Fish & Shellsh Immunology 30 (2011) 118e127

Contents lists available at ScienceDirect

Fish & Shellsh Immunology

journal homepage: www.elsevier.com/locate/fsi

Cloning of two rainbow trout nucleotide-binding oligomerization

domain containing 2 (NOD2) splice variants and functional
characterization of the NOD2 effector domains
Mingxian Chang a, b, Tiehui Wang a, Pin Nie b, Jun Zou a, Christopher J. Secombes a, *
a
Scottish Fish Immunology Research Centre, University of Aberdeen, Aberdeen AB24 2TZ, UK
b
State Key Laboratory of Freshwater Ecology and Biotechnology, and Laboratory of Fish Diseases, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan,
Hubei Province, 430072, P. R. China

a r t i c l e i n f o a b s t r a c t

Article history: Nucleotide-binding oligomerization domain 2 (NOD2) is a cytoplasmic pattern recognition receptor
Received 28 July 2010 (PRR), which is involved in innate antibacterial and antiviral responses. Here, two NOD2 splice variants,
Received in revised form trNOD2a and trNOD2b, are reported in rainbow trout Oncorhynchus mykiss, that share 63% and 61%
20 September 2010
similarity with human NOD2, respectively. These two trout NOD2 splice variants were shown to be
Accepted 20 September 2010
Available online 1 October 2010
constitutively expressed in thymus, gills, skin, muscle, liver, spleen, head kidney, intestine, heart, and
brain, with the expression of trout NOD2 (trNOD2) mainly contributed by trNOD2a in all the examined
tissues. PolyI:C transfection up-regulated the expression of trNOD2a and trNOD2b in RTG-2 cells. The
Keywords:
Rainbow trout
expression of trNOD2a/b was modulated by the inammatory stimulant interferon-g (IFN-g) or inter-
NOD2 leukin-1b (IL-1b). Overexpression of trout NOD2 effector domains resulted in induced expression of
Proinammatory cytokine proinammatory cytokines including IL-1b, tumor necrosis factor-a (TNF-a), IL-6 and IL-8, the antibac-
Apoptosis terial peptide cathelicidin-2, a variety of caspases including caspase-2, -6, -7, -8, -9, and type I and type II
IFN. These results suggest that sh NOD2 functions in inammatory events, possibly via NF-kB activation,
regulation of apoptosis, and triggering of antibacterial and antiviral defences.
2010 Elsevier Ltd. All rights reserved.

1. Introduction
The innate immune system, the rst line of defence against
infection, relies on host germline-encoded pathogen recognition
receptors (PRRs) to detect pathogen-associated molecular patterns
(PAMPs). After sensing the presence of a PAMP, host innate immune
cells initiate a broad spectrum of defence mechanisms that result in
the development of inammation and host resistance to infection
[1]. PRRs comprise an array of sensors present in the extracellular,
membrane, and cytoplasmic compartments. When pathogens
bypass the membrane-associated PRRs by entering the cytosol of
cells directly, or are actively transported into host cells by type III or
type IV secretion systems from microbes residing extracellularly,
cytoplasmic PRRs are required to detect PAMPs [2]. Cytoplasmic
PRRs can be grouped into three families: interferon (IFN)-inducible
proteins, the retinoic acid-inducible gene I (RIG-I)-like receptors
(RLRs), and nucleotide-binding oligomerization domain (NOD)-like
* Corresponding author. Tel.: 44 1224 272872; fax: 44 1224 272396.
E-mail address: c.secombes@abdn.ac.uk (C.J. Secombes).
receptors (NLRs). RLRs are helicases that sense primarily viruses [3].
In contrast, NLRs are mainly involved in antibacterial immune
responses [4].
In mammals, NLRs are multi-domain proteins composed of an
amino-terminal effector-binding domain (EBDs) such as a caspase
recruitment domain (CARD), pyrin domain (PYD), acidic domain, or
baculovirus inhibitor repeats (BIRs), a central nucleotide-binding
domain (NOD, also designated a NACHT domain) and carboxy-
terminal leucine-rich repeats (LRRs) [5]. The N-terminal domain of
the NLRs mediates signaling through its interaction with down-
stream factors. The NOD domain is closely related to the oligo-
merization module, which has been shown to be required for the
activation of downstream effector molecules [6]. The LRRs are
essential for pathogen detection and recognition [7].
The NOD2 gene belongs to the subfamily of NLRs characterized
by CARD-containing effector-binding domains. Vertebrate NOD2 is
composed of two adjacent N-terminal CARDs, a centrally located
NOD domain and multiple C-terminal LRRs [8e10]. In mammals,
NOD2 induces multiple effector signaling pathways to resist
microbial pathogens. The best characteristic of these is the activa-
tion of NF-kB and MAPKs through interactions with the CARD

1050-4648/$ e see front matter 2010 Elsevier Ltd. All rights reserved.
doi:10.1016/j.fsi.2010.09.014
 M. Chang et al. / Fish & Shellsh Immunology 30 (2011) 118e127 119

domain of receptor-interacting protein 2 (RIP2) [11]. NOD2
signaling by activating NF-kB and MAPKs leads to the induction of
proinammatory cytokines and chemokines [12], and anti-micro-
bial peptides [13], which mediate the antimicrobial response.
Besides the function in antibacterial defence, new studies show
that NOD2 also has an important role in recognizing viruses and
inducing type I IFN production through association with the
mitochondrial antiviral signaling protein (MAVS) [14].
In teleost sh, orthologs of human NOD2 have been reported in
zebrash [15,16], channel catsh [17], and grass carp [10]. In the
present study, our main aims were to assess whether sh NOD2
can undergo alternative splicing, as well as whether NOD2
domains have different effects in inammatory events. The results
we present clearly show that a region of the NOD2 RNA transcript
that encodes the N-terminal CARD domains is alternatively
spliced, and that overexpression of the trout NOD2 different
domains has a similar role in the production of proinammatory
cytokines, an antibacterial peptide, a variety of caspases, and type I
and type II IFN. The present study provides evidence that the
role of NOD2 in NF-kB activation, regulation of apoptosis, and
triggering of antibacterial and antiviral defences is conserved in
teleost sh.
2. Materials and methods
2.1. Cloning and sequencing of trout NOD2
The expressed sequence tag (EST) sequences in the Computa-
tional Biology and Functional Genomic Laboratory (http://compbio.
dfci.harvard.edu/cgi-bin/tgi/Blast/index.cgi) were searched using
the grass carp NOD2 protein sequence [10] as a bait sequence for
TBLASTX analysis. Several candidate ESTs were found with high
sequence homology to known NODs, among which EST sequences
TC74620 (Salmo salar) and CX244678 (Oncorhynchus mykiss)
aligned well with the C terminal and middle region of NOD2
respectively. Based on the sequence of a partial trout NOD2
(CX244678), nested primers trNOD2GSP1 and trNOD2GSP2
(Table 1) were designed and used in 50 RACE using a GeneRacer

Table 1
Primer sequences used in this study.

The rst run PCR for 50 RACE GeneRacer 50 Primer CGACTGGAGCACGAGGACACTGA

The nested PCR for 50 RACE GeneRacer 50 Nested Primer GGACACTGACATGGACTGAAGGAGTA
The rst run PCR for 50 RACE trNOD2GSP1 GGTGGAGCGGTCCGAGTTATTGTT
The nested PCR for 50 RACE trNOD2GSP2 ACCGTCGGGTCGCGATGATGCT
The rst run PCR for 30 coding region trNOD2Fout GGACCGCTCCACCATCCCTAA
trNOD2Rout TGTAACTGCTGAATCAACCC
The nested PCR for 30 coding region trNOD2Fin GCAAGACAGGCAGCAACAGC
trNOD2Rin GCACTTGGCATCATCAGAAT
Primers used to conrm trNOD2F1 GGACCATTCTGTTTCGCACTCG
alternative splice trNOD2R1 CAGGTCTCATCTCCCTTGGTGTACAC
NOD2a CARD domain NOD2aCARDF GCGAAGCTTTCCTACATCAGTATGAGTG
NOD2abCARDR GTTCCGCGGTCATTGGTTAGATGGTGAGGG
NOD2b CARD domain NOD2bCARDF GCCAAGCTTTCCTGGGGCATGCTGTTC
NOD2abCARDR GTTCCGCGGTCATTGGTTAGATGGTGAGGG
NACHT domain NACHTF GCCAAGCTTAGTATGGACACTGTGCTAGTCTCT
NACHTR GTTCCGCGGTCAGCGATGATGCTTCCTCAC
LRR domain LRRF GCGAAGCTTGCAATGGCCTACGTGCTCC
LRRR GTTCCGCGGTCAGAATGTAAGCCTGGGT
Real-time PCR trNOD2aF GCTGTAGCAAACTGGCTCAAA
trNOD2abR CAGGTCTCATCTCCCTTGGTG
trNOD2bF CTCCCGCTGAAACCTGGTCC
trNOD2abR CAGGTCTCATCTCCCTTGGTG
trNOD2F TCTCTCTCTAAGGCTGGGAAAC
trNOD2R TTGCCAACACCATTGTCTACCA
IRF3F ACTGGTCATGGTCGAGGTGGT
IRF3R CACAAGTCCATCATCTCCTGCAG
IRF7F GACCGTAAAATATTCAGGGCATGG
IRF7R CTTCTCTGTGCGGGCTCTCATA
IFNg2F CAAACTGAAAGTCCACTATAAGATCTCCA
IFNg2R GGTCCAGCCTCTCCCTCAC
IL-6F CCTTGCGGAACCAACAGTTTG
IL-6R CCTCAGCAACCTTCATCTGGTC
TNFaF CTGTGTGGCGTTCTCTTAATAGCAGCTT
TNFaR CATTCCGTCCTGCATCGTTGC
CATH2F ACATGGAGGCAGAAGTTCAGAAGA
CATH2R GAGCCAAACCCAGGACGAGA
caspase1F AAACCCATTCAACTAGTGCTG
caspase1R CTTCACTGACTCCATTTCCTCC
caspase2F CTGGGTGTTTGAGGCATTTGA
caspase2R TCTCCTTACAGCGATGGTGGG
caspase3F GCTGCTCCGCTTCGTTCGTG
caspase3R CCAGGAGCCAGTCTGAGTGTT
caspase6F CCAATGCTGACCGCTCCAATCT
caspase6R CCCACGGCACGCCTGTAGTATGA
caspase7F CTCTTCTTCATCCAGGCTTGTC
caspase7R TCTTCTCGCTGAAACGTGGGT
caspase8F GGAGGGCGGAGTCACATACA
caspase8R GCGTCAGCACCGACAGAAT
caspase9F CTTTGCCTACGCCTACCACT
caspase9R GCTCCTGCCTTATTTGCTT
120 M. Chang et al. / Fish & Shellsh Immunology 30 (2011) 118e127
Kit (Invitrogen). The cDNA template used in the PCR was generated
from RTS-11 cells [18] stimulated with 50 ng/mL IFN1 recombinant
protein [19] for 4 h. The annealing temperature of the rst round
and nested PCR was 66  C and 68  C, respectively. Specic primers
trNOD2Fout/trNOD2Fin (based on the trout NOD2 sequence) and
trNOD2Rout/trNOD2Rin (based on the salmon NOD2 30 non-coding
sequence from TC74620) (Table 1) were designed to obtain the
30 end of the coding region. The annealing temperature of the rst
and nested PCR was 55  C.
To conrm the two transcripts of trout NOD2 resulted from
alternative splicing of the same gene, two primers (trNOD2F1 and
trNOD2R1) were designed across a divergent region of the cDNA
sequences and used for PCR amplication from a set of genomic
DNA and cDNA samples from three trout cell lines (RTGill, RTG-2
and RTS-11 cells). The annealing temperature of this PCR
was 65  C.
2.2. Sequence analysis
Protein prediction was performed using software at the ExPASy
Molecular Biology Server (http://expasy.pku.edu.cn). The putative
ORFs were analyzed for the presence of signal peptides using the
algorithms Signal P 3.0 (http://www.cbs.dtu.dk/services/SignalP/).
Multiple alignments were generated by the CLUSTAL 1.8 program
within DNASTAR. A phylogenetic tree was constructed based on the
deduced amino acid sequences using the Neighbour-Joining (NJ)
algorithm within MEGA version 4 (http://www.megasoftware.net/
mega.html). Data were analyzed using Poisson correction, and
gaps were removed by pairwise deletion. Reliability of the tree was
assessed by 1000 bootstrap repetitions.
2.3. Expression of trout NOD2 splice variants in vivo
The selection of tissues, RNA preparation, cDNA synthesis and
real-time PCR analysis of gene expression was described previously
[20]. Briey, six healthy rainbow trout (average
weight  SEM 106  5 g) were killed and ten tissues (thymus,
gills, skin, muscle, liver, spleen, head kidney, intestine, heart, and
brain) were collected. Total RNA was prepared from each tissue and
converted to cDNA, and the 60 (6  10) cDNA samples generated
were used in the gene expression analysis. The primer pairs used to
amplify the trout NOD2 splice variants were trNOD2aF/trNOD2abR
and trNOD2bF/trNOD2abR (Table 1).
2.4. Expression of trout NOD2 splice variants in RTG-2 cells
transfected with polyI:C
RTG-2 cells (5  106 cells in 100 ml nucleofector solution) were
electroporated with 5 ml polyI:C (1 mg/ml) or 5 ml PBS using an
Amaxa Nucleofector II transfection system (Lonza) under Pro-
gramme T20, washed immediately with 1 ml HBSS buffer and
cultured at 20  C for 24 h. The cells were collected for RNA
extraction and real time PCR analysis as described previously [21].
Namely after total RNA was extracted using the RNASTAT reagent
(AMS Biotechnology (Europe) Ltd) and treated with RNase free
DNase I (Fermentas Life Sciences, Germany), the RNA was reverse
transcribed into cDNA using a rst strand cDNA synthesis kit (Fer-
mentas Life Sciences, Germany). Real time PCR analysis was per-
formed on a Roche LightCycler 480 using the following
conditions: 1 cycle of 95  C/10 min, 45 cycles of 95  C/20 s, 60  C/
20 s and 72  C/30 s. Each sample was run in triplicate in a 96 well
plate and the mean value recorded.
2.5. Modulation of trout NOD2 gene expression by IL-1b and IFN-g
in RTG-2 cells
The cells were passaged into fresh culture asks 2 days before
being stimulated for 6 h with either 20 ng/ml recombinant trout
IL-1b (rIL-1b) protein [22], or 20 ng/ml recombinant trout inter-
feron-g protein (rIFN-g) [23] or left untreated as control. The RNA
preparation and real-time PCR analysis were as described above.
The primer pairs for analysis of trout NOD2 expression were
trNOD2F/trNOD2R, trNOD2aF/trNOD2abR and trNOD2bF/trNO-
D2abR (Table 1).
2.6. Plasmid construction for overexpression of NOD2 domains
For overexpression studies of different effector domains, an
expression vector ptGFP1 was modied from the pTurboGFP-N
vector and contained two sets of the CMV promoter and SV40 30
UTR to drive expression of the target gene and GFP as separate
proteins rather than as a fusion protein. The trNOD2a CARD,
trNOD2b CARD, NACHT and LRR domain was amplied with primer
pairs trNOD2aF/trNOD2aR, trNOD2bF/trNOD2bR, NACHTF/NACHTR
and LRRF/LRRR (Table 1) respectively, and inserted into the Hind III
and Sac II sites of the ptGFP1 vector to make constructs ptGFP1-
trNOD2a CARD, ptGFP1-trNOD2b CARD, ptGFP1-NACHT and
ptGFP1-LRR.
2.7. Database mining of trout caspase genes
In trout, only caspase-6 has been reported previously [24],
although in salmon caspase-3, -6, and -7 have also been reported
[25]. To identify other caspase genes in trout, a tblastn search using
salmon caspase protein sequences as baits was performed against
the rainbow trout ESTs in the Computational Biology and Func-
tional Genomic Laboratory database. The translated proteins from
predicted transcripts were veried by BLASTP in the NCBI non-
redundant protein sequence database. To help dene the homology
of trout caspase molecules among caspase subfamilies, a phyloge-
netic tree was constructed using the MEGA4 program.
2.8. Modulation of the inammasome and apoptosis signaling
pathways in RTG-2 cells
RTG-2 cells were used for the overexpression studies because of
several trout cell lines available to us (e.g. RTGill, RTG-2 and RTS-11
cells), only RTG-2 cells had an optimised transfection protocol
already established. RTG-2 cells were maintained in L-15 medium
supplemented with 10% foetal bovine serum (FBS) (Sigma), 100 U/
ml penicillin (P) and 100 mg/ml streptomycin (S) at 20  C and
passaged 2 days before use. 5  106 RTG-2 cells were transfected
with 2 mg ptGFP1, ptGFP1-trNOD2a CARD, ptGFP1-trNOD2b CARD,
ptGFP1-NACHT or ptGFP1-LRR. The cells were washed immediately
with culture medium and incubated at 20  C for 6 h. The RNA
preparation and real-time PCR analysis was as described above. The
genes studied by real time PCR were trNOD2 (this paper), IRF3 and
IRF7 [26], IFN1 and IFN2 [19], IFN-g1 [23], IFN-g2 [27], IL-1b1 [28],
IL-6 [29], IL-8 [30], TNFa [31], CATH2 [32], caspase-1 (TC Number of
rainbow trout EST, TC172333), -2 (TC Number of rainbow trout EST,
TC170354), -3 (TC Number of rainbow trout EST, TC148559), -6
[24], -7 (TC Number of rainbow trout EST, TC154414), -8 (TC
Number of rainbow trout EST, TC133215), and -9 (GeneBank
accession no. NP_001118119). The primer sequences of IFN1 and
IFN2 were reported by Zou et al. [19], IFN-g1 by Daz-Rosales et al.
[33], IL-1b1 and IL-8 by Wang et al. [34]. The primer sequences of
other genes are listed in Table 1.
 M. Chang et al. / Fish & Shellsh Immunology 30 (2011) 118e127 121

2.9. Statistical analysis

The relative expression of target genes was normalized to the

expression of elongation factor (EF) -1a and expressed as arbitrary
units or fold change relative to the corresponding control group.
The mean of at least three independent experiments was used for
statistical analysis using the paired student t test. P < 0.05 was
considered to be signicant.

3. Results

3.1. Sequence analysis of NOD2 transcripts in rainbow trout

By 50 -RACE, three main products were amplied from rainbow

trout. The sizes of these products were approximately 1.9 kb, 1.5 kb
and 1 kb. Five clones for every product were sequenced. The
products of 1.9 kb and 1.5 kb were found to be NOD2 transcripts,
whereas non-specic amplication resulted in the 1 kb product.
The open reading frame of the two NOD2 transcripts was conrmed
by RT-PCR. The shorter transcript of rainbow trout NOD2 (named
trNOD2a, GenBank accession No, HM133906) is 3121 bp, and
encodes a protein of 996 aa. Another transcript of 3511 bp (named
trNOD2b, GenBank accession No, HM133907) was also sequenced,
and had a longer 50 UTR and a 65 bp deletion including the normal
start codon ATG, resulting in the predicted translation starting from
the next downstream ATG. As a result, trNOD2b is predicted to be
38 aa shorter than trNOD2a (Fig. 1). Pfam HMM analysis predicted
two CARD domains at the N terminus and a NACHT domain in the
middle both for trNOD2a and trNOD2b, whereas the rst CARD
domain of trNOD2b had insignicant Pfam-A matches by Pfam
HMM analysis due to the high E-value (0.017) and low score (14.6).
The conserved domains analysis in the NCBI database also pre-
dicted a multi Leucine-rich repeats (LRRs) domain in aa 766-987/
728-949 for trNOD2a/trNOD2b, which was not predicted by Pfam
HMM analysis.
The full ORF of trNOD2a has a similarity of 81.1% with the
reported grass carp NOD2, and 81.2% with zebrash NOD2. The
N-terminal two CARD domains, central NACHT domain and
C-terminal LRR of trNOD2a have similarities of 71.3%, 74.1%, 88.4%
and 89.3% with the corresponding domains of grass carp NOD2, and
of 56%, 56.3%, 75.6% and 66.2% with the corresponding domains of
human NOD2. The rst CARD domain of trNOD2b has a similarity of
45.2% and 30.8% with grass carp and human NOD2, respectively.

3.2. Rainbow trout NOD2 transcripts are splice variants

from the same gene

A single product was amplied from genomic DNA from six sh

studied but two products were amplied from different cDNA
samples, as seen with the cell line samples used (Fig. 2A). The larger
product was strong and of the expected size for trNOD2a (343 bp)
whilst the smaller product was weaker and of the expected size
from trNOD2b (278 bp).
The product amplied from genomic DNA was sequenced, and
the sequence results showed that all the products from genomic
DNA were identical and 805 bp in length. By comparison with the
cDNA sequences, it was clear that 462 bp of the genomic sequence
was spliced out in NOD2a, whilst a further 65 bp downstream was
also spliced out in NOD2b (Fig. 2B).

3.3. Expression of trout NOD2 splice variants in vivo
The expression of trNOD2a and trNOD2b splice variants was
examined in ten tissues, including gill, thymus, brain, skin, muscle,
liver, spleen, head kidney, intestine, and heart, from six healthy sh
Fig. 1. Multiple alignment of sh NOD2 protein sequences. Identical amino acids are
indicated with asterisks, and conservative substitutions are indicated with . or :.
The CARD, NACHT and LRR domains are underlined, double-underlined and bold
underlined, respectively. The amino acids labeled in grey are spliced out in trNOD2b.
122 M. Chang et al. / Fish & Shellsh Immunology 30 (2011) 118e127

Fig. 2. Conrmation of two trout NOD2 splice variants. A: the amplication of trout NOD2 in cDNA from RTGill, RTG and RTS-11 cell lines, and genomic DNA from 6 sh. B: the
alignment of trout NOD2 genomic DNA with the cDNA of trNOD2a and trNOD2b. 462 bp of the genomic sequence (in lower case) was spliced out in NOD2a, whilst a further 65 bp
downstream (highlighted in grey) was also spliced out in NOD2b. The primers used for amplication are underlined. The consensus GT/AG splice sequences are boxed. The start
codons of trNOD2a and trNOD2b are highlighted in bold, with the latter 38 aa shorter than the former.

using real-time PCR. The expression of the two splice variants was respectively. A high level expression of trNOD2a was also detected
detectable in all the tissues examined (Fig. 3). The highest level of in skin and brain. It was apparent that the expression of trNOD2
trNOD2a and trNOD2b was detected in muscle, whereas the lowest was mainly contributed by trNOD2a in all the examined tissues
level of trNOD2a and trNOD2b was observed in heart and liver, (>95%).
 M. Chang et al. / Fish & Shellsh Immunology 30 (2011) 118e127
Fig. 3. In vivo expression of the two trout NOD2 splice variants. The expression of the
trout NOD2 splice variants was determined by real time PCR in tissues of six sh. The
transcript level was rst calculated using a serial dilution of references in the same run.
The relative expression level for each gene was then expressed as arbitrary units
normalized against the expression level of EF-1a. The results presented are the
average S.E.M. of six sh.
3.4. Expression of trout NOD2 splice variants in RTG-2 cells
transfected with polyI:C
It is known that NOD2 is an intracellular pattern recognition
receptor. To study the effect of polyI:C, a synthetic double stranded
RNA mimicking viral dsRNA, on trout NOD2 expression, RTG-2 cells
were electroporated with 5 ml polyI:C or 5 ml PBS as a control.
trNOD2a and trNOD2b were both signicantly induced by this
stimulation, with a 17.4- and 21.8-fold increase of expression level
respectively (Fig. 4).
3.5. The effect of proinammatory cytokines on trout NOD2
To study the effect of proinammatory cytokines on trout NOD2
gene expression, RTG-2 cells were stimulated with rIL-1b or rIFN-g
Fig. 4. The effect of transfected polyI:C on expression of the two trout NOD2 splice
variants in RTG-2 cells. The RTG-2 cells (5  106 cells) were electroporated with 5 mg
polyI:C, washed and cultured for 24 h. The cells were collected and used for RNA
extraction and real time PCR analysis. The relative expression of target genes was
normalized to the expression of EF-1a and expressed as fold change relative to the
appropriate control group. The mean of three independent experiments is shown and
bars indicate the SEMs. Asterisks indicate where the increase of gene expression is
signicant (P < 0.05).
123
(at 20 ng/ml) for 6 h. Stimulation with rIL-1b or rIFN-g has
a differential effect on trNOD2a and trNOD2b. The expression of
trNOD2a was signicantly increased by stimulation with rIFN-g,
and of trNOD2b by rIL-1b. The total expression of trout NOD2 was
also detected by real time PCR. Similar to trNOD2a, stimulation with
rIFN-g resulted in increased overall gene expression of trNOD2,
whereas there was no effect of rIL-1b (Fig. 5).
3.6. Identication of trout inammatory and apoptosis caspases
In addition to trout caspase-6, multiple caspase EST sequences
including caspase-1, -2, -3, -7, -8 and -9 were found in the trout
database. The EST sequences of caspase-8 and -9 encode for the
complete open reading frame. Although the other EST sequences of
caspase-1, -2, -3 and -7 were partial, these EST sequences when
translated were found to encode for the conserved caspase domain
for caspase-2, -3 and -7, or the conserved CARD domain for caspase-
1. In order to conrm these caspase molecules were true orthologs
of known mammalian caspases, a phylogenetic tree based on
a multiple alignment of selected vertebrate caspase members was
constructed using the MEGA4 program. Each trout caspase mole-
cules formed a sub-branch with corresponding caspase molecule
from Atlantic salmon and/or zebrash and, with the exception of
caspase 1, formed clear clades with other vertebrate caspase
molecules (Fig. 6). The high bootstrap value of all sub-branches
(>80%) suggests this is a reliable phylogenetic tree.
3.7. Overexpression of trout NOD2 domains induced expression
of trNOD2
To determine whether the different trout NOD2 domains play
any role in inammation and/or apoptosis, RTG-2 cells were
transfected with ptGFP1-trNOD2a CARD, ptGFP1-trNOD2b CARD,
ptGFP1-NACHT, ptGFP1-LRR or ptGFP1 as a control. Overexpression
of trout NOD2 was apparent, with a signicant increase of the
transcript levels compared with ptGFP1 transfected cells; 35- fold
for the trNOD2a CARD domain, 82- fold for the trNOD2b CARD
domain, 8- fold for the NACHT domain, and 30- fold for the LRR
domain, respectively (Fig. 7).
3.8. Modulation of inammatory cytokine and AMP expression
by trout NOD2 effector domains
In mammals, stimulation of NOD2 results in the activation of
caspase-1 and the secretion of proinammatory cytokines. In the
present study, overexpression of trout NOD2 effector domains
Fig. 5. The effect of proinammatory cytokines on trout NOD2 expression. RTG-2 cells
were stimulated for 6 h with 20 ng/ml trout rIL-1b or rIFN-g. The cells were collected
and used for RNA extraction and real time PCR analysis. The relative expression of
target genes was normalized to the expression of EF-1a and expressed as fold change
relative to the control group. The mean of three independent experiments is shown
and bars indicate the SEMs. Asterisks indicate where the increase of gene expression is
signicant (P < 0.05).
124 M. Chang et al. / Fish & Shellsh Immunology 30 (2011) 118e127

Fig. 7. Construction and effect of different trout NOD2 domains. A: The domains used
to construct ptGFP1-trNOD2a CARD, ptGFP1-trNOD2b CARD, ptGFP1-NACHT and
ptGFP1-LRR plasmids. B: Effect of overexpression of different trout NOD2 domains on
expression of trNOD2. RTG-2 cells (5  106 cells) were electroporated with 2 mg ptGFP1,
ptGFP1-trNOD2a CARD, ptGFP1-trNOD2b CARD, ptGFP1-NACHT or ptGFP1-LRR
plasmid. After 6 h, the cells were collected and used for RNA extraction and real time
PCR analysis. The relative expression of target genes was normalized to the expression
of EF-1a and expressed as fold change relative to the appropriate control group. The
mean of three independent experiments is shown and bars indicate the SEMs. Aster-
isks indicate where the increase of gene expression is signicant (P < 0.05).

Fig. 6. Phylogenetic relationship of vertebrate caspases genes. The amino acid

sequences were aligned using the CLUSTAL program within DNASTAR and the phylo-
genetic tree was constructed using the Neighbour-Joining algorithm within MEGA
version 4. The tree was boosted 1000 times and the percentages are shown. The
sequences used for tree construction are as follows: Atlantic salmon caspase 1,
ACI69403; rainbow trout caspase 1, TC172333; rabbit caspase 1, XP_002708463;
Norway rat caspase 1, NP_036894; human caspase 1, BAD97223; Atlantic salmon
caspase 3, ACN11423; rainbow trout caspase 3, TC148559; Fugu caspase 3, AAM43816;
zebrash caspase 3, CAX14649; chicken caspase 3, NP_990056; mouse caspase 3,
AAH38825; human caspase 3, CAC88866; Atlantic salmon caspase 7, AAY28975;
rainbow trout caspase 7, TC154414; zebrash caspase 7, NP_001018443; African clawed
frog caspase 7, NP_001081408; mouse caspase 7, NP_031637; human caspase 7,
AAH15799; rainbow trout caspase 6, NP_001117743; Atlantic salmon caspase 6A,
AAY28971; Atlantic salmon caspase 6B, AAY28974; zebrash caspase 6,
NP_001018333; African clawed frog caspase 6, NP_001081406; mouse caspase 6,
AAH02022; human caspase 6, AAH04460; rainbow trout caspase 9, NP_001118119;
zebrash caspase 9, NP_001007405; mouse caspase 9, NP_056548; African clawed frog
caspase 9, NP_001079035; human caspase 9, AAO21133; rainbow trout caspase 8,
TC133215; Atlantic salmon caspase 8, ACN10768; zebrash caspase 8, NP_571585;
mouse caspase 8, CAA07677; human caspase 8, AAD24962; chicken caspase 8,
NP_989923; rainbow trout caspase 2, TC170354; zebrash caspase 2, NP_001036160;
chicken caspase 2, NP_001161173; mouse caspase 2, NP_031636; human caspase 2,
AAH02427.

resulted in increased gene expression of the proinammatory

cytokines IL-1b, IL-6, IL-8 and TNF-a (P < 0.05), whereas there was
no effect on caspase-1 expression (Fig. 8A). Notably, a 21- and
17-fold increase in IL-1b and TNF-a transcript level was detected in
cells transfected with ptGFP1-trNOD2b CARD.
Mammalian NOD2 signaling leads to the production of antimi-
crobial peptides. In rainbow trout, Chang et al. [32] have previously
identied two cathelicidin genes, with the expression of cath-
elicidin-2 (cath2) high in RTG-2 cells. Thus, we next examined the
expression of cath2 in cells tranfected with the trout NOD2 effector
Fig. 8. Modulation of inammasome genes and the antimicrobial peptide cathelicidin-
2 by trout NOD2 effector domains. A: The effect of overexpression of trout effector
domains on caspase 1 and various proinammatory cytokines. B: The effect of over-
expression of trout NOD2 effector domains on the antibacterial peptide cathelicidin-2.
The sample preparation and real time PCR analysis were as in Fig. 7. Asterisks indicate
where the increase of gene expression is signicant (P < 0.05).
 M. Chang et al. / Fish & Shellsh Immunology 30 (2011) 118e127
domains. Induced expression was apparent with signicant
increases compared with cells transfected with ptGFP1 in all cases.
The induced fold increases seen using trNOD2a CARD, trNOD2b
CARD, NACHT and LRR were 2.4-, 23-, 15-, and 9-fold, respectively
(Fig. 8B).
3.9. Overexpression of trout NOD2 effector domains induces
expression of caspase genes involved in apoptosis
In trout, the sequences of caspase-2, -3, -7, -8, and -9 were
identied by database mining, as described in section 3.6. The cells
transfected with ptGFP1-trNOD2a CARD, ptGFP1-NACHT, or
ptGFP1-LRR exhibited increased caspase-2, -6, -7, -8, and -9
expression compared with cells transfected with ptGFP1 (Fig. 9)
(P < 0.05). Cells transfected with ptGFP1-trNOD2b CARD also had
increased expression of caspase-6, -7, -8 and -9 but not caspase-2.
No effect on caspase-3 was seen with any domain.
3.10. Overexpression of trout NOD2 effector domains induces
expression of both type I and II IFN
Using real-time PCR, the induced mRNA expression of type I and
II IFN after overexpression of trout effector domains was analyzed
in RTG-2 cells. In each case, the expression of type I and II IFN was
increased signicantly in transfected cells (P < 0.05), with the
exception of IFN-g1 in NACHT transfected cells. In view of these
results the transfected cells were also used to examine the
expression of upstream genes that induce IFN responses. The
expression of IRF3 and IRF7, especially IRF7, was signicantly up-
regulated by the various trNOD2 domains (Fig. 10). However,
overexpression of the LRR domain had no impact on the expression
of IRF3 (Fig. 10).
4. Discussion
In this paper we report on the cloning of rainbow trout NOD2, an
intracellular pattern recognition receptor [4], and analyze its
expression and function in this species. NOD2 was rst identied in
2001 by Ogura et al. [8] and functions to activate NF-kB signaling
through its interaction with the serine-threonine kinase RIP2.
Previous analysis has shown that NOD1/NOD2 are well conserved
among vertebrates [15,16], and here we show that the function of
NOD2 in inammation and apoptosis has been conserved during
vertebrate evolution.
In mammals, a large variety of alternative splice variants have
been reported for NOD2. Human NOD2 RNA transcripts that
encode the N-terminal and leucine-rich repeat (LRR) domains are
Fig. 9. Effect of overexpression of trout NOD2 effector domains on expression of
caspase genes involved in apoptosis. The sample preparation and real time PCR
analysis were as in Fig. 7. Asterisks indicate where the increase of gene expression is
signicant (P < 0.05).
125
Fig. 10. Effect of overexpression of trout NOD2 effector domains on expression of IRF3,
IRF7 and both type I and II IFN. The sample preparation and real time PCR analysis
were as in Fig. 7. Asterisks indicate where the increase of gene expression is signicant
(P < 0.05).
alternatively spliced, giving two protein products encoded by two
mRNA splice variants at the N-terminal [35,36], and one protein
product encoded by ten different mRNA splice variants in the LRR
domain [37]. Alternative splice variants also exist in the sh NOD2
homologs, as seen in the present studies with rainbow trout where
two splice variants were discovered, one (trNOD2b) with the rst
CARD domain partially deleted. Many PRRs including NOD1 [38],
Dectin-1 [39], TLRs [40], PGRPs [41], undergo alternative splicing
generating multiple forms. It has been argued that each splice
variant may have a role in a coordinated defence response [40] or
that the truncated splice variants may be competitive inhibitors in
downstream signaling induced by the normal form [35].
Similar to human NOD2-S (a truncated splice variant), the
expression of trNOD2b was rather low under basal conditions
compared to trNOD2a, which may suggest that trNOD2a plays
a more dominant role in trout innate immunity. In agreement with
the studies in mammals [42], trNOD2 was up-regulated in trout
RTG-2 cells by an inammatory stimulant (IFN-g), which conrmed
that proinammatory signals could trigger the induction of NOD2
in cells. Since NOD2 is able to sense the presence of Gram-negative
or Gram-positive bacteria in the cytosolic compartment through
the detection of MDP, the up-regulation of the two trout splice
variants upon polyI:C transfection indicates the two splice variants
are likely to contribute to the early innate immune defence against
invading pathogens.
The present work also studied the overexpression of the three
distinct effector domains of trout NOD2, and showed they are able
to induce the expression of proinammatory cytokines and the
antibacterial peptide cathelicidin-2, consistent with reports in
mammals that show NOD2 is able to mediate antibacterial
responses during inammatory events via NF-kB signaling, to
induce the secretion of proinammatory cytokines and antimi-
crobial peptides [12,43]. However, mammalian NOD2 was also
shown to induce caspase-1 activation [44,45] but the present study
found no effect of trout NOD2 on caspase-1 expression. Whilst
further study is needed to determine whether sh NOD2 could
activate caspase-1 at the post-translational level, it should also be
noted that the role of caspase-1 in the sh inammasome is less
clear with no obvious ICE cute site present in IL-1b for example [28].
Extensive data mining of sh genomes has revealed a range of
orthologs of mammalian caspases in both zebrash and other non-
model sh species such as salmon [25,46]. In rainbow trout little is
known about the structure and function of caspases, except for the
study of Laing et al. [24] which showed the immunoregulatory role
of trout caspase-6. The present study revealed the existence of
caspase orthologs in rainbow trout that are potentially involved in
apoptosis, based on a few functional studies on sh caspases that
have shown caspase-2, -3, -6, -7, -8 and -9 can induce apoptosis
126 M. Chang et al. / Fish & Shellsh Immunology 30 (2011) 118e127
[25,47e51]. In humans, members of NLRs can coordinate caspase-
induced apoptotic signaling pathways [52,53]. Our previous study
showed that overexpression of zebrash NOD2 had no effect on cell
viability when expressed alone. The report from Ogura et al. [8] also
showed that overexpression of human NOD2 did not induce
apoptosis by itself but enhanced apoptosis induced by caspase-9
expression. In the present study, the signicantly increased
expression of trout caspase-2, -6, -7, -8 and -9 by trout NOD2
effector domains demonstrated that trout NOD2 has the potential
to enhance caspase-induced apoptosis. The coordination of sh
NOD2 with caspases in apoptotic signaling pathways needs further
research.
In mammals, it is well known that NOD2 is mainly involved in
antibacterial immune responses [4]. However, recent work has
shown that human NOD2 can also activate IRF3 and interferon in
RSV-infected cells, which highlights an important function of NOD2
in host antiviral defences [14]. In the present study, one interesting
nding was the ability of the trout NOD2 effector domains to affect
not only type I interferon expression but also type II interferon
expression. Since a reciprocal induction between trout NOD2 and
IFN-g was observed in RTG-2 cells, the present study further
supports our previous hypothesis [10] that sh NOD2 may act in
synergy with IFN-g in sh immune responses to viral infection.
In conclusion, two NOD2 splice variants were identied in
rainbow trout. The induced expression of proinammatory cyto-
kines, the antibacterial peptide cathelicidin-2, caspases and type I
and type II IFN by trout NOD2 effector domains suggests sh NOD2
is involved in antibacterial and antiviral immune responses,
possibly by regulating the NF-kB and apoptosis signaling pathways,
and interferon gene expression. The present data also suggest that
the two NOD2 splice variants may have a role in coordinating these
responses.
Acknowledgements
This work was supported by the National Natural Science
Foundation of China (30830083), the Royal Society of Edinburgh
and the EU Imaquanim project.
References
[1] Akira S, Uematsu S, Takeuchi O. Pathogen recognition and innate immunity.
Cell 2006;124:783e801.
[2] Fritz JH, Ferrero RL, Philpott DJ, Girardin SE. Nod-like proteins in immunity,
inammation and disease. Nat Immunol 2006;7:1250e7.
[3] Kawai T, Akira S. Innate immune recognition of viral infection. Nat Immunol
2006;7:131e7.
[4] Meylan E, Tschopp J, Karin M. Intracellular pattern recognition receptors in
the host response. Nature 2006;442:39e44.
[5] Inohara N, Nuez G. NODs: intracellular proteins involved in inammation
and apoptosis. Nat Rev Immunol 2003;3:371e82.
[6] Inohara N, Nuez G. The NOD: a signaling module that regulates apoptosis
and host defense against pathogens. Oncogene 2001;20:6473e81.
[7] Chamaillard M, Hashimoto M, Horie Y, Masumoto J, Qiu S, Saab L, et al. An
essential role for NOD1 in host recognition of bacterial peptidoglycan con-
taining diaminopimelic acid. Nat Immunol 2003;4:702e7.
[8] Ogura Y, Inohara N, Benito A, Chen FF, Yamaoka S, Nunez G. Nod2, a Nod1/
Apaf-1 family member that is restricted to monocytes and activates NF-
kappaB. J Biol Chem 2001;276:4812e8.
[9] Tohno M, Ueda W, Azuma Y, Shimazu T, Katoh S, Wang JM, et al. Molecular
cloning and functional characterization of porcine nucleotide-binding oligo-
merization domain-2 (NOD2). Mol Immunol 2008;45:194e203.
[10] Chen WQ, Xu QQ, Chang MX, Nie P, Peng KM. Molecular characterization and
expression analysis of nuclear oligomerization domain proteins NOD1 and
NOD2 in grass carp Ctenopharyngodon idella. Fish Shellsh Immunol
2010;28:18e29.
[11] Hasegawa M, Fujimoto Y, Lucas PC, Nakano H, Fukase K, Nez G, et al.
A critical role of RICK/RIP2 polyubiquitination in Nod-induced NF-kappaB
activation. EMBO J 2008;27:373e83.
[12] Windheim M, Lang C, Peggie M, Plater LA, Cohen P. Molecular mechanisms
involved in the regulation of cytokine production by muramyl dipeptide.
Biochem J 2007;404:179e90.
[13] Voss E, Wehkamp J, Wehkamp K, Stange EF, Schrder JM, Harder J. NOD2/
CARD15 mediates induction of the antimicrobial peptide human beta-
defensin-2. J Biol Chem 2006;281:2005e11.
[14] Sabbah A, Chang TH, Harnack R, Frohlich V, Tominaga K, Dube PH, et al.
Activation of innate immune antiviral responses by Nod2. Nat Immunol
2009;10:1073e80.
[15] Laing KJ, Purcell MK, Winton JR, Hansen JD. A genomic view of the NOD-like
receptor family in teleost sh: identication of a novel NLR subfamily in
zebrash. BMC Evol Biol 2008;8:42.
[16] Chang MX, Chen WQ, Nie P. Structure and expression pattern of teleost cas-
pase recruitment domain (CARD) containing proteins that are potentially
involved in NF-kappaB signalling. Dev Comp Immunol 2010;34:1e13.
[17] Sha Z, Abernathy JW, Wang S, Li P, Kucuktas H, Liu H, et al. NOD-like subfamily
of the nucleotide-binding domain and leucine-rich repeat containing family
receptors and their expression in channel catsh. Dev Comp Immunol
2009;33:991e9.
[18] Ganassin RC, Bols NC. Development of a monocyte/macrophage-like cell line,
RTS11, from rainbow trout spleen. Fish Shellsh Immunol 1998;8:457e76.
[19] Zou J, Tafalla C, Truckle J, Secombes CJ. Identication of a second group of type
I IFNs in sh sheds light on IFN evolution in vertebrates. J Immunol
2007;179:3859e71.
[20] Wang T, Holland JW, Carrington A, Zou J, Secombes CJ. Molecular and func-
tional characterization of IL-15 in rainbow trout Oncorhynchus mykiss:
a potent inducer of IFN-gamma expression in spleen leukocytes. J Immunol
2007;179:1475e88.
[21] Chang M, Nie P, Collet B, Secombes CJ, Zou J. Identication of an additional
two-cysteine containing type I interferon in rainbow trout Oncorhynchus
mykiss provides evidence of a major gene duplication event within this gene
family in teleosts. Immunogenetics 2009;61:315e25.
[22] Hong S, Zou J, Crampe M, Peddie S, Scapigliati G, Bols N, et al. The production
and bioactivity of rainbow trout (Oncorhynchus mykiss) recombinant IL-1 beta.
Vet Immunol Immunopathol 2001;81:1e14.
[23] Zou J, Carrington A, Collet B, Dijkstra JM, Bols N, Secombes CJ. Identication
and bioactivities of interferon gamma in rainbow trout Oncorhynchus mykiss:
the rst Th1 type cytokine characterised functionally in sh. J Immunol
2005;175:2484e94.
[24] Laing KJ, Holland J, Bonilla S, Cunningham C, Secombes CJ. Cloning and
sequencing of caspase 6 in rainbow trout, Oncorhynchus mykiss, and analysis
of its expression under conditions known to induce apoptosis. Dev Comp
Immunol 2001;25:303e12.
[25] Takle H, McLeod A, Andersen O. Cloning and characterization of the execu-
tioner caspases 3, 6, 7 and Hsp70 in hyperthermic Atlantic salmon (Salmo
salar) embryos. Comp Biochem Physiol B Biochem Mol Biol 2006;144:188e98.
[26] Holland JW, Bird S, Williamson B, Woudstra C, Mustafa A, Wang T, et al.
Molecular characterization of IRF3 and IRF7 in rainbow trout, Oncorhynchus
mykiss: Functional analysis and transcriptional modulation. Mol Immunol
2008;46:269e85.
[27] Purcell MK, Laing KJ, Woodson JC, Thorgaard GH, Hansen JD. Characterization
of the interferon genes in homozygous rainbow trout reveals two novel genes,
alternate splicing and differential regulation of duplicated genes. Fish Shell-
sh Immunol 2009;26:293e304.
[28] Zou J, Cunningham C, Secombes CJ. The rainbow trout Oncorhynchus mykiss
interleukin-1 beta gene has a differ organization to mammals and undergoes
incomplete splicing. Eur J Biochem 1999;259:901e8.
[29] Iliev DB, Castellana DB, MacKenzie S, Planas JV, Goetz FW. Cloning and
expression analysis of an IL-6 homolog in rainbow trout (Oncorhynchus
mykiss). Mol Immunol 2007;44:1803e7.
[30] Laing KJ, Zou JJ, Wang T, Bols N, Hirono I, Aoki T, et al. Identication and
analysis of an interleukin 8-like molecule in rainbow trout Oncorhynchus
mykiss. Dev Comp Immunol 2002;26:433e44.
[31] Zou J, Peddie S, Scapigliati G, Zhang Y, Bols NC, Ellis AE, et al. Functional
characterisation of the recombinant tumor necrosis factors in rainbow trout,
Oncorhynchus mykiss. Dev Comp Immunol 2003;27:813e22.
[32] Chang CI, Zhang YA, Zou J, Nie P, Secombes CJ. Two cathelicidin genes are
present in both rainbow trout (Oncorhynchus mykiss) and Atlantic salmon
(Salmo salar). Antimicrobial Agents Chemother 2006;50:185e95.
[33] Daz-Rosales P, Bird S, Wang TH, Fujiki K, Davidson WS, Zou J, et al. Rainbow
trout interleukin-2: cloning, expression and bioactivity analysis. Fish Shellsh
Immunol 2009;27:414e22.
[34] Wang T, Bird S, Koussounadis A, Holland JW, Carrington A, Zou J, et al.
Identication of a novel IL-1 cytokine family member in teleost sh. J
Immunol 2009;183:962e74.
[35] Rosenstiel P, Huse K, Till A, Hampe J, Hellmig S, Sina C, et al. A short isoform of
NOD2/CARD15, NOD2-S, is an endogenous inhibitor of NOD2/receptor-inter-
acting protein kinase 2-induced signaling pathways. Proc Natl Acad Sci U S A
2006;103:3280e5.
[36] Rosenstiel P, Huse K, Franke A, Hampe J, Reichwald K, Platzer C, et al. Func-
tional characterization of two novel 50 untranslated exons reveals a complex
regulation of NOD2 protein expression. BMC Genomics 2007;8:472.
[37] Leung E, Hong J, Fraser A, Krissansen GW. Splicing of NOD2 (CARD15) RNA
transcripts. Mol Immunol 2007;44:284e94.
[38] Hysi P, Kabesch M, Moffatt MF, Schedel M, Carr D, Zhang Y, et al. NOD1
variation, immunoglobulin E and asthma. Hum Mol Genet 2005;14:935e41.
[39] Brown GD. Dectin-1: a signalling non-TLR pattern-recognition receptor. Nat
Rev Immunol 2006;6:33e43.
 M. Chang et al. / Fish & Shellsh Immunology 30 (2011) 118e127
[40] Jordan T, Schornack S, Lahaye T. Alternative splicing of transcripts encoding
Toll-like plant resistance proteinsdwhats the functional relevance to innate
immunity? Trends Plant Sci 2002;7:392e8.
[41] Chang MX, Nie P, Wei LL. Short and long peptidoglycan recognition proteins
(PGRPs) in zebrash, with ndings of multiple PGRP homologs in teleost sh.
Mol Immunol 2007;44:3005e23.
[42] Rosenstiel P, Fantini M, Brutigam K, Khbacher T, Waetzig GH, Seegert D,
et al. TNF-alpha and IFN-gamma regulate the expression of the NOD2
(CARD15) gene in human intestinal epithelial cells. Gastroenterology 2003;
124:1001e9.
[43] Netea MG, Kullberg BJ, de Jong DJ, Franke B, Sprong T, Naber TH, et al. NOD2
mediates anti-inammatory signals induced by TLR2 ligands: implications for
Crohns disease. Eur J Immunol 2004;34:2052e9.
[44] Ferwerda G, Kramer M, de Jong D, Piccini A, Joosten LA, Devesaginer I,
et al. Engagement of NOD2 has a dual effect on proIL-1beta mRNA tran-
scription and secretion of bioactive IL-1beta. Eur J Immunol 2008;38:
184e91.
[45] Hsu LC, Ali SR, McGillivray S, Tseng PH, Mariathasan S, Humke EW, et al. A
NOD2-NALP1 complex mediates caspase-1-dependent IL-1beta secretion in
response to Bacillus anthracis infection and muramyl dipeptide. Proc Natl Acad
Sci U S A 2008;105:7803e8.
127
[46] Inohara N, Nuez G. Genes with homology to mammalian apoptosis regula-
tors identied in zebrash. Cell Death Differ 2000;7:509e10.
[47] Yabu T, Kishi S, Okazaki T, Yamashita M. Characterization of zebrash caspase-
3 and induction of apoptosis through ceramide generation in sh fathead
minnow tailbud cells and zebrash embryo. Biochem J 2001;360:39e47.
[48] Eimon PM, Kratz E, Varfolomeev E, Hymowitz SG, Stern H, Zha J, et al.
Delineation of the cell-extrinsic apoptosis pathway in the zebrash. Cell Death
Differ 2006;13:1619e30.
[49] Sakata S, Yan Y, Satou Y, Momoi A, Ngo-Hazelett P, Nozaki M, et al. Conserved
function of caspase-8 in apoptosis during bony sh evolution. Gene 2007;396:
134e48.
[50] Letai AG. Diagnosing and exploiting cancers addiction to blocks in apoptosis.
Nat Rev Cancer 2008;8:121e32.
[51] Sidi S, Sanda T, Kennedy RD, Hagen AT, Jette CA, Hoffmans R, et al. Chk1
suppresses a caspase-2 apoptotic response to DNA damage that bypasses p53,
Bcl-2, and caspase-3. Cell 2008;133:864e77.
[52] Bertin J, Nir WJ, Fischer CM, Tayber OV, Errada PR, Grant JR, et al. Human
CARD4 protein is a novel CED-4/Apaf-1 cell death family member that acti-
vates NF-kappaB. J Biol Chem 1999;274:12955e8.
[53] Srinivasula SM, Ahmad M, Fernandes-Alnemri T, Alnemri ES. Autoactivation of
procaspase-9 by Apaf-1-mediated oligomerization. Mol Cell 1998;1:949e57.