Вы находитесь на странице: 1из 19

CENG 1600

Genome Engineering
Lecture 12
Fei SUN
Department of Chemical and Biomolecular Engineering
Spring, 2017

1
Look beyond the central dogma
Book of Life
ATGGCACTGTGGATGCGTCT
GCTGCCGCTGCTGGCGCTGC
TGGCGCTGTGGGGTCCAGAC
CCGGCTGCGGCGTTTGTTAA
CCAGCACCTGTGCGGTTCCC
ACCTGGTTGAAGCCCTGTAT
CTGGTGTGCGGCGAACGCGG
CTTCTTCTACACCCCGAAAA
CGCGTCGTGAAGCAGAAGAT
CTGCAGGTAGGTCAGGTGGA
ACTGGGCGGCGGTCCGGGTG
CAGGTTCCCTGCAACCGCTG
GCGCTGGAAGGTTCTCTGCA
GAAACGTGGCATTGTGGAGC
AGTGTTGTACCTCTATCTGC
TCTCTGTACCAGCTGGAAAA

2017/3/17 3
Genome engineering: the next genomic revolution

Knockin Knockin Knockout

Gersbach, CA, Nature Methods (2014) 11, 1009


Tools for genome engineering

Zinc-finger protein Transcription activator- Cas9-gRNA


like effector (TALE)

A new scientific paradigm: the genome as an infinitely editable piece of software

Gersbach, CA, Nature Methods (2014) 11, 1009


Zinc finger nucleases
Nuclease is an enzyme capable of
cleaving the phosphodiester bonds
between monomers of nucleic
acids.

Gregory, PD, et al Nature Reviews Genetics (2011) 11, 636


Transcription Activator-like Effector (TALE)

Joung, JK et al. Science (2009) 11, 1491


TALE Nuclease (TALEN)

Stoddard, BL et al. Science (2012) 335, 716


Yan, N et al. Science (2012) 335, 720
The Genome Engineering Revolution: CRISPR/Cas9

Jennifer Doudna
@UC Berkeley

Zhang, Feng @MIT


http://www.genome-engineering.org/crispr/
CRISPR-Cas9

Microbial CRISPR systems in


adaptive immunity:

Clustered regularly interspaced short


palindromic repeats (CRISPR)

Streptococcus pyogenes
CRISPR-Cas9
Microbial CRISPR systems in adaptive immunity:
Clustered regularly interspaced short palindromic
repeats (CRISPR)

Cas9

Streptococcus pyogenes
www.neb.com/
12
Applications of CRISPR-Cas9

Zhang, F. et al, Cell (2014) 157, 1262


Timeline of CRISPR-Cas9

Chinese Scientists Edit Genes of


Human Embryos, Raising Concerns
(2015)

British Researcher Gets


Permission to Edit Genes of
Human Embryos (2016)

Business potential??
Bitter fight over CRISPR patent heats up

First to file v.s. First to invent


Round one of CRISPR patent legal battle goes to the
Broad Institute

17
Round one of CRISPR patent legal battle goes to the Broad
Institute

The judges ruled Wednesday that the Broad technique was sufficiently
different from Berkeleys technology, and therefore could be patented
independently and separately. Doudna and Charpentier demonstrated that
CRISPR could cut raw DNA precisely in a test tube. Broads team, led by
Feng Zhang, showed that CRISPR could work inside living cells, including
human ones. Berkeley argued that Zhangs work was an extension of
Doudnas and Charpentiers. But the patent office disagreed.

The patent we will likely be issued covers all use of this technology in all cells,
said Doudna. She likened Berkeleys patent request to a patent on all uses of all
tennis balls, and Broads to the use of green tennis balls only.

18
Take home question
Describe the original sources and functions of these genome editing
tools such as Zinc finger proteins, TALE and CRISPR-Cas9 in nature.
Compare ZFN, TALEN and CRISPR-Cas9. What makes CRISPR-Cas9 so
revolutionary? Any drawback of CRISPR-Cas9?

19