun


to, y llegaron a conclusiones similares.28 Es sumamente inusual
nom brar pueblos y regiones con el nom bre de personas ficticias.
Los pueblos y los pases reciben casi siempre sus nombres a par
tir de personas reales, normalmente, de sus fundadores. El uso
de trminos como la tierra d e ... tam bin fortalece la creencia
de que las personas nombradas son reales.
Datos de regiones incluso ms lejanas, como Asia oriental,
concuerdan tam bin con este relato. L. Carrington Goodrich,
profesor de Chino en Colum bia University, seala que una de
las cronologas chinas ms antiguas conservadas, llamada los
Anales de Bamb, da como fecha de inicio de la prim era dinas
ta en C hina 1994 a.C.; aunque existe una fecha revisada alter
nativa que sita la primera dinasta (Hsia) en 2183 a.C.29Ambas
fechas son posteriores a la fecha de la dispersin de las tribus des
de Babilonia y, por lo tanto, armonizan con el relato del Gnesis.
U na evidencia adicional de la exactitud histrica del Gnesis
proviene del descubrimiento en 1974 de un archivo de alrede
dor de 20.000 tabletas cuneiformes m uy antiguas, en Ebla, en el
norte de Siria. Estas tabletas hacen referencia a los cananeos que
vivieron en la tierra de Canan. Canan era otro hijo de Cam,
y nieto de No. Canan fue el padre de Sidn, y el pueblo que
fund se convirti despus en la ciudad principal de la antigua
Fenicia, en la costa este del m ar Mediterrneo. Segn el Gnesis,
la tierra de Canan se extenda desde Sidn hasta Lasa, en direc
cin a Sodoma, Gomorra, Adma y Zeboim (Gnesis 10:6-20).
Estos cuatro pueblos, que no existen en la actualidad, y hasta
este m om ento solamente se mencionaban en el Gnesis y en
otra literatura hebrea, aparecen tam bin nombrados en las table
tas de Ebla, al igual que pueblos y regiones como Hazor, Laquis,
Meggido, Gaza, Sina, Jopa y Damasco, lugares bien conocidos
para historiadores y arquelogos. La mencin de Canan y las

28Ver, por ej., B. Cooper, After the Flood (Chichester, England: New Wine Press, 1995).

29 L. C. Goodrich, China, Encyclopaedia Britannica, t. 5, p. 575.


SIJUtlIOM IMPCISilLS

cuatro ciudades de la llanura provee fuertes evidencias de que


el Gnesis contiene informacin histrica factual. Detalles del
contenido de las tabletas de Ebla han sido explicados por el epi
grafista que las tradujo, el Dr. Giovanni C. Pettinato, profesor
de Asiriologa en la Universidad de Roma.30
La mayora de los relatos que se han preservado sobre el dilu
vio, aparte del que aparece en el Gnesis, presentan detalles m uy
poco realistas como, por ejemplo, personas que son salvadas en
una canasta o un barco con forma cbica. En otras versiones,
los dioses o las personas tom an forma de diferentes animales,
el diluvio dura solamente siete das, etc. Por otro lado, el re
lato del Gnesis es, por lejos, el ms verosmil. Se puede citar
los relatos sumerios sobre el diluvio que aparecen en el prisma
Weld-Blundell, y en otras tabletas y manuscritos antiguos, que
contienen lo que se conoce como la lista sumeria de reyes.
Esta lista nom bra ocho reyes que vivieron antes del diluvio y
gobernaron por perodos de tiempo m uy prolongados, decenas
de miles de aos, y reyes de despus del diluvio, que gobernaron
por perodos de tiempo m ucho ms breves, cientos de aos.31
En el relato paralelo del Gnesis, se registra una lista de ocho
patriarcas antediluvianos con una longevidad bastante constan
te, que se va desde 895 hasta 969 aos, y uno, el padre de No,
que vivi solamente 777 aos. Despus del diluvio, las edades
disminuyen rpidamente.
El investigador en gentica de la Universidad Cornell, Dr. John
Sanford, ha reflejado en un grfico los datos de longevidad pos
diluviana registrados en el Gnesis, en otros libros de Moiss y en
otras fuentes de la literatura histrica hebrea de diferentes escrito
res, a travs de los siglos. Estos registros de duracin de la vida de
las personas durante un perodo de casi 2.000 aos, despus del

30 Giovanni C. Pettinato, Elba: A New Look at History (Near Eastem Studles) (Baltimore,
MD: The Johns Hopkins University Press, 1991).

31 J. A. Black, G. Cunningham, J. Ebeling, E. Flckiger-Hawker, E. Robson, J. Taylor y G.


Zlyomi, The Sumerian King List: Translation, The Electronic Text Corpus ofSumerian
Literature (1998-2006). Ver: www.etcsl.orinst.ox.ac.uk/section2/tr211.htm.
DiLUVIO UNIVERSO 0/iDER AS Hi: URICAS

diluvio, reflejan la forma de una curva de decadencia biolgica ex


ponencial. El coeficiente de correlacin de la curva es de 0,90, lo
que significa que el ajuste de los datos es m uy bueno. Estos datos
no pueden ser falsificados fcilmente, pues provienen de fuentes
diferentes que abarcan varios siglos. El Dr. Sanford seala que la
curva obtenida es muy similar a las curvas tericas que reflejan la
degeneracin del genoma con el paso del tiempo, lo que signifi
cara que la disminucin de la longevidad hum ana tras el diluvio
podra deberse a la degeneracin del genoma causada por acu
mulacin de mutaciones en el A D N .32 El estudio del Dr. Sanford
muestra cmo se pueden obtener datos cientficos del libro del
Gnesis y, por tanto, reafirma su validez y su fiabilidad histricas.
El lector puede preguntar: Por qu la longevidad disminuye
repentinamente despus del diluvio? Aunque no sabemos con
certeza qu caus este efecto, podemos teorizar una explicacin
cientfica, teniendo en cuenta qu factores ambientales cambiaron
de antes a despus del diluvio. Segn el relato del Gnesis, parte
del agua del diluvio surgi desde las profundidades de la Tierra.
Quizs esta agua, que no estaba accesible para el ser hum ano antes
del diluvio pero s despus, pudo tener alguna relacin con la dis
minucin de la longevidad. Las molculas de agua estn formadas
por un tomo de oxgeno y dos de hidrgeno. Si en las molculas
de agua se sustituye el hidrgeno por deuterio, un elemento si
milar pero ms pesado, se obtiene lo que se llama agua pesada,
o agua de deuterio. De forma natural, un porcentaje del agua
en la naturaleza es agua pesada, pero no se encuentra en la mis
ma proporcin en todas partes. Las aguas subterrneas contienen
niveles relativamente altos de agua pesada, mientras que la nieve
rtica tiene niveles mucho ms bajos.33 Los efectos del deuterio en

32 John C. Sanford, Genetic Entropy & The Mystery o f the Genome (Waterloo, NY: FMS
Publications, 2008), p. 155.

33Ver, porej.,P. G. CookyA. L. Herczeg, Environmental Tracers in Subsurface Hydrology


(New York: Kluwer Academic Publishers, 2000); E. Mazor, ed., Chemical and Isotopic
Groundwater Hydrology, 3a ed. (New York: Marcel Dekker, 2003); W. Epstein y T. K. Ma-
yeda, Variations of the 180/160 Ratio in Natural Waters, Geochimica et Cosmochimica
Acta, vol. 4 (1953), p. 213.
E v m im m m p

los organismos vivos han sido estudiados por varios equipos cien
tficos. y se han hecho interesantes observaciones. Una cantidad
muy elevada de agua pesada es letal para los animales y las plantas;
pero cuando las plantas se cultivan con agua muy pobre en deu-
terio, crecen ms despacio. Investigadores del Instituto Hnga
ro de Investigacin Central de Fsica y de la Universidad Mdica
Semmelweis han descubierto, recientemente, que el crecimiento
del cncer se ralentiza e incluso se detiene con agua desprovista
de deuterio.34 Tambin se ha observado que cuando el contenido
de deuterio en el agua se incrementa, el nmero de mutaciones
en el A D N celular tambin aumenta.35 A partir de estos datos,
podramos proponer la siguiente hiptesis: el agua de la Tierra an
tes del diluvio contena muy poco deuterio, pero cuando fueron
liberadas las aguas subterrneas a la biosfera el resultado fue un
aumento en el nivel medio de deuterio, hasta llegar al actual nivel
de 150 partes por milln. Los niveles bajos de deuterio antedilu
vianos ralentizaban el metabolismo (crecimiento y desarrollo) de
los seres vivos, y esto hacia que las personas tardaran ms tiempo
en tener hijos (segn Gnesis 5, los patriarcas antediluvianos so
lan tardar de 60 a 100 aos en tener su primer hijo) y vivieran
mucho ms tiempo. Despus del diluvio, los niveles de deuterio
aumentaron y, con ello, las mutaciones, que se acumularon en el
A D N y provocaron una degeneracin de la especie y un envejeci
miento prematuro.
Esto es una muestra de cmo el modelo del diluvio provee
hiptesis cientficas y permite hacer predicciones que pueden
ser verificadas. Por ejemplo, podramos buscar evidencias de que
el contenido de deuterio en el agua era inferior en el pasado. Si

34 G. Somlyai, G. Jancs, G. Jkli, M. Molnr, I. Somlyai y K. Krempels, Application of


Deuterium Depletion in Cncer Treatment and Prevention. Proceedings o f the Interna
tional Scientific Conference on Nutraceuticals and Functional Foods (Zilina, Eslovaquia,
del 8 al 12 de junio de 2009), p. 45. Ver tambin: A. Kovcs, I. Guller, K. Krempels, et al.,
Deuterium Depletion May Delay the Progression of Prostate Cncer, Journal o f Cncer
Therapy, vol. 2 (2011), pp. 548-556.

35 Gbor Somlyai, Defeating Cncer! The Biolgica!. Effect o f Deuterium Depletion (Buda
pest: lst Books, 2002), pp. 27, 28.
JV!0 l.NIVEf irte: HISTRICAS

examinamos en la literatura cientfica, descubrimos que, efec


tivamente, se han encontrado evidencias de que el agua en el
pasado contena una m enor cantidad de deuterio.36
Retomemos a continuacin el tema de la viabilidad del arca
del Gnesis. Ya hemos comentado que el arca resulta bastante
ms realista que la canasta o el navio cbico mencionados en
otras narraciones. En medidas modernas, el arca tena aproxima
damente 140 metros de largo, 23 metros de ancho y 14 metros
de altura, valores apropiados en trminos de arquitectura naval y
estabilidad en el mar. Se ha calculado que, aproximadamente, la
capacidad interior del arca era de 39.644 metros cbicos; la su
perficie de cubierta era de 8.890 metros cuadrados; el desplaza
m iento (peso que alcanza una embarcacin cuando est sumer
gida hasta la lnea mxima de carga) era de 43.000 toneladas. 37
El arca era, sin lugar a dudas, una gran nave. El gelogo John
W oodmorappe ha publicado un estudio de viabilidad bien fun
damentado, que demuestra que en su interior haba capacidad
suficiente para contener y m antener con vida a los animales ne
cesarios para, despus del diluvio, repoblar la Tierra y dar lugar a
la variedad de animales terrestres que existen en la actualidad.38
Una ltima evidencia en favor del diluvio se descubri gracias
a registros histricos de observaciones astronmicas relativas a
la inclinacin del eje de la Tierra. El ngulo de inclinacin de
la Tierra, conocido como oblicuidad de la eclptica , es el res
ponsable de las estaciones. Este ngulo, que en la actualidad es
de 23,4377, vara ligeramente a causa de fuerzas astronmi
cas como la atraccin gravitatoria de los otros planetas hacia la
Tierra. La inclinacin terica del eje de Tierra para cualquier
m om ento del pasado o del futuro se puede calcular por medio

361. J. Winograd, B. J. Szabo, T. B. Copien, et al., Two-million-year Record of Deuterium


Depletion in Great Basin Ground Waters, Science, vol. 227 (Io de febrero de 1985), pp.
519-522.
37 T. D. Alexander, Gnesis 6:15 (comentario), ibd., p., 62.

38 John Woodmorappe, Noahs Ark: A Feasibility Study (El Cajn, CA: Institute for Crea-
tion Research, 1997).
pyjcsM

de una formula emprica desarrollada por el astrnomo estadou


nidense Simn Newcomb, que tiene en cuenta el efecto de todas
las fuerzas conocidas. Por otra parte, el ngulo real de inclina
cin del eje puede calcularse, fcilmente, a partir de la posicin
del sol en el da ms largo del ao (solsticio de verano) y en el
da ms corto (solsticio de invierno). Debido a que los solsticios
eran fechas importantes para muchas culturas, la posicin del
sol en tales m omentos sola marcarse en los m onum entos anti
guos; por lo tanto, en teora, dichas marcas pueden usarse para
calcular el ngulo de inclinacin de la Tierra correspondiente a
m omentos especficos del pasado. Si comparamos la inclinacin
predicha por la frmula de Newcomb para una fecha determina
da con la de una medicin conocida, ambos nmeros deberan
coincidir; pero esto no es lo que ocurre. Las medidas reflejadas
en los m onum entos antiguos se desvan significativamente de los
valores de la frmula. En 1936, el astrnomo australiano George
F. Dodwell descubri que estas desviaciones no ocurren al azar,
sino que siguen un patrn definido. Dodwell analiz medicio
nes antiguas del ngulo de la eclptica procedentes de una reco
pilacin realizada por el astrnomo belga Godefroid Wendelin,
que contena datos desde la poca de Tales, alrededor de 558
a.C., pasando por Eratstenes (230 a.C.), Hiparco (135 a.C.),
Ptolomeo (126 d.C.) y varios astrnomos medievales, incluyen
do a Tycho Brahe (1587 d.C.), hasta 1616 d.C. Al representar
los datos en una grfica, Dodwell obtuvo una curva s i n u s o i d al
logartmica. Las mediciones ms antiguas se encontraban muy
alejadas de las predicciones de Newcomb, pero con el paso del
tiempo ambas lneas se haban iban acercando. Armado con este
descubrimiento, Dodwell pas a recoger tantas mediciones de
la oblicuidad de la eclptica como pudiera encontrar entre las
marcas de los solsticios en m onum entos y otros registros anti
guos. El resultado de la representacin grfica de estos datos fue
una curva ms precisa, que mostraba una alteracin im portante
en la inclinacin, debida a una fuerza desconocida que afect
el eje en la antigedad, seguida de una recuperacin lenta hacia
los valores predichos por Newcomb, alcanzndose el equilibrio
JVO UNIVERSAL nU A S Hl

alrededor de 1850 d.C. Esa es la razn por la que la anomala


no haba sido detectada por los astrnomos del siglo XX. Se
gn la curva obtenida, Dodwell propuso que un disturbio muy
im portante en el eje de rotacin de la Tierra ocurri alrededor
del 2345 a.C., y produjo un tambaleo, que posteriormente fue
disminuyendo con lentitud a lo largo de 4.194 aos, hasta desa
parecer por completo en 1850 d.C .39
La fecha obtenida por Dodwell, 2345 a.C., es m uy prxima
a la fecha calculada para el diluvio del Gnesis, que se sita en
el ao 2303 a.C. La diferencia podra deberse a que el clcu
lo es una extrapolacin influenciada en exceso por el dato ms
antiguo representado en la curva. Este corresponde a medicio
nes obtenidas en el templo solar de Amon-Ra, construido por
Am enemhat I en Karnak, Egipto, cuya fundacin se rem onta
supuestamente a 2045 a.C. Sin embargo, la cronologa egipcia
es problemtica y m uy polmica. Una fecha alternativa para el
reinado de Am enemhat es 1703 a.C., lo que cambiara la fecha
extrapolada por Dodwell a unos cien aos despus del diluvio.40
Aunque parece razonable relacionar los catastrficos eventos del
diluvio con la desviacin del eje de Tierra, no sabemos qu even
to especfico pudo causar dicha desviacin, cundo ocurri exac
tam ente ni qu efectos tuvo sobre el planeta. Es posible que la
alteracin del eje de la Tierra estuviera relacionada con el rpido
movimiento de las placas tectnicas y la produccin de cordille
ras como el Elimalaya o los Alpes, eventos que pudieron ocurrir
algn tiempo despus del diluvio. En cualquier caso, a partir
de los datos histricos de la oblicuidad de la eclptica, podemos
afirmar que alrededor de la fecha del diluvio de No, o poco
tiempo despus, la Tierra fue testigo de un brutal evento fsico

39 George F. Dodwell, The Obliquity of the Ecliptic: Ancient, Mediaeval, and Modem
Observations of the Obliquity of the Ecliptic, Measuring the Inclination of the Earths
Axis, in Ancient Times and Up to the Present (1962). En lnea: www.setterfield.org/Dod-
well_Manuscript_l .html.
40 John Ashton y David Down, Umvrapping the Pharaohs: How Egyptian Archaeology
Confirms the Biblical Timettne (Green Forest, AR: Master Books, 2007), p. 206.
m m M c x m m p im m M

de suficiente m agnitud como para provocar una desviacin sig


nificativa del ngulo de inclinacin de su eje.
Cuando consideramos el conjunto de evidencias histricas
revisadas en este captulo, la asignacin de nombres de pueblos
y pases, las cronolgicas de distintas naciones y las mltiples
narraciones sobre el diluvio conservadas en culturas antiguas al
rededor del m undo, obtenemos un respaldo significativo para la
exactitud histrica del relato del Gnesis. Si a eso aadimos evi
dencias cientficas como las observaciones del astrnomo Dod-
well sobre un evento de gran m agnitud que afect el ngulo de
inclinacin de la Tierra en torno a la poca del diluvio, podemos
afirmar que considerables datos histricos son consistentes con
la evidencia geolgica y apoyan el modelo de un diluvio univer
sal reciente.
FALENCIAS DE
LA DATACIN
RADIOMTRICA -
JASAS DEEROSIO Y SEDME lACIN, Y OTRAS EVIDENCIAS
EN CONFLICTO CON LA DATACIN RADIOMTRICA ..______

na de las bases fundamentales que sustentan la evolucin es la

U presuncin de que la Tierra es muy antigua y, especialmente,


que las rocas que forman la columna geolgica y sus fsiles
tienen decenas o cientos de millones de aos. Son realmente tan
antiguos los fsiles y las rocas? Por qu omos esa afirmacin una
y otra vez? El cada ocasin en que visito un parque nacional, me
encuentro con un folleto informativo o un mural de la regin, cuya
leyenda explica que las formaciones de roca de la zona tienen millo
nes de aos de antigedad. En casi todos los documentales sobre la
naturaleza, se escuchan comentarios casuales sobre tal o cual caracte-
EVOLUCIN IMPOSl

rstica de un animal o una planta que evolucion hace x millones


de aos. En realidad, la presencia de la evolucin en todas partes no
debera sorprendernos, ya que la cosmovisin de largas edades para
la historia de la Tierra se encuentra exhaustivamente arraigada en la
comunidad cientfica y en la educacin secular. Las razones para este
apoyo incondicional a la Teora de la Evolucin son variadas. Pero
una de ellas es las implicaciones que supondra considerar siquiera la
perspectiva de una Tierra joven: la aceptacin de la Biblia como do
cumento histrico fiable, y la posibilidad de una intervencin divina
en la historia de la humanidad. Por desgracia, la intolerancia de la
comunidad cientfica con respecto a este tema es tal que los investi
gadores que apoyan la idea de que la vida en la Tierra fue diseada de
forma inteligente, en lugar de ser el resultado de procesos aleatorios,
sufren con frecuencia una grave marginacin por parte de colegas e
instituciones. La extensin y la gravedad de esta censura se ha ilus
trado en el documental Expelled: No Intelligence Allowed [Expulsado:
No se admite Inteligencia], de Ben Stein.1
Uno de los principales apoyos al modelo de largas edades para la
historia de la Tierra proviene de la datacin radiomtrica. Aunque
tratar este mtodo de datacin en detalle en el prximo captulo,
quiero recordar aqu que la datacin radiomtrica se basa sobre su
posiciones que no pueden ser demostradas. Como mximo, podra
considerarse un indicador de edades relativas, pero no de edades
absolutas. Menciono este punto ahora porque existe una gran can
tidad de evidencias slidas que apoyan la idea de que la Tierra es
joven, y que el diluvio universal ocurri en una fecha relativamente
reciente, es decir, hace miles de aos, no millones. En mi opinin,
es muy importante que el polmico asunto de la datacin de las
rocas sea evaluado con todos los mtodos disponibles. Considerare
mos algunos de ellos en el resto del captulo.
En el captulo 5, vimos que H utton us las tasas de sedimenta
cin de los deltas de los ros para calcular la antigedad de las for-

1Ver: J. Bergman, Slaughter ofthe Dissidents: The Shocking Truth about Killing the Ca-
reers ofDarwin Doubters (Port Orchard, WA: Leafcutter Press, 2008); Ben Stein, Expe-
lled: No Intelligence Allowed, www.expelledthemovie.com.
FALENCIAS DE LA DATACIN RADIOKTR!CA - !

maciones de rocas sedimentarias y los fsiles que contienen. En la


actualidad, tenemos datos mucho ms exactos sobre las tasas de ero
sin y sedimentacin en diferentes ambientes. Examinemos, pues,
las evidencias geolgicas a la luz de los conocimientos actuales:
Las plantas y los animales necesitan agua para sobrevivir. La llu
via y la nieve proporcionan agua a los continentes. El exceso de agua
escurre desde las montaas hacia los ros, que desembocan en lagos
u ocanos. Cuando el agua de lluvia fluye sobre la superficie, trans
porta partculas de materiales erosionados de las rocas y el suelo,
que finalmente encuentran su camino hacia los ros. A travs de un
repetido muestreo del contenido de residuos del agua de los ros en
su desembocadura, podemos estimar la cantidad de sedimento que
est siendo transportado y la velocidad con que la topografa se est
erosionando. Los sedimentlogos han calculado tales estimaciones
para un grupo de ros y regiones montaosas del mundo.2Algunos
de estos resultados se muestran en la Tabla 1.

W ei-H o 53 / 1.350 Yangtse 6,7 / 170


Hwang-Ho 35 / 900 Po 4,7 / 120
Garona
Ganges 22 / 560 4,0 / 100
y Colorado
Rin y Rdano
13 / 340 Amazonas 2,8 / 71
Alpinos
San Juan (EUA) 13 / 340 Adigio 2,6 / 65

Irrawady 1 1 /2 8 0 Savannah 1 ,3 /3 3

Tigris 10 / 260 Potomac 0 ,6 / 1 5

2 B.W. Sparks, Geographies for Advanced Study, en S. H. Beaver, ed., Geomorphology,


3 ed. (London: Longman Group, 1986), pp. 509, 510.
Isre 9,5 / 240 Nilo 0,5 / 13
Tber 7,5 /1 9 0 Sena 0 ,3 /7
Indo 7,1 / 180 Connecticut 0,04 / 1 |

Tabla 1: Dism inucin promedio de la topografa drenada por


grandes ros (en pulgadas/milmetros por cada 1.000 aos).

Muchos de los valores de la Tabla 9.1 no incluyen la carga del


lecho del ro (es decir, los sedimentos arrastrados o empujados a
lo largo del fondo por la corriente de agua, que no se observan
con facilidad en las estaciones de medicin). Los procedimientos
de medicin tampoco tienen en cuenta el transporte adicional
de material que tiene lugar durante eventos catastrficos pun
tuales, como grandes inundaciones. Esto significa que las tasas
reales de erosin a largo plazo podran ser m ucho ms elevadas.
Consideremos las implicaciones de estas tasas de erosin. Por
ejemplo, en la Tabla 9.1 vemos que la topografa en torno al Ro
Colorado se erosiona 100 milmetros cada 1.000 aos. El Ro Co
lorado corre por el Gran Can. La profundidad de este es de
1,6 kilmetros, aproximadamente, y contiene estratos portadores
de fsiles, que supuestamente se remontan 500 millones de aos
atrs, y rocas de hasta 3.000 millones.3 No obstante, basndonos
sobre la tasa actual de erosin, el rea debera haberse erosiona
do completamente en menos de 20 millones de aos; entonces,
cmo es posible que los estratos fosilferos sigan ah despus de
cientos de millones? Una explicacin posible es que estas rocas
ms viejas fueron enterradas bajo rocas ms jvenes que s se ero
sionaron. Teniendo en cuenta que las rocas de la cumbre del Gran

3S. Chemicoff y R. Venkatakrishnan, Geology: An Introduction to Physical Geology (New


York: Worth Publishers, 1995), p. 217.
FALENCIAS DE LA DATACIN RAD!

Can tienen, supuestamente, 240 millones de aos,45y dada una


tasa de erosin de 0,1 metros por cada 1.000 aos, tendran que
haber sido enterradas bajo aproximadamente 24 kilmetros de se
dimentos, para haber sobrevivido hasta la actualidad. Eso corres
pondera a extender sobre un rea equivalente a la de los Estados
Unidos una capa de sedimentos de casi tres veces la altura del
M onte Everest; que tendra que haber sido erosionada y arras
trada hacia el ocano. Aun usando un valor inferior, tal como 60
milmetros por cada 1.000 aos, que es una tasa estimada habi
tual para los clculos de erosin en los continentes,' el espesor de
sedimentos debera ser de aproximadamente 14,4 kilmetros, o
casi dos veces la altura del M onte Everest. Datos similares se obtie
nen de otras partes del mundo: un gelogo de Cambridge, B. W.
Sparks, afirma que las tasas de erosin del Rio Amarillo (I Iwang-
EIo) podan erosionar un rea con una altura media igual a la del
M onte Everest en solo 10 millones de aos.6
Esta cuestin no es nueva para los gelogos. Desde los aos 50, se
ha sealado que el continente norteamericano, que tiene una altura
media de 620 metros, debera erosionarse totalmente en diez millo
nes de aos, segn las tasas de erosin estimadas. 7 De acuerdo con
las dataciones radiomtricas, los continentes se formaron hace ms
de 2.500 millones de aos.8 Cmo pudieron sobrevivir estratos tan
antiguos en los continentes, si la erosin era tan rpida?
Las tasas de erosin en las regiones montaosas son incluso
ms altas, como se muestra en la Tabla 2.

4 Ibd.

5 S. Judson y D. F. Ritter, Rates of Regional Denudation in the United States, Journal


o f Geophysical Research, vol. 69 (1964), pp. 3.395-3.401; R. H. Dott Jr. y R. L. Batten,
Evolution ofthe Earth, 4 ed. (New York: McGraw-Hill Book Co., 1988), p. 155.

6 S. H. Beaver, ibd.

1 Ibd.

8R. Huggett, Catastivphism: Systems o f Earth History (London: Edward Amold, 1990), p. 232;
A. Kroner, Evolution of the Archean Continental Crast, Annual Review o f Earth and Planetary
Sciences, vol. 13 (1985), pp. 49-74; S. M. McLennan y S. R. Taylor, Continental Freeboard,
Sedimentation Rates and Growth of Continental Crast, Natare, vol. 306 (1983), pp. 169-172.
Cordillera de los Hidrgrafos (Papa Nueva
3 /8 0
Guinea, a nivel del mar). 10
Cordillera de los Hidrgrafos (Papa Nueva
20 / 520
Guinea, a 975 metros). 11
Montaas en la frontera entre Mxico y
3 6 /9 2 0
Guatemala. 12
Los Himalayas.13 3 9 /1.000
Monte Rainier, Washington. 14 315 / 8.000
Volcn en Papa Nueva Guinea. 15 750/19.000
Tabla 2: Tasas de erosin en regiones montaosas (pulgadas/mil-
metros por cada 1.000 aos).

Por el registro fsil, sabemos que en el pasado haba bosques


exuberantes y grandes cantidades de vegetacin, que se convir
tieron en los depsitos de carbn que encontramos alrededor
del m undo. El clima correspondiente a ese tipo de vegetacin
incluye un gran nmero de precipitaciones, que generalmen
te se relacionan con tasas de erosin superiores, del orden de
algunos de los valores que aparecen en la Tabla 9.2. (8.000 a
19.000 milmetros en 1.000 aos). En m omentos puntuales,
durante eventos catastrficos como aquellos que enterraron a los
dinosaurios, las tasas de erosin habran sido an mayores. Esto
significa que la sobrecarga requerida para preservar los estratos
desde, supuestamente, centenares de millones de aos hasta la
actualidad, sera de muchas decenas de kilmetros... y m uy poco
realista.
Sin bien, en caso de haber existido, dicha sobrecarga de de
psitos ms jvenes habra term inado en los ocanos, no se
ha encontrado en el fondo marino las capas de sedimentos de
varios kilmetros de espesor que debera haber tras cientos de
millones de aos de erosin. Por el contrario, el grosor medio
de sedimentos en el fondo marino es de aproximadamente 450
metros.9 Estas observaciones nos llevan a la conclusin de que
los continentes no se han estado erosionando durante cientos de
millones de aos, y que los estratos y sus fsiles no tienen 500
millones de aos. Las evidencias sugieren enrgicamente que los
estratos sedimentarios portadores de fsiles encontrados alrede
dor del m undo deben ser relativamente recientes.101, u , 12, 13, 14, 15
La capa relativamente fina de sedimentos que recubre los
fondos ocenicos puede proporcionarnos nuevas pistas sobre la
edad de los continentes. El gegrafo Dr. Coln Milcbell estim
la velocidad a la que los sedimentos se incorporan a los ocanos,
usando datos de los materiales slidos arrastrados por ros y gla-
ciares, las contribuciones volcnicas y el polvo arrastrado por el
viento. Despus de corregir el clculo teniendo en cuenta los
slidos eliminados en las salpicaduras provocadas por el viento
y el romper de las olas, obtuvo un resultado de 26.800 millones
de toneladas de slidos incorporados anualmente a los ocanos
del m undo.16 Mitchell calcul el tiempo necesario para deposi
tar los sedimentos presentes en el fondo marino utilizando una
estimacin antigua de su grosor medio (900 metros). Aun as, la

9B. P. Luyendyk, Ocean basin, Encyclopedia Britannica. En lnea: www.britannica.com/


EBchecked/topic/424338/ocean-basin. Ntese que el espesor promedio de los sedimentos
vara entre los ocanos. Por ejemplo, en el Pacfico vara entre 300 a 600 metros, mientras
que en el Atlntico es de alrededor de los 1.000 metros. En algunas reas ocenicas es de solo
100 metros de espesor.

10B. P. Ruxton y I. McDougal, Denudation Rates in Northeast Papua from Potassium-ar-


gon Dating of Lavas, American Journal o f Science, vol. 265 (1967), pp. 545-561.

11 Ibd.

12J. Corbel, Vitesse de Lerosin, Zeitschriftfiir Geomorphologie, vol. 3 (1959), pp. 1-28.

13H. W. Menard, Some Rates of Regional Erosin, Journal o f Geology, vol. 69 (1961),
pp. 154-161.

14 H. H. Mills, Estimated Erosin Rates on Mount Rainier, Washington, Geology, vol. 4


(1976), pp. 401-406.

15 C. D. Ollier y M. J. F. Brown, Erosin of a Young Volcano in New Guinea, Zeitschrift


f r Geomorphologie (1971), pp. 15-28.

16 Colin Mitchell, The Case fo r Creationism (Alma Park, Grantham, England: Autumn
House Limited, 1994), pp. 78-80.
m io w a m s u p u s is t e

deposicin de dicha capa de sedimentos habra requerido sola


mente 28 millones de aos.17
El bilogo marino Dr. Ariel Roth realiz un clculo similar
utilizando una tasa de deposicin de 24.108 millones de tone
ladas por ao, que obtuvo del promedio de 12 estudios de sedi
m entacin ocenica, realizados entre 1950 y 1993.18 Utilizando
esta estimacin y valores modernos, ms precisos, para los par
metros marinos (450 metros de grosor medio, 360,9 millones de
kilmetros cuadrados de rea y 2,3 toneladas por metro cbico
de densidad del sedimento) concluy que el tiempo necesario
para depositar la capa de sedimentos presente en el suelo oce
nico sera de solamente 15,5 millones de aos. Si adems tuvi
ramos en cuenta el rpido transporte de grandes cantidades de
sedimento ocurrido durante las catstrofes que enterraron a ani
males y plantas, el tiempo requerido se reducira enormemente.
O tra fuente de informacin sobre la edad de la Tierra es el
material liberado por los volcanes. A partir de datos obtenidos
de las erupciones volcnicas ocurridas entre 1940 y 1980, se ha
estimado que los volcanes alrededor del m undo expulsan cada
ao un promedio de cuatro kilmetros cbicos de material hacia
la superficie terrestre.19 Algunas erupciones, sin embargo, han
emitido volmenes m uy superiores.20 La erupcin de Tambora
(Indonesia), en 1815, expuls entre 100 y 300 kilmetros c
bicos de materia, y la de Lago Taupo (Nueva Zelanda) emiti,
aproximadamente, 1.100 kilmetros cbicos. Adems, teniendo
en cuenta el gran nmero de volcanes inactivos que observamos
en la actualidad, podemos deducir que la actividad volcnica era
notablemente mayor en el pasado. Incluso sin tener en cuenta

17Ibcl., p. 80. Ntese que MitcheU utiliza un rea ocenica de 360,9 millones de kilmetros cua
drados y un valor promedio de densidad para el sedimento de 2,3 toneladas por metro cbico.

18Ariel A. Roth, Origins: Linking Science and Scripture (Hagerstown, MD: Review and
Herald Publishing Association, 1998), p. 265.

19Ibd., pp. 267, 268.

20 S. E. Bryan, I. U. Peate, D. W. Peate, et al., The Largest Volcanic Eruptions on Earth,


Earth-Science Reviews, vol. 102, N 3, 4 (2010), pp. 207-229.
FALENCIAS DE LA DATACiN RADOMTRiCA - I

ambas observaciones, y asumiendo el modesto valor medio de


cuatro kilmetros cbicos de materia por ao, si los continentes
realmente hubiesen tenido 2.500 millones de aos, durante ese
tiempo se habran acumulado 10.000 millones de kilmetros
cbicos de materia volcnica. Esa cantidad de material habra
sido suficiente para cubrir la superficie completa de la Tierra
(ocanos incluidos) hasta una altura de 19,6 kilmetros. N o
obstante, se ha calculado que la superficie de la Tierra contie
ne solamente 135 millones de kilmetros cbicos de material
de origen volcnico.21 Si usamos la misma tasa de emisin para
calcular su antigedad, cuatro kilmetros cbicos anuales, estos
materiales se habran depositado en menos de 34 millones de
aos. Teniendo en cuenta que en el pasado las erupciones eran
ms intensas y frecuentes, este perodo de tiempo podra verse
considerablemente reducido.
Vemos una vez ms cmo se acumulan evidencias fehacientes
en contra de las edades radiomtricas, que asignan a los continen
tes antigedades de 2.500 millones de aos. Segn los datos pro
cedentes de las tasas de erosin y de sedimentacin, y de la deposi
cin de material volcnico, la antigedad de los continentes sera,
como mximo, del orden de decenas de millones de aos, lo que
reducira enormemente el tiempo disponible para la evolucin.
Adems de las evidencias geolgicas en contra de las largas
dataciones de los fsiles, existen muchas otras de que la vida so
bre la Tierra es bastante ms joven de lo que sugieren las edades
radiomtricas. En el captulo 5, comentamos el descubrimiento
de tejidos blandos en restos de dinosaurios que, supuestamente,
tenan 80 millones de aos.22 No es de esperar que las estructu
ras tisulares de base proteica sobrevivan ms all de unas decenas
de miles de aos, debido a la degradacin natural de las cadenas
moleculares. El descubrimiento de secuencias de protena intac-

21 Roth, Origins: Linking Science and Scripture, p. 268.

22M. H. Schweitzer, Biomolecular Characterization and Protein Sequences of the Campa


nean Hadrosaur B. Canadensis, Science, vol. 324 (2009), pp. 626-631.
EVOLUCIN tMNIGSlS

tas en fsiles de dinosaurio constituye una fuerte evidencia de


que esos restos tienen miles de aos de antigedad, y no millo
nes. Por razones similares, las bacterias viables que se han aislado
de cristales de sal encontrados en estratos del Prmico, supuesta
m ente tras 250 millones de aos, sugieren enrgicamente que la
antigedad real de dichos estratos es de tan solo miles de aos.23
En captulos anteriores, tambin, hemos comentado el papel de
las mutaciones, cambios aleatorios en el ADN, que resultan noto
riamente perjudiciales para los organismos vivos. Hace unos aos
se descubri que el A D N humano tiene una elevada velocidad de
mutacin, y que se est deteriorando con una rapidez alarmante.24
Si los seres humanos y sus antepasados hubieran existido durante
tanto tiempo como supone la historia evolutiva convencional, el
genoma se habra degenerado lo suficiente como para llevar a la
especie a la extincin hace mucho tiempo. Clculos basados sobre
la acumulacin de mutaciones perjudiciales tan solo en el AD N
mitocondrial sugieren que la lnea evolutiva ancestral que conduce
a la aparicin de los seres humanos se habra extinguido despus de
20 millones de aos.25
Considerando el genoma completo, y utilizando la tasa de
acumulacin de mutaciones observada actualmente, el Dr. John
Sanford, investigador en Gentica de la Universidad Cornell, ha
calculado que el A D N hum ano acumula la increble cantidad de
90.000 errores en solo 6.000 aos. Esto significa que 0,003% del
A D N se vuelve inoperante en menos de 10.000 aos. En 6 millo
nes de aos, el 3% del A D N (uno de cada 33 fragmentos) esta
ra daado, y es inconcebible que el material gentico sea todava

23 C. L. Satterfield, T. K. Lowenstein, R. H. Vreeland, et al., New Evidenee for 250 Ma


Age of Halotolerant Bacterium from a Permian Salt Crystal, Geology, vol. 33 (2005), pp.
265-268.

24 T. Beardsley, Mutations Galore: Humans Have High Mutation Rates. But Why Wo-
rry?, Scientific American, vol. 280, N 4 (1999), pp. 32, 36.

25 L. Loewe, Quantifying the Genomic Decay Paradox Due to Mullers Ratchet in Human
Mitochondrial DNA, Genetics Research, Cambridge, vol. 87 (2006), pp. 133-159.
FALENCIAS DE LA DA1ACIN RADIOMTRiCA - I

funcional en esas condiciones.26 En otras palabras, la especie ha


bra desaparecido mucho antes de alcanzar los 6 millones de aos.
La evolucin requiere la produccin de A D N nuevo por medio de
procesos naturales aleatorios; pero lo que observamos en la naturaleza
y en los laboratorios de investigacin es el proceso diametralmente
opuesto: A D N que se deteriora lentamente, volvindose afuncional
y poniendo en peligro la continuidad de la especie. Y esto no ocu
rre solamente en el caso del ser humano. 1a sumamente compleja
e interdependiente bioqumica de todos los organismos superiores,
como las aves y los mamferos, est codificada en el ADN de estos,
pero los cambios en el A D N desequilibran el sistema y causan graves
perjuicios. Por ejemplo, si la informacin gentica que codifica la pro
duccin de clulas beta est daada, sufriremos diabetes. Si se altera
la informacin responsable por la sntesis de una de las protenas que
participan en el mecanismo de coagulacin de la sangre, sangrare
mos hasta morir. Resultados similares seguirn a cualquier cambio
que inutilice una de las miles de rutas bioqumicas crticas para el
organismo. Adems, los efectos de las mutaciones se multiplican por
el hecho de que existen partes del genoma que son interdependientes.
Se puede citar el caso de los microARNs, cidos nucleicos cortos de
cadena simple, que tienen la capacidad de regular a otros genes. Aun
que los genes que codifican la sntesis de los microARNs representan
menos del 1% del total de genes humanos, estos regulan la sntesis
de protenas de ms del 10% del genoma.27 Por esta razn, las muta
ciones en los genes que codifican los microARNs tienen efectos muy
amplificados, en trminos de enfermedad. Las mutaciones de algunos
de estos genes se han vinculado con enfermedades humanas como la
leucemia, el linfoma, el cncer colorrectal, el cncer de prstata, otros
tipos de cncer, y el sndrome de Martin-Bell, o del X frgil, un tras
torno hereditario que causa retraso mental.28

26 John C. Sanford, Genetic Entropy and the Mystery ofthe Genome (Waterloo, NY: FMS
Publications, 2008), p. 153.

27 B. John, A. J. Enright, A. Aravin, et a l, Human MicroRNA Targets, PLoS Biology,


vol. 2, N 1 1(2004).

2gIbd.
EVCiCiM MPs

Aunque existen mecanismos naturales para proteger a los


organismos de las mutaciones y para reparar el A D N daado,
estos mecanismos son, en s mismos, susceptibles al dao por
m utacin. Para organismos complejos, como los seres humanos,
la especie tiende a la extincin cuando los niveles de deterioro
del A D N alcanzan proporciones del uno por mil, o incluso del
uno por diez mil, lo que corresponde a 200.000 y 20.000 aos
de mutaciones acumuladas, respectivamente. Segn estos datos,
podemos concluir que el A D N Homo no puede tener ms de
200.000 aos, y probablemente no tiene ms de 20.000.
Las tasas de m utacin del A D N que observamos en el presen
te indican edades m ucho ms cortas para la vida sobre la Tierra
que las calculadas por datacin radiomtrica. Las tasas de ero
sin continental, las tasas de sedimentacin en los ocanos y la
deposicin de material volcnico indican que los continentes no
pueden tener miles de millones de aos. Si se tienen en cuenta
los eventos catastrficos y la edad de las rocas y de la vida fsil
contenida en ellas, se ve m ucho ms reducida. El modelo de
diluvio universal, en cambio, se adeca bien a los datos que ob
servamos y sugiere que la edad de los continentes y de los fsiles
es relativamente joven, de solamente miles de aos. Evidencias
slidas y consistentes procedentes de fuentes distintas contra
dicen las edades obtenidas por datacin radiomtrica. Por esta
razn, es im portante analizar en detalle este mtodo de datacin
y, en particular, las suposiciones que lo sustentan.
FALENCIAS DE
LA DATACIN
RADIOMTRICA- II
LOS MTODOS DE DATACIN RADIOMTRICA ARROJAN
EDADES ANTIGUAS PARA ROCAS JVENES; Y OTRAS
EVIDENCIAS DE GRANDES PROBLEMAS CON ESTE
MTODO DE DATACIN

n 1896, se descubri que el uranio emita radiacin nuclear

E lenta, fenmeno que ms tarde sera conocido como radiac


tividad. Desde entonces, se ha descubierto un considerable
nmero de elementos que sufren desintegracin radiactiva. Para
poder entender correctamente el contenido de este captulo, es im
portante conocer unos pocos conceptos tcnicos, que intentar ex
plicar de forma sencilla. La mayora de elementos qumicos que en
contramos en la naturaleza, y que constituyen las partculas bsicas
de la materia a nuestro alrededor (como el oxgeno, el hidrgeno,
EVCLUCS-' iLIFOSILLS

el carbono, el silicio o el hierro), son estables y no cambian con el


tiempo. Sin embargo, existen algunos elementos como el uranio,
cuyos tomos son inestables y de manera espontnea se transfor
man en otro elemento, a la vez que emiten radiaciones peligrosas.
Al elemento inestable que se desintegra se denomina elemento
padre, y al que se obtiene al final se lo llama elemento hijo. La
transformacin del elemento padre al elemento hijo ocurre a una
tasa determinada, que depende de cada pareja de elementos. La vida
media, o perodo de semidesintegracin, de un elemento radiactivo
es el tiempo necesario para que la mitad de los tomos del elemento
padre se transforme en elemento hijo. Pongamos un ejemplo: la
vida media del carbono 14, que es un elemento radiactivo que se
usa para datar restos de seres vivos, es de aproximadamente 5.700
aos. Si tomamos una muestra con 1.000 tomos de carbono 14, al
cabo de 5.700 aos, la mitad (500) se habr transformado en nitr
geno 14, que es el elemento hijo, y la otra mitad estar todava en
forma de carbono 14. Durante los siguientes 5.700 aos, la mitad
de los 500 que quedaban (250) se transformar en nitrgeno; y en
5.700 aos ms, la mitad de los restantes. De esta forma, despus
de 17.100 aos, nuestra muestra, que originalmente tena 1.000
tomos de carbono 14, tendr solamente 125 tomos del elemento
padre, y 875 del elemento hijo, nitrgeno 14. El hecho de que la
desintegracin radiactiva se produzca de forma regular permite usar
el contenido de un elemento radiactivo en un material para calcular
su antigedad. Tericamente, si conocemos el contenido inicial del
elemento radiactivo y su perodo de semidesintegracin, y si pode
mos medir el contenido actual del elemento padre o hijo, el clculo
de la antigedad de dicho material resultar relativamente sencillo.
Los perodos de semidesintegracin de algunos elementos ra
dioactivos fueron medidos, inicialmente, a comienzos del siglo
XX, y la primera escala de tiempo basada sobre mediciones ra-
diomtricas fue propuesta por A. Holmes en 1913. Esta se basaba
sobre mediciones relativamente pobres. Sin embargo, en 1947 se
public una edicin revisada, fundamentada en el contenido de
uranio encontrado en minerales de cinco niveles diferentes de la
columna geolgica.
ENCIAS DE 1.A DAXACION RADIOME-TRIGA

Los estratos sedimentarios no pueden ser datados directamen


te por mtodos radiomtricos. En vez de ello, las capas sedi
mentarias y sus fsiles se datan a partir de las edades de las rocas
volcnicas superiores e inferiores. Cuando la colum na geolgica
fue datada, se m idieron 5 puntos y se hicieron interpolaciones
para los perodos intermedios, siguiendo la suposicin de que
la longitud de cada perodo geolgico es proporcional al grosor
mximo de las rocas sedimentarias formadas durante ese pero
do.1Esta suposicin de tasas constantes de sedimentacin basada
sobre el uniformitarianismo se us para calcular las antigedades
de los perodos de tiempo intermedios en la columna; aunque,
como hemos visto en captulos previos, hay claras evidencias de
que no se cumple a causa del pasado catastrfico de la Tierra.
Las fechas de Holmes para las distintas secciones de la colum
na geolgica se usaron hasta que a principios de los aos 60 se
obtuvieron nuevos datos. Desde entonces, las edades atribuidas
a los diferentes estratos se fueron actualizando, a m edida que se
iban recopilando nuevos resultados de datacin radiomtrica.
El problema de la datacin radiomtrica es que no es un mtodo
de datacin directo, ya que depende de varias suposiciones que de
ben cumplirse necesariamente para que el resultado de la datacin
sea vlido. A continuacin, vamos a analizar con ms detalle cmo
funciona este mtodo de datacin.
Algunos de los elementos radiactivos ms usados son los siguientes:

En el mtodo uranio-torio-plomo, tomos de uranio, con un


peso atmico de 238, se desintegran a travs de una serie de
pasos intermedios hasta el plomo 206. La vida media para esta
reaccin, es decir, el tiempo requerido para que la m itad del
uranio 238 inestable se transforme en plomo 206 estable, se ha
establecido en 4.470 millones de aos.
El uranio 235 se desintegra hasta el plomo 207, y tiene una
vida media de 704 millones de aos.

1J. L. Kulp, Geological Time Scale, McGraw-Hill Encyclopedia o f Science and Techno
logy (New York: McGraw-Hill Book Company, 1960), t. 6, p. 135-137.
El torio 232, con una vida media de 14.100 millones de aos,
se desintegra hasta plomo 208.
El rubidio 87 se descompone a estroncio 87, con una vida
media de 48.800 millones de aos.
El potasio 40 se transforma en argn 40, con una vida media
de 1.250 millones de aos.
El samario 147 se transforma en neodimio 143, con una vida
media de 106 mil millones de aos.
Por ltimo, ya hemos hablado del carbono 14, que se desin
tegra a nitrgeno 14, con una vida media de solo 5.730 aos.

Para datar una roca es necesario medir con mucha exactitud la


concentracin de los diferentes elementos radioactivos que contiene.
Sabiendo las proporciones entre los elementos padre-hijo, y utilizan
do frmulas matemticas especficas, se puede calcular la edad de la
roca. Para un sistema simple, aplicaramos la siguiente frmula:

T = (t/0.693) ln [(B +1) /A ]

Donde T es la edad de la roca en millones de aos; t es el perodo


de semidesintegracin, tambin en millones de aos, del elemento
radiactivo; B es la concentracin de tomos hijo presente en la mues
tra; A es la concentracin de tomos padre presente en la muestra; y
ln es una operacin matemtica llamada logaritmo neperiano.
En sistemas complejos donde se combinan varios elementos
radiactivos o se producen varios elementos hijo distintos, las
matemticas necesarias para calcular la antigedad se complican
considerablemente. Por ejemplo, en ocasiones, es necesario te
ner en cuenta los efectos que tiene sobre otro material radiactivo
la radiacin emitida por un elemento al desintegrarse.
Las suposiciones que deben cumplirse para garantizar la validez
de los resultados de la datacin radiomtrica son las siguientes:
Cuando la rocafu e formada, no estuviese presente ninguna canti
dad del elemento hijo. Es decir, que todos los tomos hijo presentes
sean producto de la desintegracin radiactiva del elemento padre.
Durante el tiempo transcurrido entre la form acin de la roca y
FALENCIAS DE LA DATACIN RADIOME'TRICA - II

la datacin (generalmente, decenas a miles de millones de aos)


el sistema ha permanecido cerrado, de m anera que no se han eli
minado o retirado de la roca tomos ni del elemento padre ni
del hijo.
Durante el mismo perodo, no se ha aadido ningn tomo adi
cional del elemento padre o del elemento hijo que no pueda ser
explicado por el proceso de desintegracin radioactiva.
La tasa de desintegracin no ha cambiado.

Para detectar y reducir los errores debidos al incumplimiento


de las suposiciones 1 al 3, se ha desarrollado una tcnica llama
da iscrona, por medio de la cual se calculan las proporciones
de istopos padre e hijo para diferentes minerales de la misma
muestra de roca, y se representan juntas en un mismo grfico. Si
los datos se ajustan a una lnea recta, el resultado se considera de
confianza y se asumen prdidas mnimas de material. La edad de
la roca se calcula, entonces, a partir de la pendiente de la recta. No
obstante, la tcnica iscrona no hace al mtodo infalible, porque
no permite detectar algunos procesos, como la mezcla en el pa
sado de rocas jvenes y antiguas en estado fundido, que podran
afectar el resultado de la datacin. Este problema puede ilustrarse
con numerosos casos en los que, utilizando diferentes elementos
radiactivos, la datacin iscrona de la misma roca ha resultado en
edades m uy dispares. El libro de Geologa Isotpica, de G. Faure,
cita varios ejemplos. Muestras de lava desde el Pleistoceno hasta
el presente, con antigedades de menos de 1,6 millones de aos,
segn su posicin en las capas de roca, se dataron por el mtodo
rubidio-estroncio, con un resultado de 773 millones de aos. Dos
dataciones de lava del Mioceno Superior al Plioceno dieron un re
sultado de 5 a 9 millones de aos, segn el mtodo potasio-argn,
y de 31 a 39 millones de aos segn el rubidio-estroncio. En otro
caso, la lava se dat estratigrficamente como del Plioceno-Ho-
loceno, es decir, de menos de 5,3 millones de aos, pero el resul
tado de la datacin por rubidio-estroncio fue de edades de 570 y
870 millones de aos. O tra roca del mismo perodo fue datada
en 1.500 millones de aos por el mtodo de rubidio-estroncio, y
e v m :;q ; mp eb! :

una del Mioceno-Holoceno (es decir, de menos de 24 millones de


aos segn la datacin estratigrfica convencional) fue datada en
1.200 millones de aos por el mismo mtodo.2
El Dr. Andrew Snelling, gelogo, ha escrito un informe tc
nico en que se explica detalladamente la influencia de la mezcla
de materiales preexistentes en los resultados de las iscronas, y
analiza otros intentos de explicar los resultados dispares que se
obtienen en la datacin radiactiva de una misma muestra de
roca por distintos m todos.3 En este trabajo, se describen es
tudios recientes de datacin iscrona de muestras mltiples de
roca que, a pesar de usar mtodos m uy precisos de anlisis qu
mico, han seguido dando resultados discordantes. Por ejemplo,
en Somerset Dam , en Queensland, Australia, para 15 muestras
de roca de una intrusin convencionalmente datada del Jursi-
co-Trisico (supuestamente, de 216 a 225 millones de aos), el
rango de edades estimadas por medio del mtodo potasio-argn
fue de 183 a 252 millones de aos. La datacin iscrona dio un
resultado de 174 millones de aos, con un error estimativo de
solo 9 millones de aos. Cuando las mismas muestras se data
ron por el m todo de iscrona de rubidio-estroncio, la edad ob
tenida fue de 393 millones de aos; y con el m todo de iscrona
de samario-neodimio, se calcul una edad de 259 millones de
aos. El m todo plomo-plomo dio una edad de 1.425 1.000
millones para la misma intrusin de roca.4 Entonces, cul es
la antigedad de la intrusin? 174 millones de aos? 1.425?
Alguna de las edades intermedias? O una totalm ente diferente?
Encontramos otro ejemplo en la datacin del basalto Crdenas,
de la regin oriental del Gran Can, en Arizona. La edad con-

2G. Faure, Principies oflsorope Geology, 2o ed. (New York: John Wiley and Sons, 1986),
pp. 145-147.

3Andrew A. Snelling, Isochron Discordances and the Role of Inheritance and Mixing of
Radioisotopes in the Mantle and Crust, en L. Vardiman, A. A. Snelling y E. F. Chaffin, ed.,
Radioisotopes and the Age o f the Earth (El Cajn, CA: Institute for Creation Research and
Chino Valley, AZ: Creation Research Society, 2005), pp. 393-524.
4 Ibd., pp. 405-414.

SO
FALENCIAS DE LA DATADOS RADIOMETRICA - I

vencional obtenida de dataciones radiomtricas previas era 1.103


66 millones de aos. El rango de edades obtenido en los La
boratorios Geochron, Cambridge, Massachusetts, por el mtodo
potasio-argn, fue de 577 1 2 a l .0 1 3 + 37 millones de aos; y
por el mtodo de iscrona fue de 516 30 millones de aos. Sin
embargo, el Laboratorio de Istopos de la Universidad de Co
lorado, en Boulder, Colorado, obtuvo edades iscronas basadas
sobre rubidio-estroncio de 1.111 81 millones de aos para 19
muestras, y 892 82 millones de aos para otras 22 muestras. Las
mediciones de samario-neodimio del mismo laboratorio dieron
una edad iscrona de 1.588 170 millones de aos, mientras
que las mediciones de plomo-plomo dieron una edad iscrona
de 1.385 950 millones de aos.5 Surge, entonces, la misma pre
gunta: Cun antiguo es el basalto? 516 millones de aos? 1.588
millones de aos? Quiere usted mismo escoger?
Un ltimo caso citado por Snelling es la dispersin en la estima
cin de la edad de las rocas que se obtuvo de la datacin de unas 20
muestras de las rocas anfibolitas de Brahma, situadas cerca de la base
del Gran Can. La edad estimada por rubidio-estroncio fue de
1.240 84 millones de aos, por samario-neodimio fue de 1.655
40 millones de aos; y por plomo-plomo fue 1.883 53 millones
de aos.6 En total, ms de 600 millones de aos de diferencia.
Otros autores han encontrado discrepancias similares. Un caso ex
tremo es la diferencia abismal entre las edades estimadas para los gra
nos de zircn presentes en la granodiorita Jemez, de Nuevo Mxico,
que fue datada en 1.500 millones de aos por el mtodo uranio-plo
mo, y en solamente 6.000 aos por el mtodo de uranio-helio.7
O tro caso interesante son las rocas volcnicas cuya antigedad
se conoce con exactitud porque se formaron en pocas histricas,

5lbd.

6Ibd., pp. 416-418.

7D. R. Humphreys, S. A. Austin, J. R. Baumgardner y A. A. Snelling, Recently Measured


Helium Diffusion Rate for Zircon Suggests Inconsistency with U-Pb Age for Fenton Hill
Granodiorite, EOS - Transactions o f the American Geophysical Union, vol. 84, N 46
(2003), Fall Meeting Supplement, AbstractV32C.-1047.
EVOLUCIN I

y que segn las dataciones radiomtricas se remontaran a cientos


de millones de aos. U n ejemplo son los flujos de lava en Hawai,
de solo unos siglos de antigedad, que dieron resultados de 3.340
millones de aos.8 Tambin tenemos rocas volcnicas proceden
tes de erupciones histricas de las Azores, Tristan da Cunha y el
Vesubio, de solamente cientos de aos de antigedad, que dieron
resultados de 100 a 10.500 millones de aos segn el mtodo del
uranio-plomo.9 Por ltimo, podemos citar un cuidadoso estudio
de datacin radiomtrica de los flujos de lava de las erupciones
de 1949 y 1954 del volcn Ngauruhoe, en la isla norte de Nueva
Zelanda, realizado a finales de los aos 90. Dos o tres muestras de
roca de dos o tres kilos se recolectaron de cada uno de los siguien
tes flujos de lava: 11 de febrero de 1949, 4 de junio de 1954, 30
de junio de 1954 y 14 de julio de 1954. Tambin se tomaron dos
muestras de los depsitos de avalancha de la erupcin del 19 de
febrero de 1975. Parte de las muestras se enviaron al laboratorio
PRISE, de la Escuela de Investigacin de Ciencias de la Tierra de
la Universidad Nacional Australiana, en Canberra, para su anlisis
isotpico por rubidio-estroncio, samario-neodimio y plomo-plo
mo. La iscrona de rubidio-estroncio dio una edad aparente de
133 87 millones de aos; la de samario-neodimio, de 197 +160
millones; y la de plomo-plomo, de 3.908 390 millones.10
Si rocas con una antigedad conocida de menos de 100 aos
son datadas como si tuvieran cientos o miles de millones de aos,

8 J. F. Evemden, D. E. Savage, G. H. Curts y G. T. James, Potassium-argon Dates and the


Cenozoic Mammalian Chronology of North America, American Journal o f Science, vol.
262 (1964), pp. 145-198. Pueden encontrarse muchos ejemplos debatidos en: A. P. Dicken,
Radiogenic Isotope Geology (Cambridge, UK and NY: Cambridge University Press, 1995).

9 S. P. Clementson, A Critical Examination of Radioactive Dating of Rocks, Creation


Research Society Quarterly, vol. 7 (1970), pp. 137-141.

10 A. A. Snelling, The Relevance of Rb-Sr, Sm-Nd, and Pb-Pb Isotope Systematics to


Elucidation of the Gnesis and History of Recent Andesite Flows at Mt. Ngauruhoe, New
Zealand, and the Implicatons for Radioisotopic Dating, en R. L. Ivey Jr., ed., Proceedings
o f the Fifth International Conference on Creationism. (Pittsburgh, PA: Creation Science
Fellowship Publishers, 2003), pp. 285-303. En lnea: www.answersingenesis.org/articles/
aid/v5/nl/mt-ngauruhoe-isotope.
FALENCIAS DE I.A DATACiN RADOS!TRICA - II

cmo podemos fiarnos en absoluto de los resultados de las datacio-


nes radiomtricas? Estas anomalas en las dataciones se han explica
do argumentando que los resultados no representan el momento de
solidificacin de la lava en la superficie, sino la edad de las fuentes
de roca del manto, mucho ms antiguas. Este razonamiento tiene
implicaciones muy importantes, que la mayora de los gelogos sue
len ignorar: si la datacin radiomtrica no refleja el momento real
en que los materiales se depositaron en la columna geolgica, sus
resultados tampoco pueden utilizarse para calcular las antigedades
de los materiales sedimentarios intercalados entre ellas.
Otro factor crucial del que depende la validez de las dataciones
radiomtricas es la suposicin de que las tasas de desintegracin
han permanecido constantes. Aunque esta suposicin parece ra
zonable, un artculo publicado hace unos aos en la revista Science
sugiri que los cambios en la presin fsica podan cambiar las
tasas de desintegracin.11 Desde los aos 90, los cientficos han
sido capaces de producir en experimentos de laboratorio tasas de
desintegracin radiactiva aceleradas hasta mil millones de veces, a
temperaturas extremadamente elevadas.112 Ms recientemente, un
equipo de cientficos de las universidades de Purdue y Stanford
ha descubierto que la desintegracin de los istopos radiactivos
flucta en sincrona con la rotacin del ncleo del sol.13
No sabemos de qu modo las fuerzas ambientales, u otros ti
pos de fuerzas, pudieron afectar las tasas de desintegracin en el
pasado. De todas formas, s tenemos evidencias geolgicas de
desintegracin radiactiva acelerada en algunos momentos; de ser
cierto, esto dara la apariencia de edades ms antiguas a las rocas
datadas por mtodos radiomtricos. Informes cientficos sobre las

11W. K. Hensley, W. A. Bassett y J. R. Huizenga, Pressure Dependence of the Radioactive


Decay Constant of Beryllium-7, Science, vol. 181, N 4.104 (1973), pp. 1.164, 1.165

12F. Bosch, T. Faestermann, J. Friese, F. Heine, e ta l, Observation of bound-state b - decay


of fully ionized 187Re, Physical Review Letters, vol. 77, N 26 (1996), pp. 5.190-5.193.
Pueden encontrarse ms debates y experimentos similares en: ww.answersingenesis.org/
articles/tj/v 15/n2/acceleration.

13En lnea: www.phys.org/news202456660.html#jCp.


E V O L U C I N t f .3 . . r ' r e

tasas de acumulacin y de difusin de helio procedente de desin


tegracin radiactiva en rocas granticas del Precmbrico en Fenton
Hill, Nuevo Mxico, sugieren tasas de desintegracin radiactiva
enormemente aceleradas en el pasado reciente.14 Otros estudios
de comparacin de radiohalos de uranio-238 y radiohalos de po-
lonio, en granitos y en rocas metamrficas, apoyan tambin la
existencia de desintegracin radiactiva acelerada, y la formacin
rpida y relativamente reciente de determinados tipos de roca.15
Estos hallazgos cuestionan el cumplim iento de la suposicin
de que las tasas de desintegracin radiactiva han sido constantes
durante miles de millones de aos; lo que a su vez desafa seria
mente la validez de los resultados de las dataciones radiomtri-
cas. Y si fuera verdad que las tasas de desintegracin sufrieron
importantes aceleraciones en el pasado, entonces, esto adems
implicara que las edades reales de las rocas seran m ucho m eno
res que las estimadas por medio de datacin radiometrica; sobre
todo cuando se usan istopos con largos perodos de semidesin-
tegracin.16
Hay otras suposiciones metodolgicas que se aplican a la data
cin radiomtrica, tales como la afirmacin de algunos cientficos
de que si la edad radiomtrica no es compatible con los datos
estratigrficos, la datacin radiomtrica no es de confianza.17 Esto
suscita gran cantidad de cuestionamientos respecto de las fechas
radiomtricas que no deben de haberse publicado por no concor
dar con la edad estndar de la columna geolgica, o aquellas que
quiz fueron reescritas a fin de hacerlas coincidir con las fechas

14 D. R. Humphreys, Young Helium Diffusion Age of Zircons Supports Accelerated Nu


clear Decay, en Vardiman, Snelling y Chaffin, ed., Radioisotopes and the Age o f the Ear-
th, pp. 25-100.
15A. A. Snelling, Radiohalos in Granites: Evidence for Accelerated Nuclear Decay, en:
Ibd., pp. 101-208.
16L. Vardiman, S. A. Austin, J. R. Baumgardner, et a l, Summary of evidence for a Young
Earth from the RATE Project, en: Ibd., pp. 735-772.

17D. L. Thurber, W. S. Broecker, R. L. Blanchard y H. A. Potratz, Uranium-series Ages of


Pacific Atoll Coral, Science, vol. 149 (1965), pp. 55-58.
previamente consensuadas para la historia evolutiva del planeta.
Por ejemplo, en Kenia, hay un depsito volcnico llamado KBS
Tuff, que es rico en fsiles, y originalmente fue datado con una
antigedad de entre 212 y 230 millones de aos. No obstante,
como esta edad no se ajustaba al registro fsil presente, el depsito
fue redatado por los mismos investigadores empleando distintas
muestras, y se obtuvo una nueva edad de 2,61 millones de aos.18
El famoso antroplogo Dr. Richard Leakey descubri un crneo
similar al de un ser hum ano moderno debajo del KBS Tuff, en
un estrato que contena tambin herramientas primitivas y haba
sido datado en unos 2,9 millones de aos.19 Estratos similares a
los hallados debajo del KBS se haban encontrado tambin en el
ro Orno, en Etiopa, y se haban datado con una edad inferior, de
aproximadamente 2 millones de aos; as que, en un estudio pos
terior realizado por investigadores de la Universidad de Califor
nia, en Berkeley, se volvieron a datar los estratos del KBS Tuff y el
resultado fue una nueva edad, de 1,6 millones de aos.20 Durante
los siguientes cinco aos, se realizaron estudios adicionales de da-
tacin radiomtrica, y los estratos fueron, una vez ms, redatados
por investigadores de la Universidad Australiana. Estos reportaron
edades de 1,87 y 1,89 millones de aos, valores compatibles con
la edad estndar de los mamferos fsiles encontrados, segn la
escala de tiempo evolutiva.21
O tra suposicin metodolgica que podra provocar un sesgo
e influir en los resultados de las dataciones est relacionada con

18 F.J. Fitch y J.A. Miller, Radioisotopic Age Determinations of Lake Rudolf Artefact
Site, Nature, vol. 226, N 5.242 (18 de abril de 1970), pp. 226-228.

19 F. J. Fitch, I. C. Findlater, R. T. Watkins y J. A. Miller, Dating of the Rock Succession


Containing Fossil Hominids at East Rudolf, Kenya, Nature, vol. 251 (20 de septiembre de
1974), pp. 213-215.

20 G. H. Curts, R. E. Drake, T. E. Cerling y J. H. Hampel, Age of KBS Tuff in Koobi Fora


Formation, East Rudolf, Keyna, Nature, vol. 258 (4 de diciembre de 1975), pp. 395-398.

211. McDougall, R. Maier, R Sutherland-Hawkes y A. J. W. Gleadow, K-Ar Age Estmate


for the KBS Tuff, East Turkana, Kenya, Nature, vol. 284 (20 de marzo de 1980), p. 230.
Ver tambin: A. J. W. Gleadow, FissionTrackAge of the KBS Tuff and Associated Homi-
nid Remains in Northern Kenya, ibd., pp. 225-230.
la recomendacin del Dr. J. L. Kulp, profesor de Geoqumica
en la Universidad de Columbia, de que el elemento radiactivo
escogido para realizar una datacin debe tener un perodo de
semidesintegracin del mismo orden de m agnitud que el lapso
a medir. Kulp sugiri que, para rocas antiguas, deban escogerse
los istopos con perodos de semidesintegracin de cientos de
millones de aos.22 Esto implica suponer de antem ano la edad
de la roca que se est intentando datar, lo que predispone a los
investigadores hacia un tipo determinado de resultado, e impide
la obtencin de resultados m uy dispares a lo esperado, pues es
tos ni siquiera se encuentran dentro del rango de medicin. Un
ejemplo prctico son las dataciones de carbn o de diamantes.
Se asume que estos materiales, que son esencialmente carbono
en formas diferentes, tienen antigedades de cientos de millones
de aos y, por lo tanto, no suelen ser analizados con carbono 14,
cuyo perodo de semidesintegracin es de tan solo 5.730 aos,
porque se asume que estn fuera de su alcance. A pesar de esto,
cuando algunos cientficos poco ortodoxos decidieron no seguir
esta recomendacin y dataron materiales con base de carbono,
supuestamente m uy antiguos, con el m todo del carbono 14,
obtuvieron resultados sorprendentes.
Antes de comentar algunos casos, veamos de qu m anera fun
cionan las dataciones con carbono 14:
La vida en la Tierra est basada sobre el carbono. Los seres vi
vos estn conformados por molculas orgnicas que, bsicamen
te, son compuestos de carbono, hidrgeno, oxgeno y nitrgeno,
siendo el carbono el elemento principal del esqueleto de las cade
nas de dichas molculas. La mayora del carbono que integra a los
seres vivos es carbono 12. Este elemento se incorpora a la materia
viva desde la atmsfera, por medio de la fotosntesis. Las plantas
toman su carbono del dixido de carbono del aire, y lo utilizan
para fabricar molculas orgnicas que se acumulan en la planta y
la hacen crecer. Como producto de desecho de este proceso, se

22 J. L. Kulp, Rock (Age Determination), McGraw-Hill Encyclopedia o f Science and


Technology, t. 11, pp. 591-594,
produce oxgeno, que las plantas liberan a la atmsfera. Adems
de oxgeno y dixido de carbono, la atmsfera terrestre contiene
una gran cantidad de nitrgeno. En la parte superior, algunos de
los tomos de nitrgeno se convierten en carbono 14 cuando son
golpeados por neutrones procedentes de rayos csmicos. El carbo
no 14 tiene propiedades m uy similares al carbono 12, por lo que
puede formar molculas de dixido de carbono, ser incorporado
por las plantas en la fotosntesis y, con posterioridad, pasar a los
animales por medio de la cadena alimenticia. Aproximadamente,
uno de cada un billn de tomos de carbono de la atmsfera es
carbono 14. La diferencia principal entre el carbono 12 y el 14 es
que este ltimo es radiactivo. Los tomos de carbono 14 desin
tegrarn con el tiempo y se convertirn de nuevo en nitrgeno.
Como la produccin de carbono 14 en las capas altas de la atms
fera es ms o menos constante, y las plantas no distinguen los dos
tipos de carbono, la proporcin de carbono 14 en plantas y en
animales, mientras estn vivos, es la misma que en la atmsfera.
Sin embargo, cuando los seres vivos mueren, dejan de incorporar
el carbono 14 de la atmsfera y el nivel disminuye lentamente,
segn la frmula de desintegracin descrita con anterioridad. Eso
significa que despus de 5.730 aos -la vida media del carbono
14 - solo quedar la mitad. Si se analiza una muestra orgnica, la
cantidad de carbono 14 que queda en su interior nos permitir
calcular la fecha de la muerte del ser vivo del que procede la mues
tra. No obstante, si la antigedad de la muestra fuera m uy grande,
del orden de millones de aos, esta tcnica de datacin no sera
vlida dado que, despus de tantas vidas medias transcurridas,
la cantidad de carbono 14 restante sera nula, o tan pequea que
resultara indetectable.
Uno de los problemas relacionados con la datacin con car
bono 14 es que se asume que el contenido de carbono 14 en la
atmsfera ha sido constante con el tiempo. Ya hemos comentado
que el carbono 14 se forma a causa de los rayos csmicos; enton
ces, esta suposicin requiere que el flujo de rayos csmicos que
llega a la Tierra haya sido constante durante millones de aos. Los
rayos csmicos estn formados por protones de alta energa que
tienen carga positiva, por lo tanto, su impacto en la atmsfera est
afectado por el campo magntico de la Tierra. La intensidad de
los rayos csmicos provenientes del espacio exterior podra haber
cambiado considerablemente en el pasado, de la misma mane
ra que podra haber cambiado el campo magntico de la Tierra.
Sabemos, por ejemplo, que el m omento magntico dipolar de la
Tierra se ha reducido en un 6,5 % desde el ao 1900.23 Si la acti
vidad de los rayos csmicos hubiese sido inferior en el pasado, las
dataciones daran edades mayores que las reales.
La medida exacta de la proporcin entre los carbonos 14 y 12
fue tambin problemtica hasta comienzos de los aos 80, cuando
estuvieron disponibles las tcnicas de espectrometra de masas con
aceleradores (Accelerator Mass Spectrometer, o AMS).
A finales de los aos 90, el Dr. Andrew Snelling tena en su po
der varias muestras de madera fosilizada cuya antigedad, segn su
posicin en la columna geolgica, era de entre 40 y 250 millones
de aos. Aunque en teora estas muestras tan antiguas no deberan
contener carbono 14, Snelling las envi a un laboratorio comercial
que usaba tecnologa AMS, para su datacin por este mtodo. Los
resultados no solo confirmaron la presencia de carbono 14 en las
muestras, sino tambin determinaron edades recientes para ellas, de
entre 20.700 1.200 y 44.700 950 aos.24
El Dr. Paul Giem, de la Universidad de Loma Linda, es un
mdico de Urgencias con gran inters en la datacin por carbono
14. En 2001, Giem public una evaluacin de los resultados de
datacin con carbono 14 de unas 70 mediciones AMS de fsiles,
reportadas entre 1984 y 2001. Segn su posicin en los estratos de
roca, estas muestras de carbono fsil tenan ms de 100.000 aos
y, en muchos casos, millones.25 Ninguna de estas muestras debera

23 K. Kudela y P. Bobik, Long-term Variations of Geomanetic Rigidity Cutoffs, Solar


Physics, vol. 224 (2005), pp. 423-431.

24 J. R. Baumgardner 14C Evidence for a Recent Global Flood and a Young Earth, en:
Vardiman, Snelling y Chaffin, ed., Radioisotopes and the Age o f the Earth, p. 589.

25 Paul Giem, Carbn-14 Content of Fossil Carbn-, Origins (Geoscience Research Insti-
tute), vol. 51 (2001), pp. 6-30.
~ALt NCIAS Dt DATAC

haber tenido una cantidad cuantificable de carbono 14 pero, a


pesar de ello, la mayora de ellas dieron resultados de edades entre
40.000 y 50.000 aos. El Dr. Giem observ que muchas mues
tras, aun cuando procedan de perodos de tiempos geolgicos
m uy diferentes, daban edades similares en la datacin por carbono
14. Esto concuerda con el modelo de creacin-inundacin, que
propone que la mayora de los estratos que contienen fsiles se
depositaron en un breve perodo de tiempo, y en un pasado re
ciente. Asimismo, la persistencia de carbono 14 en un nmero tan
grande de muestras fsiles procedentes de distintas ubicaciones
sugiere, firmemente, que los fsiles no pueden ser tan antiguos
como afirma la escala de tiempo geolgico. El Dr. Giem seala
que despus de 300.000 aos no debera quedar ni un solo tomo
de carbono 14 en una muestra de un gramo de carbn fsil. En
consecuencia, en muestras de carbn de entre decenas y cientos de
millones de aos, no podra haber niveles detectables de carbono
14, si las muestras tuvieran realmente esa antigedad. El hecho
de que se detecte carbono 14 prueba, claramente, que deben te
ner menos de 300.000 aos, y en trminos de anlisis prcticos,
menos de 100.000. En otras palabras, los estratos portadores de
carbn no pueden tener ni remotamente la edad que la columna
geolgica estndar les ha asignado.
El trabajo del Dr. Giem fue continuado, a comienzos del siglo
XXI, por un riguroso estudio del contenido de carbono 14 en
muestras de carbn procedentes de diferentes lugares de los Es
tados Unidos. Diez fueron obtenidas del Banco de Muestras de
Carbn del Departamento de Energa de los Estados Unidos, en
la Universidad Estatal de Pensilvania. Las muestras eran bloques
de 180 kilogramos de carbn fresco, extrados de minas de carbn
activas y almacenados en gas argn; y procedan de depsitos asig
nados a los perodos Eoceno, Cretcico y Pensilvano en la colum
na geolgica, con edades asociadas de entre 40 y 300 millones de
aos. Estas muestras de carbn fueron analizadas cuidadosamente
por medio de tcnicas AMS, y corregidas para los efectos de fondo
estndar. Todas las muestras dieron niveles medibles de carbono
14, y las edades obtenidas solo variaban entre 44.000 y 57.000
.-o;

aos.26 Estos resultados desafan seriamente las edades convencio


nales asignadas a la columna geolgica, y no dejan tiempo sufi
ciente para que la evolucin haya podido suceder.
A pesar de situarse en el rango de unos pocos miles de aos,
estas edades aun son excesivas para ajustarse al modelo de crea
cin-diluvio siguiendo la cronologa bblica. N o obstante, es
posible que las edades aparezcan aumentadas, si la proporcin
de carbono 14 respecto del 12 era m enor en el pasado. El autor
del citado informe, Dr. John Baumgardner, geofsico y miembro
jubilado del personal tcnico de la Divisin Terica del Labo
ratorio Nacional Los lamos, seala que si en el pasado existi
un contenido de carbono m ucho ms alto en la biosfera, como
revelan los extensos depsitos de carbn y piedra caliza, la pro
porcin de carbono 14 generada por rayos csmicos habra sido
menor. Si en el clculo se emplea un valor estimado inferior
para el nivel de carbono 14 en el pasado, se obtienen edades de
aproximadamente 5.000 aos para estas muestras, lo que s con
cuerda con el resto de evidencias cientficas e histricas en favor
del diluvio universal.27
U n estudio complementario se llev a cabo con diamantes
cuya datacin convencional se sita entre 1.000 y 3.000 millo
nes de aos. Diamantes de esa antigedad no deberan contener
nada de carbono 14 pero, como veremos a continuacin, las da-
taciones revelaron altos niveles de este elemento. Se ha sugerido
que los neutrones trmicos generados por otros elementos ra
diactivos, como el uranio, el torio, etc., pueden generar carbono
14 en la corteza terrestre, lo que explicara la aparicin de este
elemento en muestras antiguas. Esta posibilidad ha sido consi
derada, pero la cantidad producida sera tan pequea que estara
m uy por debajo del nivel detectable por AMS y, por lo tanto, no
justificara ninguno de los resultados observados.28

26 J. R. Baumgardner, ibd., pp. 587-609.

27 Ibd.., p. 588.

28 Ibd., pp. 614-616.

170
FALENCIAS DE LA DATACiON RADiOMTRiC

Cinco diamantes procedentes de chimeneas de kimberlita,


cuatro de las minas de De Beers, en Botsuana, y uno de Kimber-
ley, en Sudfrica, ms un diamante procedente de un depsito
aluvial de Guinea, se analizaron por el mtodo de AMS, y se
obtuvieron niveles de carbono 14 en todos ellos. Los resultados
de la datacin dieron un promedio de edad de 55.700 aos.29
Ms tarde, los mismos investigadores dataron seis diamantes
adicionales de Namibia, y todos contenan niveles detectables
de carbono 14.
Estudios posteriores, publicados en 2007 por investigadores de
la Universidad de California, obtuvieron resultados similares. Da
taron varios diamantes por el mtodo del carbono 14, usando el
espectrmetro de alta precisin Keck Carbn Cycle AMS, y obtu
vieron edades que se extendan desde los 64.900 400 aos hasta
los 80.000 1.100 aos. Seis fragmentos de un mismo diamante
dieron resultados de entre 69.300 500 y 70.600 500 aos.30
Todos los resultados anteriores fueron estadsticamente sig
nificativos, y proporcionan evidencias slidas de que estos dia
mantes, datados convencionalmente en miles de millones de
aos, deben tener menos de 100.000 aos. Com o ya hemos
comentado antes, con estos resultados, la historia geolgica del
planeta queda tan reducida que no da tiempo suficiente para la
ocurrencia de una evolucin tal como la propuesta por el m ode
lo evolutivo estndar.
El conjunto de evidencias revisadas hasta el m om ento en este
libro indican, claramente, que la edad de la vida en la Tierra es
m uy inferior a la propuesta por el modelo convencional y que
la evolucin no ha ocurrido. Evidencias geolgicas, como las ve
locidades de erosin y sedimentacin; biolgicas, como los teji
dos blandos encontrados en fsiles de dinosaurio y las tasas de
mutacin; e histricas, como las narraciones del diluvio en nu

x Ibd., pp. 609-630.

30 R. E. Taylor y J. Southon, Use of Natural Diamonds to Monitor 14C AMS Instrument


Backgrounds, Nuclear Instruments and Methods in Physics Research Section B: Beam
Interactions with Materials and Atoms, vol. 259, N 1 (junio de 2007), pp. 282-287
merosas culturas, son firmemente opuestas al concepto de que
la Tierra, los estratos y los fsiles tienen millones de aos de an
tigedad. Incluso los resultados de las dataciones radiomtricas,
que constituyen en la actualidad la base principal del modelo de
largas edades, pueden utilizarse para cuestionar dicho modelo, si
consideramos las discrepancias con otros mtodos de datacin y
los resultados anmalos, como la presencia de carbono 14 en
muestras en las que debera estar ausente.
LA TEORIA DEL
BIG BANG
NO EST RESPALDADA PO r T s I dATOS OBSERVADOS

uestro planeta es un entorno realmente extraordinario,

N diferente de cualquiera en nuestro sistema solar o en nin


gn otro lugar conocido del espacio cercano. El tamao
del Sol, y la distancia entre este y la Tierra, hacen posible que
la tem peratura permanezca dentro de un rango compatible con
la vida. La abundancia de agua, oxgeno y carbono, as como
muchos otros factores, hacen que la Tierra sea un lugar aparen
tem ente perfecto para la vida. Esto es lo que quieren decir los
astrnomos cuando hablan de un planeta Ricitos de O ro (en
ingls Goldilocksplanet),1 haciendo referencia al cuento infantil *

'Ver, por ej N. Lubrick, Goldilocks and the Three Planets, Astronomy, vol. 31, N 7
(2003), pp. 36-41.
.MIus

en el que una nia escoge entre objetos de caractersticas varia


das segn las que le resultan ms convenientes: ni m uy grande
ni m uy pequeo, ni m uy fro ni m uy caliente, ni m uy duro ni
m uy blando, etc.
La vida, tal cual la conocemos, est basada sobre el carbono,
elemento qumico que tiene propiedades particulares, incluyen
do la capacidad de establecer enlaces con hasta otros cuatro to
mos o cadenas de tomos. Esto permite a los tomos de carbono
formar el esqueleto de m ultitud de biopolmeros que constitu
yen las estructuras de nuestras clulas, las enzimas responsables
del metabolismo celular y otras molculas esenciales, como el
material gentico.
En el universo conocido, hay una cantidad relativamen
te grande de carbono. Los cientficos han propuesto que este
y otros elementos se formaron por una fusin nuclear en las
estrellas, a partir de partculas atmicas ms ligeras. El famoso
astrnomo Sir Fred Hoyle, de la Universidad de Cambridge,
estudi las reacciones necesarias para producir carbono y cal
cul los niveles de energa de sus tomos. Lleg a la conclusin
de que, para que el carbono tuviera sus propiedades qumicas
nicas, sus niveles de energa tenan que estar ajustados con tal
precisin que la probabilidad de que hayan sido generados por
las fuerzas ciegas de la naturaleza era minscula. Escribi que,
si interpretamos los datos cientficos con sentido comn, debe
ramos concluir que un intelecto sper calculador debi haber
diseado las propiedades del tomo de carbono.2
Hoyle seal, igualmente, que aun ms ridculo es suponer
que los tomos de carbono pueden juntarse a travs de procesos
aleatorios, para conformar los biopolmeros capaces de sustentar
la vida. Se ha propuesto que las primeras molculas orgnicas
aparecieron y se acumularon en ambientes determinados de la
Tierra primitiva, como lagunas costeras o chimeneas hidroter

2 Fred Hoyle, The Universe: Past and Present Reflections, Engineering and Science,
vol. 45, N 2 (noviembre de 1981), pp. 8-12. En lnea: www.calteches.library.caltech.
edu/527/2/Hoyle.pdf.
LA TEORA DEL BG BAO

males, y formaron lo que se conoce como sopa prim ordial.


Hoyle y su colega, el matemtico C handra W ickramasinghe,
calcularon que las probabilidades de que los tomos de carbono
hayan podido unirse a fin de crear las enzimas necesarias para
la form a de vida ms simple -q u e deberan haber aparecido si
m ultneam ente en el lugar y en el m om ento apropiados- son
tan pequeas que incluso si el universo entero estuviera forma
do por dicha sopa prim ordial, todava resultara improbable.3
Hoyle pensaba que, en lugar de aceptar la nfima probabilidad
de que la vida haya aparecido mediante las fuerzas ciegas de la
naturaleza, tenemos menos probabilidades de equivocarnos si
suponemos que el origen de la vida fue un acto intelectual de
liberado.4
El modo en que los elementos qumicos que com ponen de la
vida -carbono, oxgeno, nitrgeno e hidrgeno- llegaron a exis
tir, junto con los dems elementos, se suele explicar en las clases
de ciencias de la mayora de las universidades y los colegios en
relacin con la teora del Big Bang, que literalmente significa
La gran explosin. Este nombre fue acuado originalmente
por Hoyle; quien en realidad rechazaba la teora.5
La teora del Big Bang es una construccin increble de su
posiciones astronmicas no demostradas, que trata de dar una
explicacin natural a la formacin del universo. A continuacin,
realizaremos una revisin general de lo que se conoce como la
teora del Big Bang caliente:
Es im portante empezar sealando una falsa idea m uy exten
dida respecto de lo que esta teora entraa. Muchas personas,
incluyendo algunos cientficos y astrnomos, creen que el Big
Bang describe el escenario de algo (cientficamente referido
como una singularidad) con propiedades extremas como den-

3F. Hoyle y C. Wickramasinghe, Evolutionfrom Space (London: J.M. Dent & Sons, 1981),
pp. 23-33.

4Hoyle, The Universe: Past and Present Reflections", ibd., p. 12.

5Ver: www.physicsworld.com/cws/article/news/2615.
EVOLUCIN

sidad y calor infinitos, que apareci repentinam ente en el vaco y


se expandi con rapidez en el espacio tridimensional. A medida
que esta materia/energa en expansin se enfriaba, se formaron
galaxias y estrellas como islas, en el espacio que conocemos como
universo. Pero, la teora es en realidad an ms ingeniosa, pues
lo que propone es que, en el Big Bang, el espacio en s mismo
se expandi en un hiperespacio tetradimensional.6 Esta imagen
puede ser difcil de captar, as que, usaremos como analoga la
expansin de un globo que est siendo inflando. Si dibujamos
crculos pequeos en la superficie del globo, a m edida que este se
expande los crculos tam bin se expandirn, y adems se alejarn
unos de otros. En este caso, tenemos una superficie bidimensio-
nal que se dilata en el espacio tridimensional. Una observacin
im portante es que la superficie del globo no tiene centro. La
teora del Big Bang, con un espacio tridimensional que se dilata
en el hiperespacio tetradimensional (que, a propsito, nunca ha
sido observado o detectado, y es solo una suposicin inventada),
implica que el universo no tiene bordes y, por lo tanto, no tiene
centro. Este supuesto, llamado el principio cosmolgico o el
principio de Coprnico, era necesario a los fines de desarrollar
una teora en la que el universo sea esfricamente simtrico des
de donde quiera que se lo examine.
Cuando observamos el universo desde la Tierra, da la sensacin
de ser esfricamente simtrico (isotrpico) a nuestro alrededor,
como si estuviramos cerca del centro, en una posicin privilegia
da para estudiar la estructura y la naturaleza del espacio. Sin em
bargo, algunos cosmlogos queran una teora en la que la Tierra
no estuviera cerca del centro del universo. As que, adoptando el
concepto de hiperespacio, crearon una teora que explica que pa
rece que estamos cerca del centro porque es as como se ve el uni
verso desde cualquier punto en el que est situado un observador

6W. Rindler, Essential Relativity: Special, General and Cosmological, 2o ed. (New York:
Springer-Verlag, 1977), pp. 212, 213.
potencial.7 En otras palabras, la teora del Big Bang incluye una
hiptesis construida especficamente de modo de asegurar que la
Tierra no est ubicada en un lugar especial del universo.
En su intento por conseguir una explicacin mecanicista de
nuestros orgenes, en lugar de una sobrenatural que implique un
Creador Inteligente, la teora del Big Bang contiene varias supo
siciones forzadas adicionales, algunas de las cuales no pueden ser
justificadas basndose sobre las leyes conocidas de la Fsica.8 Son
invenciones no comprobadas, pero necesarias para dar forma a
la teora. Por ejemplo, la teora del Big Bang requiere un nmero
creciente de entidades hipotticas que nunca han sido demostra
das ni observadas. Las ms prominentes de estas son:

La teora inflacionaria.
La materia oscura.
La energa oscura.

Sin estas presuntas y totalm ente inventadas condiciones,


la teora del Big Bang no funciona. En otras palabras, como lo
que la teora predice y lo que los astrnomos observan no con
cuerda, los tericos desarrollan nuevos artefactos para tratar de
conseguir que funcione.
Se puede citar el grado de uniformidad que se observa en el
universo, que no es compatible con la formulacin inicial de
la teora pues el universo debera hacerse expandido demasiado
rpido para desarrollar esta uniformidad. A fin de superar esta
dificultad, los cosmlogos introdujeron el concepto de energa
inflacionaria, desconocida hasta el m om ento, que sera respon
sable por la separacin entre s de los objetos del universo. La

7 S. W. Hawking y G. F. R. Ellis, The Large Seale Structure ofSpace-Time (Cambridge, UK


and New York: Cambridge University Press, 1973), pp. 134, 135.

8Notas de una conferencia de Astronoma en la Universidad de Tennessee (en ingls):


Problems with the Big Bang. Ver: www.csepl0.phys.utk.edu/astrl62/lect/cosmology/
bbproblems.html.
EVSLIfCSDM MPO?

explicacin es que el espacio entre los objetos es lo que se expan


de a gran velocidad, superando incluso la velocidad de la luz,
mientras los cuerpos permanecen en reposo en relacin con l.
De esta manera, se consigue explicar la estabilidad (isotropa) de
la radiacin de fondo de las microondas csmicas.
De m odo semejante, la teora del Big Bang postula una pro
porcin de materia y de antimateria en el universo m uy diferen
te de la que observamos. As que, en lugar de descartar la teora
debido a la acumulacin de datos en contra, los cosmlogos han
propuesto la existencia de un tipo hipottico de materia oscu
ra, que no emite suficiente radiacin electromagntica para ser
detectada por los medios tcnicos actuales. La energa oscura
es una entidad hipottica similar. Sin ella, la teora predice la
ridicula situacin de que el universo es miles de millones de aos
ms joven que algunas de las estrellas de nuestra galaxia.
Estos importantes defectos de la teora del Big Bang son cono
cidos por los cientficos desde hace dcadas.9 En 2004, decenas de
los principales astrnomos y fsicos firmaron una carta, publica
da en la revista New Scientist, sealando que se estaba recurrien
do continuamente a nuevas entidades hipotticas para llenar los
huecos entre la teora y la observacin. Adems, la teora haba
fracasado en ofrecer alguna prediccin cuantitativa que pudiera
ser validada cientficamente.101Entre los astrnomos y cosmlo
gos ilustres que firmaron la carta, encontramos a Halton Arp,
del Instituto Max Planck de Astrofsica, en Alemania; Hermann
Bondi, de la Universidad de Cambridge; y Thomas Gold, de la
Universidad Cornell.11 Desde que la carta fuera publicada en New
Scientist, han tenido lugar dos congresos titulados Crisis en la
Cosmologa, en 2005 y 2008, y cientos de astrnomos, fsicos y
otros cientficos han aadido sus nombres a la lista.

9Ver, por ej., E. Lemer, The Big Bang Ne\>er Happened: A Startling Refutation ofthe Do-
minant Theory ofthe Origin ofthe Universe (London: Vintage, 1992).

10E. Lemer, Bucking the Big Bang, New Scientist (22 de mayo de 2004), p. 20.

11 Para una lista completa de los suscribientes, ver: homepages.xnetco.nz/~hardy/cosmo-


logystatement.html.
I.A TEORIA DEL BiG BANG

La radiacin csmica de fondo de microondas tambin se cita


como una de las principales evidencias de la teora. Sin embargo,
en la conferencia de 2008, el investigador en Termodinmica Ber-
nard Bligh, educado en la Universidad de Oxford, present cl
culos termodinmicos rigurosos que demostraban que la supuesta
bola de fuego inicial del Big Bang no poda haber producido el
espectro de cuerpo negro casi perfecto que observamos.12
Por otro lado, el Dr. Richard Lieu y sus compaeros de trabajo
de la Universidad de Alabama, en Huntsville, analizaron datos
procedentes de la Sonda Espacial W ilkinson para Anisotropa
de Microondas (WMAP, por sus siglas en ingls), relacionados
con 31 grupos de galaxias. Buscaban evidencias de las sombras
que deberan haber proyectado las galaxias situadas en primer
plano, en la radiacin de fondo de microondas procedente de
la supuesta explosin. Pero, no se detect ni una sola sombra
relacionada con ninguno de los 31 grupos, lo que es una po
derosa evidencia de que la Gran Explosin nunca ocurri.13 En
realidad, la radiacin de fondo de microondas que observamos
tiene ms sentido y coincide mejor con los valores calculados, si
se interpreta nicamente como la tem peratura del espacio calen
tado por la luz de las estrellas.14
O tro gran problema con la teora del Big Bang es que fa
lla totalm ente en su prediccin de galaxias satlite. El Dr. Pavel
Kroupa, educado en la Universidad de Cambridge y profesor de
Astronoma en la Universidad de Bonn, en Alemania, seala que
tan solo vemos el 1% del nmero de galaxias que la teora predi
ce. Segn Kroupa, esta es la evidencia ms clara de que hay algo

12 H. Ratcliffe, The Second Crisis in Cosmology Conference (2008). En lnea: www.


hiltonratdiffe.com/45.

13R. Lieu, J. P. D. Mittaz y Z. Shuang-Nan, T he Sunyaev-ZeTdovich Effect in a Sample


of 31 Clusters: A Comparison Between the X-ray Predicted and WMAP Observed Cosmic
Microwave Background Temperature Decrement, Astrophysical Journal, vol. 648, N 1
(2006), pp. 176-199.

14T. Van Flandern, The Top 30 Problems with the Big Bang, Meta Research Bulletin, vol.
11, N 1 (2002), pp. 6-13.
. . m M m n m p m s ? .

absolutamente errneo en el modelo del Big Bang como expli


cacin del origen de las galaxias que observamos en el espacio. 15
O tro aspecto de la teora del Big Bang, que ya hemos comenta
do anteriormente, es que describe un universo en expansin. Esta
expansin, si estuviera ocurriendo realmente, producira fenme
nos de dilatacin temporal, cuyo resultado sera dos efectos de
ensanchamiento en las curvas de luz de las supernovas. Pese a esto,
estudiando los anchos de las curvas de luz de las supernovas, solo
se observa un efecto de ensanchamiento.16 Del mismo modo, los
datos obtenidos en las mediciones de la luminosidad superficial
de las galaxias son consistentes con los clculos de un universo que
no se expande.17
Adems de los nombrados aqu, existen otros serios proble
mas con la teora del Big Bang que no vamos a explicar aqu,
porque son de naturaleza excesivamente tcnica.18 N o obstante,
tal acumulacin de problemas debera llevarnos a la conclusin
de que el Big Bang no puede explicar el origen del universo y,
por lo tanto, es necesario buscar otro modelo. De hecho, se po
dra proponer un sinnmero de cosmologas alternativas, pero
es realmente difcil que lleguemos a demostrar lo que en verdad
ocurri. Es cierto que algunos modelos parecen ms factibles
que otros; pero, hasta la fecha, no se ha propuesto ningn m o
delo mecanicista que se adece a todos los datos observados.
Aunque tampoco es posible demostrar su veracidad, el modelo
de creacin instantnea del universo, con la Tierra cerca de su
centro, concuerda bien con lo que en realidad observamos.19

15 M. Chown, Mystery of the Missing Mini-galaxies, New Scientist (22 de agosto de


2009), pp. 37-39.

16 T. B. Andrews, Falsification of the Expanding Universe Model, American Institute o f


Physics Conference Proceedings, vol. 822 (21 de marzo de 2006), pp. 3-22.

17 E. J. Lemer, Evidence for a Non-Expanding Universe: Surface Brightness Data From


HUDF, en: Ibd., pp. 60-74.

18Ver, por ej., Van Flandem, ibd., pp. 6-13.

19 Ver, por ej., el sitio web del Dr. Robert Herrmann, PhD, Profesor de Matemticas (re
tirado), Academia Naval de los EEUU: www.users.datarealm.com/herrmann/main.html.
I.A f tQKA DLL Bit:; BAN

La teora del Big Bang se ensea en escuelas, institutos y univer


sidades, simplemente porque es popular entre los cientficos que
no quieren llevar ninguna nocin de Dios a las aulas. Su argumen
to principal es que la Creacin no es una teora cientfica verifi-
cable y que, en consecuencia, no puede ser enseada en una clase
de ciencias. Y aun as, para tratar de salvar la teora del Big Bang,
no ven en absoluto problemtico ensear la teora inflacionaria,
que es una idea filosfica no comprobable. Como nos recuerda
el internacionalmente renombrado astrofsico George Lilis, un
universo simtricamente esfrico, con la Tierra en su centro, no
puede ser refutado sobre la base de la observacin. Segn Lilis, los
cosmlogos estn utilizando criterios filosficos con el propsito
de elegir su modelo de origen del universo; y gran parte de la pro
pia cosmologa trata de esconder este hecho.20
Cuando consideramos todos los conocimientos que hemos ido
acumulando sobre la fsica y la qumica del universo y de la Tierra,
las caractersticas de nuestro planeta y su posicin en el Sistema
Solar, junto con la baja probabilidad de que todo eso se combine
por azar para dar lugar a un escenario perfecto para que exista la
vida, encontramos evidencias abrumadoras de que ocurri como
consecuencia de la voluntad de un Dios Creador todopoderoso.
Actualmente, no hay ninguna teora probada de cmo llegamos a
existir los seres humanos y nuestro bello planeta. Sin embargo, el
ajuste fino del universo refuerza la afirmacin, de hace ya dca
das, del profesor Fred Hoyle: el universo y la vida son el resultado de
un acto deliberado de una inteligencia infinitamente superior.

20 W. W. Gibbs, Profile: George F. R. Ellis, Scientific American, vol. 273, N 4 (octubre


de 1995), p. 55.
CIENTIFICOS NO
EVOLUCIONISTAS
CIEN I incas Al JAMENTE CALDCADOS RECHAZAN LA
.PEORA DE LA EVOLUCIN

n los captulos previos, he presentado evidencias significativas de

E que los procesos evolutivos naturales no pueden explicar el ori


gen de la vida, y de que las largas edades para la vida en la Tierra
no han sido demostradas cientficamente. Por el contrario, mltiples
evidencias apoyan la idea de que la vida sobre la Tierra es relativamen
te reciente. Es posible que los lectores se estn preguntando: si existen
tantas evidencias de que la evolucin es imposible, por qu no hay
otros cientficos que lo sealen? La respuesta es que en realidad s los
hay. Este captulo es una compilacin de escritos y declaraciones de
numerosos cientficos actuales que se atreven a hablar abiertamente
de sus dudas acerca de la Teora de la Evolucin.
En 1999, edit un libro en el que 50 cientficos con docto
rados en ciencias explicaban por qu rechazaban la evolucin
CIENTFICOS NO EVOLl.iCIONISTAS

y se inclinaban en favor de la creacin reciente de la vida en la


Tierra.1 Entre los colaboradores, se incluan cientficos ilustres,
profesores y catedrticos de distintas universidades. La prim e
ra parte de este captulo recoge algunas de las expresiones mas
destacadas de estos cientficos. En estas citas, se han om itido
las notas y las referencias, pero estn disponibles en la versin
impresa de In Six Days: Why 50 Scientists Choose to Believe in
Creation [En seis das: Por qu 50 cientficos eligen creer en la
Creacin].12 Algunos de los temas tratados en estos textos ya han
sido comentados anteriormente, pero en esta seccin se encuen
tran desarrollados con ms detalle o desde otra perspectiva; otros
son nuevos aspectos de lo que no hemos hablado por falta de
espacio. M i objetivo en este captulo no es cubrir de nuevo todas
las evidencias, sino mostrar que, dentro de la com unidad cient
fica, no existe un apoyo generalizado a la Teora de la Evolucin;
y que son muchos los cientficos expertos en diferentes campos
que encuentran, en sus respectivas reas de investigacin, evi
dencias contundentes para rechazarla.
En el mencionado libro In Six Days... el profesor David B.
Gower, doctor en Bioqumica y profesor emrito de Bioqumica
de los Esteroides en la Universidad de Londres, expres su opinin
experta sobre algunas de las evidencias de la evolucin ms des
tacadas:
D urante las tres ltimas dcadas, se ha publicado m ucho tra
bajo en el campo de la Investigacin de la Creacin. Esto me
ha estimulado a criticar la Teora Evolutiva en tres reas que me
son de particular inters:
1) Mis conocimientos qumicos me han permitido compren
der las crticas a los mtodos de datacin radiomtrica para las
muestras de roca, y percatarme de que hay enormes problemas

1J. F. Ashton, ed In Six Days: Why 50 Scientists Choose to Believe in Creation (Green
Forest, AR: Master Books, 2001). Ver: www.creation.com/in-six-days-preface y www.
creation.com/isd (para leer cada captulo, cliquear sobre el nombre del autor que se en
cuentra a la izquierda).

2Ibd.
w m m a& H M Pm m M

con la interpretacin de los datos. Por consiguiente, mi opinin es


que las rocas no son ni remotamente tan antiguas como se alega.
2) Desde un punto de vista bioqumico, la idea de que los
aminocidos, los azcares, y algunos de los componentes bsi
cos esenciales para las protenas y el cido desoxirribonucleico
(ADN) podran formarse tan solo por la interaccin de descargas
elctricas, con una atmsfera primitiva de naturaleza reductora,
puede ser criticado de muchas maneras y en muchos niveles.
3) Mis propios estudios sobre numerosos mecanismos bio
qumicos de control, especialmente en el control de la forma
cin de hormonas esteroides, por el que se me otorg el ttulo de
D octor Superior en Ciencias (DSc), me convencen de que todos
estos procesos estn ordenados con suma precisin. Este orden,
y la extraordinaria complejidad, son completamente consecuen
tes, en mi opinin, con la existencia de un Creador, capaz de
crear tal diseo por s mismo.
Dicha complejidad aparece en prcticamente todas las ramas de
la ciencia, y es especialmente evidente en el campo de la naturaleza.
Ms que sealar hacia la formacin por los aleatorios procesos de
la evolucin, todo esto me habla claramente de un Creador Todo
poderoso.3

El profesor Gower afirma que los procesos aleatorios de la


evolucin, supuestamente capaces de crear y modificar la vida,
no han sido demostrados y, en su opinin de especialista, la ex
traordinaria complejidad de los mecanismos bioqumicos de
control, como la regulacin hormonal, requiere un diseo inte
ligente y asombrosamente brillante.
El Dr. John K. G. Kramer es un investigador ilustre que tra
baja en Agriculture & Agri-Food, en Canad. Tiene un doc
torado en Bioqumica por la Universidad de M innesota, y fue
uno de los cientficos responsables por evaluar las propiedades
toxicolgicas y bioqumicas del aceite de cala. Kramer escribe:

3D. B. Gower, ibd., pp. 266, 267.


CIENTFICOS NO EVOLUCIONISTAS

Nadie ha demostrado nunca cambios macroevo-


lutivos a nivel molecular; y aun as, muchas personas
especulan sobre vnculos evolutivos entre bacterias,
plantas, animales y el hombre. No estn formadas to
das las estructuras superiores por clulas individuales
con molculas complejas? Si la macroevolucin es im
probable a nivel molecular, cmo puede aceptarse, sin
ms, en niveles superiores? Las interminables compa
raciones de secuencias de A D N no demuestran el pa
rentesco evolutivo. Adems, los cambios (mutaciones)
que observamos a nivel molecular, por ejemplo en el
A D N , son predom inantem ente destructivos, y siempre
implican prdida, no ganancia, de informacin y de
complejidad.4

Kramer prosigue, utilizando un ejemplo de su propia rea de


especialidad, la investigacin de los lpidos:

En las ltimas dcadas, se ha realizado un extenso traba


jo sobre las bacterias termfilas y halfilas, que crecen bajo
condiciones de temperatura y salinidad extremas, respecti
vamente. Estas bacterias se han clasificado como arqueobac-
terias, porque algunos cientficos creen que son las formas
de vida ms antiguas y ms simples. Los lpidos de estas bac
terias presentan enlaces qumicos llamados eteres, en vez de
steres, y los grupos alquilo estn en las posiciones 2 y 3 del
esqueleto central de glicerina, en vez de en las posiciones 1
y 2, como ocurre en los sistemas de los mamferos. Adems,
producen su energa en forma de trifosfato de adenosina
(ATP), por medio de una combinacin de un gradiente de
sodio ms la fuerza protn-motriz, en vez de solamente con
la fuerza protn-motriz que usan las clulas de los mamfe
ros. [Para soportar las duras condiciones ambientales en las

4 John K. G. Kramer, ibd., p. 47.


EVOLUCIN IMPOSIBLE

que habitan] las frgiles estructuras y procesos bioqumicos


de estas bacterias, muchos de los cuales son similares a los de
las clulas de los mamferos, necesitan estar protegidos. Pero
cmo? Los enlaces ter son indudablemente ms estables
que los enlaces ster, aunque eso podra no ser la explicacin
completa. A partir de los resultados de mi investigacin, he
llegado a la conclusin de que se obtiene una mayor es
tabilidad porque estos lpidos-ter forman complejos con
iones de sodio. La integracin del gradiente electroqumico
de protones y el gradiente de sodio an no se comprende,
aunque se sabe que este ltimo inicia el crecimiento celular.
Por lo tanto, describir a estas bacterias como las
formas de vida ms simples es distorsionar totalmente
su complejidad. Las arqueobacterias son tan comple
jas como las clulas de los mamferos, y representan
un asombroso diseo, perfectamente adecuado para las
condiciones de temperatura y salinidad extremas en las
que viven. Cada clula se desarrolla segn la informa
cin contenida en su AD N . El hecho de nom brar a estas
complejas clulas y sus estructuras usando el prefijo ar
queo- sirve para comunicar la jerarqua evolutiva, pero
no proporciona ninguna evidencia cientfica. Habla de
creencias filosficas propias, pero no aade conocimien
to cientfico. En realidad, podra incluso considerarse
engaoso, al implicar que estos lpidos y mecanismos
productores de energa podran evolucionar de manera
diferente bajo condiciones ambientales distintas. Las
evidencias demuestran que, despus de millones de ge
neraciones, Methanobacteria thermoautotrophicum sigue
siendo Methanobacteria thermoautotrophicum, de acuer
do con su informacin gentica: una bacteria que crece
bajo condiciones de alta temperatura y salinidad.5

5Kramer, ibd., pp. 48, 49.


CIENTFICOS NO cVOLUCIONIS IOS

Ntese esta im portante puntualizacin del Dr. Kramer: dar


a las bacterias un nom bre cientfico que insina que son ms
primitivas que otras no prueba que lo sean. Sin embargo, para
lectores y estudiantes desinformados, el nom bre expresa el m en
saje sutil de que se ha demostrado que se trata de las bacterias
ancestrales ms primitivas.
El Dr. James S. Alian, doctor en Gentica por la Universi
dad de Edimburgo, Escocia, usa sus conocimientos expertos de
Gentica para cuestionar la afirmacin consensuada de que la
semejanza gentica implica necesariamente parentesco, y utiliza
clculos convencionales de gentica de poblaciones para refutar
la supuesta evolucin del ser humano:

Los parientes tienden a parecerse en sus caracte


rsticas fsicas, funcionales y de conducta. Este es un
fenmeno bsico en la ciencia gentica. La semejanza
se debe al hecho de que los parientes tienen genes en
comn. Cuanto ms cercana es la relacin, ms grande
es la proporcin de genes en com n y, por lo tanto,
mayor el grado de semejanza. La Teora de la Evolu
cin asume un origen com n para todas las formas de
vida, y deduce que las especies, los gneros, las familias,
los rdenes, etc., estn genticamente relacionados. Es
cierto que todos los seres vivos portan algunos genes
con estructura y funcin similares, pero implica esto
una relacin gentica en el sentido normal, intraespe-
cfico, y necesariamente se deduce de ello un origen
com n para todas las formas de vida? Hay alguna ra
zn por la que Dios debiera haber creado las diferentes
especies, gneros, etc. de maneras totalm ente diferentes
y con genes completamente distintos? [...]
Presento a continuacin dos aspectos que surgen
de este tipo de interrogantes, aplicados a la supuesta
evolucin del hombre.
1) El citocromo c es una pro tena, producto de un
gen. Funciona como una enzima clave en las reacciones
de oxidacin, y parece estar presente en prcticamente
cada organismo viviente. El citocromo c consta de una
cadena de 112 aminocidos, 19 de los cuales aparecen
exactamente en el mismo orden en todos los organismos
comprobados. Las diferencias en la identidad y la posi
cin de los 93 aminocidos restantes son consideradas
el resultado de la sustitucin por mutaciones durante el
curso de la evolucin. La secuencia de aminocidos del
citocromo c hum ano es idntica a la del chimpanc, y
hay solo una diferencia entre el citocromo c hum ano y el
del mono Rhesus (el aminocido isoleucina en posicin
66 se sustituye por treonina en este ltimo). El nmero
de diferencias entre el citocromo c hum ano con otras es
pecies comunes es: vaca, cerdo y ovejas, 10 aminocidos;
caballo, 12; gallina y pavo, 13; serpiente de cascabel, 14;
tiburn, 23; mosca, 25; trigo, 35 y levadura, 44.
Informacin de esta naturaleza se utiliza para cons
truir rboles filogenticos con la presunta relacin genti
ca entre los organismos. Esto se presenta como evidencia
en favor de la evolucin a nivel molecular y se llega, entre
otras, a la conclusin de que el hombre y el chimpanc
tienen un antepasado comn relativamente reciente. Su
ministra la constitucin de aminocidos del citocromo c
evidencias legtimas para llegar a dicha conclusin?
El hecho de que el citocromo c tenga un nmero
fijo de 112 aminocidos es una seal de la importancia
de la estructura tridimensional de la molcula. Podemos
deducir que existe una restriccin estructural sobre el
nmero total de aminocidos. Por otro lado, solo 19
de los 112 son idnticos en todos los organismos eva
luados. Dado que la identidad y la posicin de los 93
aminocidos restantes difiere entre organismos, excepto
en casos especficos como entre el hombre y el chim
panc, es razonable llegar a la conclusin de que no hay
ninguna restriccin funcional para la sustitucin de los
mismos.
CIENTFICOS NO EVOLUCIONISTAS

Aparte del gen que controla la secuencia de amino


cidos del citocromo c, los seres hum anos y los chim
pancs difieren en muchos miles de otros genes. H a
ciendo una estimacin conservadora, digamos que son
5.000. Lo que la Teora de la Evolucin afirma es que,
mientras los seres hum anos y los chimpancs evolucio
naron por separado a partir de un antepasado com n
hasta diferenciarse en esos 5.000 genes, no hubo nin
gn cambio en los 93 aminocidos especificados por el
gen del citocromo c, a pesar de no existir ninguna res
triccin funcional sobre el cambio de ellos. En mi opi
nin, esta afirmacin es inaceptable. De acuerdo con
Weaver y Hedrick (1989), la falta de diferenciacin en
la constitucin del citocromo c entre los seres humanos
y los chimpancs es atribuible a una tasa m uy lenta (0,3
x 10-9) de sustitucin de aminocidos en el citocromo
c. Cmo se determina esta tasa de sustitucin? Resulta
que se calcula sobre la base del presunto m om ento en
que las especies se bifurcaron; es decir, la afirmacin se
asume demostrada bajo la suposicin de que es verda
dera. Debo aceptar esta clase del razonamiento?
2) La terica evolucin del hom bre a partir de su
presunto antepasado en comn con el chimpanc re
quiere millones de aos de m utacin, deriva gentica
y seleccin natural antes de la aparicin del hom bre
m oderno. Sin embargo, cuando considero las tasas de
mutacin; el coste de la sustitucin de cada nuevo
gen m utante, en trminos de la cantidad de muertes
genticas, en una poblacin; el presunto nm ero de
diferencias en genes mutantes entre etapas evolutivas;
y el tam ao de poblacin necesario para complacer tal
cantidad de mutaciones sucesivas, encuentro que hay
una extraordinaria falta de evidencias sobre la evolu
cin del hom bre. Mis razones son las siguientes:
[J. B. S.] Haldane lleg a la conclusin de que el
nm ero de muertes genticas necesario para asegurar

"189
V S5.ix :6*4 s:
la sustitucin de un gen por otro, a travs de seleccin
natural, estaba en el rango de 30 veces el nm ero de
individuos en una generacin. Usando esta cifra, pue
de calcularse el coste de sustituir 5.000 genes m utantes
sucesivos en una poblacin de tam ao constante. Con
una tasa media de m utacin de 10-6, el tam ao de la
poblacin debera estar, por lo menos, en el orden de
1 milln. Esto implica unos 150 mil millones de an
cestros del hom bre m oderno; ancestros que, a m enu
do, son representados como pertenecientes a pequeos
grupos de cazadores caverncolas, llamados australopi-
thecus, que vagaban por la sabana africana. Por qu hay
escasez de evidencias en forma de fsiles, herramientas
o lo que sea, de la existencia de tan vasto nm ero de
prehumanos parecidos al australopithecust
Puede argumentarse, por supuesto, que este inm en
so nm ero de individuos se distribuy a lo largo de
millones de aos, pero yo lo encuentro problemtico
no solo debido a falta de evidencias, sino tam bin a la
factibilidad de tales cifras de poblacin total.6

El Profesor Edward A. Boudreaux es profesor emrito de Q u


mica en la Universidad de Nueva Orleans, y tiene un doctorado en
Qumica terica otorgado por la Universidad Tulane. Bodudreaux
escribe acerca de la sorprendente especificidad de las molculas que
forman parte de los seres vivos:
El elemento oxgeno (O) existe libremente en la na
turaleza como molcula la diatmica gaseosa O r Otros
elementos representativos tam bin existen como m o
lculas diatmicas libres, como el hidrgeno (H 2), el
nitrgeno (N 2), el flor (F2) y el cloro (CL,). Sin embar
go, el oxgeno diatmico es la nica molcula de este
tipo que posee dos electrones desapareados; los otros

6 James S. Alian, ibd., pp. 128-132.


CIENTFICOS NO EVOLUCIONISTAS

tienen apareados todos sus electrones. A pesar de esto,


el 0 2 todava es qumicamente estable. Esta singular y
notable regla del par electrnico para la estabilidad de
los elementos no tiene explicacin conocida. La otra
nica molcula con un arreglo de electrones exacta
m ente igual al oxigeno es el azufre. Sin embargo, el
S2 es una molcula m uy inestable, razn por la cual el
azufre no existe en esta forma. Sin los dos electrones
desapareados, el 0 2 no sera capaz de unirse a los to
mos de hierro (Fe) de la hemoglobina, con la cantidad
precisa de energa necesaria para transportar el O , en
el flujo de sangre y luego liberarlo. Otras molculas,
como el monxido de carbono (CO) y el m onxido de
nitrgeno (N O ) pueden reemplazar al 0 2 en su unin
con la hemoglobina, pero destruyen totalm ente la fun
cionalidad de la hemoglobina al hacerlo.
D e forma semejante, hay otros metales de transi
cin comparables al hierro que pueden reemplazarlo en
la hemoglobina y unirse tam bin al O z, pero el enlace
resulta demasiado fuerte o demasiado dbil. Por lo tan
to, no hay anlogos sin hierro de la hemoglobina que
tengan las propiedades requeridas para transportar 0 2
en el metabolismo sanguneo.
La parte estructural de la hemoglobina que enlaza al
hierro es el llamado anillo de porfirina. Si la porfirina se
traslada a otro ambiente biomolecular, y el tomo de hie
rro se reemplaza por magnesio (Mg), tenemos clorofila, un
componente clave para el metabolismo vegetal y la clula
fotoelctrica ms eficiente conocida, aproximadamente
un 80% ms eficiente que cualquier fotoclula fabricada
por el hombre. Aunque el calcio (Ca) y algunos metales
pueden reemplazar al magnesio en la clorofila, estos pro
ductos no replican en absoluto su eficiencia fotoelctrica.
Las protenas estn compuestas por molculas de ami
nocido qumicamente enlazadas entre s por enlaces pep-
tdicos. Los aminocidos son compuestos de carbono e hi-
EVOLUCIN II-:' 5IBI.iT

drgeno que contienen un grupo amino, es decir, -NH,,


-N H R o -NR; (donde R representa uno o ms compuestos
de carbono-hidrgeno) enlazados a un tomo de C, adems
de un grupo cido (-COOH) enlazado al mismo tomo de
C. Aunque hay miles de variedades de aminocidos, sola
mente 20 forman parte de las estructuras proteicas.
Los aminocidos existen en dos formas estructura
les, D y L, que son reflejos especulares opuestos que
no pueden superponerse entre s. En ausencia de un
control externo, ambas formas, D y L, aparecern de
forma natural en cantidades esencialmente iguales; sin
embargo, todas las protenas estn formadas solamente
por aminocidos tipo L.
De manera similar, los azcares, o sacridos, que
son compuestos de carbono-hidrgeno-oxgeno, pue
den presentarse en forma de anillos cerrados, existien
do tam bin formas ismeras D y L. De entre las m u
chas variedades de azucares de 5 tomos de carbono
que pueden formar una estructura de anillo, tan solo la
ribosa, y nicamente su forma D, est presente como
uno de los tres componentes moleculares fundam enta
les de las estructuras del ADN y del ARN.
Los cidos nucleicos (ADN, o cido desoxirribo-
nucleico, y ARN, o cido ribonucleico) son, en cierta
manera, ms complejos que las protenas, pues contie
nen una variedad mayor de unidades moleculares. Los
cidos nucleicos son cadenas de unidades complejas
llamadas nucletidos, que a su vez estn formadas por
tres componentes: una base nitrogenada, una molcu
la de azcar (ribosa o desoxirribosa) y un grupo fosfa
to. Estos nucletidos estn unidos siguiendo patrones
m uy especficos, que les perm iten efectuar funciones
nicas y cruciales. El azcar y el grupo fosfato (-PCL)
estn unidos en una secuencia alterna, y producen lar
gas cadenas enrolladas en espiral. Cada nucletido est
unido a un tomo de carbono especfico de la ribosa del

19:'
CIENTf ICOS NO EVOLUCiONSTAS

siguiente nucletido de la cadena. En el caso del ARN,


la estructura es una espiral de hebra nica, enrollada
hacia la derecha, que contiene cuatro nucletidos di
ferentes (adenina, citosina, guanina y uracilo), organi
zados en secuencias especficas a lo largo de la cadena.
Cada ARN presenta una secuencia diferente de los cua
tro nucletidos. La estructura del A D N consta de una
doble hlice enrollada hacia la derecha, que contiene
tam bin cuatro nucletidos. Tres de estos son iguales
que en el ARN, y la tim ina reemplaza al uracilo.
Los nucletidos pertenecen a dos especies de m o
lculas llamadas purinas y pirimidinas. Adenina y
guanina son purinas; mientras que citosina, tim ina
y uracilo son pirimidinas. Hay cientos de variedades
de purinas y pirimidinas, pero solamente estas selec
tas cinco determinan las estructuras y las funciones del
A D N y del ARN.
De forma semejante, la ribosa es solo una de entre
un gran nmero de molculas llamadas sacridos. Por
qu solo encontramos ribosa, y especficamente su is
mero D, y no otros sacridos diferentes en el A D N y el
ARN? De igual modo, por qu solamente fosfato, y no
sulfato o silicato? Pues, porque solo funciona el fosfato.
Estos pocos ejemplos contienen evidencias claras
de un complejo diseo responsable por la elevada efi
ciencia de funciones m uy especficas. Sus caractersti
cas desafan la probabilidad de que ocurriera por azar.
N ingn proceso evolutivo aleatorio puede explicar tal
precisin en el diseo.7

El Dr. John R. Baumgardner trabaj como cientfico investiga


dor en la Divisin Terica del Laboratorio Nacional Los Alamos,
durante 20 aos. Tiene un doctorado en Geofsica por la Univer

7EdwardA. Boudreaux, >;,pp. 207-210.


EVOLUCIN IMPOSIBLE

sidad de California en Los ngeles (UCLA), y fue el desarrollador


principal de TERRA, un programa 3-D para modelar el manto y la
litosfera de la Tierra. Tambin tiene un mster en Ingeniera elctrica
por la Universidad de Princeton, y se ha especializado en simulacio
nes numricas complejas. En su contribucin al libro In Six Days...
Baumgardner usa un clculo matemtico, relativamente sencillo,
para demostrar que las probabilidades de la creacin de protenas
funcionales por medio de procesos aleatorios son tan bajas que se
pueden considerar nulas. A continuacin, hace una disertacin muy
convincente acerca de las propiedades lingsticas del material gen
tico, que sugieren el origen no material de la informacin:

Muchos evolucionistas estn persuadidos de que los


15.000 millones de aos que se asumen como la edad
del cosmos es tiempo suficiente para que interacciones
aleatorias entre tomos y molculas generen la vida.
Una sencilla leccin de aritmtica revela que esto no es
ms que una fantasa irracional.
Esta leccin de aritmtica es similar a calcular las
probabilidades de ganar la lotera. El nm ero de com
binaciones posibles de la lotera corresponde al nmero
total de estructuras de protena (de un rango de ta
mao apropiado) que es posible ensamblar desde sus
componentes bsicos estndar. Los boletos premiados
corresponden al dim inuto conjunto de tales protenas,
con las propiedades especiales correctas para que un or
ganismo viviente, digamos, una bacteria simple, pueda
construirse con xito. El nm ero mximo de billetes de
lotera que una persona puede comprar corresponde al
nmero mximo de molculas de protena que puede
haber existido en la historia del cosmos.
Establezcamos, primero, un lmite superior razona
ble para el nmero de molculas que se pudieron for
m ar a lo largo y lo ancho del universo durante toda su
historia. Tomamos 1.080 como un clculo aproximado
generoso para el nm ero total de tomos en el cosmos,
1.012 para un lmite superior generoso para el nmero
medio de interacciones interatmicas por segundo por
tomo, y 1.018 segundos (cerca de 30.000 millones de
aos) como un lmite superior para la edad del univer
so. Entonces, obtenemos 10.110 como un lmite supe
rior m uy generoso del nm ero total de interacciones
interatmicas que pudieron haber ocurrido durante la
larga historia csmica postulada por los evolucionistas.
Si a continuacin suponemos que cada interaccin in
teratmica produce siempre una molcula nica (supo
sicin sumamente generosa), llegamos a la conclusin
de que pudieron haber existido en el universo durante
toda su historia no ms de 10.110 molculas nicas.
Consideremos ahora las implicaciones de exigir que
un proceso puramente aleatorio produzca el conjunto
mnimo de aproximadamente 1.000 molculas de pro
tena necesarias para la forma de vida ms primitiva. Para
simplificar drsticamente el problema, supongamos que,
de algn modo, ya hemos encontrado 999 de las 1.000
protenas diferentes requeridas y necesitamos solamen
te una secuencia mgica final de aminocidos, que nos
dar esa ltima protena especial. Restrinjamos nuestra
consideracin al conjunto especfico de 20 aminocidos
que forman parte de los sistemas vivos, y hagamos caso
omiso de los cientos que no forman parte de la vida.
Ignoremos tambin el hecho de que solo aquellos con
simetra izquierda (L) aparecen en las protenas de los
seres vivos. Ignoremos tambin la increblemente desfa
vorable cintica de las reacciones qumicas implicadas en
la formacin de cadenas peptdicas largas en cualquier
tipo de ambiente qumico inanimado plausible.
Concentrmonos, simplemente, en la tarea de obte
ner una secuencia apropiada de aminocidos que pro
duzca una estructura proteica 3D con un grado mnimo
de funcionalidad. Evidencias tericas y experimentales
- sj w im ;

indican que, como promedio, deben ser especificadas


con precisin la mitad de las posiciones de los amino
cidos. Para una protena relativamente pequea que
conste de una cadena de 200 aminocidos, el nmero
de intentos necesarios para obtener una probabilidad
razonable de aceitar una secuencia til es del orden de
20.100 (100 hipares posibles con 20 candidatos para
cada sitio) o, aproximadamente, 10.130 intentos. Esto
es cien (nilones de veces el lmite superior que habamos
calculado para el nmero total de molculas que han po
dido existir en la historia del cosmos!! Entonces, si no se
puede esperar obtener, de ningn proceso aleatorio, ni
siquiera la estructura de una protena sencilla como la
del ejemplo, mucho menos se podr obtener el conjunto
completo de cerca de 1.000 protenas, necesarias para las
formas de vida ms simples. Por lo tanto, es una irracio
nalidad absoluta que una persona crea que las interac
ciones qumicas aleatorias pudieron alguna vez dar lugar
a un conjunto viable de protenas funcionales, frente la
asombrosa cantidad de alternativas posibles.
Ante tales probabilidades extremadamente desfavo
rables, cmo puede un cientfico con algn sentido
de la honestidad apelar a interacciones aleatorias para
explicar la complejidad que observamos en los sistemas
vivientes? Hacer esto, teniendo conocimiento cons
ciente de estos datos, representa en mi opinin una
grave falta de integridad cientfica. Esta lnea de argu
m ento se aplica, por supuesto, no solo a la abiognesis,
sino tambin a cmo podran surgir nuevos genes/pro-
tenas por alguna suerte de proceso de macroevolucin.
Un qumico colega, jubilado del Laboratorio N a
cional de Los lamos, objet mi argumento dicien
do que om it los detalles de la cintica de la reaccin
qumica. M i intencin fue escoger deliberadamente
una velocidad de reaccin tan gigantesca (un billn de
reacciones por tomo por segundo, como media) que

186
CIENTIFICOS NO EVOLUCIONISTAS

cualquier consideracin de ese tipo sera completamen


te irrelevante. Cmo puede una persona razonable,
entrenada en Qum ica o Fsica, imaginar que hay un
modo de armar polipptidos del orden de cientos de
unidades de aminocidos de longitud, de permitirles
plegarse en sus estructuras tridimensionales y de ex
presar sus propiedades nicas, todo dentro de una pe
quea fraccin de un picoscgundo!? Los compromisos
metafisicos anteriores lo forzaron a tal irracionalidad.
Otro cientfico, un fsico en los Laboratorios Nacionales
Sandia, afirm que yo haba empleado mal las reglas de la
probabilidad en mi anlisis. Si mi ejemplo fuera correcto,
sugiri, revolucionara el mundo cientfico. Le respond que
la comunidad cien tfica haba sido confrontada con este ar
gumento bsico en el pasado, pero que, simplemente, se
comprometieron en una negacin masiva. Fred Hoyle, el
eminente cosmlogo britnico, public clculos similares
hace dos dcadas. La mayora de los cientficos se colocaron
las manos sobre las orejas y se negaron a escuchar.8

Baumgardner contina:

Uno de los descubrimientos ms dramticos de


la Biologa del siglo XX es que los seres vivos son la
materializacin de estructuras expresadas en lenguaje
codificado. Toda la detallada complejidad qumica y
estructural asociada con el metabolismo, la reparacin,
el funcionamiento especializado y la reproduccin de
cada clula viva es la materializacin de algoritmos co
dificados almacenados en su A D N . Esto nos conduce a
una cuestin primordial: de dnde surgieron las largas
y complejas cadenas de informacin tipo lenguaje que
codifican las estructuras y funciones celulares?

8John R. Baumgardner, ibd., pp. 223-226.

197
PC

Este es, por supuesto, un aspecto central en la cues


tin del origen de la vida. Las bacterias ms simples
tienen genomas que constan de cerca de un milln de
codones (cada codn, o palabra gentica, consta de tres
letras del alfabeto gentico de cuatro letras). Estos al
goritmos codificados de un milln de palabras de lon
gitud pueden surgir espontneamente por medio de
algn proceso natural conocido? Hay algo en las leyes
de la fsica que sugiera de qu forma pueden aparecer
tales cadenas de informacin de modo espontneo? La
respuesta franca es simple: nuestros conocimientos de
termodinmica y de teora de la informacin argumen
tan persuasivamente que ni lo hacen ni pueden hacerlo.
El lenguaje implica un cdigo simblico, un vo
cabulario, y un conjunto de reglas gramaticales para
transm itir o registrar el pensamiento. Muchos de no
sotros pasamos la mayora de nuestras horas de vigilia
generando, procesando o difundiendo datos lingsti
cos. Rara vez reflexionamos sobre el hecho de que las
estructuras del lenguaje son claras manifestaciones de
una realidad inmaterial.
Esta conclusin se alcanza al observar que la infor
macin lingstica, en s misma, es independiente de su
soporte material. El significado o mensaje no depende
de si se representa como ondas de sonido en el aire,
patrones de tinta sobre papel, dominios magnticos ali
neados sobre un disco flexible o patrones de voltaje en
una red de transistores. El mensaje de que una persona
ha ganado 100.000 millones de dlares en la lotera es
el mismo ya sea que esa persona reciba la informacin
de alguien que llama a su puerta, por telfono, por co
rreo, en la televisin o en Internet.
De hecho, Einstein sealaba a la naturaleza y al
origen de la informacin simblica como una de las
cuestiones profundas acerca del m undo tal como lo co
nocemos. El no fue capaz de identificar ningn medio
CIENTFICOS NO EVOi. UCIONISTAS

por el que la materia pudiera otorgar significado a los


smbolos. La clara implicancia de este hecho es que la
informacin simblica, o lenguaje, representa una cate
gora de realidad distinta de la materia y de la energa.
Los lingistas se refieren a esta Actualmente, en nuestra
era de la informacin, nadie discute que la informacin
lingstica es objetivamente real, pero con solo reflexio
nar un m om ento llegamos a la conclusin de que, ade
ms, su realidad es cualitativamente diferente de la del
sustrato material/energtico que almacena, transporta
o transmite esa informacin lingstica.
Dnde se origina, entonces, la informacin lings
tica? En nuestra experiencia humana, conectamos inme
diatamente el lenguaje que creamos y procesamos con
nuestras mentes. Pero cul es la naturaleza de la mente
humana? Algo tan real como la informacin lingstica
tiene existencia independiente de la materia y la energa;
por lo tanto, si tenemos en cuenta consideraciones cau
sales, no es irracional sospechar que una entidad capaz
de crear informacin lingstica tambin sea, en ltima
instancia, no material en su naturaleza esencial.
La conclusin inmediata de estas observaciones con
respecto a la informacin lingstica es que el materialis
mo -q u e durante mucho tiempo ha sido la perspectiva
filosfica dominante en los crculos cientficos, y con
su presuposicin fundamental de que no existe ninguna
realidad no material, es simple y claramente falso. Resul
ta asombroso que esta falsedad sea tan trivial.
Las implicancias son tambin inmediatas cuando
hablamos de evol ucin. La suposicin evolutiva de que
existe una explicacin materialista para las extremada
m ente complicadas estructuras lingsticas que consti
tuyen los planos de construccin, para los manuales de
operacin y para los sofisticados mecanismos retroali-
mentados de control de la compleja nanomaquinaria
qumica presente incluso en el ser vivo ms simple, es

199
EVOLUCIN IMPOSIBLE

bsicamente errnea. Pero, entonces, cmo se expli


ca la existencia de este lenguaje simblico que se erige
como el ingrediente crucial por el que todos los seres
vivos se desarrollan, Funcionan y manifiestan sus asom
brosas capacidades? La respuesta es obvia: se requiere
indiscutiblemente un Creador Inteligente.
Y qu pasa con la macroevolucin? Los procesos fsi
cos de la esfera de la materia y la energa, son capaces de, al
menos, modificar una estructura preexistente de lenguaje
gentico para producir otra con alguna novedad significa
tiva, como tan desesperadamente quieren creer los evolu
cionistas? Sobre esta pregunta, el Prof. Murray Edn, un
especialista en Teora de la Informacin y Lenguas Forma
les del Instituto de Tecnologa de Massachusetts (MIT),
afirm hace varios aos que las modificaciones aleatorias
de estructuras formales del lenguaje no logran tales haza
as mgicas. En sus propias palabras: Ningn lenguaje
formal existente en la actualidad puede tolerar cambios
aleatorios en la secuencia de los smbolos que expresan sus
oraciones. El significado se destruir casi con toda seguri
dad. Cualquier cambio debera ser sintcticamente legal.
En mi opinin, lo que uno podra llamar gramaticalidad
gentica tiene una explicacin determinista, y no debe
su estabilidad a la presin de la seleccin actuando sobre
variaciones aleatorias.
En resumidas cuentas, la respuesta es: No. Los cam
bios aleatorios en las letras del alfabeto gentico no tie
nen ms capacidad de producir nuevas estructuras pro
teicas tiles que la generacin de cadenas aleatorias de
aminocidos discutida en la seccin anterior. Esta es la
evidente deficiencia de cualquier mecanismo materialis
ta propuesto para explicar la macroevolucin. La vida
depende de complejas estructuras de lenguaje no mate
rial, que especifican detalladamente su forma y funcio
namiento. Los procesos materiales son completamente
incapaces de crear tales estructuras o modificarlas para
determinar nuevas funciones. Si la tarea de crear los cer
ca de 1.000 genes necesarios para definir la maquina
ria celular de una bacteria es inimaginable dentro de un
marco materialista, considere cunto ms inimaginable
es para el materialista la tarea de obtener los cerca de
100.000 genes requeridos para definir a un mamfero!
A pesar de los millones de pginas de publicaciones
evolucionistas -desde artculos cientficos en revistas
especializadas y libros de texto, hasta publicaciones de
divulgacin- que asumen que los procesos materiales
son completamente capaces de lograr el milagro de la
macroevolucin, no hay ninguna base racional para tal
creencia. Es una completa fantasa. Las estructuras de
lenguaje codificado son no materiales en su naturaleza
y, por lo tanto, requieren una explicacin no material.'

Esta es solamente una pequea muestra de los escritos de


algunos de los cientficos que participaron como autores en el
libro In Six D ays... (En seis das...). Otros exponen sus objecio
nes a la evolucin en sus pginas web. Por ejemplo, el 1)r. Robert
H errm ann, ex profesor de Matemticas de la Academia Naval
de los Estados Unidos, presenta algunos argumentos cientficos
m uy detallados contra la evolucin y en favor de una creacin
reciente.910 Algunos cientficos se han tom ado incluso el tiempo
para escribir libros enteros sobre las evidencias cientficas que
refutan la evolucin:
John Sanford, al que ya hemos citado en captulos previos,
tiene un doctorado en Gentica Vegetal de la Universidad de
Wisconsin, en Madison, y se desempe como profesor adjun
to en la Universidad Cornell durante ms de veinte aos. A su
vez, es famoso por coinventar la pistola de genes que inici la
ingeniera gentica. En su libro Genetic Entropy and the Mys-

9Baumgardner, ibd., pp. 227-230.

10En lnea: www.uscrs.datareata.com/herrmann/main.html.


i IMPOSIBLE

tery o fth e Genome [La entropa gentica y el misterio del ge-


noma], el Dr. Sanford argumenta que las mutaciones no crean
informacin, como la Teora de la Evolucin requiere, sino que
arruinan consistentemente la informacin gentica. Proporcio
na poderosas evidencias tericas de que los genomas no pueden
evolucionar ascendiendo en el rbol evolutivo, y refuta as la
premisa de que las diferentes formas de vida son, simplemente,
resultado de mutaciones y seleccin natural. Basndose sobre
rigurosos estudios cientficos y modelos matemticos, Sanford
argumenta que el A D N debe tener menos de 100.000 aos.11
Walter J. Veith, doctor en Zoologa por la Universidad de Cape
Town y ex jefe del Departamento de Zoologa en la Universidad
de Western Cape, Sudfrica, escribi el libro The Gnesis Conflict:
Putting the Pieces Together [El conflicto del Gnesis: Juntando las
piezas]. Esta obra muestra de qu modo el registro fsil no apoya
la Teora de la Evolucin, y recoge numerosos descubrimientos
modernos en Biologa y Zoologa que respaldan la Creacin.112
Duane T. Gish, doctor en Bioqumica por la Universidad de
California, en Berkcley, trabaj durante aos en investigacin
bioqumica mdica en las Universidades de California y de
Cornell. En sus libros Evolution: The Fossils Say No! [Evolucin:
Los fsiles dicen: No!] y Evolution: The Challenge o fth e Fossil
Record [Evolucin: El desafo del registro fsil], argumenta que
la falta de intermediarios evolutivos supone una evidencia feha
ciente de que la evolucin no ha ocurrido.13
George Javor es profesor de Bioqumica en la Escuela de Me
dicina de la Universidad de Loma Linda y tiene un doctorado

11 J. C. Sanford, Genetic Entropy & the Mystery ofthe Genome (Waterloo, NY: FMS Pu-
blications, 2008).

12W. J. Veith, The Gnesis Conflict: Putting the Pieces Together (Delta, BC, Caada: Ama-
zing Discoveries, 2002).

13 D. T. Gish, Evolution: The Fossils Say No! (San Diego, CA: Creation-Life Publishers,
1976); y D. T. Gish, Evolution: The Challenge ofthe Fossil Record (El Cajn, CA: Crea-
tion-Life Publishers, 1986).
O tN !'l 'K ;S NO J. ! CONISTAS

en Bioqumica por la Universidad de Columbia. Escribi el


libro Evidences fo r Creation: N atural Mysteries Evolution Can-
not Explain [Evidencias para la creacin: Misterios naturales
que la evolucin no puede explicar]. En esta obra, el Dr. Javor
explica cmo, desde una perspectiva bioqumica, la evolucin
es imposible.14
Coln W. Mitchell tiene un doctorado en Geografa por la Uni
versidad de Cambridge, y ejerci como consultor especialista
en el desarrollo de tierras ridas para los gobiernos de 16 pases.
En su libro The Casefo r Creationism [Argumentos para el crea
cionismo], examina concienzudamente las evidencias cientfi
cas procedentes de la biologa, la paleontologa, la geologa y la
datacin radiomtrica que refutan la evolucin.1516
Lee M. Spetner recibi su doctorado en Fsica en el prestigio
so Instituto de Tecnologa de Massachusetts (MIT), y ense
Teora de la Informacin y la Comunicacin en la l Jniversitlad
Johns Hopkins durante diez aos. El Dr. Spetner escribi No!
by Chance: Shattering the Modern Iheory <j Erolitlion |N<> por
casualidad: Demoliendo la teora moderna de la evolucin],
donde expone evidencias que refutan poderosamente el con
cepto evolutivo de que las mutaciones aleatorias pueden pro
ducir nueva informacin gentica.1'1
Andrew A. Snelling, doctor en Geologa por la Universidad do
Sdney y ya conocido por los lectores, ha escrito recientemente
una obra de 1.100 pginas en dos volmenes, titulada Earths
Catastrophic Past; Geology, Creation, and the Flood [El pasado
catastrfico de la Tierra; Geologa, Creacin y el d+iluvio].
Esta obra incluye referencias exhaustivas y recoge evidencias

14G. Javor, Evidences fo r Creation: Natural Mysteries Evolution Cannot Explain (Hagers-
town, MD: Review and Herald Publishing Association, 2005).

15 Coln W. Mitchell, The Case fo r Creationism (Alma Park, Grantham, England: Autumn
House, 1994).

16Lee M. Spetner. Not By Chance: Shattering the Modern Theory o f Evolution (New York:
Judaica Press. 1997 ).

273
0

geolgicas detalladas de eventos catastrficos recientes de tipo


inundacin global. Tambin incluye una explicacin detalla
da de los principales problemas relacionados con la datacin
radiomtrica, y presenta evidencias obtenidas por mtodos de
datacin alternativos que dan resultados de solo miles de aos
de antigedad para los materiales de la Tierra.17
Ariel A. Roth, que tambin ha sido citado en varias oportunida
des en captulos anteriores, tiene un doctorado en Zoologa de la
Universidad de Michigan, y desempe durante aos el puesto de
jefe de departamento y profesor de Biologa en la Universidad de
Loma Linda, en California. El Dr. Roth escribi un libro titulado
Origins: Linking Science and Scripture [Orgenes: Relacionando las
ciencias y las Escrituras], que proporciona un resumen exhaustivo
de las evidencias cientficas que respaldan una creacin reciente y
un diluvio universal, en oposicin a la evolucin.18
Werner Gitt, doctor en Ingeniera por la Universidad Tcnica
de Aachen y director del Instituto Federal Alemn de Fsica
durante aos, es una autoridad en Teora de la Informacin.
En su libro In the Beginning Was Information [En el principio
fue la informacin], el Dr. Gitt discute cmo la Teora de la In
formacin refuta la evolucin. Presenta poderosos argumentos
que explican por qu razn la informacin biolgica codificada
en molculas como el ADN no puede surgir por procesos alea
torios, sino que requiere un Creador inteligente.19
Andy M clntosh tiene un doctorado en Matemticas por la Uni
versidad de Gales, y fue profesor de Termodinmica y Teora de
la Combustin en la Universidad de Leeds. H a participado en
proyectos de diseo de reactores para aeronaves, y ha aplicado
estos conocimientos para analizar la complejidad del vuelo de

17A. A. Snelling, Earths Catastrophic Past: Geology, Creation & the Flood, Vols. 1, 2
(Dallas, TX: Institute for Creation Research, 2009).

18A. A. Roth, Origins: Linking Science and Scripture (Hagerstown, MD: Review and He-
rald Publishing Association, 1998).

19Werner Gitt, In the Beginning Was Information (Oreen Forest, AR: Master Books, 2006).
c e n t f i c o s n o e v o i. u c io n is t a s

los organismos vivos. Tambin es experto en el mecanismo de


defensa del escarabajo bombardero. En su libro Gnesisfor Today
[Gnesis para hoy], el Dr. Mclntosh presenta evidencias funda
mentales de orden y diseo en nuestro mundo, y argumenta que
existen evidencias cientficas muy poderosas a favor de la Crea
cin y del diluvio universal.20 En 2009, el Dr. Mclntosh public
un innovador trabajo de investigacin en la revista International
Journal ofDesign & Nature and Ecodynamics, en el que demuestra
que las estructuras biolgicas contienen instrucciones codificadas
que no estn definidas por la materia y la energa de las molculas
que portan esta informacin. Esto implica que la informacin
gentica requerida para codificar estructuras complejas como las
protenas requiere que dicha informacin provenga de una fuen
te externa, y no puede surgir de fuerzas ambientales de la natura
leza. La informacin tiene una naturaleza no material, y no pue
de surgir como resultado de una entrada de energa aleatoria.21
Este trabajo de investigacin proporciona un poderoso apoyo al
concepto de un Diseador sper inteligente externo, responsable
por la compleja informacin contenida en cada lipo de ser vivo.
John Hartnett posee un doctorado en f sica por la Universidad
de Australia Occidental, donde trabaja actualmente como profe
sor investigador de fsica. El 1)r. I lartnett ha escrito un libro que
ofrece una explicacin cientfica detallada de la paradoja de la luz
de las estrellas y el tiempo en un universo joven.22 Tambin ha
coescrito un libro que expone defectos y problemas importantes
de la teora del Big Bang.23

A. C. Mclntosh. Gnesis fo r Today: Showing the Relevance o fthe Creation/Evolution


Debate to Todays Society (Epsom, Surrey, England: Day One Publications, 1997).

21 Mclntosh, Information and Entropy - Top-Down or Bottom-Up Development in Living


Systems?, International Journal ofDesign & Nature atul Ecodynamics, vol. 4, N 4 (2009),
pp. 351-385.

22 J. Hartnett, Starlight, Time, and the New Physics (Eight Mile Plains, Queensland: Crea-
tion Book Publishers, 2007).

23 A. Williams y J. Hartnett, Dismantling the Big Bang (Creen Forest, AR: Master Books,
2005).
EV0LUC90 IPOSiBLi

Danny R. Faulkner, astrnomo diplomado por la Universidad


de Indiana, es profesor de Astronoma y Fsica en la Universi
dad de Carolina del Sur, en Lancaster. El Dr. Faulkner escribi
el libro Universe by Design [El universo por diseo], que argu
menta a favor de un universo creado.2425
El rechazo a la evolucin por parte de un creciente sector
de la com unidad cientfica no se aprecia solamente en pgi
nas web y publicaciones. M uchos cientficos estn exponiendo
pblicam ente sus opiniones sobre la incapacidad de la evolu
cin para explicar la complejidad de la vida, y la necesidad de
buscar modelos alternativos. El Dr. Richard E. Smalley, doctor
en Q um ica por la Universidad de Princeton, y laureado con
el Premio Nobel de Q um ica en 1996, expresaba su rechazo
a la evolucin y su respaldo a la narracin del Gnesis en sus
conferencias pblicas.23
Otros investigadores han explicado sus razones para rechazar
la Teora de la Evolucin en entrevistas personales: por ejemplo,
el Dr. M atti Leisola, decano de la Facultad de Ciencias Qumicas
y de los Materiales de la Universidad de Alto, Finlandia. El Dr.
David King, ex astrnomo del gobierno de Nueva Gales del Sur;
el Dr. Larry Thacte, investigador de Biologa Celular en la Uni
versidad Noroccidental de Chicago; el Dr. Ross Pettigrew, confe
renciante superior en la Escuela de Medicina en la Universidad
de Otago, en Nueva Zelanda; y el Dr. Stuart Burgess, profesor de
Diseo en Ingeniera en la Universidad de Bristol.26
Podra continuar alargando la lista, pero no creo que sea nece
sario, ya que mi intencin es, simplemente, demostrar que son
muchos los cientficos competentes y altamente calificados que
han declarado pblicamente y en detalle su rechazo de la Teora
de la Evolucin. Sus razones estn basadas sobre los resultados

24 D. R. Faulkner, Universe by Design (Green Forest. AR: Master Books, 2004).

25 Scholarship Convocation Speaker Challenges Scholars to Serve the Greater Good


(2004). En lnea: www.tuskegee.edu/Articles/scholarship_convocation_speaker_challen-
ges_scholars_to_serve_the_greater_good.aspx.

24 Para ms detalles y entrevistas con muchos otros cientficos, ver: www.creation.com.


CIENTIF COS NO EVOLUCIONISTAS

de sus propias investigaciones o en hallazgos reportados en la


literatura cientfica. En todos los casos, se trata de expertos in
vestigadores, acostumbrados a evaluar objetivamente los datos
cientficos. Despus de examinar concienzudamente las supues
tas evidencias de la evolucin, han llegado a la conclusin, desde
m uy distintos campos de estudio, de que las evidencias cientfi
cas no respaldan la teora. La vida no pudo aparecer espontnea
m ente por procesos naturales, y las mutaciones y la seleccin na
tural no tienen capacidad para producir nuevas formas de vida.
En 1999, la Academia Nacional de Ciencias de los Estados Uni
dos public una declaracin titulada Science and Creationism: A
View from the National Academy of Sciences, Second Edition
[Ciencia y creacionismo: Una visin de la Academia Nacional
de Ciencias, 2o edicin] ,27 En la pgina 28, la declaracin afirma
que el consenso cientfico sobre la evolucin es abrumador y que
ningn cientfico prominente la rechaza. Esta aseveracin es falsa.
Hemos mencionado numerosos cientficos ilustres que rechazan
la evolucin. Sin embargo, la mayora de los que apoyan la visin
convencional no son conscientes de la existencia de las obras men
cionadas en este captulo porque, generalmente, no se debaten en
las aulas de ciencia, ni se promocionan en los medios de comuni
cacin. La mayora de los cientficos que adhieren a la evolucin
trabajan en campos de investigacin muy especializados y basan
sus investigaciones sobre los resultados de investigaciones previas.
No se plantean que algunas de las suposiciones en las que se apoya
todo su campo de investigacin podran ser errneas. Profesores y
conferenciantes confan en las afirmaciones de los libros de texto,
sin ser conscientes de la gran cantidad de evidencias cientficas
que refutan la evolucin. En 2009, el Dr. Richard Dawkins es
cribi el libro The Greatest Show on Earth: The Evidence fo r Evo-
lution [El espectculo ms grande del mundo: Evidencias de la
evolucin], que recibi amplia promocin en libreras, y muchas

27 Science and Creationism: A View from the National Academy o f Sciences, 2a cd. (Was
hington, DC: National Academy Press, 1999). Ver: www.nap.edu/catalog/6024.html.

2 07
EVOLUCIN IMPOSIBLE

revisiones y crticas en todo tipo de publicaciones.2*28 Sin embar


go, la mayora de los cientficos y los profesores, probablemente,
no sean conscientes de que en 2010 el doctor Jonathan Sarfati,
qumico y experto en lgica, public una refutacin poderosa, y
exhaustivamente referenciada, de la mayora de las evidencias de
la evolucin de Dawkins.29
Es necesario que la comunidad cientfica y la poblacin en
general sean informadas de las graves deficiencias que presenta
la Teora de la Evolucin. Com o seal hace 25 aos el bilogo
molecular Michael D entn, la evolucin es una teora en crisis.

2SRichard Dawkins, The Greatest Show on Earth: The Evidence fo r Evolution (London:
Bantam Press, 2009).

29 J. Sarfati, The Greatest Hoax on Earth? Refiiting Dawkins on Evolution (Atlanta, GA:
Creation Book Publishers, 2010).

30 M. Dentn, Evolution: A Theory in Crisis (Bethesda, MD: Adler & Adler, 1986)

208
EVIDENCIAS DE LA
EXISTENCIA DE DIOS
UN DIOS QUE IN I ERVIENE EN LA HISTORIA F INI 'E FRACT IJA
CON LA ESPECIE HUMANA

n un captulo anterior me refer a la afirmacin del astr

E nom o britnico Sir Fred Hoyle de que abrumadoras evi


dencias procedentes de la fsica, la qumica y la biologa su
geran que un superintelecto ha intervenido en la naturaleza.1
El eminente historiador britnico H erbert Butterfield, que tra
baj como profesor de Historia M oderna en la Universidad de
Cambridge en los aos 50, hizo una observacin similar, sugi
riendo que podramos pensar que una inteligencia superior se ha
estado moviendo continuamente a lo largo de toda la historia.12

1Fred Hoyle, The Universe: Past and Present Reflections, Engineering and Science, vol.
45, N 2 (noviembre de 1981), pp. 8-12.

2 Herbert Butterfield, Christianity and History (London: Fontana Books, 1958), p. 143.
EVOLUCIN IMPOSIBLE

En este captulo, he decidido presentar algunas evidencias


que, en mi opinin, apoyan la existencia de una inteligencia so
brenatural, que no solo dise y cre la vida en la Tierra, sino
tambin interviene en la historia e interacta con la especie hum a
na. Algunos lectores se estarn preguntando qu hace este tipo
de material en un libro cuyo tema principal son las evidencias
cientficas en contra de la evolucin. La respuesta es simple: si,
como he intentado demostrar, la evolucin es imposible, y por
lo tanto falsa, es necesario buscar otro modelo para el origen del
universo, la Tierra y la vida.
De entre todas las posibles alternativas, yo personalmente me
decanto por la descrita en el relato bblico, tal como el lector
ya habr deducido. Esta narracin incluye la creacin reciente
de un m undo perfecto, donde la especie hum ana convivi en
arm ona con el resto de los animales y las plantas; y tam bin un
diluvio universal posterior, que destruy la vida y transform
drsticamente la superficie de la Tierra. Muchos de los cient
ficos que he citado en captulos anteriores tambin comparten
esta cosmovisin.
Las razones por las que creo literalmente en la historia bbli
ca, en lugar de aceptar otras posibilidades como la panspermia
(que propone que la vida lleg a nuestro planeta desde el espacio
exterior) o alguna versin de evolucin testa (en la que Dios
dirige la evolucin) son varias. Algunas son de carcter personal
y filosfico: mi visin de Dios como un ser personal que ama y
se preocupa por sus criaturas es incompatible con la idea de ese
mismo Dios que forja a dichas criaturas a travs de un proceso
de millones de aos de sufrimiento, muerte y lucha por la super
vivencia. Sin embargo, existen razones de carcter ms objetivo
que refuerzan mi confianza en la historia bblica, y esas razones
constituyen el lema de este captulo.
Ya hemos comentado anteriorm ente que existe m ultitud de
datos histricos extra bblicos que concucrdan con las narracio
nes del Gnesis, lo que confirma su veracidad. A continuacin,
vamos a comentar dos historias que encontramos en otro libro
de la Biblia, Daniel, que tam bin han sido corroboradas por

210
EVIDENCIAS DE LA EXISTENCIA DE DIOS

evidencias histricas, y que ilustran las dos tesis contenidas en el


ttulo de este captulo: que Dios interviene en la historia y que
interacta con los seres humanos.
La prim era historia se refiere a un sueo de Nabucodonosor,
registrado en el captulo 2 del libro de Daniel. Nabucodonosor
fue un rey del antiguo Imperio Babilnico, que recibe el crdito
de haber hecho construir los Jardines Colgantes de Babilonia,
una de las siete maravillas del m undo antiguo, para el disfru
te de su esposa, Amytis.3 En el ao 605 a.C., Nabucodonosor
derrot a los ejrcitos egipcios en la batalla de Karkemish, y
Jerusaln pas del control egipcio al control babilnico. Tras
este suceso, varios nobles hebreos fueron hechos prisioneros y
trasladados a Babilonia. Uno de estos cautivos era un joven par
ticularmente talentoso, llamado Daniel, quien ms tarde fue
consejero de Nabucodonosor y funcionario superior en la corte
del rey. Unos aos despus, Daniel registr el sueo del rey,
junto con otros eventos que incluyen la cada de Babilonia, en
el libro que lleva su nom bre y que lleg a formar parte de la
Biblia hebrea y, posteriorm ente, del Antiguo Testamento de la
Biblia cristiana.
Daniel describe que, una noche, Nabucodonosor tuvo un sue
o que lo atorment, pero que no poda recordar. Daniel y los
dems consejeros del rey fueron puestos bajo pena de muerte, a
menos que pudieran revelar el sueo. Daniel cuenta cmo or al
Dios que cre los cielos y la Tierra para que le revelara el sueo, y
describe la visin que recibi durante la noche. Cuando inform
sobre el sueo al rey, este confirm que eso era exactamente lo
que haba visto, y las vidas de los consejeros fueron perdonadas.
El sueo es realmente asombroso. Daniel vio la imagen de una
gran estatua con cabeza de oro, pecho de plata, estmago y mus
los de bronce, piernas de hierro y pies de hierro mezclado con
barro. Al final, una piedra no cortada por mano de hom bre
golpeaba los pies de la estatua y la haca caer, lo que la destrua

3 M. E. L. Mallowan, 'Babylon, Encyclopedia Britannica (Chicago, IL: Encyclopedia


Britannica Inc., 1967), t. 2, pp. 949-951.

O - 'i
EVOLUCIN !Mi 0811LE

por completo. Entonces, la piedra creca hasta transformarse en


una m ontaa que llenaba toda la Tierra.
A continuacin, Daniel explic al rey la interpretacin de todo
esto. Le dijo que el mismo Dios que le haba revelado el sueo
tambin le haba mostrado su significado. La estatua era una ima
gen de lo que sucedera en el futuro. La cabeza de oro represen
taba a Nabucodonosor y su reino, que sera seguido por otros de
menor esplendor, representados por el pecho de plata y el estma
go de bronce. Las piernas de hierro simbolizaban un reino muy
fuerte, que al final se dividira en varios ms dbiles, representados
por los pies de hierro y barro. Estos trataran de unirse, pero no lo
lograran. La piedra que destrua la estatua y se converta en una
montaa representaba el final de la Historia, cuando Dios destrui
ra los reinos terrenales y establecera un Reino eterno.
Segn Daniel, el sueo tuvo lugar en el segundo ao del rei
nado de Nabucodonosor, que corresponde aproximadamente al
ao 603 a.C. Aun as, predijo con exactitud asombrosa una serie
de eventos que sucedieron posteriormente y que llegan hasta el
presente, ms de 2.500 aos despus. Sabemos, por la historia,
que Babilonia cay frente a los medo-persas cuando el general
Gobrias tom la ciudad, el 12 de octubre del ao 539 a.C., des
pus de desviar el ro Eufrates, cuyo cauce pasaba por en medio
de la ciudad.4As, el Imperio Medo-persa correspondera al pecho
de plata. Este fue seguido por el imperio griego, que se estableci
cuando Alejandro Magno derrot al rey persa Daro III, en una
batalla cerca de Arbela, el 1 de octubre de 331 a.C. El Imperio
Griego, representado por el estmago y los muslos de bronce, fue
sustituido por el Imperio Romano a medida que los ejrcitos de
Roma conquistaban varias secciones entre los aos 168 y 30 a.C.,
cuando Egipto finalmente cay bajo su poder. As, el Imperio Ro
mano corresponde al reino representado por las piernas de hierro.
El Imperio Romano sucumbi gradualmente a olas sucesivas
de invasores brbaros. En el ao 476 d.C., los hrulos derroca

4 D. J. Wiseman. Belshazzar, Encyclopedia Britannica, t. 3. p. 458.

212
EVIDENCIAS DE LA DIOS

ron al ltimo emperador romano, Rmulo Augusto, y durante


el siguiente siglo y medio los ataques continuaron hasta que se
complet el proceso de invasin. Hoy, despus de casi 1.500
aos, el antiguo gran imperio que fue Roma permanece dividi
do, exactamente como se indic en el sueo.
Daniel predijo que los gobernantes de estos reinos menores se
mezclaran entre s por medio de m atrim onios, en un esfuerzo
por lograr la unin, pero que no lo conseguiran. A travs de los
siglos, ha habido repetidos intentos de unificar las naciones de
Europa con m atrimonios concertados y por medio del poder
militar, pero nunca se consigui una autntica unin duradera.
Carlomagno lo intent en el ao 800 d.C.; Carlos V de Espaa,
en 1520; y Napolen Bonaparte, en 1800. La persecucin de
una ambicin similar por el Kiser Guillermo II llev a Europa
a la Primera Guerra M undial, y la de Adolfo Hitler a la Segun
da. Muchos no consiguieron sus objetivos, y el xito de los que
lo hicieron fue relativamente efmero. Podemos concluir que el
sueo del rey babilnico revel con exactitud el futuro de Occi
dente hasta la poca actual.
Este es un ejemplo sorprendente de una visin detallada del fu
turo revelada con mucha antelacin. En mi opinin, predecir al
rededor del ao 600 a.C. que solo habra otros tres imperios en el
m undo conocido, a los que seguiran una serie de reinos separados
que nunca llegaran a unirse totalmente, y estar en lo correcto du
rante 2.500 aos, es un logro realmente impresionante. No se me
ocurre ningn medio por el cual Daniel por s solo pudiera haber
sabido lo que iba a ocurrir cientos de aos despus de su tiempo.
La fuente de tal informacin tiene que ser una Inteligencia supe
rior, capaz de ver y, probablemente, controlar el futuro. Siendo
que el mismo Daniel identifica a esta inteligencia como el Dios
que cre los cielos y la Tierra, parece razonable aceptar su palabra
y considerar al Dios de la Biblia como una entidad real capaz de
realizar grandes hazaas, y que adems decidi interactuar con los
seres humanos y comunicarles sus intenciones.
La segunda historia tambin se encuentra en el libro de D a
niel y registra detalladamente los eventos que tuvieron lugar la

213
EVOLUCIN IMPOSIBLE

noche de la cada de Babilonia. En esta ocasin el rey, que en


ese m om ento era Belsasar, estaba celebrando un banquete para
mil de sus nobles en el palacio. En medio de la juerga, una es
critura sobrenatural apareci en la pared del saln de banquetes.
El anciano Daniel, que haba servido como consejero de todos
los reyes desde Nabucodonosor, fue llamado por el rey para in
terpretar el escrito. Daniel ley el texto, y explic que era una
advertencia de parte de Dios de que el reinado de Belsasar termi
nara esa noche. Y as ocurri, dado que en pocas horas los persas
invadieron la ciudad, y el rey m uri asesinado, sin ver la luz de
un nuevo da. Es de este relato de donde procede la expresin
Est escrito en la pared, queriendo decir que no es posible
escapar de las consecuencias de un determinado suceso.
En esta ocasin, Dios se manifest no en un sueo a una per
sona en particular, sino de manera sobrenatural ante cientos de
personas. Y una vez ms Daniel recibi informacin privilegiada
de parte de Dios, y predijo con todo detalle lo que iba a ocurrir;
esta vez, en el futuro inmediato. Algunas personas escpticas han
sugerido que las historias registradas en el libro de Daniel nunca
ocurrieron, o que el relato se escribi con posterioridad, despus
de que gran parte de los sucesos de la profeca ya se hubiesen
cumplido. Hasta el siglo XIX, el nombre del rey Belsasar no
haba sido encontrado en ningn escrito, aparte del libro de D a
niel, por lo que los eruditos dudaban de la exactitud histrica
del relato. Sin embargo, a partir de 1860 se descubri un gran
nm ero de textos cuneiformes que confirmaron que Belsasar,
corregente con su padre, Nabonidus, era el rey de Babilonia
cuando el general persa Gobrias tom la ciudad sin resistencia.55
U n detalle curioso es que el antiguo historiador griego Jenofonte
cuenta el m odo en que el impo rey de Babilonia fue asesinado al
pie de su trono, en el saln de banquetes, cuando Gobrias entr
en el palacio, pero no menciona el nom bre del rey en toda la na
rracin. Jenofonte tam bin relata que, la noche en que los persas5

5 Ibd.
EVIDENCIAS DE LA EXISTENCIA DE DIOS

tom aron la ciudad, se estaba celebrando una gran fiesta durante


la cual toda Babilonia beba y disfrutaba de la juerga.6 Estos es
critos independientes respaldan la exactitud de la descripcin de
los eventos registrados en el libro de Daniel.
Tambin hay evidencias de que, definitivamente, el libro de
Daniel exista antes del ao 332 a.C., cuando Alejandro Magno
invadi Jud. Josefo, historiador romano del siglo primero, es
cribe que cuando los ejrcitos de Alejandro se estaban acercando
a Jerusaln, el sumo sacerdote de aquel entonces, Jaddua, or al
Dios del cielo pidiendo proteccin para la ciudad, lisa noche,
so que los sacerdotes deban llevar puestas sus prendas de ves
tir sacerdotales, abrir las puertas y salir decididamente, seguidos
por el pueblo, para encontrarse con Alejandro. As lo hicieron.
Al verlos, Alejandro desmont de su caballo y se inclin ante
ellos. Cuando se le pregunt despus por qu haba hecho eso,
respondi que en su juventud haba tenido un sueo en el que
un hom bre vestido con idnticas prendas sacerdotales lo haba
invitado a ir a Asia, garantizndole la conquista. Josefo escri
be que, cuando Alejandro entr en la ciudad, los sacerdotes le
m ostraron el libro de Daniel, que contena la descripcin de un
griego que llegara y destruira a los persas.7 Por consiguiente,
los judos fueron tratados muy favorablemente por Alejandro.8
El libro de Daniel es otra muestra de que podemos encon
trar informacin histrica fiable en las narraciones bblicas; pero
tambin nos sugiere que la Biblia es mucho ms que un libro de
historia. Las profecas que se han cumplido con extraordinaria
exactitud nos dicen que la Biblia no tiene un origen plenamente
hum ano, y nos animan a confiar no solo en el Libro, sino tam
bin en su Autor. Cuando Dios dice algo, se cumple. La Biblia
describe a Dios como un Ser atemporal, todopoderoso y om

6 Cyropaedia, Book vii, pp. 5, 10. 13, 15, 16, 26-30.

7 Para detalles de otra visin del futuro registrada por Daniel, ver: Daniel 8:7. 20. 21.

8Flavius Joseplnis, T he Antiquities of the Jews.Book 11, cap. 8, en: W. Whiston, ed The
Complete Works o f the Learned and Authentic Jewish Historian Flavius Josephus (Lon-
don: J. F. Tallis, sin fecha), pp. 237, 238.

r :
EVOLUCIN IMPOSIBLE

nisciente, que tiene la historia de la hum anidad bajo su control


desde el principio y que, en ocasiones puntuales como en el caso
del diluvio o en otros m omentos (ver, por ej., Josu 6; 2 Reyes
6; 7), interviene de forma sobrenatural cambiando el curso de
los acontecimientos.
Sin embargo, el Dios de la Biblia no se comunica solo con los
reyes y los gobernantes de los grandes imperios, y no interviene
en la vida humana solo cuando se trata de eventos de envergadura
mundial. La Biblia describe a Dios como un Ser cercano, que se
preocupa de manera especial por cada uno de los seres humanos
que habitan la Tierra, y que se describe a s mismo como un Padre
amoroso, que desea tener una relacin personal con cada uno de
ellos. En la Biblia encontramos decenas de historias que describen
cmo Dios acta en las vidas de las personas para protegerlas y
ayudarlas en situaciones difciles, a veces en respuesta a una pe
ticin directa; otras, sin necesidad siquiera de que se lo soliciten.
Muchas de estas intervenciones divinas incluyen algn elemento
sobrenatural o inexplicable, y son normalmente conocidas como
milagros. El mismo Daniel experiment uno de estos milagros,
tras ser traicionado por los otros ministros del reino a causa de
su integridad. Estos engaaron al rey Daro y consiguieron que
Daniel fuera condenado a morir en el foso de los leones. Pero,
durante la noche que pas en su interior rodeado de leones ham
brientos un ngel lo protegi, y los animales no lo tocaron. La
historia completa puede leerse en el captulo 6 del libro de Daniel.
Segn la Biblia, Dios no cambia (Malaquas 3:6). Es posi
ble que el Dios de la Biblia siga en la actualidad interviniendo
activamente en las vidas de las personas, incluso de forma mi
lagrosa? Yo personalmente creo que s, y a lo largo del tiempo
he escuchado numerosos testimonios de personas que afirman
haber experimentado milagros en algn m om ento de sus vidas.
Quiero term inar el captulo compartiendo dos de estas historias
que me llamaron poderosamente la atencin.
As como en el resto del libro he intentado en todo m om ento
presentar evidencias cientficas objetivas para reforzar mis ar
gumentos, en esta instancia reconozco que no poseo ese tipo
EVIDENCIAS DE LA EXISTENCIA DE DIOS

d e evidencias para esta seccin. Por eso, invito amablemente al


le c to r escptico convencido a que deje de leer en este punto y
pase directam ente al captulo siguiente. A los dems, quizs algo
de lo que encuentren a continuacin les pueda ser til, los haga
replantearse el tipo de Dios en el que creen o, incluso, los anime
a p e d ir ayuda a Dios cuando se encuentren ante una situacin
com plicada.
E n mi iglesia local, unas pocas semanas antes de escribir este
captulo, un hombre mayor cont una curiosa experiencia de su
niez. Tena aproximadamente seis aos, y estaba jugando con
sus primos en el hogar de sus abuelos. Su abuela estaba lavando
ro p a pero, de pronto, dej lo que estaba haciendo y fue corriendo
hacia donde l y los otros nios estaban jugando, con una cma
ra de rueda de tractor inflada. Asiendo la cmara, la abuela sali
corriendo calle abajo. Ms tarde, la abuela explic que mientras
estaba lavando la ropa, tuvo una visin sobre la superficie del agua
de que su marido se estaba ahogando. Sabiendo que el abuelo
haba ido a pescar a un arrecife que distaba aproximadamente dos
kilmetros de la casa, ella corri hasta el lugar con la rueda, y lo
encontr intentando nadar en un mar agitado que lo haba barri
do del arrecife. Lanz la cmara al agua y su esposo pudo m an
tenerse a flote hasta ser rescatado por unos pescadores cercanos.
La segunda historia me la cont una buena amiga, Joy Butler,
que trabaja como capelln en un hospital de Sdney. Joy y su m a
rido estuvieron trabajando en Harare, Zimbabue, durante varios
aos en la dcada de los 90. En esa poca, los robos de vehculos
eran habituales en esa zona y resultaba muy difcil recuperarlos,
porque los ladrones solan conducir inmediatamente a travs de
la frontera para venderlos en el pas vecino. Una amiga de Joy
que haba llegado a casa en su automvil con su hija de cinco
aos, sali del vehculo para abrir la puerta, dejando el m otor
encendido. Un individuo que estaba escondido detrs de un seto
salt al asiento del conductor y se march, con la nia todava
en el asiento trasero. La madre, desesperada, busc ayuda, pero
pas cierto tiempo hasta que consigui llamar la atencin de
otro conductor, explicarle lo que haba ocurrido y salir en per-

2
: IN

secucin del secuestrador. Sabiendo que era difcil que pudieran


alcanzarlo por sus propios medios, oraron a Dios pidiendo que
el automvil de la mujer se averiara. Unos pocos kilmetros ms
adelante, encontraron el automvil parado en medio de la ca
rretera, con la nia sana y salva en su interior. La nia les cont
que estaba suplicndole al ladrn que la llevara de regreso con su
mam, cuando vio aparecer un ngel sobre la parte delantera del
automvil, que atraves el cap con una espada larga y brillante.
El automvil se detuvo en el acto. Cuando ms tarde el vehculo
fue revisado, se descubri que el embrague haba fallado, a pesar
de que nunca antes haba tenido problemas de embrague.
En la Biblia, tanto el Antiguo Testamento como el Nuevo
Testamento registran narraciones de ngeles que intevienen en
las vidas de las personas. En particular, el libro de los Hechos
de los Apstoles, que est escrito como una narracin histrica
factual de la iglesia cristiana temprana, habla sobre varias in
tervenciones de ngeles. El libro es m uy exacto en sus detalles
geogrficos e histricos de ese perodo del siglo I, lo que sugiere
que los registros sobre los ngeles son igual de legtimos.
Usted puede decidir creer o no en la historia de Daniel, as
como las narraciones de la Creacin y el diluvio, los milagros, las
intervenciones de ngeles, o cualquiera del resto de las historias
que se encuentran en la Biblia. En este y en captulos anteriores,
he presentado numerosas evidencias de que la Biblia contiene in
formacin factual fiable, que ha sido confirmada por diferentes
fuentes extrabblicas; pero, al final, se trata de una decisin per
sonal.
A lo largo de este libro hemos visto, tambin, que hay muchas
cosas que la ciencia no puede explicar. N o existe una explicacin
mecanicista del origen del universo, ni del origen de la vida, ni
de dnde salieron las leyes de la fsica y la qumica, ni de cmo
apareci la informacin codificada en el AD N . A esta lista, po
dramos aadir los fenmenos sobrenaturales de los que hemos
hablado en este captulo y otras entidades que nos son bien co
nocidas, como la conciencia. De dnde sale el conocimiento
innato que tienen todas las personas de cualquier cultura de que
L 1 ; AH LA EXISTENCIA DE DIOS

hay ciertas cosas que no son correctas? La ciencia no puede ex


plicarlo. Sin embargo, la existencia de una Inteligencia sobrena
tural independiente del espacio y del tiempo, un Dios creador
del cielo y de la Tierra, que se preocupa por la hum anidad en
general y por cada persona en particular, que interviene en la
historia e interacta personalmente con aquellos que lo buscan,
ofrece una explicacin llena de significado no solo para todas
estas cuestiones, sino tambin para nuestra propia existencia.

219

~~
. ,. . , .

RESUMEN
DOCE RAZONES BASADAS EN EVIDENCIAS CIENTFICAS
PARA RECHAZAR LA EVOLUCIN

n febrero de 2010, el cientfico jefe del M inisterio de Edu

E cacin Israel, Dr. Gavriel Avital, provoc furor entre los


acadmicos universitarios locales cuando el peridico Haa-
retz inform que estaba anim ando a los estudiantes a examinar
de forma crtica las enseanzas evolucionistas que les eran im
puestas. Se lo cit diciendo:

Si los libros de texto plantean explcitamente que hay que


buscar los orgenes de los seres humanos en los monos, me gus
tara que los estudiantes exploraran otras opiniones. Hay muchas
personas que no creen que el relato evolucionista sea correcto.1

1O. Kashti y Z. Rinat, Education Ministry Chief Scientists Dismissive Remarles on Fun
damental Tenets of Science Spark Calis for His Ouster, Haaretz (21 de febrero de 2010).
En lnea: www.haaretz.com/print-edition/news/scientists-irate-after-top-educationoffi-
cial-questions-evolution-1.263673.
RESUMEN

En una entrevista anterior, Avital ya haba aadido lea al


fuego, al decir:

La Biologa, la ciencia ele la vida y del medio ambiente, es


otro campo cientfico problemtico. Cuando tu doctrina est
basada sobre la Teora ele la Evolucin de Darwin y sus implica
ciones, te ests sosteniendo sobre cimientos poco fiables.2

Estas declaraciones dieron lugar a peticiones para cpie el Dr.


Avital fuera depuesto, mientras varios acadmicos expresaban
indignacin o consternacin. U n profesor emrito de Ciencias
de la Tierra en la Universidad Hebrea dijo: Negar la evolucin
es como negar la ciencia misma.

O tro profesor de la Universidad de Tel Aviv afirm:

Estas declaraciones son el equivalente a decir que hay que darle


espacio en los libros de texto a la opinin de que la Tierra es pla
na y que el sol gira a su alrededor. Es asombroso que el cientfico
responsable de un Ministerio del gobierno pueda decir cosas tan
bizarras. 3

Estas reacciones no deberan sorprendernos. Si todos los


libros de texto de Biologa de todos los colegios y las univer
sidades ensean la Teora de la Evolucin; si las declaraciones
oficiales de la com unidad cientfica afirman que la evolucin es
un hecho indiscutible de la ciencia; y si los medios de comunica
cin se unen en la divulgacin de sus presupuestos y conclusio
nes sin el m enor asomo de duda, no es completamente lgico
que este funcionario del M inisterio de Educacin sea despedido
por atreverse a animar a los estudiantes a cuestionar esa teora?
Por qu debera ser tolerada una persona con semejantes ideas

2ibd.

3Ibd.
EVOLUCION r.

perturbadoras, en un puesto tan influyente que puede afectar la


educacin de los futuros cientficos de un pas desarrollado?
Asimismo, cabe tambin preguntarse por qu un cientfico ca
lificado, en un puesto de tanta responsabilidad, pondra en juego
su carrera haciendo declaraciones tan controvertidas y animando
a los estudiantes a buscar alternativas a la evolucin. Uno de los
propsitos de este libro ha sido presentar las evidencias que llevan a
cientficos honestos como el Dr. Avital a enfrentarse a la comunidad
cientfica y a rechazar la explicacin convencional del origen de la
vida, aun a riesgo de perder su prestigio y sus puestos de trabajo.
Los datos que he presentado no son exhaustivos. Existen ms
evidencias en contra de la evolucin y el modelo de largas eda
des, que se pueden encontrar explicadas con detalle en varios
sitios en Internet.4 N o obstante, creo que hemos presentado evi
dencias suficientes para rechazar objetivamente la Teora de la
Evolucin. Y quiero term inar este trabajo con una recopilacin
de 12 razones concretas que constituyen un resumen de todo lo
expuesto en los captulos anteriores.

1. Las mutaciones no producen nueva informacin gentica


significativa.
2. Nunca se ha observado la evolucin de una nueva especie
como consecuencia del surgimiento de informacin gentica nueva.
3. No hay ningn mecanismo demostrado que explique de
qu modo podra aparecer nueva informacin gentica signifi
cativa a partir de procesos naturales aleatorios; y adems, resulta
estadsticamente imposible.
4. No hay ningn mecanismo conocido, fctico o terico, que
explique cmo podra formarse una clula viva a partir de mol
culas inanimadas (abiognesis). Tambin es estadsticamente im
posible.
5. La abiognesis nunca ha sido observada, y todos los experi
mentos para.iniciarla han fallado.

4 Ver: www.icr.org;www .creation.com ;www.answersingenesis.org; www.creationre-


search.org; www.discovery.org/csc;www.users.datarealm.com/herrmann/main.html.
RESUMEN

6. El registro fsil es un registro de extincin de animales y


plantas completamente formados, no un registro de la evolucin
de formas de vida.
7. Aunque, segn la Teora de la Evolucin, tienen que haber exis
tido millones de formas de transicin entre organismos, no existen
fsiles demostrados de organismos intermedios. El registro fsil no
muestra el esperado desarrollo progresivo de las novedades evolutivas.
8. Algunas de las rocas ms antiguas portadoras de fsiles con
tienen animales complejos completamente desarrollados, como
los trilobites, sin que se haya encontrado evidencias de sus su
puestos antepasados evolutivos.
9. Las tasas de erosin actuales son demasiado rpidas para
que los continentes y su contenido fsil puedan tener las edades
que se les asignan convencionalmente. Las estimaciones de an
tigedad obtenidas son demasiado cortas para que la evolucin
pudiera tener lugar.
10. Las cantidades de sedimentos ocenicos y materiales vol
cnicos presentes en la superficie del planeta no se corresponden
con las antigedades propuestas por los gelogos. Tambin en
este caso, los resultados de edades que se obtienen teniendo en
cuenta los datos reales son m ucho menores que el tiempo m ni
mo estimado necesario para la evolucin biolgica.
11. Las dataciones radiomtricas no son fiables puesto que,
con frecuencia, arrojan resultados anmalos, como edades muy
antiguas para rocas recientes, o resultados dispares para la misma
muestra datada con distintos mtodos. Adems, la presencia de
carbono 14 en carbn y diamantes implica que dichos materia
les, supuestamente de millones de aos de antigedad, tienen en
realidad menos de 100.000 aos.
12. La velocidad de mutacin del A D N observada en la actua
lidad sugiere tambin una antigedad de menos de 100.000 aos.

La conclusin es evidente: la evolucin es imposible, y nunca


ocurri!
Por supuesto, sera impensable plantear estas objeciones con
tra la evolucin en una revista cientfica. Simplemente, inten-
LTAL A- 3 tT

tarlo generara un escndalo y un rechazo similares a los que


experiment el Dr. Avital. De hecho, un artculo que publiqu
en la revista cientfica Chemistry in Australia, que llamaba la
atencin sobre algunas de las suposiciones no demostradas que
sostienen la Teora de la Evolucin, obtuvo una respuesta muy
hostil por parte de algunos cientficos.5 Es revelador, sin embar
go, que nadie refut mis argumentos por medio de evidencias
cientficas; se lim itaron a expresar su conmocin por el hecho de
que un artculo de esas caractersticas pudiera ser publicado en
una reputada revista cientfica. 6 Estos profesores me acusaron
de utilizar argumentos basados sobre una creencia religiosa, y no
sobre la ciencia. Este tipo de afirmacin se esgrime con frecuen
cia contra aquellos que rechazan la evolucin; pero creo que ha
quedado refutada con creces a lo largo de este libro. Es cierto
que tengo una creencia religiosa, pero los argumentos que he
utilizado con el fin de rebatir la evolucin proceden del anlisis
de datos cientficos. Todas las personas se ven influidas por sus
convicciones filosficas y sus creencias personales, a la hora de
tom ar decisiones en los distintos aspectos de la vida. Muchos
cientficos actuales se aferran desesperadamente a la Teora de la
Evolucin porque su concepcin materialista del universo no les
permite siquiera considerar otras opciones. En mi caso, despus
de comprobar repetidamente que la Teora de la Evolucin no
puede explicar la realidad que observo a m i alrededor, he podido
escoger un modelo alternativo coherente con los datos observa
dos, y que incluye la intervencin divina porque m i cosmovisin
no excluye a priori dicha posibilidad.
La restriccin mental que produce una concepcin puram en
te materialista del m undo impide a algunos cientficos seguir las
evidencias hacia donde estas apuntan. Lo hemos repetido hasta
la saciedad a lo largo del libro: para que la evolucin ocurra,

5 John Ashton, A Creationists View of the Intelligent Design Debate, Chemistry in Aus
tralia, vol. 74, N 3 (2007), pp. 19, 20.

6 Ver: C. Bamer-Kowollik, R. Brooks y A. Whittaker, Your say..., Chemistry in Austra


lia, vol. 74, N 4 (2007), pp. 2, 29.
RESUMEN

para que la rana se convierta en prncipe, una enorme cantidad


de informacin gentica nueva tiene que aparecer como por arte
de magia. En el popular cuento de hadas, el milagro ocurre ins
tantneam ente en respuesta al beso de la doncella. En el cuento
de la evolucin, demora m ucho ms tiempo, cientos de millones
de aos; pero alargar el tiempo no lo hace menos milagroso.
Los procesos aleatorios de la naturaleza no pueden proporcionar
el beso transform ador (la informacin gentica nueva que per
m itira convertir un anfibio anuro en un ser hum ano de sangre
azul), incluso contando con eones de tiempo. Com o seala el
eminente cientfico y escritor Paul Davies, la informacin bio
lgica no est codificada en las leyes de la qumica y la fsica,
y esta informacin no puede llegar a existir espontneamente.
En sus propias palabras: N o existe ley fsica conocida capaz de
crear informacin de la nada.7 La evolucin es, pues, una teora
deseo, no m uy distinta de un cuento de hadas, pero que se alza
como nica alternativa posible para los cientficos que desean
m antener un modelo puram ente mecanicista de la existencia.
La evidencia geolgica y paleontolgica es consistente con
una inundacin de gran envergadura, acompaada de actividad
volcnica y tectnica, en un pasado reciente. La ciencia no pue
de explicar el origen de los seres vivos, pero encontramos abru
madoras evidencias de diseo en todos los rincones de la natura
leza, que parecen provenir de una asombrosa Superinteligencia.
El escenario de Creacin-diluvio de la Biblia se adeca m uy bien
a estas evidencias. Sin embargo, quedan en el aire dudas im por
tantes. Algunos lectores se estarn preguntando: Y qu hay de
todo el dolor y el sufrimiento que vemos a nuestro alrededor?
Cmo puede formar parte de la creacin perfecta de un Dios
bueno y todopoderoso? La mayora de nosotros lidiamos con esa
pregunta alguna vez.8 A lo largo de este libro, hemos llegado a

1 Paul Davies, Life Forc, New Scientist (18 de septiembre de 1999), pp. 27-30.

8Ver, por ej., J. Paulien, The Problem of Evil, en: John Ashton y Michael Westacott, ed.,
The BigArgument: Does God Exist? (Oreen Forest, AR: Master Books, 2006), pp. 179-196.
EVtHUClOhlffvSf-5' ? -

la conclusin de que la Biblia es una fuente fiable de informa


cin, por lo que probablemente es tambin un buen lugar para
buscar respuestas. En la Biblia, Dios nos cuenta que la Tierra y
el universo fueron creados en seis das literales hace aproxima
damente 6.000 aos (Gnesis 1:1-2:1). El resultado era muy
bueno, pero poco despus las cosas se torcieron y se alejaron
progresivamente del plan original de Dios. El ser hum ano uti
liz su libre albedro para alejarse de su Creador (Gnesis 3), y
como consecuencia, la naturaleza se corrompi y la violencia se
multiplic sobre la Tierra. La situacin de perversidad extrema
condujo a la destruccin de la hum anidad y de la mayor parte
de la vida sobre la Tierra por medio de un diluvio universal, hace
aproximadamente 4.300 aos (Gnesis 6:5-7:24).9 Afortunada
mente, Dios tena un plan de rescate preparado (Efesios 1:4-10;
1 Pedro 1:20), que se puso en marcha en el propio Jardn del
Edn (Gnesis 3:15) y cuyo desarrollo se pone de manifiesto a
travs de toda la Biblia.
La hum anidad fue creada a imagen de nuestro Dios Creador
sperinteligente (Gnesis 1:26, 27). A pesar de la degeneracin
sufrida a lo largo de miles de aos, esa imagen todava se encuen
tra presente en nosotros. Por eso, nuestras mentes tienen la habi
lidad de descubrir y comprender los asombrosos misterios de la
naturaleza. No evolucionamos de los monos: somos mucho ms
especiales que eso. M uy lejos de nuestro presunto origen prima
te, hemos sido dotados de capacidades asombrosas, reflejo de las
ilimitadas cualidades de nuestro Creador. Podemos usar nuestros
conocimientos y capacidades para mejorar nuestra vida y nuestro
entorno, sabiendo que nuestra existencia tiene sentido, que no
somos producto del azar sino de un cuidadoso plan de amor, cuyo
desenlace est prximo. Se trata de una existencia con trascendencia
y propsito, y la promesa de un futuro eterno sin dolor, injusticia
ni muerte. No restrinjamos nuestro acceso a estos maravillosos
dones en favor de una teora imposible.

9 Para el clculo de la fecha aproximada del diluvio, ver el Apndice.

226
CALCULO DE LAS FECHAS
APROXIMADAS PARA LA
CREACIN Y EL DILUVIO,
EMPLEANDO DATOS DEL
REGISTRO BBLICO

l captulo 5 del Gnesis registra cuntos aos tena cada pa

E triarca cuando tuvieron hijos: Adn, 130; Set, 105; Ens,


90; Cainn, 70; Mahalaleel, 65; Jared, 162; Enoc, 65; M a
tusaln, 187; Lamec, 182.
A su vez, en el momento del diluvio No tena 600 aos. Su
mando estos datos, se llega a un total de 1.656 aos desde la Crea
cin hasta el diluvio (Aclaracin: estas edades pueden ser de 1 ao
ms para cada uno de los diez patriarcas, dependiendo de si fue
ron padres justo antes o justo despus de su fecha de cumpleaos.
Es decir, 1.656 es el nmero mnimo de aos, y 1.666 el mximo,
estando el valor exacto en algn lugar entre ambos.)
Gnesis 11:10 al 25 registra la edad a la que procrearon los pa
triarcas posdiluvianos: Sem, 2 aos despus del diluvio; Arfaxad,
a los 35 aos; Sala, a los 30; Heber, a los 34; Peleg, a los 30; Reu, a
los 32; Serug, a los 30; Nacor, a los 29; Tar, a los 130 (muri con
205 aos, cuando Abraham tena 75, Gn. 11:32; 12:4). Abra-
ham dej Harn a los 75 aos, e hizo un pacto con Dios (Gn.
12:4). Sumando estos aos, obtenemos un total de 427 desde el
diluvio hasta el pacto de Dios con Abraham. Igual que en el clcu
lo anterior, el total podra aumentar hasta en diez aos, por lo que
nos encontramos ante un nmero mximo de 437.
Las fechas aproximadas para el diluvio y la Creacin se pue
den calcular usando como referencia la fecha del cuarto ao del
reinado de Salomn, que se considera que fue el ao 967 a.C.
El Exodo ocurri 479 aos antes, es decir, en 1446 a.C. (1 Rey.
6:1). El pacto con Abraham tuvo lugar 430 antes del Exodo
(Exo. 12: 40-4 1; Gl. 3:16-17). Siendo que el pacto con Abra
ham fue 427 aos despus del diluvio, el tiempo transcurrido
entre el diluvio y el Exodo fue de 857 aos.
Por lo tanto, el diluvio ocurri en 1.446 + 857 = 2.303 aos a. C..
La Creacin en 2.303 + 1 .6 5 6 = 3 .9 5 9 aos a.C. (aproximadamente).

Nota 1: Segn Ussher, el cuarto ao del reinado de Salomn


fue en 1012 a.C., 45 aos antes de la fecha actualmente asignada
a este evento. Por tanto, la fecha de Ussher para la Creacin sera
4004 a.C. - 45 = 3959 a.C. Los clculos mostrados en este apn
dice son consistentes con los clculos de Ussher, pero dependen de
la exactitud de la fecha histrica para el cuarto ao de Salomn.
Nota 2: El margen de incertidumbre para la fecha del diluvio
sera de 10 aos y, en el caso de la Creacin, de 20. Es decir, el
diluvio pudo haber ocurrido hasta 10 aos antes de 2303 a.C. y
la Creacin hasta 20 aos antes de 3959 a.C.
EVOLUCION
IMPOSIBLE
D [i I na de las refutaciones actuales ala evolucin ms po-
I derosay autorizada!
I V v Usando recientes descubrimientos en gentica, bio
qumica, geologa, datacin radiomtrica y otras disciplinas cien
tficas, el Dr. John Ashton explica captulo por captulo, en un
lenguaje sencillo, doce poderosas razones por las que laTeora de la
Evolucin de Darwin es solo un mito. Aprenda:

Cmo losfsilessonevidencias deextincin, no deevolucin.


Por qulasmutacionesnuncaproduceninformacingenticanueva.
Cmo losdatosgeolgicos minan lasescalasdetiempo seculares.
Por qu no pueden formarsepor azar clulasvivasy nuevas especies
deorganismos.

Llevando lasevidencias que refutan laevolucin aun nuevo nivel,


con anlisis detallados y datos procedentes de una gran variedad de
fuentes, esteesun libro delecturaobligatoriaparaestudiantes, educa
dores cristianos, cientficos y todos aquellos que quieren comprome
tersecon lacosmovisin bblica respecto delos orgenes.

SOBRE ELAUTOR
EL DR. JOHN F. ASHTON LLEVA CERCA DE CUARENTA AOS EN EL
CAMPO DE LA INVESTIGACIN CIENTfiCA Y DE LA ENSEANZA.
POPULAR EDITOR DE LIBROS CREACIONISTAS, TRABAJA COMO
PROFESOR ADJUNTO DE CIENCIAS BIOMDICAS Y CIENCIAS APLI
CADAS EN MELBOURNE, AUSTRALIA.

C j 9 7 8 9 8 7 7 lio 1 4 4