Вы находитесь на странице: 1из 18

BIOLOGA

(cdigo 08)

Ctedra Valerani

Gua de Actividades
Segunda Parte

Segundo cuatrimestre
de 2017

TEMAS:
Reproduccin.
Ciclo celular.
Duplicacin del ADN.
Divisin celular (mitosis, meiosis).
Gentica. Leyes de Mendel.
Transcripcin y traduccin.
Mutaciones.
Genotipo, fenotipo, ambiente.
Evolucin.
2

Reproduccin. Ciclo celular. Duplicacin del ADN.

Gua de estudio
1. Cules son las principales diferencias entre la reproduccin sexual y la reproduccin asexual?
2. A qu llamamos fisin binaria?
3. Cules son las fases o perodos del ciclo celular eucarionte y qu eventos importantes ocurren en cada
una de ellas?
4. Cul es la importancia del proceso de duplicacin del ADN y cmo se relaciona con la reproduccin?
5. Repas la estructura del ADN. Explic qu significa que las cadenas son complementarias.
6. Clasific al proceso de duplicacin del ADN segn la materia y segn la energa. Justific tu respuesta
indicando claramente cules son los sustratos y cules son los productos de este proceso.
7. Qu es la cromatina y cmo est compuesta? En qu etapas del ciclo celular se puede observar?
8. Qu son los cromosomas? En qu etapas del ciclo celular se pueden observar? ?Cul es la diferencia
entre cromatina y cromosomas?
9. En qu se diferencian un cromosoma simple y un cromosoma duplicado? A qu se llama cromtides
hermanas?

Actividades
1) Ubic las fases del ciclo celular eucarionte en el siguiente grfico:

Cantidad de ADN

Perodos del ciclo celular

2) Indic si las siguientes afirmaciones son verdaderas o falsas, justificando brevemente todas tus respuestas:
1. Los organismos unicelulares se reproducen asexualmente, mientras que los pluricelulares se reproducen
sexualmente.
2. Cuando una clula eucariota pasa por el perodo S del ciclo celular, su contenido de ADN aumenta al doble.
3. Las clulas procariontes no duplican su ADN.
4. Si una clula se va a dividir, previamente debe duplicar su ADN.
5. En la duplicacin del ADN se utilizan nucletidos monofosfatados como sustratos.
6. La duplicacin del ADN es un proceso catablico.
7. La enzima ADN polimerasa es un sustrato del proceso de duplicacin del ADN.
8. La duplicacin del ADN es semiconservativa.
9. En las clulas eucariontes las cromtides hermanas se forman durante la divisin celular.
10. Si una clula eucarionte no dispone de timina ni puede sintetizarla, su ciclo celular se detendr.

3) Dada la siguiente cadena de ADN, escrib abajo la cadena complementaria:

GAACTAGCTAACGATTCATGG

.....

4) Se quiere obtener de forma experimental copias de molculas de ADN.


a. Qu elementos agregaras en un tubo de ensayo para lograr ese objetivo?
b. De los elementos mencionados en el punto anterior cules son sustratos y cules son productos?
c. A qu temperatura obtendra mayor cantidad de producto por unidad de tiempo: a 37C a 4C?
d. Qu resultado se espera obtener si en el tubo de ensayo se agregan ribonucletidos en vez de
desoxiribonucletidos? Justific tu respuesta.
3
Mitosis y meiosis

Gua de estudio
1. Qu es un cariotipo? Averigu cmo es el cariotipo humano y qu informacin se puede obtener de l.
2. Cul es la importancia biolgica de la mitosis? En tu respuesta diferenci las funciones de la mitosis en los
organismos pluricelulares de su funcin en organismos unicelulares.
3. Qu organismos se reproducen por mitosis y qu organismos se reproducen por fisin binaria? Nombr
ejemplos.
4. Mencion cules son las fases de la mitosis y los principales eventos que ocurren en cada una de ellas.
5. En un organismo pluricelular, en qu se diferencian las clulas somticas de las gametas?
6. Qu significa que una clula es diploide? Qu son los cromosomas homlogos?
7. Qu significa que una clula es haploide?
8. En muchas especies las gametas son haploides. Por qu? Mediante qu proceso de divisin se
obtienen? Cul es la importancia de este proceso y cmo se relaciona con la reproduccin sexual?
9. Mencion cules son las fases de la meiosis y los principales eventos que ocurren en cada una de ellas.

Actividades
1) Sobre los cariotipos:
a. Cul es su utilidad? Para qu puede servir comparar cariotipos de la misma especie? Y de distinta
especie?
b. Cul es el nmero caracterstico de cromosomas en la especie humana?
c. Cmo se determina el sexo en nuestra especie?

2) Para cada clula observ el nmero y la forma de sus cromosomas e indic su complemento cromosmico:

.. .. .. ..

3) a. Para cada fase de la mitosis, indic su nombre y el complemento cromosmico.


b. En cada dibujo seal, si fuera posible, un par de cromosomas homlogos y un par de cromtides
hermanas.
4
4) Indic si las siguientes oraciones son verdaderas o falsas, justificando brevemente todas tus respuestas:
1. Una cromtide contiene una secuencia de ADN idntica a la de su cromtide hermana.
2. Una clula resultante de la divisin mittica tiene la misma cantidad de ADN que la clula madre en G2.
3. Una clula 2n=6 tiene 6 cromosomas, con una cromtide cada uno.
4. Los cromosomas homlogos son idnticos en cuanto a la forma y a la informacin que contienen.
5. La presencia o ausencia de cromtides hermanas determina si una clula es diploide o haploide.
6. Si despus de formarse la cigota se inhibe la accin de la ADN polimerasa, el desarrollo del nuevo individuo
se detendr.

5) En una especie cuya ploida es 2n=6, las clulas presentan en G1 una cantidad de ADN de 80 picogramos.
En base a estos datos complet el cuadro:

Etapa del ciclo N de Cantidad N de cromtides N de molculas


(clula somtica) cromosomas de ADN por cromosoma de ADN en la clula
G1

G2

Metafase
En cada polo
de telofase

6) Complet el cuadro teniendo en cuenta que se parte de una clula 2n=8, que en G1 posee 30 picogramos
de ADN

Cantidad Nmero de N de molculas


de ADN cromosomas de ADN en la clula
G1

G2

Metafase
Migrando a cada
polo en Anafase
En una clula hija
recin formada

7) Indic los perodos del ciclo celular en el grfico:


Cantidad
de ADN

Perodos del ciclo celular


5
8) a. Para cada fase de la meiosis, indic su nombre y el complemento cromosmico.
b. En cada dibujo seal, si fuera posible, n par de cromosomas homlogos y un par de cromtides
hermanas o recombinantes.

9) Cules son las fuentes de variabilidad gentica de la meiosis? En qu fase ocurre cada una?

10) Indic si las siguientes oraciones son verdaderas o falsas, justificando brevemente todas tus respuestas:
a. Una poblacin de papas reproducidas sexualmente presenta mayor variabilidad gentica que una
poblacin de la misma especie reproducida asexualmente.
b. En la primera divisin meitica se generan dos clulas diploides.
c. La segregacin de cromosomas homlogos que ocurre en anafase I genera variabilidad gentica.
d. Los cromosomas homlogos son idnticos en cuanto a la forma y a la informacin que contienen.
e. La presencia o ausencia de cromtides hermanas determina si una clula es diploide o haploide.
6
11) En una especie cuya ploida es 2n=6, las clulas presentan en G1 una cantidad de ADN de 80
picogramos. En base a estos datos complet el cuadro:

Etapa del ciclo N de Cantidad N de cromtides N de molculas


(clula germinal) cromosomas de ADN por cromosoma de ADN
G1

G2

Metafase I
En cada polo
de telofase I
Metafase II
En cada polo
de telofase II

12) Complet el cuadro comparativo:


MITOSIS MEIOSIS
Clulas en las que se produce
(procariontes o eucariontes)

Genera variabilidad gentica?

Presencia de cromosomas
homlogos
Apareamiento de cromosomas
homlogos
Cantidad de ADN en cada
clula hija respecto a la original
Nmero de divisiones
(una o dos)
Tipo de divisin
(ecuacional o reduccional)
Requiere de la duplicacin
previa del ADN?

13) Complet el cuadro teniendo en cuenta que se parte de una clula 2n=46 y que en G2 posee 40
picogramos de ADN

Nmero de Nmero de cromtides


Cantidad de ADN
cromosomas por cromosoma
G1

G2

Metafase I
Migrando a cada
polo en Anafase I
Metafase II
Migrando a cada
polo en Anafase II
En una clula hija
recin formada
7
14) Confeccion prrafos de aproximadamente 5 renglones, relacionando los conceptos:
a. cromtides hermanas ADN polimerasa mitosis
b. cigota - mitosis - crecimiento
c. variabilidad gentica - meiosis - fecundacin
d. cromtides hermanas - cromosomas homlogos - ploida
e. cromtides hermanas - cromtides recombinantes - profase I

15) Para cada clula, indic el tipo de divisin que est ocurriendo, la fase en la que se encuentra y su
complemento cromosmico:

Gentica, Leyes de Mendel

Gua de estudio
1. Averigu el significado de los siguientes conceptos: alelo alelo dominante alelo recesivo homocigota
heterocigota.
2. Luego de leer un texto sobre las leyes de Mendel, escrib con tus palabras en qu consistieron sus
experimentos.
3. Qu postula la llamada Primera Ley de Mendel?
4. Qu postula la llamada Segunda Ley de Mendel?

Actividades
1) En las ratas de laboratorio el color de pelo negro domina sobre el blanco. En un laboratorio se tienen una
rata macho de pelo negro y una rata hembra de pelo blanco. Se realiza el cariotipo de una clula somtica
de cada uno de ellos y se localizan los lugares donde se encuentra la informacin para dicho carcter.
Como convencin usaremos N para representar la variante pelo negro y n para representar la variante
pelo blanco. Se obtiene lo siguiente:
8

Cariotipo del macho: Cariotipo de la hembra:

N N NN n n n n

a. Cul es la ploida de esta especie?


b. Dibuj el cariotipo de una gameta del macho y el cariotipo de una gameta de la hembra.
c. Supongamos que una gameta cualquiera del macho fecunda a una gameta cualquiera de la hembra. Dibuj
el cariotipo de la cigota resultante.
d. Cmo ser el cariotipo de cualquiera de las clulas somticas de los descendientes de esta pareja? Por
qu?
e. Qu color de pelo tendrn los descendientes? Por qu?

2) Problemas de gentica. Primera ley de Mendel.

Resolv los siguientes problemas de gentica.


No olvides justificar todas las respuestas con las explicaciones y/o los cruzamientos necesarios.

1. En los ogros el color de piel verde domina sobre el color de piel azul.
a. Complet el cuadro:

gen estudiado alelos letra

b. Indic todos los genotipos posibles para un ogro azul y para un ogro verde.
c. Puede una pareja de ogros azules tener un ogrito de piel verde?
d. Cmo deben ser genotpicamente Shrek y Fiona (que son verdes) para poder tener un ogrito de piel
azul?

2. El factor Rh presenta dos alelos: Rh+ domina sobre Rh.


a. Complet el cuadro:

gen estudiado alelos letras

b. Paula es heterocigota para el factor Rh, y Martn es homocigota dominante para este mismo gen.
Cul es la probabilidad de que esta pareja tenga un hijo de factor Rh?
c. Ana tiene sangre factor Rh+ y Juan tiene sangre factor Rh Cul es la probabilidad de que esta pareja
tenga un hijo de factor Rh+? Si corresponde, plante todos los casos posibles.

3. Una mujer Rh+ tiene un hijo Rh.


a. Cules son sus genotipos?
b. Indic los posibles genotipos del padre.
c. Podra esa mujer tener hijos Rh+? Justific tu respuesta.
9
4. El albinismo es una enfermedad gentica recesiva. Dos personas no albinas (A_) tienen un hijo albino
(aa). En base a esta informacin:
a. Cul es la probabilidad de que su segundo hijo manifieste ese rasgo?
b. Dibuj una clula somtica de uno de los padres, indicando cromosomas homlogos y alelos (suponer
2n=4)

5. Tres hermanos presentan los siguientes fenotipos y genotipos: uno tiene el lbulo de la oreja separado,
y es heterocigota; otro tiene el lbulo de la oreja separado, y es homocigota, y el tercero tiene el lbulo
de la oreja unido.
a. Cul es el alelo dominante?
b. Cul es el genotipo y el fenotipo de los padres?

6. En las ratas de laboratorio el carcter cola larga domina sobre el carcter cola corta. Si tens una rata
de cola larga Cmo haras para averiguar su genotipo?

7. Un ratn A de pelo blanco se cruza con una ratona de pelo negro y toda la descendencia es de pelo
blanco. Otro ratn B de pelo blanco se cruza con la misma ratona y en la descendencia se observan
ratoncitos de pelo blanco y de pelo negro. Sabiendo que uno solo de los dos ratones es heterocigota
a. Cul es el alelo dominante?
b. Cul de los dos ratones es el heterocigota?
c. Dibuj el cariotipo de una clula somtica del ratn heterocigota, indicando cromosomas homlogos,
cromtides hermanas y alelos (suponer 2n=4).

8. La ptosis es una enfermedad que consiste en la imposibilidad de abrir los prpados totalmente, y se
debe a la presencia de un alelo dominante. Un vulo de una mujer enferma es fecundado por un
espermatozoide de un hombre fenotpicamente normal, originando un beb normal.
a. Indic el genotipo y el fenotipo de los tres integrantes de la familia.
b. Cul es la probabilidad de esta pareja de tener hijos enfermos de ptosis?

9. En las langostas, el color de ojos rojo domina sobre el color de ojos blanco. Se cruza una langosta
macho de ojos blancos con una hembra de ojos rojos y se obtienen 303 langostas de ojos blancos y
298 de ojos rojos.
a. Indic el genotipo y el fenotipo de los padres y de la descendencia.
b. Dibuj las posibles gametas de la hembra indicando cromosomas homlogos y alelos (suponiendo
2n=8)

10. Una mujer de grupo sanguneo A tiene un hijo de grupo B. Indic todos los genotipos posibles de la
mam, el beb y el pap.

11. Un hombre de grupo sanguneo A y una mujer de grupo AB tienen un hijo de grupo B Cul es la
probabilidad de que su prximo hijo sea de grupo A?

12. Indic la respuesta correcta: Qu grupos sanguneos pueden heredar los hijos de un hombre de grupo
B y una mujer de grupo A, ambos homocigotas?
a) A o B solamente b) A, B, AB o 0 c) A, B o 0 d) AB solamente

3) Problemas de gentica. Segunda ley de Mendel.

Resolv los siguientes problemas de gentica. En todos los casos suponemos que los dos genes
estudiados no estn ligados (es decir, no se encuentran en el mismo par de homlogos).
No olvides justificar todas las respuestas con las explicaciones y/o los cruzamientos necesarios.

1. En la especie humana los colores oscuros dominan sobre los colores claros. Una mujer morocha y de
ojos negros y un hombre rubio y de ojos celestes tienen dos hijos: uno morocho y de ojos celestes y otro
rubio y de ojos negros. Con estos datos:
10
a. Complet los cuadros:

gen estudiado 1 alelos letras

gen estudiado 2 alelos letras

b. Indic los genotipos de los cuatro integrantes de la familia


c. Cul es la probabilidad de que un tercer hijo sea morocho y de ojos negros?
d. Dibuj una clula del hombre en anafase I, indicando cromosomas homlogos, cromtides hermanas o
recombinantes y alelos (suponer 2n=6).
e. Dibuj una clula de la mujer en anafase II, indicando cromosomas homlogos, cromtides hermanas o
recombinantes y alelos (suponer 2n=6).

2. Cuntas gametas diferentes puede formar...


a. ...una persona que presenta un genotipo heterocigota para dos genes (AaBb).
b. ...una persona que presenta un genotipo heterocigota para el color de pelo y homocigota recesivo para el
factor Rh?
c. ...una persona que presenta un genotipo homocigota para dos caracteres?

3. En una especie de aves, el pico recto domina sobre el pico curvo, y el color gris de las plumas domina
sobre el marrn. Un ave macho heterocigota para ambos genes se cruza con una hembra de pico recto y
plumas marrones. Algunos de sus pichones tienen pico curvo. Con estos datos:

a. Complet los cuadros:

gen estudiado 1 alelos letras

gen estudiado 2 alelos letras

b. De acuerdo a estos datos cul es la probabilidad de que tengan pichones de pico recto y plumas grises?
c. Suponiendo 2n=4, dibuj: i) una clula somtica del macho en metafase y ii) una clula sexual de la
hembra en anafase I. En ambos dibujos seal un par de cromosomas homlogos, un par de cromtides
hermanas o recombinantes y los alelos para cada gen.

4. La fibrosis qustica es una enfermedad gentica recesiva, que afecta principalmente a los pulmones.
Pablo y Daniela, que son sanos, tienen un hijo, Martn, que padece fibrosis qustica. Adems Pablo es
morocho, mientras que Daniela y Martn son rubios. En base a estos datos:
a. Indic el genotipo de los tres integrantes de la familia.
b. Cul es la probabilidad de que Pablo y Daniela tengan un hijo heterocigota para ambas caractersticas?
c. Dibuj una clula germinal de Daniela en metafase II, indicando claramente un par de cromosomas
homlogos, un par de cromtides hermanas o recombinantes y los alelos para el gen estudiado.
Consider 2n=6.
11
5. Marcos tiene ojos oscuros y padece fenilcetonuria (enfermedad recesiva). Marcela, de ojos claros, es
sanita. Pepe, el hijo de ambos, es de ojos claros y fenilcetonrico.
a. Indic el genotipo y el fenotipo de los tres integrantes de la familia
b. Cul es la probabilidad de que un hermanito de Pepe sea fenilcetonrico y de ojos claros?
c. Dibuj una clula de Marcos en metafase, otra en metafase I y otra en metafase II, indicando
cromosomas homlogos, cromtides hermanas o recombinantes y alelos (supon 2n=4).

6. En una especie de delfn, el carcter aleta dorsal recta domina sobre aleta dorsal curva y el carcter
pigmentacin uniforme domina sobre el de pigmentacin manchada.
R: aleta recta D: pigmentacin uniforme
r: aleta curva d: pigmentacin manchada
Un delfn de aleta dorsal curva y pigmentacin uniforme se cruza con una hembra de aleta dorsal recta y
pigmentacin manchada. Tienen dos delfines de aleta dorsal recta y pigmentacin manchada
a. Cul es el genotipo de los padres?
b. Puede haber descendientes con distintos fenotipos a los sealados? Si respondiste afirmativamente,
indic como podran ser esos individuos genotpicamente y fenotpicamente.

7. Una mujer de grupo 0 y factor Rh tuvo un hijo de sangre B Rh+.


a. Cules son sus genotipos?
b. Indic todos los genotipos posibles del pap.

8. Una mujer cuyo fenotipo es B, Rh+ da a luz un beb de fenotipo A, Rh.


a. Indic todos los genotipos posibles de la mam y del hijo.
b. Qu genotipos podra tener un hombre que seguro no es el pap de ese beb? Indic por lo menos tres
de esos genotipos.
c. Si un hombre dice ser el padre, qu genotipos podra tener? Alcanza con que tenga alguno de estos
genotipos para estar seguros de que es el pap?

9. En una especie de zorros el color marrn domina sobre el gris. Por otro lado, algunos tienen orejas
redondeadas y otros tienen orejas punteagudas. Una zorra gris y de orejas redondeadas tiene dos
zorritos tambin grises, uno de orejas redondeadas y uno de orejas punteagudas. Adems se sabe que
el pap zorro es marrn y tiene orejas redondeadas.
a. Indic los genotipos de todos los integrantes de la familia.
b. Considerando que la especie estudiada presenta una ploida de 2n=8, complet el siguiente cuadro:

Etapa del N de N de cromtides Cantidad


ciclo celular cromosomas por cromosoma de ADN

G1 (interfase) 100

Metafase I

En cada polo
4
de telofase I

10. Al cruzar dos ratones sanos y de color blanco (homocigotas recesivos para el color) se obtienen 9 cras
sanas y 3 enfermas, todas blancas.
a. La enfermedad es una caracterstica dominante o recesiva?
b. Indic las proporciones genotpicas de la descendencia.
c. Las proporciones genotpicas y fenotpicas son iguales?
d. Suponiendo un complemento cromosmico 2n=4, dibuj una clula germinal de la hembra en anafase I y
una clula del pulmn del macho en metafase. En ambos esquemas seal un par de cromosomas
homlogos, un par de cromtides (aclarando si son hermanas o recombinantes) y los alelos estudiados.
12
Transcripcin y traduccin. Cdigo gentico. Mutaciones.

Gua de estudio
1. Repas la estructura del ARN y del ADN. En qu se parecen y en qu se diferencian? Confeccion un
cuadro comparativo entre ellos, eligiendo vos al menos cuatro criterios.
2. A qu llamamos gen? Qu tipo de informacin contienen la mayora de los genes?
3. Mencion los tres tipos de ARN que participan en la sntesis de protenas.
4. Mediante qu proceso se sintetizan las molculas de ARN?
5. Cules son los sustratos de dicho proceso?
6. Qu rol cumple el ADN en ese proceso?
7. Mediante qu proceso se sintetizan las protenas?
8. Cules son los sustratos de dicho proceso?
9. Qu rol cumplen los distintos tipos de ARN en ese proceso?
10. Qu es el cdigo gentico?
11. Qu significa que es universal?
12. Qu significa que es degenerado?
13. A qu se llama mutacin? En qu molcula ocurren?
14. A qu se llama mutacin puntual? Durante qu proceso pueden ocurrir este tipo de mutaciones?

Actividades
1) Para cada par de trminos, redact una oracin en la que queden relacionados funcionalmente:
a. gen ADN d. cromosoma ADN
b. gen ARN e. herencia ADN
c. gen protena f. ADN mutaciones

2) a. A partir del siguiente fragmento de ADN cul ser la secuencia de nucletidos del ARN que se obtiene
por transcripcin?
Cadena molde: CAGGTACGCATTTTACGACCGACGAACTTA
Cadena codificante: GTCCATGCGTAAAATGCTGGCTGCTTGAAT
ARN: ...

b. Dado el siguiente fragmento de ARN, cul es la secuencia de nucletidos del ADN del cual se
transcribi?

ARN: AUGGUUCGACCCAGUUUUAGCCCGC
Cadena molde: ......

Cadena codificante: ......

3) Realiz un cuadro comparativo entre los dos procesos en cuanto a los siguientes tems:
- Sustratos
- Productos
- Tipo de proceso segn la materia
- Tipo de proceso segn la energa
- Molcula con funcin de molde
- Enzima principal
- Localizacin en procariontes
- Localizacin en eucariontes
13
4) Indic si las siguientes afirmaciones son verdaderas o falsas, justificando brevemente:
a. El cdigo gentico contiene la informacin para la sntesis de las protenas.
b. Dada una secuencia de nucletidos, el cdigo gentico nos permite saber a qu secuencia de aminocidos
corresponde.
c. Dada una secuencia de aminocidos, el cdigo gentico nos permite saber a qu secuencia de nucletidos
corresponde.
d. Si a una levadura se le insertara el ARNm de una protena humana, la levadura producira dicha protena.

5) Suponiendo que las dos molculas de ARN del ejercicio 2) corresponden a ARN mensajero cules sern
las secuencias de aminocidos que se obtendrn al traducirlas?

6) Estos cinco tubos de ensayo, contienen biomolculas en un medio acuoso en condiciones adecuadas. Para
cada uno, indic si ser o no posible sintetizar insulina humana, justificando tu eleccin:

Tubo Contiene

1 ARNm de insulina humana, ATP, ARNt, ribosomas, enzimas

2 ARNm de insulina humana, aminocidos, ATP, ARNt, ribosomas, enzimas

3 ARNm de insulina humana, aminocidos, ATP, ARNt, ribosomas de rata, enzimas

4 ARNm de insulina de cerdo, aminocidos, ATP, ARNt, ribosomas de rata, enzimas

5 ARNm de insulina humana, aminocidos, ATP, ARNt de perro, ribosomas de perro, enzimas

CDIGO GENTICO

1era 2da 3ra


posicin posicin posicin
U C A G
UUU fen UCU ser UAU tir UGU cis U
U UUC fen UCC ser UAC tir UGC cis C
UUA leu UCA ser UAA stop UGA stop A
UUG leu UCG ser UAG stop UGG trp G
CUU leu CCU pro CAU his CGU arg U
CUC leu CCC pro CAC his CGC arg C
C CUA leu CCA pro CAA gln CGA arg A
CUG leu CCG pro CAG gln CGG arg G
AUU ile ACU tre AAU asn AGU ser U
AUC ile ACC tre AAC asn AGC ser C
A AUA ile ACA tre AAA lis AGA arg A
AUG met ACG tre AAG lis AGG arg G
GUU val GCU ala GAU asp GGU gli U
GUC val GCC ala GAC asp GGC gli C
G GUA val GCA ala GAA glu GGA gli A
GUG val GCG ala GAG glu GGG gli G
14
7) En cierta especie de plantas, las flores son rojas o blancas. El color rojo se debe a un pigmento rojo que se
encuentra en las clulas de las flores. Se observa que el alelo para el color rojo (R) domina sobre el alelo para
el color blanco (r). Mediante estudios bioqumicos se determin que el pigmento rojo es el producto de una
reaccin catalizada por la enzima pigmentosintetasa, que puede representarse de la siguiente manera:

pigmentosintetasa
molcula precursora pigmento rojo

A su vez, se logr identificar y secuenciar el gen que codifica para la enzima pigmentosintetasa, ubicado en el
par de homlogos n3.
En los individuos homocigota dominantes (RR) esta secuencia se encuentra en ambos miembros del par.

TTATGCGACTTGAGGCAGCACCCTTGTGAGGTA

Atencin: para representar un gen se escribe la secuencia de bases de una sola de las cadenas del ADN, ya
que no es necesario, conocida la complementariedad entre bases, escribir la secuencia de ambas. En este
caso transcribimos la cadena codificante.
1. Cul es la caracterstica estudiada? Cules son sus variantes?
2. Suponiendo que la especie es 2n=6, represent un cariotipo de una clula somtica de un individuo
heterocigota para esta caracterstica (record que el gen se encuentra en el par de homlogos n3).
3. Explic brevemente cul es la relacin entre el fenotipo color rojo de las flores y la secuencia de ADN
presentada.

Por otro lado, en los individuos homocigota recesivos (rr) no se encuentra la enzima pigmentosintetasa. En los
cromosomas del par n3 de estas plantas, la secuencia hallada en el mismo locus es la siguiente:

TTATGCGACTTTAGGCAGTACCCATGTGAGGTA

4. Compar esta secuencia con la anterior En qu se diferencian?


5. Cmo explicaras la relacin entre el fenotipo color blanco de las flores y esta nueva secuencia?
6. Reformulando la pregunta 1.: Cul es el gen que se corresponde con la caracterstica estudiada? Cules
son los alelos de dicho gen?
7. Cmo explicaras el hecho de que los individuos heterocigotas (Rr) presentan flores rojas?
8. Para cada una de las dos secuencias presentadas, escrib la secuencia correspondiente a la cadena molde.
9. Para cada una, hac la transcripcin, es decir, escrib la secuencia de nucletidos del ARN mensajero
correspondiente.
10. Para cada una, hac la traduccin, es decir, escrib la secuencia de aminocidos de la protena
correspondiente.
11. Analiz los resultados obtenidos y volv a responder la pregunta 5.

8) La siguiente secuencia de nucletidos corresponde a la cadena molde de un fragmento de ADN. Supon


que se trata de un gen que codifica para una protena.

TAGCCTACGTATCATCTCCCGGGTACAAAATCAC

1. a. Cul es la secuencia de la cadena codificante? Escribila.


b. Cul es el resultado de la transcripcin? Escrib la secuencia correspondiente e indic qu tipo de
molcula es.
b. Cul es el resultado de la traduccin? Escrib la secuencia correspondiente e indic qu tipo de
molcula es.
2. Si se produce una sustitucin (cambio) del nucletido de la posicin 19 (cuya base nitrogenada es citosina)
por un nucletido de timina,
a. cul ser la consecuencia en la traduccin?
b. la protena obtenida tendr la misma estructura espacial y funcin? Por qu?
15
3. Puede ocurrir que una sustitucin de un nucletido por otro no altere la secuencia de aminocidos de la
protena? Por qu? Explic con un ejemplo.
4. Dadas las siguientes mutaciones puntuales cul ser la consecuencia en la traduccin para cada una de
ellas?
a. Sustitucin del nucletido de la posicin 15 (timina) por adenina.
b. Sustitucin del nucletido de la posicin 8 (citosina) por guanina.
c. Insercin (agregado) de un nucletido de adenina entre las posiciones 22 y 23.
d. Delecin (prdida) del nucletido de guanina de la posicin 9.
5. Considerando los ejemplos de los puntos 2, 3 y 4, explic:
a. Cules son las mutaciones llamadas silenciosas? Con qu caracterstica del cdigo gentico se
relacionan dichas mutaciones?
b. Qu tipo de mutaciones producen un corrimiento del marco de lectura?

9) Indic si las siguientes oraciones son verdaderas o falsas. Justific tu eleccin en no ms de cinco
renglones.
1. Durante el proceso de traduccin se forman enlaces fuertes.
2. El proceso de transcripcin es anablico.
3. El resultado de la transcripcin es la secuencia de aminocidos que forma una protena.
4. Los ARN de transferencia son sustratos en el proceso de traduccin.
5. Los sustratos de la transcripcin son los ribonucletidos trifosfatados.
7. Una mutacin puntual siempre provoca el corrimiento del marco de lectura durante la traduccin.
8. Un error en la actividad de la ADN polimerasa puede llevar al surgimiento de un nuevo alelo.
9. Una mutacin en una clula de la piel podr heredarse a la descendencia.
10. No todas las mutaciones pueden heredarse.

10) Qu pasar si la ARN polimerasa comete un error cambiando un ribonucletido durante la transcripcin?
Justific tu respuesta.

Fenotipo, genes y ambiente

1) El fenotipo de un individuo es en parte la expresin de sus genes. Qu otro factor lo determina?


2) Mencion:
a. dos ejemplos en los que el fenotipo es simplemente la expresin del genotipo.
b. dos ejemplos en los que el ambiente tambin interviene.
c. un ejemplo de una caracterstica del fenotipo que se deba nicamente al ambiente.
d. un ejemplo de una caracterstica del fenotipo de la cual no se sepa con certeza cul es la participacin
del genotipo.

Evolucin

1. El caso de la Old Order Amish


Entre las personas pertenecientes a la Old Order Amish (Antigua Orden de los Amish), que viven en Lancaster,
Pensylvannia, hay una frecuencia sin precedentes de un alelo recesivo. Este alelo en estado homocigtico
causa una combinacin de enanismo y polidactilia (dedos supernumerarios). La colonia de Amish se ha
mantenido virtualmente aislada del resto del mundo desde que fue fundada en 1770. Desde entonces se
registraron ms de 60 casos de esta malformacin congnita rara; casi tantos como en todo el resto de la
poblacin mundial. Se calcula que aproximadamente el 13% de los miembros de este grupo formado por unas
17.000 personas- son portadores de este alelo. Todos los integrantes de la colonia, descienden de unos pocos
individuos. Por azar, uno de ellos debi haber sido portador de este raro alelo.
16
Cuestionario
a. El texto trata de un ejemplo referido a una especie o a una poblacin? De acuerdo a esto, decidan si se
trata de un ejemplo de micro o de macroevolucin.
b. Cules son las condiciones que se presentan en este caso que permiten explicar la altsima frecuencia de
este alelo raro entre los Amish?
c. Qu agente de cambio evolutivo consideran que est actuando? Justifiquen su respuesta.

2. Alteraciones numricas y poliploida


Las alteraciones numricas son mutaciones que, como su nombre indica, alteran el nmero total de
cromosomas tpico de la especie. Se originan frecuentemente por fallas durante la meiosis: la no-disyuncin
(no segregacin de homlogos) produce gametas con uno o varios cromosomas de ms (por ejemplo, la
trisoma del par 21 -que causa el sndrome de Down- se produce cuando una gameta n=23 se fusiona con una
gameta con 24 cromosomas).
La poliploida puede ser resultado de la no-disyuncin durante la meiosis. Cuando ocurre este fenmeno, todo
el complemento cromosmico queda, por ejemplo, duplicado (clulas 4n, o tetraploides), de modo que de cada
cromosoma habr cuatro homlogos en la misma clula. Tambin puede repetirse el genoma ms de dos
veces.
Los individuos poliploides no pueden reproducirse y dejar descendencia frtil con organismos diploides: pueden
reproducirse entre s, pero no con sus ancestros inmediatos.
Aqu se presentan algunos ejemplos: - Papa (Solanum tuberosum) 4n=48
- Caf (Coffea arabica) 2n=22, 4n=44, 6n=66
- Banana (Musa sapientum) 2n=22, 3n=33
- Man (Arachis hypogaea) 4n=40
- Batata (Ipomoea batata) 6n=90
Cuestionario
a. En una especie 2n=4, un individuo sufre no-disyuncin en un solo par de homlogos; dibujen las gametas
que puede originar, sealando claramente los cromosomas homlogos.
b. Si en una poblacin de frutillas (Fragaria grandiflora, 2n=14), un pequeo grupo de plantas pasaran a tener
56 cromosomas, qu grado de ploida tendran? Expliquen brevemente qu pudo haber ocurrido (pueden
hacer esquemas o explicarlo con palabras).
c. Cules son las fuentes de variabilidad gentica que actan en dicha poblacin?
d. Qu agente de cambio evolutivo podra ponerse en marcha ante esta situacin? Por qu?
e. Este caso ilustra un mecanismo microevolutivo o macroevolutivo? Por qu?

3. Los pinzones de Darwin


En el archipilago de las Galpagos, visitado por Charles Darwin durante su viaje a bordo del Beagle, habitan
numerosas especies de animales y plantas que no han sido encontradas en otros lugares del planeta. Un
ejemplo es el de unos pequeos pjaros llamados genricamente pinzones. Constituyen unas 13 especies que
se parecen mucho entre s, aunque presentan notables diferencias en la forma de sus picos. En cada isla
habitan determinados grupos de pinzones, es decir, no todas las variedades de pinzones habitan en todas las
islas. Por otra parte, en el continente, frente al archipilago, se encuentra una nica especie de pinzn,
parecida tambin a las que habitan en las islas. De entre lo muchsimos casos que Darwin estudi y que le
permitieron postular su famosa teora, el de los pinzones es uno de los ms bellos y claros.
Cuestionario
a. Las distintas poblaciones de pinzones pertenecen a la misma o a distintas especies? De acuerdo a esto,
decidan si se trata de un ejemplo de micro o de macroevolucin.
b. Con qu caracterstica del hbitat de los pinzones se relaciona la forma del pico? De acuerdo a su
respuesta, por qu en cada isla habitan diferentes grupos de pinzones?
c. Cmo explican la presencia de otra especie de pinzn en el continente?
d. Qu agente de cambio evolutivo acta en este ejemplo? Justifiquen la respuesta explicando cmo pudo
haber sido la evolucin de los pinzones.
e. Qu se podra hacer para comprobar que las 13 variedades de pinzones corresponden a 13 especies
diferentes?

4. En una plantacin afectada por un parsito, se realiz una fumigacin con DDT, con lo cual se logr la
desaparicin de dicho parsito. Sin embargo al poco tiempo se detect que las plantas estaban nuevamente
infectadas por el mismo parsito. Explic este hecho teniendo en cuenta los siguientes conceptos: seleccin
natural, reproduccin diferencial, mutaciones y azar.
17
5. Hace tiempo la pediculosis (infeccin de piojos) no era frecuente en las escuelas porque esos parsitos eran
mantenidos a raya con peine fino y piojicidas. Sin embargo actualmente gran cantidad de chicos y chicas tienen
piojos. Cmo se explica que los piojicidas que hace aos eran efectivos ahora no lo sean? Para desarrollar tu
explicacin eleg algunos de los siguientes trminos: adaptacin al ambiente, mayor capacidad reproductiva,
variabilidad gentica, herencia.

Ms actividades
1) Indic si las siguientes oraciones son verdaderas o falsas. Justific tu eleccin en no ms de cinco
renglones.
a. La enzima ADN polimerasa forma uniones covalentes.
b. La cantidad de ADN que hay en una clula en G2 es el doble de la que hay en cada polo de telofase.
c. La divisin mittica puede ser un mecanismo de reproduccin asexual en organismos eucariontes.
d. La meiosis I es redaccional porque las dos clulas resultantes tienen la mitad de ADN que tena la clula
madre.
e. Tanto las clulas procariontes como las eucariontes duplican su ADN en el perodo S, que es previo a la
divisin celular.
f. Observando el cariotipo de una clula es posible determinar qu genes constituyen su genoma.
g. Una gameta que tiene 5 cromosomas y una cantidad de ADN de 30 unidades, provino de una clula madre
que en G2 tena 10 cromosomas y 60 unidades de ADN.
h. La fecundacin es una fuente de variabilidad gentica.
i. El cdigo gentico establece una relacin entre dos lenguajes diferentes.
j. Conociendo la secuencia de aminocidos de una protena es posible saber la secuencia de nucletidos del
ARN mensajero a partir del cual se obtuvo dicha protena.
k. Todas las caractersticas del fenotipo de un individuo son el resultado de la interaccin de su genotipo con
el ambiente.

2) Los lemures de cola anillada son una especie de primates. Se sabe que el color de sus ojos est codificado
en un gen con dos variantes: el color miel domina sobre el color negro. Por otro lado, los mechones que
recubren sus orejas pueden ser largos (dominante) o cortos (recesivo). Una hembra, homocigota recesiva
para ambas caractersticas, tiene, tras sucesivos apareamientos con un mismo macho, cuatro
descendientes todos fenotpicamente diferentes entre s.
a. Indic los genotipos y fenotipos de los padres y de las cras.
b. Cul es la probabilidad de que nazca otro hijo de ojos color negro y mechones largos?
c. Suponiendo que los lemures tienen en sus clulas somticas 4 cromosomas, y que en G1 contienen 40
unidades arbitrarias de ADN, complet la tabla:

No de No de cromtides Cantidad
Etapa del ciclo celular
cromosomas en la clula de ADN
G2 (interfase)

Metafase mittica

En cada polo de telofase II

3) Daniel es de grupo sanguneo AB y Carla es de grupo 0. Ambos son alrgicos a la penicilina (un antibitico).
Daniel y Carla tienen su primer hijo. Sabiendo que los cuatro abuelos del beb toleran bien el antibitico:
a. Determin cul de los dos alelos relacionados con la penicilina es el dominante. Explic tu deduccin.
b. Indic las proporciones fenotpicas y genotpicas esperadas para este nio.
c. Considerando un complemento cromosmico 2n=6, dibuj una clula de la madre en metafase II y una
clula del padre en anafase. Seal en cada esquema un par de cromtides (aclarando si son hermanas o
recombinantes), los alelos estudiados y, si es posible, un par de cromosomas homlgos.

4) Dada la siguiente lista de elementos, indic para cada uno y segn corresponda, cul es su rol en la
transcripcin y/o cul es su rol en la traduccin: ARN polimerasa aminocidos ARN de transferencia
ribonucletidos trifosfatados ribosomas ADN.
18
5) En una especie de ratones se descubri una enfermedad hereditaria, debida a una alteracin en un gen.
Las secuencias correspondientes a las cadenas molde son:

Alelo ratn sano: AGGTACAAAGGCCTTGCACAGCTTTTACT


Alelo ratn enfermo: AGGTACAAAGGCCTTGCACTGCTTTTACT
a. Indic cules son los productos de la transcripcin y de la traduccin de cada alelo (mencion el nombre de
la molcula resultante y la secuencia de bases correspondiente).
b. Explic brevemente cmo pudo haberse originado el alelo que codifica para la enfermedad (no olvides
mencionar la fuente de variabilidad involucrada).

6) Las personas que padecen fenilcetonuria son homocigotas recesivas para una mutacin en el gen que
codifica para una enzima. Cuando se analiza la enzima de las personas enfermas se observa que sta se
diferencia de la enzima normal en un slo aminocido. Las siguientes frases se refieren a las personas
enfermas y dan posibles explicaciones del fenmeno descrito. Indic cul o cules de ellas pueden ser
correctas y cul o cules no lo son, justificando todas tus respuestas:
a. El gen de la enzima no est alterado pero la estructura terciaria de la misma es diferente a la protena
normal.
b. El gen mutado difiere del normal en que le sobra un nucletido.
c. Es imposible que en las clulas de una persona estn simultneamente ambos tipos de protenas.

7) En las plantas de durazno, el alelo que lleva informacin para la piel lisa del fruto domina sobre la piel con
vellosidades y el alelo para pulpa amarilla domina sobre pulpa blanca. El color amarillo de los frutos se debe a
la presencia de un pigmento que es fabricado por la enzima amarillasa. Una planta de frutos vellosos y pulpa
amarilla ha sido fecundada por el polen de otra planta de pulpa blanca. Se obtuvieron 100 plantas hijas: 25
tienen frutos lisos y pulpa blanca, 25 frutos lisos y pulpa amarilla, 25 frutos vellosos y amarillos y 25 frutos
vellosos y de pulpa blanca.
a) En base a estos datos indic el genotipo de todos los individuos mencionados.
b) Los duraznos vellosos y amarillos son de mejor comercializacin. Qu progenitores elegiras para obtener
mayor cantidad de plantas con este fenotipo?
c) Dibuj una clula en anafase II de la planta padre, sealando un par de cromosomas homlogos, un par de
cromtides hermanas y los alelos estudiados. Supon que las clulas de esta especie son 2n=4.
d) En qu clulas de la planta de durazno se encuentra la informacin gentica para fabricar la enzima
amarillasa? Justifc tu respuesta.

8) La enzima amarillasa del problema anterior produce el pigmento amarillo mediante la siguiente reaccin:
amarillasa
molcula A + Mg (magnesio) pigmento amarillo
El gen de la enzima amarillasa posee 2 alelos. Cuando uno de ellos se expresa, se sintetiza la enzima
amarillasa, mientras que a partir del otro alelo se produce una protena con ms aminocidos (ms larga) que
no cumple ninguna funcin.
a. De acuerdo a los dados cul es el alelo dominante?
b. Cul es el color de la pulpa del durazno en una planta heterocigota para esta caracterstica?
c. Si una planta homocigota dominante crece en un ambiente donde no hay magnesio Cul ser el color los
frutos?
d. Qu tipo de mutacin pudo haber originado el segundo alelo? Justific tu respuesta.

9) Con cada conjunto de trminos, redact un prrafo de no ms de 8 renglones:


a. clula diploide duplicacin del ADN cromtides hermanas
b. cigota meiosis gameta duplicacin del ADN
c. reproduccin asexual cromtides hermanas variabilidad gentica
d. reproduccin sexual entrecruzamiento (crossing-over) variabilidad gentica.
e. mutacin alelo reproduccin asexual poblacin de levaduras.
f. poblacin de gorriones de Buenos Aires variabilidad gentica reservorio gnico seleccin natural.

Похожие интересы