Trabajo 2

http://funpecrp.com.br/gmr/year2003/vol1-2/sim0005_full_text.
htm
Mini Review
Operon mer: Bacterial resistance to mercury and

potential for bioremediation of contaminated
environments
Andra M.A. Nascimento and Edmar Chartone-Souza
Departamento de Biologia Geral, Instituto de Cincias Biolgicas,
Universidade Federal de Minas Gerais, Avenida Antnio Carlos, 6627,
31270-901 Belo Horizonte, MG, Brasil
Corresponding author: A.M.A. Nascimento
E-mail: amaral@icb.ufmg.br
Genet. Mol. Res. 2 (1): 92-101 (2003)
Received November 27, 2002
Published March 31, 2003
ABSTRACT. Mercury is present in the environment as a result of natural processes and from
anthropogenic sources. The amount of mercury mobilized and released into the biosphere has
increased since the beginning of the industrial age. Generally, mercury accumulates upwards through
aquatic food chains, so that organisms at higher trophic levels have higher mercury concentrations.
Some bacteria are able to resist heavy metal contamination through chemical transformation by
reduction, oxidation, methylation and demethylation. One of the best understood biological systems
for detoxifying organometallic or inorganic compounds involves the mer operon. The mer
determinants, RTPCDAB, in these bacteria are often located in plasmids or transposons and can also
be found in chromosomes. There are two classes of mercury resistance: narrow-spectrum specifies
resistance to inorganic mercury, while broad-spectrum includes resistance to organomercurials,
encoded by the gene merB. The regulatory gene merR is transcribed from a promoter that is
divergently oriented from the promoter for the other mer genes. MerR regulates the expression of the
structural genes of the operon in both a positive and a negative fashion. Resistance is due to
Hg2+being taken up into the cell and delivered to the NADPH-dependent flavoenzyme mercuric
reductase, which catalyzes the two-electron reduction of Hg2+ to volatile, low-toxicity Hg0. The
potential for bioremediation applications of the microbial mer operon has been long recognized;
consequently, Escherichia coli and other wild and genetically engineered organisms for the
bioremediation of Hg2+-contaminated environments have been assayed by several laboratories.
Key words: Operon mer, Bacterial mercury resistance, Bioremediation
INTRODUCTION
Mercury, the 6th most toxic in a universe of 6 million substances, exists naturally in small amounts
in the environment, being the 16th most rare element on Earth. However, its levels have risen due to
environmental contamination from human activities, such as burning coal and petroleum products,
use of mercurial fungicides in paper making and agriculture and mercury catalysts in industry, with a
consequent release of mercury into the air and water and on the land. These activities can increase
local mercury levels several thousand-fold above background (Tuovinen, 1984). In Brazil, huge
amounts of mercury are used at prospecting sites for amalgam formation in gold extraction. An
average of 1.32 kg of mercury is used for each kilogram of gold produced (Lacerda and Solomons,
1991). As a consequence, metallic mercury is introduced into the environment, representing one of
the major sources of aggression against man and the environment. Its use in seed and bulb dressings
directed against bacteria and fungi on fruit trees has introduced much of the mercury that
contaminates agricultural land. Therefore, environmental pollution is an increasing problem both for
developing and developed countries.
Minamata disease, discovered in 1956 around Minamata Bay, Japan, is the first instance on record of
severe methylmercury poisoning, having affected thousands of people, 887 of whom were killed
(Daher, 1999). It resulted from the consumption, mainly by fishermen and their families, of large
amounts of fish and shellfish contaminated with methylmercury, resulting from the transformation of
the HgCl2 discharged from a chemical plant (Chisso Co. Ltd.). Methylmercury is a neurological
poison primarily affecting the central nervous system, liver and kidney. When ingested, almost all of
the methylmercury is absorbed. Its half-life is about 44 days. Most methylmercury is converted and
excreted into the feces and urine (Abelsohn et al., 2002). The other chemical forms of mercury,
vapor and inorganic mercury, accumulate in the brain (Hg0) and kidney (Hg2+). The kidney is the
main target organ for inorganic mercury. The typical symptoms of Minamata disease include
neurological disorders, such as sensory disorders, cerebellar ataxia, constriction of the visual field,
auditory disturbances, tremoring of the visual field, and disequilibrium (Langford and Ferner, 1999).
Furthermore, many of the affected individuals in Minamata were congenitally affected by
methylmercury. Their mothers had only mild or no manifestation of poisoning (Harada, 1978). This
fact demonstrates the much higher vulnerability of fetuses than adults and shows that methylmercury
easily passes through the placenta and affects the fetus (Nishigaki and Harada, 1975).
MERCURY CYCLE IN THE ENVIRONMENT
The environmental mercury cycle is mediated by both geological and biological processes. Mercury
vapor (metallic mercury) emitted from both natural and anthropogenic sources is globally distributed
in the atmosphere. The major form of mercury in the atmosphere is vapor mercury (Hg0), which is
volatile and is oxidized to mercuric ion (Hg2+) as a result of its interaction with ozone in the presence
of water (Munthe and McElroy, 1992; DeMagalhaes and Tubino, 1995; Pleijel and Munthe, 1995).
Most of the mercury entering aquatic environments is Hg2+. Inorganic mercury, present in water and
sediments, is subject to bacterial conversion to methylmercury compounds that are bioaccumulated
in the aquatic food chain. Organomercury compounds are translocated rapidly through the food
chain, with tragic consequences. Predatory organisms at the top of the food chain generally have
higher mercury concentrations, found as organic forms of methylmercury.
The major chemical forms of mercury to which humans are exposed are mercury vapor, Hg0, and
methylmercury compounds, which are highly toxic to all living organisms. The toxicity of inorganic
and organic mercury compounds is due to their strong affinity for sulfur-containing organic
compounds, such as enzymes and other proteins. For this reason these compounds are extremely
toxic to biological systems. However, bacteria, fungi and plants have evolved mechanisms of
resistance to several of these different chemical forms. The bacteria play a major role in the global
cycling of mercury in the natural environment. Bacterial resistance to mercury and their role in
mercury cycling have been extensively studied (Osborn et al., 1997). This mini-review focuses
predominantly on mercury resistance mer operons.
BIOCHEMICAL BASIS OF BACTERIAL MERCURY RESISTANCE
As a response to toxic mercury compounds globally distributed by geological and anthropogenic

activities, microorganisms have developed a surprising array of resistance systems to overcome the
poisonous environment. An extensively studied resistance system, based on clustered genes in an
operon (mer operon), allows bacteria to detoxify Hg2+ into volatile metallic mercury by enzymatic
reduction (Komura and Izaki, 1971; Summers, 1986; Misra, 1992; Silver, 1996; Osborn et al., 1997).
Mercury-resistance determinants have been found in a wide range of Gram-negative and Gram-
positive bacteria isolated from different environments. They vary in the number and identity of genes
involved and are encoded by mer operons, usually located on plasmids (Summers and Silver, 1972;
Brown et al., 1986; Griffin et al., 1987; Radstrom et al., 1994) and chromosomes (Wang et al., 1987;
Inoue et al., 1991); they are often components of transposons (Misra et al., 1984; Kholodii et al.,
1993) and integrons (Liebert et al., 1999).
Two main mer determinant types have been described: narrow-spectrum mer determinants confer
resistance to inorganic mercury salts only, whereas broad-spectrum mer determinants confer
resistance to organomercurials such as methylmercury and phenylmercury, as well as to inorganic
mercury salts (Misra, 1992; Silver and Phung, 1996; Bogdanova et al., 1998).
The biochemical basis of resistance to inorganic mercury compounds such as HgCl2 appears to be
quite similar in several different species. It involves the reduction of Hg2+ to volatile Hg0 by an
inducible enzyme, mercuric reductase. This enzyme has been characterized in plasmid-carrying
strains of Pseudomonas, Escherichia coli and Staphylococcus aureus (Summers and Silver, 1978;
Bhriain and Foster, 1996; Silver and Phung, 1996; Osborn et al., 1997). This reductase is a
flavoprotein, which catalyzes the NADPH-dependent reduction of Hg2+ to Hg0. Since mercury has
such a high vapor pressure, it volatilizes and the bacterial environment is left mercury free. This
mercuric reductase is found intracellularly and is inducible by subinhibitory concentrations of
mercuric ions and a variety of organomercurial substances (Furukawa and Tonomura, 1972;
Summers, 1972; Schottel, 1978).
Based on a comparison with other bacterial periplasmic binding, protein-dependent transport

systems, it has been proposed that Hg2+ diffuses across the outer membrane (Brown, 1985). Mercuric
ions are transported outside the cell by a series of transporter proteins. This mechanism involves the
binding of Hg2+ by a pair of cysteine residues on the MerP protein located in the periplasm. Hg2+ is
then transferred to a pair of cysteine residues on MerT, a cytoplasmic membrane protein, and finally
to a cysteine pair at the active site of MerA (mercuric reductase) (Hamlett et al., 1992). Next, Hg2+ is
reduced to Hg0 in an NADPH-dependent reaction. The non-toxic Hg0 is then released into the
cytoplasm and volatilizes from the cell.
The biochemical mechanism for broad-spectrum resistance to organomercurials involves, in addition

to mercuric reductase, another inducible, soluble enzyme: organomercurial lyase. This enzyme
cleaves the organometallic linkage to yield Hg2+, and then the reductase uses NADPH to reduce the
elemental mercury form, which volatilizes from the cell (Schottel, 1978).
STRUCTURE OF THE MER OPERON

The mer operons vary in structure and are constituted by genes that encode the functional proteins
for regulation (merR), transport (merT, merP and/or merC, merF) and reduction (merA) (Figure 1).
In some cases, known as broad-spectrum mercury resistance, additional merB genes are required to
confer resistance to many organomercurials, such as methylmercury and phenylmercury, by
hydrolyzing the C-Hg bond before Hg2+ reduction. In general, the additional merB genes are found
downstream of the merA gene in the mer operon (Osborn et al., 1997).
Most mer operons contain a regulatory gene, mer R, which is transcribed separately and divergently
from the structural mer genes. However, in Gram-positive bacteria the merR genes of pI258
from Staphylococcus aureus and RC 607 from Bacillus sp. are transcribed in the same direction as
the structural genes (Laddaga et al., 1987; Wang et al., 1989). MerR, the metalloregulatory protein,
binds the promoter-operator region, where it both positively and negatively regulates the expression
of the divergently transcribed structural genes, and also negatively regulates its own expression.
MerR protein activates transcription of the operon in the presence of inducing concentrations of Hg2+.
It represses transcription of the structural genes from the mer operon (merTPCFAD) in the absence
of Hg2+, and activates transcription in the presence of Hg2+. The most distal promoter gene, merD,
which is co-transcribed with the structural genes, down-regulates the mer operon. MerD, a secondary
regulatory protein, also binds the same operator-promoter region as MerR, although very weakly
(Nucifora et al., 1990; Mukhopadhyay et al., 1991).
A number of structural genes are found downstream of the operator/promoter site; the proteins they
code for are involved in mercuric ion transport. All the mer operons have merT and merP, however,
some operons, such as transposon Tn21, have merC (the first example found with the merC gene).
The additional merC gene is located between merP and merA. However, it seems not to be essential
for Hg2+ resistance since it is absent from Tn501, which confers identical Hg2+ resistance levels
(Bhriain and Foster, 1986; Summers, 1986). Both merT and merP are required for full expression of
Hg2+ resistance, but loss of merP is less deleterious than loss of merT. In contrast, mutating merC had
no effect on Hg2+ resistance, though it decreased the level of expression. Recently, one
more mer gene implicated in mercuric transport, merF, was found in plasmid pMER327/419
of Pseudomonas fluorescens between merP and merA (Wilson et al., 2000).
The merA gene, determining mercuric reductase, and merB, if present, encoding the enzyme
organomercurial lyase, are immediately followed by genes encoding transport function. However, as
observed in Pseudomonas stutzeri, the merB gene is found between merR and merT, together with an
extra operator-promoter region (Weiss et al., 1977; Walsh et al., 1988; Reniero et al., 1995). The
other genes encoding organomercury resistance have been identified and designated merG and merE,
located between merA and merB on the broad-spectrum mer operon (Huang et al., 1999; Kiyono and
Pan-Hou, 1999). Furthermore, merB seldom occurs in Gram-negative bacteria (Laddaga et al., 1987;
Wang et al., 1989; Sedlmeier and Altenbuchner, 1992; Bogdanova et al., 1998).
Various mercury detoxification mechanisms, without mercury-reducing activity, have been reported,
such as reduced uptake of mercuric ions due to reduction in cellular permeability to Hg2+ ions (Pan-
Hou et al., 1981), demethylation of methylmercury by Clostridium cochlearium T-2P, which
involves the decomposition and inactivation of inorganic mercury with hydrogen sulfide (H2S) (Pan-
Hou and Imura, 1981), mercury methylation by certain bacteria that use methylation as a
resistance/detoxification mechanism (Trevors, 1986) and sequestration of methylmercury (Silver and
Misra, 1984).
MERCURY AND ANTIBIOTIC RESISTANCE
Mercury pollution can contribute to increased antibiotic resistance (McArthur and Tuckfield, 2000).
The combined expression of antibiotic resistance and mercury may be caused by selection, as a
consequence of the mercury present in an environment (Santana et al., 1989). Mercury resistance
operons, which are often found in conjugative plasmids and transposons, provide a suitable model
system for the study of horizontal gene transfer in natural populations of bacteria. Bacterial plasmid
resistance systems (mer gene) for mercurials and organomercurials are the best understood of such
systems at the biochemical and molecular genetic levels (Kalyaeva et al., 1988; Silver, 1994).
BIOTECHNOLOGICAL APPLICATIONS OF MER GENES TO
MERCURY DECONTAMINATION AND RECOVERY
Industrial use of mercury led to pollution of the environment. Consequently, mercury removal is a
challenge for environmental management. Common processes to remove mercury from contaminated
sources, based on adsorption with ion-exchange resins or biosorbents, have been found to be
sensitive to environment conditions (Ritter and Bibbler, 1992; Chang and Hong, 1994). Biological
processes have been employed in bioremediation, including metal recovery, and are potentially low
cost. The use of bacteria for removing metal from contaminated environments is a promising
technology. However, passive adsorption and immobilization treatments produce a large volume of
mercury-loaded biomass, the disposal of which is problematic. Microorganisms in contaminated
environments have developed resistance to mercury and are playing a major role in natural
decontamination (Cursino et al., 1999).
The bacterial plasmid/transposon resistance systems for mercurials and organomercurials (mer
systems) are the best understood at the biochemical and molecular genetic levels (Silver, 1994), and
are of great interest since they represent a natural strategy for the detoxification of mercury-
contaminated environments. The potential of the microbial mer operon, which functions by active
enzymatic reduction of mercury ions to water-insoluble metallic mercury, has been recognized for a
long time, because of its high levels of efficacy and specificity. Inside the cell, Hg2+ is reduced to
metallic mercury (Hg0), which passively diffuses out of the cell and its environment (with no energy
expenditure) (Saouter et al., 1994; Silver, 1996; Silver and Phung, 1996; von Canstein et al., 1999;
Chen et al., 1999; Nies, 1999). Therefore, the bacterial biomass acts continuously as a catalyst,
without the accumulation of large volumes of biomass. However, currently there are no records of
the use of the mer operon for the treatment of industrial waste or of other environments contaminated
with mercury (von Canstein et al., 1999).
Some experiments have been conducted in the form of a microcosmos (a glass apparatus with
different chambers) used to perform environmental simulations (river, lake, etc.). In a central
chamber the contaminated medium is treated with mercury-reducing bacteria. The concentration and
form of mercury can be monitored in the different chambers. Mercury reduction from Hg2+ to Hg0can
reach a 95% rate when the Hg2+ in the first chamber (entry) is compared to that in the last one (exit),
demonstrating the high biotechnological potential of mercury reduction by the mer operon (Saouter
et al., 1994).
Other studies, some of them conducted in our laboratory, have described mercury-reducing bacterial
strains, with emphasis on Escherichia coli, obtained and genetically improved by means
of mer operon cloning and by other recombinant DNA techniques (Hou et al., 1988; Nascimento et
al., 1992a,b; Chen and Wilson, 1997; Cursino et al., 2000). MerA has been found to be active in
yeast (Rensing et al., 1992) and plants (Rugh et al., 1996, 1998).
Techniques to detect mercurial compounds in the environment using mechanical analysis procedures,
such as atomic spectrophotometry (Omang, 1971) or cold-vapor atomic fluorescence detection
(Bloom and Fitzgerald, 1988), have been developed. However, the preparation of samples is very
laborious. An alternative will be the use of bacterial sensors. Bioassays can complement analytical
chemical methods for the detection of biologically available mercury in environmental samples.
Bacterial biosensors have been engineered to contain a report plasmid that carries gene fusions
between the regulatory region of the mer operon (merR) and bacterial luminescence genes (lux-
CDABE) that quantitatively respond to Hg2+ (Selifonova et al., 1993; Ramanathan et al., 1997;
Rasmussena et al., 2000).
REFERENCES
Abelsohn, A., Gibson, B.L., Sanborn, M.D. and Weir, E. (2002). Identifying and managing adverse environmental
health effects: 5. Persistent organic pollutants. Can. Med. Assoc. J. 166: 1549-1554.
Bhriain, N.N. and Foster, T.J. (1986). Polypeptides specified by the mercuric resistance (mer) operon of plasmid
R100. Gene 42: 323-330.
Bloom, N. and Fitzgerald, W.F. (1988). Determination of volatile mercury species at the picogram level by low-
temperature gas chromatography with cold-vapour atomic fluorescence detection. Anal. Chim. Acta 208: 151-161.
Bogdanova, E.S., Bass, I.A., Minakhin, L.S., Petrova, M.A., Mindlin, S.Z., Volodin, A.A., Kalyaeva, E.S., Tiedje,
J.M., Hobman, J.L., Brown, N.L. and Nikiforov, V.G. (1998). Horizontal spread of mer operons among gram-positive
bacteria in natural environments. Microbiology 144: 609-620.
Brown, N.L. (1985). Bacterial resistance to mercury-reductio ad absurdum? Trends Biochem. Sci. 10: 400-403.
Brown, N.L., Misra, T.K., Winnie, J.N., Schmidt, A., Seiff, M. and Silver, S. (1986). The nucleotide sequence of the
mercuric resistance operons of plasmid R100 and transposon Tn501: further evidence for mer genes which enhance the
activity of the mercuric ion detoxification system. Mol. Gen. Genet. 202: 143-151.
Chang, J.S. and Hong, J. (1994). Biosorption of mercury by the inactivated cells of Pseudomonas aeriginosa PU21
(Rip64). Biotechnol. Bioeng. 44: 999-1006.
Chen, S. and Wilson, D.B. (1997). Construction and characterization of Escherichia coli genetically engineered for
bioremetiation of Hg2+-contaminated environments. Appl. Environ. Microbiol. 63: 2442-2445.
Chen, W., Bruhlmann, F., Richins, R.D. and Mulchandani, A. (1999). Engineering of improved microbes and
enzymes for bioremediation. Curr. Opin. Biotechnol. 10: 137-141.
Cursino, L., Oberd, S.M., Ceclio, R.V., Moreira, R.M., Chartone-Souza, E. and Nascimento, A.M.A. (1999).
Mercury concentration in the sediment at different gold prospecting sites along the Carmo stream, Minas Gerais, Brazil,
and frequency of resistant bacteria in the respective aquatic communities. Hydrobiologia 394: 5-12.
Cursino, L., Mattos, S.V.M., Azevedo, V., Galarza, F., Bucker, D.H., Chartone-Souza, E. and Nascimento,
A.M.A. (2000). Capacity of mercury volatilization by mer (from Escherichia coli) and glutathione S-
transferase (from Schistosoma mansoni) genes cloned in Escherichia coli. Sci. Total Environ. 261: 109-113.
Daher, V. (1999). No rastro do mercrio. Cinc. Hoje 26: 46-48.
DeMagalhaes, M.E.A. and Tubino, M. (1995). A possible path for mercury in biological systems - the oxidation of
metallic mercury by molecular oxygen in aqueous-solutions. Sci. Total Environ. 170: 229-239.
Furukawa, K. and Tonomura, K. (1972). Mettalic mercury releasing enzyme in mercury-resistant Pseudomonas. Agric.
Biol. Chem. 36: 217-226.
Griffin, H.G., Foster, T.J., Silver, S. and Misra, T.K. (1987). Cloning and DNA sequence of the mercuric- and
organomercurial-resistance determinats of plasmid pDU1358. Proc. Natl. Acad. Sci. USA 84: 3112-3116.
Hamlett, N.V., Landale, E.C., Davis, B.H. and Summer, A.O. (1992). Roles of the Tn21 merT, merP, and merC gene
products in mercury resistance and mercury binding. J. Bacteriol. 174: 6377-6385.
Harada, M. (1978). Congenital Minamata disease: Intrauterine methylmercury poisoning. Teratology 18: 285-288.
Hou, Y.M., Kim, R. and Kim, S.H. (1988). Expression of the mouse metallothionein-I gene in Escherichia coli:
increased tolerance to heavy metals. Biochim. Biophys. Acta 951: 230-234.
Huang, C.C., Narita, M., Yamagata, T. and Endo, G. (1999). Identification of three merB genes and characterization
of a broad-spectrum mercury resistance module encoded by a class II transposon of Bacillus megaterium strain
MB1. Gene 239: 361-366.
Inoue, C., Sugawara, K. and Kusano, T. (1991). The merR regulatory gene in Thiobacillus ferrooxidans is spaced apart
from the mer structural genes. Mol. Microbiol. 5: 2707-2718.
Kalyaeva, E.S., Tiedjie, J.M., Hobman, J.L., Brown, N.L. and Nikiforov, V.G. (1998). Horizontal spread
of mer operons among Gram-positive bacteria in natural environment. Microbiology 44: 609-620.
Kholodii, G.Y., Yurieva, O.V., Lomovskaya, O.L., Gorlenko, Z.M., Mindlin, S.Z. and Nikiforov, V.G. (1993).
Tn5053, a mercury resistance transposon with integron ends. J. Mol. Biol. 230: 1103-1107.
Kiyono, M. and Pan-Hou, H. (1999). The merG gene product is involved in phenylmercury resistance
in Pseudomonas strain K-62. J. Bacteriol. 81: 726-730.
Komura, I. and Izaki, K. (1971). Mechanism of mercuric chloride resistance in microorganisms. I. Vaporization of a
mercury compound from mercuric chloride by multiple drug resistance strain of Escherichia coli. J. Biochem. 70: 885-
893.
Lacerda, L.D. and Solomons, W. (1991). Mercury in the Amazon: A Chemical Time Bomb? CETEM/CNPq, Rio de
Janeiro, RJ, Brazil, pp. 46.
Laddaga, R.A., Chu, L., Misra, T.K. and Silver, S. (1987). Nucleotide sequence and expression of the mercurial-
resistance operon from Staphylococcus aureus plasmid pI258. Proc. Natl. Acad. Sci. USA 84: 5106-5110.
Langford, N. and Ferner, R. (1999). Toxicity of mercury. J. Hum. Hypertens. 13: 651-656.
Liebert, C.A., Hall, R.M. and Summers, A.O. (1999). Transposon Tn21, flagship of the floating genome. Microbiol.
Mol. Biol. Rev. 63: 507-522.
McArthur, J.V. and Tuckfield, R.C. (2000). Spatial patterns in antibiotic resistance among stream bacteria: effects of
industrial pollution. Appl. Environ. Microbiol. 66: 3722-3726.
Misra, T.K. (1992). Bacterial resistances to inorganic mercury salts and organomercurials. Plasmid 25: 4-16.
Misra, T.K., Brown, N.L., Fritzinger, D.C., Pridmore, R.D., Barnes, W.M., Haberstroh, L. and Silver, S. (1984).
The mercuric-ion resistance operons of plasmid R100 and transposon Tn501: the beginning of the operon including the
regulatory region and the first two structural genes. Proc. Natl. Acad. Sci. USA 81: 5975-5979.
Mukhopadhyay, D.H., Yu, H., Nucifora, G. and Misra, T.K. (1991). Purification and functional characterization of
MerD: a coregulator of the mercury resistance operon in Gram-negative bacteria. J. Biol. Chem. 266: 18538-18542.
Munthe, J. and McElroy, W.J. (1992). Some aqueous reactions of potential importance in the atmospheric chemistry of
mercury. Atmos. Environ. 26A: 553-557.
Nascimento, A.M.A., Azevedo, M.O., Astolfi-Filho, S. and Chartone-Souza, E. (1992a). Cloning of the mercuric-ion
resistance operon into Escherichia coli 5K using the mini-plasmid technique. Biotechnol. Tech. 6: 139-142.
Nascimento, A.M.A., Azevedo, M.O., Astolfi-Filho, S. and Chartone-Souza, E. (1992b). Cloning of the mercuric-ion
resistance operon of pBH100 into Escherichia coli 5K using pAT153 as vector. Rev. Microbiol. 23: 217-220.
Nies, N.H. (1999). Microbial heavy-metal resistance. Appl. Microbiol. Biotechnol. 51: 730-750.
Nishigaki, S. and Harada, M. (1975). Methylmercury and selenium in umbilical cords of inhabitants of Minamata
area. Nature 258: 324-325.
Nucifora, G., Silver, S. and Misra, T.K. (1990). Down regulation of the mercury resistance operon by the most promter-
distal gene merD. Mol. Gen. Genet. 220: 69-72.
Omang, S.H. (1971). Determination of mercury in natural waters and effluents by flameless atomic absorption
spectrophotometry. Anal. Chim. Acta 53: 415-419.
Osborn, A.M., Bruce, K.D., Strike, P. and Ritchie, D.A. (1997). Distribution, diversity and evolution of the bacterial
mercury resistance (mer) operon. FEMS Microbiol. Rev. 19: 239-262.
Pan-Hou, H.S. and Imura, N. (1981). Role of hydrogen sulfide in mercury resistance determined by plasmid
of Clostridium cochlearium T-2. N. Arch. Microbiol. 129: 49-52.
Pan-Hou, H.S.K., Nishimoto, M. and Imura, N. (1981). Possible role of membrane proteins in mercury resistance of
Enterobacter aerogenes. Arch. Microbiol. 130: 93-95.
Pleijel, K. and Munthe, J. (1995). Modelling the atmospheric mercury cycle - 13687. Chemistry in fog droplets. Atmos.
Environ. 29: 1441-1457.
Ramanathan, S., Ensor, M. and Daunert, S. (1997). Bacterial biosensor for monitoring toxic metals. Trends
Biotechnol. 15: 500-506.
Radstrom, P., Skold, O., Swedberg, G., Flensburg, J., Roy, P.H. and Sundstrom, L. (1994). Transposon Tn5090 of
the plasmid R751, which carries integron, is related to Tn7, Mu, and the retroelements. J. Bacteriol. 176: 3257-3268.
Rasmussena, L.D., Srensena, S.J., Turnerb, R.R. and Barkay, T. (2000). Application of a mer-lux biosensor for
estimating bioavailable mercury in soil. Soil Biol. Bioch. 32: 639-646.
Reniero, D., Galli, E. and Barbieri, P. (1995). Cloning and comparison of mercury- and organomercurial-resistance
determinants from a Pseudomonas stutzeri plasmid. Gene 166: 77-82.
Rensing, C., Kues, U., Stahl, U., Nies, D.H. and Friedrich, B. (1992). Expression of bacterial mercuric ion reductase
in Saccharomyces cerevisiae. J. Bacteriol. 174: 1288-1292.
Ritter, J.A. and Bibbler, J.P. (1992). Removal of mercury from wastewater: large scale performance of an ion exchange
process. Wat. Sci. Technol. 25: 165-172.
Rugh, C.L., Wilde, H.D., Stack, N.M., Thompson, D.M., Summers, A.O. and Meagher, R.B. (1996). Mercuric ion
reduction and resistance in transgenic Arabidopsis thaliana plants expressing a modified bacterial merA gene. Proc. Natl.
Acad. Sci. USA 93: 3182-3187.
Rugh, C.L., Senecoff, J.F., Meagher, R.B. and Merkle, S.A. (1998). Development of transgenic yellow poplar for
mercury phytoremediation. Nat. Biotechnol. 16: 925-928.
Santana, Y.X., Chartone-Souza, E. and Ferreira, M.D. (1989). Drug resistance and colicinogeny of Salmonella
typhimurium strains isolated from sewage-contaminated surface water and humans in Belo Horizonte, Brazil. Rev.
Microbiol. 20: 41-49.
Saouter, E., Turner, R. and Barkay, T. (1994). Microbial reduction of ionic mercury for the removal of mercury from
contaminated environments. Ann. N. Y. Acad. Sci. 721: 423-427.
Schottel, J.L. (1978). The mercuric and organomercurial detoxifying enzymes from a plasmid-bearing strain
of Escherichia coli. J. Biol. Chem. 253: 4341-4349.
Sedlmeier, R. and Altenbuchner, J. (1992). Cloning and DNA sequence analysis of the mercury resistance genes
of Streptomyces lividans. Mol. Gen. Genet. 236: 76-85.
Selifonova, O., Burlage, R. and Barkay, T. (1993). Bioluminescent sensors for detection of bioavailable mercury (II) in
the environment. Appl. Environ. Microbiol. 59: 3083-3090.
Silver, S. (1994). Exploiting heavy metal resistance systems in bioremediation. Res. Microbiol. 145: 61-67.
Silver, S. (1996). Bacterial resistances to toxic metal ions - a review. Gene 179: 9-19.
Silver, S. and Misra, T.K. (1984). Bacterial transformations of and resistances to heavy metals. Basic Life Sci. 28: 23-
46.
Silver, S. and Phung, L.T. (1996). Bacterial heavy metal resistance: new surprises. Annu. Rev. Microbiol. 50: 753-789.
Summers, A.O. (1972). Mercury resistance in a plasmid-bearing strain of Escherichia coli. J. Bacteriol. 112: 1228-1236.
Summers, A.O. (1986). Organization, expression and evolution of genes for mercury resistance. Annu. Rev. Microbiol.
40: 607-634.
Summers, A.O. and Silver, S. (1972). Mercury resistance in a plasmid-bearing strain of Escherichia coli. J. Bacteriol.
112: 1228-1236.
Summers, A.O. and Silver, S. (1978). Microbial transformations of metals. Annu. Rev. Microbiol. 32: 637-672.
Trevors, J.T. (1986). Mercury methylation by bacteria. J. Basic Microbiol. 26: 499-504.
Tuovinen, O.H. (1984). Mechanisms of microbial resistance and detoxification of mercury and organomercury
compounds: physiological, biochemical and genetic analyses. Microbiol. Rev. 48: 95-124.
von Canstein, H., Li, Y., Timmis, K.N., Deckwen, W.D. and Wagner-Dobler, I. (1999). Removal of mercury from
chloralkali electrolysis wastewater by a mercury-resistant Pseudomonas putida strain. Appl. Environ. Microbiol. 65:
5279-5284.
Walsh, C.T., Distefano, M.D., Moore, M.J., Shewchuk, L.M. and Verdine, G.L. (1988). Molecular basis of bacterial
resistance to organomercurial and inorganic mercuric salts. FASEB J. 2: 124-130.
Wang, Y., Mahler, I., Levinson, H.S. and Halvorson, H.O. (1987). Cloning and expression in Escherichia coli of
chromosomal mercury resistance genes from a Bacillus sp. J. Bacteriol. 169: 4848-4851.
Wang, Y., Moore, M., Levinson, H.S., Silver, S., Wash, C. and Mahler, I. (1989). Nucleotide sequence of a
chromosomal mercury resistance determinant from a Bacillus sp. With broad-spectrum mercury resistance. J. Bacteriol.
171: 83-92.
Weiss, A.A., Murphy, S.D. and Silver, S. (1977). Mercury and organomercurial resistance determined by plasmid
in Staphylococcus aureus. J. Bacteriol. 132: 197-208.
Wilson, J.R., Leang, C., Morby, A.P., Hobman, J.L. and Brown, N.L. (2000). MerF is a mercury transport protein:
different structures but a common mechanism for mercuric ion transporters? FEBS Lett. 472: 78-82.
Copyright 2003 by FUNPEC
Increase methylmercury accumulation
in Arabidopsis thaliana expressing
bacterial broad-spectrum mercury
transporter MerE
Yuka Sone,
Ryosuke Nakamura,
Hidemitsu Pan-Hou,
Masa H Sato,
Tomoo Itoh and
Masako KiyonoEmail author
AMB Express20133:52
DOI: 10.1186/2191-0855-3-52
Sone et al.; licensee Springer. 2013
Received: 22 July 2013
Accepted: 29 August 2013
Published: 3 September 2013
Abstract
The bacterial merE gene derived from the Tn21 mer operon encodes a
broad-spectrum mercury transporter that governs the transport of
methylmercury and mercuric ions across bacterial cytoplasmic
membranes, and this gene is a potential molecular tool for improving
the efficiency of methylmercury phytoremediation. A
transgenic Arabidopsis engineered to express MerE was constructed
and the impact of expression of MerE on methylmercury accumulation
was evaluated. The subcellular localization of transiently expressed
GFP-tagged MerE was examined in Arabidopsis suspension-cultured
cells. The GFP-MerE was found to localize to the plasma membrane
and cytosol. The transgenic Arabidopsis expressing MerE accumulated
significantly more methymercury and mercuric ions into plants than the
wild-type Arabidopsis did. The transgenic plants expressing MerE was
significantly more resistant to mercuric ions, but only showed more
resistant to methylmercury compared with the wild
type Arabidopsis. These results demonstrated that expression of the
bacterial mercury transporter MerE promoted the transport and
accumulation of methylmercury in transgenic Arabidopsis, which may
be a useful method for improving plants to facilitate the
phytoremediation of methylmercury pollution.
Keywords
Bacterial broad-spectrum mercury

transport MerE Methylmercury Phytoremediation
Introduction
Mercury pollution is still a worldwide problem in environments because
of natural events and human activities such as coal burning, industrial
use and gold-mining activities (Harada 1995). Metallic and ionic form of
mercury can accumulate in sediments, where they are readily
converted to highly toxic methylmercury by microbes (Barkay et
al. 2003). Clinical investigations have shown that methylmercury is the
principal form of mercury that accumulated in fish and biomagnifies in
their consumers, causing severe neurodegenerative symptoms
(Harada 1995). The severe adverse effects of this contaminant mean
there is an urgent need to develop an effective and affordable
technology to facilitate its removal from the environment.
Phytoremediation refers to the use of green plants in the removal of

environmental pollutants, which is recognized as a cost effective,
sustainable, and environmentally friendly approach that has many
advantages during the large-scale clean-up of contaminated sites
(Clemens et al. 2002; Kramer 2005; Malik 2004; Ruiz and
Daniell 2009; Salt 1998). In recent studies, Meager et al. engineered
bacterial mer operons such as MerA (mercuric reductase) to reduce
reactive mercuric ions to volatile and relatively inert monoatomic Hg(0)
vapor, and MerB (organomercurial lyase) to degrade methylmercury to
mercuric ions into plants, thereby remediating methylmercury
contamination (Meagher and Heaton 2005). Plants such as
cottonwood trees (Lyyra et al. 2007) and tobacco (Heaton et al. 2003)
have been modified to express either MerB or both MerB and MerA,
which convert methylmercury to mercuric ions or mercury vapor,
respectively. The disadvantage of this approach is that elemental
mercury Hg(0) is released into the environment, where it accumulates
and can eventually be converted into highly toxic methylmercury. To
help address this environmental problem, a new methylmercury
remediation method is required to replace the merA- mediated mercury
reduction mechanism so plant cells can accumulate methylmercury
from contaminated sites without releasing mercury vapor into the
ambient air.
In general, rehabilitation of metal-contaminated soils by plants requires
a long time for the purification process to be completed. McGrath and
Zhao reported that several months were required to reduce the
mercury content by half in contaminated soils (McGrath and
Zhao 2003). The expression of mercury transporter in the plant may
provide a means of improving mercury uptake, thereby shortening the
purification completion time. In a previous study, we demonstrated for
the first time that the MerE protein encoded by pE4 is localized in the
membrane cell fraction and that MerE is a novel, broad-spectrum
mercury transporter, which governs the transport of CH3Hg(I) and
Hg(II) across bacterial cytoplasmic membranes (Kiyono et al. 2009;
Sone et al. 2010).
The current study evaluated the feasibility of engineering

transgenic Arabidopsis plants to express bacterial broad-spectrum
mercury transporter, MerE and its potential use in the
phytoremediation of methylmercury pollution. This study showed that
expression of MerE promoted the transport and accumulation of
methylmercury in transgenic Arabidopsis. Enhanced methylmercury
accumulation mediated by MerE represents one way for improving
plants to be more suitable for use in phytoremediation of
methylmercury pollution.
Materials and methods

Materials and growth conditions
Table 1 shows the Escherichia coli (E. coli), Arabidopsis thaliana (A.
thaliana) - cultured cells and plasmids used in this study. E. coli XL1-
Blue was grown at 37C in Luria-Bertani (LB) medium and used for
routine plasmid propagation. When necessary, the medium was
supplemented with 25 g/mL kanamycin. Suspension-cultured A.
thaliana cells were maintained in Murashige and Skoog (MS) medium
on a rotary shaker at 22C with continuous white light and sub-cultured
once a week. A. thaliana ecotype Columbia was used for the plant
transformations. The seeds produced were germinated and grown on
jiffy-7 peat pellets, whereas the surface-sterilized seeds were sown
onto MS agar plates. The plants were grown in an environmental
growth chamber (Sanyo, Tokyo, Japan) at 22C in long-day (16 h
light/8 h dark) conditions.
Table 1
Strains and plasmids used in this study
Strains and plasmids Description of relevant features(s) Refer
Strains
recaAI endAI gyrA96 thi hsdR17 supE44 reIAI

E.coli XL1-Blue (Bullo
lac/[F::Tn/0proAB + lac1q lacZM15 traD36
Arabidopsis
thaliana suspension-cultured Alex (Ueda
cells
Plasmids
pE4 meR-o/p-merE in pKF19k (Kiyo
None: binary expression vector with a CaMV35S promoter (Mats

pMAT137
produced by tandem duplication of the enhancer sequence Naka
CaMV35S(S65T)-NOS3 GFP in pUC18 (Uem
pE18 GFP-MerE in pUC18 This s
pMAE2 MerE in pMAT137 This s

Enzymes and reagents
The restriction enzymes, the DNA ligation kit and Taq polymerase
were obtained from Takara Shuzo Corp. (Kyoto, Japan). Analytical
reagent grade mercury was purchased from Wako Chemicals (Tokyo,
Japan).
Plasmid construction
The recombinant plasmids and oligonucleotide primers used in this
study are described in Table 1 and Table 2, respectively. The plasmid
pE18 that carried the gfp-merE fusion gene was constructed in pUC18
as follows. A 0.23 kb fragment containing merE was PCR-amplified
using the primers U-Bgl-merE and L-Kpn-merE, which contained Bgl II
and Kpn I sites. The pE4 plasmid (Kiyono et al. 2009) was used as a
template. After digestion the PCR product with Bgl II and Kpn I, the
fragment was cloned into the corresponding sites in CaMV35S-
sGFP(S65T)-NOS3 (Uemura et al. 2004) and sequenced, and then
designated as pE18.
Table 2
Oligonucleotide primers used in this study
Primer Oligonucleotide (53)
U-Bgl-merE GAAGATCTATGAACGCCCCTGACAAA
Primer Oligonucleotide (53)
L-Kpn-merE GGGGTACCTCATGATCCGCCCCGGAA
U-Not-merE AAGGAAAAAAGCGGCCGCATGAACGCCCCTGACAAACT
L-Xba-merE GCTCTAGATCATGATCCGCCCCGGAAGG
U-321NPTII ATTGAACAAGATGGATTGCA
L-1109NPTII GAAGAACTCGTCAAGAAGGC
- ACT-Fd CAACTGGGACGACATGGAGA
- ACT-Rv GATCCACATCTGCTGGAAGG
The plasmid pMAE2 that carried the merE gene was constructed in
pMAT137 (Matsuoka and Nakamura 1991) as follows. The primers U-
Not-merE and L-Xba-merE were used to amplify the merE region
(0.23 kb) with pE18 as a template. After digestion the PCR products
with Not I-Xba I, the fragment was cloned into the Not I-Xba I sites of
pMAT137. The cloned fragment was sequenced and the resulting
plasmid was designated as pMAE2.
Confocal laser scanning microscopy

GFP-fused proteins were transiently expressed in A.
thaliana suspension-cultured cells using a published method (Uemura
et al. 2004). Cells transformed with pE18 were viewed without fixation
under an Olympus BX60 fluorescence microscope, which was
equipped with a Model CSU10 confocal scanner (Yokogawa Electric)
(Nakano 2002) and a Zeiss LSM510 META or LSM5 PASCAL
microscope, which were equipped with green HeNe and argon lasers.
Transformation of plants and confirmation of transgenic plants

The pMAE2 plasmid was introduced into Agrobacterium
tumefaciens (A. tumefaciens) via electroporation (Mozo and
Hooykaas 1991). A. tumefaciens was grown at 2528C in LB medium
added with 25 g/mL kanamycin and employed for the transformation
of A. thaliana. A. thaliana ecotype Columbia plants were transformed
using the floral dip method (Clough and Bent 1998) by Inplanta
Innovations Inc. (Kanagawa, Japan). The progeny seedlings were
selected on MS medium containing 50 mg/L kanamycin. The third
generations of merE transgenic plants (T3) were used for all
experiments described in this paper.
Plant genomic DNA was isolated from transformed and untransformed

leaves using the FTA Kit (GE Healthcare, Buckinghamshire, England)
in accordance with the manufacturers instructions. The target genome
DNA was amplified using specific primers, i.e., U-Not-merE and L-Xba-
merE for merE, according to the manufacturers instructions (Table 2).
The primers U-321NPTII and L-1109NPTII were used to amplify NOS-
NPTII in each PCR reaction, as control (Table 2). The PCR products
were separated on 2% agarose gels and visualized by ethidium
bromide staining.
Quantitation of mRNA levels by reverse transcription PCR

Total RNA was extracted from cells using an RNeasy Plant Mini Kit
(Qiagen, CA, USA), according to the manufacturers instructions. The
Superscript First-strand Synthesis System for reverse transcription
PCR (Life Technologies, CA, USA) was used to prepare single-
stranded cDNA. The target cDNAs were amplified using specific
primers, i.e., U-Not-merE and L-Xba-merE to merE, according to the
manufacturers instructions. The primers -ACT-Fd and -ACT-Rv
were used to amplify ACT1 in each PCR reaction as controls (Table 2).
The PCR products were separated on 2% agarose gels and visualized
by ethidium bromide staining.
Subcellular fractionation of Arabidopsis tissues

To generate roots, surface-sterilized A. thaliana seeds were
germinated in sterile MS liquid medium with 100 rpm shaking using a
rotary shaker in dark conditions. The roots of 14-day-old plants were
homogenized in a grinding buffer, which contained 50 mM TrisHCl,
pH 7.5, 250 mM sorbitol, 5 mM EDTA, 5 mM EGTA, 1 mM
dithiothreitol, and 100 M p-(amidinophenyl) methanesulfonyl fluoride
hydrochloride (APMSF). The homogenate was filtered through four
layers of Miracloth (EMD Biosciences, Darmstadt, Germany), and
centrifuged at 10,000g for 10 min. The supernatant was centrifuged
at 100,000g for 30 min and the precipitate was then suspended in
the grinding buffer.
SDS-PAGE and immunoblotting

Proteins were separated by SDS-PAGE and transferred to an
Immobilon-P membrane (Millipore, Billerica, USA). After blocking with
de-fatted milk, the membrane filter was incubated with rabbit anti-MerE
polyclonal antibody (Kiyono et al. 2009). The membranes were washed
and reacted with peroxidase-conjugated anti-rabbit IgG antibody
(Sigma Aldrich, MO, USA). Anti-MerE polyclonal and peroxidase-
conjugated anti-rabbit IgG antibodies were used at a dilution of
1:3,000. Chemiluminescent reagents ECL (GE Healthcare, Chalfont St
Giles, UK) were used to detect antigens.
Mercury accumulation
T3 transgenic plants were cultured in MS gellan gum plates with
different concentrations of HgCl2 or CH3HgCl for 2 weeks at 22C. After
treatment with 10 M HgCl2 or 0.3 M CH3HgCl, the total amount of
mercury accumulated by an entire plant was determined as follows,
using 60 plants in total. Entire plants samples were digested with a
concentrated acid mixture (nitric acid: perchlonic acid=4: 1) for 4 h at
90C and their total cellular mercury contents were measured using an
atomic absorption spectrometry analyzer HG-310 (Hiranuma, Japan).
The standard deviation of the measurements was less than 10%.
Mercury resistance
The sensitivities of T3 transgenic plants to mercury were tested using
the following method. The sterilized seeds from wild-type and
transgenic plants were aligned in a horizontal array of MS gellan gum
plates, which contained 5 M HgCl2 or 0.3 M CH3HgCl, where they the
seeds germinated and grew vertically. The root lengths of the
seedlings were measured after 2 weeks cultivation at 22C.
Statistical analysis
Data analysis was performed using the statistical tools (Students t-
test) of Microsoft Excel software.
Results
Cellular localizations of GFP-MerE in suspension-cultured plant
cells
To determine the subcellular localization of GFP-fusion proteins in
suspension-cultured plant cells, GFP-tagged MerE was expressed
transiently (Figure 1A) and its fluorescence was visualized by confocal
laser scanning microscopy (Figure 1B). GFP-MerE was detected
primarily in the endoplasmic reticulum (Closed arrowheads in
Figure 1B), but some fusion proteins were detected in the plasma
membrane (Open arrowheads in Figure 1B).
Figure 1
Construction of gfp-merE fusion plasmid (A) and cellular
localization of GFP-MerE in suspension-cultured plant cells
(B). GFP-tagged fusion proteins were expressed in suspension-
cultured plant cells and viewed by confocal laser scanning microscopy.
GFP fluorescence images are shown for GFP-MerE (B). Bars=20 m.
Expression of MerE in transgenic plants
The PCR-amplified merE DNA fragment was subcloned into a binary
vector, pMAT137, to generate the plasmid pMAE2 (Figure 2A). The
plasmid was transformed into A. thaliana ecotype Columbia
via Agrobacterium- mediated gene transfer (Clough and Bent 1998).
Eleven merE independent transgenic lines were obtained by selection
using MS medium containing 50 mg/L kanamycin. The MerE
transformants exhibited no distinctive phenotypes. For instance, the
MerE transgenic plants had an equally normal growth as wild-
type Arabidopsis. Six of eleven merE transgenic lines (lines E2, E3,
E4, E5, E6, and E7) were selected for further studies. To confirm the
presence of the merE transgene in the transgenic plants, total genomic
DNA was extracted from the mature leaves of T3 progeny, and the
regions of the introduced merE fragments were amplified using the
genomic DNA as a template. As expected, 0.23 kb PCR fragment was
detected in the merE (lines E2, E3, E4, E5, E6 and E7) when U-Not-
merE/L-Xba-merE were used as PCR primers (Figure 2B). The
expression levels of merE in plants were determined by reverse
transcription-PCR (RT-PCR). The total RNA was isolated from leaves
and specific primers were used to detect merE and Actin mRNA.
The merE mRNA was detected in all transformants tested (Figure 2C).
There was no significant difference in the mRNA levels of the individual
transgenic lines, so the E2 transgenic plant was selected for further
studies.
Figure 2
Characterization of merE in transgenic plant lines. The structure of
the DNA region transferred using the plant expression plasmids
pMAE2 (A). Confirmation of the expression of merE (E2, E3, E4, E5,
E6, and E7) in transgenic plants based on genomic PCR expression
analysis (B). Expression analyses of merE (E2, E3, E4, E5, E6, and
E7) in transgenic plants, which were determined by reverse
transcription PCR (C). Transgenic plants were grown on MS gellan
gum plates. Plates were incubated at 22C for 2 weeks. Genome DNA
prepared from transgenic plants and used for genomic PCR analysis
of merE (U-Not-merE and L-Xba-merE) and NPT II (U-321NPTII and L-
1109NPTII). The total RNA was prepared from transgenic plants and
used for reverse transcription PCR analysis to determine the merE (U-
Not-merE and L-Xba-merE) and Actin (primer -ACT-Fd and -ACT-
Rv) transcription levels.
The expression levels of MerE protein were measured in transgenic
plants (lines E2) by immunoblot analysis using a polyclonal anti-MerE
antibody, which was prepared in a previous study (Kiyono et al. 2009).
A novel protein band of 8 kDa, which reacted specifically with the anti-
MerE antibody, was identified in the crude cell extract and crude
membrane fraction from transgenic plants (Figure 3, lane 1&3),
whereas no protein band reacted with anti-MerE antibody was
detected in the soluble fraction (Figure 3, lane 2). The protein size was
consistent with the size predicted from the translation of the DNA
sequence of the merE gene. These results demonstrated that
the merE gene in transgenic plants was transcribed and translated into
proteins with molecular mass of 8 kDa, which were probably located in
the membrane fraction.
Figure 3
Immunoblot of MerE protein in transgenic plants. Immunoblot
analysis of the crude cell extracts (lane 1), soluble fractions (lane 2),
and membrane fractions (lane 3) obtained from wild type (Wild)
and merE (E2) transgenic plants, which were performed using anti-
MerE polyclonal antibodies. The amount of protein applied in each lane
was 25 g. The arrow indicates MerE (8 kDa).
Effect of MerE expression on mercury accumulation and mercury
resistance in transgenic plants
Mercury accumulation was determined in
transgenic Arabidopsis plants after exposure to HgCl2 or CH3HgCl in
MS gellan gum plates for 2 weeks. After treatment with 10 M HgCl2,
the amount of mercury accumulated in the entire merE transgenic
plants were higher than that in wild-type plants (Figure 4A). After
treatment with 0.3 M CH3HgCl, the amount of mercury accumulated in
the entire merE transgenic plants were about 2-fold higher than that in
the wild-type plants (Figure 4B).
Figure 4
Accumulation of mercury from MS gellan gum plates containing
Hg(II) and CH Hg(I). The amounts of mercury (A; ng/plant, B; ng/fresh
3
weight) that accumulated in wild-type plants (Wild; empty bar)

and merE- transgenic plants (black bar) were determined after culture
for 2 weeks on MS gellan gum plates with various concentrations of
HgCl or CH HgCl, as described in the Materials and Methods. The
2 3
data are expressed as the means S.E.M. based on four

determinations from three independent experiments. *P<0.05 vs. the
wild type.
The effect of MerE expression on mercury resistance was evaluated in
transgenic Arabidopsis plants (lines E2) by monitoring the root and
shoot growth of seedlings after exposure to HgCl2 or CH3HgCl in MS
gellan gum plates for 2 weeks. In the absence of
mercury, merE transgenic plants exhibited the same normal growth as
wild-type Arabidopsis (Figure 5A). In the presence of 5 M HgCl2 or
0.3 M CH3HgCl, root and shoot growth were inhibited in transgenic
seedlings and wild-type Arabidopsis (Figure 5A). However, the shoot
and root growth of the merE transgenic seedlings indicated significant
tolerance compared with wild-type Arabidopsis in the presence of 5 M
HgCl2 (Figure 5AC). The shoot and root growth of merE transgenic
seedlings also appeared to be better than that of wild-
type Arabidopsis in the presence of 0.3 M CH3HgCl (Figure 5AC).
Figure 5
Susceptibility of transgenic plants to Hg(II) and
CH Hg(I). Sterilized seeds of wild-type (Wild) and transgenic (E2)
3
plants were germinated and grown on MS gellan gum plates in the

presence or absence of 5 M HgCl and 0.3 M CH HgCl (A). After
2 3
culture for 2 weeks at 22C, the total wet weights of plants (B) and root
growth (C) levels of wild-type plants (empty bar) and merE- transgenic
plants (black bar) were evaluated as described in the Materials and
Methods. The total wet weight of the wild-type plants in the absence of
mercurials was considered as control (B). The data are expressed as
the means S.E.M. based on four determinations from three
independent experiments. *P<0.05 vs. the wild type.
Discussion
Phytoremediation, using green plants to remove environmental
pollutants including hazardous toxic metals removal from a large
volume of contaminated sites is recognized as a cost-effective,
sustainable and aesthetically pleasing technology (Tong et al. 2004).
However, the use of plants, like all biological methods, does not allow
100% removal of contaminants because the remediation rates
decrease as the concentrations of contaminant decrease (Clemens et
al. 2002). In addition, phytoremediation is a slow process that requires
a long time to complete the purification (McGrath and Zhao 2003).
These potential faults may predominantly result from the low metal-
uptake activity and thereby limit its usefulness for practical application.
Among the strategies being used to overcome these disadvantages is

the use of metal transporter to boost the uptake and transport of metal
from soil into transgenic plants (Song et al. 2003). Expression of heavy
metal transporter or periplasmic Hg(II)-binding protein genes under the
control of a constitutive or inducible promoter may provide a means of
improving metal uptake, thereby shortening the phytoremediation
completion time (Kiyono et al. 2013; Kiyono et al. 2012; Nagata et
al. 2009; Hsieh et al. 2006). In the present study, a
transgenic Arabidopsis plants engineered to express mercury
transporter, MerE (Kiyono et al. 2009; Sone et al. 2010) was
constructed and the impact of expression of MerE on methylmercury
accumulation was evaluated.
By using the Agrobacterium- floral dip method, many independent

transgenic Arabidopsis plants were obtained. The results obtained by
genomic PCR (Figure 2B), RT-PCR (Figure 2C) and immunoblot
(Figure 3) analysis demonstrated that the gfp tagged merE was
successfully integrated into the genome of Arabidopsis plants and
substantially transcribed into mRNA and then translated into the
expected fusion proteins in the transgenic plants.
Transgenic Arabidopsis plants expressing merE grew vigorously at
rates similar to those of wild-type plants, without exhibiting notable
symptoms of stress (Figure 5A). These results suggest that the
integration of merE gene had no deleterious effects on the plant
growth. The transgenic Arabidopsis expressing MerE accumulated
significantly more Hg(II) and CH3Hg(I) than the wild-
type Arabidopsis from the mercurial-containing medium (Figure 4).
These results reveal that MerE is indeed functional as a broad-
spectrum mercury transporter in transgenic Arabidopsis, and suggest
that accelerated mercurials uptake into the plants mediated by MerE
would provide one possible way for shortening the completion time of
phytoremediation of mercury pollution.
Growth in a relatively higher concentration of mercurials and

constitutive expression of mercury transport activity seem to be
necessary for the plants applied in mercury remediation. The
transgenic Arabidopsis displayed a relatively high level of Hg(II) and
CH3Hg(I) resistance compared with the wild type (Figure 5). These
results demonstrated that the toxic Hg(II) and CH3Hg(I) in the culture
medium may have been transported into plant cells by the
integrated merE and substantially inactivated in the cells by the
physiological activity of the plant.
Phytoremediation is an effective and aesthetically pleasing technique

for cleaning up soils contaminated with mercurials where excavation or
bioremediation is not practical or possible (Heaton et al. 2003; Lyyra et
al. 2007; Meagher and Heaton 2005). However, the technique is still in
its infancy stage. This study showed that the expression of the
bacterial mercury transporter MerE promoted the transport and
accumulation of mercuric ions and methylmercury in
transgenic Arabidopsis, which may be a useful method to facilitate the
improvement of plants that could be applied to the phytoremediation of
mercuric ions and methylmercury pollution. It is hoped that the
efficiency of these newly-designed transgenic Arabidopsis plants will
be validated in field experiments in the near future.
Declarations
Acknowledgments
We thank Miss. Y. Oka, Mr. H. Tojo, Miss. M. Kaburagi and Miss. C.

Kageyama for their technical assistance. This work was supported in
part by a Grant-in-Aid for Young Scientists (B) (No. 24790128) to Y.S.
and a Grant-in-Aid for Scientific Research (C) (No. 24510104) to M.K.
from the Ministry of Education, Science and Culture, Japan.
Authors' original submitted files for images
Below are the links to the authors original submitted files for images.
13568_2013_167_MOESM1_ESM.pdf Authors original file for figure 1
Competing interests
The authors declare that they have no competing interests.
Authors contributions
YS carried out the molecular studies, characterized transgenic plants,

participated in analysis of mercury accumulation and resistant, and
helped to prepare the manuscript. RN contributed valuable
suggestions to the study. MHS carried out the cellular localization of
GFP-MerE and supervised experimental design. HPH and TI
supervised experimental design and revised the manuscript for
submission. MK conceived and conducted the conception and design
of the study and drafted the manuscript. All authors read and approved
the final manuscript.
References
1. Barkay T, Miller SM, Summers AO: Bacterial mercury resistance
from atoms to ecosystems. FEMS Microbiol Rev 2003,27(23):355
384. 10.1016/s0168-6445(03)00046-9PubMedView ArticleGoogle
Scholar
2. Bullock WO, Fernandez JM, Short JM: XL1-Blue: a high efficiency

plasmid transforming recA Escherichia colistrain with -
galactosidase selection. BioTechniques 1987, 5: 376379.Google
Scholar
3. Clemens S, Palmgren MG, Kramer U: A long way ahead:

understanding and engineering plant metal accumulation. Trends
Plant Sci 2002,7(7):309315. 10.1016/S1360-1385(02)02295-
1PubMedView ArticleGoogle Scholar
4. Clough SJ, Bent AF: Floral dip: a simplified method

for Agrobacterium -mediated transformation of Arabidopsis
thaliana . Plant J 1998,16(6):735743. 10.1046/j.1365-
313x.1998.00343.xPubMedView ArticleGoogle Scholar
5. Harada M: Minamata disease: methylmercury poisoning in Japan

caused by environmental pollution. Crit Rev Toxicol 1995,25(1):1
24. 10.3109/10408449509089885PubMedView ArticleGoogle
Scholar
6. Heaton AC, Rugh CL, Kim T, Wang NJ, Meagher RB: Toward
detoxifying mercury-polluted aquatic sediments with rice
genetically engineered for mercury resistance. Environ Toxicol
Chem 2003,22(12):29402947. 10.1897/02-442PubMedView
ArticleGoogle Scholar
7. Hsieh JL, Chen CY, Chiu MH, Chein MF, Chang JS, Endo G, Huang
CC: Expressing a bacterial mercuric ion binding protein in plant
for phytoremediation of heavy metals. J Hazard Mater 2006,161(2
3):920925. 10.1016/j.jhazmat.2008.04.079Google Scholar
8. Kiyono M, Sone Y, Nakamura R, Pan-Hou H, Sakabe K: The MerE

protein encoded by transposon Tn 21 is a broad mercury
transporter in Escherichia coli . FEBS Lett 2009,583(7):11271131.
10.1016/j.febslet.2009.02.039PubMedView ArticleGoogle Scholar
9. Kiyono M, Oka Y, Sone Y, Tanaka M, Nakamura R, Sato MH, Pan-Hou

H, Sakabe K, Inoue K: Expression of the bacterial heavy metal
transporter MerC fused with a plant SNARE, SYP121,
in Arabidopsis thaliana increases cadmium accumulation and
tolerance. Planta 2012,235(4):841850. 10.1007/s00425-011-1543-
10. Kiyono M, Oka Y, Sone Y, Nakamura R, Sato MH, Sakabe K,

Pan-Hou H: Bacterial heavy metal transporter MerC increases
mercury accumulation in Arabidopsis thaliana . Biochem Eng
J 2013, 71: 1924. 10.1016/j.bej.2012.11.007View ArticleGoogle
Scholar
11. Kramer U: Phytoremediation: novel approaches to cleaning

up polluted soils. Curr Opin Biotechnol 2005,16(2):133141.
10.1016/j.copbio.2005.02.006PubMedView ArticleGoogle Scholar
12. Lyyra S, Meagher RB, Kim T, Heaton A, Montello P, Balish RS,
Merkle SA: Coupling two mercury resistance genes inEastern
cottonwood enhances the processing of organomercury. Plant
Biotechnol J 2007,5(2):254262. 10.1111/j.1467-
7652.2006.00236.xPubMedView ArticleGoogle Scholar
13. Malik A: Metal bioremediation through growing cells. Environ

Int 2004,30(2):261278. 10.1016/j.envint.2003.08.001PubMedView
14. Matsuoka K, Nakamura K: Propeptide of a precursor to a

plant vacuolar protein required for vacuolar targeting.Proc Natl
Acad Sci USA 1991,88(3):834838. 10.1073/pnas.88.3.834PubMed
CentralPubMedView ArticleGoogle Scholar
15. McGrath SP, Zhao FJ: Phytoextraction of metals and

metalloids from contaminated soils. Curr Opin
Biotechnol 2003,14(3):277282. 10.1016/S0958-1669(03)00060-
16. Meagher RB, Heaton AC: Strategies for the engineered

phytoremediation of toxic element pollution: mercury and
arsenic. J Ind Microbiol Biotechnol 2005,32(1112):502513.
10.1007/s10295-005-0255-9PubMedView ArticleGoogle Scholar
17. Mozo T, Hooykaas PJ: Electroporation of megaplasmids into

Agrobacterium. Plant Mol Biol 1991,16(5):917918.
10.1007/BF00015085PubMedView ArticleGoogle Scholar
18. Nagata T, Nakamura A, Akizawa T, Pan-Hou H: Genetic

engineering of transgenic tobacco for enhanced uptake and
bioaccumulation of mercury. Biol Pharm Bull 2009,32(9):14911495.
10.1248/bpb.32.1491PubMedView ArticleGoogle Scholar
19. Nakano A: Spinning-disk confocal microscopy a cutting-

edge tool for imaging of membrane traffic. Cell Struct
Funct 2002,27(5):349355. 10.1247/csf.27.349PubMedView
20. Ruiz ON, Daniell H: Genetic engineering to enhance mercury

phytoremediation. Curr Opin Biotechnol 2009,20(2):213219.
10.1016/j.copbio.2009.02.010PubMed CentralPubMedView
21. Salt DE: Arboreal alchemy. Nat Biotechnol 1998,16(10):905.

10.1038/nbt1098-905PubMedView ArticleGoogle Scholar
22. Sone Y, Pan-Hou H, Nakamura R, Sakabe K, Kiyono M: Roles
played by MerE and MerT in the transport of inorganic and
organic mercury compounds in Gram-negative bacteria. J Health
Sci 2010,56(1):123127. 10.1248/jhs.56.123View ArticleGoogle
Scholar
23. Song WY, Sohn EJ, Martinoia E, Lee YJ, Yang YY, Jasinski M,
Forestier C, Hwang I, Lee Y: Engineering tolerance and
accumulation of lead and cadmium in transgenic plants. Nat
Biotechnol 2003,21(8):914919. 10.1038/nbt850PubMedView
24. Tong YP, Kneer R, Zhu YG: Vacuolar compartmentalization: a

second-generation approach to engineering plants for
phytoremediation. Trends Plant Sci 2004,9(1):79.PubMedView
25. Ueda T, Yamaguchi M, Uchimiya H, Nakano A: Ara6, a

plantunique novel type Rab GTPase, functions in the endocytic
pathway of Arabidopsis thaliana . EMBO J 2001, 20: 47304741.
10.1093/emboj/20.17.4730PubMed CentralPubMedView
26. Uemura T, Ueda T, Ohniwa RL, Nakano A, Takeyasu K, Sato

MH: Systematic analysis of SNARE molecules inArabidopsis :
dissection of the post-Golgi network in plant cells. Cell Struct
Funct 2004,29(2):4965. 10.1247/csf.29.49PubMedView
ORIGINAL ARTICLE
OPEN ACCESS
Mercurial-resistance determinants in Pseudomonas strain K-62 plasmid pMR68
Yuka Sone,
Yusuke Mochizuki,
Keita Koizawa,
Ryosuke Nakamura,
Hidemitsu Pan-Hou,
Tomoo Itoh and
Masako KiyonoEmail author
AMB Express20133:41
DOI: 10.1186/2191-0855-3-41
Sone et al.; licensee Springer. 2013
Received: 5 July 2013
Accepted: 24 July 2013
Published: 28 July 2013
Abstract
We report the complete nucleotide sequence of plasmid pMR68, isolated

from Pseudomonas strain K-62, two plasmids contribute to broad-spectrum mercury resistance
and that the mer operon from one of them (pMR26) has been previously characterized. The
plasmid was 71,020 bp in length and contained 75 coding regions. Three mer gene clusters
were identified. The first comprised merR-orf4-orf5-merT1-merP1-merF-merA-merB1, which
confers bacterial resistance to mercuric ions and organomercury. The second and third clusters
comprised merT2-merP2, which encodes a mercury transport system, and merB2, which
encodes an organomercurial lyase, respectively. The deduced amino acid sequences for the
proteins encoded by each of the mer genes identified in pMR68 bore greater similarity to
sequences from Methylobacterium extorquens AM1 than to those from pMR26, a second
mercury-resistance plasmid from Pseudomonas strain K-62. Escherichia coli cells carrying
pMKY12 (containing merR-orf4-orf5-merT1-merP1-merF-merA-merB1 cloned from pMR68) and
cells carrying pMRA114 (containing merR-merT-merP-merA-merG-merB1 cloned from plasmid
pMR26) were more resistant to, and volatilized more, mercury from mercuric ions and
phenylmercury than the control cells. The present results, together with our earlier findings,
indicate that the high phenylmercury resistance noted for Pseudomonas strain K-62 seems to
be achieved by multiple genes, particularly by the multiple merB encoding organomercurial
lyase and one merG encoding cellular permeability to phenylmercury. The novel mer gene
identified in pMR68 may help us to design new strategies aimed at the bioremediation of
mercurials.
Keywords
Mercury resistance mer operon Plasmid pMR68 Pseudomonas strain K-62
Introduction
Pseudomonas strain K-62, a bacterial strain isolated from phenylmercury-polluted soil, is about
1,000 times more resistant to phenylmercury than sensitive strains of Escherichia
coli (Tonomura et al. 1968). A study performed about 40 years ago showed that the
biochemical mechanism underlying this mercurial resistance is based on the enzymatic
degradation of organomercurials and the subsequent reduction of the resulting mercuric ions
to the less toxic and more volatile metallic mercury (Tonomura et al. 1968). Two separate
organomercurial lyases, designated S-1 and S-2, each showing somewhat different physical
properties and substrate specificities, are thought to be responsible for the resistance of P. K-
62 to phenylmercury (Tezuka and Tonomura 1976;Tezuka and Tonomura 1978). The
organomercurial resistance of this soil strain is encoded by two plasmids, pMR26 and pMR68
(Kiyono et al. 1995b). In addition, pMR26 contains two mer operons that map about 1 kb apart
(Kiyono et al. 1997). One comprises merR- o/p-merT-merP-merA-merG-merB1. The other is a
defective mer operon comprising merR-o/p-merB2-merD (Kiyono and Pan-Hou 1999a).
Studies suggest that merR is a regulatory gene that both negatively and positively controls the
transcription of merTPABD (Ansari et al. 1995;Brown et al. 2003), whereas MerD is a
transcriptional co-regulator (Hobman and Brown 1997;Kiyono et al. 1995a;Lund and
Brown 1987). MerT, merP, merA, and merB encode a membrane Hg2+-transport protein
(Hobman and Brown 1997;Kiyono et al. 1995a;Lund and Brown 1987), a periplasmic Hg2+-
binding protein (Hobman and Brown 1997;Kiyono et al. 1995a;Kiyono et al. 2000;Lund and
Brown 1987), a mercuric reductase (Hobman and Brown 1997; Schiering et al. 1991; Silver and
Phung 1996), and a organomercurial lyase (Griffin et al. 1987;Lafrance-Vanasse et
al. 2009;Miller 1999), respectively. merG, identified in pMR26, is a newly-identified mer-gene
involved in phenylmercury resistance, which is thought to act by reducing cell permeability to
phenylmercury (Kiyono and Pan-Hou 1999b). Taken together, these findings suggest that the
high resistance to phenylmercury shown by P. K-62 is mediated by the two functional
organomercurial lyase enzymes encoded by pMR26 merB1 and merB2 (Kiyono et al. 1995b;
Kiyono and Pan-Hou 1999a), by changes in cellular permeability to phenylmercury mediated
by merG (Kiyono and Pan-Hou 1999b), and by an presumptive mer operon located on plasmid
pMR68 (Kiyono et al. 1995b) However, no mercurial-resistance loci have been identified in
pMR68; indeed, a previous study shows that removal of pMR26 from strain K-62 does not alter
its mercurial-resistant phenotype nor prevent it from volatilizing Hg2+ and organomercurials
(Kiyono et al. 1995b).
To fully explain the high resistance to phenylmercury observed in this strain of soil bacteria, it
is essential to understand the mer genes expressed by pMR68. The aim of the present study
was to completely identify the mercury resistance genes of plasmid pMR68 isolated from
strain K-62. The mer genes encoded by pMR68 were then cloned and analyzed.
Materials and methods
Bacterial strains and culture conditions
P. strain K-62, isolated from phenylmercury-polluted soil in Japan (Tonomura et al. 1968) and
deposited in a culture collection belonging to the WDCM56, was kindly supplied by Dr. K.
Tonomura and grown in nutrient broth as previously described (Tezuka and Tonomura 1976)
(see Table 1). E. coli XL1-Blue was grown at 37C in Luria-Bertani (LB) medium. Antibiotics or
mercuric chloride were added to the medium at the following concentrations when
appropriate: ampicillin, 100 g/ml (E. coli); mercuric chloride, 40 g/ml.
Table 1
Strains and plasmids used in this study
Stains and plasmids Description or relevant feature(s)
Strains
Stains and plasmids Description or relevant feature(s)
recA1 endA1 gyrA96 thi hsdR17 supE44 relA1 lac/ [F::Tn 10 proAB+lacI q lacZM15
E. coli XL1-Blue
traD36]
82, 68,56, 31, 26, 8.5 kb IC50 of mercuric chloride; 100 ppm, mercury vapor
P. strain K-62 (wild)
plasmids activity; +
P. strain K-62 (mutant 82, 68, 56, 31, 8.5 kb IC50 of mercuric chloride; 50 ppm, mercury vapor
26) plasmids activity; +
P. strain K-62 (mutant 82, 56, 31, 26, 8.5 kb IC50 of mercuric chloride; 17 ppm, mercury vapor
68) plasmids activity; +
P. strain K-62 (mutant IC50 of mercuric chloride; 2 ppm, mercury vapor

82, 56, 31, 8.5 kb plasmids
TY) activity; -
Plasmids
pMR26 26 kb plasmids from P. strain K-62
pMR68 68 kb plasmids from P. strain K-62
pUC118 None; cloning vector
pMRA17 merR-o/p-merT-merP-merA-merG-merB1 of pMR26 in pBluescriptII
pMRA114 merR-o/p-merT-merP-merA-merG-merB1 of pMR26 in pUC118
pMKY12 merR-o/p-orf4-orf5-merT1-merP1-merA-merB1 of pMR68 in pUC118
DNA purification
Six plasmids (8.582 kb) (Kiyono et al. 1995b) were purified from strain K-62 grown in nutrient
broth for 3 days at 30C according to the method of Sasakawa et al. (Sasakawa et al. 1986). The
purified plasmids were loaded into the wells of a 0.7% low-melting temperature agarose gel
(SeaPlaque GTG agarose, Lonza Rockland, Inc., Rockland, ME) and electrophoresed in 0.5TBE
(45 mM Tris HCl, 45 mM boric acid, 1 mM EDTA) in a contour clamped homogeneous electric
field (CHEF) DRII device (Bio-Rad Laboratories, Hercules, CA) with the pulse-time ramped from
10 to 60 s (6 V/cm) for 16 h at 14C. The gels were then stained with ethidium bromide. The
band corresponding to the pMR68 plasmid was excised and equilibrated in small amount of
buffer (10 mM Tris HCl pH 7.5, 0.25 mM EDTA, 100 mM NaCl). The agarose was melted at 68C
and digested with -agarase (New England Biolabs, Hertfordshire, England). The pMR68
plasmid was then concentrated by ethanol precipitation.
DNA sequencing
Purified pMR68 plasmid DNA (15 g) was sequenced by Eurofins MWG Operon (Ebersberg,
Germany) using a Genome Sequencer FLX Titanium system (Roche, Basel, Switzerland).
Shotgun sequencing was then performed on the range of one region of a 16-region picotiter
plate, resulting in 33,964 reads with an average length of 340 bp. The sequences were
assembled using Celera Assembler Version 5.3, generating 18 contigs of at least 1,000 bp in
length, some of which were high coverage (>100-fold). Connections between these contigs and
adjacent contigs with similarly high coverage were identified by looking for sequencing reads
that were split between contigs by the assembly software. Using this process, a chain of seven
contigs was assembled into a 71,020 bp sequence. The joins between the seven contigs were
checked by PCR using the following primer pairs: 1U-68 kb-15850 and 8 L-68 kb-16600; 2U-
68 kb-18520 and 9 L-68 kb-19216; 3U-68 kb-19421 and 10 L-68 kb-20259; 4U-68 kb-38451 and
11 L-68 kb-39477; 5U-68 kb-42220 and 12 L-68 kb-43396; 6U-68 kb-67929 and 13 L-68 kb-
68480; and 7U-68 kb-70484 and 14 L-68 kb-457 (see Additional file 1: Table S1).
After the complete nucleotide sequence of pMR68 was obtained, potential open reading
frames (ORFs) was searched using the program of genetic information processing software
(Genetyx corporation, Tokyo, Japan) and using protein BLAST
(http://blast.ncbi.nlm.nih.gov/Blast.cgi) to confirm the results. Conserved domains were
identified searching for Clusters of Orthologous Groups of proteins (COGs) in the NCBI data
base. The molecular weights of the encoded proteins were determined by ProtParam (Swiss
Institute of Bioinformatics; http://www.expasy.ch/tools/protparam.html). The annotated
sequence of pMR68 was deposited in the NCBI database under Accession No. NC019309.
Gene cloning and analysis of the mer operon
Plasmid pMKY12 was constructed as follows: Plasmid pMR68 (accession no. NC019309) was
used as the template for PCR amplification (PrimeSTAR GXL DNA polymerase, Takara Bio, Inc.,
Otsu, Japan) of a 10.3 kb fragment containing the merR- o/p-ofr4-orf5-merT1-merP1-merF-
merA-merB1 genes. The primers used were 16U-68 kb-2393 and 21 L-68 kb-9566 (Additional
file 1: Table S1). After blunting and 5'-phosphorylation of the DNA fragment using a Mighty
Cloning Kit (Blunt End) (Takara Bio, Inc., Otsu, Japan), the DNA fragment was cloned into the
blunt-ended (Hin c II) vector, pUC118 (Vieira and Messing 1987).
Plasmid pMRA114 was constructed as follows: Plasmid pMRA17, containing a

6.6 kb merR- o/p-merT-merP-merA-merG-merB1 fragment from pMR26 (accession no.
D83080), which contains restriction sites for Sac I, was used as the starting material. After
digestion with Sac I, the 6.6 kb fragment was cloned into the corresponding sites in pUC118.
The integrity of all cloned fragments was confirmed by sequencing.
Mercury susceptibility tests and volatilization activity tests
The resistance of E. coli XL1-Blue carrying pUC118 (control vector), pMRA114, or pMKY12 to
HgCl2 or C6H5HgOCOCH3 was determined in liquid medium. E. coli cells carrying the control or
recombinant plasmids were grown overnight in LB medium at 37C. Cells were harvested and
suspended in LB medium (1.6107cells/200 L/well) containing HgCl2 or C6H5HgOCOCH3 at
various concentrations. After incubation at 37C for 16 h, the absorbance of each culture was
read at A600 to measure cell growth.
The mercury volatilization assay was performed as follows: E. coli cells carrying the control or
recombinant plasmids were grown to mid-exponential phase and then suspended in LB
medium containing 50 M HgCl2 or 5 M C6H5HgOCOCH3. After incubating at 37C for 16 h, the
samples were digested with concentrated nitric acid for 2 h at 90C and the amount of
mercury remaining in the medium was determined by flameless cold-vapour atomic
adsorption spectrometry using an atomic mercury analyser (HG-310; Hiranuma, Japan).
Results
General features of plasmid pMR68
The complete nucleotide sequence of plasmid pMR68 was assembled into a circular DNA
sequence comprising 71,020 bp, with an overall G+C content of 64.5%. The sequence showed
that pMR68 was 3 kb larger than previously calculated on the basis of agarose gel
electrophoresis (Kiyono et al. 1995b). Figure 1 shows a detailed genetic map of pMR68. The
predicted coding regions showed a particular genetic organization, highlighting two well-
defined regions that corresponded to genomic islands (comprising 41 kb of the complete
plasmid). The first region possessed a 21 kb island (pMR68 co-coordinates: 59,28571,020 and
19,472), which contained genes involved in mercurial resistance and mobility (Figure 1). The
second region possessed a 20 kb island (pMR68 co-coordinates; 10,18930,567), which
contained plasmid transposable elements (Figure 1). A summary of the sequence data for
pMR68, including the length and molecular mass of the predicted proteins and their sequence
homology with known proteins, is shown in Additional file 2: Table S2.
Figure 1
Genetic map of the P. strain K-62 plasmid, pMR68. The deduced coding regions are shown by
open arrows indicating the direction of transcription. The circular positions are indicated at
intervals of 20,000 bp. The gene clusters responsible for mercurial resistance, transposable
elements, metabolizing enzymes, and hypothetical proteins are indicated by the black, gray,
open and shaded arrows, respectively.
Mercury-resistance (HgR) determinants
The pMR68 plasmid contained three putative mercury-resistance (mer) gene clusters
(Figure 1): Cluster 1) a potential mer operon, consisting of the merR-orf4-orf5-T1-P1-F-A-
B1 genes (ORFs 3 and 610); Cluster 2) mercury transport genes, merT2-P2 (ORFs 62 and 63);
and Cluster 3) an organomercurial lyase gene, merB2 (ORF 72) (Additional file 2: Table S2 and
Figures 1 and 2). The potential mer operon within pMR68 was located between putative
transposable elements, and flanked by genes encoding a transposase IS4 family protein (ORF
75) and a transposase IS5 family protein (ORF 11) (Additional file 2: Table S2). The
incomplete mer operon (cluster 2) within pMR68 was also located between putative
transposable elements, and flanked by genes encoding a transposase IS30 family protein (ORF
56) and a transposase IS116 family protein (ORF 68) (Additional file 2: Table S2). The DNA
sequence showed the presence of putative promoters upstream of the merT1 genes within the
complete mer operon of cluster 1 (Figure 2). Upstream of merR and upstream of merT1 were
sequences containing potential 35 (ATCAGA) and 10 (GATTAT) and 35 (TTGCAC) and 10
(CATAAT) sequences, and a dyad symmetrical sequence (GCACCTGTAGCCGCTACAGGTTG),
respectively, which could be interpreted as an operator/promoter (o/p) sequence (cluster 1,
Figure 2).
Figure 2
Organization of the mer operon of pMR68 and its homology with the
corresponding mer genes identified in pMR68. merR, regulatory gene; merT and merF,
mercury transport genes; merP, mercury binding gene; merA, mercuric reductase gene; merB,
organomercurial lyase gene; orf, unknown open reading frame.
ORF4 (encoding a hypothetical protein (HP)) and ORF5 (showing 63% identity to
phosphoribosyl-AMP cyclohydrolase from Parvibaculum lavamentivorans DS-1) were located
between MerR and MerT1. Two sets of merT, merP, and merB genes were found in pMR68,
and the similarities between merT1 and merT2, merP1 and merP2,
and merB1 and merB2 ranged from 27% to 69% at both the nucleic acid and amino acid levels
(Figure 2). The sequence similarity between the pMR68 and pMR26 proteins (Kiyono et al.
1997;Kiyono and Pan-Hou 1999a) from strain K-62 or the well-known pDU1358 (Griffin et
al. 1987) and Tn21 (Gilbert and Summers 1988;Liebert et al. 1999) proteins from Gram-
negative bacteria was low (Table 2).
Table 2
Amino acid sequence homology of mer genes between pMR68 and pMR26, pDU1358,
Tn 21 or M. extorquens AM1 putative mer operon
% of amino acid sequence homology
pMR68 MerR MerT1 MerT2 MerP1 MerP2 MerF MerA Me
pMR26 32.4 38.8 47.0 31.3 36.0 - 35.4 21
pDU1358 32.5 38.8 45.5 31.2 36.0 - 26.7 21
Tn21 31.8 38.8 47.0 31.1 38.7 - 38.6 -
M. extorquens AM1 73.0 76.0 71.0 76.0 67.0 - 84.0 -
Gene cloning and analysis of the mer operon
To identify the physiological role played by the mer operons in pMR68 and pMR26 in E. coli,
we constructed recombinant plasmids pMKY12 and pMRA114, which contained the merR-orf4-
orf5-merT1-merP1-merF-merA-merB1 genes from pMR68 and the merR-merT-merP-merA-
merG-merB1 genes from pMR26, respectively (Table 1). Bacteria containing pMKY12 showed
greater resistance to Hg(II) than control cells carrying plasmid pUC118; the level of resistance
was almost the same as that shown by cells containing pMRA114 (Figure 3A).
Figure 3
Susceptibility to mercurials. E. coli cells carrying pUC118 (filled triangles), pMKY12 (filled
circles), or pMRA114 (filled diamonds) were grown in liquid medium containing varying
concentrations of HgCl2 (A) or C6H5HgOCOCH3(B). Growth was estimated by measuring the
turbidity at 600 nm. Data represent the meanS.D. of triplicate measurements from three
independent experiments. *p<0.05 vs. control. **p<0.01 vs. control. ## p<0.01 vs. pMRA114.
We next examined the volatilization of mercury from Hg(II) and C6H5Hg(I) by cells containing a
control vector (pUC118) or the pMKY12 or pMRA114 plasmids. As shown in Figure 4, cells
carrying both pMKY12 and pMRA114 were able to volatilize mercury from both Hg(II) and
C6H5Hg(I). Volatilization of Hg(II) was similar between cells carrying pMKY12 or pMRA114;
however, volatilization of C6H5Hg(I) was significantly higher in cells carrying pMKY12 than in
those carrying pMRA114 (Figure 4B). A volatilization test indicated that the cells carrying
pMKY12 were able to volatilize almost 90% of the total phenylmercury.
Figure 4
Volatilization of mercury from Hg(II) and C 6 H 5 Hg(I). E. coli cells carrying pUC118 (empty bar),
pMRA114 (shaded bar), or pMKY12 (black bar) were grown in liquid medium containing 50 M
HgCl2 (A) or 5 M C6H5HgOCOCH3 (B). After incubation at 37C for 16 h, the amount of mercury
remaining in the medium was measured as described in Materials and Methods. Data
represent the meanS.D. of triplicate measurements from three independent experiments.
**p<0.01 vs. control. ## p<0.01 vs. pMRA114.
Discussion
The present study determined the complete nucleotide sequence of plasmid pMR68 (isolated
from P. strain K-62). In addition, the mer genes in pMR68 and pMR26 were identified,
sequenced, and cloned in E. coli. The pMR68 sequence contained 75 complete coding regions;
however, we were not able to identify a predicted origin of replication (Additional file 2: Table
S2 and Figure 1). Although most of the identified genes (44%) encoded mobile elements
related to transfer functions, 12% encoded mercurial-resistance determinants, 16% encoded
metabolism-related genes, and 28% encoded hypothetical proteins (HPs).
One of the three mer- gene clusters in pMR68 (merR-orf4-orf5-merT1-merP1-merF-merA-

merB1) was identified as a potential mer operon, which confers bacterial resistance to both
inorganic and organic mercury (Additional file 2: Table S2 and Figure 3). The number and order
of the mer genes on this potential mer operon were different to those of merR1- o/p-T-P-A-G-
B1 of pMR26 (which encodes resistance to both inorganic and organic mercury)
and merR2- o/p-B2-D of pMR26 (which confers bacterial hypersensitivity to organomercury
compounds) (Table 2 and Figures 1 and 2) (Kiyono et al. 1997;Kiyono and Pan-
Hou 1999a;Kiyono et al. 1997). The deduced amino acid sequences for the proteins encoded
by the mer genes in pMR68 were more similar (6784%) to those of a putative mer operon
in Methylobacterium extorquens AM1, which lacks the merB gene (Vuilleumier et al. 2009),
than to those in pMR26 (2147%) (Table 2).
We identified potential 35 and 10 sequences and a dyad symmetrical sequence lying

upstream of pMR68 merR and upstream of merT1, respectively; these sequences may
represent putative promoters of the mer operon of cluster 1 in pMR68. The distance between
the 35 and 10 positions within the putative pMR68 merR promoter was 19 bp. The spacing
between the merR promoter and Tn21 in pMR26 was also 19 bp, which is essential for the
twist and bend mechanism underlying transcriptional activation (Ansari et al. 1995;Kiyono et
al. 1997;Kiyono and Pan-Hou 1999a). Taken together, these observations suggest that merT1-
P1-F-A-B1 is regulated by both the merR gene and the mer operator.
Volatilization of mercury from organomercurials is thought to result from the degradation of

organic mercury by the organomercurial lyase encoded by merB, followed by the reduction of
the resulting Hg2+ to volatile Hg0 by the mercuric reductase encoded by merA (Barkay et
al. 2003;Silver and Phung le 2005). Cells carrying pMKY12 (containing merR-orf4-orf5-merT1-
merP1-merF-merA-merB1 cloned from pMR68) and cells carrying pMRA114 (containing merR-
merT-merP-merA-merG-merB1 cloned from plasmid pMR26) were more resistant to, and
volatilized more, mercury from mercuric chloride and phenylmercuric acetate than the control
cells (Figures 3 and 4).
The present results, together with those of our previous study, suggest that the high resistance
to phenylmercury shown by strain K-62 may be due to the following: [1] the functional
organomercurial lyase enzymes encoded by pMR26 merB1 and merB2 (Kiyono et
al. 1995b;Kiyono et al. 1997;Kiyono and Pan-Hou 1999a), and pMR68 merB1; [2] the two
functional mercuric reductases encoded by pMR26 merA (Kiyono et al. 1995b;Kiyono and Pan-
Hou 1999a) and pMR68 merA; [3] the multi-functional transporters encoded by
pMR26 merT and merP (Kiyono et al. 1995a;Kiyono et al. 2000;Nagata et al. 2006;Uno et
al. 1997), and by pMR68 merT1-merP1-merF; and [4] alterations in cellular permeability to
phenylmercury mediated by pMR26 merG (Kiyono and Pan-Hou 1999b). Further analysis
of orf4 and orf5 within pMR68 is currently on-going.
In conclusion, sequence analysis of pMR68 showed that the plasmid contains novel genes that
may provide Pseudomonas strains with the means to adapt to a wide variety of challenging
environments, including exposure to heavy metals. Such resistance mechanisms are likely to
be linked to the evolution of the bacterial hosts. The novel mer gene identified in pMR68 may
help us to design new strategies aimed at the bioremediation of mercury-containing
compounds present in the environment.
Declarations
Acknowledgments
We thank Miss M. Suzuki, Mr. M. Saito and Mr. I. Okuno for their technical assistance. This
work was supported in part by a Grant-in-Aid for Young Scientists (B) (No. 24790128) to Y.S.
and a Grant-in-Aid for Scientific Research (C) (No. 24510104) to M.K. from the Ministry of
Education, Science and Culture, Japan.
Electronic supplementary material
13568_2013_155_MOESM1_ESM.pdf Additional file 1: Table S1: Oligonucleotide primers used

in this study. (PDF 30 KB)
13568_2013_155_MOESM2_ESM.pdf Additional file 2: Table S2: Summary of location of

predicted coding regions on plasmid pMR68. (PDF 71 KB)
Below are the links to the authors original submitted files for images.
Competing interests
The authors declare that they have no competing interests.
References
1. Ansari AZ, Bradner JE, O'Halloran TV: DNA-bend modulation in a repressor-to-

activator switching mechanism.Nature 1995,374(6520):371375.
10.1038/374370a0PubMedView ArticleGoogle Scholar
2. Barkay T, Miller SM, Summers AO: Bacterial mercury resistance from atoms to
ecosystems. FEMS Microbiol Rev 2003,27(23):355384. 10.1016/s0168-
6445(03)00046-9PubMedView ArticleGoogle Scholar
3. Brown NL, Stoyanov JV, Kidd SP, Hobman JL: The MerR family of transcriptional
regulators. FEMS Microbiol Rev 2003,27(23):145163.PubMedView ArticleGoogle
Scholar
4. Bullock WO, Fernandez JM, Short JM: XL1-Blue: A high efficiency plasmid
transforming recA Escherichia colistrain with beta-galactosidase
selection. Biotechniques 1987,5(4):376379.Google Scholar
5. Gilbert MP, Summers AO: The distribution and divergence of DNA sequences related
to the Tn 21 and Tn 501 meroperons. Plasmid 1988,20(2):127136. 10.1016/0147-
619X(88)90015-7PubMedView ArticleGoogle Scholar
6. Griffin HG, Foster TJ, Silver S, Misra TK: Cloning and DNA sequence of the mercuric-
and organomercurial-resistance determinants of plasmid pDU1358. Proc Natl Acad
Sci USA 1987,84(10):31123116. 10.1073/pnas.84.10.3112PubMed
CentralPubMedView ArticleGoogle Scholar
7. Hobman JL, Brown NL: bacterial mercury-resistance genes. Met Ions Biol
Syst 1997, 34: 527568.PubMedGoogle Scholar
8. Kiyono M, Pan-Hou H: DNA sequence and expression of a defective mer operon

from Pseudomonas K-62 plasmid pMR26. Biol Pharm Bull 1999,22(9):910914.
10.1248/bpb.22.910PubMedView ArticleGoogle Scholar
9. Kiyono M, Pan-Hou H: The merG gene product is involved in phenylmercury

resistance in Pseudomonas strain K-62. J Bacteriol 1999,181(3):726730.PubMed
CentralPubMedGoogle Scholar
10. Kiyono M, Omura T, Fujimori H, Pan-Hou H: Lack of involvement of merT and merP in
methylmercury transport in mercury resistant Pseudomonas K-62. FEMS Microbiol
Lett 1995,128(3):301306. 10.1111/j.1574-6968.1995.tb07540.xPubMedView
11. Kiyono M, Omura T, Fujimori H, Pan-Hou H: Organomercurial resistance determinants

in Pseudomonas K-62 are present on two plasmids. Arch Microbiol 1995,163(4):242
247. 10.1007/BF00393375PubMedView ArticleGoogle Scholar
12. Kiyono M, Omura T, Inuzuka M, Fujimori H, Pan-Hou H: Nucleotide sequence and

expression of the organomercurial-resistance determinants from a Pseudomonas K-
62 plasmid pMR26. Gene 1997,189(2):151157. 10.1016/S0378-1119(96)00741-
XPubMedView ArticleGoogle Scholar
13. Kiyono M, Uno Y, Omura T, Pan-Hou H: Role of MerT and MerP from Pseudomonas K-
62 plasmid pMR26 in the transport of phenylmercury. Biol Pharm
Bull 2000,23(3):279282. 10.1248/bpb.23.279PubMedView ArticleGoogle Scholar
14. Lafrance-Vanasse J, Lefebvre M, Di Lello P, Sygusch J, Omichinski JG: Crystal structures

of the organomercurial lyase MerB in its free and mercury-bound forms: insights into
the mechanism of methylmercury degradation. J Biol Chem 2009,284(2):938944.
10.1074/jbc.M807143200PubMedView ArticleGoogle Scholar
15. Liebert CA, Hall RM, Summers AO: Transposon Tn 21 , flagship of the floating
genome. Microbiol Mol Biol Rev 1999,63(3):507522.PubMed CentralPubMedGoogle
Scholar
16. Lund PA, Brown NL: Role of the merT and merP gene products of transposon
Tn 501 in the induction and expression of resistance to mercuric
ions. Gene 1987,52(23):207214.PubMedView ArticleGoogle Scholar
17. Miller SM: Bacterial detoxification of Hg(II) and organomercurials. Essays

Biochem 1999, 34: 1730.PubMedGoogle Scholar
18. Nagata T, Kiyono M, Pan-Hou H: Involvement of aromatic amino acids in

phenylmercury trasport by MerT protein.J Health Sci 2006,52(4):475477.
10.1248/jhs.52.475View ArticleGoogle Scholar
19. Sasakawa C, Kamata K, Sakai T, Murayama SY, Makino S, Yoshikawa M: Molecular

alteration of the 140-megadalton plasmid associated with loss of virulence and
Congo red binding activity in Shigella flexneri . Infect Immun 1986,51(2):470
475.PubMed CentralPubMedGoogle Scholar
20. Schiering N, Kabsch W, Moore MJ, Distefano MD, Walsh CT, Pai EF: Structure of the
detoxification catalyst mercuric ion reductase from Bacillus sp. strain
RC607. Nature 1991,352(6331):168172. 10.1038/352168a0PubMedView
21. Silver S, le Phung T: A bacterial view of the periodic table: genes and proteins for
toxic inorganic ions. J Ind Microbiol Biotechnol 2005,32(1112):587605.
10.1007/s10295-005-0019-6PubMedView ArticleGoogle Scholar
22. Silver S, Phung LT: Bacterial heavy metal resistance: new surprises. Annu Rev
Microbiol 1996, 50: 753789. 10.1146/annurev.micro.50.1.753PubMedView
23. Tezuka T, Tonomura K: Purification and properties of an enzyme catalyzing the

splitting of carbon-mercury linkages from mercury-resistant Pseudomonas K-62
strain. I. Splitting enzyme 1. J Biochem 1976,80(1):7987.PubMedGoogle Scholar
24. Tezuka T, Tonomura K: Purification and properties of a second enzyme catalyzing the
splitting of carbon-mercury linkages from mercury-resistant Pseudomonas K-62. J
Bacteriol 1978,135(1):138143.PubMed CentralPubMedGoogle Scholar
25. Tonomura K, Maeda K, Futai F, Nakagami T, Yamada M: Stimulative vaporization of

phenylmercuric acetate by mercury-resistant bacteria. Nature 1968,217(5129):644
646.PubMedView ArticleGoogle Scholar
26. Uno Y, Kiyono M, Tezuka T, Pan-Hou H: Phenylmercury transport mediated by merT-

merP genes of PseudomonasK-62 plasmid pMR26. Biol Pharm Bull 1997,20(1):107
109. 10.1248/bpb.20.107PubMedView ArticleGoogle Scholar
27. Vieira J, Messing J: Production of single-stranded plasmid DNA. Methods

Enzymol 1987, 153: 311.PubMedView ArticleGoogle Scholar
28. Vuilleumier S, Chistoserdova L, Lee MC, Bringel F, Lajus A, Zhou Y, Gourion B, Barbe V,
Chang J, Cruveiller S, Dossat C, Gillett W, Gruffaz C, Haugen E, Hourcade E, Levy R,
Mangenot S, Muller E, Nadalig T, Pagni M, Penny C, Peyraud R, Robinson DG, Roche D,
Rouy Z, Saenampechek C, Salvignol G, Vallenet D, Wu Z, Marx CJ, Vorholt JA, Olson MV,
Kaul R, Weissenbach J, Medigue C, Lidstrom ME: Methylobacterium genome
sequences: a reference blueprint to investigate microbial metabolism of C1
compounds from natural and industrial sources. PLoS One 2009,4(5):e5584.
10.1371/journal.pone.0005584PubMed CentralPubMedView ArticleGoogle Scholar

Trabajo 2

Загружено:

Сведения о документе

Оригинальное название

Авторское право

Доступные форматы

Поделиться этим документом

Поделиться или встроить документ

Параметры публикации

Этот документ был вам полезен?

Это неприемлемый материал?

Авторское право:

Доступные форматы

Trabajo 2

Загружено:

Авторское право:

Доступные форматы

http://funpecrp.com.br/gmr/year2003/vol1-2/sim0005_full_text.

Operon mer: Bacterial resistance to mercury and

Departamento de Biologia Geral, Instituto de Cincias Biolgicas,

Universidade Federal de Minas Gerais, Avenida Antnio Carlos, 6627,

31270-901 Belo Horizonte, MG, Brasil

Corresponding author: A.M.A. Nascimento

Genet. Mol. Res. 2 (1): 92-101 (2003)

Received November 27, 2002

Published March 31, 2003

Key words: Operon mer, Bacterial mercury resistance, Bioremediation

MERCURY CYCLE IN THE ENVIRONMENT

BIOCHEMICAL BASIS OF BACTERIAL MERCURY RESISTANCE

As a response to toxic mercury compounds globally distributed by geological and anthropogenic

Based on a comparison with other bacterial periplasmic binding, protein-dependent transport

The biochemical mechanism for broad-spectrum resistance to organomercurials involves, in addition

STRUCTURE OF THE MER OPERON

MERCURY AND ANTIBIOTIC RESISTANCE

Daher, V. (1999). No rastro do mercrio. Cinc. Hoje 26: 46-48.

Bacterial broad-spectrum mercury

Phytoremediation refers to the use of green plants in the removal of

The current study evaluated the feasibility of engineering

Materials and methods

recaAI endAI gyrA96 thi hsdR17 supE44 reIAI

pE4 meR-o/p-merE in pKF19k (Kiyo

None: binary expression vector with a CaMV35S promoter (Mats

CaMV35S(S65T)-NOS3 GFP in pUC18 (Uem

pE18 GFP-MerE in pUC18 This s

pMAE2 MerE in pMAT137 This s

Confocal laser scanning microscopy

Transformation of plants and confirmation of transgenic plants

Plant genomic DNA was isolated from transformed and untransformed

Quantitation of mRNA levels by reverse transcription PCR

Subcellular fractionation of Arabidopsis tissues

SDS-PAGE and immunoblotting

weight) that accumulated in wild-type plants (Wild; empty bar)

data are expressed as the means S.E.M. based on four

plants were germinated and grown on MS gellan gum plates in the

Among the strategies being used to overcome these disadvantages is

By using the Agrobacterium- floral dip method, many independent

Growth in a relatively higher concentration of mercurials and

Phytoremediation is an effective and aesthetically pleasing technique

We thank Miss. Y. Oka, Mr. H. Tojo, Miss. M. Kaburagi and Miss. C.

Authors' original submitted files for images

The authors declare that they have no competing interests.

YS carried out the molecular studies, characterized transgenic plants,

2. Bullock WO, Fernandez JM, Short JM: XL1-Blue: a high efficiency

3. Clemens S, Palmgren MG, Kramer U: A long way ahead:

4. Clough SJ, Bent AF: Floral dip: a simplified method

5. Harada M: Minamata disease: methylmercury poisoning in Japan

8. Kiyono M, Sone Y, Nakamura R, Pan-Hou H, Sakabe K: The MerE

9. Kiyono M, Oka Y, Sone Y, Tanaka M, Nakamura R, Sato MH, Pan-Hou

10. Kiyono M, Oka Y, Sone Y, Nakamura R, Sato MH, Sakabe K,

11. Kramer U: Phytoremediation: novel approaches to cleaning

13. Malik A: Metal bioremediation through growing cells. Environ

14. Matsuoka K, Nakamura K: Propeptide of a precursor to a

15. McGrath SP, Zhao FJ: Phytoextraction of metals and

16. Meagher RB, Heaton AC: Strategies for the engineered

17. Mozo T, Hooykaas PJ: Electroporation of megaplasmids into

18. Nagata T, Nakamura A, Akizawa T, Pan-Hou H: Genetic

19. Nakano A: Spinning-disk confocal microscopy a cutting-

20. Ruiz ON, Daniell H: Genetic engineering to enhance mercury

21. Salt DE: Arboreal alchemy. Nat Biotechnol 1998,16(10):905.

24. Tong YP, Kneer R, Zhu YG: Vacuolar compartmentalization: a