Вы находитесь на странице: 1из 9

Gene, 26 (1983) 91-99

91

Gene, 26 (1983) 91-99 91 Elsevier GENE 897 Short Communications New versatile cloning aad sequencing vectors

Elsevier

GENE 897

Short Communications

New versatile cloning aad sequencing vectors based on bacteriophage Ml3

(Recombinant

DNA;

polylinker;

oligonucleotide

synthesis)

M.P. Kieny,R. Lathe * and J.P. Lecocq

synthesis) M.P. Kieny, R. Lathe * and J.P. Lecocq (Received July 5th, 1983) (Revision received August

(Received July 5th, 1983) (Revision received August 2&h, 1983) (Accepted August 31st, 1983)

received August 2&h, 1983) (Accepted August 31st, 1983) SUMMARY A new pair of cloning and sequencing

SUMMARY

A new pair of cloning and sequencing vectors based on bacte~oph~e M 13mp7 has been developed. These vectors (M13tg130 and M13tg131) contain, in addition to the EC&I, BamHI, HindIII, SmaI, Sal1 and &I sites present in other vectors [cf., M 13mpS and M13mp9, Messing and Vieira, Gene 19 (1982) 269-2761, unique restriction recognition sequences for the enzymes EcoRV, &&I, Sph I, SstI and XbaI. A restriction site for the enzyme BglII has been incorporated into the polylinker region of one of the vector pair to permit rapid discrimination between the two vectors.

pair to permit rapid discrimination between the two vectors. INTRODUCHON Ml3 is a male-specific fllamentous bacteriophage

INTRODUCHON

Ml3 is a male-specific fllamentous bacteriophage of Escherichia coli which, after infection, proliferates as a double-stranded plasmid form within the host. V&ions cont~ning complete circular singe-str~ded genomes are concomitantly exported from the cell. DNA packaging in Ml3 has no defined size limit, and DNA fragments inserted into the double- stranded phage replicative form can be recovered from the phage particle in a unique single-stranded

* To whom all correspondence

should be addressed.

Abbreviations: bp, base pairs; DMSO, dimethylsulfoxide; X-gal, 5-bromo 4-chloro, indolyl ED-galactopyranoside. Restriction recognition sequences are presented as 5’-3’; the exact cleavage site is presented by a slash (/).

form. This property permits the rapid preparation of single-stranded template material suitable for primed “dideoxy” sequencing (Sanger et al., 1977; 1980). Single-stranded bacteriophage vectors have also proved to be of great utility in the local&d muta- genesis of inserted DNA fr~ents by either the bisuifite (Everett and Chambon, 1982; Weiher and SchalIer, 1982) or oligonucleotide-directed (Smith and Gillam, 1981) protocols. Such vectors have further allowed the preparation of strand-specific probes for hybridisation studies (Hu and Messing, 1982) and permitted the identification of specific clones by hybrid arrest translation (Chandler, 1982). Messing et al. (1977) describe the incorporation of

a segment of the E. coli lac operon into bacteriophage M13. Here complementation between the phage- borne IacZ segment and a chromosomal lucZ mu- tation permits the production of functional j?-galac-

92

tosidase in the infected celI. Further manipulation of this hybrid (Messing et al., 1981) yielded a vector,

M 13mp7, in which an array of restriction sites was

inserted, without disrupting the translation reading frame, into the N-terminal region of the phage

P-galactosidase segment. Messing and Vieira (1982) have reported the con- struction of two new advanced M 13 vectors, M13mp8 and M13mp9, whose polylinker regions

contain further unique restriction sites for enzymes Hind111 and SmaI. In addition, they cite vectors

M 13mp 10 and M 13mp 11 containing unique sites for

Sstl and XbaI. We have extended

new unique recognition sequences and the two

vectors described here, M13tg130 and M13tg131,

present

sequences suitable for cloning fragments with dis- similar termini in either orientation. In common with other Ml3 vectors, insertion of an exogenous DNA fragment may be recognized by the abolition of coloration with X-gal, a synthetic chromogenic sub- strate for the fl-galactosidase.

their approach

to incorporate

a total of 11 unique restriction recognition

EXPERIMENTAL

(a) Incorporation of new unique restriction sites; design of the synthetic block

To improve the versatility of our M 13 vectors we judged that the introduction of cleavage sequences for the enzymes EcoRV, HindIII, KpnI, Smal, Sph I, SstI and X6aI might prove to be the most useful. In the design of a synthetic polylinker segment a major concern was to avoid the generation of hairpin structures in the single-stranded poiylinker region present in the mature bacteriophage genome which interfere with primed “dideoxy” sequencing. Inverted repeated sequences as short as four in length can, in certain circumstances, cause significant distortion of the gel pattern obtained (see Sanger et al., 1977). Further, we felt it essential to conserve the reading frame of the /%galactosidase (cad) a-peptide into which the polylinker region was to be inserted. A particular problem was encountered here with the recognition sequence of XbuJ (TCTAGA) which contains a potential stop codon. Our eventual

intention was to construct a second vector containing the complete polylinker segment in the reverse orien- tation. As the sequence TAG occurs in both strands, many of our preliminary designs entailed an in-phase translation-termination codon. In addition, certain recognition sequences (e.g., HindIII; AAGCTT and Sst I; GAGCTC) create a stop codon (here TGA) when placed side by side. Computer assisted analysis (not presented) per- mitted the identification of a number of permissible sequences, and the order of restriction sites EcuRI,

SmaI, Sst I, EcoRV, SphI,

BarnHI, S&f, PstI was chosen for our final con- struction. To minimize our requirements for synthetic oligo- nucleotide synthesis, we elected to synthesise a block comprising the SmaI, Sst I, EcoRV, Sph I, KpnI and XbaI recognition sequences. This was subsequently introduced between the EcoRI and Hind111 sites M13tg109 (Lathe et al., 1983b, see Fig. 1) to recon- struct the complete polylinker segment. To facilitate this construction, the initial cloning of the synthetic block was performed in a plasmid vector.

KpnI,

XbaI,

HindIII,

(h) Cloning of the synthetic polylinker segment

Oligonucleotides

5’-dAATTCCCGGGAGAGC-

TCGATATCGCAT-3’ (27-mer) and 5’-dAGCTT-

CTTCTAGAGGTACCGCATGCGATA-3’ (29” mer) were synthesised using solid-phase phos-

photriester techniques (Narang

et al., 1982) and purified by high-pressure liquid chromatography (Fritz et al., 1978; Gait and Sheppard, 1977). After hybridisation of the 8-mer overlap at their 3’ termini, DNA polymerase I (Klenow fragments was used to fiI1 in the singie- stranded regions to give a duplex 48-mer. At the same time, plasmid pBR322 (Bolivar et al., 1977) was cleaved to completion with Clal (cleavage site AT/CGAT) and Sal1 (G/TCGAC) and the cohesive ends filled in using DNA polymerase as before. This procedure results in the generation of the 3’-G at the C&I site and a 5’-T at the SafI site, suitable for the regeneration of restriction recognition sequences after ligation to the duplex 48-mer (Fig. 2) *

et al., 1980; Kohli

*

into

manner analogous

Our

original

termini

intention

was

to ligate

with

the

two

EcoRl

oligonucleotidcs

Hind111 in a

of

addition

generated

by digestion

procedure

and

terminal

to the

for the

tll3mp7

lMetThrMetIleThrAsnSerProAspProSerlhrCysArgSerlhrAspProGlyAmnSerL~uAla

ATGACCATGATTACGAATTCCCCGGATCCGTCGACCTGCAGGTCGACGGAlCCGGGGAAllCAClGSCC

TACTGGTACTAATGCTTAAGGGGCCTAGGCAGCTGGACGTCCAGClGCCTAGGCCCCTTAAGlGACCGG

****t*

r****t

*****t

***a**

*****a

 

******

******

ECORI

BamHI

Sal1

PstI

SO11

B0mHI

EcoRI

 

Hind11

Hind11

AccI

AccI

Ml

3mp701

tMetThrMetIleThrAsnSerProAspProSerThrCysSerAsnSarLauAla

ATGACCATGATTACGAATTCCCCGGATCCGTCGACCTGCAGCAATTCACTGGCC

TACTGGTACTAATGCTTAAGGGGCCTAGGCAGCTGGACGTCGTTAAGTGACCGG

*a****

**tt**

*t****

******

EcoRI

BamHI

Sal1

Hind11

AccI

Pst

I

93

M13tg109

t~etThrMetIleThrAsnSerProAspProLysLeuGlyIleArgArgProAlaAlaIloHis

 

ATGACCATGATTACGAATTCCCCGGATCCCAAGCTTGGGATCCGTCGACCTGCAGCAATTCAC

 

TACTGGTACTAATGCTTAAGGGGCCTAGGGTTCGAACCCTAGGCAGCTGGACGTCGTTAAGTG

 

******

******

**t***

******

******

 

******

 

EcoRI

BamHI

Hind111

BamHI

Sal1

Pot

I

 

Hind11

AccI

M13tgllO

CMatThrMetIleThrAsnSerProAspProSerLysLeuGlyProAlaAlaIleHi6

 

ATGACCATGATTACGAATTCCCCGGATCCGTCCAAGCTTGGACCTGCAGCAATTCAC

 

TACTGGTACTAATGCTTAAGGGGCCTAGGCAGGTTCGAACCTGGACGTCGTTAAGTG

 

***t**

*t****

******

******

EcoRI

BamHI

Hind111

Pst

I

M13tg115

CHetThrM~tIleThrGlnIleCysProGlySerValGlnA~aTrpThrCysSerA~nSarLeuAla

 

ATGACCATGATTACGCAGATCTGCCCCGGATCCGTCCAAGCTTGGACCTGCAGCAATTCACTGGCC

 

TACTGGTACTAATGCGTCTAGACGGGGCCTAGGCAGGTTCGAACCTGGACGTCGTTAAGTGACCGG

 

******

****t*

***t**

******

 

BglII

 

BamHI

Hind111

 

P¶t

I

M13tg119

fMetThrfletIleThrGlnIleCysSerAsnSerLeuAla

 

ATGACCATGATTACGCAGATCTGCAGCAATTCACTGGCC

 

TACTGGTACTAATGCGTCTAGACGTCGTTAAGTGACCGG

 

******

 

*****t

 
 

GglII

PstI

M13tg120

f~etThrMetIleThrGlnIlcCysArgSerThrAspProGlyAsnSerLeuAla

 

ATGACCATGATTACGCAGATCTGCAGGTCGACGGATCCGGGGAATTCACTGGCC

 

TACTGGTACTPATGCGTCTAGACGTCCAGCTGCCTAGGCCCCTTAAGTGACCGG

 
 

******

******

******

 

**w.**

 

******

 

BglII

PstI

Sal1

BamHI

EcoRI

 
 

Hind11

AccI

Fig.

1.

Nuckotide

sequences

of vector

phage

M13mp7

(Messing

et al.,

1981)

M13mp701

(Bentley,

D.R.,

personal

communication),

 

M13tgIO9

and

110 (Lathe

et al.,

1983b)

and

M13tgl15,

119 and

120 (this

work)

in the

N-terminal

section

of the p-galactosidase

(lucZ)

gene.

Restriction

recognition

sequences

are

indicated.

 

adaptor ohgonucleotides

described

previously

(Lathe

et al.,

repair

in vitro

should,

in theory,

reconstruct

a viable

circular

1982).

Here

oligonucleotides

complementary

to

the

singlc-

molecule having incorporated

 

the

polylinker

segment

(see

also

stranded

extension

produced

by

certain

are

able

to

Messing

et al.,

1981).

This

approach

was

not

successful,

hydrogen-bond

with and be ligated

enzymes into such termini.

Subsequent

 

94

pBR322

C/a1

S/k

Sal1 site

5’--ATCGATp

GTCGAC

--

3’

3’--TAGCTA

CAGCTG

--

5’

Cbl+

Sal1

--AT

TCGAC

--

--TAGC

G--

 

pol

I (Klenowl

 

I

--ATCG 3’

5’TCGAC

--

--TAGC 5,

3,AGCTG--

OLIGONUCLEOTIDES

5’AATTCCCGGGAGAGCTCGATATCGCAT

3’

3,ATAGCGTACGCCATGGAGATCTTCTTCGA

pal

I (Klenow)

5 AATTCCCGGGAGAGCTCGATATCGCATGCGGTACCTCTAGAAGAAGCT3

3,TTAAGGGCCCTCTCGAGCTATAGCGTACGCCATGGAGATCTTCTTCGA5

5,

,

3,TTAAGGGCCCTCTCGAGCTATAGCGTACGCCATGGAGATCTTCTTCGA5 5, , E c o R I . % a * Sst I Eco RV
3,TTAAGGGCCCTCTCGAGCTATAGCGTACGCCATGGAGATCTTCTTCGA5 5, , E c o R I . % a * Sst I Eco RV

EcoRI

.%a*

Sst

I

Eco RV

Sph I

Kpn

I

Xba

I

Hind

III

5*--ATC+i&&AG~&i?i??66%6i%t~AG&&$CGAC--3’

~‘--TAGCITTMGGGCCCTCTCGAGCTATAGCGTACGCCATGGAGATCTTCTTCGAIAGCTG--~’

Fig.

polymerase. The two synthetic oligonucleotides

inserted

2.

Construction

between

the

and

tilled

cloning

of a synthetic

and

Sal1

in CIuI

polylinker

block.

were

hybridised

sites

of plasmid

The

together,

C/al

and .Safl sites of pBR322

were

the single-stranded

to regenerate

the

extensions

EcoRI

and

cleaved

filled in and the duplex

recognition

and

filled m using

sequences.

DNA

segment

pBR322

Hind111

Plasmid

pBR322

cut

with

CIaI

and

Sal1

and

cleotides.

Ten colonies

gave a positive

signal with the

repaired

with

DNA

polymerase

I Klenow

fragment

29-mer

and

nine

with

the

27-mer.

Only

one

gave,

was

ligated

overnight

with

an

excess

of polylinker

under

our

conditions

of

hybridisation,

a positive

duplex.

Since

the

synthetic

oligonucleotide

lacks

5’

signal

with both

probes

(clone

3). These

clones were

terminal

phosphate

groups

ligation

was restricted

to

examined

by

direct

plasmid

sequencing

(Wallace

one

This

complementary

strand

resulted

at

the

oligonucleotide-vector

junction.

in termini

carrying

oligonucleotides

single-stranded

permit

which

and

recir-

et al.,

of generating

diately

198 la) using

flanking

an oligonucleotide

ClaI

data

from

primer

region

capable

imme-

sequence

the

the

site of plasmid

pBR322.

cularisation

of the vector

in vivo (for a discussion

of

All clones

examined

were

found

to have

incorpo-

this

strategy

see Lathe

et al.,

1983a).

Following

an

rated

only

a

section

of

the

complete

polylinker

 

the duplex,

excess

oligo-

duplex.

We have

no clear

explanation

for this result.

80’ C heat nucleotides

step to dissociate were removed

by precipitation

with sper-

Nevertheless,

two

plasmids

(clones

3

and

7)

had

mine

(Hoopes

and

McClure,

1981) in the

presence

incorporated

segments

of the

polylinker

duplex

sui-

of 30%

DMSO.

After rehybridisation

of the oligonu-

table

for reconstruction

of the complete

segment by

cleotide-tailed

extremities

to permit

recircularisation,

conventional

restriction

and

religation.

 

this

material

was

transformed

into

E. co/i

8759

(Murray

et al.,

1977)

and

ampicillin-resistant

colo-

(c) Construction

of ptg130 by recombining

polylinker

nies

were

 

segments

A total

selected. of 150 colonies

were

screened

by a modil’i-

cation

of the procedure

of Wallace

et al.

Clone

3 contains

the

right

hand

(SstI,

EcoRV,

sequences

hybridising

to

the

“*P-labelled

(198 1b) for oligonu-

Sph I, KpnI,

X6a1, HindIII)

segment

of the

synthetic

M13tg130

-

---

95

fMetThrMetIleThrAsnSerArgGluSerSerIleSerHisAlaValProLeuGluGluAlaTrpA~pPr~CysThrCysSerAsnSerLeu

ATGACCATGATTACGAATTCCCGGGAGAGCTCGATATCGCATGCGGTA&CTCTAGAAGAAGCTT~GGATCCGTCGAC~TG~AGCAATTCACTG

TACTGGTACTAATGCTTAAGGGCCCTCTCTCGAGCGTACGCCATGGAGATCTTCTTCGAACC~TAGGCAG~TGGACGTCGTTAAGTGAC

*****I*

*ux**I

******

******

xx****

******

******

 

*****x

*****a

******

******

EcoRI

SmaI

SstI

EcoRV

SphI

KpnI

Xbal

Hind111 BemHI Sal1 AccI

PstI

M13tg131

----

Hind11

fMetThrMetIleThrGlnIleCysArgSerThrAspProLy~LeuLeuLeuGluValProHisAlaIleSerSerSerProGlyAsnSerLeu

ATGACCATGATTACGCAGATCTGCAGGTCGACGGATCCCAAGCTTCTTCTAGAGGTACCGCATGCGA~ATCGAGCTCTCCCGGGAATTCACTG

TACTGGTACTAATGCGTCTAGACGTCCAGCTGCCTAGGGTTCGAAGAAGATCTCCATGGCGTACGCTATAGCTGCAGAGGGCC~TTAAGTGAC

******

I%%c*XV

*****x

x*x***

****I*

83111 PstI Sal1 BamHI Hind111

Hind11

AccI

******

XbaI

******

KpnI

******

****I*

******

SphI ECORV SstI

******

***x*x

SmaI EcoRI

Fig.3. Nucleotide sequences of M13tgl30 and M 13tg131 in the N-terminal section of the lucZ gene. In both the reading frame of the 1ucZ gene is conserved. Restriction recognition sequences are indicated.

conserved. Restriction recognition sequences are indicated. block, whereas clone 7 carries the left-hand (EcoRI, SmaI,

block, whereas clone 7 carries the left-hand (EcoRI, SmaI, Ss61, EcoRV) section (not shown). The two segments were therefore combined through their SstI

sites, taking advantage of an outside Pst I site present

two

plasmids were cleaved to completion with PstI and Sst I and ligated in equimolar propo~ions. Three out of twelve Ap’ transformants contained plasmids sensitive to cleavage with both SmaI and XbaI, and sequence analysis revealed that these plasmids carried the complete synthetic block (ptgl30).

in the Ap’ gene of the plasmid vector. The

(d) Construction of bacteriophage M13tg130

Bacteriophage M13tg109 (Lathe et al., 1983b) contains the following series of restriction sites at the N-terminus of the IacZ gene: EcoRI-BarnHI- -~~~dIII-~~rnHI-~a~I-P~t I (see Fig. 1). The poly- linker segment present in ptgl30 comprises a total of six additional restriction recognition sequences flanked by EcoRI and Hind111 sites. We therefore inserted the EcoRI-Hind111 section from ptgl30 between the EcoRI and Hind111 sites of Ml3t8109 to create the complete polylinker segment. This exchange deletes the first BamHI site present in Ml3tg109, the second site becoming unique. Double-stranded DNAs from M13tg109 and ptgl30

were digested to completion with EcoRI and Hind111 and ligated together prior to transfection of M 13 host strain JM103 (Messing et al., 1981). Lac’ plaques were picked from a background of parental M13tg109 lac- plaques and subjected to dideoxy sequencing (Sanger et al., 1977) using a commercially available primer 5’-dT~A~GACG~GT-3’ or a second primer 5’-dAGTCACGACGTTGTA-3’ synthesised in this laboratory. Ten out of ten bac- teriophages presented the correct nucleotide se- quence (Fig. 3) and one such isolate, M13tg130, was retained.

(e) Construction of a vector permitting inversion of inserted DNA fragments

The rapid sequencing protocols described by Sanger et al. (1980) and Messing et al. (1981) generate sequence data from one end of a particular inserted DNA fragment. Only if the fragment is flanked by identical termini can the orientation of the insert be easily reversed. Although it is possible in some cases to obtain sequence data directly from the other extremity of an inserted fragment (Hong, 1981), the required manipulations are technically complex. It was therefore of interest to construct a vector

M

13tg 13 1, in which

the array

of cloning

sites

is in the

where

ATG

codes

for the

N-terminal

methioninc

of

opposite

orientation

to

that

in

M13tg130.

Since

fl-galactosidase

and

E, B, S,

and

Pare

the recognition

reversal

of the orientation

of an inserted

DNA

frag-

sequences

for

EroRI,

BN/~~HI, S~rl1 (AccI.

NirrdII)

ment

from

means

(M13tg131)

without

end

ultimately

both

an

for

involves

we

mixing

material

to

reversed

derived

have

a

vector

vectors,

felt

it necessary

the

discriminating

from

its

to nucleic

BglII

complement

acid

(M13tg130)

To this

was

recourse

additional

sequencing.

recognition

sequence

and Y.cfI respectively.

personal

been

recognition

adjacent

sequence

In M 13mp701

now

EcoRI

site

of structure

(Bentley.

repcat

D.K

has

coIn~llun~c~~ti~~n) the

to generate

distal

second

deleted

ATG-EBSP

abuts

where

the Ps? I

formerly

1).

(the

sequences

(see

ATG

Fig.

to the

To generate

a vector

- PSBE

introduced

into

the cloning

region

of M 13tgllO

as

a

opposite

orientation

to

that

of

M 13mp701)

WG

first

step

towards

the

construction

of M13tg131.

positioned

a PsrI

recognition

sequence

close

to the

In

the construction

of vector

phage

M 13mp7,

aBgfII

site originally

occupied

by the proximal EcoRI recog-

recognition

sequence

was acquired

at the Ace1 site

of

nition

sequence

of M 13mp7

by fusing

the distal

Pst I

M

13 (see

Messing

et al.,

198 1). The

presence

of this

site

of

M 13mp701

with

the

proximal

BglII

site

BglII

site

prohibits

the

insertion

of

a

second

site

present

in

M 13tgl15.

Double-stranded

replicative

BglII

by the

addition

of linker

oligonucleotides,

for

form

DNA

M 13tg 115 was cleaved

with Pst I, partial-

the required

cleavage

with BglII

after linker addition

ly

digested

with

BglII.

and

religated

in the presence

would

result

in cleavage

at the

outside

site.

Linker

of

B&II-PstI

adaptor

oligonucleotide

5’-dGA-

oligotlucleotides

groups

were

used

lacking

to limit

5’-terminal

ligation

to only

phosphate

one

strand

TCTGCA-3’

and

Bg/II

(Lathe

sites

and

et al.,

1982).

regenerate

to

both

fuse

the

P.FII

recognition

at

each

linker-vector

junction

(linker

tailing).

This

sequences.

Eleven

out

of

twelve

Lac

plaques

results

in termini

carrying

single-stranded

and

com-

emerging

after

transfection

presented

the

desired

plementary

oligonucleotides

which permit

recirculari-

nucleotide

sequence

(M 13tgl19;

see

Fig.

1).

sation

in

vivo,

eliminating

the

necessity

for

subse-

In a subsequent

step

we linked

the

proximal

Pst I

quent

cleavage

by

the

cognate

restriction

enzyme

site deriving

from

M 13tg 119 to the distal

EcoRI

site

(Lathe,

R., Kieny,

M.P.,

Skory,

S. and

Lecocq,

J.P.,

from

M 13mp7 through

the array

of restriction

recog-

in

preparation).

 

nition

sequences

present

in M 13mp70 1. Replicative

 

Bacteriophage

M 13tgl10

is a derivative

of vector

 

form

DNA

from

M13tg119

was

cleaved

with

PstI

M13mp701

(Bentley,

D.R.,

personal

communica-

and

additionally

at the unique

external

Bg/I site and

tion)

in which

the

Sal1

site has

been

replaced

by

a

dephosphorylated

using

calf intestinal

phosphatase.

 

Hind111

site.

This

replacement

disrupts

the

lacZ

M

13mp70 1 and

M 13mp7

were cleaved

with

Pst I

+

reading

frame

to give

a

luc -

vector.

M 13tgllO

was

EcoRI

and EcoRI

+ BglI

respectively.

After ligation

chosen

since

the

construction

will

reconstitute

the

and

transfection

into

E.

cd,

four out of luc + phages

reading

frame

to generate

a lac + phage.

The

nucleo-

yielded

the correct

restriction

profile

and ofthese

two

tide

sequence

at the

beginning

of the

I&Z

gene

is

had the desired

nucleotide

sequence

(M 13tg120;

see

presented

in Fig.

1.

 

Fig.

1).

Replicative

form

DNA

from

M 13tg 110 was cleav-

 

ed

with

EcoRI,

the

single-stranded

protrusions

re-

(f)

Construction

of

the

complementary

vector:

moved

by treatment

with

S 1 nuclease,

and

the flush

M13tg.131

 

termini

ligated

overnight

with

an

excess

of

non-

 

phosphorylated

linker

oligonucleotides

This

final

construction

involved

the

insertion

of

GATCTG-3’.

Following

precipitation

5 -dCA- with spermine

the

complete

polylinker

segment

M13tg120.

of M 13tg130

into

and

reannealing

the

linker-tailed

vector

was trans-

the intermediate

vector

Replicative

form

fected

into

E.

coli, and

15 out of 24 luc + phages

were

DNAs

of

M13tg130

and

M13tg120

were

cleaved

found

to

have

incorporated

a

BglII

recognition

 

with

Pst I

and

EcoRI,

ligated,

and

transfected

into

sequence

at the

EcoRI

site

(M13tg11.5;

see Fig.

I).

JM 103. About

30”/,

of lac + phages

examined

pres-

In

vector

phage

M13mp7

(Messing

et al.,

198 I)

ented

the

desired

sequence

(M 13tg 13 1;

see

Fig. 3).

the arrangement

of sites in the N-terminal

section

of

The various

manipulations

performed

upon

the mul-

the

iucZ

gene

is,

schematically,

ATG-EBSPSBE,

tiple restriction

site

segment

to generate

M13tg130

91

91 f 3 CHEMICAL 6 Fig. 4. Schematic summary of the construction of M13tg130 and M13tg131.
91 f 3 CHEMICAL 6 Fig. 4. Schematic summary of the construction of M13tg130 and M13tg131.
91 f 3 CHEMICAL 6 Fig. 4. Schematic summary of the construction of M13tg130 and M13tg131.
91 f 3 CHEMICAL 6 Fig. 4. Schematic summary of the construction of M13tg130 and M13tg131.

f

3

CHEMICAL

91 f 3 CHEMICAL 6 Fig. 4. Schematic summary of the construction of M13tg130 and M13tg131.
91 f 3 CHEMICAL 6 Fig. 4. Schematic summary of the construction of M13tg130 and M13tg131.

6

91 f 3 CHEMICAL 6 Fig. 4. Schematic summary of the construction of M13tg130 and M13tg131.
91 f 3 CHEMICAL 6 Fig. 4. Schematic summary of the construction of M13tg130 and M13tg131.
91 f 3 CHEMICAL 6 Fig. 4. Schematic summary of the construction of M13tg130 and M13tg131.
91 f 3 CHEMICAL 6 Fig. 4. Schematic summary of the construction of M13tg130 and M13tg131.
91 f 3 CHEMICAL 6 Fig. 4. Schematic summary of the construction of M13tg130 and M13tg131.
91 f 3 CHEMICAL 6 Fig. 4. Schematic summary of the construction of M13tg130 and M13tg131.
91 f 3 CHEMICAL 6 Fig. 4. Schematic summary of the construction of M13tg130 and M13tg131.
91 f 3 CHEMICAL 6 Fig. 4. Schematic summary of the construction of M13tg130 and M13tg131.

Fig. 4. Schematic summary of the construction of M13tg130 and M13tg131. Only the multiple restriction site (“polylinker”) segments are presented. Restriction sites which are unique in each bacteriophage are presented above the line; sites occurring more than once are below the line. The various steps in the construction were: (1) Deletion of the second EcoRI-P&I repeat in M13mp7 to generate M13mp701 (Bentley, D.R., personal comm~ication); (2) insertion of H&d111 linker oligonucleotides at the BumHI or Sal1 sites of M13mp701 to generate Ml3tg109 and M13tgllO (Lathe et al., 1983b); (3) insertion of a EglII linker into the EcoRI site of MlkgllO

to generate M13tgl15; (4) fusion of the Bg/II and PsrI sites of M13tgl15 using an adaptor oligonucleotide such as to regenerate both

recognition

M13tg120; (6)

insertion of the synthetic polyli~er segment from ptgi30 between the EcoRI and Hind111sites of M13tglO9 to generate M13tg130; (7) insertion of the complete polylinker segment from M13tg130 between the EcoRI and &I sites of Ml3tg120, reversing the orientation of the segment to generate M13tg131.

sequences;

(5) insertion

of the polylinker segment from M13mp701 in the reversed

orientation

to generate

98

and

of

M13tg13

M13tg130

1 are outlined

and

in Fig. 4. A detailed

in

map

M13tg130 1 are outlined and in Fig. 4. A detailed in map (g) A new pair

(g) A new pair of versatile

and M13tg131

Ml3

vectors;

M13tg130

131 is presented

Fig.

5.

To extend

the range

and versatility

of M 13 vectors,

we have

constructed

a new

pair

of bacteriophages,

 

M13tg130

and

M13tg131,

which

comprise

a total

of

eleven

unique

restriction

sites. As with other

vectors,

 

insertion

of

exogenous

DNA

fragments

 

into

the

polylinker

region

may be detected

by the abolition

 

of

coloration

with

X-gal.

These

vectors,

deriving from

 

the parental

bacteriophage

M 13mp7 (Messing

et al.,

1981),

lack

extraneous

DNA

and

give

reliable

 

se-

quence

data

with

all primers

tested

*. In our

design

 

of

the

vectors

we

attempted

to remove

all possible

secondary

structure

generated

by

the

polylinker

Fig.5.

Map

of

M13tg130

and

M13tg131.

Numerbering

of

region,

and

this is evidenced

by the uniformity

of the

nucleotides

and

Ml3

structural

genes

is

according

to

Van

gel patterns

obtained

(not

shown).

 

Wezenbeek

et al. (1980).

Major

restriction

sites are indicated;

 

When

inverting

the

orientation

of

an

inserted

the

position

of each

site

is defined

by the

first

nucleotide

 

of the

DNA

fragment

by

transfer

between

vectors,

it

is

recognition

sequence.

Coordinates

for

the

polylinker

segment

useful

to have

a means

of distinguishing

the parental

correspond

to theEcoR1

sites ofM13tg130(6231)and

M13tg131

from

the

inversion

vector.

A

final

modification

(6300).

segment

on’: origin

of Ml 3 replication.

of the

luc repressor

gene.

lack’ : inactive C-terminal

IacZ ’ : N-terminal

section

of

involved

the inclusion

of a restriction

recognition

site

the

fl-galactosidase

gene

coding

for

a peptide

active

in

alpha

(BglII)

in

the

polylinker

region

of

one

of the

two

complementation;

the promoter

forlutZ’

transcription

is located

bacteriophages

(M13tg131),

to

permit

the

rapid

between

the

lucl’

and

IucZ’

genes.

 

discrimination

between

the

two

vectors

 

by

direct

 

restriction

analysis

of their

replicative

form

DNAs.

 

In

the

accompanying

paper,

Norrander

et al.

*

We

have

routinely

observed

that

certain

vector-primer

combi-

 

nations

cannot

be used

to generate

sequence

data

by the dideoxy

(1983)

describe

the preparation

 

of two

new

vectors,

technique.

For

instance,

under

standard

conditions.

we

have

M13mp18

and

19,

with

characteristics

broadly

been

unable

to

use

the

commercially-available

primers

S’-

similar

to the

vectors

described

here.

dTCACGACGTTGT-3’,

5’.dTCCCAGTCACGACGT-3’

and

 

5’.dCCCAGTCACGACGTT-3’

to

sequence

material

inserted

 

into the polylinker

region

ofbacteriophage

M13mp9,

whereas

the

same

primers

can

be used

to success

with

M13mp8

(Findeli,

A.,

ACKNOWLEDGEMENTS

Kieny,

M.P.

and

Lathe,

R., unpublished

data). Similar incompa-

We thank

D.R.

Bentley

(Sir William

Dunn

School

of

Pathology,

University

of

Oxford)

for

vector

M

13mp70 1. We

gratefully

acknowledge

technical

assistance

from A. Findeli,

D. Schmitt,

S. Skory

and

D. Villeval,

and

thank

I. Batra for help in preparing

the text.

We are particularly

V. Kohli

(Department

indebted to A. Balland

and

of Chemistry, Transg&ne

S.A.)

for their

synthesis

oligonucleotides

of the long We thank

described

P. Chambon

in this

paper. for their continued

P. Kourilsky

and

in this work

interest

and

manuscript.

M. Gottesman

for

critical

comments

on

the

tability

has

been

observed

with

our

own

primer

5’-dAGCTAC-

GACGTTGTA-3’.

 

In

contrast,

the

longer

primer

5’-

dGATCCGGACGTTGTAAAACGACGGCCAGTG-3’

 

(also

available

commercially)

and a downstream

primer

5’-dAAGGC-

GATTAAGTTG-3’

 

prepared

in

this

laboratory

give

reliable

sequence

data

with

both

bacteriophages.

 

We

have

used

the

downstream

primer

to demonstrate

that

the

phenomenon

is not

due

to

mutation

in

the

primer-complementary

region

of

M13mp9.

We

cannot

exclude

the

possibility

that

this

effect

is

linked

to the

370-bp

Htr~Il

fragment

of pBR322

DNA

present,

in M 13mp9

but not

in M 13mp8,

at the Narl

site of the lcrcl gene

segment

(see addendum

in Messing

and

Vieira,

1982). M13tg130

and

131

have

been

examined

for

their

compatibility

with

the

various

primers,

and

all

tested

were

found

to

give

reliable

sequence

data.

REFERENCES

Bolivar, F., Rodriguez, R.L., Greene, P.J., Betlach, M.C., Heynecker, H.L., Boyer, H.W., Crosa, J.H. and Falkow, S.:

Construction and characterization of new cloning vehicles, II. A multipurpose cloning system. Gene 2 (1977) 95-113. Chandler, P.M.: The use of single-stranded phage DNAs in hybrid arrest and release translation. Analyt. Biochem. 127 (1982) 9-16. Everett, R. and Chambon, P.: A rapid and efficient method for region and strand-specific mutagenesis of cloned DNA. EMBO J. (1982) 433-437. Fritz, H.J., Belagaje, R., Brown, E.L., Fritz, R.H., Jones, R.A., Lees, R.G. and Khorana, H.G.: High pressure liquid chroma- tography in polynucleotide synthesis. Biochemistry 17 (1978)

1257-1267.

Gait, M.J. and Sheppard, R.C.: Rapid synthesis of oligodeoxynu- cleotides: a new solid phase method. NucL Acids Res. 4 (1977) 1135-1158. Hong, G.F.: A method for sequencing single-stranded cloned DNA in both directions. Biosci. Rep. 1 (1981) 243-252. Hoopes, B.C. and McClure, R.R.: Studies on the selectivity of DNA precipitation by spermine. Nucl. Acids Res. 9 (1981)

5493-5504.

Hu, N.T. and Messing, J.: The making of strand-specific Ml3 probes. Gene 17 (1982) 271-277. Kohli, V., Balland, A., Wintzerith, M., Sauerwald, R., Staub, A. and Lecocq, J.P.: Silica gel: An improved support for the solid-phase synthesis of oligonucleotides. Nucl. Acids Res. 10 (1982) 7439-7448. Lathe, R., Balland, A., Kohli, V. and Lecocq, J.P.: Fusion of restriction termini using synthetic adaptor oligonucleotides. Gene 20 (1982) 187-195. Lathe, R., Lecocq, J.P. and Everett, R.: DNA engineering: the use ofenzymes, chemicals and oligonucleotides to restructure DNA sequences in vitro, in Williamson, R. (Ed.), Genetic Engineering, Academic Press, London, 1983a, pp. l-56. Lathe, R., Kieny, M.P., Schmitt, D., Curtis, P. and Lecocq, J.P.:

Ml3 bacteriophage vectors for the expression of foreign proteins in E. coli: The rabies glycoprotein. J. Mol. Appl. Genet. (1983b) in press. Messing, J., Gronenborn, B., Mtiller-Hill, B. and Hofschneider, P.H.: Filamentous coliphage Ml3 as a cloning vehicle:

Insertion of a Hind11 fragment of the luc regulatory region in Ml3 replicative form in vitro. Proc. Natl. Acad. Sci. USA 74 (1977) 3642-3646.

99

Messing, J., Crea, R. and Seeburg, P.H.: A system for shotgun sequencing. Nucl. Acids Res. 9 (1981) 309-321.

Messing, J. and Vieira, J.: A new pair of M 13vectors for selecting either double-digest restriction fragments. Gene 19 (1982)

269-276.

Murray, N.E., Brammar, W.J. and Murray, K.: Lambdoid phages that simplify the recovery of in vitro recombinants. Mol. Gen. Genet. 150 (1977) 53-61. Narang, S.A., Brousseau, R., Hsiung, H.M. and Michniewicz, J.J.: Chemical synthesis of deoxyoligonucleotides by the modified triester method. Methods Enzymol. 65 (1980)

610-620.

Norrander,

proved M 13vectors using oligonucleotide-directed mutagen- esis. Gene 26 (1983) 101-106. Sanger, F., Nicklen, S. and Coulson, A.R.: DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74 (1977) 5463-5467. Sanger, F., Cot&on, A.R., Barre& B.G., Smith, A.J.H. and Roe, B.A.: Cloning in single-stranded bacteriophage as an aid to rapid DNA sequencing. J. Mol. Biol. 143 (1980) 161-178. Smith, M. and Gillam, S.: Constructed mutants using synthetic oligodeoxyribonucleotides as site-specific mutagens, in Set- low, J.K. and Hollaender, A. (Eds.), Genetic Engineering; Principles and Methods, Vol. 3, Plenum, New York, 1981, pp. I-32. Van Wezenbeek, P.M.G.F., Hulsebos, T.J.M. and Schoen- makers, J.G.G.: Nucleotide sequence of the tilamentous bac- teriophage Ml3 DNA genome: Comparison with phage fd. Gene I I (1980) 129-148. Wallace, R.B., Johnson, M.J., Suggs, S.V., Miyoshi, K.-i., Bhatt, R. and Itakura, K.: A set of synthetic ohgodeoxyribonucleo- tide primers for DNA sequencing in the plasmid vector pBR322. Gene 16 (1981a) 21-26. Wallace, R.B., Schold, M., Johnson, M.J., Dembek, P. and Itakura, K.: Oligonucleotide directed mutagenesis of the human /?-globin gene: a general method for producing specific point mutations in cloned DNA. Nucl. Acids Res. 9 (1981b) 3647-3656. Weiher, H. and Schaller, H.: Segment-specific mutagenesis:

J., Kempe, T. and Messing, J.: Construction

of im-

Extensive mutagenesis of a lac promoter/operator element. Proc. Natl. Acad. Sci. USA 79 (1982) 1408-1412.

Communicated

by Z. HradeEnC.