Technical Journal of Engineering and Applied Sciences

Available online at www.tjeas.com

2014 TJEAS Journal-2014-4-04/339-348
ISSN 2051-0853 2014 TJEAS

Terpenoids and Phenolic Compounds Production of

Mint Genotypes in Response to Mycorrhizal Bio-
Elicitors
Samaneh Bagheri1, Mohammad Ali Ebrahimi2, Saeid Davazdahemami3,Javad Minooyi
Moghadam4
1 2
Department of Agricultural Biotechnology, Payame noor University, Tehran, Iran, Associated Professor,
Department of Agricultural Biotechnology, Payame noor University, Tehran, Iran,
3
Agricultural and Natural Resources Research Center of Esfahan, Iran ,
Email: s.12emami@yahoo.com
4
Young Researchers and Elite Club, Damghan Branch, Islamic Azad University, Damghan, Iran

ABSTRACT: Mentha spicata is known as a rich source of valuable secondary metabolites with lots
of medicinal properties. Application of many fungal species as bio-elicitors to improve secondary
metabolite biosynthesis is recommended, but few studies have been conducted regarding the
obvious effect of mycorrhizal fungi on the content of secondary metabolites and their biosynthetic
pathways in host plants. In this study, the effect of two species of mycorrhizal fungi Glomus
etunicatum and Glomus mosseae on concentrations of essential oil, expression of limonene synthase
gene (the key regulating gene in the biosynthesis pathway of terpenoids) and amount of total phenolic
compounds in three genotypes of Mentha spicata with origin of Isfahan, Kermanshah and Yazd was
investigated. In addition, activity of the phenylalanine ammonia lyaz (PAL) enzyme and the number of
trichome (main sites of essential oil synthesis) in fresh leaves was measured. In this study,
application of mycorrhizal bio-elicitors increased content of phenolic compounds (especially in root),
to higher degree compared to essential oil content and limonene synthase gene expression in mint
genotypes. The results of increasing of phenolic compounds accumulation in treated mint genotypes
were observed following increase in PAL enzyme activity. Increased Essential oil in mint inoculated
plants, was associated to biomass content and number of glandular trichomes significantly. Also the
mycorrhiza inoculation did not lead to significant changes in expression of limonene synthase gene in
these plants. This study showed that difference in the increase of secondary metabolites is
dependent on fungal species of Glomus as bio-elicitor and host plants' genotype.
Key words: mycorrhiza, mint, phenolic, terpenoid.

INTRODUCTION

Mentha spicata is considered edible vegetable because its leafs' pleasant flavor and smell. Its branches and leafs
have a lot of uses in healthcare industry, pharmaceutical and food (Arnold, 1997). Mentha spicata L. is one of 25-30
species in Mentha genus and belonging to the Lamiaceae family (Daz-Maroto et al., 2003(. Nowadays the mint
plant is exploited extensively because of production of Essential oil (Zeinali et al., 2004). Essential oil is
combination of monoterpene and sesquiterpene that are present in the trichome gland of plants (Croteau et al.,
1972). limonene synthase is a key enzyme in the biosynthesis of terpenoids that catalyzes transfer reaction
geranyl pyrophosphate to limonene. Production of limonene as the first intermediate in this biosynthesis path is a
rate-limiting step (Muoz-Bertomeu et al., 2008). This plant also has series of non-enzymatic antioxidants
compounds such as phenolic compounds that play an important role in plant defense system and has anti-oxidant,
antibacterial and anti-inflammatory properties (Mousavi nodoshan et al., 2010). Mint genus has high genetic
diversity due to high different ploidy level and hybrids between species; that this diversity provides possibility of
choosing superior genotypes in terms of various properties including essential oil (El-zaher et al., 2005). Nowadays,
arbuscular mycorrhizal fungi that are the largest group of symbiotic with agricultural products are widely used as
bio-elicitors in agricultural ecosystems (Smith and Read, 1997). These bio-elicitors increase producing primary
Tech J Engin & App Sci., 4 (4): 339-348, 2014

productions and providing more resources for production of secondary metabolites through increase of available
nutrient uptake (Garcia-Garrido and Ocampo, 2002).
In this context Gupta et al (2002), reported an obvious increase in the essential oil content of M. arvensis plant
inoculated with mycorrhizal fungi in comparison with non-mycorrhizal plants (Gupta et al., 2002). Also Eftekhari et
al (2012), showed Increased content of total phenol and quercetin in four varieties of Iranian grape inoculated with
mycorrhizal fungi in comparison with non-mycorrhizal plants (Eftekhari et al., 2012). Therefore, symbiosis with AMF
led to changes in the accumulation of secondary metabolites, including phenolics of shoot and root and essential oil
content in host plants (Yao et al., 2003; Copetta et al., 2006; Toussaint et al., 2007). Despite numerous reports on
mycorrhizal fungi symbiosis with different plants, investigating the effect of this fungus on gene expression of
terpenoids and followed by it, increasing of essential oil content in medicinal plants have been done less. The
purposes of this study were investigate the effects of two species of mycorrhizal fungi Glomus etunicatum and G.
mosseae as bio-elicitors on synthase limonene gene expression, Essential oil production and total phenolic
compounds in the leaves of three genotypes of Mentha spicata plants and also the relationship between amount of
the production rate of Essential oil and phenolic compounds as different biosynthesis pathways of mint genotypes
in response to mycorrhizal infection.

2. MATERIALS AND METHODS

2.1. Plant material and fungal inoculation
In this study, three genotypes of mint belonging to Mentha spicata species, native of Isfahan, Kermanshah and
Yazd were prepared from gene bank of research center of forests and grasslands and were studied. Plant samples
were planted in pots with opening of 25 cm and depth of 12 cm containing a mixture of sand and clay soils. After
plants entering into reproductive phase, about 10 to 15 cm from their stem end was cut. Then these pieces were
kept in clean cotton cloth and constantly wet. After about two weeks the stems got rhizome. For inoculation,
rhizomed stems and about 25 grams of inoculum (prepared from biotech company of Turan , Semnan, Iran ) of two
fungus species of Glomus etunicatum and G. mosseae were used for each pot. Pots were kept in a greenhouse at
35/25 C day / night and at a relative humidity of 70%. After 90 days of fungal inoculation, presence of AMF fungi
in the roots of inoculated plants were confirmed using Philips and Hayman painting method (Phillips and Hayman,
1970). For determining the dry weight of samples' shoot, they were kept inside cardboard pockets and away from
direct sunlight for 4 days and their dry weight were determined.
2.2. Measurement of Limonene synthase gene expression
2.2.1. Total RNA extraction and RT-PCR
Limonene synthase gene expression in the fully developed leaves was investigated. gapdh gene was selected as
house keeping gene. Limonene synthase genes as involved genes in plant's response to fungal inoculation were
selected by resources review and their sequence was found by searching in information banks (Table 1). Total
RNA was extracted using buffer (QIAGEN) QIAzolLysis Reagent from leaf tissue. RNA samples were treated with
DNase1 enzyme (RNase-free Dnase Promega RQ1) to ensure the complete removal of genomic DNA. Treated
RNA samples were used as pattern for PCR reaction. After equalizing of different RNAs concentration, cDNA
synthesis reaction was performed using QuantiTect Reverse Transcription Kit.
2.2.2 Real-time PCR
Gene expression pattern was investigated using Real-time PCR (iCycler iQ real-time PCR, Bio-Rad). Amplification
was performed by SYBR Premix Ex and TaqTaKaRa. level of gene expression was determined by Efficiency
adjusted Ct method. In this method, the level of limonene synthase gene expression was normalized based on
gapdh gene by constant expression, then the amount of gene expression changes in all treatments were measured
compared to the non-mycorrhizal samples.
2.3. Measurement of Essential oil
Essential oil was extracted by steam distillation and Clevenger device. Flowers of studied genotypes were dried in
the shade to reduce the moisture content to 12%. A 30 g sample of dried flowers of each genotype, with 200 ml of
distilled water were put into the flask of Clevenger, then they were heated for 4 h and at 70 C to 80 C. as a result
of increasing the heat and pressure of water vapor, Essential oil glands disintegrated. The resultant essential oil
was gathered in graded tube of device and its value was measured by volumetric method. After removing the
essential oil from liquid, its percentage was determined (Hornok, 1992).
2.4. Counting Trichome
Counting Trichomes was done with three replication per each treatment. In order to determine that, two leaves of
each genotype with the same age and position in each sample were taken. Number of its Trichomes was
determined in 1sq.cm behind the leaves by stereomicroscope (Olympus) device.

340
Tech J Engin & App Sci., 4 (4): 339-348, 2014

2.5. Measurement of total phenolic content

Total phenolic content of shoot and root in studied mint plants were determined using Singleton and Rossi (1965)
method. 100 mg of leaf tissue at 1.5 mL of 80% methanol were grinded and then centrifuged at 1000 g / min. 300
ml of resulting extracts were combined with 1.2 ml of sodium carbonate and 1.5 ml of folin syokalto reagent and its
absorption spectra was read in the wavelength of 765 nm by a spectrophotometer. Amount of total phenolic
compounds in shoot and root samples were assessed using the standard curve of gallic acid (25, 50, 75 and 100
mg/ l).

2.6. Measurement of anthocyanin amount

Amount of anthocyanin was determined based on extinction coefficient of mulirafanozin (Ishikura and Hayashi,
1963). For this purpose, 0.1 g fresh leave of studied plants were grinded in 2 ml of 0.1 normal HCl and were placed
at room temperature for 3 hours. The resulting extracts were centrifuged in 1000 g/min and their supernant
absorption nm was read in wavelength of 511.

2.7. Phenylalanin ammonia lyase enzyme activity

Enzyme activity was determined using Abell and Shen method (1987). 0.1 g shoot of the studied genotypes were
grinded in Tris-HCl buffer (0.1 M, pH=7.6) with (PVP) %0.5 on the ice . The obtained extracts were centrifuged in
1260 g /min at 4C temperature.
In one series of experiment tubes, 0.25 ml of enzyme extract and 1.25 ml of Tris-HCl buffer (0.1 M, pH=8.5)
containing 12 mM phenylalanine as substrate, were poured. In the second series of experiment tubes, non-
mycorrhizal samples without phenylalanine and containing 0.25 ml of enzyme extract and 1.25 ml of Tris-HCl
buffer (0.1 mM) in pH=8.5 were prepared . After 60 min incubation at 30C, uptake increasing by enzyme activity in
both series of samples was read at 290 nm wavelength. Cinnamic acid concentration was determined using
Lambert law (2005).
Statistical analysis
In this research, factorial experiment in a completely randomized design with two mycorrhizal factors (non
inoculated and inoculated with G. etunicatum and G. mosseae) and three genotypes in three replications was
performed. Mean Comparison was done by LSD test. All statistical analysis was performed using SAS and
MSTATC software.

Table1. Primer sequences of gapdh and ls genes

Target Forward Primer (5-3) Reverse Primer (5-3) Product size (bp)
Ls TGGAAGAGGTGAGCAGAGGG ACACCTCCGCTATCAGCCAT 171
Gapdh CTCAGAGAGGAGTCGGTGGG CTACACAACAGAGCGCGGAA 114

3. RESULTS

The results of this study indicate that mycorrhizal inoculation led to significant increasing in the amount of phenolic
compounds of mint genotypes. In all studied genotypes except of Yazd, inoculated plants with G. etunicatum had
the highest total shoot and root phenolic compounds in compared with non-mycorrhizal plants. In Yazd genotype,
the highest phenolic compounds was achieved in inoculated plants with the G. mosseae (Figure 1).
The results of shoot anthocyanin in Mentha spicata are shown in Figure 2. Significant increasing in anthocyanin
amount in all genotypes except of Kermanshah, was observed in inoculated plants with G. etunicatum. In all
genotypes, inoculated plants with G. etunicatum fungi had the highest activity of phenylalanin ammonia Lyase
anzyme (cinnamic acid rate) compared to non-mycorrhizal plants (Figure 3). According to changes pattern in
phenolic compounds concentration and activity of phenylalanin ammonia Lyase enzyme, Isfahan and Kermanshah
genotypes that had higher concentrations of phenolic compounds in shoot, had more enzyme activity in leaves,
whereas this relationship in Yazd genotype was reversed.
Results of mean comparison indicate that mycorrhizal inoculation did not lead to significant differences in the
2
number of trichomes on a cm of leaves in the Kermanshah and Yazd genotypes. While in the Yazd genotype, the
highest number of trichome was observed with significant differences in inoculation with G. etunicatum fungus
(Figure 4, 5).
According to the results in all genotypes, plants inoculated with both species of fungi showed significant increase in
biomass amount (dry weight) compared to non-mycorrhizal plants. The greatest amount of biomass was obtained
in the plants inoculated with G. mosseae fungus (Figure 6).

341
Tech J Engin & App Sci., 4 (4): 339-348, 2014

Also, essential oil concentration in the inoculated plants of the all studied genotypes showed a significant increasing
compared with non-mycorrhizal plants, while the difference between two used bio-elicitors in genotypes of Isfahan
and Kermanshah was not significant (Figure. 7). In general, the highest amount of essential oil percentage was
obtained in Kermanshah genotypes plants that inoculated with G. mosseae (1.38 vs. non-mycorrhizal samples)
fungus.
The results of limonene synthase gene expression showed that mycorrhizal inoculation resulted a little increasing in
the level of this gene expression in mint genotypes, but nevertheless, difference between non-mycorrhizal and
inoculated plants was not significant (Figure 8).
According to these results, application of mycorrhizal bio-elicitors increased content of phenolic compounds
especially in roots to a greater extent in comparison with the Essential oil content in mint genotypes.

(A)

(B)

Figure 1. Effect of fungal inoculation on total phenolic content (mg/100g DW) in shoot (A) and root (B) of mint
genotypes. Mean values of three replicates are standard error (SE). Dissimilar letters on each column indicate
significant differences based to Duncan's test (P <0.05).

342
Tech J Engin & App Sci., 4 (4): 339-348, 2014

Figure 2. Effect of fungal inoculation on anthosyanin content (mol/g FW) in shoot of mint genotypes. Mean values
of three replicates are standard error (SE). Dissimilar letters on each column indicate significant differences
based to Duncan's test (P <0.05).

Figure 3. Effect of fungal inoculation on cinnamic acid content (nmol/g FW) in shoot of mint genotypes. Mean
values of three replicates are standard error (SE). Dissimilar letters on each column indicate significant
differences based to Duncan's test (P <0.05).

343
Tech J Engin & App Sci., 4 (4): 339-348, 2014

Figure 4. Effect of fungal inoculation on density of glandular trichomes in leave of mint genotypes. Mean values of
three replicates are standard error (SE). Dissimilar letters on each column indicate significant differences based
to Duncan's test (P <0.05).

Leaf of non-mycorrhizal Mentha spicata plant Leaf of inoculated Mentha spicata plant
Figure 5. Comparison of trichome number in mycorrhizal and non-mycorrhizal mint plants

Figure 6. Effect of fungal inoculation on shoot dry weight (gr) of mint genotypes. Mean values of three replicates
are standard error (SE). Dissimilar letters on each column indicate significant differences based to Duncan's test (P
<0.05).

344
Tech J Engin & App Sci., 4 (4): 339-348, 2014

Figure 7. Effect of fungal inoculation on Essential oil concentration (ml/100g DW) in shoot of mint genotypes. Mean
values of three replicates are standard error (SE). Dissimilar letters on each column indicate significant
differences based to Duncan's test (P <0.05).

Figure 8. Effect of fungal inoculation on gene expression of limonene synthase in mint genotypes. Mean values of
three replicates are standard error (SE). Dissimilar letters on each column indicate significant differences based
to Duncan's test (P<0.05).

4. DISCUSSION

Symbiosis with mycorrhizal arbuscular fungi (AMF), effects on the primary and secondary metabolism of host plants
(Schliemann et al., 2008). These fungi by creating significant changes in the enzymatic activities (Marin et al,.
2002) and involved physiological mechanisms, lead to the accumulation of secondary metabolites such as
carotenoids and polyphenols in host plants (Fester et al., 2005 Marulanda et al., 2007 Toussaint et al., 2007).
Researches revealed that secondary metabolites play an important role in different interaction between plants and
the natural environment. In this regard, it has been found that phenolics are the main compounds in pathogenic
interactions between plants and fungi (Dixon et al., 1994).
In this respect, Ceccarelli et al., (2010) showed an increasing in the content of phenolic compounds in inoculated
Artichoke plants with two fungal species Glomus intraradices and Glomus mosseae in comparison to non-
mycorrhizal plants (Ceccarelli et al., 2010). Also, Eftekhari et al., (2012) reported that the amount of increasing in
the total phenol and quercetin content in four varieties of inoculated Iranian grapes is dependent on the genotype of

345
Tech J Engin & App Sci., 4 (4): 339-348, 2014

the host plant. The results of the present study (Fig. 1) are also in agreement with these reports, so that application
of two species of mycorrhizal fungi led to increasing in phenolic compounds in each three genotypes of inoculated
mint plants compared to non-mycorrhizal plants. Genotypes of Isfahan, Kermanshah and Yazd increased
production of phenolic compounds with significant difference, in response to mycorrhizal infection. Thus, it can be
concluded that the genotype type of host plant and fungal species are the affecting factors on phenolic content.
Phenolic compounds Increasing in inoculated mint plants can be justified as a defensive response in pathogenic
interactions between the plant and fungus. PAL enzyme is involved in biosynthesis of the antimicrobial and
Phytoalexins compounds and compounds with phenylpropanoid skeleton. This enzyme lead to formation of trans-
cinnamic acid compound by removal of ammonium from L-phenylalanine (Ronald and Soderhall, 1985). In this field
Volpin et al., (1994) showed that inoculation with mycorrhizal fungi leads to increasing in PAL enzyme activity and
flavonoids accumulation in the roots of mycorrhizal alfalfa plants compared to non-mycorrhizal plants (Volpin et al.,
1994). Therefore inoculation of mint genotypes with mycorrhizal fungi in this study, has led to increasing in activity
of PAL enzymes and thus increasing in the amount of phenolic compounds.
The results of this study that are presented in Figure 3, suggest that inoculation of mycorrhizal fungi as bio-elicitors
has led to significant increasing in anthocyanin content (one of the important phenolic compounds) in leaf of mint
plants. Increased anthocyanin in inoculated plants with mycorrhizal fungi in comparison to non-mycorrhizal plants in
others plants such as lettuce (Baslam and Goicoechea, 2012) and basil (Lee and Scagel, 2009) has also been
reported.
Based on the results of this study (Fig 7), Symbiosis of each of two mycorrhizal fungi species with mint genotypes
has led to a significant increasing in essential oil concentration in comparison to non-mycorrhizal plants. Several
reports have revealed improve of the content of Essential oil in inoculated plants compared to non-mycorrhizal
plants . In this context Heydarizadeh et al., (2013), reported enhance of essential oil content in three species of
mint inoculated plants with mycorrhizal fungi (Heydarizadeh et al, 2013). Also Mucciarelli et al (2003), reported
amount increasing and composition change of the essential oils in inoculated M. piperita plants compared to non-
mycorrhizal plants (Mucciarelli et al., 2013). There are different reasons about the mechanism of Essential oil
increasing in mycorrhizal symbiosis phenomenon. In this study, positive significant relationship was observed
2
between the density of gland trichome and Essential oil concentration in mint genotypes (r of Esfahan genotype=
2 2
0.81, r of Kermanshah genotype= 0.93 and r of Yazd genotype= 0.85). Greater number of gland trichomes in
inoculated plants with mycorrhiza has been reported in other species such as Artemisia (Chaudhary et al., 2008)
and basil (Copetta et al., 2006). Greater number of glands in Mycorrhizal plants may be associated with changes in
hormonal profiles and increased levels of auxin, cytokinin and gibberellin in these plant (Torelli et al., 2000), which
eventually lead to the increase of the essential oil content. Also, the mint plants having more dry weight of shoot
(biomass), showed more esential oil amount in the leaves and high correlation between the biomass of shoot and
2 2 2
esential oil (r of Isfahan genotype = 0.85, r of Kermanshah genotype=0.81 and r of Yazd genotype = 0.75) in all
genotypes were observed. Thus, factors that increase the production of dry matter may affect primary and
secondary metabolites and resulting in increased biosynthesis of secondary metabolites (Shukla et al., 1992).
Plants responds to the environmental stresses through changing in expression of genes that involved in primary
and secondary metabolism. Thus industrial plants that producing Essential oils such as Mint, respond to the
environmental changes through changing in quantity and quality of this oil (Maffei, 1990 and Sacco et al., 1992).
Results of this experiment (Fig. 8), showed that the presence of mycorrhizal fungi led to a slight increase in the
limonene synthase gene expression in genotypes of Isfahan, Kermanshah and Yazd. In this regard Dolzhenko et
al., (2010), reported that M. pipperita plants grown in a growth chamber and exposed to UV-B light, showed
increasing in Essential oil content compared to non-mycorrhizal plants by changes in expression of genes involved
in the biosynthesis of terpenoids (Delzhenko et al., 2010). While in the present research, a little correlation
between gene expression of LS (which showed no significant change as a result of inoculation) and increasing in
Essential oil content in mint plants was observed. Lack of correlation between gene expression and production of
Essential oil may be related to different levels of terpenoids outflow from secretary structures and a number of
Posttranscription processes involved in this pathway (McConkey et al., 2000).
A variable concentration of root and shoot phenolic compounds and Essential oil concentration in fungal-genotypes
communities were observed in this study show functional diversity among fungi isolates. Also, more increasing in
phenolic compounds (especially in root), in inoculated mint plants (that showed lower levels of terpenoid
compounds) expressed the relationship between production of terpenoids and phenolic compounds in response to
mycorrhizal infection. In this regard Dolzhenko et al (2010), reported relationship between production of terpenoids
and flavonoids compounds in M. piperita plants grown in nature and growth chamber that exposed to UV-B
radiation. They stated that more increasing in phenolic compounds in M. piperita plants grown in nature leads to
their less susceptibility to metabolism of terpenoids (as a defensive mechanism), while these results proved true

346
Tech J Engin & App Sci., 4 (4): 339-348, 2014

reversely in plants grown in growth chamber (Dolzhenko et al., 2010). Therefore, in this study higher content of
phenolic compounds in genotypes of Isfahan, Kermanshah and Yazd in response to fungal infection may reduce
the need to increase of gene expression and metabolism of Essential oils in them. Finally, the study of different
genotypes for surveying different biosynthesis pathways in response to fungal infection is recommended.

REFERENCES
Abell, C. W. and Shen, R. S. (1987) Phenylalanine ammonia-lyase from the yeast Rhodotorula glutinis. Methods In Enzymology 142: 242-253.
Arnold, ML. (1997) Natural Hybridization and Evolution. Oxford University Press, New York 2: 251-255.
Baslam, M. and Goicoechea, N. (2012) Water deficit improved the capacity of arbuscular mycorrhizal fungi (AMF) for inducing the accumulation
of antioxidant compounds in lettuce leaves. Mycorrhiza 22: 347-359.
Ceccarelli, N., Curadi, M., Martelloni, L., Sbrana, C., Picciarelli, P. and Giovannetti, M. (2010) Mycorrhizal colonization impacts on phenolic
content and antioxidant properties of artichoke leaves and flower heads two years after field transplant. Plant and Soil 335: 311-323.
Chaudhary, V., Kapoor, R. and Bhatnagar, A. (2008) Effectiveness of two arbuscular mycorrhizal fungi on concentrations of essential oil and
artemisinin in three accessions of Artemisia annua L. Applied Soil Ecology 40: 174-181.
Copetta, A., Lingua, G. and Berta, G. (2006) Effects of three AM fungi on growth, distribution of glandular hairs, and essential oil production in
Ocimum basilicum L. var. Genovese. Mycorrhiza 16: 485-494.
Croteau, R., Burbott, A. J. and Loomis, W. D. (1972) Apparent energy deficiency in mono-and sesqui-terpene biosynthesis in peppermint.
Phytochemistry 11: 2937-2948.
Diaz-Maroto, M. C., Perez-Coello, M. S., Vinas, M. a. G. and Cabezudo, M. D. (2003) Influence of drying on the flavor quality of spearmint
(Mentha spicata L.). Journal Of Agricultural And Food Chemistry 51: 1265-1269.
Dixon, R. A., Harrison, M. J. and Lamb, C. J. (1994) Early Events in the Activation of Plant Defense Responses. Annual Review of
Phytopathology 32: 479-501.
Dolzhenko, Y., Bertea, C.M., Occhipinti, A., Bossi, S. and Maffei, M. E. (2010) UV-B modulates the interplay between terpenoids and flavonoids
in peppermint (Mentha piperita L.). Journal of Photochemistry and Photobiology B: Biology 100: 6775
Eftekhari, M., Alizadeh, M. and Ebrahimi, P. (2012) Evaluation of the total phenolics and quercetin content of foliage in mycorrhizal grape (Vitis
vinifera L.) varieties and effect of postharvest drying on quercetin yield. Industrial Crops and Products 38: 160-165.
El-Zaher, A., Mustafa, MA., Badr, A., El-Galabi, M., Mobarak, A.A. and Hassan, MG. (2005) Genetic diversity among Mentha populations in
Egypt as reflected by Isozyme polymorphism. International Journal of Botany 1: 188-195.
Fester, T., Wray, V., Nimtz, M. and Strack, D. (2005) Is stimulation of carotenoid biosynthesis in arbuscular mycorrhizal roots a general
phenomenon? Phytochemistry 66:17811786.
Garcia-Garrido, J. M. and Ocampo, J. A. )2002( Regulation of the plant defence response in arbuscular mycorrhizal symbiosis. J Exp Bot
53:13771386.
Gupta, M.L., Prasad, A., Ram, M. and Kumar, S. (2002) Effect of the vesicular-arbuscular mycorrhizal (VAM) fungus Glomus fasciculatum on the
essential oil yield related characters and nutrient acquisition in the crops of different cultivars of menthol mint (Mentha arvensis) under
field conditions. Bioresour Technol 81: 7779.
Heydarizadeh, P., Zahedi, M., Sabzalian, M. R. and Ataii, E. (2013) Mycorrhizal infection, essential oil content and morpho-phenological
characteristics variability in three mint species. Scientia Horticulturae 153: 136142.
Hornok, L. (1992) Cultivation and processing of medicinal plants. John Wiley & Sons Ltd.
Ishikura, N. and Hayashi, K. (1963) Chromatographic separation and characterization of the component anthocyanins in radish root. Bot. Mag.
Tokyo 76: 6-13.
Lambert, J.D., Hong, J., Yong, G. Y., Liao, J. and Yang, C. S. (2005) Inhibition of carcinogenensis by polyphenols evidences from laboratory
investigations. The American Jornal of Clinical Nutriton 81:284S-291S.
Lee, J. and Scagel, C. F. (2009) Chicoric acid found in basil (Ocimum basilicum L.) leaves. Food Chemistry 115: 650-656.
Maffei, M. (1990) Plasticity and genotypic variation in some Mentha verticillata hybrids. Biochem. Syst. Ecol 18: 493502.
Marin, M., Ybarra, M., Garcia-Ferriz, F. and Garcia-Ferriz, L. (2002) Effect of arbuscular mycorrhizal fungi and pesticides on Cynara cardunculus
growth. Agr Food Sci Finland 11:245251.
Marulanda, A., Porcel, R., Barea, JM. and Azcon, R. (2007) Drought tolerance and antioxidant activities in lavander plants colonized by native
drought-tolerant of drught-sensitive Glomus species. Microb Ecol 54:543552.
McConkey, M. E., Gershenzon, J. and Croteau, R.B. (2000) Developmental regulation of monoterpene biosynthesis in the glandular trichomes
of peppermint. Plant Physiol 122: 215223.
Mousavi Nodoshan, S., Owlia, P., Moein Najafabadi, L., Rasooli, I, Saderi, H. and Salari, M.H. (2010) Effect of sub inhibitory concentrations of
Essential oils of Mentha spicata and Cumminum Cyminum on virulence factors of pseudomonas aeroginusa. Journal of medicinal
plants 9:124-130.
Mucciarelli, M., Scannerini, S., Bertea, C. and Maffei, M. (2003) In vitro and in vivo peppermint (Mentha piperita) growth promotion by
nonmycorrhizal fungal colonization.New Phytol 158: 579591.
Muoz-Bertomeu, J., Ros, R., Arrillaga, I. and Segura, J. (2008) Expression of spearmint limonene synthase in transgenic spike lavender results
in an altered monoterpene composition in developing leaves. Metabolic Engineering. 10(3): 166-177.
Phillips, J. M., Hayman, D. S. (1970) Improved procedures for clearing roots and staining parasitic and vesicular arbuscular mycorrhizal fungi for
rapid assessment of infection. Transactions of the British Mycological Society 5: 158160.
Ronald, P. and Soderhall, K. (1985) Phenylalanine ammonia lyase and peroxidase activity in mycorrhizal and nonmycorrhizal short roots of
scots pine, Pinus sylvestris L. New Phytologist 487-494.
Sacco, T. Peracino, V. and Maffei, M. (1992) Phenotypic plasticity in Mentha viridis lavanduliodora, J. Essent. Oil Res 4: 491496.
Schliemann, W., Ammer, C. and Strack, D. (2008) Metabolic profiling of mycorrhizal roots of Medicago truncatula. Phytochemistry 69:112146.
Shukla, A., Abad Farooqi, A., Shukla, Y. and Sharma, S. (1992) Effect of triacontanol and chlormequat on growth, plant hormones and
artemisinin yield in Artemisia annua L. Plant Growth Regulation 11: 165-171.
Singleton, V. L. and Rossi, J. A. (1965) Colorimetry of Total Phenolics with Phosphomolybdic Phosphotungstic Acid Reagents. American Journal
of Enology and Viticulture 16: 144-158.

347
Tech J Engin & App Sci., 4 (4): 339-348, 2014

Smith, S.E. and Read, D.J. (1997) Mycorrhizal Symbiosis. 2nd ed Academic Press, San Diego CA.
Torelli, A., Trotta, A., Acerbi, L., Arcidiacono, G., Berta, G. and Branca, C. (2000) IAA and ZR content in leek (Allium porrum L.), as influenced
by P nutrition and arbuscular mycorrhizae, in relation to plant development. Plant and Soil 226: 29-35.
Toussaint, J.P., Smith, F. and Smith, S.E. (2007) Arbuscular mycorrhizal fungi can induce the production of phytochemicals in sweet basil
irrespective of phosphorus nutrition. Mycorrhiza 17: 291297.
Volpin, H., Elkind, Y., Okon, Y. and Kapulnik, Y. (1994) A vesicular arbuscular mycorrhizal fungus(Glomus intraradix) induces a defense
response in alfalfa roots. Plant Physiology 104: 683-689.
Yao, M.K., Desilets, H., Charles, M.T., Boulanger, R. and Tweddell, R.J. (2003) Effect of mycorrhization on the accumulation of rishitin and
solavetivone in potato plantlets challenged with Rhizoctonia solani. Mycorrhiza 13: 333336.
Zeinali, H., Arzani, A. and Razmjoo, K. (2004) Morphological and Essential oil content diversity of Iranian mints (Mentha spp.). Iran. J. Sci.
Technol. Trans. A 28: 1-9.

348