RESEARCH ARTICLE

FineScale Population Genetics

Analysis of Platynereis dumerilii
(Polychaeta, Nereididae) in the
Black Sea: How Do Local
Marine Currents Drive
Geographical Differentiation?
LUIS OVIDIU POPA1,2*, OANA PAULA POPA1,
ANAMARIA KRAPAL1,3, ELENA IULIA IORGU1,
2
AND VICTOR SURUGIU *
1
Department of Molecular Biology, Grigore Antipa National Museum of Natural History,
Bucharest, Romania
2
Faculty of Biology, Alexandru Ioan Cuza University of IaSsi, IaSsi, Romania
3
Faculty of Biology, University of Bucharest, Bucharest, Romania

ABSTRACT In this study we analyzed at a submesogeographic scale (2 km) the genetic diversity of two sub
populations of Platynereis dumerilii and correlated this with the physical characteristics of the
marine currents along the western Black Sea coast. For this purpose, we developed a set of 13 new
polymorphic microsatellite markers and used them to assess the genetic differentiation, as well as
the bidirectional migration rates between the studied subpopulations. We also computed the
Peclet number (Pe) as an indicator of the relative effect of advection and eddy diffusion on larval
dispersion for the specic conditions of the Black Sea study area. The results indicated no genetic
structure in P. dumerilii subpopulations which indicates that the longitudinal alongshore currents
dominate in the population structuring of this species. This nding is important, because with the
average current speeds of 5 cm/sec on the Black Sea coast during MayAugust we might have
expected a certain population structuring to occur. In accordance with the periodical change of
direction of the longitudinal current (either form North to South, or form South to North)
the gene ow was found to be bidirectional, with the same intensity. J. Exp. Zool. 321A:4147,
2014. 2013 Wiley Periodicals, Inc.
How to cite this article: Popa LO, Popa OP, Krapal AM, Iorgu EI, Surugiu V. 2014. Finescale
J. Exp. Zool. population genetics analysis of Platynereis dumerilii (Polychaeta, Nereididae) in the Black Sea:
321A:4147, 2014 How do local marine currents drive geographical differentiation? J. Exp. Zool. 321A:4147.

Grant sponsor: CommScie; grant number: POSDRU/89/1.5/S/63663.
Conflicts of interest: None.
Luis Ovidiu Popa and Oana Paula Popa contributed equally to this paper.
*Correspondence to: Luis Ovidiu Popa, Department of Molecular Biology,
Grigore Antipa National Museum of Natural History, Kiseleff Street, No. 1,
Bucharest 011341, Romania.
Email: popaluis@antipa.ro or
*Correspondence to: Victor Surugiu, Faculty of Biology, Alexandru Ioan Cuza
University of IaSsi, 20A, Carol I Boulevard, Iasi 700507, Romania.
Email: vsurugiu@uaic.ro
Received 12 April 2013; Revised 21 August 2013; Accepted 4 September
2013
DOI: 10.1002/jez.1835
Published online 7 October 2013 in Wiley Online Library

2013 WILEY PERIODICALS, INC.

42
The polychaete Platynereis dumerilii (Audouin and M.Edwards,
1834), also known as Dumeril's clam worm, is widely distributed
on both Atlantic coasts from tropical to temperate waters of both
hemispheres (Simakov et al., 2012). The species is one of the
leading components of the macrophyte communities in the Black
Sea, acting as keystone species by controlling the matter and
energy uxes between primary producers and higher trophic
levels (Kisseleva, '71; Makkaveeva, '76). It is also widely used as
indicator species in ecological and environmental quality
assessment studies, exhibiting uctuating population parameters
under pollution and eutrophication stress (Grassle and Grassle, '74;
; Bellan, '80; Borja et al., 2000; Simboura and Zenetos, 2002).
In the Black Sea the species is particularly abundant at depths of
up to 8 m on rocky substrate (Sarmatic limestone) covered by algae
and in eutrophic environments (Kisseleva, '71; Giangrande
et al., 2002; Surugiu and Novac, 2007). The rocky bed is
interrupted from place to place by sandy sediments creating a
patchy habitat for the species (Bacescu et al., '71).
This tubedwelling species, widely studied from the reproduc-
tive point of view, is characterized by low motility and a
semelparous life cycle with a brief pelagic lecithotrophic
development (Fischer et al., 2010).
P. dumerilii is one of the many marine species, which are
sedentary as adults and are dispersed by currents during larval
planktonic stages. For many such species, the dispersal range is
considered now much smaller than it used to be, as small as
hundreds of meters for species with relatively closed populations
(Pinsky et al., 2012). For these species, the simplest scenario would
be that the main current speed and direction determine their
distribution, the population sources, and dispersal routes. If the
main current is the only force driving the dispersal, these species
will exhibit a distribution range moving constantly downstream.
The persistence of species upstream suggests that different forces
are involved in the dispersal process. More realistic (and complex)
scenarios for marine species dispersal take into consideration
different factors, like the main current, the uctuating currents
and the biology of the species (larval production, larval behavior)
(Byers and Pringle, 2006).
The relative importance of these factors remains to be studied in
particular species and/or marine environments. In this study we
analyzed the genetic diversity of P. dumerilii at a submeso
geographic scale and correlated this with the physical character-
istics of the marine currents along the western Black Sea coast.
MATERIALS AND METHODS
Material Collection
Populations of P. dumerilii were sampled in July 2011 at two sites
(A, Agigea and B, Belona) situated approximately 2 km apart,
along the Romanian Black Sea coast (Fig. 1). Distances between 1
and 10 km are classied by Niewiadomska et al. (2008) as
submesogeographic scale in marine studies. At each site, samples
J. Exp. Zool.
POPA ET AL.
were collected at 0.5 m depth, by scraping off mussels and algal
mat covering rocky seabed. Specimens of P. dumerilii were picked
up in situ and/or in the laboratory by hand and transferred to 96%
ethanol. Genomic DNA was extracted from the posterior half of
the body with the NucleoSpin Tissue kit (MachereyNagel GmbH
& Co. KG, Dren, Germany), according to the producer's
specications. For this study we used 24 specimens from Agigea
and 20 specimens from Belona.
Lagrangian Descriptions of Marine Larval Dispersion
Larval dispersion is determined by two simultaneous processes,
advection, and eddy diffusion (spreading) over the same time scale
for which the circulation is calculated. The relative effect of
advection and eddy diffusion on larval dispersion was estimated
as the Peclet number (Pe), using a Lagrangian (water parcel
following) model of larval dispersion based on larval pre
competency/competency periods and basic statistics of coastal
oceanographic ow elds. The Peclet number is a measure of the
effectiveness of advective or diffusive transports in marine
environment (Kjerfve and Magill, '89). We calculated Pe using the
following equation (Siegel et al., 2003):
U 2T
Pe
s2 t
where, U is the mean alongshore current velocity (in cm/sec)
experienced by larvae in plankton, T is the time larvae spend in
plankton (in days), s is a measure of the amplitude of the
uctuating currents alongshore experienced by planktonic larvae
(in cm/sec), and t is the Lagrangian decorrelation time scale (in
days) and it equals the approximate time after which the particle's
motion will become independent of the value for the previous time
step.
The following values of the above parameters were used: U 3
20 cm/sec (ISMAR, 2013), T 7 days (Fischer et al., 2010), and
s 30 cm/sec (Siegel et al., 2003).
The Lagrangian decorrelation time is assumed to vary with
distance offshore, as described by the equation (Siegel et al., 2003):
ty 3  2:5e2y ;
where y is the distance offshore (in km). For y 0.001 km, we
obtained a value of t 0.5 days.
Isolation of Microsatellite Markers
Microsatellite markers were isolated using two different strategies.
First a set of EST sequences was generated by interrogation of the
Nucleotide database of GenBank, with the following query:
txid6359[Organism:noexp] and EST. This yielded a total of
1,825 DNA sequences which were mined for microsatellites with
the SciRoKo 3.4 software package (Koer et al., 2007). The search
POPULATION GENETICS OF Platynereis dumerilii
Figure 1. The map of the study area with location of sampling sites. Site A, Agigea; Site B, Belona.
criteria were set at minimum three repetitions for di, tri, tetra,
penta, and hexanucleotides. For the sequences containing
microsatellite motifs, PCR primers were designed with Primer3
(Rozen and Skaletsky, 2000). For the second approach, microsat-
ellite markers were isolated using 454 FLX Titanium pyrosequenc-
ing technology (Malausa et al., 2011). The DNA libraries, highly
enriched in microsatellites loci, have been prepared by a
technology developed by Genoscreen (Lille, France). Eight probes
were used in the enrichment procedure: TG, TC, AAC, AAG, AGG,
ACG, ACAT, and ACTC.
The PCR genotyping reaction was performed in a 10 mL total
volume containing about 50 ng of DNA template, 10 mM TrisHCl
(pH 8.8 at 25C), 50 mM KCl, 0.08% (v/v) Nonidet P40, 2.5 mM
MgCl2, each dNTP at 0.1 mM, each primer at 0.1 mM (the forward
primer of each locus was 50 end labeled with an M13tail to enable
43
uorescentdye labeling), 0.02 mM of IRD700 or IRD800 labeled
M13 primer and 0.5 units of Taq DNA polymerase (Fermentas
UAB, Vilnius, Lithuania). The temperature prole of the PCR
reaction consisted of an initial denaturation step at 95C for 3 min
followed by 30 cycles of denaturation at 95C for 30 sec, annealing
at a specic temperature for each locus (see Table 1 for details for
each locus) for 30 sec and extension at 72C for 45 sec, followed by
a nal extension step at 72C for 5 min. The genotyping process
was performed on a LICOR 4300L system using the SagaGT ver. 3.1
software package.
Population Genetics Analysis
GenAlEx 6.4 (Peakall and Smouse, 2006) was used to estimate the
number of alleles per locus (NA), observed heterozygosity (HO),
expected heterozygosity (HE), and the xation index (FIS) using
J. Exp. Zool.
44 POPA ET AL.

Table 1. Primer sequences and characteristics of the microsatellite loci successfully amplied in Platynereis dumerilii.

GenBank NA NE HO HE FIS
accession Repeat Allele
Marker number motif Primer sequences Ta size A B A B A B A B A B
PD_3 GR911680.1 [AGC]12 F: ACCACCTCCTGAACCATTTG 55 172 4 2 1.93 1.86 0.57 0.61 0.48 0.46 0.17 0.32
R: ATCGTTCAGCCAGTCCAATC
PD_7 GR911720.1 [AT]11 F: ATGAAATCACCCCTGAATTG 55 177 4 6 3.32 4.73 0.90 1.00 0.70 0.79 0.30 0.27
R: TTGCCCCATTGAGTTAGTCC
PD_8 GR911729.1 [AT]11 F: GCACTGACGAGGAGCAATAG 55 200 10 7 6.47 4.98 0.67 0.76 0.85 0.80 0.21 0.04
R: TTATGGTGATGTCGAAACTGC
PD_13 KC858962 [ATCT]8 F: ACTCATGGCACTGCAAGTTCT 55 234 13 9 4.88 6.23 0.67 1.00 0.80 0.84 0.16 0.19
R: TCCGCATGCTTCAATAAATG
PD_15 KC858963 [GGTA]8 F: AGGCACAGGTAGGCAGAGTC 55 200 10 7 6.50 4.17 0.92 0.70 0.85 0.76 0.09 0.08
R: TTGCAACTGGGAACCTACAA
PD_16 KC858964 [TGAT]8 F: TCATCTGTAACATCAGGCTATTGA 55 185 10 8 5.78 6.03 1.00 1.00 0.83 0.83 0.21 0.20
R: TCGGTCCATTTGGGATAAGA
PD_26 KC858965 [ATCC]7 F: TTCAACCAACCAAGTGCTTAAA 50 154 9 8 6.26 4.10 1.00 1.00 0.84 0.76 0.19 0.32
R: CCTGCTTCAACAACATTTGC
PD_56 KC858966 [ATCT]6 F: ATTCTGTGCAGACATGCCA 50 240 8 8 5.26 4.69 0.91 0.89 0.81 0.79 0.13 0.14
R: GTGTTGTACCTCTTGTGAGCG
PD_60 KC858967 [GATA]6 F: ATAAAAGGGACATCCAGGGC 55 217 15 14 10.29 11.33 0.83 1.00 0.90 0.91 0.08 0.10
R: TTGAATTCCTCCACATCATACC
PD_63 KC858968 [AAC]6 F: TTGCCTGTTATTGAACTTGGA 55 195 9 7 3.46 4.10 0.92 0.76 0.71 0.76 0.29 0.01
R: ACACAATTGCAAGGTTGCTG
PD_66 KC858969 [CTT]6 F: AGAGTTTGCCCATAATTCCAA 55 159 8 4 3.05 1.78 0.92 0.55 0.67 0.44 0.36 0.26
R: ATCCAATGTGCAGCTCCTCT
PD_69 KC858970 [TCTA]6 F: TTCACCTCAGGTATTTCGAGC 55 240 9 7 3.39 3.06 0.75 0.50 0.70 0.67 0.06 0.26
R: ACATACCGTAGATAAGGAGATAGATGG
PD_79 KC858971 [TA]5 F: ATTCCAGTATCCAGGTGGCA 55 250 9 9 3.72 4.08 0.63 0.80 0.73 0.76 0.14 0.06
R: ATTGCAATTGGTCGCAAAAG
Mean values 9.08 7.38 4.95 4.70 0.82 0.81 0.76 0.74 0.09 0.11
Standard error (SE) 0.83 0.77 0.61 0.66 0.04 0.05 0.03 0.04 0.05 0.05

A, Agigea; B, Belona; Ta, annealing temperature (C); NA, number of alleles; NE, effective number of alleles; HO, observed heterozygosity; HE, expected
heterozygosity; FIS, xation index.

Indicated deviation from HardyWeinberg equilibrium (P < 0.05) after Bonferroni's correction.

the standard error (SE) as a measure of variability. Deviation
from the HardyWeinberg equilibrium (HWE) was tested using
the same software package. The presence of null alleles was
tested using MicroChecker ver. 2.2.3 (Van Oosterhout
et al., 2004) while linkage disequilibrium test was carried out
using Genepop software (Raymond and Rousset, '95;
Rousset, 2008). The population differentiation was estimated
by the AMOVA test implemented in GenAlEx, by the
calculation of Cockerham and Weir ('84) FST index as
implemented in Fstat v.2.9.3 (Goudet, 2001) and by the
calculation of Jost (2008) Dest measure of genetic differentia-
tion with the software package SMOGD vsn. 1.2.5
(Crawford, 2010). The directionality of larval transportation
was estimated by calculating the recent gene ow between the
two sites (Agigea and Belona) using the Bayesian approach
implemented in BayesAss (Wilson and Rannala, 2003), with
1 107 iterations, with a burnin of 1 106 and a delta value for
migration rate of 0.2.
RESULTS
Lagrangian Descriptions of Marine Larval Dispersion
The relative effect of advective and uctuating components of
ow on larval dispersion, quantied using the Peclet number, is
depicted in Figure 2. For current speed values of 8 cm/sec, the
Peclet number Pe 1. Values of Pe < 1 show that the uctuating
component of the currents are dominating, while Pe > 1 indicate a
dominance of the mean ow advection.
Molecular Markers (Microsatellite) Description
The database mining was performed on 1825 EST sequences. A
number of 21 loci were selected according to the search criteria

J. Exp. Zool.
POPULATION GENETICS OF Platynereis dumerilii 45

Peclet number as a function of current velocity

10
8
Peclet number, P

P<1 P>1
Dispersal Dispersal
dominated dominated
4

by diffusion by advection
TU2
P= 2

2

P=1

U=8cm/s
0

0 5 10 15 20 25
Current velocity, U (cm/s)

Figure 2. Peclet number as a function of the advection current velocity (U). The shaded area represents current speeds observed during the
MayAugust 2011 period, when P. dumerilii larvae were supposed to be in the plankton, according to Kisseleva ('71).

and primers were designed to test for consistent amplications
and variability in P. dumerilii.
The highly enriched DNA library sequenced by 454GsFLX
Titanium chemistry (Roche Diagnostics, Branford, CT, USA) yielded
a total of 5,525 sequences containing microsatellites motives. After
the bioinformatics analysis a total of 294 pairs of validated primers
were delivered, of which we tested 151 primer pairs for constant
amplication, expected size of the PCR products and variability.
Finally, a total of 13 loci (3 from database mining and 10 from
454_GsFLX sequencing), all of them polymorphic, were success-
fully genotyped in our populations of P. dumeriliii (Table 1). The
mean number of alleles across loci was 9.08 (0.83) in the Agigea
population, and 7.38 (0.77) in the Belona population, while the
corresponding values for the effective number of alleles was 4.95
(0.61) and 4.70 (0.66), respectively. The mean observed
heterozygosity was 0.82 (0.04) in Agigea and 0.81 (0.05) in
Belona. The corresponding mean expected heterozygosities were
0.76 (0.03) and 0.74 (0.04), respectively (Table 1).
After Bonferoni corrections, the PD15 locus in the Agigea
population exhibited departure from the HardyWeinberg
equilibrium (P 0.04). No evidence of null alleles was detected.
No linkage disequilibrium was observed between any of the 13
markers in the two populations.
Population Genetic Differentiation
The xation index FIS ranged from 0.09 (0.05) in Agigea to
0.11 (0.05) in Belona.
The FST index describing the genetic differentiation of the two
populations exhibited the value of 0.02. The analysis of molecular
variance (AMOVA) attributed 2% of the total genetic variation to
interpopulation variability, with a FPT value of 0.02. Jost's Dest
index of population differentiation yielded an average value of
0.01 across loci.
Directionality of Transport
The recent immigration rates estimated using the Bayesian
approach implemented in BayesAss did not show signicant
different values for the two possible senses of migration: 0.30
(0.03) for the Agigea to Belona transportation and 0.28 (0.07)
for the reverse transportation of the larvae.
DISCUSSION
The results presented here illustrate the relative importance of the
mean and uctuating currents in determining the population
structuring as well as the directionality of dispersal for the marine
polychaete species P. dumerilii at a submesogeographic scale in
the Black Sea. The efciency of two different strategies for the

J. Exp. Zool.
46
development of microsatellite markers for the same species is also
discussed.
P. dumerilii is a semelparous species producing lecytotrophic
larvae which have to settle down before the depletion of their food
source. As a consequence, the time larvae spend in the plankton vary
from 5 to 7 days (Kisseleva, '71; Fischer et al., 2010). In the Black Sea,
P. dumerilii reproduces from May to August (Kisseleva, '71). During
this period, the daily average current speed ranged from 0 to about
20 cm/sec (ISMAR, 2013), while the direction of the current changed
periodically. The correlation analysis of the wind speed/direction
(data not shown) and current speed/directions along Romanian
Black Sea coast shows that for low wind conditions during the
summer months, the average current speed is around 5cm/sec
(Stanica and Panin, 2009; Dinu et al., 2011).
The Peclet numbers calculated from the above physical
conditions of the Black Sea and biological characteristic of the
species P. dumerilii covered a range from bellow to above unity.
This means that in conditions of low current speeds, Pe would be
expected to be lower than unity, indicating a domination of the
uctuating currents on the structuring of the populations. This
situation would translate in a local retention of the larvae and, as a
consequence, an important degree of selfrecruitment of the species
populations, which will determine a signicant amount of genetic
differentiation between local subpopulations. During periods with
higher current speed, the Peclet number would raise above unity, in
which case the dominating mean advection ow would generate a
homogenization of the subpopulations, which would translate in
very low levels of the genetic differentiation of the subpopulations.
For average current speeds during the study (MayAugust) of about
5 cm/sec, the corresponding to Pe value is bellow unity and we
might expect local genetic differentiation occurring in the study
area. The situation was further explored with genetic markers.
Our genetic analysis aimed to answer two questions: (i) is there a
biological signicant genetic differentiation between the investi-
gated populations? and (ii) if gene ow will be identied, is there a
preferred directionality for this phenomenon?
The rst question was answered by calculating different indices
of genetic differentiation. First we computed FST and FPT from our
data. Both values were bellow 0.05, which is generally seen as a
measure of very low level of genetic differentiation (Balloux and
LugonMoulin, 2002). However, because there are concerns that
these indices might not reect very accurately the actual level of
genetic diversity, especially when dealing with multiallelic
markers, we also computed the Dest index of Jost, which is
supposed to vary linearly from zero (in completely non
differentiated populations) to one (in completely differentiated
populations) (Jost, 2008). From our data, Dest was very close to zero,
which supports the earlier nding of very little genetic differenti-
ation in our samples. The xation index FIS exhibited slightly
negative values, which suggest that outbreeding is occurring in our
populations. This is consistent with the scenario of reproducing
individuals coming from different population sources, with
J. Exp. Zool.
POPA ET AL.
different genetic background. This aspect, which is the second
question raised above, was further analyzed by calculating the
migration rate between our sampling points. A Bayesian approach
was used to split this migration rates in two components, the
directional gene ows mA,B (migration rate from Agigea to Belona)
and mB,A (migration rate from Belona to Agigea). The reason for
this splitting is twofold: rst we were interested to see how the
differential gene ow correlates with the directionality of marine
currents along the Black Sea coast; second, an asymmetric gene
ow might promote population differentiation at genetic loci
involved in the dispersal process (Zakas and Hall, 2012). In our
study, the differential migration rates were found to be around 0.3
and not signicantly different. Our interpretation of the results is
that the documented change in the direction of the main current
promotes species dispersal in both directions.
The molecular markers used in the study are the rst ones
described for P. dumerilii and two different strategies were
involved in the development process. The efciency was compared
for the two methods. With database mining, we ended up with 3
polymorphic markers out of 21 repetitive motif containing EST
sequences (an efciency of 14%). When considering the efciency
reported to the initial number of EST sequences screened, the
efciency drops to 0.16%, which is comparable with what other
authors have found (Zhan et al., 2009). With the next generation
sequencing of enriched libraries, we ended up with 10 markers out
of 151 tested sequences (7% efciency). However, this last value
was certainly lowered by our strategy of mixing DNA from
different species in the initial DNA source pool, in order to reduce
cost of microsatellite development.
The bottom line of our analysis is that at submesogeographic
scale, no genetic structure was identied in P. dumerilii sub
populations at the Romanian coast of the Black Sea. This indicates
that the longitudinal currents alongshore are dominating in the
structuring of the population of this species. This nding is important,
because for the average current speeds of 5 cm/sec during the study
(MayAugust 2011), with Pe < 1, we expected a certain level of
structuring in the local populations of the species may occur. In
accordance with the periodical change of direction of the longitudinal
current (either form North to South, or form South to North) the gene
ow was found to be bidirectional, with the same intensity.
ACKNOWLEDGMENTS
We would like to thank Prof. Marius Skolka from the Ovidius
University, Constanta, Romania for help with collecting the
samples and Prof. Florin Serbu from the Carmen Sylva High School,
Eforie Sud, Romania, for providing the wind speed/direction data.
LITERATURE CITED
Bacescu MC, Mller GI, Gomoiu MT. 1971. Cercetari de ecologie
bentala n Marea Neagra. Analiza cantitativa, calitativa sSi
comparata a faunei bentale pontice. BucureSsti, Romania: Editura
Academiei Republicii Socialiste Romnia [in Romanian].
POPULATION GENETICS OF Platynereis dumerilii
Balloux F, LugonMoulin N. 2002. The estimation of population
differentiation with microsatellite markers. Mol Ecol 11:155165.
Bellan G. 1980. Relationship of pollution to rocky substratum polychaetes
on the French Mediterranean coast. Mar Pollut Bull 11:318321.
Borja A, Franco J, Prez V. 2000. A Marine biotic index to establish the
ecological quality of softbottom benthos within european
estuarine and coastal environments. Mar Pollut Bull 40:11001114.
Byers J, Pringle JM. 2006. Going against the ow retention, range
limits and invasions in advective environments. Mar Ecol Prog Ser
313:2741.
Cockerham CC, Weir BS. 1984. Covariances of relatives stemming from
a population undergoing mixed self and random mating. Biometrics
40:157164.
Crawford NG. 2010. SMOGD: software for the measurement of genetic
diversity. Mol Ecol Resour 10:556557.
Dinu I, Bajo M, Umgiesser G, Stanica A. 2011. Inuence of wind and
freshwater on the current circulation along the Romanian Black Sea
coast. GeoEcoMarina 17:1326.
Fischer AH, Henrich T, Arendt D. 2010. The normal development of
Platynereis dumerilii (Nereididae, Annelida). Front Zool 7:31.
Giangrande A, Fraschetti S, Terlizzi A. 2002. Local recruitment
differences inPlatynereis dumerilii (Polychaeta, Nereididae) and
their consequences for population structure. Ital J Zool 69:133139.
Goudet J. 2001. FSTAT, a program to estimate and test gene diversities
and xation indices. Version 2.9.3: http://www.unil.ch/izea/soft-
wares/fstat.html.
Grassle JF, Grassle JP. 1974. Opportunistic life histories and genetic
systems in marine benthic polychaetes. J Mar Res 32:253284.
ISMAR IdSM. 2013. Kassandra Storm Surge Modelling System.
Jost L. 2008. GST and its relatives do not measure differentiation. Mol
Ecol 17:40154026.
Kisseleva MI. 1971. Dynamique et la production de la population des
polychtes Platynereis dumerilii dans la biocoenose des cystosires
en Mer Noire. Trav Mus Hist Nat Gr Antipa 11:4958.
Kjerfve B, Magill KE. 1989. Geographic and hydrodynamic character-
istics of shallow coastal lagoons. Mar Geol 88:187199.
Koer R, Schlotterer C, Lelley T. 2007. SciRoKo: a new tool for whole
genome microsatellite search and investigation. Bioinformatics
23:16831685.
Makkaveeva EB. 1976. The dynamics of mass species populations of
eelgrass biocenoses [in Russian]. Biol Morya 36:2540.
Malausa T, Gilles A, Meglecz E, et al. 2011. Highthroughput
microsatellite isolation through 454 GSFLX Titanium pyrosequenc-
ing of enriched DNA libraries. Mol Ecol Resour 11:638644.
Niewiadomska K, Claustre H, Prieur L, d'Ortenzio F. 2008. Sub-
mesoscale physicalbiogeochemical coupling across the Ligurian
47
current (northwestern Mediterranean) using a biooptical glider.
Limnol Oceanogr 53:22102225.
Peakall R, Smouse PE. 2006. GENALEX6: Genetic analysis in Excel.
Population genetic software 6 for teaching and research. Mol Ecol
Notes 6:288295.
Pinsky Ml, Palumbi SR, Fouet SA, Purkis SJ. 2012. Open and closed
seascapes: where does habitat patchiness create populations with
high fractions of selfrecruitment? Ecol Appl 22:12571267.
Raymond M, Rousset F. 1995. GENEPOP (version 1.2): population
genetics software for exact tests and ecumenicism. J Hered 86:248
249.
Rousset F. 2008. Genepop'007: a complete reimplementation of the
Genepop software for Windows and Linux. Mol Ecol Resour 8:103
106.
Rozen S, Skaletsky H. 2000. Primer3 on the WWW for general users
and for biologist programmers. In: Krawetz S, Misener S, editors.
Bioinformatics methods and protocols. Totowa, NJ: Humana Press. p
365386.
Siegel DA, Kinlan BP, Gaylord B, Gaines SD. 2003. Lagrangian
descriptions of marine larval dispersion. Mar Ecol Prog Ser 260:83
96.
Simakov O, Larsson TA, Arendt D. 2012. Linking micro and macro
evolution at the cell type level: a view from the lophotrochozoan
Platynereis dumerilii. Brief Funct Genomics 12:430439.
Simboura N, Zenetos A. 2002. Benthic indicators to use in ecological
quality classication of Mediterranean soft bottom marine
ecosystems, including a new biotic index. Mediterr Mar Sci 3:77
111.
Stanica A, Panin N. 2009. Present evolution and future predictions for
the deltaic coastal zone between the Sulina and Sf. Gheorghe
Danube river mouths (Romania). Geomorphology 107:4146.
Surugiu V, Novac A. 2007. Biodiversity and vertical distribution of
polychaetes associated with mussel beds on articial hard
substrates (Romanian coast, Black Sea). Rapp Comm Int Mer Mdit
38:609.
Van Oosterhout C, Hutchinson WF, Wills DPM, Shipley P. 2004. Micro
checker: software for identifying and correcting genotyping errors
in microsatellite data. Mol Ecol Notes 4:535538.
Wilson GA, Rannala B. 2003. Bayesian inference of recent migration
rates using multilocus genotypes. Genetics 163:11771191.
Zakas C, Hall DW. 2012. Asymmetric dispersal can maintain larval
polymorphism: a model motivated by Streblospio benedicti. Integr
Comp Biol 52:197212.
Zhan A, Bao Z, Hu X, Lu W, Hu J. 2009. Methods comparison for
microsatellite marker development: different isolation methods,
different yield efciency. J Ocean Univ China 8:161165.
J. Exp. Zool.