Gene, 26 (1983) 91-99 91

Elsevier

GENE 897

Short Communications

New versatile cloning aad sequencing vectors based on bacteriophage Ml3

(Recombinant DNA; polylinker; oligonucleotide synthesis)

M.P. Kieny,R. Lathe * and J.P. Lecocq

(Received July 5th, 1983)

(Revision received August 2&h, 1983)
(Accepted August 31st, 1983)

SUMMARY

A new pair of cloning and sequencing vectors based on bacte~oph~e M 13mp7 has been developed. These
vectors (M13tg130 and M13tg131) contain, in addition to the EC&I, BamHI, HindIII, SmaI, Sal1 and &I
sites present in other vectors [cf., M 13mpS and M13mp9, Messing and Vieira, Gene 19 (1982) 269-2761, unique
restriction recognition sequences for the enzymes EcoRV, &&I, Sph I, SstI and XbaI. A restriction site for the
enzyme BglII has been incorporated into the polylinker region of one of the vector pair to permit rapid
discrimination between the two vectors.

INTRODUCHON form. This property permits the rapid preparation of

Ml3 is a male-specific fllamentous bacteriophage
of Escherichia coli which, after infection, proliferates
as a double-stranded plasmid form within the host.
V&ions cont~ning complete circular singe-str~ded
genomes are concomitantly exported from the cell.
DNA packaging in Ml3 has no defined size limit,
and DNA fragments inserted into the double-
stranded phage replicative form can be recovered
from the phage particle in a unique single-stranded
* To whom all correspondence should be addressed.
Abbreviations: bp, base pairs; DMSO, dimethylsulfoxide; X-gal,
5-bromo 4-chloro, indolyl ED-galactopyranoside. Restriction
recognition sequences are presented as 5’-3’; the exact cleavage
site is presented by a slash (/).
single-stranded template material suitable for primed
“dideoxy” sequencing (Sanger et al., 1977; 1980).
Single-stranded bacteriophage vectors have also
proved to be of great utility in the local&d muta-
genesis of inserted DNA fr~ents by either the
bisuifite (Everett and Chambon, 1982; Weiher and
SchalIer, 1982) or oligonucleotide-directed (Smith
and Gillam, 1981) protocols. Such vectors have
further allowed the preparation of strand-specific
probes for hybridisation studies (Hu and Messing,
1982) and permitted the identification of specific
clones by hybrid arrest translation (Chandler, 1982).
Messing et al. (1977) describe the incorporation of
a segment of the E. coli lac operon into bacteriophage
M13. Here complementation between the phage-
borne IacZ segment and a chromosomal lucZ mu-
tation permits the production of functional j?-galac-

0378-I 119/83/$03.00 0 1983 Elsevier Science Publishers

92
tosidase in the infected celI. Further manipulation of
this hybrid (Messing et al., 1981) yielded a vector,
M 13mp7, in which an array of restriction sites was
inserted, without disrupting the translation reading
frame, into the N-terminal region of the phage
P-galactosidase segment.
Messing and Vieira (1982) have reported the con-
struction of two new advanced M 13 vectors,
M13mp8 and M13mp9, whose polylinker regions
contain further unique restriction sites for enzymes
Hind111 and SmaI. In addition, they cite vectors
M 13mp 10 and M 13mp 11 containing unique sites for
Sstl and XbaI.
We have extended their approach to incorporate
new unique recognition sequences and the two
vectors described here, M13tg130 and M13tg131,
present a total of 11 unique restriction recognition
sequences suitable for cloning fragments with dis-
similar termini in either orientation. In common with
other Ml3 vectors, insertion of an exogenous DNA
fragment may be recognized by the abolition of
coloration with X-gal, a synthetic chromogenic sub-
strate for the fl-galactosidase.
EXPERIMENTAL
(a) Incorporation of new unique restriction sites;
design of the synthetic block
To improve the versatility of our M 13 vectors we
judged that the introduction of cleavage sequences
for the enzymes EcoRV, HindIII, KpnI, Smal, Sph I,
SstI and X6aI might prove to be the most useful.
In the design of a synthetic polylinker segment a
major concern was to avoid the generation of hairpin
structures in the single-stranded poiylinker region
present in the mature bacteriophage genome which
interfere with primed “dideoxy” sequencing. Inverted
repeated sequences as short as four in length can, in
certain circumstances, cause significant distortion of
the gel pattern obtained (see Sanger et al., 1977).
Further, we felt it essential to conserve the reading
frame of the /%galactosidase (cad) a-peptide into
which the polylinker region was to be inserted. A
particular problem was encountered here with the
recognition sequence of XbuJ (TCTAGA) which
contains a potential stop codon. Our eventual
intention was to construct a second vector containing
the complete polylinker segment in the reverse orien-
tation. As the sequence TAG occurs in both strands,
many of our preliminary designs entailed an in-phase
translation-termination codon. In addition, certain
recognition sequences (e.g., HindIII; AAGCTT and
Sst I; GAGCTC) create a stop codon (here TGA)
when placed side by side.
Computer assisted analysis (not presented) per-
mitted the identification of a number of permissible
sequences, and the order of restriction sites EcuRI,
SmaI, Sst I, EcoRV, SphI, KpnI, XbaI, HindIII,
BarnHI, S&f, PstI was chosen for our final con-
struction.
To minimize our requirements for synthetic oligo-
nucleotide synthesis, we elected to synthesise a block
comprising the SmaI, Sst I, EcoRV, Sph I, KpnI and
XbaI recognition sequences. This was subsequently
introduced between the EcoRI and Hind111 sites
M13tg109 (Lathe et al., 1983b, see Fig. 1) to recon-
struct the complete polylinker segment. To facilitate
this construction, the initial cloning of the synthetic
block was performed in a plasmid vector.
(h) Cloning of the synthetic polylinker segment
Oligonucleotides 5’-dAATTCCCGGGAGAGC-
TCGATATCGCAT-3’ (27-mer) and 5’-dAGCTT-
CTTCTAGAGGTACCGCATGCGATA-3’ (29”
mer) were synthesised using solid-phase phos-
photriester techniques (Narang et al., 1980; Kohli
et al., 1982) and purified by high-pressure liquid
chromatography (Fritz et al., 1978; Gait and
Sheppard, 1977). After hybridisation of the 8-mer
overlap at their 3’ termini, DNA polymerase I
(Klenow fragments was used to fiI1 in the singie-
stranded regions to give a duplex 48-mer. At the
same time, plasmid pBR322 (Bolivar et al., 1977)
was cleaved to completion with Clal (cleavage site
AT/CGAT) and Sal1 (G/TCGAC) and the cohesive
ends filled in using DNA polymerase as before. This
procedure results in the generation of the 3’-G at the
C&I site and a 5’-T at the SafI site, suitable for the
regeneration of restriction recognition sequences
after ligation to the duplex 48-mer (Fig. 2) *
* Our original intention was to ligate the two oligonucleotidcs
into termini generated by digestion with EcoRl and Hind111 in a
manner analogous to the procedure for the terminal addition of
 93

tll3mp7 lMetThrMetIleThrAsnSerProAspProSerlhrCysArgSerlhrAspProGlyAmnSerL~uAla
ATGACCATGATTACGAATTCCCCGGATCCGTCGACCTGCAGGTCGACGGAlCCGGGGAAllCAClGSCC
TACTGGTACTAATGCTTAAGGGGCCTAGGCAGCTGGACGTCCAGClGCCTAGGCCCCTTAAGlGACCGG
****t* r****t *****t ***a** *****a
****** ******
ECORI BamHI Sal1 PstI SO11 B0mHI EcoRI
Hind11 Hind11
AccI AccI

Ml 3mp701 tMetThrMetIleThrAsnSerProAspProSerThrCysSerAsnSarLauAla
ATGACCATGATTACGAATTCCCCGGATCCGTCGACCTGCAGCAATTCACTGGCC
TACTGGTACTAATGCTTAAGGGGCCTAGGCAGCTGGACGTCGTTAAGTGACCGG
**tt** *t**** *a****
******
EcoRI BamHI Sal1 Pst I
Hind11
AccI

M13tg109 t~etThrMetIleThrAsnSerProAspProLysLeuGlyIleArgArgProAlaAlaIloHis
ATGACCATGATTACGAATTCCCCGGATCCCAAGCTTGGGATCCGTCGACCTGCAGCAATTCAC
TACTGGTACTAATGCTTAAGGGGCCTAGGGTTCGAACCCTAGGCAGCTGGACGTCGTTAAGTG
****** ****** **t*** ****** ******
******
EcoRI BamHI Hind111 BamHI Sal1 Pot I
Hind11
AccI

M13tgllO CMatThrMetIleThrAsnSerProAspProSerLysLeuGlyProAlaAlaIleHi6
ATGACCATGATTACGAATTCCCCGGATCCGTCCAAGCTTGGACCTGCAGCAATTCAC
TACTGGTACTAATGCTTAAGGGGCCTAGGCAGGTTCGAACCTGGACGTCGTTAAGTG
***t** *t**** ****** ******
EcoRI BamHI Hind111 Pst I

M13tg115 CHetThrM~tIleThrGlnIleCysProGlySerValGlnA~aTrpThrCysSerA~nSarLeuAla
ATGACCATGATTACGCAGATCTGCCCCGGATCCGTCCAAGCTTGGACCTGCAGCAATTCACTGGCC
TACTGGTACTAATGCGTCTAGACGGGGCCTAGGCAGGTTCGAACCTGGACGTCGTTAAGTGACCGG
****** ****t* ***t** ******
BglII BamHI Hind111 P¶t I

M13tg119 fMetThrfletIleThrGlnIleCysSerAsnSerLeuAla
ATGACCATGATTACGCAGATCTGCAGCAATTCACTGGCC
TACTGGTACTAATGCGTCTAGACGTCGTTAAGTGACCGG
******
*****t
GglII PstI

M13tg120 f~etThrMetIleThrGlnIlcCysArgSerThrAspProGlyAsnSerLeuAla
ATGACCATGATTACGCAGATCTGCAGGTCGACGGATCCGGGGAATTCACTGGCC
TACTGGTACTPATGCGTCTAGACGTCCAGCTGCCTAGGCCCCTTAAGTGACCGG
****** ****** ******
**w.** ******
BglII PstI Sal1 BamHI EcoRI
Hind11
AccI

Fig. 1. Nuckotide sequences of vector phage M13mp7 (Messing et al., 1981) M13mp701 (Bentley, D.R., personal communication),
M13tgIO9 and 110 (Lathe et al., 1983b) and M13tgl15, 119 and 120 (this work) in the N-terminal section of the p-galactosidase (lucZ)
gene. Restriction recognition sequences are indicated.

adaptor ohgonucleotides described previously (Lathe et al., repair in vitro should, in theory, reconstruct a viable circular
1982). Here oligonucleotides complementary to the singlc- molecule having incorporated the polylinker segment (see also
stranded extension produced by certain enzymes are able to Messing et al., 1981). This approach was not successful,
hydrogen-bond with and be ligated into such termini. Subsequent
94

pBR322 OLIGONUCLEOTIDES

C/a1 S/k Sal1 site

5’--ATCGATp GTCGAC -- 3’ 5’AATTCCCGGGAGAGCTCGATATCGCAT 3’
3’--TAGCTA CAGCTG -- 5’ 3,ATAGCGTACGCCATGGAGATCTTCTTCGA 5,

Cbl+
pal I (Klenow)
Sal1
,
5’
--AT TCGAC -- AATTCCCGGGAGAGCTCGATATCGCATGCGGTACCTCTAGAAGAAGCT3
--TAGC G-- 3,TTAAGGGCCCTCTCGAGCTATAGCGTACGCCATGGAGATCTTCTTCGA5

pol I (Klenowl

--ATCG 3’ 5’TCGAC --
--TAGC 5, 3,AGCTG--

EcoRI .%a* Sst I Eco RV Sph I Kpn I Xba I Hind III

5*--ATC+i&&AG~&i?i??66%6i%t~AG&&$CGAC--3’
~‘--TAGCITTMGGGCCCTCTCGAGCTATAGCGTACGCCATGGAGATCTTCTTCGAIAGCTG--~’

Fig. 2. Construction and cloning of a synthetic polylinker block. The C/al and .Safl sites of pBR322 were cleaved and filled m using DNA
polymerase. The two synthetic oligonucleotides were hybridised together, the single-stranded extensions filled in and the duplex segment
inserted between the tilled in CIuI and Sal1 sites of plasmid pBR322 to regenerate the EcoRI and Hind111 recognition sequences.

Plasmid pBR322 cut with CIaI and Sal1 and cleotides. Ten colonies gave a positive signal with the
repaired with DNA polymerase I Klenow fragment 29-mer and nine with the 27-mer. Only one gave,
was ligated overnight with an excess of polylinker under our conditions of hybridisation, a positive
duplex. Since the synthetic oligonucleotide lacks 5’ signal with both probes (clone 3). These clones were
terminal phosphate groups ligation was restricted to examined by direct plasmid sequencing (Wallace
one strand at the oligonucleotide-vector junction. et al., 198 la) using an oligonucleotide primer capable
This resulted in termini carrying single-stranded and of generating sequence data from the region imme-
complementary oligonucleotides which permit recir- diately flanking the ClaI site of plasmid pBR322.
cularisation of the vector in vivo (for a discussion of All clones examined were found to have incorpo-
this strategy see Lathe et al., 1983a). Following an rated only a section of the complete polylinker
80’ C heat step to dissociate the duplex, excess oligo- duplex. We have no clear explanation for this result.
nucleotides were removed by precipitation with sper- Nevertheless, two plasmids (clones 3 and 7) had
mine (Hoopes and McClure, 1981) in the presence incorporated segments of the polylinker duplex sui-
of 30% DMSO. After rehybridisation of the oligonu- table for reconstruction of the complete segment by
cleotide-tailed extremities to permit recircularisation, conventional restriction and religation.
this material was transformed into E. co/i 8759
(Murray et al., 1977) and ampicillin-resistant colo- (c) Construction of ptg130 by recombining polylinker
nies were selected. segments
A total of 150 colonies were screened by a modil’i-
cation of the procedure of Wallace et al. (198 1b) for Clone 3 contains the right hand (SstI, EcoRV,
sequences hybridising to the “*P-labelled oligonu- Sph I, KpnI, X6a1, HindIII) segment of the synthetic
 95

M13tg130
__- __---

fMetThrMetIleThrAsnSerArgGluSerSerIleSerHisAlaValProLeuGluGluAlaTrpA~pPr~CysThrCysSerAsnSerLeu
ATGACCATGATTACGAATTCCCGGGAGAGCTCGATATCGCATGCGGTA&CTCTAGAAGAAGCTT~GGATCCGTCGAC~TG~AGCAATTCACTG
TACTGGTACTAATGCTTAAGGGCCCTCTCTCGAGCGTACGCCATGGAGATCTTCTTCGAACC~TAGGCAG~TGGACGTCGTTAAGTGAC
*****I* *ux**I ****** ****** xx**** ****** ******
*****x *****a ****** ******
EcoRI SmaI SstI EcoRV SphI KpnI Xbal Hind111 BemHI Sal1 PstI
AccI
Hind11
M13tg131
__----__

fMetThrMetIleThrGlnIleCysArgSerThrAspProLy~LeuLeuLeuGluValProHisAlaIleSerSerSerProGlyAsnSerLeu
ATGACCATGATTACGCAGATCTGCAGGTCGACGGATCCCAAGCTTCTTCTAGAGGTACCGCATGCGA~ATCGAGCTCTCCCGGGAATTCACTG
TACTGGTACTAATGCGTCTAGACGTCCAGCTGCCTAGGGTTCGAAGAAGATCTCCATGGCGTACGCTATAGCTGCAGAGGGCC~TTAAGTGAC
****** *****x ****I* ****** ****** ****** ******
I%%c*XV x*x*** ****** ****I* ***x*x
83111 PstI Sal1 BamHI Hind111 XbaI KpnI SphI ECORV SstI SmaI EcoRI
Hind11
AccI
Fig.3. Nucleotide sequences of M13tgl30 and M 13tg131 in the N-terminal section of the lucZ gene. In both the reading frame of the
1ucZ gene is conserved. Restriction recognition sequences are indicated.

block, whereas clone 7 carries the left-hand (EcoRI,
SmaI, Ss61, EcoRV) section (not shown). The two
segments were therefore combined through their Sst I
sites, taking advantage of an outside Pst I site present
in the Ap’ gene of the plasmid vector. The two
plasmids were cleaved to completion with PstI and
Sst I and ligated in equimolar propo~ions. Three out
of twelve Ap’ transformants contained plasmids
sensitive to cleavage with both SmaI and XbaI, and
sequence analysis revealed that these plasmids
carried the complete synthetic block (ptgl30).
(d) Construction of bacteriophage M13tg130
Bacteriophage M13tg109 (Lathe et al., 1983b)
contains the following series of restriction sites at the
N-terminus of the IacZ gene: EcoRI-BarnHI-
-~~~dIII-~~rnHI-~a~I-P~t I (see Fig. 1). The poly-
linker segment present in ptgl30 comprises a total of
six additional restriction recognition sequences
flanked by EcoRI and Hind111 sites. We therefore
inserted the EcoRI-Hind111 section from ptgl30
between the EcoRI and Hind111 sites of Ml3t8109
to create the complete polylinker segment. This
exchange deletes the first BamHI site present
in Ml3tg109, the second site becoming unique.
Double-stranded DNAs from M13tg109 and ptgl30
were digested to completion with EcoRI and Hind111
and ligated together prior to transfection of M 13 host
strain JM103 (Messing et al., 1981). Lac’ plaques
were picked from a background of parental
M13tg109 lac- plaques and subjected to dideoxy
sequencing (Sanger et al., 1977) using a commercially
available primer 5’-dT~A~GACG~GT-3’ or a
second primer 5’-dAGTCACGACGTTGTA-3’
synthesised in this laboratory. Ten out of ten bac-
teriophages presented the correct nucleotide se-
quence (Fig. 3) and one such isolate, M13tg130, was
retained.
(e) Construction of a vector permitting inversion of
inserted DNA fragments
The rapid sequencing protocols described by
Sanger et al. (1980) and Messing et al. (1981)
generate sequence data from one end of a particular
inserted DNA fragment. Only if the fragment is
flanked by identical termini can the orientation of the
insert be easily reversed. Although it is possible in
some cases to obtain sequence data directly from the
other extremity of an inserted fragment (Hong,
1981), the required manipulations are technically
complex.
It was therefore of interest to construct a vector
M 13tg 13 1, in which the array of cloning sites is in the where ATG codes for the N-terminal methioninc of
opposite orientation to that in M13tg130. Since fl-galactosidase and E, B, S, and Pare the recognition
reversal of the orientation of an inserted DNA frag- sequences for EroRI, BN/~~HI, S~rl1 (AccI. NirrdII)
ment ultimately involves mixing material derived and Y.cfI respectively. In M 13mp701 (Bentley. D.K..
from both vectors, we felt it necessary to have a personal coIn~llun~c~~ti~~n) the second repcat has
means for discriminating the reversed vector been deleted to generate ATG-EBSP where the Ps? I
(M13tg131) from its complement (M13tg130) recognition sequence now abuts sequences formerly
without recourse to nucleic acid sequencing. To this adjacent to the distal EcoRI site (see Fig. 1).
end an additional BglII recognition sequence was To generate a vector of structure ATG - PSBE (the
introduced into the cloning region of M 13tgllO as a opposite orientation to that of M 13mp701) WG
first step towards the construction of M13tg131. positioned a PsrI recognition sequence close to the
In the construction of vector phage M 13mp7, aBgfII site originally occupied by the proximal EcoRI recog-
recognition sequence was acquired at the Ace1 site of nition sequence of M 13mp7 by fusing the distal Pst I
M 13 (see Messing et al., 198 1). The presence of this site of M 13mp701 with the proximal BglII site
BglII site prohibits the insertion of a second site present in M 13tgl15. Double-stranded replicative
BglII by the addition of linker oligonucleotides, for form DNA M 13tg 115 was cleaved with Pst I, partial-
the required cleavage with BglII after linker addition ly digested with BglII. and religated in the presence
would result in cleavage at the outside site. Linker of B&II-PstI adaptor oligonucleotide 5’-dGA-
oligotlucleotides lacking 5’-terminal phosphate TCTGCA-3’ (Lathe et al., 1982). to fuse the P.FII
groups were used to limit ligation to only one strand and Bg/II sites and regenerate both recognition
at each linker-vector junction (linker tailing). This sequences. Eleven out of twelve Lac ’ plaques
results in termini carrying single-stranded and com- emerging after transfection presented the desired
plementary oligonucleotides which permit recirculari- nucleotide sequence (M 13tgl19; see Fig. 1).
sation in vivo, eliminating the necessity for subse- In a subsequent step we linked the proximal Pst I
quent cleavage by the cognate restriction enzyme site deriving from M 13tg 119 to the distal EcoRI site
(Lathe, R., Kieny, M.P., Skory, S. and Lecocq, J.P., from M 13mp7 through the array of restriction recog-
in preparation). nition sequences present in M 13mp70 1. Replicative
Bacteriophage M 13tgl10 is a derivative of vector form DNA from M13tg119 was cleaved with PstI
M13mp701 (Bentley, D.R., personal communica- and additionally at the unique external Bg/I site and
tion) in which the Sal1 site has been replaced by a dephosphorylated using calf intestinal phosphatase.
Hind111 site. This replacement disrupts the lacZ M 13mp70 1 and M 13mp7 were cleaved with Pst I +
reading frame to give a luc - vector. M 13tgllO was EcoRI and EcoRI + BglI respectively. After ligation
chosen since the construction will reconstitute the and transfection into E. cd, four out of luc + phages
reading frame to generate a lac + phage. The nucleo- yielded the correct restriction profile and ofthese two
tide sequence at the beginning of the I&Z gene is had the desired nucleotide sequence (M 13tg120; see
presented in Fig. 1. Fig. 1).
Replicative form DNA from M 13tg 110 was cleav-
ed with EcoRI, the single-stranded protrusions re- (f) Construction of the complementary vector:
moved by treatment with S 1 nuclease, and the flush M13tg.131
termini ligated overnight with an excess of non-
phosphorylated linker oligonucleotides 5 ‘ -dCA- This final construction involved the insertion of
GATCTG-3’. Following precipitation with spermine the complete polylinker segment of M 13tg130 into
and reannealing the linker-tailed vector was trans- the intermediate vector M13tg120. Replicative form
fected into E. coli, and 15 out of 24 luc + phages were DNAs of M13tg130 and M13tg120 were cleaved
found to have incorporated a BglII recognition with Pst I and EcoRI, ligated, and transfected into
sequence at the EcoRI site (M13tg11.5; see Fig. I). JM 103. About 30”/, of lac + phages examined pres-
In vector phage M13mp7 (Messing et al., 198 I) ented the desired sequence (M 13tg 13 1; see Fig. 3).
the arrangement of sites in the N-terminal section of The various manipulations performed upon the mul-
the iucZ gene is, schematically, ATG-EBSPSBE, tiple restriction site segment to generate M13tg130
 91

f 3 CHEMICAL

Fig. 4. Schematic summary of the construction of M13tg130 and M13tg131. Only the multiple restriction site (“polylinker”) segments
are presented. Restriction sites which are unique in each bacteriophage are presented above the line; sites occurring more than once
are below the line. The various steps in the construction were: (1) Deletion of the second EcoRI-P&I repeat in M13mp7 to generate
M13mp701 (Bentley, D.R., personal comm~ication); (2) insertion of H&d111 linker oligonucleotides at the BumHI or Sal1 sites of
M13mp701 to generate Ml3tg109 and M13tgllO (Lathe et al., 1983b); (3) insertion of a EglII linker into the EcoRI site of MlkgllO
to generate M13tgl15; (4) fusion of the Bg/II and PsrI sites of M13tgl15 using an adaptor oligonucleotide such as to regenerate both
recognition sequences; (5) insertion of the polylinker segment from M13mp701 in the reversed orientation to generate M13tg120; (6)
insertion of the synthetic polyli~er segment from ptgi30 between the EcoRI and Hind111 sites of M13tglO9 to generate M13tg130; (7)
insertion of the complete polylinker segment from M13tg130 between the EcoRI and &I sites of Ml3tg120, reversing the orientation
of the segment to generate M13tg131.
98

and M13tg13 1 are outlined in Fig. 4. A detailed map

of M13tg130 and 131 is presented in Fig. 5.

(g) A new pair of versatile Ml3 vectors; M13tg130

and M13tg131

To extend the range and versatility of M 13 vectors,

we have constructed a new pair of bacteriophages,
M13tg130 and M13tg131, which comprise a total of
eleven unique restriction sites. As with other vectors,
insertion of exogenous DNA fragments into the
polylinker region may be detected by the abolition of
coloration with X-gal. These vectors, deriving from
the parental bacteriophage M 13mp7 (Messing et al.,
1981), lack extraneous DNA and give reliable se-
quence data with all primers tested *. In our design
of the vectors we attempted to remove all possible
secondary structure generated by the polylinker
Fig.5. Map of M13tg130 and M13tg131. Numerbering of
region, and this is evidenced by the uniformity of the nucleotides and Ml3 structural genes is according to Van
gel patterns obtained (not shown). Wezenbeek et al. (1980). Major restriction sites are indicated;
When inverting the orientation of an inserted the position of each site is defined by the first nucleotide of the
DNA fragment by transfer between vectors, it is recognition sequence. Coordinates for the polylinker segment
correspond to theEcoR1 sites ofM13tg130(6231)and M13tg131
useful to have a means of distinguishing the parental
(6300). on’: origin of Ml 3 replication. lack’ : inactive C-terminal
from the inversion vector. A final modification
segment of the luc repressor gene. IacZ ’ : N-terminal section of
involved the inclusion of a restriction recognition site the fl-galactosidase gene coding for a peptide active in alpha
(BglII) in the polylinker region of one of the two complementation; the promoter forlutZ’ transcription is located
bacteriophages (M13tg131), to permit the rapid between the lucl’ and IucZ’ genes.

discrimination between the two vectors by direct

restriction analysis of their replicative form DNAs.
* We have routinely observed that certain vector-primer combi-
In the accompanying paper, Norrander et al.
nations cannot be used to generate sequence data by the dideoxy
(1983) describe the preparation of two new vectors, technique. For instance, under standard conditions. we have
M13mp18 and 19, with characteristics broadly been unable to use the commercially-available primers S’-
similar to the vectors described here. dTCACGACGTTGT-3’, 5’.dTCCCAGTCACGACGT-3’ and
5’.dCCCAGTCACGACGTT-3’ to sequence material inserted
into the polylinker region ofbacteriophage M13mp9, whereas the
same primers can be used to success with M13mp8 (Findeli, A.,
ACKNOWLEDGEMENTS
Kieny, M.P. and Lathe, R., unpublished data). Similar incompa-
tability has been observed with our own primer 5’-dAGCTAC-
We thank D.R. Bentley (Sir William Dunn School GACGTTGTA-3’. In contrast, the longer primer 5’-
of Pathology, University of Oxford) for vector dGATCCGGACGTTGTAAAACGACGGCCAGTG-3’ (also
available commercially) and a downstream primer 5’-dAAGGC-
M 13mp70 1. We gratefully acknowledge technical
GATTAAGTTG-3’ prepared in this laboratory give reliable
assistance from A. Findeli, D. Schmitt, S. Skory and
sequence data with both bacteriophages. We have used the
D. Villeval, and thank I. Batra for help in preparing downstream primer to demonstrate that the phenomenon is not
the text. We are particularly indebted to A. Balland due to mutation in the primer-complementary region of
and V. Kohli (Department of Chemistry, Transg&ne M13mp9. We cannot exclude the possibility that this effect is
S.A.) for their synthesis of the long oligonucleotides linked to the 370-bp Htr~Il fragment of pBR322 DNA present,
in M 13mp9 but not in M 13mp8, at the Narl site of the lcrcl gene
described in this paper. We thank P. Kourilsky and
segment (see addendum in Messing and Vieira, 1982). M13tg130
P. Chambon for their continued interest in this work
and 131 have been examined for their compatibility with the
and M. Gottesman for critical comments on the various primers, and all tested were found to give reliable
manuscript. sequence data.

REFERENCES
Bolivar, F., Rodriguez, R.L., Greene, P.J., Betlach, M.C.,
Heynecker, H.L., Boyer, H.W., Crosa, J.H. and Falkow, S.:
Construction and characterization of new cloning vehicles,
II. A multipurpose cloning system. Gene 2 (1977) 95-113.
Chandler, P.M.: The use of single-stranded phage DNAs in
hybrid arrest and release translation. Analyt. Biochem. 127
(1982) 9-16.
Everett, R. and Chambon, P.: A rapid and efficient method for
region and strand-specific mutagenesis of cloned DNA.
EMBO J. (1982) 433-437.
Fritz, H.J., Belagaje, R., Brown, E.L., Fritz, R.H., Jones, R.A.,
Lees, R.G. and Khorana, H.G.: High pressure liquid chroma-
tography in polynucleotide synthesis. Biochemistry 17 (1978)
1257-1267.
Gait, M.J. and Sheppard, R.C.: Rapid synthesis of oligodeoxynu-
cleotides: a new solid phase method. NucL Acids Res. 4
(1977) 1135-1158.
Hong, G.F.: A method for sequencing single-stranded cloned
DNA in both directions. Biosci. Rep. 1 (1981) 243-252.
Hoopes, B.C. and McClure, R.R.: Studies on the selectivity of
DNA precipitation by spermine. Nucl. Acids Res. 9 (1981)
5493-5504.
Hu, N.T. and Messing, J.: The making of strand-specific Ml3
probes. Gene 17 (1982) 271-277.
Kohli, V., Balland, A., Wintzerith, M., Sauerwald, R., Staub, A.
and Lecocq, J.P.: Silica gel: An improved support for the
solid-phase synthesis of oligonucleotides. Nucl. Acids Res. 10
(1982) 7439-7448.
Lathe, R., Balland, A., Kohli, V. and Lecocq, J.P.: Fusion of
restriction termini using synthetic adaptor oligonucleotides.
Gene 20 (1982) 187-195.
Lathe, R., Lecocq, J.P. and Everett, R.: DNA engineering: the
use ofenzymes, chemicals and oligonucleotides to restructure
DNA sequences in vitro, in Williamson, R. (Ed.), Genetic
Engineering, Academic Press, London, 1983a, pp. l-56.
Lathe, R., Kieny, M.P., Schmitt, D., Curtis, P. and Lecocq, J.P.:
Ml3 bacteriophage vectors for the expression of foreign
proteins in E. coli: The rabies glycoprotein. J. Mol. Appl.
Genet. (1983b) in press.
Messing, J., Gronenborn, B., Mtiller-Hill, B. and Hofschneider,
P.H.: Filamentous coliphage Ml3 as a cloning vehicle:
Insertion of a Hind11 fragment of the luc regulatory region in
Ml3 replicative form in vitro. Proc. Natl. Acad. Sci. USA 74
(1977) 3642-3646.
99
Messing, J., Crea, R. and Seeburg, P.H.: A system for shotgun
sequencing. Nucl. Acids Res. 9 (1981) 309-321.
Messing, J. and Vieira, J.: A new pair of M 13 vectors for selecting
either double-digest restriction fragments. Gene 19 (1982)
269-276.
Murray, N.E., Brammar, W.J. and Murray, K.: Lambdoid phages
that simplify the recovery of in vitro recombinants. Mol. Gen.
Genet. 150 (1977) 53-61.
Narang, S.A., Brousseau, R., Hsiung, H.M. and Michniewicz,
J.J.: Chemical synthesis of deoxyoligonucleotides by the
modified triester method. Methods Enzymol. 65 (1980)
610-620.
Norrander, J., Kempe, T. and Messing, J.: Construction of im-
proved M 13 vectors using oligonucleotide-directed mutagen-
esis. Gene 26 (1983) 101-106.
Sanger, F., Nicklen, S. and Coulson, A.R.: DNA sequencing with
chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74
(1977) 5463-5467.
Sanger, F., Cot&on, A.R., Barre& B.G., Smith, A.J.H. and Roe,
B.A.: Cloning in single-stranded bacteriophage as an aid to
rapid DNA sequencing. J. Mol. Biol. 143 (1980) 161-178.
Smith, M. and Gillam, S.: Constructed mutants using synthetic
oligodeoxyribonucleotides as site-specific mutagens, in Set-
low, J.K. and Hollaender, A. (Eds.), Genetic Engineering;
Principles and Methods, Vol. 3, Plenum, New York, 1981,
pp. I-32.
Van Wezenbeek, P.M.G.F., Hulsebos, T.J.M. and Schoen-
makers, J.G.G.: Nucleotide sequence of the tilamentous bac-
teriophage Ml3 DNA genome: Comparison with phage fd.
Gene I I (1980) 129-148.
Wallace, R.B., Johnson, M.J., Suggs, S.V., Miyoshi, K.-i., Bhatt,
R. and Itakura, K.: A set of synthetic ohgodeoxyribonucleo-
tide primers for DNA sequencing in the plasmid vector
pBR322. Gene 16 (1981a) 21-26.
Wallace, R.B., Schold, M., Johnson, M.J., Dembek, P. and
Itakura, K.: Oligonucleotide directed mutagenesis of the
human /?-globin gene: a general method for producing
specific point mutations in cloned DNA. Nucl. Acids Res. 9
(1981b) 3647-3656.
Weiher, H. and Schaller, H.: Segment-specific mutagenesis:
Extensive mutagenesis of a lac promoter/operator element.
Proc. Natl. Acad. Sci. USA 79 (1982) 1408-1412.
Communicated by Z. HradeEnC.