Food Control 74 (2017) 9e16

Contents lists available at ScienceDirect

Food Control
journal homepage: www.elsevier.com/locate/foodcont

Isolation and characterization of Listeria monocytogenes in Chinese

food obtained from the central area of China
Xin-jun Du a, Xiang Zhang a, Xiao-yi Wang a, Yu-lan Su a, Ping Li a, Shuo Wang a, b, *
a
Key Laboratory of Food Nutrition and Safety, Ministry of Education, Tianjin University of Science and Technology, Tianjin 300457, China
b
Beijing Advanced Innovation Center for Food Nutrition and Human Health, Beijing Technology & Business University (BTBU), Beijing 100048, China

a r t i c l e i n f o a b s t r a c t

Article history: The objective of this study was to investigate the prevalence and characteristics of Listeria monocytogenes
Received 21 September 2016 isolated from Chinese food, including frozen dumplings, avored raw meat, roasted meat, braised meat,
Received in revised form and a cold vegetable dish with sauce. A total of 900 food samples were collected from supermarkets,
14 November 2016
open-air markets, and delicatessens in three large cities in the central area of China to examine the
Accepted 15 November 2016
Available online 21 November 2016
presence of L. monocytogenes; 21 (2.3%) of the samples were positive for this pathogen. Among the
different samples, braised meat showed the highest L. monocytogenes detection rate (4.4%). Samples
obtained from delicatessens showed a much higher L. monocytogenes contamination rate (8.3%) than
Keywords:
Chinese food
those from open-air markets (6.7%) or supermarkets (0%). Multilocus sequence typing (MLST) analysis
Listeria monocytogenes indicated that the 21 bacterial isolates belonged to 12 ST subgroups. ST5 was the largest and contained 7
Antimicrobial susceptibility isolates (33.3%); it was followed by ST474, ST121 and ST9 (each containing 2 isolates [10.5%]). Antibiotic
MLST typing susceptibility analysis showed that the 21 L. monocytogenes isolates were thoroughly resistant to
Virulence genes cefoxitin but highly susceptible to doxycycline and ciprooxacin. The presence of 10 virulence genes was
evaluated by PCR, which showed that inlA, inlC, inlJ, prfA, hlyA, and plcB were present in all isolates and
that inlB, actA, plcA and iap were present in 71.4e90.5% of the isolates. This study provides a useful
reference for risk assessment and control of L. monocytogenes contamination in Chinese food and for the
treatment of clinical listeriosis.
2016 Elsevier Ltd. All rights reserved.

1. Introduction bacterium to survive in different environments. Most

Among the different species of the Listeria genus, Listeria mon-
ocytogenes is pathogenic in humans (Fallah, Saei-Dehkordi, &
Mahzounieh, 2013; Orsi & Wiedmann, 2016). L. monocytogenes is a
food-borne pathogen that can cause severe listeriosis, with symp-
toms including meningitis, meningoencephalitis, septicemia, and
abortion (Wehner et al., 2014). High rates of hospitalization (over
92%) and mortality (20e30%) are the greatest threats to infected
persons, especially fetuses, infants, the elderly, and immunocom-
promised individuals (Todd & Notermans, 2011; Ward, Ducey,
Usgaard, Dunn, & Bielawski, 2008).
Listeriosis is typically caused by the consumption of contami-
nated food (Mead et al., 1999). Food is highly susceptible to
contamination with L. monocytogenes due to the ability of this
* Corresponding author. Key Laboratory of Food Nutrition and Safety, Tianjin
University of Science and Technology, Tianjin 300457, China.
E-mail address: s.wang@tust.edu.cn (S. Wang).
L. monocytogenes strains can grow over a wide pH range (4.1e9.6)
and at high salt concentrations of up to 14% (Fallah et al., 2013).
Moreover, its minimum growth temperature is 0.5e3
C, allowing
L. monocytogenes replication in contaminated food even during
storage in a refrigerator (Ooi & Lorber, 2005). Therefore, this
pathogen is often found in raw and processed ready-to-eat (RTE)
foods. A study performed in Turkey showed that the prevalence of
L. monocytogenes in raw poultry meat was as high as 45% (Elmali
et al., 2015). In Italy, a study showed that the frequency of
contamination in smoked sh samples was as high as 34.1% (Di
Pinto, Novello, Montemurro, Bonerba, & Tantillo, 2010). The prev-
alence of L. monocytogenes in RTE food reached 3.8% in a recent
report in Spain (Dome
nech, Jimenez-Belenguer, Amoros, Ferrus, &
Escriche, 2015). Even in well-cooked Chinese RTE foods, the
L. monocytogenes contamination rate is 5.3e6.33%, according to
recent surveys (Chen, Wu, Zhang, Yan, & Wang, 2014; Wang et al.,
2015a; Wu, Wu, Zhang, Chen, & Yan, 2015b). However, in contrast
to the high prevalence of this pathogen in food, the overall rate of
listeriosis is low, at 0.41 cases per 100,000 individuals in the

http://dx.doi.org/10.1016/j.foodcont.2016.11.024
0956-7135/ 2016 Elsevier Ltd. All rights reserved.
10 X.-j. Du et al. / Food Control 74 (2017) 9e16
European Union (European Food Safety Authority & European
Centre for Disease Prevention and Control [EFSA & ECDC], 2014).
To some extent, this inconsistency is due to variability in the
virulence levels of different L. monocytogenes strains. Therefore,
further typing and characterization are necessary to accurately
assess the potential hazards of food-borne L. monocytogenes.
Serotyping is the rst step in typing L. monocytogenes. However,
the classic immune-based serotyping method is time-consuming,
costly and inaccurate (Burall, Simpson, & Datta, 2011). To over-
come these disadvantages, several genomic sequence-based gen-
otyping methods have been developed (Jadhav, Bhave, & Palombo,
2012). However, the limited ability of some methods to discrimi-
nate bacterial genotypes has greatly hindered our understanding of
bacterial pathogenesis and genomic evolution, sources of contam-
ination and routes of transmission, and emerging species with new
traits. Therefore, many molecular typing methods with enhanced
discriminatory ability have been developed, including pulsed-eld
gel electrophoresis (PFGE) (Graves & Swaminathan, 2001),
randomly amplied polymorphic DNA (RAPD) (Cocolin et al., 2005),
repetitive-element sequence-based PCR (rep-PCR) (Jersek et al.,
1999), and amplied fragment length polymorphism (Parisi et al.,
2010). PFGE is highly discriminatory and reproducible but is
time-consuming and labor-intensive. Although the other fragment-
based methods are easier to perform, they also have limitations,
such as difculties in interpreting and analyzing banding patterns,
a lack of phylogenetic information, and poor reproducibility, all of
which greatly affect the extent of their use (Jadhav et al., 2012). The
multilocus sequence typing (MLST) method developed by Maiden
et al. (1998) has many advantages over the fragment-based
methods mentioned above, including (i) high discriminatory abil-
ity, (ii) the ability to exchange and compare data worldwide and
(iii) the ability to characterize the genetic relationships among
different isolates.
Monitoring the antibiotic resistance, particularly multidrug
resistance, of microbial pathogens is another important aspect of
potential hazard assessment. Antimicrobial multiple resistance
(AMR) may cause approximately 25,000 deaths each year
(European Commission [EC], 2011). Improper and excessive use of
antibiotics in humans and veterinary animals is the main reason for
antimicrobial resistance (EC, 2011; Granier et al., 2011). In recent
decades, increasing global trade and travel have promoted the
spread of antimicrobial resistance throughout the world, and thus,
antimicrobial resistance is a global public health concern
(Dome
nech et al., 2015). Monitoring antibiotic resistance in food-
borne pathogens improves our understanding of antibiotic resis-
tance patterns, suggests preventive strategies to reduce environ-
mental spread, and informs treatments for the clinical symptoms
caused by the pathogen.
In the present study, ve types of typical Chinese foods were
collected from three large cities in the central area of China and
surveyed for the presence of L. monocytogenes. The detected
L. monocytogenes isolates were then further characterized. This
study provided a useful reference for quality assessment and risk
management of L. monocytogenes in Chinese food.
2. Materials and methods
2.1. Sample collection
A total of 900 Chinese food samples, including frozen dump-
lings, avored raw meat, roasted meat, braised meat, and a cold
vegetable dish in sauce (180 samples of each type) were collected
between March and December of 2014. Each month, 90 different
food samples were collected. The samples were obtained from
three large cities in the central area of China. In each city, 300 food
samples were collected from supermarkets, open-air markets and
delicatessens (220 samples from supermarkets, including 60 frozen
dumpling, 60 avored raw meat, 60 roasted meat, 20 braised meat
and 20 cold vegetable dish in sauce samples; 40 samples from
open-air markets including 20 braised meat and 20 cold vegetable
dish in sauce samples; 40 samples from delicatessens including 20
braised meat and 20 cold vegetable dish in sauce samples). After
collection, all samples were sealed in sterile plastic wrap and
placed in refrigerated containers (less than 4
C). The samples were
immediately transported to the laboratory and subjected to
microbiological analysis within ve hours.
2.2. Isolation and identication of L. monocytogenes
L. monocytogenes isolation and identication were performed
according to the National Food Safety Standards of China (GB
4789.30e2010), with slight modications. A 25-g portion of each
food sample was added to 225 mL of LB1 enrichment broth culture
(Land Bridge, Beijing, China). The mixture was homogenized in a
stomacher bag and incubated for 24 h at 30
C to enrich the target
pathogen. Next, 0.1 mL of the LB1 enrichment broth was inoculated
into 10 mL of LB2 enrichment broth (Land Bridge, Beijing, China)
and further cultured at 30
C for 24 h. A 10-mL portion of LB2 was
streaked onto Listeria-selective plates (Land Bridge, Beijing, China)
and incubated at 37
C for 24 h. At least two suspected colonies
from each sample were selected for identication using a previ-
ously reported PCR method that targets the hlyA gene (Wu, Chan, &
Kado, 2004). To further conrm the identity of the isolates, 16S
rDNA gene fragments were amplied and sequenced using gene-
specic primers (forward, 50 -GTTTTCCCAGTCACGACGTTGTA-30 ;
reverse, 50 -TTGTGAGCGGATAACAATTTC-30 ).
2.3. Template DNA extraction
After overnight cultivation at 37
C on an LB plate, a single
colony of pure L. monocytogenes was inoculated into 10 mL of LB
and cultured with shaking at 37
C overnight. The overnight culture
was transferred to fresh LB broth at a dilution of 1:100 and further
cultured with shaking at 37
C until the OD600 reached 0.6e0.8.
Genomic DNA was extracted from the logarithmic-phase cells using
a TIANamp Bacteria DNA kit (TianGen, Beijing, China) according to
the manufacturers instructions.
2.4. Multilocus sequence typing
MLST analysis was performed based on internal fragments of 7
housekeeping genes, including abcZ (ABC transporter), bglA (beta-
glucosidase), cat (catalase), dapE (succinyl diaminopimelate
desuccinylase), dat (D-amino acid aminotransferase), ldh (L-lactate
dehydrogenase), and lhkA (histidine kinase). Each 25-mL PCR reac-
tion contained 2.5 mL of 10 Taq buffer, 0.5 mM dNTPs, 0.4 mM each
primer, 1 mL of extracted DNA and 1 U of Taq DNA polymerase
(Tiangen, Beijing, China). Thermal cycling was performed in a Bio-
metra TGradient Thermocycler (Biometra, Go ttingen, Germany)
using the following program: 5 min of initial denaturation at 94
C;
35 cycles of denaturation at 94
C for 30 s, annealing at 52
C (or
45
C for bglA) for 1 min, and elongation at 72
C for 2 min; and a
nal elongation for 10 min at 72
C. The resulting PCR products
were puried and sequenced by the GENEWIZ company (Beijing,
China). The MLST allele proles were determined according to the
criteria at the MLST Pasteur web site.
2.5. Antimicrobial susceptibility testing
The disk-diffusion method recommended by the Clinical and
 X.-j. Du et al. / Food Control 74 (2017) 9e16 11

Laboratory Standards Institute (Cockerill & Clinical and Laboratory Table 2

Standards Institute [CLSI], 2012) was used for antimicrobial sus- Prevalence of L. monocytogenes isolates in different food samples.

ceptibility analysis using Mueller-Hinton agar (Landbridge, Beijing, Sample type No. of samples No. of positive samples (%)
China). Based on their importance in human medicine and inhibi- Frozen dumpling 180 1 (0.6)
tory effects on L. monocytogenes reported in recent studies, 11 Flavored raw meat 180 6 (3.33)
antimicrobial drugs were selected for this analysis: cefotaxime Roasted meat 180 0
(30 mg), cefuroxime (30 mg), cefoxitin (30 mg), tetracycline (30 mg), Braised meat 180 8 (4.4)
Cold vegetable dish in sauce 180 6 (3.33)
doxycycline (30 mg), nitrofurantoin (300 mg), clindamycin (2 mg),
Total (%) 900 21 (2.33)
ciprooxacin (5 mg), chloramphenicol (30 mg), ampicillin (10 mg),
and trimethoprim/sulfamethoxazole (1.25/23.75 mg) (Hangzhou
Binhe Microorganism Reagent Corporation, Hangzhou, China). The
meat was the only food type that was free of L. monocytogenes. A
diameters of the inhibition zones were measured and compared to
comparison of the L. monocytogenes prevalence in raw and RTE
the breakpoints for Staphylococcus spp., as recommended by the
foods showed that the contamination rates of the three RTE foods
CLSI. Based on the comparison results, the strains were classied
were higher (2.6%) than those of the two raw foods (1.9%).
into sensitive, intermediate resistant, and resistant groups. Staph-
Ninety samples were collected each month between March and
ylococcus aureus ATCC 25923 and Escherichia coli ATCC25922 were
December 2014. L. monocytogenes surveillance results indicated
used as quality-control strains.
that food samples collected in December, March, April and May
were contaminated by this pathogen at higher rates than food
2.6. Detection of virulence markers
samples collected in other months (Table 3). Food samples
collected in December showed the highest rate of L. monocytogenes
Fragments from 10 virulence genes (inlA, inlB, inlC, inlJ, actA,
contamination (5.6%). September was the only month during which
prfA, hlyA, plcA, plcB, and iap) were amplied using primer sets
all collected samples were free of this pathogen. Food samples
reported in previous studies (Coroneo et al., 2016; Lomonaco, Patti,
collected from Tianjin had the highest rates of L. monocytogenes
Knabel, & Civera, 2012; Wu et al., 2004) with some modications
contamination (3.0%), followed by Shijiazhuang (2.3%) and Beijing
(Table 1). Amplications were performed using the following pro-
(1.7%) (Table 3).
gram: 5 min of initial denaturation at 94
C; 35 cycles of denatur-
The prevalence of L. monocytogenes in two types of food samples
ation at 94
C for 35 s, annealing at 52
C for 30 s and elongation at
(braised meat and a cold vegetable dish in sauce) obtained from
72
C for 1 min; and a nal elongation for 10 min at 72
C.
three different retailer types was also analyzed. As shown in
Table 4, the contamination rate was higher in food from delica-
3. Results
tessens and lower in food from open-air markets. However,
L. monocytogenes was not detected in the food samples that were
3.1. Prevalence and contamination levels of L. monocytogenes in
collected from supermarkets.
Chinese foods

A total of 21 (2.3%) of the 900 Chinese food samples, including
two processed raw foods (frozen dumplings and avored raw meat)
and three RTE foods (roasted meat, braised meat, and cold vege-
table dish in sauce), were contaminated with L. monocytogenes
(Table 2). Among the ve different types of food, braised meat had
the highest L. monocytogenes detection rate (4.4%). Flavored raw
meat and the cold vegetable dish in sauce were contaminated with
L. monocytogenes at the second-highest level (both 3.3%). Roasted
3.2. MLST typing
The 21 total isolates belonged to 12 different ST subgroups
(Table 5). The most common ST subgroup was ST5 (7/21, 33.3%),
which was mainly detected in braised meat (four samples) and
avored raw meat (two samples). Three additional ST subgroups
(ST9, ST 121 and ST474) each contained two isolates. Both of the ST9
isolates were detected in samples of a cold vegetable dish in sauce.

Table 1
PCR primers used for the amplication of virulence genes in this study.

Gene Primer Sequence (50 to 30 ) Amplicon size Reference

(bp)

inlA inlAF CCTAGCAGGTCTAACCGCAC 256 Coroneo et al., 2016

inlAR TCGCTAATTTGGTTATGCCC
inlB inlBF TGATGTTGATGGAACGGTAAT 272 This study
inlBR CTCGTGGAAGTTTGTAGATGC
inlC inlCF AATTCCCACAGGACACAACC 517 Liu et al., 2007
inlCF CGGGAATGCAATTTTTCACTA
inlJ inlJF TGTAACCCCGCTTACACAGTT 238 Liu et al., 2007
inlJR AGCGGCTTGGCAGTCTAATA
actA actAF CCAAGCGAGGTAAATACGGGA 650 Lomonaco et al., 2012
actAR GTCCGAAGCATTTACCTCTTC
prfA prfAF ACCAATGGGATCCACAAGA 467 Bubert et al., 1999
prfAR CAGCTGAGCTATGTGCGAT
hlyA hlyF ATCATCGACGGCAACCTCGGAGAC 404 This study
hlyR CACCATTCCCAAGCTAAACCAGTGC
plcA plcAF CTCGGACCATTGTAGTCATCTT 326 Lomonaco et al., 2012
plcAR CACTTTCAGGCGTATTAGAAACGA
plcB plcBF AATATTTCAATCAATCGGTGGCTGA 289 This study
plcBR GGGTAGTCCGCTTTCGCTCTT
iap iapF ACAAGCTGCACCTGTTGCAG 131 Kaur et al., 2007
iapF TGACAGCGTGTGTAGTAGCA
12 X.-j. Du et al. / Food Control 74 (2017) 9e16

Table 3
Prevalence of L. monocytogenes isolates in different cities and different months.

Month Tianjin Beijing Shijiazhuang Total

Samples Positive (%) Samples Positive (%) Samples Positive (%) Samples Positive (%)

March 30 3 (10.0) 30 1 (3.3) 30 0 90 4 (4.4)

April 30 2 (6.7) 30 2 (6.7) 30 0 90 4 (4.4)
May 30 2 (6.7) 30 0 30 1 (3.3) 90 3 (3.3)
June 30 1 (3.3) 30 0 30 0 90 1 (1.1)
July 30 0 30 0 30 1 (3.3) 90 1 (1.1)
August 30 1 (3.3) 30 0 30 0 90 1 (1.1)
September 30 0 30 0 30 0 90 0
October 30 0 30 0 30 1 (3.3) 90 1 (1.1)
November 30 0 30 0 30 1 (3.3) 90 1 (1.1)
December 30 0 30 2 (6.7) 30 3 (10.0) 90 5 (5.6)

Total 300 9 (3.0) 300 5 (1.7) 300 7 (2.3) 900 21 (2.3)

Table 4
Positive samples of L. monocytogenes collected from different types of retailers.

Sample collection site Sample type No. of samples No. of positive samples (%) Total (%)

Supermarket Braised meat 60 0 0

Cold vegetable dish in sauce 60 0
Open-air market Braised meat 60 4 (6.7) 4 (6.7)
Cold vegetable dish in sauce 60 0
Delicatessen Braised meat 60 4 (6.7) 10 (8.3)
Cold vegetable dish in sauce 60 6 (10)

The two ST121 strains were both isolated from avored raw meat. respectively. In summary, the isolates were highly resistant to b-
The remaining ST subgroups were each represented by a single lactam antibiotics but highly susceptible to the tetracyclines and
isolate. quinolone used in this study.

3.4. Virulence genes

3.3. Antibiotic resistance of L. monocytogenes isolates
The prevalence of 10 virulence-related genes was assessed, and
The susceptibility of the 21 isolates to 11 different antibiotics
the results were summarized in Fig. 2. The genes inlA, inlC, inlJ, prfA,
was examined using the disk diffusion method; the results are
hlyA, and plcB were detected in all L. monocytogenes isolates; actA
summarized in Fig. 1. All isolates were resistant to cefoxitin (100%).
(90.5%), plcA (76.2%) iap (76.2%) and inlB (71.4%) were slightly less
Furthermore, the isolates also showed strong resistance to cefur-
prevalent.
oxime (18, 85.7%) and ampicillin (17, 81.0%). Approximately half of
the isolates were resistant to cefotaxime (10, 47.6%) and clinda-
mycin (11, 52.4%). The isolates exhibited multidrug resistance to 4. Discussion
3e8 of the 11 tested antibiotics. Intermediate resistance against
chloramphenicol was observed in most of the isolates (17, 81.0%). L. monocytogenes is extensively present in the environment and
However, the isolates were highly susceptible to ciprooxacin (19, has been isolated from many different raw and cooked foods. In this
90.5%) and doxycycline (17, 81.0%). More than half of the isolates study, 21 L. monocytogenes isolates were collected from a total of
were susceptible to tetracycline, trimethoprim-sulfamethoxazole, 900 Chinese food samples (2.3%). The samples were divided into
and nitrofurantoin: 12 (57.1%), 12 (57.1%), and 11 (52.4%) isolates, two groups: raw foods (frozen dumplings and avored raw meat)
and RTE foods (roasted meat, braised meat, and a cold vegetable
dish in sauce). In the raw and RTE food samples, the prevalence
Table 5
rates of L. monocytogenes were 1.9% and 2.9%, respectively.
MLST typing and source analysis of L. monocytogenes isolates.
Compared with surveys performed in other countries, the preva-
MLST type No of isolates (%) Food sources (No.) lence of L. monocytogenes in raw food observed in this study was
ST 5 7 (33.3) Braised meat (4) signicantly lower, whereas that in RTE food was generally com-
Flavored raw meat (2) parable. For example, several studies performed in Algeria,
Cold vegetable dish in sauce (1) Malaysia, Turkey, and Brazil found that the prevalence of
ST 9 2 (9.5) Cold vegetable dish in sauce (2)
ST 121 2 (9.5) Flavored raw meat (2)
L. monocytogenes in raw meat reached 8.9%, 9.0%, 45%, and 48.7%,
ST 474 2 (9.5) Frozen dumpling (1) respectively (Bouayad, Hamdi, Naim, Leclercq, & Lecuit, 2015;
Flavored raw meat (1) Elmali et al., 2015; Jamali et al., 2015; Ristori et al., 2014). The
ST 8 1 (4.8) Braised meat (1) prevalence of the pathogen in RTE foods in different studies in
ST 87 1 (4.8) Cold vegetable dish in sauce (1)
Japan, Italy, Jordan and Spain reached 1.7%, 1.92%, 2% and 3.8%,
ST 155 1 (4.8) Cold vegetable dish in sauce (1)
ST 492 1 (4.8) Cold vegetable dish in sauce (1) respectively (Dome
nech et al., 2015; Iannetti et al., 2016; Osaili
ST 532 1 (4.8) Braised meat (1) et al., 2014; Shimojima et al., 2016). The prevalences in the two
ST 537 1 (4.8) Flavored raw meat (1) foods were lower than those reported in most similar surveys of
ST 602 1 (4.8) Braised meat (1) different foods performed in China. Recent studies showed that the
ST 637 1 (4.8) Braised meat (1)
contamination rate of L. monocytogenes in chilled pork was
 X.-j. Du et al. / Food Control 74 (2017) 9e16 13

Fig. 1. Susceptibility of the L. monocytogenes isolates to 11 antibiotics. The numbers 1e11 indicate cefotaxime, cefuroxime, cefoxitin, ampicillin, clindamycin, tetracycline, doxy-
cycline, ciprooxacin, trimethoprim-sulfamethoxazole, nitrofurantoin and chloramphenicol, respectively. The three numbers in brackets under each column indicate the numbers of
sensitive, intermediately resistant and resistant isolates, which are shown in different colors. (For interpretation of the references to colour in this gure legend, the reader is
referred to the web version of this article.)

5.5e11.5% (Fang et al., 2016; Wang et al., 2015b). Generally, the
reported prevalence of the bacterium in raw meats is 5.7e6.7% (Yan
et al., 2010; Yu & Jiang, 2014; Zhang et al., 2013). However, a study
conducted in 24 Chinese cities showed that the total prevalence of
L. monocytogenes in raw foods was as high as 20.0% (Wu et al.,
2015a). The contamination rate of the pathogen in RTE foods was
generally reported to be 5.3e6.87% (Chen et al., 2014; Wang et al.,
2015b; Wu et al., 2015b), which was signicantly higher than the
prevalence observed in the present study. The lower isolation rate
Fig. 2. Prevalence rates of 10 virulence genes in the L. monocytogenes isolates. Among
the 10 genes, inlB, actA, plcA and iap were positive in 71.4%, 90.5%, 76.2% and 76.2% of
L. monocytogenes isolates, respectively. The remaining six genes were positive in all
isolates.
of L. monocytogenes in raw food in this study may be due to the
inclusion of only commercially processed raw food samples in this
study. The lower prevalence of L. monocytogenes in RTE food found
in this study may be due to differences in collection sites or pro-
cessing methods of the food samples. In particular, many of the food
samples were collected from supermarkets, which generally have
good sanitary conditions because of the application of guidance for
food processing in supermarket suggested by the Ministry of
Commerce of the Peoples Republic of China. Except the 120 braised
meat samples and the 120 cold vegetable dish samples, all food
samples in this study were purchased from different supermarkets.
Among the ve different food types, only roasted meat was not
contaminated with L. monocytogenes (Table 2). Because all of the
roasted meat samples were purchased from supermarkets, the
absence of the pathogen may be due to good thermal maintenance,
personal hygiene, cleaning procedures, and processing and storage
conditions. On the other hand, the lower water activity of this food
may make it difcult for L. monocytogenes to survive (Wang et al.,
2015a). Surprisingly, braised meat, which usually undergoes
lengthy boiling during processing, showed the highest prevalence
of L. monocytogenes among all sampled food types, including the 2
types of raw foods. This result suggests that cross-contamination
after processing may be the main source of the pathogen. A com-
parison of the occurrence of the pathogen in different months
showed that most isolates were recovered in months with lower
temperatures, including March, April and December (Table 3). This
preferential prevalence of L. monocytogenes during cooler times of
year may be due to the psychrophilic characteristics of the path-
ogen. At lower temperatures, competition from other bacteria may
14 X.-j. Du et al. / Food Control 74 (2017) 9e16
decrease, as most microorganisms are more sensitive to low tem-
peratures than L. monocytogenes. Regarding sample collection sites,
most of the isolates were obtained from samples collected at open-
air markets and delicatessens (66.7%), although only 26.7% of the
food samples were collected from these 2 types of retailers
(Table 4). This result indicates that better surveillance and sanita-
tion should be performed to improve the hygienic conditions of
such retailers, so as to achieve higher food safety levels.
Compared with other typing methods, MLST is a more powerful
method with a higher degree of discrimination and reliability. MLST
can be used as an effective approach to identify the source of
contaminated bacterial pathogens. In the present study, the 21
isolates were grouped into 12 different STs, thus demonstrating
great genetic diversity. ST5 (33.3%) was the predominant allelic
prole and was followed by ST9 (9.5%), ST121 (9.5%) and ST474
(9.5%), as shown in Table 5. The predominant subtypes were mainly
isolated from braised meat, avored raw meat, and a cold vegetable
dish in sauce collected from different cities, revealing the wide
presence of the individual subtypes in different locations in the
central area of China. Subtyping analysis of L. monocytogenes iso-
lates from meat processing plants in Spain showed that ST9 (33%)
and ST121 (16%) were the two most prevalent STs (Martn et al.,
2014), and subtyping analysis of L. monocytogenes isolated from
food in Switzerland and France also showed that ST121 and ST9
were the two most prevalent STs (Ebner et al., 2015; Henri et al.,
2016). The predominant sequence types in L. monocytogenes iso-
lates recovered from chilled pork in Nanjing, China, were ST121
(30.8%), ST9 (19.2%) and ST311 (11.5%) (Wang et al., 2015b). In
agreement with our results, a survey conducted on RTE foods in
Nanjing, China indicated that ST5 and ST121 were the two most
predominant STs (Wang et al., 2015a). In a study performed by Wu,
Wu, Zhang, Chen, and Guo (2016), among the 80 isolates obtained
from RTE foods collected from 24 large cities, the most common
allelic prole was ST8 (30%) followed by ST1 (20%). From these
comparisons, it may be concluded that in China and in other
countries, the ST5, ST9 and ST121 subtypes were more prevalent
than other subtypes.
It was previously reported that L. monocytogenes was typically
susceptible to a wide range of antibiotics (Charpentier & Courvalin,
1999). However, studies performed in recent years have extensively
observed reduced susceptibility of L. monocytogenes to many anti-
biotics in various countries (Korsak, Borek, Daniluk, Grabowska, &
Pappelbaum, 2012; Pesavento, Ducci, Nieri, Comodo, & Lo Nostro,
2010). In the present study, susceptibility analysis with 11 antibi-
otics indicated that the antimicrobial resistance of the isolates was
generally higher than or comparable with that of isolates in pre-
vious reports. Four different b-lactam antibiotics (cefotaxime,
cefuroxime, cefoxitin and ampicillin) were selected to analyze the
antimicrobial susceptibility of the isolates, and strong resistance
was observed for several samples. A total of seven isolates were
susceptible to these four antibiotics, indicating that these b-lactam
antibiotics may not be good choices for the effective treatment of
listeriosis. The resistance to cefotaxime (Fig. 1) observed in this
study is in agreement with previous studies, which showed 30.5%
and 77.8% resistance levels (Yan et al., 2010; Yu & Jiang, 2014). The
high resistance to cefoxitin observed in this study is also compa-
rable with a previous report, which indicated that 98% of
L. monocytogenes isolates were resistant to this antibiotic
(Kovacevic, Sagert, Wozniak, Gilmour, & Allen, 2013). However, the
resistance to cefuroxime and ampicillin that we observed was
higher than in most previous studies (Chao, Zhou, Jiao, Qian, & Xu,
2007; Chen et al., 2014; Conter et al., 2009; Dome
nech et al., 2015).
Ampicillin in combination with other antibiotics is generally used
to treat listeriosis (Charpentier & Courvalin, 1999). However, in the
present study, the strong observed resistance to ampicillin suggests
that this antibiotic may not be a good choice for listeriosis treat-
ment. In accord with our study, high rates of resistance to ampicillin
have also been found in L. monocytogenes isolates recovered from
dairy-based food products (Harakeh et al., 2009) and treated
wastewater efuent (Olaniran, Nzimande, & Mkize, 2015), with
resistance in 60% and 83.3% of samples, respectively. Excessive use
of ampicillin in the treatment of various human diseases may be the
main cause of reduced susceptibility to this antibiotic (Harakeh
et al., 2009). Many studies have demonstrated a strong resistance
to clindamycin, at levels of 46.8%e100% (Kova cevi

c, Mesak, & Allen,
2012; Wu et al., 2015b, 2015a). Similar results were obtained in the
present study (Fig. 1). Susceptibility to tetracyclines has been well
documented in recent studies, in which most L. monocytogenes
isolates were susceptible to these antibiotics (Chen et al., 2014;
Conter et al., 2009; Li et al., 2016; Shen et al., 2013). In accor-
dance with such ndings, high susceptibility to tetracyclines was
also observed in this study. Most antibiotic resistance analyses have
shown a high sensitivity of L. monocytogenes to ciprooxacin, with
generally less than 10% of isolates showing resistance to this anti-
biotic (Chen et al., 2014; Conter et al., 2009; Shen et al., 2013; Wu
et al., 2015b, 2015a). In the present study, ciprooxacin exhibited
the highest antimicrobial activity (90.5%) against L. monocytogenes
of the 11 antibiotics examined. Trimethoprim-sulfamethoxazole
has generally been used as a second choice to treat listeriosis
(Charpentier & Courvalin, 1999). However, 57.1% of the isolates in
our study were resistant to these antibiotics, suggesting that they
may not be as effective against L. monocytogenes as they once were.
According to recent reports, low-level resistance to chloramphen-
icol has been observed (Chen et al., 2014; Dome
nech et al., 2015). In
our study, none of the 21 isolates was fully resistant to chloram-
phenicol. However, the proportion of isolates with intermediate
chloramphenicol resistance was as high as 81%, implying that
L. monocytogenes is gaining resistance to this antibiotic. In sum-
mary, some antibiotics that are commonly used for treatment of
listeriosis, specically ampicillin and trimethoprim-
sulfamethoxazole, may not be as effective as once thought.
Although none of the antibiotics used in this study thoroughly
inhibited the growth of all the isolates when used alone, doxycy-
cline combined with ciprooxacin could inhibit all of the isolated
L. monocytogenes strains.
The prevalence of virulence genes can reect the risk levels of
different L. monocytogenes strains. In the present study, the prev-
alence of 10 virulence-associated genes was detected using a PCR
method. Among them, the internalin gene family represents a class
of critical and well-studied virulence factors that mainly mediate
adhesion to and internalization of L. monocytogenes within
epithelial cells (Bonazzi, Lecuit, & Cossart, 2009). We found that
four internalin genes, namely inlA, inlB, inlC, and inlJ, were present
in 100%, 71.4%, 100%, and 100% of the L. monocytogenes isolates,
respectively. The high prevalence of inlA, inlC, and inlJ observed in
this study is consistent with most previous studies, such as those
performed by Wu et al. (2016), Wang et al. (2015a) and Jamali,
Radmehr, and Thong (2013). However, a wide range of inlB preva-
lence, from 47% to 100%, has been observed in different studies
(Coroneo et al., 2016; Wu et al., 2015a, 2016), indicating that the
presence of this gene in L. monocytogenes is variable. The actA gene,
which is responsible for the spread of L. monocytogenes in host cells
by mediating actin polymerization (Kocks et al., 1992), was found in
90.5% of the isolates in this study. This prevalence is higher than
that found in a study by Olaniran et al. (2015) but lower than those
found in studies conducted by Coroneo et al. (2016) and Lomonaco
et al. (2012), indicating that actA is not a ubiquitous virulence factor
of this pathogen. The prevalence of the virulence genes plcA and
iap, which encode phospholipase and invasion-associated protein,
respectively, was also similar to those observed in previous studies
 X.-j. Du et al. / Food Control 74 (2017) 9e16
(Coroneo et al., 2016; Lomonaco et al., 2012; Olaniran et al., 2015;
Wang et al., 2015a). The differences between the prevalences of
virulence genes observed in this study and those reported in pre-
vious studies (Coroneo et al., 2016; Lomonaco et al., 2012; Olaniran
et al., 2015; Wu et al., 2016, 2015a) may be due to the use of
different PCR target fragments within the genes. In fact, truncations
in some genes, such as internalin-encoding genes, are commonly
observed (Jonquieres, Bierne, Mengaud, & Cossart, 1998). For
example, an epidemiological study performed by Jacquet et al.
(2004) showed that full-length internalin was detected in 96% of
clinical strains but in only 65% of the food-derived strains.
In summary, the prevalence of L. monocytogenes in Chinese food
samples collected from three large cities in the central area of China
was lower than that reported by most surveillance studies in recent
years. However, high contamination rates in certain RTE foods
indicate that the potential risk of food-borne illness in these foods
requires further assessment. MLST demonstrated that the pre-
dominant sequence subgroups in this area of China are somewhat
different from those observed in other studies. The greater resis-
tance to antibiotics, particularly those commonly used to treat
listeriosis, provides useful information for effectively treating
L. monocytogenes infections. The different prevalence rates of
virulence genes in the isolates assessed in this study demonstrated
the various risk levels associated with different L. monocytogenes
strains.
Acknowledgements
This study received nancial support from a project of the
Ministry of Science and Technology of the Peoples Republic of
China (Project No. 2014BAD04B03) and International Science and
Technology Cooperation Program of China (Project No.
2014DFR30350).
References
Bonazzi, M., Lecuit, M., & Cossart, P. (2009). Listeria monocytogenes internalin and E-
cadherin: From bench to bedside. Cold Spring Harb Perspectives in Biology, 1,
a003087.
Bouayad, L., Hamdi, T. M., Naim, M., Leclercq, A., & Lecuit, M. (2015). Prevalence of
Listeria spp. and molecular characterization of Listeria monocytogenes isolates
from broilers at the abattoir. Foodborne Pathogens and Disease, 12, 606e611.
Bubert, A., Sokolovic, Z., Chun, S. K., Papatheodorou, L., Simm, A., & Goebel, W.
(1999). Differential expression of Listeria monocytogenes virulence genes in
mammalian host cells. Molecular & General Genetics: MGG, 261, 323e336.
Burall, L. S., Simpson, A. C., & Datta, A. R. (2011). Evaluation of a serotyping scheme
using a combination of an antibody-based Serogrouping method and a multi-
plex PCR assay for identifying the major serotypes of Listeria monocytogenes.
Journal of Food Protection, 74, 403e409.
Chao, G., Zhou, X., Jiao, X., Qian, X., & Xu, L. (2007). Prevalence and antimicrobial
resistance of foodborne pathogens isolated from food products in China.
Foodborne Pathogens and Disease, 4, 277e284.
Charpentier, E., & Courvalin, P. (1999). Antibiotic resistance in Listeria spp. Antimi-
crobial Agents and Chemotherapy, 43, 2103e2108.
Chen, M., Wu, Q., Zhang, J., Yan, Z., & Wang, J. (2014). Prevalence and character-
ization of Listeria monocytogenes isolated from retail-level ready-to-eat foods in
South China. Food Control, 38, 1e7.
Cockerill, F., & Clinical and Laboratory Standards Institute [CLSI]. (2012). Perfor-
mance standards for antimicrobial susceptibility testing: Twenty-rst informa-
tional supplement. Wayne, PA: Clinical and Laboratory Standards Institute.
Cocolin, L., Stella, S., Nappi, R., Bozzetta, E., Cantoni, C., & Comi, G. (2005). Analysis of
PCR-based methods for characterization of Listeria monocytogenes strains iso-
lated from different sources. International Journal of Food Microbiology, 103,
167e178.
Conter, M., Paludi, D., Zanardi, E., Ghidini, S., Vergara, A., & Ianieri, A. (2009).
Characterization of antimicrobial resistance of foodborne Listeria mono-
cytogenes. International Journal of Food Microbiology, 128, 497e500.
Coroneo, V., Carraro, V., Aissani, N., Sanna, A., Ruggeri, A., Succa, S., et al. (2016).
Detection of virulence genes and growth potential in Listeria monocytogenes
strains isolated from ricotta salata cheese. Journal of Food Science, 81,
M114eM120.
Di Pinto, A., Novello, L., Montemurro, F., Bonerba, E., & Tantillo, G. (2010). Occur-
rence of Listeria monocytogenes in ready-to-eat foods from supermarkets in
Southern Italy. New Microbiologica, 33, 249e252.
15
Dome
nech, E., Jimenez-Belenguer, A., Amoros, J. A., Ferrus, M. A., & Escriche, I.
(2015). Prevalence and antimicrobial resistance of Listeria monocytogenes and
salmonella strains isolated in ready-to-eat foods in Eastern Spain. Food Control,
47, 120e125.
Ebner, R., Stephan, R., Althaus, D., Brisse, S., Maury, M., & Tasara, T. (2015). Pheno-
typic and genotypic characteristics of listeria monocytogenes, strains isolated
during 2011e2014 from different food matrices in Switzerland. Food Control, 57,
321e326.
Elmali, M., Can, H. Y., & Yaman, H. (2015). Prevalence of Listeria monocytogenes in
poultry meat. Food Science Technology, 35, 672e675.
European Commission [EC]. (2011). Commission staff working paper. Accompanying
document to the Commission recommendation on the research joint programming
initiative The microbial challenge - an emerging threat to human health. Brussels,
27.10.2011. SEC (2011) 1295 nal. Retrieved March 2014 from http://era.gv.at/
object/document/677/attach/CommRec_DOCUMENTDETRAVAIL_f.pdf.
European Food Safety Authority & European Centre for Disease Prevention and
Control [EFSA & ECDC]. (2014). The European Union summary report on trends
and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2012.
EFSA Journal, 12, 3547.
Fallah, A. A., Saei-Dehkordi, S. S., & Mahzounieh, M. (2013). Occurrence and anti-
biotic resistance proles of Listeria monocytogenes isolated from seafood
products and market and processing environments in Iran. Food Control, 34,
630e636.
Fang, C., Shan, Y., Cao, T., Xia, Y., Xin, Y., Cheng, C., et al. (2016). Prevalence and
virulence characterization of Listeria monocytogenes in chilled pork in Zhejiang
Province, China. Foodborne Pathogens and Disease, 13, 8e12.
Granier, S. A., Moubareck, C., Colaneri, C., Lemire, A., Roussel, S., Dao, T. T., et al.
(2011). Antimicrobial resistance of Listeria monocytogenes isolates from food
and the environment in France over a 10-year period. Applied and Environmental
Microbiology, 77, 2788e2790.
Graves, L. M., & Swaminathan, B. (2001). PulseNet standardized protocol for sub-
typing Listeria monocytogenes by macrorestriction and pulsed-eld gel elec-
trophoresis. International Journal of Food Microbiology, 65, 55e62.
Harakeh, S., Saleh, I., Zouhairi, O., Baydoun, E., Barbour, E., & Alwan, N. (2009).
Antimicrobial resistance of Listeria monocytogenes isolated from dairy-based
food products. Science of the Total Environment, 407, 4022e4027.
Henri, C., Fe
lix, B., Guillier, L., Leekitcharoenphon, P., Michelon, D., Mariet, J. F., et al.
(2016). Population genetic structure of listeria monocytogenes strains as
determined by pulsed-eld gel electrophoresis and multilocus sequence typing.
Applied & Environmental Microbiology, 82, 5720e5728.
Iannetti, L., Acciari, V. A., Antoci, S., Addante, N., Bardasi, L., Bilei, S., et al. (2016).
Listeria monocytogenes in ready-to-eat foods in Italy: Prevalence of contami-
nation at retail and characterisation of strains from meat products and cheese.
Food Control, 68, 55e61.
Jacquet, C., Doumith, M., Gordon, J., Martin, P., Cossart, P., & Lecuit, M. (2004).
A molecular marker for evaluating the pathogenic potential of foodborne Lis-
teria monocytogenes. Journal of Infectious Diseases, 189, 2094e2100.
Jadhav, S., Bhave, M., & Palombo, E. A. (2012). Methods used for the detection and
subtyping of Listeria monocytogenes. Journal of Microbiological Methods, 88,
327e341.
Jamali, H., Payda,r, M., Ismail, S., Looi, C. Y., Wong, W. F., Radmehr, B., et al. (2015).
Prevalence, antimicrobial susceptibility and virulotyping of Listeria species and
Listeria monocytogenes isolated from open-air sh markets. BMC Microbiology,
15, 144.
Jamali, H., Radmehr, B., & Thong, K.-L. (2013). Prevalence, characterisation, and
antimicrobial resistance of listeria species and Listeria monocytogenes isolates
from raw milk in farm bulk tanks. Food Control, 34, 121e125.
Jersek, B., Gilot, P., Gubina, M., Klun, N., Mehle, J., Tcherneva, E., et al. (1999). Typing
of Listeria monocytogenes strains by repetitive element sequence-based PCR.
Journal of Clinical Microbiology, 37, 103e109.
Jonquieres, R., Bierne, H., Mengaud, J., & Cossart, P. (1998). The inlA gene of Listeria
monocytogenes LO28 harbors a nonsense mutation resulting in release of
internalin. Infection and Immunity, 66, 3420e3422.
Kaur, S., Malik, S. V. S., Vaidya, V. M., & Barbuddhe, S. B. (2007). Listeria mono-
cytogenes in spontaneous abortions in humans and its detection by multiplex
PCR. Journal of Applied Microbiology, 103, 1889e1896.
Kocks, C., Gouin, E., Tabouret, M., Berche, P., Ohayon, H., & Cossart, P. (1992).
L. monocytogenes-induced actin assembly requires the actA gene product, a
surface protein. Cell, 68, 521e531.
Korsak, D., Borek, A., Daniluk, S., Grabowska, A., & Pappelbaum, K. (2012). Antimi-
crobial susceptibilities of Listeria monocytogenes strains isolated from food and
food processing environment in Poland. International Journal of Food Microbi-
ology, 158, 203e208.
Kova cevi

c, J., Mesak, L. R., & Allen, K. J. (2012). Occurrence and characterization of
Listeria spp. in ready-to-eat retail foods from Vancouver, British Columbia. Food
Microbiology, 30, 372e378.
Kovacevic, J., Sagert, J., Wozniak, A., Gilmour, M. W., & Allen, K. J. (2013). Antimi-
crobial resistance and co-selection phenomenon in Listeria spp. recovered from
food and food production environments. Food Microbiology, 34, 319e327.
Li, L., Olsen, R. H., Ye, L., Wang, W., Shi, L., Yan, H., et al. (2016). Characterization of
antimicrobial resistance of Listeria monocytogenes strains isolated from a pork
processing plant and its respective meat markets in Southern China. Foodborne
Pathogens and Disease, 13, 262e268.
Liu, D., Lawrence, M. L., Austin, F. W., & Ainsworth, A. J. (2007). A multiplex PCR for
species and virulence-specic determination of Listeria monocytogenes. Journal
16 X.-j. Du et al. / Food Control 74 (2017) 9e16
of Microbiological Methods, 71, 133e140.
Lomonaco, S., Patti, R., Knabel, S. J., & Civera, T. (2012). Detection of virulence-
associated genes and epidemic clone markers in Listeria monocytogenes iso-
lates from PDO Gorgonzola cheese. International Journal of Food Microbiology,
160, 76e79.
Maiden, M. C., Bygraves, J. A., Feil, E., Morelli, G., Russell, J. E., Urwin, R., et al. (1998).
Multilocus sequence typing: A portable approach to the identication of clones
within populations of pathogenic microorganisms. Proceedings of the National
Academy of Sciences of the United States of America, 95, 3140e3145.
Martn, B., Perich, A., Go
mez, D., Yangela, J., Rodrguez, A., Garriga, M., et al. (2014).
Diversity and distribution of Listeria monocytogenes in meat processing plants.
Food Microbiology, 44, 119e127.
Mead, P. S., Slutsker, L., Dietz, V., McCaig, L. F., Bresee, J. S., Shapiro, C., et al. (1999).
Food-related illness and death in the United States. Emerging Infectious Diseases,
5, 607e625.
Olaniran, A. O., Nzimande, S. B., & Mkize, N. G. (2015). Antimicrobial resistance and
virulence signatures of Listeria and Aeromonas species recovered from treated
wastewater efuent and receiving surface water in Durban, South Africa. BMC
Microbiology, 15, 234.
Ooi, S. T., & Lorber, B. (2005). Gastroenteritis due to Listeria monocytogenes. Clinical
Infectious Diseases, 40, 1327e1332.
Orsi, R. H., & Wiedmann, M. (2016). Characteristics and distribution of Listeria spp.,
including Listeria species newly described since 2009. Applied Microbiology and
Biotechnology, 100, 5273e5287.
Osaili, T. M., Alnabulsi, A. A., Shaker, R. R., Jaradat, Z. W., Taha, M., Alkherasha, M.,
et al. (2014). Prevalence of salmonella serovars, listeria monocytogenes, and
escherichia coli o157:h7 in mediterranean ready-to-eat meat products in Jor-
dan. Journal of Food Protection, 77, 106e111.
Parisi, A., Latorre, L., Normanno, G., Miccolupo, A., Fraccalvieri, R., Lorusso, V., et al.
(2010). Amplied fragment length polymorphism and multi-locus sequence
typing for high-resolution genotyping of Listeria monocytogenes from foods and
the environment. Food Microbiology, 27, 101e108.
Pesavento, G., Ducci, B., Nieri, D., Comodo, N., & Lo Nostro, A. (2010). Prevalence and
antibiotic susceptibility of Listeria spp. isolated from raw meat and retail foods.
Food Control, 21, 708e713.
Ristori, C. A., Rowlands, R. E., Martins, C. G., Barbosa, M. L., Yoshida, J. T., &
Franco, B. D. (2014). Prevalence and populations of Listeria monocytogenes in
meat products retailed in Sao Paulo, Brazil. Foodborne Pathogenes and Disease,
11, 969e973.
Shen, J., Rump, L., Zhang, Y., Chen, Y., Wang, X., & Meng, J. (2013). Molecular sub-
typing and virulence gene analysis of Listeria monocytogenes isolates from food.
Food Microbiology, 35, 58e64.
Shimojima, Y., Ida, M., Nakama, A., Nishino, Y., Fukui, R., Kuroda, S., et al. (2016).
Prevalence and contamination levels of listeriamonocytogenes in ready-to-eat
foods in Tokyo, Japan. Journal of Veterinary Medical Science, 78, 1183e1187.
Todd, E. C. D., & Notermans, S. (2011). Surveillance of listeriosis and its causative
pathogen, Listeria monocytogenes. Food Control, 22, 1484e1490.
Wang, G., Qian, W., Zhang, X., Wang, H., Ye, K., Bai, Y., et al. (2015a). Prevalence,
genetic diversity and antimicrobial resistance of Listeria monocytogenes isolated
from ready-to-eat meat products in Nanjing, China. Food Control, 50, 202e208.
Wang, K., Ye, K., Zhu, Y., Huang, Y., Wang, G., Wang, H., et al. (2015b). Prevalence,
antimicrobial resistance and genetic diversity of Listeria monocytogenes isolated
from chilled pork in Nanjing, China. LWT-Food Science and Technology, 64,
905e910.
Ward, T. J., Ducey, T. F., Usgaard, T., Dunn, K. A., & Bielawski, J. P. (2008). Multilocus
genotyping assays for single nucleotide polymorphism-based subtyping of
Listeria monocytogenes isolates. Applied and Environmental Microbiology, 74,
7629e7642.
Wehner, S., Mannala, G. K., Qing, X., Madhugiri, R., Chakraborty, T., Mraheil, M. A.,
et al. (2014). Detection of very long antisense transcripts by whole tran-
scriptome RNA-Seq analysis of Listeria monocytogenes by semiconductor
sequencing technology. PLoS One, 9, e108639.
Wu, S. J., Chan, A., & Kado, C. I. (2004). Detection of PCR amplicons from bacterial
pathogens using microsphere agglutination. Journal of Microbiological Methods,
56, 395e400.
Wu, S., Wu, Q., Zhang, J., Chen, M., & Guo, W. (2016). Analysis of Multilocus
sequence typing and virulence characterization of Listeria monocytogenes iso-
lates from Chinese retail ready-to-eat Food. Frontiers in Microbiology, 7, 168.
Wu, S., Wu, Q., Zhang, J., Chen, M., & Yan, Z. (2015b). Prevalence, antibiotic resis-
tance and genetic diversity of Listeria monocytogenes isolated from retail ready-
to-eat foods in China. Food Control, 47, 340e347.
Wu, S., Wu, Q., Zhang, J., Chen, M., Yan, Z. A., & Hu, H. (2015a). Listeria mono-
cytogenes prevalence and characteristics in retail raw foods in China. PLoS One,
10, e0136682.
Yan, H., Neogi, S. B., Mo, Z., Guan, W., Shen, Z., Zhang, S., et al. (2010). Prevalence and
characterization of antimicrobial resistance of foodborne Listeria monocytogenes
isolates in Hebei province of Northern China, 2005-2007. International Journal of
Food Microbiology, 144, 310e316.
Yu, T., & Jiang, X. (2014). Prevalence and characterization of Listeria monocytogenes
isolated from retail food in Henan, China. Food Control, 37, 228e231.
Zhang, W., Wang, X., Xia, X., Yang, B., Xi, M., & Meng, J. (2013). Isolation and
characterization of Listeria monocytogenes isolates from retail foods in Shaanxi
Province, China. Foodborne Pathogens and Disease, 10, 867e872.