You are on page 1of 306

Qumica Biolgica para

las Ciencias Mdicas

Alfredo Rigalli
Mara Eugenia Chulibert
Alejo Ferrer

Laboratorio de Biologa sea


Facultad de Ciencias Mdicas
Universidad Nacional de Rosario
2017
Rigalli, Alfredo
Qumica biolgica para las ciencias mdicas : textos & vdeos / Alfredo
Rigalli ; Mara Eugenia Chulibert ; Alejo Ferrer ; editado por Alfredo
Rigalli. - 1a edicin para el alumno - Rosario : Alfredo Rigalli, 2017.
Libro digital, PDF

Archivo Digital: descarga


ISBN 978-987-42-4085-9

1. Bioqumica. I. Chulibert, Mara Eugenia II. Ferrer, Alejo III. Rigalli,


Alfredo, ed. IV. Ttulo.
CDD 540

ISBN
978-987-42-4085-9
LOS AUTORES

Alfredo Rigalli
Bioqumico y Doctor en Bioqumica. Director del Laboratorio
de Biologa sea, director del Doctorado en Ciencias
Biomdicas y docente de Qumica Biolgica en la Facultad de
Medicina de la UNR. Editor regional de Journal Fluoride para
Amrica Latina y miembro de la International Society for
Fluoride Research. rea de Investigacin: efectos biolgicos y
ambientales del fluoruro.

Alejo Ferrer.
Estudiante de Medicina, Facultad de Ciencias Mdicas de la
Universidad Nacional de Rosario. Becario del Laboratorio de
Biologa sea. Docente del curso capacitacin en el uso de
bases de datos para el estudio de la ciencias Biomdicas. rea
de investigacin: separacin y efectos de las protenas de la
leche tratada con Kfir.

Mara Eugenia Chulibert


Licenciada en Nutricin, egresada de la Facultad de Qumica,
Universidad del Centro Educativo Latinoamericano. Miembro
del Laboratorio de Biologa sea, Facultad de Ciencias
Mdicas, Universidad Nacional de Rosario. Tema de
investigacin: desarrollo de una bebida probitica enriquecida
en calcio.
PRLOGO

Se habla de la "revolucin del saber" de la "era del conocimiento" y no es para menos: la cantidad
de informacin que surgi durante el siglo XX ha sido abrumadora. A diario nuevos compuestos
son descubiertos o nuevas propiedades de viejos compuestos son anunciadas. Resulta imposible en
la poca que corre conocer todos los rincones qumicos del saber. Este crecimiento explosivo de la
Qumica ha sido acompaado por el mejoramiento de los medios para acceder a la informacin,
sin embargo nuestra capacidad de asimilar estos conocimientos no ha crecido. Aunque las teoras
del aprendizaje han hecho y hacen esfuerzos por mejorar el rendimiento de las tareas de enseanza
y aprendizaje, la batalla que libran es desigual y quedamos los seres humanos agobiados frente a
tanta informacin. An el profesor de qumica queda asombrado frente a compuestos que ni en su
imaginacin hubiesen tenido existencia.
El problema que hoy se nos plantea no es buscar la informacin ni encontrarla, ya que las
herramientas provistas por la era digital han facilitado su hallazgo . El conflicto real surge cuando
tenemos que decidir qu parte de la Qumica necesitamos para fundamentar otras reas como
pueden ser la Biologa o la Farmacologa.
Corra el ao 1994, cuando el Prof. Augusto Raynald me invit a formar la ctedra de Qumica
Biolgica del Centro de Estudios Superiores. Fue entonces que escrib el primer libro de Qumica
en bsqueda de solucin para reas especficas: Qumica Biolgica. Nivel Terciario. Por el ao
2003, escrib el libro Qumica Biolgica. Fundamentos y Conceptos, un libro con mayor cantidad
de temas orientado a las ciencias biomdicas, llenando un vaco entre los libros de nivel medio y los
libros de buena profundidad para nivel universitario.
El avance la tecnologa ha determinado que este libro, que es la continuacin de la serie
mencionada sume al desarrollo de los temas en textos, con ejercicios resueltos y/o con respuesta
para que el alumno pueda verificar sus conocimientos, una oferta de ejercicios on-line y desarrollo
de cada tema en vdeos.
El libro ha sumado adems dos autores, discpulos y colaboradores incansables en el laboratorio y la
docencia.
Tabla de contenidos
1.ESTADOS DE AGREGACIN DE LA MATERIA.........................................................................1
1.1.Introduccin...............................................................................................................................1
1.2.Propiedades de la materia..........................................................................................................3
1.3.Estados de agregacin de la materia..........................................................................................3
1.4.Cambios de estado..................................................................................................................... 4
1.5.Estudio de la qumica.................................................................................................................5
1.6.Prctica.......................................................................................................................................6
2.COMPUESTOS INORGNICOS.................................................................................................... 8
2.1.xidos bsicos.........................................................................................................................10
2.2.Oxidos cidos...........................................................................................................................11
2.3.Hidrxidos................................................................................................................................11
2.4.Hidrcidos................................................................................................................................12
2.5.Oxocidos................................................................................................................................ 12
2.6.Radicales cidos.......................................................................................................................13
2.7.Sales.........................................................................................................................................15
2.8.Hidratos....................................................................................................................................17
2.9.Perxidos................................................................................................................................. 17
2.10.Superxidos........................................................................................................................... 17
2.11.Prctica...................................................................................................................................18
3.SISTEMAS MATERIALES............................................................................................................23
3.1.Sistema material.......................................................................................................................23
3.2.Fraccionamiento de soluciones................................................................................................32
3.3.Solubilidad...............................................................................................................................32
3.4.Soluciones diluidas y concentradas......................................................................................... 33
3.5.Otros trminos aplicables a soluciones....................................................................................34
3.6.Soluciones con mezcla de solutos............................................................................................34
3.7.Propiedades coligativas de soluciones.....................................................................................35
3.8.Prctica.....................................................................................................................................36
4.REACCIONES QUMICAS........................................................................................................... 43
4.1.Reacciones qumicas................................................................................................................43
4.2.Ecuaciones moleculares, inicas e inicas netas..................................................................... 43
4.3.Prctica.....................................................................................................................................44
5.ESTEQUIOMETRA...................................................................................................................... 46
5.1.Cantidad de sustancia...............................................................................................................46
5.2.Reacciones qumicas y relaciones estequiomtricas................................................................47
5.3.Principios bsicos de la estequiometra...................................................................................48
5.4.Estequiometra......................................................................................................................... 49
5.5.Prctica.....................................................................................................................................53
5.6.................................................................................................................................................. 53
6.EQUILIBRIO QUMICO................................................................................................................60
6.1.Velocidad de reaccin.............................................................................................................. 63
6.2.Reacciones reversibles.............................................................................................................64
6.3.Velocidades de reaccin directa e inversa................................................................................65
6.4.Ley de accin de masas........................................................................................................... 66
6.5.Equilibrio qumico...................................................................................................................67
6.6.Constante de equilibrio............................................................................................................ 68
6.7.Usos de Ke...............................................................................................................................70
6.8.Prediccin del estado de una reaccin.....................................................................................72
6.9.Prediccin de la evolucin de una reaccin al sacarla del equilibrio...................................... 74
6.10.Principio de Le Chatelier....................................................................................................... 75
6.11.Energa asociada a una reaccin qumica.............................................................................. 75
6.12.Reacciones en equilibrio y en estado estacionario.................................................................76
6.13.Equilibrio Acido-Base............................................................................................................76
6.14.cidos y bases....................................................................................................................... 80
6.15.Buffers fisiolgicos................................................................................................................96
6.16.Prctica.................................................................................................................................105
7.ESTRUCTURA ATMICA.......................................................................................................... 110
7.2.Relaciones entre tomos........................................................................................................ 113
7.3.Distribucin electrnica.........................................................................................................114
7.4.Ubicacin de los elementos en la tabla peridica.................................................................. 116
7.5.Propiedades peridicas...........................................................................................................118
7.6.Enlace qumico...................................................................................................................... 122
7.7.Prctica...................................................................................................................................126
Ejercitacin sobre estructura atmica en el siguiente link...........................................................126
Sus respuestas.............................................................................................................................. 126
..................................................................................................................................................... 126
8.QUMICA ORGNICA................................................................................................................129
8.1.Grupos funcionales................................................................................................................ 129
8.2.Hidrocarburos........................................................................................................................ 130
8.3.Compuestos aromticos......................................................................................................... 135
8.4.Grupos funcionales................................................................................................................ 135
8.5.Isomera................................................................................................................................. 145
9.TERMODINMICA.....................................................................................................................155
9.1.Tipos de sistemas...................................................................................................................155
9.2.Termodinmica en los seres vivos......................................................................................... 160
10.COMPLEJIDAD DE LOS ORGANISMOS VIVOS..................................................................162
10.1.Complejidad de los organismos vivos................................................................................. 162
11.ENZIMAS....................................................................................................................................165
11.2.Nomenclatura de enzimas....................................................................................................168
11.3.Enzimas en la clnica........................................................................................................... 172
11.4.Prctica.................................................................................................................................172
12.HIDRATOS DE CARBONO.......................................................................................................179
12.1.Estructura de hidratos de carbono........................................................................................179
12.2.Metabolismo de glcidos.....................................................................................................187
12.3.Prctica.................................................................................................................................194
13.LPIDOS......................................................................................................................................210
13.1.Estructura de lpidos............................................................................................................ 210
13.2.Clasificacin de los lpidos..................................................................................................210
13.3.Metabolismo de lpidos .......................................................................................................219
13.4.Membranas biolgicas......................................................................................................... 225
13.5.Prctica.................................................................................................................................227
14.AMINOCIDOS Y PROTENAS..............................................................................................234
14.1.Estructura de aminocidos...................................................................................................234
14.2.Metabolismo de aminocidos.............................................................................................. 244
14.3.Digestin y absorcin de protena....................................................................................... 247
14.4.Prctica.................................................................................................................................248
15.CIDOS NUCLEICOS...............................................................................................................257
15.1.Estructura de nucletidos.....................................................................................................257
15.2.estructura del ADN.............................................................................................................. 261
15.3.Prctica.................................................................................................................................266
16.SISTEMA ENDOCRINO............................................................................................................269
16.1.Hormonas liberadoras hipotalmicas ..................................................................................269
16.2.Hormonas de la neurohipfisis............................................................................................ 270
16.3.Hormonas tiroideas..............................................................................................................272
17.QUMICA DE LOS ESTEROIDES............................................................................................276
17.1.Hormonas esteroideas..........................................................................................................276
17.2.Acidos biliares..................................................................................................................... 278
18.PROCESOS BIOQUMICOS MULTIORGNICOS.................................................................281
18.1.Sntesis y degradacin del grupo Hemo.............................................................................. 281
19.BIOQUMICA DE SISTEMAS.................................................................................................. 284
19.1.Sistema inmunolgico..........................................................................................................284
19.2.Respuesta inmune................................................................................................................ 284
ESTADOS DE AGREGACIN DE LA MATERIA

1. ESTADOS DE AGREGACIN DE LA MATERIA

1.1. Introduccin

Si bien este curso tendr una complejidad elevada y orientada a la qumica biolgica, se comenzar de
conceptos muy bsicos pertenecientes a la qumica general y otras ramas de la qumica. El nimo de
este enfoque del curso es permitir el inicio, an, con escasos conocimientos de esta ciencia. Puede ver
este captulo en vdeo a travs del siguiente link: https://youtu.be/ke5FyWNzlwk
La qumica se define como la ciencia que estudia la materia y sus transformaciones.
La qumica puede clasificarse de muchas maneras, pero la ms comn es segn los objetos de estudio.
As podemos tener:
Qumica inorgnica: aquella que estudia los compuestos inorgnicos y sus transformaciones. Se
entiende por compuesto inorgnico aquel que no involucra cadenas carbonadas.
Qumica orgnica o del carbono: es aquella que estudia los compuestos en los que interviene el
carbono, especialmente cuando ste forma enlaces consigo mismo.
Qumica Biolgica o bioqumica: es aquella que estudia los compuestos que forman los organismos
vivos y las transformaciones que entre ellos ocurre, conocidas como metabolismo.
Pero por supuesto tenemos otras ramas como la inmunoqumica, histoqumica, etc. Cada una de ellas
tendr diferentes tipos de objetos de estudio, pero la base ser la misma. Por ejemplo la histoqumica,
estudia las sustancias relacionadas a estructuras tisulares, celulares y subcelulares, habitualmente
observables a nivel microscpico.

1.1.1. Materia

Es todo aquello que ocupa un lugar en el espacio, tiene peso e impresiona directa o indirectamente
nuestros sentidos. Es fcil comprender que una manzana es materia, la vemos y pesa. Pero otras cosas
tambin son materia, como el aire. Estamos hechos de materia y estamos inmersos en materia. sta
puede estar muy condensada como ocurre con un trozo de hierro o menos condensada como ocurre
con el aire, pero es materia.

1.1.2. Cuerpo

La materia se nos presenta fraccionada y cada una de estas fracciones las llamamos cuerpos. Podemos
decir que un cuerpo es una porcin limitada de materia. Por ejemplo, una moneda est formada por
materia y tiene lmites claros. Aun si no existen los lmites claros puede seguir siendo un cuerpo, como
ocurre con el agua que se adapta a la forma del recipiente que la contiene.
Los cuerpos tienen tres propiedades fundamentales, que por estar formados por materia podramos
considerar tambin que son las propiedades de la materia o de las sustancias:
1- inercia: todo cuerpo tiende a permanecer en reposo o movimiento si no hay una fuerza externa que
modifique dicho estado.
2- extensin: todo cuerpo tiene dimensiones, pudiendo ser muy pequeas como el caso de un ribosoma

1
ESTADOS DE AGREGACIN DE LA MATERIA

o muy grandes como podra ser un planeta.


3- impenetrabilidad. Un cuerpo no puede ocupar el lugar de otro.
Adems pueden tener otras propiedades que no son comunes a todos los cuerpos, como por ejemplo el
brillo, sabor agrio, etc.

1.1.3. Sustancia

Si comparamos dos bolitas (2 cuerpos), una de vidrio y otra de oro, vemos que difieren en sus
propiedades. Ambos cuerpos estn formados por materia, pero es evidente que son diferentes entre s.
En este caso son distintas calidades de materia las que componen ambas bolitas. Las diferentes
calidades con las que se presenta la materia representa diferentes sustancias. Es decir, que podemos
definir a las sustancias como las diferentes calidades de materia.
Veamos un ejemplo:
Un anillo de oro: es un cuerpo formado por materia, donde la materia tiene caractersticas especiales y
se llama oro. Es decir, el oro es un tipo de materia, diferente de otros tipos, pero materia al fin. Esto
significa que toda sustancia es materia y toda la materia se nos presentar como diferentes sustancias.
Supongamos que dispongo de dos bolitas de igual dimetro, una de oro y otra de aluminio. Podramos
decir que son cuerpos iguales, ambos formados por materia pero la sustancia que las constituye es
diferente, mientras en un caso es oro, en el otro es aluminio.
En un tipo de clasificacin podemos dividir a las sustancias como simples y compuestas.

Sustancia simple
Es aquella en la cual las molculas que la componen estn formadas por un slo tipo de tomos. Por
ejemplo, el oxgeno (O2) y el ozono (O3).

Sustancia compuesta
Es aquella que tiene molculas formadas por diferentes tipos de tomos. Por ejemplo el carbonato de
calcio: CaCO3.
Surgen de las definiciones anteriores dos conceptos: tomos y molculas.

Molcula
Es la menor porcin de la materia que conserva las propiedades de la sustancia a la cual pertenece. Las
molculas estn formadas por tomos. Puede haber molculas mono, di, tri y poliatmicas,
dependiendo si estn formadas por 1, 2, 3 o ms tomos. Por ejemplo, el bromo (Br 2), oxgeno (O2),
nitrgeno (N2) son molculas diatmicas formadas por un slo tipo de tomo. En cambio el cido
clorhdrico (HCl) es tambin una molcula diatmica, pero formada por tomos distintos.

tomo
Es la menor porcin de la materia que puede intervenir en una reaccin qumica, es decir, una
transformacin en la que una o ms sustancias pueden transformarse en una o ms sustancias distintas.

2
ESTADOS DE AGREGACIN DE LA MATERIA

1.2. Propiedades de la materia

La materia y, por ende, las sustancias tienen otras propiedades adems de las tres fundamentales
mencionadas anteriormente. Son propiedades de la materia: el brillo, la conductividad elctrica, la
ductilidad, la dureza, etc. Existen diferentes formas de clasificar a las propiedades.
En una clasificacin podemos dividir a las propiedades en extensivas e intensivas. Las propiedades
extensivas son aquellas que dependen del tamao del cuerpo, mientras que las intensivas son
independiente de las dimensiones del cuerpo en cuestin.
Ejemplo: el peso es una propiedad extensiva, cuanto ms grande es el cuerpo que consideramos, mayor
es su peso. Las dimensiones largo, ancho, alto, dimetro, radio, superficie y el volumen son ejemplos
sencillos de comprender propiedades extensivas. En cambio, el color no depende del tamao del
cuerpo, y, por lo tanto, el color es una propiedad intensiva. Otras propiedades como la conductividad,
el pH y la concentracin, tambin son intensivas, pero su significado puede ser en esta etapa del
aprendizaje dificultoso de comprender.
El cociente de dos propiedades extensivas da normalmente una propiedad intensiva, pero no es el nico
mecanismo de definir una propiedad intensiva. Por ejemplo, la densidad es una propiedad intensiva y
la misma se calcula conociendo la masa y el volumen de un cuerpo, que son dos propiedades
extensivas.

masa
densidad=
volumen
Ecuacin 1.1.
La concentracin de una solucin, tema que veremos ms adelante, tambin es una propiedad intensiva
y se define por el cociente de la cantidad de una sustancia que se halla en un dado volumen de una
solucin.

cantidad de soluto
concentracin=
volumen de solucin
Ecuacin 1.2.

1.3. Estados de agregacin de la materia

De la observacin del medio en que vivimos surge claramente que la materia se presenta de maneras
diferentes tanto en formas (cuerpos) como calidades (sustancias). Pero tambin surge de la observacin
que una misma sustancia la podemos tener con diferentes propiedades fsicas. La ms evidente es el
agua. Cuando colocamos un recipiente con agua en una freezer, es claro que las propiedades han
cambiado a lo largo del proceso. Cuando la colocamos poda volcarse del recipiente, pero luego de un
tiempo ya no puede ocurrir ms este proceso. Lo mismo ocurre si colocamos un recipiente con agua
sobre el fuego, veremos que se va reduciendo el volumen de agua y a la vez aparece el vapor de agua
sobre el recipiente. Estas diferentes formas que pueden presentarse de una dada sustancia se conocen
como estados de agregacin de la materia. Existen tres estados fundamentales de la materia: slido,
lquido y gaseoso. Que una sustancia exista en alguno de estos estados depende de las fuerzas de
atraccin y repulsin de las molculas que forman la materia.

3
ESTADOS DE AGREGACIN DE LA MATERIA

1.3.1. Estado slido

Este estado de agregacin presenta fuerzas de atraccin entre las molculas mayores que las de
repulsin, tiene volumen definido, forma propia, sus molculas se hallan en un ordenamiento regular,
su volumen se modifica poco por la presin (son poco compresibles), son muy poco fluidos, es decir,
que es muy difcil hacerlos pasar por orificios pequeos.

1.3.2. Estado lquido

El estado lquido presenta fuerzas de atraccin similares a las de repulsin, tiene volumen definido
pero no forma propia, sus molculas se hallan en estado de movimiento, su volumen se modifica poco
por la presin, son ms fluidos que los slidos y se amoldan al recipiente que los contiene.

1.3.3. Estado gaseoso

La materia en estado gaseoso presenta fuerzas de atraccin menores que las de repulsin, no tiene
volumen definido ni forma propia, sus molculas se hallan en estado de amplio movimiento y
desorden. Su volumen se modifica mucho al aplicar presin (son compresibles). Es el estado de
agregacin ms fluido.
El estado gaseoso puede presentarse en dos formas indistinguibles para nosotros: gas y vapor. En
principio consideraremos vapor y gas como la misma cosa, un estado de la materia caracterizado por
alta compresibilidad y posibilidad de fluir con facilidad.
Una sustancia puede encontrarse en cualquiera de los tres estados, dependiendo de las condiciones y
segn cambien estas condiciones, la sustancia puede cambiar de un estado a otro. El cambio de un
estado a otro es una modificacin de la sustancia en algunas de sus propiedades pero sin cambio de la
sustancia, por lo tanto el cambio de estado es una transformacin fsica y no qumica. Las
transformaciones qumicas representan cambios en la sustancia. Por ejemplo, si tenemos una hoja
(cuerpo) de papel (sustancia) que est compuesta por celulosa (sustancia compuesta) que la hago
reaccionar con oxgeno a travs de un proceso de combustin, se obtendr dixido de carbono y agua
como producto, desapareciendo el papel. Este es un fenmeno o transformacin qumica, uno de los
objetos de estudio de la qumica.

1.4. Cambios de estado

A continuacin se mencionan los cambios de estado que puede experimentar la materia:


Fusin es el paso de estado slido a lquido. Se produce a una temperatura definida, llamado punto o
temperatura de fusin. Por ejemplo, el agua funde a 0 C, pasando de hielo a agua lquida.
Solidificacin: es el pasaje de lquido a slido, se produce tambin a una temperatura definida,
conocida como punto de solidificacin o de congelacin para el caso particular del agua. El punto de
solidificacin coincide en valor numrico con el punto de fusin. Para el agua la solidificacin
(formacin de hielo) tiene lugar a 0 C.
Vaporizacin: es el pasaje de estado lquido a estado gaseoso. Se denomina evaporacin cuando se
produce a cualquier temperatura y slo se produce en la superficie del lquido. Por ejemplo, el agua se
evapora ya sea un da de 10 o de 35C. Se denomina ebullicin cuando el pasaje se produce en toda la
masa del lquido, comnmente cuando se produce este pasaje se dice que el lquido hierve. La

4
ESTADOS DE AGREGACIN DE LA MATERIA

ebullicin se produce a una temperatura definida, para el agua este pasaje se da a 100 C. La
temperatura a la cual se produce la ebullicin se conoce como temperatura o punto de ebullicin..
Condensacin: es cuando se produce el pasaje de estado gaseoso vapor a estado lquido. En cambio, se
llama licuefaccin al pasaje de estado gaseoso gas a lquido. Un gas es una sustancia que en estado
gaseoso, para pasar al estado lquido necesita disminucin de temperatura y habitualmente aumento de
presin. Por otra parte el vapor es la forma gaseosa que para pasar al estado lquido solo le alcanza con
un aumento de presin.
Volatilizacin: es el pasaje de estado slido a gaseoso directamente sin pasar por el estado lquido. No
es un cambio de estado comn, pero se puede observar, por ejemplo, en el caso de la naftalina que pasa
directamente de slido a vapor o cuando hervimos determinadas verduras que liberan cidos voltiles.
Sublimacin: es el pasaje de gas a slido sin pasar por el estado lquido. Es poco comn observar ste
cambio de estado en la vida cotidiana.

1.5. Estudio de la qumica

La qumica, como toda ciencia, tiene objetos de estudio y representaciones de esos objetos. Si bien
iremos profundizando sobre los mismos a lo largo del curso, en este sitio haremos una breve
introduccin para tener claridad de los trminos utilizados.
Recordemos la definicin de qumica: ciencia que estudia la materia y sus transformaciones. Veamos
una secuencia de conceptos.
La materia es todo lo que nos rodea y se presenta bajo diferentes calidades de las sustancias y, a su vez,
stas se presentan con formas o tamaos, llamados cuerpos.
Ejemplo:
Tengo una bolita (cuerpo) de aluminio (sustancia). Tambin podra tener una bolita (cuerpo) de
mrmol (sustancia). El aluminio y el mrmol son sustancias diferentes. El aluminio est formado slo
por tomos de aluminio (por lo que decimos que es una sustancia simple) mientras que el mrmol est
formado por molculas de carbonato de calcio (lo que le da la denominacin de sustancia compuesta).
Las sustancias sean simples o compuestas son objetos reales que encontrar en el medio ambiente, ya
sea en una mina, en un supermercado o al costado del camino. Cuando trabajemos con ellos usaremos
representaciones simblicas. Para los tomos utilizaremos smbolos y para las sustancias frmulas.

1.5.1. Smbolo

Un smbolo es una representacin grfica de un tomo. Por ejemplo, al aluminio lo representar por
smbolo Al. Los smbolos se escriben siempre con una o dos letras, siempre la primera en mayscula.
Ejemplo: O, N, F, Si, P, Se, S, Na. En general los smbolos se originan en palabras del latn como el
smbolo del sodio: Na se origina de la palabra Natrium, palabra del latn. Los smbolos de los
elementos los podemos hallar en la tabla peridica de los elementos.
La tabla peridica es una clasificacin de los elementos donde podemos hallar las principales
propiedades de cada elemento, sin embargo a esta altura de la civilizacin colocando sodio en
cualquier buscador, nos dirigimos a Wikipedia, donde hallaremos la informacin necesaria del
elemento; incluyen su historia, aplicaciones y hasta fotos de cuerpos formados por este elemento.

5
ESTADOS DE AGREGACIN DE LA MATERIA

1.5.2. Frmula

Una frmula es una representacin grfica de una sustancia formada por ms de un tomo. Por
ejemplo, al agua la representar por H2O. El agua es una sustancia compuesta porque est formada por
ms de un tipo de tomos: dos tomos de hidrgeno (H) y un tomo de oxgeno (O). Podemos tener
frmulas como O2, que representa el oxgeno que se halla en el aire y respiramos a lo largo de toda la
vida. Es una sustancia simple, ya que est formada por un mismo tipo de tomos. Si bien estudiaremos
formas sistemticas y razonadas de construir frmulas de compuestos, en internet podemos acceder a
ellas con las propiedades de la sustancia y todos los datos necesarios. Siempre Wikipedia es un buen
buscador, ya que est enlazado con otros sitios de prestigio y confiables. Existen por supuesto otras
bases de datos creadas por universidades o instituciones de renombre a nivel mundial que agrupan
compuestos por sus orgenes, aplicaciones, estructuras y funciones. As, podremos encontrar pginas
en las que hallamos compuestos predominantemente del metabolismo humano, de los seres vivos en
general, drogas, molculas transportadoras, enzimas, etc.

1.5.3. Elemento

Un elemento es cada uno de los tomos que podemos hallar en el universo. Son elementos: oxgeno
(O), nitrgeno (N), etc. Los elementos se representan con smbolos.

1.5.4. Reaccin qumica

Una reaccin qumica es un proceso por el cual una o ms sustancias dan una o ms sustancias
diferentes. Por ejemplo, si coloco oxgeno e hidrgeno en contacto, en ciertas condiciones ellos
reaccionarn y formarn agua. Llamamos reactivos al oxgeno y el hidrgeno y productos al agua. Los
reactivos son los que se consumen y productos los que se forman durante un proceso qumico. Cuando
estudiemos esta transformacin qumica utilizaremos representaciones grficas que se llaman
ecuaciones qumicas y que se escriben habitualmente como:
H2 + O2 = H2O
Puede utilizarse en lugar del signo = una flecha ()
Quedara entonces:
2H2 + O2 2H2O
Obviamente reactivos y productos de una ecuacin qumica se representan con smbolos o frmulas
dependiendo que sean elementos o sustancias (simples o compuestas). La ecuacin anterior es la
representacin simblica del proceso de formacin de agua y nos est indicando, por un lado, que una
de las formas de obtener agua es utilizando las sustancia simples oxgeno e hidrgeno y, por otro lado,
que para formar 2 molculas de agua necesitamos dos molculas de hidrgeno y una molcula de
oxgeno.

1.6. Prctica

Realice la ejercitacin del siguiente link:


https://docs.google.com/forms/d/e/1FAIpQLSc4O72BKyp7SORiMelVIYiXkHzgVEbuB0mSiSsvJbD

6
ESTADOS DE AGREGACIN DE LA MATERIA

8QpMJUg/viewform
Para ver las respuestas visite el siguiente link:
https://docs.google.com/forms/d/e/1FAIpQLSc4O72BKyp7SORiMelVIYiXkHzgVEbuB0mSiSsvJbD
8QpMJUg/viewform?entry.1065045187=por+los+%C3%A1tomos+y/o+mol
%C3%A9culas+que+la+componen&entry.1354824664=es+una+forma+convencional+de+representar
+a+un+%C3%A1tomo+o+elemento&entry.440725502=una+sustancia+s
%C3%B3lida+pasa+a+estado+l
%C3%ADquido&entry.1421512045=forman+los+cuerpos&entry.436028204=no+depende+de+la+for
ma+del+cuerpo+que+contiene+la+sustancia&entry.500227211=L%C3%B3pez,
+Mauro&entry.105263287=12123456

7
COMPUESTOS INORGNICOS

2. COMPUESTOS INORGNICOS

Como vimos anteriormente la materia se presenta con diferentes propiedades a las que llamamos
sustancias. Una sustancia puede ser simple o compuesta. Se dice que es simple cuando est formada
por un mismo tipo de tomos y compuesta cuando est formada por ms de un tipo de tomos. Las
sustancias simples son escasas a la par del incontable nmero de las sustancias compuestas. Estas
ltimas se hallan en tanta cantidad y variedad que es comn estudiarla inclusive en diferentes materias
o reas del conocimiento. As tenemos los compuestos inorgnicos, orgnicos y biolgicos, como una
simple clasificacin.
Se define a un compuesto inorgnico como aquel compuesto formado por tomos diferentes pero que
no incluyen al carbono unido consigo mismo. Los compuestos orgnicos contrariamente, son aquellos
que tienen carbono y los tomos de carbono se hallan unidos entre s formando cadenas carbonadas.
Por otra parte los compuestos biolgicos o biomolculas son estructuras qumicas formadas por
carbono unidos consigo mismo, pero que son sintetizados por organismos vivos. Podramos considerar
que los compuestos biolgicos son un grupo dentro de los compuestos orgnicos.
Puede consultar los siguientes videos sobre el tema:
xidos, hidrxidos y oxocidos: https://youtu.be/YhTviKw2smY
Sales, perxidos y superxidos: https://youtu.be/Hgd-W9yuCo8
Recordemos algunos conceptos!
Smbolo: es la representacin grfica de un tomo de un dado elemento. Por ejemplo un tomo del
elemento sodio se representa con Na. Un tomo de carbono se representa con C.
Frmula: es la representacin grfica de una sustancia, ya sea simple o compuesta. Por ejemplo la
representacin del cido clorhdrico se hace a travs de la frmula HCl (sustancia compuesta), mientras
que la del ozono por la frmula O3 (sustancia simple).
Comenzaremos a introducirnos en las estructuras qumicas de los compuestos dando algunos
rudimentos de las frmulas de los compuestos inorgnicos. Dentro de las sustancias estudiaremos:
xidos bsicos y cidos, oxocidos, hidrxidos, sales e hidruros.
En un compuesto qumico de la clasificacin que sea, los tomos se encuentran unidos por enlaces
qumicos. Cada tomo tiene una determinada capacidad de unin y no otra. A modo ilustrativo
podramos utilizar una comparacin. Supongamos que tenemos dos electrodomsticos, uno con un
enchufe de dos patas redondas y otro electrodomstico con un enchufe de tres patas planas. En la pared
tenemos un enchufe con tres orificios planos. Es obvio que solo podr enchufar el electrodomstico
que tiene tres patas planas y no el otro. Con los tomos pasa igual. Cada tomo tiene una capacidad de
combinacin que podramos interpretar como enchufes o ganchos. Una regla prctica rudimentaria
pero entendible es que los tomos al unirse a travs de estos "ganchos" lo hacen sin dejar ningn
gancho libre. Estos "ganchos" con los que se unen los tomos se los conoce como valencias o
capacidad de combinacin. Los tomos se ligan entre s utilizando un nmero de enlaces determinado.
Estas posibilidades de enlaces se denominan valencias, capacidad de combinacin y como veremos
ms adelante est ntimamente relacionado al nmero de oxidacin. Por ejemplo cuando el sodio se
une a otro tomo slo puede establecer un enlace, entonces se dice que tiene valencia 1.
En el caso de los electrodomsticos diramos que uno de ellos tiene valencia 2 y el otro valencia 3. Por
otra parte el enchufe de la pared tendra valencia 3.

8
COMPUESTOS INORGNICOS

Las valencias pueden obtenerse de la tabla peridica. La misma es comn hallarla con signo positivo o
negativo, que enteremos su significado ms adelante. En principio utilizaremos una breve lista de los
elementos ms comunes para comprender los principios por los cuales se forman los compuestos
inorgnicos. La lista siguiente da las valencias ms comunes de los elementos ms utilizados. Como se
puede ver algunos elementos tienen una nica forma de combinacin, en cambio otros tienen
diferentes capacidades de combinacin. Por ejemplo el aluminio solo se puede unir a otro tomo
utilizando 3 "valencias". En cambio el Hg, puede hacerlo en algunos casos con una capacidad de
combinacin de 1 "valencia" y en otros casos con 2 "valencias".
valencia elementos
1 Li, Na, K, Rb, Cs, H, Ag, F
2 O, Ca, Ba, Be, Mg, Cd, Zn
3 Al, B
4 C, Si
1,2 Hg, Cu
1,3 Au, Tl
2,3 Fe, Co, Ni
2,4 Pb, Sn
3,5 N, As, Sb, P
2,4,6 S, Se, Te
1,3,5,7 Cl, Br, I

Para escribir la frmula de una sustancia es importante tener presente que al unirse los elementos se
unen valencias de uno con valencias del otro y no deben quedar valencias libres.
Por ejemplo el O tiene valencia 2 y el H valencia 1. Al unirse ambos, cada valencia del H se liga a una
del oxgeno, por lo tanto son necesarios dos H por cada O. De esta manera la frmula que resulta es
H2O, que es la frmula del agua.

Figura 2.1

Otro ejemplo es la unin de N e H, en este caso el N acta con valencia 3 y el H con 1; por lo que son
necesarios 3 H por cada nitrgeno, quedando la frmula NH 3. Como se puede ver en ambas frmulas
queda debajo de cada elemento la valencia del otro elemento. Esta es la regla general para escribir una
frmula de cualquier compuesto: "se colocan los elementos y se escribe como subndice la valencia del
otro"
Ej: escribir la frmula que resulta de ligar el N con valencia 5 y el O con valencia 2.

9
COMPUESTOS INORGNICOS

Respuesta: Coloque los dos smbolos


NO
coloque como subndice de cada smbolo la valencia del otro
N2O5
Es la frmula molecular de pentxido de dinitrgeno.
Si bien este principio de construccin no es siempre aplicable y en algunos casos se requiere un poco
ms de trabajo, siempre subyace ese mecanismo.
A continuacin veremos los compuestos inorgnicos ms comunes.

2.1. xidos bsicos

Son compuestos que resultan de la combinacin entre oxgeno y un metal. Los metales son elementos
que se hallan en general ubicados en la parte izquierda de la tabla peridica y tienen ciertas
propiedades como el brillo y la conduccin del calor y la electricidad.
Construyamos el xido bsico que resulta de la combinacin entre oxgeno y sodio. Se colocan los
smbolos de los elementos y se intercambian valencias.
Ej. Na2 O
Se nombran de dos maneras: 1) xido de sodio
2) monxido de disodio
Cuando el metal tenga ms de una valencia puede dar dos xidos diferentes. En la nomenclatura se le
coloca la terminacin oso al compuesto en el que el metal tiene menor valencia y terminacin ico al
compuesto con mayor valencia.
Ej: el Fe tiene valencia 2 y 3
Con valencia 2: Fe2O2 se simplifican los subndices, quedando FeO
La nomenclatura es: xido ferroso, monxido de hierro u xido de hierro (II).
Con valencia 3: Fe2O3, en este caso la frmula no sufre simplificacin.
La nomenclatura es xido frrico, trixido de dihierro u xido de hierro (III).
Ejercicio: escribir la frmula de los siguientes xidos:
xido de calcio
xido cobltico
xido de aluminio
Respuesta: CaO, Co2O3, Al2O3
Resumen: para escribir un xido bsico se coloca primer el smbolo del metal, luego el oxgeno. Como
subndice del metal se coloca 2 (la valencia del oxgeno) y como subndice del oxgeno la valencia del
metal. Si ambos subndices son mltiplos se simplifican. Existen varias formas de nombrar un xido
bsico, la ms sencilla es como "oxido de (nombre del metal)" para metales con una sola valencia,
"oxido (nombre del metal con terminacin oso)" para el xido de un metal con la menor de sus
valencias y "xido (nombre del metal con terminacin ico)" para el xido de un metal con la mayor de
sus valencias.

10
COMPUESTOS INORGNICOS

2.2. Oxidos cidos

Son la combinacin de oxgeno con un no metal. Los no metales se hallan en la parte derecha de la
tabla peridica. En general son gases o slidos.
Un ejemplo clsico de un no metal es el cloro, que pertenece a la familia de los halgenos. Este
halgeno tiene valencias 1, 3, 5 y 7. Con valencia 5 podra combinarse con el oxgeno, formado un
compuesto:
Cl2O5, su nombre es pentxido de dicloro.
Ejercicios: Escribir la frmula de los siguientes compuestos:
trixido de azufre
pentxido de dinitrgeno
dixido de carbono
Respuesta: SO3, N2O5 y CO2.
Resumen: para escribir un xido cido se coloca primer el smbolo del no metal, luego el oxgeno.
Como subndice del no metal se coloca 2 (la valencia del oxgeno) y como subndice del oxgeno la
valencia del no metal. Si ambos subndices son mltiplos se simplifican. Habitualmente se nombran
indicando el nombre del oxgeno y del no metal precedidos por prefijos que indican el nmero de
tomos de cada elemento: (mono-di-tri-penta) xido de (mono-di) nombre del no metal

2.3. Hidrxidos

Son compuestos ternarios1 que resultan de la unin de un metal con el radical hidroxilo u oxhidrilo:
OH. Este radical tiene valencia 1. En realidad el oxhidrilo puede pensarse como un oxgeno con
valencia 2 que se uni a un hidrgeno con valencia 1, quedando al oxgeno una valencia libre. La
escritura de la frmula sigue las mismas reglas, se coloca el tomo del metal y a la derecha el grupo
oxhidrilo. Se intercambian valencias como en cualquier frmula.
Para el hierro con valencia 3 la frmula resulta: Fe(OH) 3. La nomenclatura se da siempre con la
palabra hidrxido seguido del nombre del metal con terminacin oso o ico dependiendo si acta con la
menor o la mayor valencia. En este caso se denomina hidrxido frrico o hidrxido de hierro (III). En
cambio si el hierro acta con valencia 2, quedar Fe(OH)2 y su nomenclatura es hidrxido ferroso o
hidrxido de hierro (II).
En el caso de un metal que tiene una sola valencia como el potasio queda: K(OH). Su nomenclatura es
hidrxido de potasio. TAmbin se puede llamar hidrxido potsico. Cuando tiene una sola valencia se
lo trata como si fuera la mayor valencia. Para los hidrxidos, como el K(OH), donde como subndice
del oxhidrilo qued un 1, se pueden omitir los parntesis, quedando la frmula KOH.
Ejercicios: Escribir las frmulas de los siguientes hidrxidos:
hidrxido de aluminio
hidrxido niqueloso
hidrxido de sodio
Respuestas: Al (OH)3, Ni (OH)2, Na (OH).

1 Compuesto ternario: formado por tres elementos diferentes. Compuesto binario: por dos elementos diferentes.

11
COMPUESTOS INORGNICOS

2.4. Hidrcidos

Resultan de la combinacin del hidrgeno con un no metal. Los no metales que forman hidrcidos son:
Cl, Br, I, F, S, Se y Te con su menor valencia. La nomenclatura de stos es: cido seguido del nombre
del no metal terminado en hdrico o el nombre del no metal terminado en uro y seguido de las palabras
"de hidrgeno".
Por ejemplo el cloro acta con valencia 1, generando el siguiente hidrcido:
HCl y su nombre es cido clorhdrico o cloruro de hidrgeno.

2.5. Oxocidos

Los oxocidos son compuestos ternarios, formados por un no metal, oxgeno e hidrgeno. Para la
escritura de la frmula el mecanismo es diferente: primero se debe escribir el xido cido
correspondiente y luego sumarle agua. Por ejemplo si se desea escribir la frmula de cido sulfrico se
debe hacer el siguiente razonamiento. La terminacin ico indica que el azufre est actuando con la
mayor valencia. Para formar oxocidos el azufre puede utilizar valencia 4 o 6. En este caso lo est
haciendo con valencia 6. Entonces primero formamos el oxido cido con valencia 6
S2O6
como los subndices son mltiplos pueden simplificarse por divisin por 2, resultando
SO3
luego le sumamos una molcula de agua

SO3 + H2 O H2 SO4 cido sulfrico

Intente escribir la frmula de cido sulfuroso, sabiendo que el azufre acta en este compuesto con
valencia 4.
Respuesta:

SO2 + H2 O H2 SO3.

Existen casos especiales, por ejemplo el cloro que tiene valencias: 1, 3, 5, y 7, cuando forma
oxocidos, se deben agregar a los nombres algunos prefijos. Para las dos valencias menores (1 y 3) la
terminacin ser oso y para las dos mayores (5 y 7) la terminacin ser ico. Para distinguir a los dos
oxocidos de menor valencia, al menor de los dos se le agrega el prefijo hipo. De manera similar para
distinguir a los dos oxocidos con mayor valencia que terminan en ico, se le agrega al de mayor
valencia el prefijo per.
con valencia 1: cido hipocloroso: HClO.
con valencia 3: cido cloroso: HClO2.
con valencia 5: cido clrico: HClO3.
con valencia 7: cido perclrico: HClO4.

12
COMPUESTOS INORGNICOS

Casos similares al cloro son el bromo y iodo.

Otro tipo de excepcin corresponde al fsforo, que cuando forma el oxocido puede combinarse con 1,
2 o 3 molculas de agua: Por ejemplo con valencia 5 el fsforo da los siguientes oxocidos:
Con una molcula de agua

P2O5 + H2 O H2P2O6

En este caso se puede simplificar y la frmula que se obtiene es: HPO 3 y su nombre es cido
metafosfrico. El prefijo meta indica una molcula de agua.
Con dos molculas de agua

P2O5 + 2 H2 O H4P2O7

Que se llama cido pirofosfrico; el prefijo piro indica 2 molculas de agua.


Con tres molculas de agua

P2O5 + 3 H2 O H6P2O8

que luego de simplificar se obtiene el cido ortofosfrico: H3PO4. El prefijo orto indica 3 molculas
de agua.
El arsnico y el antimonio dan el mismo tipo de compuestos que el fsforo. El boro y el silicio dan
compuestos similares pero tienen algunas variantes que resultarn fcil de comprender cuando los
enfrente.

2.6. Radicales cidos

Si a un oxocido o hidrcido se le quitan los hidrgenos se obtiene un radical cido. La nomenclatura


del radical es igual al nombre del cido del cual se origin pero cambiando la terminacin ico por ato
u oso por ito.
Por ejemplo: a partir del cido sulfrico : H2SO4, se obtiene: SO4 al quitarle los dos hidrgenos, que es
el radical sulfato. Si se le hubiera quitado slo un hidrgeno se obtendra HSO 4, que es el radical
sulfato monocido (por quedarse con un hidrgeno).
Es importante tener en cuenta que un radical tiene una valencia que es igual al nmero de hidrgenos
que se le han quitado. Por ejemplo para el radical sulfato la valencia es 2, mientras que el sulfato
monocido tiene valencia 1.
Hagamos algunos ejercicios: Escribir las frmulas de los siguientes oxocidos y de sus radicales
cidos. Indicar adems la valencia de cada radical y su nombre :
1- cido carbnico

13
COMPUESTOS INORGNICOS

2- cido nitroso
3- cido ortofosfrico
Resolucin: veamos en el primer caso
El cido carbnico es un oxocido (la palabra "acido" y la terminacin "ico" estando en compuestos
inorgnicos nos orienta en este caso). Recuerdo que esto no es aplicable a toda la qumica. El cido
propinico, con las mismas caractersticas de su nomenclatura es un cido orgnico y el cido
glutmico es un aminocido. Lo que si es regla general es que si comienza con "cido" es un
compuesto que al disolverlo en agua tendr comportamiento cido, es decir liberar hidrgenos.
El cido carbnico involucra carbono con valencia 4. Si lo escribiramos desde su inicio utilizando el
razonamiento, primero combinaramos el dixido de carbono con el agua, para obtener el cido
carbnico
CO2 + H2O H2CO3
Ahora escribamos los radicales cidos. Recordemos que es la misma estructura del cido pero
quitando los hidrgenos. Como tiene dos hidrgenos podemos generar dos radicales
HCO3
CO3
Veamos su nomenclatura y valencia. Ambos provienen del cido carbnico, entonces eliminamos la
palabra cido y cambiamos la terminacin ico por ato. Si hubiera terminado en oso, se cambiara por la
terminacin ito.
Luego agregaremos a continuacin la palabra monocido, si qued con un hidrgeno, dicido si qued
con dos y tricido si se qued con tres hidrgenos. No se agrega nada si qued sin hidrgenos
Recuerde que para dar un radical al menos debe perder un hidrgeno
Para la valencia, debemos contar cuantos hidrgenos perdi. Si el cido tena dos y el radical qued
con uno, indica que perdi un hidrgeno y esa es su valencia. Si el cido tena dos y perdi los dos,
pues la valencia ser dos.
HCO3 : cido carbnicoato mono cido : carbonato monocido valencia 1
CO3 : cido carbnicoato : carbonato valencia 2
Ahora veamos el caso 2
cido nitroso HNO2
Como este cido tiene un solo hidrgeno, solo podr perder ese hidrgeno.
NO2 : cido nitrosoito : nitrito valencia 1
El caso 3 es el cido ortofosfrico cuya formula es
H3PO4
Por tener tres hidrgenos, este compuesto puede perder 1, 2 y hasta tres hidrgenos, en cada caso la
valencia del radical correspondiente ser 1, 2 o 3 y la cantidad de hidrgenos que quedarn en el
radical sern 2, 1 o ninguno. Vemos
H2PO4 cido ortofosfricoato : ortofosfato dicido valencia 1
H1PO4 cido ortofosfricoato : ortofosfato monoido valencia 2
PO4 cido ortofosfricoato : ortofosfato valencia 3

14
COMPUESTOS INORGNICOS

Ntese que la regla para la nomenclatura eran los reemplazo


ato por ico
ito por oso
En algunos casos como el anterior se hacen pequeas modificaciones. Siguiendo la regla al pie de la
letra correspondera
cido ortofosfrico : ortofosforato
A los fines de mejor pronunciacin y nombre mas armnico, suelen eliminarse o agregarse algunas
letras o slabas. En este caso se reemplazo ato por rico
Los radicales cidos en realidad son aniones. La valencia asignada como se expres anteriormente es la
carga del radical. Por ejemplo a partir de cido ortofosfrico: H 3PO4, podemos obtener tres radicales
cidos, que se originarn en el proceso de disociacin del cido.
H2PO4- : fosfato dicido, perdi un hidrgeno, valencia 1, carga 1 -.
HPO42-: fosfato monocido, perdi dos hidrgenos, valencia 2, carga 2 -.
PO43-: fosfato, perdi tres hidrgenos, valencia 3, carga 3 -.
Si a un hidrcido se le quita el hidrgeno, se obtiene un radical cuyo nombre termina en uro.
Por ejemplo el cido sulfhdrico es: H2S; al quitarle los hidrgenos se obtiene S, que es el sulfuro y
cuya valencia es 2.
Si se le quitara un solo hidrgeno se obtendra SH que es el sulfuro monocido. De la misma manera
que para los radicales de los oxocidos, estos radicales tienen carga negativa coincidente con su
valencia.
Hagamos el proceso inverso. Si tenemos un radical deduzcamos de qu cido proviene. Hagamos el
ejercicio con el sulfato monocido. Debemos cambiar la terminacin ato por ico o bien si su
terminacin fuera ito, la cambiaramos por oso y antepondramos en ambos casos la palabra cido,
elimnando si existieran las palabras monocido, dicido y tricido.
sulfato moncido : cido sulfatorico monocido
En este caso tenemos una situacin similar a la explicada anteriormente. Si bien ato va por ico e ito
por oso. En ese caso se reemplazo ato por rico. Si se siguiera al pie de la letra la nomenclatura el
cido se llamara "cido slfico", que no es el nombre con que lo hallaremos.

2.7. Sales

Son compuestos que resultan de la unin entre un radical cido y un metal. Por ejemplo el sulfito de
potasio. Analizando el nombre se puede deducir que el radical es el sulfito que deriva del cido
sulfuroso, H2 SO3, el radical ser: SO3, cuya valencia es 2, al combinarse con el potasio generar:
K2 SO3.
Analicemos otro ejemplo: ortofosfato monocido de aluminio
ortofosfato deriva del cido ortofosfrico: H3 PO4.
como es "monocido" el radical queda con un hidrgeno, es decir con la estructura: HPO 4, cuya
valencia es 2 por haber perdido 2 hidrgenos. Al enfrentar este radical con el aluminio e intercambiar
valencias resulta:

15
COMPUESTOS INORGNICOS

Al2(HPO4)3

Clasificacin de las sales


1- Sales oxigenadas: son aquellas que derivan de oxocidos y por lo tanto tienen oxgeno en su
estructura. Por ejemplo el clorato de aluminio, cuya frmula es Al(ClO3)3
2- Sales oxigenada cidas: provienen de un oxocido pero el radical cido tiene hidrgenos. Por
ejemplo el ortoarseniato dicido niqulico: Ni (H2AsO4)3
En las sales oxigenadas cidas, especialmente en algunos casos se utiliza otra nomenclatura, de mucha
aplicacin en ciencias biomdicas. Veamos
El carbonato cido de sodio, por ejemplo, cuya frmula es NaHCO 3. En algunos casos especiales, y el
mencionado es el ms comn, cuando una sal es cida se suele eliminar la palabra cido y colocar
delante el prefijo bi (que no quiere decir 2). En este se puede utilizar el nombre bicarbonato de sodio.
3- Sales oxigenadas bsicas: son sales provenientes de oxocidos pero el metal est acompaado de
algn oxhidrilo que satura algunas de sus valencias. Por ejemplo el nitrito monobsico cobltico:
[Co (OH)] (NO2)2
Razonmosla
nitrito monobsico cobltico
nitrito: viene del cido nitroso, cuya frmula es HNO2. El radical ser entonces NO2 con valencia 1 por
haber perdido 1 Hidrgeno.
cobltico: se trata del cobalto con su mayor valencia, es decir 3.
monobsico, quiere decir que tiene un oxhidrilo unido a una valencia del cobalto, por lo tanto Co y
oxhidrilo quedara unidos formando una estructura
Co(OH).
como el cobalto tiene valencia 3, pero una est unida al oxhidrilo, la valencia de la estructura Co(OH)
ser 2.
Entonces enfrentamos las estructuras e intercambiamos valencias
Co(OH) NO2
para ver mejor encerramos cada una de ellas entre parntesis. Note que la primera va entre corchetes,
ya que la estructura tiene parntesis en el oxhidrilo
[Co(OH)]1 (NO2).2
podemos eliminar el corchete de la primera, ya que el subndice es 1.
[Co(OH)] (NO2).2
y tambin podemos eliminar el corchete
Co(OH) (NO2).2

4- Sales no oxigenadas: provienen de un hidrcido. Por ejemplo el cloruro de bario: BaCl2

16
COMPUESTOS INORGNICOS

2.8. Hidratos

Los hidratos son sales que presentan agua unida en proporcin constante. Son compuestos comunes en
las ciencias biomdicas. Se escribe la frmula seguida de la cantidad de molculas de agua. Por
ejemplo
Cu(SO4).5H2O
su nomenclatura es sulfato cprico pentahidratado.
Escribamos el cloruro de magnesio hexahidratado. Es una sal no oxigenada formada por el radical
cloruro y el magnesio con 6 molculas de agua unidas a su estructura. La frmula sera
MgCl2.6 H2O

2.9. Perxidos

Los perxidos son la unin de un metal con el radical perxido. Este radical est formado por dos
tomos de oxgeno unidos entre s, teniendo el radical valencia 2
Para escribir las estructuras se procede de la misma manera que para los xidos. Se colocan las
estructuras y se intercambian valencias.
Por ejemplo el perxido correspondiente al sodio. Colocamos las estructuras
Na (O2)
intercambiamos valencias
Na2 (O2)1
eliminamos subndice 1 y parntesis
Na2O2
no se simplifican los dos, ya que el dos debajo del oxgeno es parte del radical perxido.
Se nombran con la palabra perxido, seguido del nombre del metal. Para este caso: perxido de
hidrgeno. Estos compuestos en general lo dan elementos metlicos del grupo I y II de la tabla
peridica.

2.10. Superxidos

Los superxidos son la unin de un metal con el radical superxido. Este radical est formado por dos
tomos de oxgeno unidos entre s, teniendo el radical valencia 1
Para escribir las estructuras se procede de la misma manera que para los xidos. Se colocan las
estructuras y se intercambian valencias.
Por ejemplo el superxido correspondiente al sodio. Colocamos las estructuras
Na (O2)
intercambiamos valencias
Na1 (O2)1
eliminamos subndice 1 y parntesis

17
COMPUESTOS INORGNICOS

Na O2
Se nombran con la palabra superxido, seguido del nombre del metal. Para este caso: superxido de hidrgeno. Estos compuestos en general lo dan elementos metlicos del grupo I.

2.11. Prctica

1) Escribir las frmulas de los compuestos que se dan a continuacin, indicando de que tipo de
compuestos se trata:
a- cido ortoarsenioso
b- cido bromhdrico
c- Fluoruro
d- xido de plata
e- Hidrxido de calcio
f- Nitrito de bario
g- Ortoantimoniato ferroso

2). Dar la nomenclatura de los siguientes compuestos


a- Ba (NO3)2.
b- Al (NO3)3.
c- Fe2 (CO3)3.
d- MgCl2.
e- Zn (NO3)2.
f- CaCl2.
g- Ca (NO3)2.

3). Escribir la frmula molecular de los siguientes compuestos


a- Ortoarseniato niqueloso.
b- Sulfato frrico.
c- Nitrito cobaltoso.
d- Cloruro de magnesio.
e- Ortofosfato ferroso.
f- Cloruro de potasio.
g- Nitrito de estroncio.

4). Escribir la frmula molecular o la nomenclatura de los siguientes compuestos:


Nomenclatura Frmula molecular

18
COMPUESTOS INORGNICOS

Hidrxido cuproso
Cloruro arico
Mg3 (PO4)2
HNO2
Hidrxido de Plata
Clorato Frrico
K2 SO4
H2 SO3
Trixido de dinitrgeno
clorito ferroso
Na3 PO4
H2 SO4
Pentxido de difsforo
hipoiodito frrico
Li2 SO4
H3 PO4
heptxido de dicloro
iodito ferroso
K3 PO4
H2 TeO3

10) Escribir la frmula molecular de los siguientes compuestos:


a- Sulfito cido de sodio
b- Carbonato bsico de aluminio
c- Sulfuro cido de potasio
d- Perxido de hidrgeno
e- Ortofosfato dicido de litio

11). Escribir la frmula molecular o la nomenclatura de los siguientes compuestos:

Nomenclatura frmula molecular


Hidrxido Frrico
Perclorato de aluminio

19
COMPUESTOS INORGNICOS

Na2SO3
H2SO4
Hidrxido niqulico
Sulfito de aluminio
Na2TeO3
H4P2O5

12) Escribir la frmula molecular del


a- Sulfito cobltico
b- Nitrito niqulico
c- Ortoarseniato niqueloso
d- Sulfato frrico
e- Nitrito cobaltoso
f- Cloruro de magnesio
g- Ortofosfato frrico
h- Cloruro de calcio

13). a- Dar la nomenclatura de los siguientes compuestos


b- en cada caso indicar tipo de compuestos (sal, cido, hidrxido, etc)
a- Zn (NO3)2.
b- Al (NO2)3.
c- Co2 (CO3)3.
d- BaCl2.
e- Zn (NO2)2.
f- CdCl2.
g- Ca (ClO3)2.
h- Sr (NO2)2

14) Ejercitacin on-line sobre xidos, hidrxidos y oxocidos


https://docs.google.com/forms/d/e/1FAIpQLSfN724RrjYSH_pYNAv1CoCofyXjUeSoq4imWU57dWt
X_S_hOg/viewform?usp=sf_link
repuesta en el siguiente link
https://docs.google.com/forms/d/e/1FAIpQLSfN724RrjYSH_pYNAv1CoCofyXjUeSoq4imWU57dWt

20
COMPUESTOS INORGNICOS

X_S_hOg/viewform?entry.589495961=un+oxo
%C3%A1cido&entry.1987083787=un+compuesto+ternario&entry.902891671=un+oxo
%C3%A1cido+del+ars%C3%A9nico&entry.698990843=son+compuestos+inorg
%C3%A1nicos&entry.1824096335=HIO&entry.1608243741=P%C3%A9rez,
+Carlos&entry.395841345=14788963
15) ejercitacin on line sobre sales, perxidos y superxidos en el siguiente link
https://docs.google.com/forms/d/e/1FAIpQLSdioRJ3obd5GLoRIxzvUlXvJ22nmnUDXDES1XK71rW
VOt191Q/viewform?usp=sf_link
respuestas en el siguiente link
https://docs.google.com/forms/d/e/1FAIpQLSdioRJ3obd5GLoRIxzvUlXvJ22nmnUDXDES1XK71rW
VOt191Q/viewform?usp=pp_url&entry.412765141=una+sal&entry.1198343430=tiene+ox
%C3%ADgeno+en+su+estructura&entry.219087076=ortofosfito+niqueloso&entry.1877083905=un+c
ompuesto+inorg
%C3%A1nico&entry.1181816599=presentan+un+metal+en+su+estructura&entry.1417758828=P
%C3%A9rez,+Juan&entry.1555609230=12456789

2.11.1. Respuestas

1- a- H3 AsO3: oxocido.
b- HBr: hidrcido
c- F- : radical de hidrcido
d- Ag2O : xido bsico
e- Ca (OH)2: hidrxido
f- Ba (NO2)2: sal
g- Fe3 (SbO4)2, sal.
2- a- nitrato de bario
b- nitrato de aluminio
c- carbonato frrico
d- cloruro de magnesio
e- nitrato de cinc
f- cloruro de calcio
g- nitrato de calcio
3- a- Ni3 (AsO4)2
b- Fe2 (SO4)3
c- Co (NO2)2
d- MgCl2
e- Fe3 (PO4)2

21
COMPUESTOS INORGNICOS

f- KCl
g- Sr (NO2)2
4- Cu (OH); AuCl3, fosfato de magnesio, cido nitroso.
Ag (OH); Fe(ClO3)3, sulfato de potasio, cido sulfuroso.
N2 O3; Fe (ClO2)2; ortofosfato de sodio, cido sulfrico.
P2 O5, Fe (IO)3, sulfato de litio, cido ortofosfrico.
Cl2 O7, Fe (IO2)2, fosfato de potasio, cido teluroso.
10- a- NaHSO3
b- Al (OH)CO3
c- KHS
d- H 2O2
e- LiH2 PO4
11- Fe(OH)3, Al(ClO4)3, Sulfito de sodio, cido sulfrico.
Ni(OH)3, Al2(SO3)3, Telurito de sodio, cido pirofosforoso.
12- a- Co2 (SO3)3, b- Ni (NO2)3, c- Ni3 (AsO4)2, d- Fe2 (SO4)3, e- Co (NO2)2, f- MfCl2, g- Fe PO4, h-
CaCl2
13- a- nitrato de zinc (sal oxigenada neutra)
b- nitrito de aluminio (sal oxigenada neutra)
c- carbonato cobltico (sal oxigenada neutra)
d- cloruro de bario (sal no oxigenada neutra)
e- nitrito de zinc (sal oxigenada neutra)
f- cloruro de cadmio (sal no oxigenada neutra)
g- clorato de calcio (sal oxigenada neutra)
h- nitrito de estroncio (sal oxigenada neutra)

22
SISTEMAS MATERIALES

3. SISTEMAS MATERIALES

3.1. Sistema material

Se denomina as a toda porcin del universo formada por una o ms sustancias, entendindose por
universo todo aquello donde existe materia o energa. Puede ver este captulo en vdeo a travs del
siguiente link: https://youtu.be/hwqcx5uAblM
Existen dos tipos fundamentales de sistemas materiales: homogneos y heterogneos. Para diferenciar
los distintos tipos de sistemas debemos comprender los trminos "superficie de discontinuidad" y
"propiedades diferentes". Por ejemplo, un trozo de hielo en el agua lquida presenta una superficie
definida que lo separa del lquido. sta es la superficie de discontinuidad ya que en ellas las
propiedades cambian bruscamente, de lquido pasa a ser slido, de ser fluido pasa a ser rgido, etc. Si el
trozo de hielo es grande esta diferencia se observa a simple vista: la heterogeneidad se observa a
simple vista. En cambio, si el trozo de hielo fuera microscpico la heterogeneidad existira pero se
hara evidente con el uso de algn tipo de microscopio.

3.1.1. Sistema homogneo

Es aquel sistema que presenta propiedades constantes en todos sus puntos. No presenta superficies de
discontinuidad an observndolos al ultramicroscopio. Dentro de estos sistemas tenemos las
soluciones.

3.1.2. Sistema heterogneo

Es aquel sistema que presenta diferentes propiedades en los diferentes puntos del mismo y por lo tanto
presenta superficies de discontinuidad. Las propiedades sufren cambios bruscos de un punto a otro del
sistema.
Dentro de los sistemas heterogneos tenemos diferentes tipos:
1- Dispersiones gruesas: aquellas en los que se puede determinar la heterogeneidad a simple vista. Es
decir, a simple vista podemos ver las superficies de discontinuidad y las propiedades diferentes del
sistema. Por ejemplo, un vaso de agua con un clavo de hierro en su interior. Es evidente a simple vista
el cambio en las propiedades dentro del sistema, slo utilizando la visin.
2- Dispersiones finas: en las que la heterogeneidad se determina con el uso del microscopio ptico. Son
casos donde las partes del sistema son muy pequeas y la agudeza visual impide distinguirlas. Un
ejemplo de este tipo de sistema es la sangre. A simple vista es un lquido rojizo, pero al microscopio
ptico se observan superficies de discontinuidad, especialmente establecidas por las membranas
celulares de las clulas que se hallan entre los elementos figurados de este fluido biolgico.
3- Dispersiones coloidales: en los que la heterogeneidad se determina con el ultramicroscopio. El
ultramicroscopio es un dispositivo con una iluminacin particular que permite ver partculas muy
pequeas por la dispersin de la luz. Un ejemplo de estas dispersiones es el plasma sanguneo. Este
fluido es homogneo a simple vista y, an, al microscopio. Sin embargo, al iluminarlo se producir
dispersin de la luz que evidencia la presencia de partculas muy pequeas.

23
SISTEMAS MATERIALES

La dispersin coloidal presenta un efecto conocido como Efecto Tyndall, producida por esta dispersin
de la luz. Los sistemas homogneos no presentan este fenmeno y se ven lo que se llama pticamente
vacos. Qu significa esto? Si hacemos pasar un haz laser o cualquier haz de luz por un sistema
homogneo, como podra ser agua, no se ver el rayo a travs del sistema. Sin embargo, al pasar a
travs del sistema coloidal quedar el rayo trazado.

3.1.3. Fase

Una fase es cada una de las porciones homogneas de un sistema heterogneo. Podemos redefinir
sistema homogneo como aquel formado por una sola fase. Sistema heterogneo es aquel formado por
ms de una fase. Por ejemplo, un sistema que est formado por agua lquida y hielo, tendr dos fases.

3.1.4. Componente

Un componente de un sistema es cada una de las sustancias puras que forman dicho sistema. Por
ejemplo, el vaso con agua y hielo, si bien tiene dos fases, tiene un slo componente, el agua.
Separacin de partes de un sistema heterogneo: un sistema heterogneo se puede separar en fases,
utilizando mtodos fsicos como ser: filtracin, manualmente, magnetismo, decantacin,
sedimentacin, levigacin, tamizado. Los componentes de una fase, a su vez, se pueden separar por
mtodos de fraccionamiento de fases como son: destilacin, destilacin fraccionada, evaporacin.
Todos estos mtodos son fsicos ya que no cambian las sustancias del sistema sino que las separan.

3.1.5. Solucin

Tambin conocida como disolucin, es un sistema homogneo que resulta de la mezcla homognea de
dos o ms sustancias conocidas como solutos y solventes. Es homognea porque no es posible
distinguir el soluto una vez disuelto. Por ejemplo, al colocar sal en agua no es posible distinguir la sal
disuelta. En cambio, si se coloca arena en agua se observa que la arena se puede distinguir, sta ltima
no es una solucin sino una mezcla heterognea.
Solvente: en nuestro caso el agua ser el solvente ms utilizado y las soluciones se denominan acuosas.
Existen soluciones donde el solvente puede ser otro lquido (alcohol, acetona, etc) o puede ser,
tambin, un gas e incluso un slido.
Cuando estudiemos el tema concentracin de soluciones, ampliaremos algunos conceptos.
Puede consultar el tema des soluciones en las siguientes direcciones:
https://youtu.be/Z3OwyLlJ5Sw
https://youtu.be/H_P60kffZI0

3.1.6. Tipos de solutos

Bsicamente existen dos tipos de solutos: no electrolitos (no disociables o no inicos) y los electrolitos
(disociables o inicos).
No electrolitos: son solutos que al colocarlos en agua cada molcula queda como tal sin disociarse
(Error: Reference source not found, izquierda).

24
SISTEMAS MATERIALES

Electrolitos: se disocian originando dos o ms partculas, llamadas cationes y aniones (Error:


Reference source not found, derecha).

NO ELECTROLITO ELECTROLITO

1 MOL 1 MOL

1 PARTICULA 3 PARTICULAS

Figura 3.1
Por ejemplo: en la Figura 1 izquierda al colocar 1 molcula de un no electrolito en agua queda una
partcula en solucin. En el panel de la derecha de la Figura 1, al colocar una molcula de electrolito se
disocia formndose en este caso 3 partculas. Son electrolitos las sales, cidos e hidrxidos. Los no
electrolitos son compuestos generalmente de naturaleza orgnica.
Un compuesto como Na2SO4, al colocarlo en agua se disocia en el radical cido: SO 4= y dos cationes
Na+.
En las soluciones verdaderas, dispersiones coloidales o en las mezclas heterogneas (gruesas o finas)
existen partculas dispersas (fase dispersa) en otra, como por ejemplo el agua, a la que llamaremos fase
dispersante. Estas partculas pueden separarse por diferentes mtodos. Cuando las partculas se separan
por algn mtodo, se dice que la mezcla no es estable . En el caso que no se puedan separar se dice que
la mezcla es estable a ese mtodo.
A continuacin se describen brevemente los mtodos para separar fases o componentes de sistemas
materiales.

3.1.7. Separacin de fases y componentes de un sistema

Filtracin: es un mtodo que separa partculas al hacerlas pasar por un filtro. Las dispersiones gruesas y
finas pueden ser separadas por filtracin, mientras que son estables a este mtodo las soluciones y
dispersiones coloidales. Ejemplo: si tenemos un vaso de agua con granos de arena podremos separar la
arena del agua por filtracin. Sin embargo, si tengo agua con protenas disueltas como podra ser en el
caso del plasma sanguneo, que es una dispersin coloidal, un filtro comn como un tamiz o colador no
lograr separar las protenas del agua.
Ultrafiltracin: es un mtodo que retiene las partculas de las dispersiones coloidales, pudindolas
separar de la fase dispersante. Las soluciones son estables a este mtodo. Bsicamente esta tcnica es

25
SISTEMAS MATERIALES

una filtracin, en la cual el filtro tiene resolucin a nivel molecular. Inclusive existen filtros
moleculares que permiten separar partculas de estas dimensiones. El proceso tambin se conoce como
dilisis, aunque entre ultrafiltracin y dilisis puede haber en algunos casos algunas diferencias segn
la implementacin de la tcnica. La dilisis se utiliza en ciencias mdicas en personas con insuficiencia
renal. La insuficiencia renal impide la eliminacin de algunas sustancias de la sangre, que normalmente
se eliminaran por orina. Al someter la sangre del paciente a dilisis, las sustancias pasan a una
solucin que luego se descarta y, por ende, la sangre del paciente queda con menor concentracin de
dichas sustancias.
Cromatografa y electroforesis: ambas tcnicas son tiles para la separacin especialmente de
partculas que se hallan en estado de dispersin coloidal. En las ciencias biolgicas son de extrema
importancia para separar protenas, cidos nucleicos, aminocidos, etc. En las cromatografas la
separacin se hace por la afinidad que las diferentes partculas tienen por una fase esttica respecto de
una fase mvil. En la electroforesis, lo ms comn es que la separacin se logre por la diferente
velocidad que tienen las partculas para moverse en presencia de un campo elctrico en funcin de su
masa y tamao.
Gravedad: es un mtodo para separar partculas basado en el peso de las mismas. Si su peso es
importante las partculas sedimentan separndose del solvente. Las soluciones y dispersiones
coloidales son estables mientras que las mezclas heterogneas gruesas y finas no lo son.
Centrifugacin: es un mtodo de separacin aumentando la sedimentacin por accin de la fuerza
centrfuga. Las soluciones y dispersiones coloidales son estables, no as las mezclas heterogneas
gruesas y finas. La diferencia entre la gravedad y la centrifugacin es la fuerza que acta y el tiempo
que tarda. La centrifugacin al utilizar la fuerza centrfuga que puede ser miles de veces mayor que la
fuerza de la gravedad acelera el proceso hacindolo miles de veces ms rpido.
Ultracentrifugacin: es similar a la centrifugacin pero a mayores fuerzas centrfugas. Slo las
soluciones son estables a este mtodo. La fuerza de la gravedad se conoce como 1 g. En las centrfugas
se puede aumentar miles de veces llegando a valores de 4000 g por ejemplo, lo que significa que la
fuerza que sufre una partcula es 4000 veces la fuerza de la gravedad. En las ultracentrfugas se puede
llegar a varias decenas de miles de esta fuerza.

3.1.8. Peso molecular

Todo soluto tiene un peso molecular. Esto es un dato que hace referencia al tamao de la molcula del
soluto. Se calcula sumando los pesos atmicos de los elementos que componen la molcula. Este dato
puede presentarse sin unidades, en gramos, en uma (unidad de masa atmica) o en Dalton (Da); ste
ltimo es sinnimo de uma. Si bien sta ltima es la forma adecuada, ser ms comn para nosotros el
gramo. Ejemplo: El NaCl tiene un PM de 58,5 uma y la albmina de 60000 Da ; la molcula de
albmina es ms grande que la de cloruro de sodio.
Cantidad de soluto:
Puede expresarse en diferentes unidades, la ms comn es el gramo, pero tambin se pueden utilizar
otras como ser: el mol (o molcula gramo), el equivalente (o equivalente gramo) y el osmol.
Ejemplo 1:
NaCl (cloruro de sodio). La frmula est compuesta por un catin sodio y un anin cloruro. Al
disociarse se forma un catin (una carga positiva) y anin (una carga negativa). Siempre deben
coincidir la cantidad de cargas positivas y negativas.

26
SISTEMAS MATERIALES

NaCl: Na+ + Cl-


Para el caso del cloruro de sodio, el peso molecular es 58,5 uma.
Calculemos las diferentes formas en las que se puede expresar la cantidad. El peso molecular (en
gramo) es igual a 1 mol, adems es igual a tantos equivalentes como cargas positivas o negativas tiene
el soluto al disociarse y a tantos osmoles como partculas se formaron. A partir de un mol de cloruro de
sodio se formaron un sodio (una carga positiva) y un cloruro (una carga negativa) por lo tanto hay 1
equivalente; y como se form un sodio y un cloruro, dos partculas, entonces hay dos osmoles.
58,5 g = 1 mol = 1 equivalente = 2 osmoles
Ejemplo 2:
CaCl2, cloruro de calcio,cuyo peso molecular es 111 uma.
CaCl2: Ca++ + 2 Cl-
A partir de una molcula se form un catin calcio con dos cargas positivas y dos aniones cloruro cada
uno con una carga negativa (se formaron dos cargas positivas y dos negativas), por lo tanto
111 g = 1 mol = 2 equivalentes = 3 osmoles
Ejemplo 3:
Ca3(PO4)2, fosfato de calcio, peso molecular 310 uma.
Ca3(PO4)2 : 3 Ca++ + 2 PO43-
Se han formado 3 cationes calcio y dos aniones fosfato, 5 partculas lo que corresponde a 5 osmoles.
Los tres iones calcio tienen 6 cargas positivas y los dos iones fosfato 6 cargas negativas, por lo tanto
tienen 6 equivalentes. Resumiendo los datos:
310 g = 1 mol = 6 equivalentes = 5 osmoles.
Ejemplo 4:
Urea, peso molecular 60. Es un no electrolito; al colocar una molcula en agua dar origen a una sola
partcula (1 osmol) y sin carga (no se calcula equivalente). Por lo tanto:
60 g = 1 mol = 1 osmol.
Son solutos no disociables: glucosa, manitol, sacarosa y en general todo soluto que no sea sal, cido o
hidrxido.
Otras definiciones: ya se vio como calcular cuntos moles, equivalentes y osmoles existen en el peso
molecular. Ahora veamos las definiciones de ellos, teniendo en cuenta que el nmero 6x1023 se
denomina Nmero de Avogadro.
Mol: cantidad de sustancia que contiene 6x1023 molculas o un Nmero de Avogadro de molculas.
Equivalente: cantidad de sustancia que contiene 6x1023 cargas o valencias o un Nmero de Avogadro
de cargas o valencias.
Osmol: cantidad de sustancia que contiene 6x1023 partculas o un Nmero de Avogadro de partculas.

3.1.9. Concentracin

Es la relacin o cociente entre la cantidad de soluto y el volumen de la solucin (Error: Reference


source not found).

27
SISTEMAS MATERIALES

cantidad de soluto
concentracin=
volumen de solucin

ecuacin 3.1
La concentracin es un cociente de dos magnitudes: la cantidad de soluto y el volumen. Si es grande
el numerador (mucha cantidad de soluto) o chico el denominador (poco volumen de solucin) el
resultado ser grande, es decir, la solucin tendr una elevada concentracin. Se dice que se tiene
una solucin concentrada. En caso contrario, se trata de una solucin diluida.
De acuerdo a las unidades de cantidad de soluto que se utilicen, se obtendrn diferentes formas de
expresar la concentracin.
% P/V o g %: representa la cantidad de gramos disueltos en 100 ml de solucin. Tambin puede
expresarse en g/l o , que expresa los gramos de soluto disueltos en 1 litro (o 1000 ml) de solucin.
Ejemplo: glucosa 5% (se lee glucosa al 5 por ciento): significa que en 100 ml de solucin hay disuelto
5 g de glucosa.
% P/P : expresa la cantidad de gramos de soluto en 100 gramos de solucin. Esta forma de
concentracin siempre va acompaada de la densidad de la solucin, es decir, la masa de solucin
contenida en 1 ml. Por ejemplo, el agua tiene una densidad de 1 g/cm3, esto quiere decir que un cm3 de
agua pesa 1 gramo. La concentracin en %P/P se relaciona con el % P/V por la Error: Reference
source not found:

% P/V =% P/ P densidad
ecuacin 3.2
Molaridad: M: representa la cantidad de moles disueltos en 1 litro de solucin.
Ejemplo: urea 0,3 M (se lee urea 0,3 molar): significa que en 1 litro de la solucin hay disuelto 0,3
moles de urea.
Molalidad: m: representa la cantidad de moles de soluto que contiene 1 Kg de solvente. La ventaja que
presenta con respecto a la M es que como no tiene en cuenta el volumen y ste se modifica por la
presin y la temperatura, puede medirse con mayor precisin.
Ejemplo: HNO3 2m (se lee cido ntrico 2 molal): significa que hay 2 moles de HNO 3 disueltos en 1
Kg de solvente.
Normalidad: N: representa la cantidad de equivalentes disueltos en 1 litro de la solucin.
Ejemplo: KCl 0,75 N (se lee cloruro de potasio 0,75 normal): en 1 litro de la solucin hay disuelto 0,75
equivalentes de KCl, 0,75 equivalentes de Cl- y 0,75 equivalentes de K+.
Osmolaridad: Osm: representa la cantidad de osmoles disueltos en 1 litro de la solucin.
Ejemplo: CaCl2 0,03 Osm (se lee cloruro de calcio 0,03 osmolar) : hay 0,03 osmoles de soluto en 1
litro de la solucin.
Formularidad o formalidad: F: representa la cantidad de frmulas gramo disueltas en 1 litro de
solucin.
Ejemplo: NaCl 0,3 F (se lee cloruro de sodio 0,3 formal): significa que en 1 litro de la solucin hay
disuelto 0,3 frmulas gramo de cloruro de sodio.
Fraccin molar: es la relacin entre el nmero de molculas gramo de soluto y el nmero de molculas

28
SISTEMAS MATERIALES

gramo de soluto ms solvente.


ppm: significa "partes por milln" y expresa habitualmente los mg de una sustancia en 1 litro de
solucin. Dnde se origina el concepto partes por milln? Un litro de solucin es aproximadamente 1
Kg de solucin si la densidad es cercana a 1 g/ml y 1 Kg es lo mismo que 1.000.000 de mg. De all que
si expreso la masa en mg y el volumen en mg, podramos decir que es la cantidad de mg en 1.000.000
de mg de solucin.
Es comn el uso para expresar ciertos contaminantes del agua. Para el caso del fluoruro, contaminante
habitual del agua de consumo, por ejemplo, la OMS sugiere que el agua no supere 1.5 ppm, es decir,
que el agua no tenga ms 1,5 mg en 1000 ml de solucin.
Simplificando, si una solucin tienen una concentracin de una sustancia de 50 ppm, es lo mismo que
decir que la solucin tiene una concentracin 50 mg/L.
ppb: significa "partes por billn" y expresa la cantidad de microgramos de una sustancia por cada litro
de solucin. Se utiliza habitualmente para contaminantes que estn en menor proporcin. Por ejemplo,
la OMS estableci como lmite superior de concentracin de arsnico en el agua de bebida el valor de
10 ppb, es decir, 10 ug/l.
Vol: expresa la concentracin en volmenes y se utiliza casi exclusivamente para el agua oxigenada.
Recordemos que el agua oxigenada es una solucin acuosa de perxido de hidrgeno: H2O2. Es comn
que cuando adquirimos agua oxigenada, esta tenga su concentracin expresada en Vol (volmenes).
Qu significa que el agua oxigenada tenga una concentracin de 10 Vol?. Si una solucin de agua
oxigenada tiene una concentracin de 10 Vol, indica que 1 litro de esta solucin libera 10 litros de O 2
cuando se descompone a travs de la siguiente reaccin:
2 H2O2 ---------> 2 H2O + O2
si aplicamos las relaciones estequiomtricas aprendidas

2 H2O2 ---------> 2 H2O + O2


2 molec g 2 molec g 1 molec g
68 g 36 g 32 g
22.4 litros
Entonces si una solucin de agua oxigenada tiene 10 Vol, cul es su molaridad.?
22,4 L ..................... 2 molec g de H2O2
10 L .................... x = 0,89 molc g H2O2
Como 10 L es el volumen liberado por un litro de solucin y este volumen se origin de 0,89 molec g
que estn en 1 litro de solucin, la concentracin es 0,89 M.
csp: son siglas comunes que se hallan especialmente en la descripcin de la frmula de soluciones de
uso en medicina.
Por ejemplo podemos tener una solucin que diga:
0,2 g cido saliclico
agua csp 100 ml.
Qu indica csp?

29
SISTEMAS MATERIALES

La descripcin anterior indica que se han colocado 0,2 g del soluto, en este caso el cido saliclico y
luego se agreg agua, Cantidad Suficiente Para ( de all las siglas csp) llegar a un volumen final de
100 ml. Por ende la solucin anterior podramos decir que es una solucin de cido saliclico al 0,2 %
P/V.
Hagamos un ejercicio que involucre los conceptos aprendidos.
Disponemos de 200 ml de una solucin de perxido de hidrgeno (agua oxigenada 20 Vol). A la
solucin le agregamos agua hasta 500 ml. Indicar:
1- Concentracin de la solucin "madre" expresada en M.
2- Concentracin en ppm de la solucin "diluida".
Respuestas:
1- La solucin es 20 Vol, por lo tanto desprende 20 L O2 por cada litro de solucin.
Segn la reaccin 68 g o sea una molcula gramo de perxido de hidrgeno desprenden 22,4 L.
2 H2O2 ---------> 2 H2O + O2
2 molec g 2 molec g 1 molec g
68 g 36 g 32 g
22.4 litros
Entonces si
22,4 l .........................2 molculas g
20 l ......................... X = 1,79 molec g = => 1,79 M

2- La solucin tiene 1,79 mol/l


Si a 200 ml de esta solucin le agregamos agua hasta 500 ml resulta
1000 ml ............................... 1,79 mol
200 ml ................................. x= 0,358 mol

1 mol H2O2 ........................ 34 g


0,358 mol " . ...................... x = 12,172 g
Esta cantidad de gramos se hallar tambin en 500 ml, ya que en el proceso de dilucin slo se agreg
agua.
500 ml ...................... 12,172 g
1000 ml .................... x = 24,344 g que se hallan en 1 litro.
Pasando el valor a mg, resulta 24344 mg.
Por ende la solucin diluida tiene una concentracin de 24344 ppm.

30
SISTEMAS MATERIALES

3.1.10. Dilucin

100 ml

mas 100 ml de agua

200 ml

cantidad de soluto
3g

Figura 3.2

Proceso en el cual se agrega solvente a una solucin ya preparada. Durante la dilucin no cambia la
cantidad de soluto, pero como aumenta el volumen, se produce una disminucin de la concentracin.
En un proceso de dilucin llamamos solucin madre, inicial o concentrada a la que recibe el
agregado de solvente, o sea, la solucin de la cual partimos. La solucin que obtenemos despus del
agregado del solvente, la llamamos solucin resultante, final o diluida. El volumen de la solucin
resultante ser igual a la suma del volumen de la solucin madre ms el volumen de agua agregado. En
la Error: Reference source not found, 100 ml de solucin reciben el agregado de 100 ml de agua, como
se puede ver la solucin resultante est ms diluida, aunque la cantidad de soluto permaneci
constante.
En el ejemplo anterior se dice que se realiz una dilucin al medio o se diluy dos veces: se diluye dos
veces cuando el volumen de la solucin final es el doble de la inicial, en este caso la concentracin ser
la mitad de la inicial. Si se hubiera diluido 7 veces o lo que equivale a hacer una dilucin a 1/7, el
volumen de la solucin final sera 7 veces mayor y la concentracin 7 veces menor.
Para calcular el nmero de diluciones realizadas se pueden aplicar la Error: Reference source not found
o Error: Reference source not found

volumen solucin final (Vfinal)


nmero de diluciones=
volumen solucin inicial (Vinicial )

ecuacin 3.3

concentracin solucin inicial (Cinicial)


nmero de diluciones=
concentracin solucin final (Cfinal )
ecuacin 3.4

31
SISTEMAS MATERIALES

3.2. Fraccionamiento de soluciones

200 ml

cantidad de soluto 1,5 %


3g

100 ml 100 ml

1,5 g 1,5 g
1,5 % 1,5 %

Figura 3.3
Significa tomar una fraccin o alcuota de la solucin madre. En este caso cada fraccin tendr un
volumen y cantidad de soluto menor que la madre, pero igual concentracin. En el ejemplo de la
Figura 3.3, a partir de 200 ml de solucin al 1,5% se toman dos fracciones de 100 ml; si el volumen
total contena 3 g ahora cada fraccin tendr 1,5 (menor cantidad), pero la concentracin es la misma.
Dilucin vs disolucin: diluir una solucin o hacer una dilucin es agregar agua a una solucin ya
preparada. Disolver un soluto o hacer una disolucin es agregar solvente a un soluto o bien agregar
soluto a un solvente.

3.3. Solubilidad

Se define como solubilidad a la cantidad mxima de un soluto que puede disolverse en una
solucin. Habitualmente se expresa en g/100 ml o g/l, pudindose expresar en submltiplos para
sustancias poco solubles.
Si a un solucin se le agrega ms soluto que el valor de la solubilidad, se disolver el valor
correspondiente a la solubilidad y el resto permanecer en el fondo como soluto. En este caso la
solucin obtenida se dice que es una solucin saturada.
Ejemplo: El cloruro de sodio tiene una solubilidad de 359 g/l. Esto implica que si en un litro de
solucin tenemos 359 g, el sistema ser homogneo y todo el cloruro de sodio permanecer en
solucin. Sin embargo, si en un litro de solucin quisiramos disolver 459 g, slo 359 g
permaneceran disueltos y los otros 100 g quedaran en el fondo como un "precipitado" en forma de
droga slida.
En base a la solubilidad se pueden clasificar a las soluciones en: saturadas, no saturadas y
sobresaturadas.

3.3.1. Solucin saturada

Es aquella solucin que tiene disuelta la mxima cantidad de soluto permitida por la solubilidad.
Por ejemplo, una solucin de NaCl que tiene 359 g/l es saturada.

32
SISTEMAS MATERIALES

3.3.2. Solucin no saturada

Es aquella solucin que tiene disuelto una masa de soluto menor a la solubilidad. Por ejemplo, una
solucin de NaCl 10 g/l

3.3.3. Solucin sobresaturada

Es aquella solucin que tiene ms soluto disuelto que la solubilidad. Por ejemplo, una solucin de
NaCl 400 g/l. Estas soluciones son inestables y pueden permanecer por poco tiempo como sistemas
homogneos producindose la precipitacin del exceso. En el caso de la solucin mencionada: 400
g/l, esta solucin en algn momento, de manera espontnea desprender 41 g de NaCl que
aparecern como una nueva fase, en forma slida que se dirigir al fondo del recipiente por ser ms
denso que la solucin. Cuando en una solucin se forma un slido y este se dirige al fondo del
recipiente se dice que se ha formado un "precipitado" y que el exceso de la sustancia "precipit".
La solubilidad es dependiente de la temperatura. En general, las sustancias son ms solubles cuanto
ms alta es la temperatura, pero existen casos inversos. Para aquellas sustancias en que la
solubilidad aumenta con la temperatura, al calentar se obtendr una solucin de mayor
concentracin. Si a esta solucin se la deja regresar a la temperatura anterior, decrecer la
solubilidad y, por lo tanto, el exceso de sustancia precipitar.
Por ejemplo, para el cloruro de sodio la solubilidad en agua a diferentes temperaturas es:
35.9 %P/V 20C
36.1% P/V 30C
36.4 %P/V 40C
Si en 100 ml de solucin colocramos 50 g a 40 C se disolveran 36,4 g, quedando en el fondo del
recipiente 13,6 g. La solucin resultante sera una solucin saturada de NaCl a 40C, pero el sistema
sera heterogneo, ya que en el fondo habra NaCl slido. Si filtramos la solucin, retendremos en el
filtro el slido y ahora s tendremos una solucin saturada a 40C. Si ahora a esa solucin la
enfriamos a 20 C, momentneamente la solucin se sobresaturar, ya que a 20 C la solubilidad es
de 35,9 %P/V. Espontneamente se producir el desprendimiento de NaCl slido en una cantidad de
0,5 g, que producirn posiblemente un enturbiamiento de la solucin y la aparicin de un
precipitado de NaCl slido. La solucin resultante ser ahora saturada a 20 C y contendr 35,9
g/100 ml.

3.4. Soluciones diluidas y concentradas

Estos trminos son comunes de escuchar en la qumica y, en general, tienen un significado relativo.
Se aplica el trmino solucin diluida a una solucin que contiene baja cantidad de soluto y solucin
concentrada a aquella solucin que tiene alta cantidad de soluto disuelto. Pero la pregunta es
Cundo se considera alta o baja la cantidad? Esto no tiene regla y, por lo tanto, en general se utiliza
de forma comparativa. Supongamos que tenemos dos soluciones KCl 0,1 M y KCl 0,0001 M. La
segunda es una solucin diluida con respecto a la primera o, bien, la primera es una solucin
concentrada con respecto a la segunda.
No debemos confundir diluida-concentrada con no saturada-saturada. Por ejemplo, una solucin
saturada de NaCl tiene aproximadamente 350 g/L de soluto, es sin duda una solucin concentrada

33
SISTEMAS MATERIALES

por la elevada cantidad de soluto por litro. Sin embargo, una solucin saturada de CaCO3 tiene
0,013 g/L, pero por su baja cantidad de soluto en un litro decimos que es diluida.

3.5. Otros trminos aplicables a soluciones

3.5.1. Solucin madre

Es aquella solucin a partir de la cual preparamos otra solucin por dilucin. Por ejemplo, si a partir
de una solucin de NaOH 0,1 M preparamos por dilucin una solucin de NaOH 0,03 M, la
solucin de NaOH es la solucin madre. La solucin de NaOJ 0,03 M es la solucin diluida.

3.5.2. Solucion isoosmolar

Es una solucion con igual osmolaridad que otra.

3.5.3. Solucin hiperosmolar

Es una solucin que tiene mayor osmolaridad que otra.

3.5.4. Solucin hipoosmolar

Es una solucin que tiene menor osmolaridad que otra con la cual se est comparando.

3.6. Soluciones con mezcla de solutos

Cuando una solucin tiene ms de un soluto se procede a describir cada uno de ellos con las formas de
concentracin ya explicadas.
Por ejemplo, si en 1 litro de solucin disolvimos 4 g NaOH (PM 40 uma) y 5,85 g de NaCl (PM 58.5
uma), describimos a la solucin como: NaOH 4 g/l, NaCl 5,85 g/l.
Tambin podra describirse de la siguiente manera:
NaOH 4 g
NaCl 5,85 g
H2O csp 1000 ml
Suele ser muy til conocer la osmolaridad de la solucin. Las osmolaridades son las nicas formas de
concentracin que se suman y se expresa la osmolaridad total de la solucin. Para el caso anterior
calculemos la osmolaridad total:
40 g NaOH .................. 2 osmol
4 g NaOH .................. x = 0,2 osmol
como 2 osmoles estn en 1 L, entonces es 0,2 Osm
Para el NaCl:

34
SISTEMAS MATERIALES

58,5 g NaCl ....................2 osmoles


5,85 g .......................... 0,2 osmoles, que al estar en 1 L dan una concentracin de 0,2 Osm.
La solucin tiene entonces una concentracin de 0,4 Osm.

3.7. Propiedades coligativas de soluciones

Se conocen como propiedades coligativas a aquellas propiedades que dependen del nmero de
partculas y no de la cantidad de gramos o la naturaleza del soluto. Tal es el caso del ascenso
ebulloscpico, el descenso crioscpico y la presin osmtica.

35
SISTEMAS MATERIALES

3.8. Prctica

Puede realizar una ejercitacin on-line. Haga click en el siguiente link:


https://docs.google.com/forms/d/e/1FAIpQLSfrB5bz_uKQmPKAqATbZhTFxKmfMH_hCdIwi9wxQ
kWjX6swuw/viewform
Para ver las respuestas visite el siguiente link:
https://docs.google.com/forms/d/e/1FAIpQLSfrB5bz_uKQmPKAqATbZhTFxKmfMH_hCdIwi9wxQ
kWjX6swuw/viewform?
entry.545641722=un+sistema+material&entry.475480426=tres+fases+y+tres+componentes&entry.106
9271098=en+un+solvente+se+disuelve&entry.1912923201=47+y+por+lo+tanto+tiene+47+protones+
en+su+n%C3%BAcleo&entry.691192818=son+is%C3%B3tonos&entry.430466374=P%C3%A9rez,
+Juan&entry.1233883546=25852147

1) Dado el siguiente sistema indicar:


N
2
vapor agua

Fe

Solucin NaCl

a) Nmero de fases
b) Nmero de sustancias simples que forman el sistema.
c) Cantidad de elementos presentes en el sistema.
2) Dado el siguiente sistema indicar:

vapor agua

hielo

agua con NaCl

NaCl

a- Nmero de fases
b- Nmero de sustancias simples que forman el sistema.
c- Cantidad de elementos presentes en el sistema.
d- Como separara los componentes del sistema

36
SISTEMAS MATERIALES

3) Dado el siguiente sistema indicar:


O
2
vapor agua

hielo

Solucin KCl

KCl solido

a- Cantidad de sustancias compuestas.


b- Nmero de elementos presentes en el sistema.
c- Nmero de fases.
4) Se tiene un recipiente con agua y KCl disuelto, indicar:
a- Nmero de fases
b- Nmero de componentes.
5) Se tiene un recipiente con solucin acuosa de KCl, indicar:
a- nmero de fases.
b- nmero de componentes.
6) Dado el siguiente sistema indicar:

vapor agua

hielo

agua con NaCl

NaCl

a- Si es homogneo o heterogneo
b- nmero de fases.
c- nmero de componentes.
d- cmo separara los componentes del sistema?
7) Se tiene un recipiente con solucin acuosa de NaOH, indicar:
a- nmero de fases.
b- nmero de componentes.
8) Se disuelven 5 g de HNO3 (peso molecular 63) en 3500 ml de agua. A esta solucin se le agrega
agua hasta un volumen final de 7500 ml. Calcular la M de la solucin final.
9) Se disuelven 0,55 moles de HCl (peso molecular 36,5) en 700 ml de agua. Calcular la concentracin
de la solucin final expresada en g% .
10) Calcular la molaridad de la solucin que se obtiene al disolver 0,8 equivalentes de Ca(OH)2 en

37
SISTEMAS MATERIALES

1500 ml de agua. Peso molecular Ca(OH)2= 74.


11) Calcular la Normalidad de la solucin que se obtiene al disolver 0,8 g de KOH en 500 ml de agua.
Peso molecular KOH= 56.
12) Se disuelven 3 g de NaOH en 500 ml de agua (solucin inicial) . A esta solucin se le agrega agua
hasta un volumen final de 2500 ml (solucin final). Calcular la M de la solucin final.
13) Se disuelven 0,4 g de NaOH en 1500 ml de agua. A esta solucin se le agrega agua hasta un
volumen final de 2500 ml. Calcular la M de la solucin final. Peso molecular NaOH= 40.
14). Se disuelven 4 g de NaOH en 500 ml de agua. A esta solucin se le agrega agua hasta un volumen
final de 2500 ml. Calcular la N de la solucin final. Peso molecular NaOH= 40.
15) Se disuelven 4 g de sulfato de sodio (PM 142) en 500 ml de agua.
a- Escribir la formula molecular
b- Calcular la concentracin de la solucin.
16) Se dispone de una solucin 0,5 M de HCl (PM 36,5), densidad: 1,18 g/cm 3 que contiene 2,5 g de
ese cido:
a- Qu volumen tiene la solucin?
b- Cual es su % P/V?
17) Qu volumen de una solucin al 36 % P/P de cido clorhdrico (HCl, PM 36,5), densidad: 1,18
g/cm3 contiene 2,5 g de ese cido ?
18) Cuntos equivalentes de cido clorhdrico hay en 35 ml de solucin de HCl al 36 % P/P? (HCl,
PM 36,5), densidad: 1,18 g/cm3 ?
19) Se disuelven 0,25 moles de HCl obtenindose una solucin al 36 % P/P de cido clorhdrico (HCl,
PM 36,5), densidad: 1,18 g/cm3. Calcular el volumen preparado.
20) Qu volumen de una solucin al 36 % P/P de cido clorhdrico (HCl, PM 36,5), densidad: 1,18
g/cm3 contiene 0,3 mol g. de ese cido ?
21) Se disuelven 0,2 g de cloruro de calcio (CaCl 2, PM 111) en 250 cm3 de solucin; a la misma se le
agregan 3000 ml de agua. Cul es la concentracin de la solucin final expresada en % P/V?
22) Se disuelven 0,5 moles de NaCl en 1500 ml de solucin.
a- Calcular la molaridad.
b- Calcular el % P/V.
c- Si a la solucin original se le agrega agua hasta 2000 ml, cuantos moles contiene el recipiente?
23) Se disuelven 0,5 moles de NaCl en 1500 ml de solucin.
a- Calcular la normalidad.
b- Calcular el % P/V.
c- Si a la solucin original se le agrega agua hasta 3000 ml, cuantos moles contiene el recipiente?
24) Se disuelven 0,5 moles de NaCl en 1500 ml de solucin.
a- Calcular la osmolaridad.
b- Calcular el % P/V.

38
SISTEMAS MATERIALES

c- Si a la solucin original se le agrega agua hasta 5000 ml, cuantos moles contiene el recipiente?
25) Se disuelven 2,7 g de cloruro de calcio (CaCl2, PM 111) en 1700 cm3 de solucin; a la misma se le
agregan agua hasta un volumen final de 3000 ml. Cul es la concentracin de la solucin final
expresada en M?
26) Calcular cuntos gramos de sulfuro cido de potasio son necesarios para preparar 200 cm3 de
solucin al 3 % P/V.
27) Cuntos ml de una solucin cuya concentracin es 50 % P/P de cido clorhdrico, d: 1,25 g/cm 3
contienen disuelto 0,1 molcula gramo de soluto?
28) Calcular la molaridad de la solucin que contiene 0,2 g de cloruro de calcio en 250 cm 3 de
solucin?
29) Cuntos gramos de cido sulfrico estarn contenidos en 20 cm3 de solucin 0,5 N?
30) Calcular la molaridad de una solucin de cloruro de sodio que tiene disuelto 2 g de soluto en 150
cm3 de solucin.
31) Una solucin de hidrxido de sodio que tiene 10 g de soluto disuelto en 200 ml de solucin. Cul
es su molaridad?
32) Calcular la concentracin en % P/V y M de una solucin de HCl 30% P/P d: 1,15 g/cm3
33) Calcular la concentracin expresada en % P/P y N de una solucin de cido clorhdrico 3M; d:
1,05 g/ml
34) Calcular qu volumen de solucin de cido sulfrico 0,2N se puede preparar con 98 g de cido.
35) Qu volumen de solucin de sulfato de sodio 0,25 N se podr preparar con 14,2 g de sulfato de
sodio al 50 % de pureza?
36) Cuntos ml de solucin de nitrato de amonio al 4,5 % P/P d: 1,20 g/ml se podrn preparar con
160 g de nitrato de amonio con 20 % de impurezas?
37) Hallar la concentracin emprica (g%) de una solucin de cido ntrico al 30 % P/P siendo la
densidad de la solucin 1,20 g /cm3.
38) Cuntos gramos de hidrxido de sodio son necesarios para preparar 2 litros de solucin 0,25 N?
39) Se desea preparar 2 litros de solucin 0,5 N de cido ntrico a partir de una solucin 63 %P/P d:
1,2 g/ml , cuntos ml del mismo necesito?
40) Calcular la molaridad de una solucin que contiene 60 g de hidrxido de sodio por litro de
solucin.
41) Hallar la normalidad de una solucin de cido sulfrico puro que tiene una densidad de 1,84 g/ml
y una concentracin de 96 %P/P.
42) Una solucin de cido sulfrico tiene una concentracin de 96 % P/P y una densidad de 1,84
g/cm3 cuntos ml de esa solucin son necesarios para preparar 1400 cm3 de una solucin que
contenga 0,001 eq del cido por mililitro?
43) Cuntos equivalentes gramo hay en 80 ml de solucin 5 N de ortofosfato de sodio?
44) Cuntos gramos de hidrxido de potasio se necesitan para preparar 4 litros de solucin 1 M ?
45) Cuntos equivalentes gramo de soluto hay en:
a- 800 ml de solucin 3 N de cido orto fosfrico.

39
SISTEMAS MATERIALES

b- 4 litros de solucin 0,5 N de una sal.


c- 4 litros de solucin 3 N de una base.
46). Qu volumen de solucin al 5 % P/V se podr preparar con 0,5 g de NaOH, PM 40 ?
47) Qu volumen de solucin de cido actico 0,2 N se podr preparar con 20 ml de solucin al 90 %
P/P d:1,07 g/ml.
48) Qu volumen de solucin de cido clorhdrico al 36 % P/P d: 1,18 g/ml es necesario para
preparar un cuarto litro de una solucin de ese cido al 1% P/V?
49) Cuntos ml de una solucin de HClO4 al 70 % P/P d: 1,70 g/ml se requieren para preparar 280
ml de una solucin de cido perclrico al 5% P/P d: 1,2 g/ml.
50) Qu volumen de cido ortofosfrico al 40 % P/P d:1,65 g/ml se necesitar para preparar 5 litros de
solucin 4 M ?
51) A 2 ml de solucin de cido clorhdrico al 36% P/P d: 1,18 g/ml se le agregan 198 ml de agua.
Calcular % P/V de la nueva solucin y cuntas veces se diluy la solucin.
52) Veinte gramos de solucin de cido ortofosfrico al 10 % P/P d: 1,15 g/ml se diluyen con agua
hasta un volumen final de 2 litros. Calcular la Normalidad de la solucin diluida.
53) Calcular la N de la solucin que resulta de agregarle 300 cm 3 de agua a 200 ml de solucin de
cido sulfrico 0,1 M .
54) Se dispone de 200 ml de solucin de hidrxido de calcio 1 M, se le agrega agua hasta un volumen
final de 500 ml. Calcular %P/V de la solucin final.
55) Cuntos ml de agua hay que agregar a 200 ml de cido sulfrico 3 N para preparar una solucin
0,5 M?
56) Ciento cincuenta mililitros de solucin de cido ntrico al 10 % P/P d: 1,20 g/ml se diluyen con
agua hasta un volumen final de 6000 ml. Calcular la normalidad de la solucin final.
57) Calcular Osm y mOsm de una solucin de ortofosfato dicido de calcio que tiene 30 g de esta sal
por cada 5 litro de solucin .PM :234.
58) Calcule la molaridad de la solucin que se obtiene disolviendo 8,7 g de K 2SO4 en 200 ml de
solucin. Calcule la Osm de la solucin despus de diluirla a la mitad.
59) Cuntos gramos de Na2SO4 (PM 142) se deben agregar a 350 ml de agua para obtener una
solucin 0,146 Osm?
60) Qu volumen de solucin de HCl al 32 % P/P d: 1,16 g/ml es necesario para preparar 0,250 litros
de una solucin 0,1 M?
61). Se colocan 30 g de (NH4)2SO4 (PM 132) en 1525 ml de solucin. A esta solucin se le agrega agua
hasta un volumen final de 7000 ml.
a- Calcular M de la solucin inicial.
b- Calcular N de la solucin diluida.
c- Cuntos osmoles hay en 500 ml de la solucin final?
62) Cuntos cm3 de solucin de sulfato de sodio 0,1N se podrn preparar con 1,1 g de sulfato de
sodio al 35 % de pureza?

40
SISTEMAS MATERIALES

3.8.1. Respuestas

1- a- 3 fases (N2, vapor - Fe - Solucin de NaCl); b- 2 (N2, Fe); c- 6 (N, H, O, Na, Cl, Fe)
2- a- 4 fases, b- ninguna; c- 4 (H, O, Na, Cl)
3- a- 2 (agua, cloruro de potasio); b- 4 (O, H, K, Cl); c- 4
4- a- 1, b- 2
5- a- 1, b- 2
6- a- heterogneo, b- 4, c- 2, d- separacin manual del hielo, filtracin del NaCl slido
7- a- 1, b- 2
8- 0,0106 M
9- 2,87 g%
10- 0,267 M
11- 0,029 N
12- 0,03 M
13- 0,004 M
14- 0,04 N
15- Na2(SO4), b- 0,8 %P/V
16- a- 137 ml; b- 1,82% P/V
17- 5,89 ml
18- 0,407 eq
19- 21, 48 ml
20- 25,78 ml
21- 0,00615 % P/V
22- a- 0,33 M, b- 1,95%P/V, c- 0,5 moles
23- a- 0,33 N, b- 1,95%P/V, c- 0,5 moles
24-a- 0,66 Osm, b- 1,95%P/V, c- 0,5 moles
25- 0,0081 M
26- 6 g
27- 5,88 cm3
28- 0,0072 M
29- 0,49 g
30- 0,227 M
31- 1,25 M
32- 34,5 %P/V; 9,5 M
33- a- 10,42 %P/P; 3 N

41
SISTEMAS MATERIALES

34- 10000 cm3


35- 400 ml
36- 2370 cm3
37- 36 g%
38- 20 g
39- 83,3 ml
40- 1,5 M
41- 36,05 N
42- 38,84 ml
43- 0,4 eq.g
44- 224
45-a- 2,4, b- 2, c- 12
46- 10 ml
47-1605
48- 5,9 ml
49- 14,12 ml
50- 2970 ml
51- 0,42 % P/V - 100 veces
52- 0,0306 N
53- 0,08 N
54- 2,96 %P/V
55- 400 ml
56- 4,76x10-2 N
57- 0,077 Osm; 77mOsm
58- 0,25 M, 0,375 Osm
59- 2,42 g de sulfato de sodio
60- 2,46 ml
61- a- 0,149 M, b- 0,064 N, c- 0,049 osmoles
62- 54,2 ml

42
REACCIONES QUMICAS

4. REACCIONES QUMICAS

4.1. Reacciones qumicas

Son aquellos fenmenos en los cuales se produce cambio de la sustancia. Por ejemplo cuando se
quema un papel,al terminar la transformacin no se tiene ms papel, sino una mezcla de gases: dixido
de carbono y agua. En otros trminos se produjo un fenmeno qumico.
Para estudiar las transformaciones qumicas, es necesario saber escribir las mismas. La escritura de una
reaccin qumica se hace a travs de una ecuacin qumica. Para poder escribir ecuaciones qumicas es
necesario saber escribir frmulas qumicas.
Por ejemplo sabemos que al reaccionar cido clorhdrico con hidrxido de sodio se forma cloruro de
sodio y agua. Este fenmeno qumico se puede representar mediante la ecuacin

HCl + NaOH NaCl + H2 O

Las sustancias de la izquierda se llaman reactivos y las de la derecha productos.


Otro ejemplo: cuando reacciona hidrxido de sodio con cido sulfrico se forma sulfato de sodio y
agua, esto queda representado con la ecuacin

H2SO4 + NaOH Na2 SO4 + H2 O

Al escribir una reaccin es importante que la cantidad y calidad de tomos presente entre los reactivos
sea igual al de los productos, esto es que se cumpla la Ley de conservacin de los elementos y la
materia. Para lograrlo se procede a balancear la ecuacin, es decir anteponer a las frmulas un nmero,
que lleva el nombre de coeficiente estequiomtrico. Realizando este procedimiento la ecuacin
balanceada quedar

H2SO4 + 2 NaOH Na2 SO4 + 2 H2 O

Escrita de esta manera la ecuacin indica que cuando reaccione un mol de cido sulfrico con dos
moles de hidrxido de sodio se formar un mol de sulfato de sodio y dos moles de agua.

4.2. Ecuaciones moleculares, inicas e inicas netas

La ecuacin desarrollada en el tem anterior es la ecuacin molecular. Si los compuestos son inicos
los mismos en solucin se encontrarn disociados. Si los compuestos son covalentes en solucin se
encontrarn como molculas. La ecuacin anterior la podemos escribir

43
REACCIONES QUMICAS

2 H+ + SO4= + 2 Na+ + 2 OH- 2 Na+ + SO4= + 2 H2 O

que es la ecuacin inica total. Como se puede observar, catin sodio y el anin sulfato estn
inalterados a ambos lados de la ecuacin, lo que indica que ellos no sufrieron cambios, por lo tanto la
ecuacin la podemos escribir

2 H+ + 2 OH- 2 H2 O

que es la ecuacin inica neta, que representa el cambio neto ocurrido durante la reaccin: se form
agua a partir de la neutralizacin entre protn y oxhidrilo.

4.3. Prctica

1) Completar y balancear la siguiente ecuacin, de manera que se obtenga una sal oxigenada
monocida

H3PO4 + Ca(OH)2. ........ + .........

2). Completar y balancear las siguientes ecuaciones

a- H3PO3 + Mg(OH)2 Mg3(PO3)2 + .......

b- H3SbO4 + Ni(OH)2 Ni3(SbO4)2 + .......

c- H2SO4 + Al(OH)3 Al2(SO4)3 + .......

d- H3PO4 + Ca(OH)2 Ca3(PO4)2 + .......

3). Completar y balancear las siguientes ecuaciones, de manera que uno de los productos sea una sal
oxigenada neutra.

a- H2SO3 + Fe(OH)3 .......... + .........

b- H2SO4 + Co(OH)3 .......... + .........

44
REACCIONES QUMICAS

c- HNO3 + Co(OH)3 .......... + .........

4). Escribir la ecuacin de obtencin del nitrato de potasio a partir del cido ntrico y el hidrxido de
potasio

4.3.1. Respuestas

1- H3 PO4 + Ca(OH)2 Ca(HPO4) + 2 H2 O


2- a- 2 H3 PO3 + 3 Mg (OH)2 Mg3 (PO3)2 + 6 H2 O
b- 2 H3 SbO4 + 3 Ni (OH)2 Ni3 (SbO4)2 + 6 H2 O
c- 3 H2 SO4 + 2 Al(OH)3 Al2 (SO4)3 + 6 H2 O
d- 2 H3 PO4 + 3 Ca (OH)2 Ca3 (PO4)2 + 6 H2 O
3- a- 3 H2 SO3 + 2 Fe (OH)3 Fe2 (SO3)3 + 6 H2 O
b- 3 H2 SO4 + 2 Co (OH)3 Co2 (SO4)3 + 6 H2 O
c- 3 HNO3 + Co (OH)3 Co (NO3)3 + 3 H2 O
4- HNO3 + K (OH) K (NO3) + H2 O

45
ESTEQUIOMETRA

5. ESTEQUIOMETRA

Como ya hemos visto la qumica estudia la materia y sus transformaciones. La materia se puede
presentar en forma de diferentes sustancias, las que difieren en la cantidad y calidad de los tomos
que la forman.

5.1. Cantidad de sustancia

En la qumica es importante a cada paso tener una certeza de la cantidad de cada sustancia presente
en un sistema. La cantidad de sustancia o materia es una magnitud cuantitativa en cierto grado
continua. La cantidad de una sustancia puede expresarse en diferentes unidades, la ms comn es el
gramo, pero tambin se pueden utilizar otras formas, como ser: el mol (o molcula gramo), el
equivalente (o equivalente gramo), el osmol, el nmero de molculas o tomos. Puede ver este
captulo en vdeo a travs del siguiente link: https://youtu.be/0p3ZPpd8HVc
Toda sustancia pura tiene un peso molecular. Esto es un dato que hace referencia al tamao de la
molcula. El peso molecular se calcula sumando los pesos atmicos de los elementos que componen la
molcula. Este dato puede presentarse sin unidades, en gramos, en uma (unidad de masa atmica) o en
Dalton (Da) ste ltimo es sinnimo de uma. Si bien sta ltima es la forma adecuada, ser ms comn
para nosotros el gramo, aunque sabemos que no es lo correcto. Ejemplo: El NaCl tiene un PM de 58,5
y la albmina de 60000; la molcula de albmina es ms grande que la de cloruro de sodio.
Veamos algunos ejemplos sobre unidades de cantidad de soluto
Ejemplo 1
NaCl (cloruro de sodio). La frmula est compuesta por un catin sodio y un anin cloruro. Al
disociarse se forma un catin (una carga positiva) y anin (una carga negativa). Siempre deben
coincidir la cantidad de cargas positivas y negativas.
NaCl: Na+ + Cl-
Para el caso del cloruro de sodio, el peso molecular es 58,5.
Calculemos las diferentes formas en las que se puede expresar la cantidad de sustancia. Siempre, el
peso molecular expresdo en gramo es igual a 1 molcula gramo (a la que en simplificamos llamndola
mol), adems es igual a tantos equivalentes gramo (a los que solemos llamar simplemente equivalente)
como cargas positivas o negativas tiene la sustancia al disociarse y a tantos osmoles como partculas se
formaron. A partir de un mol de cloruro de sodio se formaron un sodio (una carga positiva) y un
cloruro (una carga negativa) por lo tanto hay 1 equivalente; y como se form un sodio y un cloruro, dos
partculas, entonces hay dos osmoles.
58,5 g = 1 molcula gramo = 1 equivalente gramo = 2 osmoles

Ejemplo 2:
CaCl2, cloruro de calcio,cuyo peso molecular es 111.
CaCl2: Ca++ + 2 Cl-
A partir de una molcula se form un catin calcio con dos cargas positivas y dos aniones cloruro cada
uno con una carga negativa (se formaron dos cargas positivas y dos negativas), por lo tanto

46
ESTEQUIOMETRA

111 g = 1 molcula gramo = 2 equivalentes gramo = 3 osmoles

Ejemplo 3:
Ca3(PO4)2, fosfato de calcio, peso molecular 310.
Ca3(PO4)2 : 3 Ca++ + 2 PO43-
Se han formado 3 cationes calcio y dos aniones fosfato, 5 partculas lo que corresponde a 5 osmoles.
Los tres iones calcio tienen 6 cargas positivas y los dos iones fosfato 6 cargas negativas, por lo tanto
tienen 6 equivalentes. Resumiendo los datos:
310 g = 1 molcula gramo = 6 equivalentes gramo = 5 osmoles.

Ejemplo 4:
Urea, peso molecular 60. Es un no electrolito; al colocar una molcula en agua dar origen a una sola
partcula (1 osmol) y sin carga (no se calcula equivalente). Por lo tanto:
60 g = 1 molcula gramo = 1 osmol.
Son sustancias no disociables: glucosa, manitol, sacarosa y en general todo soluto que no sea sal, cido
o hidrxido.
Otras definiciones: ya se vio como calcular cuantos moles, equivalentes y osmoles existen en el peso
molecular. Ahora veamos las definiciones de ellos, teniendo en cuenta que el nmero 6x10 23 , al que se
denomina Nmero de Avogadro. El nmero de Avogadro expresa una cantidad de unidades que se
denomina "mol". Como la palabra "docena" hacer referencia a doce unidades de algo, "mol" hace
referencia a 6*1023 de algo. As podemos redefinir algunos trminos.
Molcula gramo: cantidad de sustancia que contiene 6x10 23 molculas o un Nmero de Avogadro de
molculas.
Equivalente gramo: cantidad de sustancia que contiene 6x1023 cargas o valencias o un Nmero de
Avogadro de cargas o valencias.
Osmol: cantidad de sustancia que contiene 6x1023 partculas o un Nmero de Avogadro de partculas.

5.2. Reacciones qumicas y relaciones estequiomtricas

Como se vio anteriormente, una ecuacin qumica es la forma de representar una reaccin qumica. Si
analizamos una reaccin qumica, por ejemplo la formacin de cloruro de sodio y agua a partir de
cido clorhdrico e hidrxido de sodio. Esta reaccin se representa con las siguiente ecuacin. Las
sustancias de las que parto (en este caso cido clorhdrico e hidrxido de sodio) son los reactivos y se
colocan a la izquierda. Las sustancias que se forman, en este caso el cloruro de sodio y el agua, son los
productos y se colocan a la derecha, separando los productos de los reactivos por una flecha

HCl + NaOH NaCl + H2O

47
ESTEQUIOMETRA

Luego de escribir las frmulas de los reactivos y productos, la reaccin se debe balancear de manera
que la cantidad de tomos que se hallan a la izquierda, es decir entre los reactivos, sea igual a la que se
halla entre los productos. En el caso anterior vemos que la cantidad de tomos ya est balanceada al
escribir las frmulas. Si no lo estuviera se utilizaran coeficientes estequiomtricos para hacerlo
(nmeros que se colocan delante de las frmulas y veremos ms adelante). En esta ecuacin cada
frmula se puede interpretar que tiene un 1 delante

1 HCl + 1 NaOH 1 NaCl + 1 H2O


Lo que nos indica que 1 mol de cido clorhdrico reacciona con 1 mol de hidrxido de sodio para dar
1mol de cloruro de sodio y 1 mol de agua, esto se podra escribir debajo de la ecuacin, no slo
expresando la relacin en moles sino tambin en gramos, equivalentes, osmoles y molculas.

HCl + NaOH NaCl + H2O


1mol 1 mol 1 mol 1 mol
36,5 g 40 g 58,5 g 18 g
1 eq 1 eq 1 eq 1 eq
2 osmol 2 osmol 2 osmol 1 osmol
23 23 23
6x10 molculas 6x10 molculas 6x10 molculas 6x1023 molculas

En base a esta relacin se puede decir que 1 mol de HCl reacciona exactamente con 1 equivalente de
NaOH y forman 58,5 g de NaCl y 6x10 23 molculas de agua. Cualquier otra relacin tambin es
vlida.

5.3. Principios bsicos de la estequiometra

Es la parte de la qumica que estudia las relaciones entre las cantidades de los diferentes reactivos y
productos que intervienen en una reaccin qumica.
Este tema es inminentemente prctico. Es imprescindible la escritura de una reaccin balanceada para
su resolucin.
Podemos tener problemas de estequiometra donde intervengan sustancias puras, impuras, soluciones o
gases, sin embargo las reacciones qumicas se realizan siempre con sustancia puras. Las sustancias
pueden estar en cantidades exactas para la reaccin o bien puede existir exceso o defecto de alguna de
ellas. Plantearemos ejemplos tpicos de cada uno.
Como dijimos la estequiometra es una parte de la qumica que estudia las reacciones qumicas desde
el punto de vista cuantitativo, relacionando cantidad de reactivos y productos consumidos o formados.
Veremos unos breves ejemplos para conocer el tema, sabiendo que las situaciones pueden ser
muchsimo ms complejas. Veamos el siguiente problema e intentemos dar una respuesta a la pregunta.
Cuntos gramos de xido de sodio y de agua son necesarios para obtener 20 gramos de hidrxido de
sodio?
La pregunta me da a entender la reaccin que est ocurriendo. En este caso se forma hidrxido de
sodio a partir de agua y xido de sodio. Coloquemos la frmula de los reactivos a la izquierda y la de

48
ESTEQUIOMETRA

los productos a la derecha.


En base a la ecuacin:
Na2 O + H2 O 2 NaOH
esta reaccin necesita balancearse, es decir colocar un coeficiente esteqiometrico 2 delante del agua
para que la cantidad de tomos a la izquierda y la derecha quede igual

Na2O + H2O 2 NaOH


1 mol 1 mol 2 mol
62 g 18 g 80 g

Calcule los pesos de xido de sodio y agua necesarios para formar 20 g de hidrxido de sodio.
Resolucin: Ya tenemos la ecuacin balanceda, completamos con las cantidades estequiomtricas, slo
moles y gramos
respondemos la primer pregunta Cuntos gramos de xido de sodio son necesarios?. La ecuacin
estequiomtrica establece que 80 g de NaOH se forman a partir de 62 g de Na2O.
80 g NaOH ........ 62 g Na2O
20 g " ........ x = 15,5 g de Na2O
La segunda pregunta: Cuntos gramos de agua son necesarios?. Por la ecuacin estequiomtrica
sabemos que 80 g de NaOH se forman a partir de 18 g de agua, entonces
80 g NaOH ........ 18 g H2O
20 g " ........ x = 4,5 g de H2O

Hagamos otra preguntas!


Cuntos gramos de NaOH se formarn con 3 moles de Na2O y agua en exceso?
En base a la ecuacin puedo plantear que
2 moles Na2O ..........80 g NaOH
3 " ........ x = 120 g de NaOH

5.4. Estequiometra

Es la parte de la qumica que estudia las relaciones entre las cantidades de los diferentes reactivos y
productos que intervienen en una reaccin qumica.
Este tema es inminentemente prctico. Es imprescindible la escritura de una reaccin balanceada para
su resolucin.
Podemos tener problemas de estequiometra donde intervengan sustancias puras, impuras, soluciones o
gases. Las sustancias pueden estar en cantidades exactas para la reaccin o bien puede existir exceso o

49
ESTEQUIOMETRA

defecto de alguna de ellas. Plantearemos ejemplos tpicos de cada uno.

5.4.1. Estequiometra con sustancias puras:

Cuntos gramos de xido de sodio y de agua son necesarios para obtener 20 gramos de hidrxido de
sodio?
En base a la ecuacin:
Na2 O + H2 O 2 NaOH
Calcule los pesos de xido de sodio y agua necesarios para formar 20 g de hidrxido de sodio.
Resolucin: Ya tenemos la ecuacin balanceda, completamos con las cantidades estequiomtricas, slo
moles y gramos

Na2O + H2O 2 NaOH


1 mol 1 mol 2 mol
62 g 18 g 80 g
respondemos la primer pregunta Cuntos gramos de xido de sodio son necesarios?. La ecuacin
estequiomtrica establece que 80 g de NaOH se forman a partir de 62 g de Na2O.
80 g NaOH ........ 62 g Na2O
20 g " ........ x = 15,5 g de Na2O
La segunda pregunta: Cuntos gramos de agua son necesarios?. Por la ecuacin estequiomtrica
sabemos que 80 g de NaOH se forman a partir de 18 g de agua, entonces
80 g NaOH ........ 18 g H2O
20 g " ........ x = 4,5 g de H2O

5.4.2. Estequiometra con reactivos en exceso y defecto

Se hacen reaccionar 7,2 g de xido de calcio con 3 gramos de agua:


a- Qu reactivo est en exceso?
b- Calcule la masa de hidrxido de calcio formada.
Resolucin: Primeramente escribiremos la ecuacin qumica
CaO + H2O Ca(OH)2
1 mol 1 mol 1 mol
56 g 18 g 74 g
a- Segn la ecuacin estequiomtrica reaccionan exactamente 56 g del xido con 18 g de agua, lo que
permite plantear

50
ESTEQUIOMETRA

56 g CaO ........ 18 g H2O


7,2 g " ........ x = 2,3 g de H2O
esto indica que para reaccionar exactamente con los 7,2 g de xido son necesarios 2,3 g de agua. Segn
el enunciado se dispones de 3 gramos de agua, por lo tanto sta se encuentra en exceso. Slo
reaccionarn 2,3 g de agua, hasta que se agote el CaO, quedando sin reaccionar 0,7 g de agua.
b- La segunda pregunta es cunto se forma del hidrxido. La cantidad de hidrxido que se formar
depender del reactivo limitante (CaO), que es el reactivo que se agota primero. El planteo es el
siguiente
56 g CaO ........ 74 g Ca(OH)
7,2 g " ........ x = 9,51 g de Ca(OH)

5.4.3. Estequiometra con sustancias impuras

Cuntos gramos de ortofosfato de plata se obtienen al hacer reaccionar 10 g de cido ortofosfrico al


80 % de pureza y 30 g de nitrato de plata con 30 % de impurezas?
Resolucin: lo primero es escribir la ecuacin estequiomtrica
H3PO4 + 3 AgNO3 Ag3PO4 + 3 HNO3
1mol 3 mol 1 mol 3 mol
98 g 510 g 419 g 189 g
Resolucin: en este problema tenemos sustancias reaccionantes expresadas con su grado de pureza o
impureza. El primer paso es obtener los gramos de sustancia pura.
Acido ortofosfrico al 80% de pureza , significa que cada 100 g del material que disponemos para la
reaccin slo 80 g son de H 3PO4 puro y 20 g son otra sustancia que no es de nuestro inters. As
planteamos
100 g material ........ 80 g H3PO4
10 g " ........ x = 8 g H3PO4 puros
lo mismo planteamos para el nitrato de plata que tiene el 30 % de impurezas (70 % pureza)
100 g material ........ 70 g AgNO3
30 g " ........ x = 21 g AgNO3 puros

En este momento conocemos que 8 g de H3PO4 reaccionan con 21 g de AgNO3. La pregunta que nos
debemos hacer es Estn en cantidades exactas o tenemos algn reactivo en exceso?. Para responder
esta pregunta hacemos el planteo del problema anterior. Segn la ecuacin estequiomtrica 510 g
AgNO3 reaccionan exactamente con 98 g H3PO4
510 g AgNO3 ........ 98 g H3PO4
21 g " ........ x = 4,04 g H3PO4
Como disponemos de 8 g de H 3PO4 puro, ste se encuentra en exceso. La cantidad de Ag 3PO4 que se
formar depender del reactivo limitante, es decir el nitrato de plata

51
ESTEQUIOMETRA

510 g AgNO3 ........ 419 g Ag3PO4


21 g " ........ x = 17,3 g Ag3PO4

5.4.4. Estequiometra con soluciones

Calcule cuntos gramos de cido sulfrico son necesarios para neutralizar 2400 ml de solucin 0,5 N
de hidrxido de potasio.
Resolucin: Escribimos la ecuacin estequiomtrica

H2SO4 + 2 KOH K2SO4 + 2 H2O


1mol 2 mol 1 mol 2 mol
98 g 112 g 174 g 36 g
2 eq 2 eq 2 eq 2 eq
Primeramente calcularemos cuantos equivalente de KOH tenemos en la solucin
1000 ml sol ........ 0,5 eq KOH
2400 ml " ........ x = 1,23 eq KOH
Como conocemos que 2 eq de KOH reaccionan con 98 g de H2SO4
2 eq KOH ........ 98 g H2SO4
1,2 " ........ x = 58,8 g "

5.4.5. Estequiometra con gases

Calcular la masa (gramos) y el volumen (litros) de dixido de carbono que se obtiene al descomponer
trmicamente 10 g de carbonato de calcio, cuyo peso molecular es 100 uma.
CaCO3 CO2 + CaO
1mol 1 mol 1 mol
100 g 44 g 56 g
22,4 litros
Conocemos que 100 gramos de carbonato de calcio producen 44 g de CO2, entonces
100 g CaCO3 ........ 44 g CO2
10 " ........ x = 4,4 g "

Para cualquier gas, 1 mol del mismo en condiciones normales de presin y temperatura (CNPT) es
decir a una presin de 1 atmsfera y una temperatura de 0C, ocupa un volumen de 22,4 litros,
entonces.

52
ESTEQUIOMETRA

100 g CaCO3 ........ 22,4 litros CO2


10 " ........ x = 2,24 "

5.5. Prctica

Puede realizar una prctica on line accediendo al siguiente link:


https://docs.google.com/forms/d/e/1FAIpQLSdBAODuHMmx1srxlHC70_m2lGLpiW9CrYEkQWb
5cIx-ni2EHA/viewform?usp=sf_link
hallar las respuestas correctas en el siguiente link:
https://docs.google.com/forms/d/e/1FAIpQLSdBAODuHMmx1srxlHC70_m2lGLpiW9CrYEkQWb
5cIx-ni2EHA/viewform?usp=pp_url&entry.424969272=1+mol+de+
%C3%A1tomos&entry.939381861=una+cantidad+de+gramos+coincidente+en+n
%C3%BAmero+con+el+peso+molecular+expresado+en+umas&entry.394256723=2+moles+de+m
ol
%C3%A9culas&entry.1305294010=162.5+uma&entry.246108574=6+osmoles&entry.295629806=
P%C3%A9rez,+Juan&entry.855171922=14258963

5.6.

1)Se hacen reaccionar 0,25 equivalentes de hidrxido de sodio (Peso molecular 40) con 0,4 gramos de
cido ntrico (peso molecular 63).
a- Escribir la reaccin balanceada.
b- Cuntos gramos de nitrato de sodio se formarn?
2) Reaccionan 25 g de Al al 70 % de pureza con HCl en exceso:
a- Escribir la ecuacin balanceada.
b- Cuntos gramos de cloruro de aluminio se formarn?
3) Se hacen reaccionar 0,25 equivalentes de hidrxido de potasio (peso molecular 56) con 0,4 gramos
de cido ntrico (peso molecular 63).
a- Escribir la reaccin balanceada.
b- Cuntos gramos de nitrato de potasio se formarn?
4) Se hacen reaccionar 25 g de NaOH (peso molecular 40) con 0,3 equivalentes de HCl (peso
molecular 36,5), formndose cloruro de sodio y agua:
a- Escribir la ecuacin balanceada.
b- Indicar que reactivo est en exceso.
c- Cuntos gramos de cloruro de sodio se formarn?
5) Se hacen reaccionar 0,25 equivalentes de NaOH (peso molecular 40) con 0,4 gramos de HNO3 (peso
molecular 63), formndose nitrato de sodio y agua:
a- Escribir la ecuacin balanceada.

53
ESTEQUIOMETRA

b- Indicar qu reactivo est en exceso.


c- Cuntos gramos de nitrato de sodio se formarn?
6) Se hacen reaccionar 3,25 g de Al al 8% de impurezas con HCl en exceso.
a- Cuntos gramos de H2 se obtendrn?
b- Cuntos gramos de cloruro aluminio se formarn?
7) Se hacen reaccionar 3 g de Al con HCl en exceso, formndose cloruro de aluminio e hidrgeno:
a- Escribir la ecuacin balanceada.
b- Cuntos gramos de cloruro de aluminio se formarn?
8) Se hacen reaccionar 25 g de Fe al 35% de pureza con HCl en exceso, formndose hidrgeno y
cloruro frrico:
a- Escribir la ecuacin balanceada.
b- Cuntos gramos de cloruro frrico se formarn?
9) Se hacen reaccionar 5 g de Al con 0,2 equivalentes de HNO 3, formndose hidrgeno y nitrato de
aluminio. Cuntos gramos de nitrato de aluminio se formarn?
10) Se hacen reaccionar 25 g de Al al 70 % de pureza con 0,2 equivalentes de HCl:
a- Escribir la ecuacin balanceada.
b- Qu reactivo est en exceso?
c- Cuntos gramos de cloruro de aluminio se formarn?
d- Cuntos litros de hidrgeno en condiciones normales se formarn?
11) Se hacen reaccionar 25 g de Al con 0,2 equivalentes de HCl, formndose hidrgeno y cloruro de
aluminio:
a- Escribir la ecuacin balanceada.
b- Indicar qu reactivo est en exceso.
c- Cuntos gramos de cloruro de aluminio se formarn?
12) Se hacen reaccionar 2,5 g de hidrxido de sodio al 25 % de pureza con cido sulfrico en exceso.
Cuntos moles de sulfato cido de sodio se formarn?
13) Se hacen reaccionar 25 g de aluminio con cido clorhdrico en exceso, formndose hidrgeno y
cloruro de aluminio:
a- Escribir la ecuacin balanceada.
b- Cuntos gramos de cloruro de aluminio se formarn?
14) Calcule cuantos equivalentes gramo de cido sulfrico son necesarios para neutralizar 2400 ml de
solucin 0,5 N de hidrxido de potasio.
15) Indicar qu reactivo est en exceso y cuntos gramos de hidrxido de calcio se formarn cuando
reaccionan 7,2 g de xido de calcio con tres gramos de agua.
16) Calcular cuntos gramos de xido cuproso y oxgeno se formarn cuando se descompongan 20,1 g
de xido cprico siguiendo la reaccin 4 CuO 2 Cu2 O + O2
17) Calcular cuantos gramos estn presentes en 2,5 molculas gramo de una sustancia cuyo peso

54
ESTEQUIOMETRA

molecular es 73.
18) Calcular la masa de ortofosfato de plata que se obtendr al hacer reaccionar 20 g de cido
ortofosfrico al 40 % de pureza y 30 g de nitrato de plata con 70 % de pureza?
19) Qu volumen de solucin de cido clorhdrico 33 % P/P, d: 1,16 g/ml es necesario para
neutralizar 100 ml de solucin de hidrxido de sodio 35 % P/P, d: 1,38 g/ml.
20) a- Se hacen reaccionar 16,9 g de nitrato de plata puro con 10 ml de solucin de cido clorhdrico al
40% P/V Cuntos gramos de cloruro de plata se obtiene?
b- Calcular cuantos gramos de reactivo en exceso se han gastado.
21) Cuntos gramos de cido sulfrico sern necesarios para reaccionar con 32 g de nitrato de
sodio? Cuntos gramos de cido ntrico se formarn?
22) Calcular los gramos de dixido de carbono que se obtendrn por descomposicin trmica de 10 g
de carbonato de calcio.
23) Calcular la masa de oxgeno formada por descomposicin trmica de 250 g de clorato de potasio
en cloruro de potasio y oxgeno.
24) Calcular cuntos gramos de hidrxido de potasio son necesarios para reaccionar exactamente con
73 g de cido clorhdrico.
25) Calcular la cantidad de molculas gramo y los gramos de cido ntrico que reaccionando con
cantidad suficiente de hidrxido de zinc formaron 3 equivalentes gramo de nitrato de zinc. Calcular la
masa de hidrxido de zinc que reaccion.
26) Se hacen reaccionar 32 g de cloruro de sodio con cido sulfrico. Qu cantidad de ste ltimo es
necesaria?
27) .Cuntos gramos de hidrgeno se formarn al reaccionar 54 g de aluminio con 800 g de cido
sulfrico?
28) Indicar qu reactivo est en exceso y en qu cantidad cuando reaccionan 7,2 g de xido de calcio
con 0,167 molculas gramo de agua.
29) Calcular la cantidad de sulfato de zinc que est contenida en 400 gramos de un material de pureza
30 % .
30) Cuntos gramos de un material de cloruro de sodio con 20% de impurezas se necesitarn para
tener 240 g del compuesto puro?
31) Se hacen reaccionar 10 g de cido ortofosfrico al 80% de pureza con nitrato de plata en exceso
Cuntos gramos de ortofosfato de plata se obtienen?
32) 1,825 g de cido clorhdrico reaccionan con un exceso de carbonato de calcio al 32 % de pureza :
a- Cuntos gramos de dixido de carbono se obtienen?
b- Calcular la cantidad de material de carbonato de calcio que se ha empleado.
33) Cuntos mg de amonaco se obtienen al reaccionar 0,050 g de hidrxido de sodio al 20% de
impureza con 200 mg de sulfato de amonio con 90 % de pureza?
34) Qu cantidad de gramos de cido ortofosfrico son necesarios para que, por reaccin con 40 ml
de hidrxido de sodio 2N, se transformen totalmente en fosfato monocido de sodio.
35) Qu cantidad de nitrato de zinc se puede obtener con 1 gramo de xido de zinc al 87% de pureza?

55
ESTEQUIOMETRA

36) Calcular cuantos moles de cido hipoiodoso se obtendrn al hacer reaccionar 0,5 moles de ICl con
agua en exceso segn la ecuacin siguiente : ICl + H2O IOH + HCl
37) El dixido de carbono reacciona con el agua y el carbonato de sodio para formar carbonato cido
de sodio. Calcular cuntos gramos de bicarbonato de sodio se formarn al reaccionar 0,5 mol de
carbonato de sodio con 4,4 g de dixido de carbono y agua en exceso.
38) El nitruro de magnesio reacciona con el agua formando hidrxido de magnesio y amonaco
siguiendo la siguiente ecuacin :
N2Mg3 + 6 H2 O 3 Mg(OH)2 + 2 NH3
Cuntos gramos y molculas gramo de hidrxido de magnesio se obtendrn al reaccionar 10 g de
nitruro de magnesio? Cuantos moles de agua se gastarn?
39) Se hace reaccionar hidrxido de calcio con cido metafosfrico. Cuntos milimoles de ste ltimo
se necesitan para obtener 0,004 moles de metafosfato de calcio ?
40) Cuntas molculas gramo de amonaco se obtienen y cuntas molculas gramo de hidrgeno son
necesarias para reaccionar totalmente con 3 molculas gramo de nitrgeno?
41) Se desean obtener 4 molculas gramo de trixido de dinitrgeno. Cuntas molculas gramo y
gramos de oxgeno son necesarias?
42) Cuntos miliequivalentes de sulfato de aluminio se obtendrn al reaccionar 0,147 g de cido
sulfrico con 0,002 moles de nitrato de aluminio? Calcular la cantidad de reactivo en exceso.
43) . Cuntas molculas gramo de cloruro de plata se obtienen al hacer reaccionar 21,25 g de nitrato
de plata al 20 % de impureza con 0,2 molculas gramo de cido clorhdrico?
44) Cuntos ml de cido sulfrico al 20% P/V son necesarios para reaccionar con 16 g de hidrxido
de sodio?
45) Qu volumen de solucin de cido clorhdrico al 10 % P/V reacciona exactamente con 92 g de
nitrato de plata al 50 % de impureza.
46) Se hacen reaccionar 100 ml de solucin de cido ntrico 0,1 M con 400 ml de hidrxido de potasio
1,4 % P/V. Calcular la molaridad del nitrato de potasio en la solucin final.
47) Qu cantidad de moles de cloruro de plata se obtendrn al reaccionar 0,169 g de nitrato de plata
con 10 ml de cido clorhdrico 1 mM. Calcular cuntos gramos se gastaron del reactivo en exceso.
48) Cuntos gramos de ortofosfato de calcio se obtiene al reaccionar 44,4 g de hidrxido de calcio al
50 % de impureza con 2000 ml de cido ortofosfrico al 15% P/V.
49) Calcular cuantas molculas gramo de cido clorhdrico reaccionan y la M de la solucin de cido
clorhdrico, si sabemos que 20 ml de una solucin de cido clorhdrico es neutralizada exactamente
con 18 ml de solucin de hidrxido de potasio 0,2 M.
50) Cuntos gramos de sulfato de calcio se formarn al mezclar 10 ml de solucin de hidrxido de
calcio 0,02 N con 90 ml de cido sulfrico 0,3 M? Calcular la cantidad de gramos y equivalentes
gramo de reactivo en exceso.
51) Se hace reaccionar 2,5 g de hidrxido de sodio al 25 % de pureza con un exceso de cido ntrico al
3%. Cuntos moles de nitrato de sodio se formarn?
52) Se hacen reaccionar 2,5 g de hidrxido de sodio con 5,3 equivalentes de cido sulfrico. Cuntos
moles de sulfato de sodio se formarn?

56
ESTEQUIOMETRA

53) Se disuelven 2,7 g de cloruro de calcio (CaCl 2, PM 111) en 1700 cm3 de solucin. Cuntos g de
CaCO3 se formarn al reaccionar 1000 ml de esta solucin con un exceso de CO2?
54) Se hacen reaccionar 50 g de hidrxido de potasio al 95 % de pureza con cido sulfrico en exceso:
a- Calcular la cantidad de gramos de cido sulfrico que se utilizaron.
b- Cuntos gramos de sulfato de potasio se formarn?
55) Se hacen reaccionar 30 g de hidrxido de sodio al 75 % de pureza con 1000 ml de cido sulfrico 7
N:
a- Calcular la cantidad de gramos de reactivo en exceso.
b- Cuntos gramos de sulfato de sodio se formarn?
56) Se hace reaccionar 25 g de hidrxido de sodio con 5,3 moles de cido clorhdrico. Cuntos
gramos de cloruro de sodio se formarn?
57) Se hace reaccionar 3 g de hidrxido de sodio (PM 40) con 1000 ml de cido sulfrico 7 N (PM
98):
a- Escribir la ecuacin balanceada.
b- Cuntos gramos de sulfato de sodio se formarn?.
c- Cuntos gramos de cido sulfrico reaccionaron?

5.6.1. Respuestas

1- a- NaOH + HNO3 NaNO3 + H2O. b- 0,54 g


2- a- 2 Al + 6 HCl 2 AlCl3 + 3 H2 . b- 86,5 g
3- a- KOH + HNO3 KNO3 + H2O. b- 0,641 g
4- a- a- NaOH + HCl NaCl + H2O. b- NaOH. c- 17,55 g
5- a- NaOH + HNO3 NaNO3 + H2O. b- NaOH. c- 0,54 g
6- a- 0,33 g. b- 14,8 g
7- a- 2 Al + 6 HCl 2 AlCl3 + 3 H2. b- 14,8 g
8- a- 2 Fe + 6 HCl 2 FeCl3 + 3 H2 b- 25,4 g
9- 14,2 g
10- a- 2 Al + 6 HCl 2 AlCl3 + 3 H2 b- Al. c- 8,9 g
d- 2,24 L.
11- a- 2 Al + 6 HCl 2 AlCl3 + 3 H2 b- Al. c- 8,9 g.
12- 0,0156 moles
13- a- 2 Al + 6 HCl 2 AlCl3 + 3 H2. b- 123,6 g
14- 1,2 eq. g.
15- Agua en exceso. 9,5 g de hidrxido de calcio.
16- 18,08 g de xido cprico. 2,02 g de oxgeno.

57
ESTEQUIOMETRA

17- 182,5 g.
18- 17,3 g de ortofosfato de plata.
19- 115,12 ml.
20- a- 14,25 g. b- 3,65 g.
21- 18,4 g de cido sulfrico. 23,72 g de cido ntrico.
22- 4,4 g de CO2
23- 97,96 g de oxgeno.
24- 112 g.
25- a- 3 molculas gramo, 189 g de HNO3. b- 148,5 g de hidrxido de zinc.
26- 26,8 g
27- 6 g.
28- 0,69 g de agua.
29- 120 g.
30- 300 gramos de material.
31- 34,2 g.
32- a- 1,1 g de CO2. b- 7,81 g de material.
33- 17 mg.
34- 3,92 g.
35- 2,03 g.
36- 0,5 moles.
37- 16,8 g.
38- a- 17,4 g , 0,3 molc. g. b- 0,6 molc . g.
39- 8 mmoles
40- 9 molc g de hidrgeno. 6 molc g de amonaco
41- 6 molc .g. y 192 g.
42- 3 meq. de sulfato de aluminio, 1 mmol, 213 mg de nitrato de aluminio.
43- 0,1 molc.g.
44- 98 ml.
45- 98,8 ml.
46- 0,02 M.
47- 0,00001 mol, 0,00169 g.
48- 31 g.
49- a- 3,6x10-3 molculas gramo. b- 0,18 M.
50- a- 0,0136 g. b- 0,054 eq. g, 2,6 g.

58
ESTEQUIOMETRA

51- 0,0156 mol.


52- 0,031 mol.
53- 1,43 g.
54- a- 41,6 g cido sulfrico. b- 73,8 g de sulfato de potasio.
55- a- 315 g cido sulfrico, b- 39,9 g sulfato de sodio
56- 36,56 g NaCl.
57- b- 5,325 g, c- 3,675 g.

59
EQUILIBRIO QUMICO

6. EQUILIBRIO QUMICO

El estudio del equilibrio qumico requiere de un claro conocimiento de la estequiometra de una


reaccin. Como se vio anteriormente, una ecuacin qumica es la forma de representar una reaccin
qumica. Si analizamos una reaccin qumica, por ejemplo la formacin de cloruro de sodio y agua a
partir de cido clorhdrico e hidrxido de sodio. Esta reaccin se representa con las siguiente ecuacin.
Las sustancias de las que parto (en este caso cido clorhdrico e hidrxido de sodio) son los reactivos y
se colocan a la izquierda. Las sustancias que se forman, en este caso el cloruro de sodio y el agua, son
los productos y se colocan a la derecha, separando los productos de los reactivos por una flecha

HCl + NaOH NaCl + H2O

Luego de escribir las frmulas de los reactivos y productos, la reaccin se debe balancear de manera
que la cantidad de tomos que se hallan a la izquierda, es decir entre los reactivos, sea igual a la que se
halla entre los productos. En el caso anterior vemos que la cantidad de tomos ya est balanceada al
escribir las frmulas. Si no lo estuviera se utilizaran coeficientes estequiomtricos para hacerlo
(nmeros que se colocan delante de las frmulas y veremos ms adelante). En esta ecuacin cada
frmula se puede interpretar que tiene un 1 delante

1 HCl + 1 NaOH 1 NaCl + 1 H2O


Lo que nos indica que 1 mol de cido clorhdrico reacciona con 1 mol de hidrxido de sodio para dar
1mol de cloruro de sodio y 1 mol de agua, esto se podra escribir debajo de la ecuacin, no slo
expresando la relacin en moles sino tambin en gramos, equivalentes, osmoles y molculas.

HCl + NaOH NaCl + H2O


1mol 1 mol 1 mol 1 mol
36,5 g 40 g 58,5 g 18 g
1 eq 1 eq 1 eq 1 eq
2 osmol 2 osmol 2 osmol 1 osmol
6x1023 molculas 6x1023 molculas 6x1023 molculas 6x1023 molculas
En base a esta relacin se puede decir que 1 mol de HCl reacciona exactamente con 1 equivalente de
NaOH y forman 58,5 g de NaCl y 6x10 23 molculas de agua. Cualquier otra relacin tambin es
vlida.
Para la resolucin de problemas estequiomtricos as como la interpretacin de equilibrios qumicos es
imprescindible la escritura de una reaccin balanceada para su resolucin. Podemos tener problemas de
estequiometra donde intervengan sustancias puras, impuras, soluciones o gases, sin embargo las
reacciones qumicas se realizan siempre con sustancia puras. Las sustancias pueden estar en cantidades
exactas para la reaccin o bien puede existir exceso o defecto de alguna de ellas. Plantearemos
ejemplos tpicos de cada uno.
Los coeficientes estequiomtricos nos dan una interesante informacin respecto del requerimiento de

60
EQUILIBRIO QUMICO

compuestos para concretar una reaccin. Hagamos algunas interpretaciones.


Supongamos la reaccin entre el hidrgeno y el oxgeno para dar agua
2 H2 + O2 2 H2O
La reaccin nos indica que necesitamos 2 moles de hidrgeno para que con un mol de oxgeno se
formen dos moles de aguas.
La pregunta es Qu cantidad de agua se forma con 4 moles de hidrgeno?
La respuesta es depende de algunos factores:
1- Si hay oxgeno en exceso, podemos decir que se formarn 4 moles de agua.
El clculo sera:
2 moles de H2 ............... 2 moles de agua
4 moles de H2 ............... x= 4 moles de H2
Por supuesto que se utilizaran dos moles de O2.
2- Si no hay oxgeno presente, no se formar agua.
3- Si hay un mol de oxgeno solo se formarn dos moles de agua y sobrarn 2 moles de hidrgeno. En
este caso decimos que el oxgeno es el reactivo limitante y la cantidad de producto depender de aquel
que se halla en menor proporcin.
El concepto podemos extenderlo a situaciones ms complejas como las que hallaremos en un futuro
respecto de reacciones biolgicas. Estas reacciones son ms demandantes en recursos, en lo que
concierne a la cantidad de integrantes de una reaccin y las dependencias directas e indirectas. Si bien
comprenderemos el tema ms adelante hagamos una introduccin. Supongamos la reaccin de
formacin de glucosa-6-fosfato a partir de glucosa y ATP. Como lo muestra la Figura 6.1

61
EQUILIBRIO QUMICO

Figura 6.1

Esta reaccin requiere por cada un mol de glucosa, un mol de ATP, Mg ++, al menos una enzima (la
glucokinasa). El Mg++ es aportado por los nutrientes y el ATP por el funcionamiento de numerosas
reacciones que involucran vas catablicas y procesos de fosforilacin, los cuales utilizan entre otros
numerosos requerimientos el aporte de oxgeno.
Cmo interpretamos este proceso? La respuesta es: de la misma manera que antes.
Si la pregunta es cuantos moles de glucosa-6-fosfato se forman a partir de 1 mol de glucosa, la
respuesta es "uno" siempre y cuando nada falte de los dems componentes involucrados. Es evidente
que la falta de oxgeno, la deficiencias de cualquier gen que de origen a una de las enzimas
involucradas, la deficiencia de magnesio, decaimiento de reservas o nutrientes asi como la
acumulacin de glucosa-6-fosfato que puede inhibir a la enzima que lo produce, afectarn el
rendimiento terico planteado.
En estos sistemas complejos, donde las reacciones se hallan encadenadas o en red, con ciclos de
molculas y dependencias genticas habr que estar alerta a la hora de analizar una situacin en
particular. Hablamos de "reactivo limitante" o "componente limitante" cuando nos referimos a un
componente del sistema que es el que determina la velocidad y produccin total de procesos.
Siguiendo con el esquema anterior. tambin podemos mencionar que en algunas situaciones puede
ocurrir que no toda la estequiometra est visible y las relaciones no estn descripta de manera exacta.
Tambin podr ocurrir que analicemos un proceso y el producto en cuestin se halle en ms de un sitio
del proceso, tanto consumido como producidos. Veamos el caso de un conjunto de reacciones qumicas
que pertenecen a un proceso conocido como gluclisis, Figura 6.2

62
EQUILIBRIO QUMICO

Figura 6.2
La pregunta es Cuntas molculas de ADP se forman cuando una molcula de glucosa se transforma
en fructosa-1,6-bisfosfato?
La respuesta es 2. Como podemos ver en el proceso representado, el pasaje de glucosa a fructosa-1,6-
bisfosfato involucra tres reacciones. En la primera y tercera se forma ADP a partir de ATP. Por
supuesto la respuesta es "dos" siempre y cuando no falte nada del resto. Cul sera la respuesta
anterior si la secuencias de reacciones ocurriera en un ser vivo que carece de la enzima glucokinasa?
La respuesta sera "dos" siempre y cuando dicho individuo tenga la enzima hexokinasa. Pero la
respuesta sera "cero" si adems carece de hexokinasa.

6.1. Velocidad de reaccin

A una reaccin qumica se le puede medir su velocidad. Definamos primeramente que es una
velocidad. Velocidad es una magnitud que muestra el cambio de una variable a lo largo del tiempo.
Como ejemplo sencillo veamos la velocidad de un automvil. Esta se calcula dividiendo el espacio
recorrido por el tiempo empleado. Por ejemplo si un automvil recorri 100 km en 1 h, decimo que
tiene una velocidad de 100 km/h. De la misma manera podramos medir la velocidad a la que sale agua
por una canilla. En este caso por ejemplo si salieron 20 litros de agua en 2 minutos decimos que la
velocidad de salida del agua es de 20 litros / 2 minutos = 10 litros/minutos. La velocidad siempre nos
indica cuanto cambia el numerador por cada unidad del denominador.

63
EQUILIBRIO QUMICO

Para las reacciones qumicas es igual!


Supongamos la reaccin entre el glicerol y el ATP para dar glicerol fosfato y ADP.
glicerol + ATP glicerol-fosfato + ADP
La estequiometra nos indica que con un mol de glicerol obtendremos 1 mol de glicerol-fosfato, pero
A qu velocidad ocurrir el proceso? Cmo podemos medir dicha velocidad?
La velocidad de una reaccin se define como la cantidad de producto formado y de reactivos
consumidos en la unidad de tiempo. Por ejemplo la velocidad de esta reaccin podra ser 0,001
mol/min. Esto indica que en 1 minutos 0,001 mol de glicerol y de ATP se consumiran para formar
0,001 mol de glicerol-fosfato y de ADP en el mismo tiempo. En este caso las velocidades son iguales,
independientemente qu sustancia se considere. Si la reaccin se incia con por ejemplo 0.2 mol de
glicerol y 0,5 mol de ATP. Si se consume glicerol a razn de 0,001 mol/min, tambin se consumirn
0,001 mol de ATP por minuto. Simultneamente se formarn 0,001 mol de glicerol-fosfato y ADP por
minuto.
Asi podemos decir que la velocidad de la reaccin en funcin del glicerol es: V glicerol = - 0,001 mol/min.
El signo menos indica que se est consumiendo. Para las otras sustancias las velocidades seran:
VATP = -0,001 mol/min
Vglicerol-fosfato= 0,001 mol/min
VATP = 0,001 mol/min
Hipotticamente estas reacciones se mantendran hasta que algn reactivo se transforme en limitante y
la reaccin finalice. Ms adelante veremos que no es as y las velocidades van cambiando a lo largo del
tiempo.
Supongamos otra reaccin:
Arginina + aspartato + ATP Argininosuccinato + AMP + 2 fosfatos
Supongamos que se est gastando arginina a razn de 3 mmol/min, Cul es la velocidad de la
reaccin para el asparta, el AMP y el fosfato?
Por cada mol de arginina que se gasta tambin uno de aspartato y se forma uno de AMP. Por lo tanto
Varginina = -3 mmol/min
Vaspartato= -3 mmol/min
VAMP = + 3 mmol/min
Vfosfato = + 6 mmol/min
la diferencia en velocidad para la formacin de fosfato se debe a su coeficiente estequiomtrico.

6.2. Reacciones reversibles

Las reacciones son procesos qumicos reversibles, lo que implica que si bien los reactivos pueden
dar productos, tambin los productos pueden dar reactivos. Supongamos una reaccin
succinato + FAD fumarato + FADH2
Si en un recipiente colocramos solo succinato y FAD, al cabo de un tiempo habra menos
succinato y menos FAD, apareciendo dentro del recipiente molculas de fumarato y FADH2.

64
EQUILIBRIO QUMICO

Esto se debe a lo que llamamos la reaccin directa. Ahora, si en el mismo recipiente hubiramos
colocado fumarato y FADH2 al cabo de un tiempo habra menos moles de ambos compuestos y
habran aparecido molculas de succinato y FAD, como consecuencia de la reaccin inversa.
El equivalente a ambos procesos es un sistema de vasos comunicantes que se coloca con agua a la
izquierda o con agua a la derecha. Al cabo de un tiempo habr agua en ambos recipientes por el
flujo de agua hacia el contrario, Figura 6.3.

Figura 6.3

6.3. Velocidades de reaccin directa e inversa

Llamamos velocidad de reaccin directa a la cantidad de moles de producto que se forman o de


reactivos que se consumen, como consecuencia de la unin entre los reactivos para formar
productos. La velocidad de reaccin inversa es la cantidad de moles de reactivos que se forman o
productos que se consumen para dar reactivos. Volvamos a la reaccin
succinato + FAD fumarato + FADH2
Supongamos que se consumen 3 nmoles de succinato y 3 nmoles de FAD/ minuto. En tal situacin
se formaran simultneamente 3 nmoles de fumarato y 3 nmoles de FADH 2/ minutos y este valor
sera la velocidad de reaccin directa. Si en la misma reaccin 2 nmoles de fumarato reaccionaran
con 2 nmoles de FADH2 para formar 2 nmoles/min de succinato y FAD, esta sera la reaccin
inversa.
En este caso vemos que la velocidad a la que se forma los productos es mayor que la que se forman
los reactivos. Es decir ambas velocidades son diferentes. Para ver un vdeo sobre el tema haga click

65
EQUILIBRIO QUMICO

en el siguiente link: https://youtu.be/EUeoxoZZox0

6.4. Ley de accin de masas

Las velocidades de reaccin se pueden calcular con la ley de accin de masas, cuyo enuncia dice: la
velocidad de una reaccin es proporcional al producto de las concentraciones de los reactivos elevados
a sus coeficientes estequiomtricos. Veamos el enunciado aplicado a la reaccin anterior.
La velocidad directa ser proporcional al producto de la concentracin de gliceraldehdo-3-P, NAD y P,
elevados a sus coeficientes estequiomtricos. El hecho que sea proporcional implica que en la frmula
de velocidad aparece una constante (kd) conocida como constante de velocidad de la reaccin directa.
Asi podemos escribir la velocidad de la reaccin con la 6.1

vd =kd[gliceraldehdo3fosfato ][ NAD][P]
Ecuacin 6.1.
Prescindiendo de las unidades si la constante kd= 0,1 y las concentraciones de gliceraldehdo-3-fosfato,
NAD y P fueran: 0,1, 0,2 y 0,3 respectivamente. La velocidad directa valdra:
vd= 0,1*0,1*0,2*0,3= 0,0006
Vemos que si la concentracin de cualquiera de los reactivos aumentara al doble, la velocidad
aumentara al doble. Por ejemplo si el NAD pasa a valer 0,4, el resultado dara
vd= 0,1*0,1*0,4*0,3= 0,0012
de la misma manera podemos calcular la velocidad inversa. Segn la ley de accin de masas, la vi
quedar escrita como lo indica la 6.2
vi=ki[1,3bisfosfoglicerato][ NADH ]
Ecuacin 6.2.
Si las concentraciones de 1,3-bisfosfoglicerato y NADH fueran: 0,2 y 0,3 respectivamente y la ki= 0,2,
la velocidad inversa de la reaccin sera
vi= 0,2 * 0,2*0,3= 0,012
Vemos que la vi > vd, por lo tanto esta reaccin est cursando ms rpido desde productos a reactivos
que de reactivos a productos. Como consecuencia, las concentraciones de los reactivos aumentar y
por ende la vd y contrariamente disminuirn los productos y por ende la vi. En sntesis, partiendo de
una valor de vi>vd, se ir produciendo cambios en los reactivos y productos de manera que vi es cada
vez mayor y vd cada vez menor. Cuando ambas velocidades se igualen, se alcanzar el equilibrio
qumico y la reaccin cursar a la misma velocidad para la derecha que para la izquierda,
permaneciendo constantes las concentraciones.
Si tuviramos otra situacin para la misma reaccin en que la constante kd= 0,1 pero las
concentraciones de gliceraldehdo-3-fosfato, NAD y P fueran: 2, 2 y 3 respectivamente. La velocidad
directa valdra:
vd= 0.1*2*2*3= 1.2
Si las concentraciones de 1,3-bisfosfoglicerato y NADH se mantuvieran en los valores anteriores: 0,2 y
0,3 respectivamente y la ki= 0,2, la velocidad inversa de la reaccin sera
vi= 0,2 * 0,2*0,3= 0,012

66
EQUILIBRIO QUMICO

en esta situacin la vd>vi, por lo tanto se gastaran ms rpido los reactivos que los productos,
determinando esto que se acumulen productos y disminuyan los reactivos, como consecuencia la vd
ira disminuyendo a lo largo del tiempo y la vi ira aumentando. En un momento se alcanzara que vd =
vi y se arribara al equilibrio qumico, aun habiendo partido de una situacin diferente.
En el primer caso tenemos vi>vd.
En el segundo caso tenemos vd>vi.

6.5. Equilibrio qumico

Las dos situaciones que planteamos tenan vi diferente a vd, sin embargo en ambos casos la reaccin
llegar a una situacin en que vd=vi. Esta situacin se llama equilibrio qumico y las concentraciones
permanecern constantes, ocurriendo la reaccin directa e inversa a la misma velocidad. Podemos
considerar que en este momento la reaccin finaliz, aunque est ocurriendo a la misma velocidad para
la derecha que para la izquierda.
Si graficaramos las vd y vi para la reaccin planteada anteriormente
gliceraldehdo-3-fosfato + NAD + P 1,3-bisfosfoglicerato + NADH
suponiendo que en el recipiente al inicio solo hay reactivos con las siguientes concentraciones
gliceraldehdo-3-fosfato, NAD y P fueran: 0,1, 0,2 y 0,3 respectivamente. y suponiendo un valor kd=
0.1, la vd sera
vd= 0,1*0,1*0,2*0,3= 0,0006
suponiendo que inicialmente no existiera nada de los productos y kd fuera 0.2
vi= 0,2 * 0* 0 = 0
Por lo tanto la reaccin cursara solo para la derecha, pero no para la izquierda. Esto llevara a que se
gasten reactivos y se acumulen productos, con lo que la vd ira descendiendo y la vi aumentando, en un
momento se igualaran y se alcanzara el equilibrio qumico, Figura 6.4

Figura 6.4

Es importante resaltar que la expresin "una reaccin ocurre para la derecha" o "la reaccin ocurre
hacia la izquierda" son convencionales y hacen referencia a como est frente a nosotros la reaccin.

67
EQUILIBRIO QUMICO

Convencionalmente consideramos a los reactivos a aquellas sustancias que quedan a nuestra izquierda
y productos a los que quedan a la derecha. Consideramos que una reaccin ocurre hacia la derecha
cuando forma productos a partir de los reactivos y que la reaccin ocurre hacia la izquierda cuando los
productos o sustancias que estn a la derecha forman los reactivos.
Segn la ley de accin de masas las vd y vi se escriban

vd =kd[gliceraldehdo3fosfato][ NAD][P]
Ecuacin 6.3.
vi=ki[1,3bisfosfoglicerato ][ NADH ]
Ecuacin 6.4.
En el estado de equilibrio qumico, vd = vi
Si los primeros miembros de las igualdades son iguales, tambin lo son los segundos miembros,
pudiendo escribir la siguiente ecuacin

kd[ gliceraldehdo3fosfato][NAD ][ P]=ki[1,3bisfosfoglicerato][ NADH ]


Ecuacin 6.5.
si reordenamos la ecuacin

kd [1,3bisfosfoglicerato ][ NADH ]
=
ki [gliceraldehdo3fosfato ][ NAD ][P ]
Ecuacin 6.6.

6.6. Constante de equilibrio

El cociente entre kd y ki lo llamaremos Ke o constante de equilibrio. El valor de Ke es constante para


una dada reaccin y depende del valor de la temperatura al cual se est realizando la reaccin. Para ver
un vdeo sobre el tema haga click en el siguiente link: https://youtu.be/ZyjMzxLLx98
Definicin de Ke: cociente entre la multiplicacin de las concentraciones de los productos elevados a
sus coeficientes estequiomtricos y la multiplicacin de las concentraciones de los reactivos elevados a
sus respectivos coeficientes estequiomtricos.
Antes de interpretar el significado de Ke, hagamos otro ejemplo. Supongamos la reaccin
NH3 + 2 ATP + CO2 Carbamil fosfato + 2 ADP + P
la vd quedara

vd =kd[ NH3][ ATP]2[CO 2 ]


Ecuacin 6.7.
Note que la concentracin de ATP qued elevada al cuadrado, dado que el coeficiente estequiomtrico
del ATP es 2.
Por su parte la vi quedara

vi=ki[carbamilfosfato][ ADP] 2[P]


Ecuacin 6.8.

68
EQUILIBRIO QUMICO

En este caso tambin est elevado al cuadrado la concentracin de ADP, debido a que su coeficiente
estequiomtrico es 2.
La expresin de Ke sera
2
kd [carbamilfosfato ][ ADP ] [P ]
Ke= =
ki [NH 3 ][ ATP]2[CO 2]
Ecuacin 6.9.
Supongamos que esta reaccin al alcanzarse el equilibrio tuviera las siguientes concentraciones
carbamilfosfato = 10
ADP= 10
P =10
NH3 = 1
ATP = 1
CO2 =1
la Ke sera entonces
Ke = 10*102*10 / 1*12*1
Ke= 10000.
Como podemos ver cuando la reaccin termin (es decir cuando arrib al equilibrio) las
concentraciones de los productos son ms grandes que las de los reactivos. Situaciones de este tipo
coincidirn siempre por razones matemticas con un valor de Ke mayor que 1.
Supongamos otra reaccin
glucosa-6-fosfato fructosa-6-fosfato
escribamos su expresin de Ke

[frutosa6fosfato]
Ke=
[glucosa6fosfato]
Ecuacin 6.10.

y supongamos que al alcanzar el equilibrio las concentraciones reactivos y productos fueran


glucosa-6-fosfato = 4
fructosa-6-fosfato= 4
la Ke sera entonces
Ke = 4 / 4
Ke= 1
Vemos que si al alcanzar el equilibrio las concentraciones son iguales, el valor de Ke sera igual a 1,
independientemente de los valores de concentracin.
Veamos un ltimo ejemplo, considerando la reaccin
3-fosfoglicerato 2-fosfoglicerato

69
EQUILIBRIO QUMICO

que al arribar a su equilibrio tiene las concentraciones siguientes


2-fosfoglicerato = 0.1
3-fosfoglicerato= 10
su Ke la podemos escribir como

[2fosfoglicerato]
Ke=
[3fosfoglicerato ]
Ecuacin 6.11.
si reemplazamos los valores de las concentraciones en la constante
Ke = 0.1 / 10
Ke= 0.01
Cuando el valor de Ke es menor que 1 nos indica que las concentraciones de los productos al llegar al
equilibrio sern menores que las de los reactivos.

Conclusin e interpretacin del valor de Ke


Si al llegar al equilibrio
a- las concentraciones de productos son mayores que la de los reactivos, la Ke > 1
b- las concentraciones de los productos son menores que la de los reactivos, la Ke <1
c- las concentraciones de reactivos y productos son iguales, la Ke=1

6.7. Usos de Ke

Cul es la utilidad de conocer el valor de Ke?


Si bien tiene diversas utilidades relacionadas con el flujo de sustancias en los diferentes procesos
metablicos, las posibilidades de que una reaccin ocurra o no para un lado en particular o el valor de
energa involucrado en la reaccin, en este momento solo la utilizaremos para saber en qu condiciones
una reaccin finaliza en lo que respecta a la proporcin de reactivos y productos.

6.7.1. Anlisis del estado de equilibrio

Veamos algunos ejercicios.


1- La reaccin
citrato isocitrato
tiene una Ke=25
Analice las siguientes preguntas y sus respuestas.
a- Escriba la expresin matemtica de la Ke para esta reaccin.
Respuesta: la expresin de la Ke siempre se escribe como un cociente entre las concentraciones de los
productos y las concentraciones de los reactivos, multiplicados en cada caso entre si y elevados a sus
respectivos coeficientes estequiomtricos.

70
EQUILIBRIO QUMICO

[isocitrato ]
Ke=
[citrato]
Ecuacin 6.12.
b- Qu nos indica el valor de Ke=25?
El valor de Ke indica la relacin entre las concentraciones de productos y reactivos al finalizar la
reaccin. Un valor de Ke > 1 nos indica que cuando la reaccin alcance el equilibrio la concentracin
de los productos ser mayor que la de los reactivos. En este caso, un valor de Ke de 25 indica que al
alcanzar el equilibrio la concentracin de isocitrato ser 25 veces mayor que la concentracin de
citrato.

2- Suponga que est estudiando la reaccin


malato + NAD oxalacetato + NADH
la que al arribar al equilibrio tiene [malato]= 2 y [NAD]= 4, con un valor de Ke = 0,01
a- escriba la expresin matemtica de Ke.
Como explicamos Ke es una expresin que divide las concentraciones de los productos por las
concentraciones de los reactivos, cada uno de ellos elevados a sus coeficientes estequiomtricos. En
este caso los coeficientes estequiomtricos son todos 1, por lo que la expresin quedar.
[oxalacetato ][NADH ]
Ke=
[malato ][NAD ]
Ecuacin 6.13.
b- Cuanto estima que podran valer las concentraciones de oxalacetato y NADH en el equilibrio?
Como el valor de Ke es menor que 1, dado que las concentraciones de los reactivos valen 2 y 4, las
concentraciones de oxalacetato y NADH deberan ser menores que dicho valores para que el cociente
sea menor que 1. No calcularemos valores exactos en este caso.

3- Suponga que usted ha desarrollado un frmaco A, el cual tiene propiedades adecuadas y escasos
efectos adversos, razn por la cual decide producirlo y comercializarlo. Para obtener el frmaco A en
su laboratorio dispone de tres reacciones qumicas en las que en cada caso parte de sustancias
diferentes. Las reacciones qumicas son:
2B A
C +D 2A
D+X A +Y
como podemos ver las tres reacciones forman el producto A. Es decir si coloca B, C+D o D+X en
un recipiente hallar la sustancia A. La pregunta es Cul de ellas le conviene?Es indistinto
cualquiera de las reacciones?
Disponemos de las constantes de equilibrio. Para la primer reaccin

[A]
Ke= 2
=0,01
[B]
Ecuacin 6.14.

71
EQUILIBRIO QUMICO

para la segunda reaccin


2
[A]
Ke= =100
[C ][ D]
Ecuacin 6.15.
para la tercer reaccin
[ A ][Y ]
Ke= =100
[ D][ X ]
Ecuacin 6.16.
Suponiendo que con las tres reacciones arranco con un recipiente que solo tenga reactivos, es decir
nada de A. Al finalizar la reaccin tendr diferentes situaciones. En la primer reaccin tendr 100
veces menos de productos que de reactivos. Es decir se formar muy poco de A a partir del reactivo
B. En cambio en las segunda y tercer reaccin, que tienen un valor de Ke una centena de veces
mayor que 1, al finalizar la reaccin los productos, entre los que se halla A ser mucho mayor que
los reactivos. Es decir en el recipiente quedar mucho de A y muy poco de los productos. Por lo
tanto ambas reacciones seran beneficiosas para la produccin de A ya que forman mucho del
producto que deseamos. Tenemos algo que permita elegir entonces entre la segunda y la tercera?.
La respuesta es si. Cuando la segunda reaccin finalice en el recipiente quedar prcticamente A
puro, ya que la concentracin del reactivo remanente ser 100 veces menor. En cambio en la tercer
reaccin si bien quedar en el recipiente mucho de A, quedar la misma cantidad del producto Y, el
cual luego deber eliminar de la preparacin y me demandar gastos y tiempo. Solo se justificara
utilizar la tercer reaccin si el proceso de eliminacin de Y fuera rpido y econmico o bien que los
reactivos utilizados, D y X fueran muy accesibles en cuestiones de costos y disponibilidad.

6.8. Prediccin del estado de una reaccin

La constante de equilibrio tambin nos permite predecir si en un dado momento un reaccin est en
equilibrio y de no estarlo, nos permitir concluir si vd>vi o viceversa. Para ello definiremos primero el
cociente de reaccin al que identificaremos con la letra Q. Para ver un vdeo sobre el tema haga click
en el siguiente link: https://youtu.be/i5bRCac6LlU
Planteemos una reaccin sencilla e hipottica
A+ B C
su constante de equilibrio sera

[C ]
Ke=
[ A][B]
Ecuacin
6.17.
supongamos que en el equilibrio
[A]= 0,2
[B]= 0,5
[C]= 10
la Ke tendra entonces un valor

72
EQUILIBRIO QUMICO

10
Ke= =100
0,20,5
Ecuacin 6.18.
Que indica que en el equilibrio, las concentraciones de productos sern 100 veces mayores que la de
los reactivos.
Si las sustancias que participan de esa reaccin tuvieran las siguientes concentraciones
[A]= 4
[B]= 2,5
[C]= 10
En que estado se encuentra la reaccin?
Con estos valores, que desconocemos el estado de la reaccin planteamos el cociente de reaccin

10
Q= =1
42,5
Ecuacin 6.19.
Si Q = Ke, indica que la reaccin est en equilibrio. Nuestra primer conclusin sobre la reaccin que
estamos analizando es que no est en equilibrio.
Si el valor de Q > Ke, esto implica que para que la reaccin alcance el equilibrio, es decir que Q se
haga igual a Ke, deberan disminuir las concentraciones de los productos, que se hallan en el
numerador y aumentar las de los reactivos que se hallan en el denominador. Para que aumenten los
reactivos y disminuyan los productos, debe ser mayor la vi que la vd. Es decir que deben formarse
reactivos a mayor velocidad que lo que se forman los productos. Esta situacin es compatible con un
formacin predominante de reactivos y se dice que la reaccin est ocurriendo hacia la izquierda.
Contrariamente, si Q <Ke, en esta situacin la concentracin de los productos debera aumentar y la
concentracin de los reactivos bajar. Para que disminuyan los reactivos y aumenten los productos, tiene
que ser vd > vi. En tal situacin se formarn productos a mayor velocidad que los reactivos. Es decir la
reaccin est ocurriendo hacia la derecha.
Ejemplos.
1- Una reaccin
XY
tiene una Ke=1000 y Q=100. Responda las siguientes preguntas
a- En esta situacin est la reaccin en equilibrio?
b- Qu relacin de igualdad-desigualdad existe entre vd y vi?
c- La concentracin X estar aumentando, constante o disminuyendo?
Respondamos los tems anteriores:
a- La reaccin no est en equilibrio, ya que Q Ke.
b- Como Q < Ke, deben aumentar las concentraciones de los productos y disminuirlos reactivos, de
manera que el valor de Q aumente hasta hacerse igual a Ke. Para que Q aumente deben aumentar los
productos y bajar los reactivos. Esto ocurrir si vd> vi.

73
EQUILIBRIO QUMICO

c- si vd > vi, entonces se gastan reactivos a mayor velocidad que lo que se forman por la reaccin
inversa. Como consecuencia la concentracin de X estar disminuyendo.

6.9. Prediccin de la evolucin de una reaccin al sacarla del equilibrio

Regresemos a trabajar con la reaccin


gliceraldehdo-3-fosfato + NAD + P 1,3-bisfosfoglicerato + NADH
cuya Ke podemos expresar como

[1,3bisfosfoglicerato ][NADH ]
Ke=
[gliceraldehdo3fosfato ][ NAD][P]
Ecuacin 6.20.
y supongamos que Ke = 10
Ya sabemos su interpretacin. Si Ke = Q la reaccin estar en equilibrio. Si Q > Ke la reaccin est
ocurriendo hacia la izquierda y si Q<Ke, la reaccin est ocurriendo hacia la derecha.
Pero que ocurrira con la reaccin si modificramos la concentracin de algn productos o reactivo,
mientras la reaccin est en equilibrio? La respuesta a dicha pregunta se obtiene nuevamente con los
valores de Q y Ke.
Supongamos que estando en equilibrio, aumentamos la concentracin de NADH. Qu ocurre con las
vd, vi, Ke y Q?
En primer lugar Ke podemos decir que no se modificar ya que depende de la temperatura, para una
dada reaccin. Si observamos la expresin de Q

[1,3bisfosfoglicerato][ NADH ]
Q=
[ gliceraldehdo3fosfato][ NAD][ P]
Ecuacin 6.21.
en el equilibrio Q =10. Si en un momento aumentamos la concentracin de NADH, el valor de Q
aumentar. Cuando el valor de Q aumenta, ya vimos que vi se hace mayor que vd, comienzan a
acumularse reactivos y a decrecer los productos.
Razonemos que ocurrir si bajamos la concentracin de 1,3-bisfosfoglicerato. Esto determinar que
disminuya el valor de Q hacindose menor que Ke. Como ya vimos vd se har mayor que vi y esto
determinar que se acumulen productos.
De estas dos observaciones vemos que cuando aumentamos un producto, la reaccin ocurri en un
dado sentido pero su consecuencia fue el descenso de las concentraciones de los productos.
Contrariamente cuando decrecimos la concentracin de un producto, la reaccin ocurri de manera que
se produjo un aumento de la concentracin de los productos.
Qu ocurrira si aumentamos la concentracin del reactivo NAD?. Como el NAD forma parte del
denominador de Q, esto determinar un descenso de Q. Ante un descenso de Q se producir un
aumento de vd por encima de vi, esto llevar a acumulacin de productos y descenso de reactivos.
Concluimos que una aumento de un reactivo lleva a desplazar la reaccin de manera que los reactivos
disminuyen.
Para analizar todas las posibilidades, veamos que ocurrira si disminuimos la concentracin de P. Como
P est en el denominador de Q, esto producir un aumento de Q. Si Q aumenta vi se har mayor que vd

74
EQUILIBRIO QUMICO

y por ende disminuirn los productos y aumentarn los reactivos.

6.10. Principio de Le Chatelier

Dado que estas situaciones que analizamos se repetirn de la misma manera en cualquier otra reaccin:
un aumento de reactivos se acompaarn de cambios que hagan decrecer los reactivos, as como un
aumento de reactivos producir desplazamientos de la reaccin que hagan decrecer los reactivos. Si
aumentramos un producto, el desplazamiento del equilibrio llevar a que los productos bajen, as
como una disminucin de los productos harn que los productos aumenten. Este razonamiento nos
lleva al principio de Le Chatelier que se puede enunciar de la siguiente manera. Cuando una reaccin
se halla en equilibrio, cualquier cambio que la saque del equilibrio determinar que la reaccin ocurra
en el sentido de contrarrestar dicho cambio. Este principio nos permite analizar de manera cualitativa
qu ocurre con una reaccin en equilibrio cuando el mismo es perturbado.
Ejemplos
1- Dada la reaccin
1,3-bisfosfoglicerato + ADP 3-fosfoglicerato + ATP
Si la misma se encuentra en equilibrio, qu ocurrir con las vd y vi as como con las concentraciones si
aumentamos la concentracin de ADP.
Segn el principio de Le Chatelier, si aumentamos la concentracin de ADP la reaccin ser sacada del
equilibrio y ella para volver a alcanzar el equilibrio, disminuir la concentracin de ADP. Ahora, para
disminuir la concentracin de ADP tiene que ser la vd > vi. En estas condiciones, las concentraciones
de 1,3-bisfosfoglicerato y ADP decrecern respecto del valor que tenan inmediatamente despus del
agregado de ADP, mientras que las concentraciones de 3-fosfoglicerato y ATP aumentarn.

2- Dada la reaccin
CO2 + H20 H2CO3
Hacia donde se desplazar la reaccin si aumentamos la concentracin de CO 2? Que ocurrir con la
concentracin de H2CO3?Qu relacin momentnea existir entre vd y vi?
Si aumentamos la concentracin de CO 2, el equilibrio tender a disminuirla, desplazando el equilibrio
hacia la derecha. Es decir consumir molculas de CO 2 y agua para formar H2CO3, aumentando su
concentracin. Momentneamente sera vd>vi

6.11. Energa asociada a una reaccin qumica

Todas las reacciones tiene un cambio energetico asociado. En algunas reacciones se libera calor y se
conocen como exotrmicas mientras que otras consumen calor y se conocen como endotrmicas.
Supongamos una reaccin hipottica que cuando el reactivo se transforma en producto libera calor.
R P + calor
Qu ocurrir con la reaccin si le aumentamos la temperatura, estando en equilibrio?. El principio de
Le Chatelier nos dice que una equilibrio se opone al cambio que le aplicamos. Si en este caso le
estamos aumentado la temperatura, es porque estamos dando energa en forma de calor. La reaccin
consumir el calor, para lograr esto se desplazar hacia la izquierda gastando P y formando R.

75
EQUILIBRIO QUMICO

6.12. Reacciones en equilibrio y en estado estacionario

Una reaccin est en equilibrio cuando la vd = vi y como consecuencia las concentraciones


permanecen constantes.
Puede ocurrir que las concentraciones permanezcan constantes, pero esto se deba no a que las vd = vi,
sino porque es una reaccin que est encadenada a otra y la velocidad a la que se forma el reactivo es
igual a la velocidad a la que se consume para formar producto. Adems este producto puede formar
otra sustancia a la misma velocidad que se forma a partir del reactivo. En este caso las sustancias se
hallan en estado estacionario.

6.13. Equilibrio Acido-Base

El equilibrio cido-base es aquel equilibrio en que entre los reactivos y productos tenemos
sustancias que podemos clasificar como cidos y bases. A continuacin definiremos estas sustancias

6.13.1. cido

Un cido es una sustancia que tiene la capacidad de ceder hidrgenos. El hidrgeno cedido por un
cido se denomina protn, hidrogenin o hidronio y se representa: H + o H3O+, debido a que no es un
tomo de hidrgeno sino un catin hidrgeno. Cuando un cido cede un hidrogenin decimos que se
dicosica. En general la reaccin de disociacin de un cido se puede escribir de la siguiente manera:
AH A- + H+
Como la disociacin ocurre en general en medio acuoso, el hidrogenin cedido por el cido es captado
por el agua, por lo que podemos escribir la reaccin anterior como
AH + H2O A- + H3O+
Un cido al ceder un protn, genera una especie con carga negativa llamada base conjugada, que en la
ecuacin anterior queda representada por A-.
Si tomamos el HCl la reaccin de disociacin sera
HCl + H2O Cl- + H3O+
Donde el Cl- es la base conjugada del HCl. Llamamos protlisis al proceso por el cual una sustancia
cede un protn. En este caso diremos que el HCl se protoliz generando Cl- e hidronio.

6.13.2. Base

Una base es una sustancia con capacidad de captar protones. Si bien la anterior el la definicin ms
general, podemos definir una base tambin como una sustancia con capacidad de ceder oxhidrilos, los
cuales se representan: OH-. La reaccin de disociacin de una base se puede escribir
BOH B+ + OH-

B + H+ BH+
Cuando una base capta un protn, genera una especie con carga positiva llamada cido conjugado.

76
EQUILIBRIO QUMICO

Por ejemplo el NH3 es una base y podemos plantear la reaccin de protonizacin, o sea del proceso de
ganar un protn de las siguiente manera
NH3 + H+ NH4+
Diremos en este caso que el amonaco se protoniz y form la base conjugada amonio.
Al trabajar con soluciones donde los solutos son cidos o bases, interesa conocer ms que la
concentracin del soluto, la concentracin que tienen los protones y los oxhidrilos. Estas
concentraciones se expresan en N (eq/l).
Para comprender los temas siguientes debemos analizar primero el comportamiento del agua como
electrolito. Un electrolito es una sustancia que se puede disociar en iones. El agua si bien es un
compuesto covalente, debido a la polaridad del enlace entre el H y el O, consecuencia de la mayor
electronegatividad del O respecto del hidrgeno este enlace se halla polarizado, pudiendose romper en
determinadas circunstancias. Cuando esto ocurre un protn de una molcula de agua puede liberarse y
ser captado por otra molcula de agua. Esta reaccin queda representada por el siguiente equilibrio
qumico
H2O + H2O H3O+ + OH-
Al tratarse de un equilibrio podemos escribir su constante de equilibrio

[H 3 O + ][OH ]
Ke=
[ H 2 O]2
ecuacin 6.22
En una solucin acuosa, la concentracin de agua es constante y toma un valor de 55,5 mole/L. Como
este valor es constante se puede agrupar con el valor de Ke, que tambin es constante y llamaremos al
producto de Ke por la concentracin de agua: Kw. Esta constante tiene el valor de 1*10-14.
+ 14
Kw=[H 3 O ][OH ]=110
ecuacin 6.23

Podemos simplificar la expresin para una ms rpida escritura, reemplazando hidronio por protn
ecuacin 6.24

Kw=[H + ][OH ]
ecuacin 6.24

Dado que las concentraciones de protones y oxhidrilos son nmeros generalmente pequeos,
expresados en notacin cientfica, con el objetivo de simplificar estos nmeros, se calcula a partir de
ellos el pH y el pOH.

77
EQUILIBRIO QUMICO

6.13.3. pH

Es una medida de la acidez de una solucin y se calcula como menos el logaritmo de la concentracin
de protones

pH=log [ H + ]
ecuacin 6.25

Para ver un vdeo sobre conceptos de pH y acidez haga click en el siguiente link:
https://youtu.be/CWDutCOulmU

6.13.4. pOH

Es menos el logaritmo de la concentracin de oxhidrilos

pOH=log[OH ]
ecuacin 6.26

Ejemplo: una solucin de un cido puede tener


[H+] = 1.10-5 eq/l
pH = - log 1.10-5 eq/l = 5
Veamos otro ejemplo, supongamos que tenemos una concentracin de protones = 6,1*10 -3 eq/L, el pH
resultara
pH = - log (6,1*10-3) = 2,21
El pH como el pOH son nmeros adimensionales, es decir sin unidades.
Note que para el clculo de pH se obtiene el logaritmo de la concentracin de protones en eq/Litro.
Nunca calcule el pH con cantidad de protones, sino con la concentracin en un litro.
pH y pOH estn relacionados a travs del pKw. El pKw es logaritmo negativo de la Kw.

pKw=log Kw=log (1014)=14


ecuacin 6.27

pH+ pOH = pKw


ecuacin 6.28

pH+ pOH =14


ecuacin 6.29
La ecuacin anterior nos permite calcular pH o pOH conociendo uno de ellos.
Ya hemos visto como calcular pH a partir de la [H+]. En el caso que deseemos calcular [H+] a partir de
datos de pH, utilizaremos la ecuacin

78
EQUILIBRIO QUMICO

[H + ]=10( pH )
ecuacin 6.30

de igual manera para calcular concentracin de oxhidrilos


( pOH )
[OH ]=10
ecuacin 6.31

Veamos algunos ejemplos:


1- Calcular el pH y pOH de una solucin de [H+]= 2*10-4 eq/L
pH = - log [H+]= - log (2*10-4 ) = 3.7
como
pH + pOH = 14
pOH = 14 pH = 14 3,7 = 10,3
2- Calcular pOH, [OH-] y [H+] de una solucin de pH=3
Como pH + POH = 14
pOH = 14 pH = 14 3 = 11
[OH-] = 10 -pOH = 10-11 eq/L
[H+]= 10-pH = 10-3 eq/L
De las cuatro variables que se manejan habitualmente: pH, pOH, [H +] y [OH-], dado un valor de ellas
se pueden conocer las otras tres. Las frmula que las vinculan se observan en la Figura 6.5.

Figura 6.5

79
EQUILIBRIO QUMICO

Medio cido: es una solucin en la cual predominan los protones sobre los oxhidrilos. En estos medios
la [H+] es mayor que 10-7 eq/l mientras que la de [OH-] es menor que 10-7 eq/l. En estos medios el pH
tiene un valor entre 0 y 7. Cuanto ms bajo el pH ms grande ser la concentracin de protones y ms
cido el medio.
Medio alcalino o bsico: es una solucin en la cual predominan los oxhidrilos sobre los protones. En
estos medios la [H+] es menor que 10-7 eq/l mientras que la de [OH-] es mayor que 10-7 eq/l. En estos
medios el pH tiene un valor comprendido entre 7 y 14. Cuanto ms alto el pH mas grande ser la
concentracin de oxhidrilos y mas bsico ser el medio.
Medio neutro: es aquella solucin en la que las concentraciones de protones y oxhidrilos son iguales,
[H+] = [OH-] = 10-7 eq/l. En este medio el pH y pOH tambin son iguales pH = pOH = 7.

6.14. cidos y bases

Los cidos y las bases se clasifican en fuertes y dbiles. Haga click en el siguiente link si desea ver
conceptos de cidos y bases y formas de clculo de pH: https://youtu.be/APn5-dH2Ubc

6.14.1. cido fuerte

es un cido que cede completamente sus protones, es decir que se disocia en un 100 % o su grado de
disociacin () es 1. Son cidos fuertes: HCl (cido clorhdrico), H2SO4 (cido sulfrico), HNO3
(cido ntrico), HI, HBr y HClO4.
En el caso de los cido fuertes la concentracin de protones es igual a la normalidad del cido:

[H + ]=N
ecuacin 6.32

6.14.2. Base Fuerte

es una base que cede completamente sus oxhidrilos, es decir que se disocia en un 100% y su grado de
disociacin () vale 1.
Son bases fuertes: NaOH (hidrxido de sodio), KOH (hidrxido de potasio) y Ca(OH) 2 (hidrxido de
calcio). Para las bases fuertes la concentracin de oxhidrilos es igual a la normalidad de la base:

[OH ]=N
ecuacin 6.33

6.14.3. Acido dbil

es un cido que cede parcialmente sus protones, es decir que no se disocia en un 100 % o su grado de
disociacin () es menor que 1.

80
EQUILIBRIO QUMICO

Como consecuencia de no ceder en un 100 % los protones, lo que queda del cido tiene capacidad de
captar nuevamente el protn y se dice que es una base conjugada fuerte. Los cidos dbiles ms
comunes en temas biolgicos son: HAc (cido actico), H 2CO3 (cido carbnico) y H3PO4 (cido
fosfrico). Muchas ms sustancias son cidos dbiles como: cido lctico, cido oxalactico, cido
ctrico, etc. Muchas sustancias componentes de medicamentos son tambin cidos dbiles
Ejemplo:
HAc Ac- + H+
cido dbil base conjugada fuerte

En este caso los productos pueden reaccionar nuevamente para dar el cido sin disociar. Es decir que
tanto el Ac-, CO3= y PO4 son bases conjugadas fuerte, por provenir de cidos dbiles y por lo tanto
captarn protones. Las bases conjugadas nombradas se denominan tambin aniones bsicos.
Para la reaccin se puede escribir la constante de equilibrio, la que resultar

+ -
[ H ][ Ac ]
Ka=
[ AcH ]
ecuacin 6.34
.
Como toda constante de equilibrio cuanto mayor sea su valor, indica que mayores son las
concentraciones de protones y de la base conjugada y por lo tanto ms se disocia el cido. A mayor
disociacin del cido decimos que ste es ms fuerte.
Los cidos dbiles presentan un equilibrio de disociacin entre la forma sin disociar (cida) y la forma
disociada (base conjugada). El desplazamiento hacia la derecha de este equilibrio (es decir la
disociacin del cido) viene dado por el valor de la constante de disociacin o Ka. Se puede utilizar
tambin el pKa que es menos el logaritmo del valor de la Ka.

pKa=log Ka
ecuacin 6.35

Es importante notar que cuanto mayor sea el valor de Ka menor ser el valor de pKa.
Un cido dbil puede ser ms o menos fuerte cuando se lo compara con otro cido dbil. Se dice que
un cido dbil es ms fuerte cuando:
* mas disociado se encuentra.
* mas grande es el .
* mas grande es la Ka.
* menor es el pKa.
* mas elevada es la concentracin de protones.
* menor es el pH.
* mas dbil es su base conjugada.

81
EQUILIBRIO QUMICO

Sin cometer un gran error se puede considerar que cuando el pH supera al valor del pKa, el cido se
halla disociado en ms de un 50%, si el pH es menor al pKa la cantidad de cido est disociado en
menos de un 50%. Cuando el pH es igual al pKa, la mitad de las molculas se hallarn disociadas y el
otro 50% sin disociar. Por ejemplo el AcH tiene pKa = 4,7. A pH = 7 se encontrar predominantemente
como acetato, mientras que si el pH fuera 3 su estructura qumica predominante sera AcH.
En soluciones diludas, para calcular la concentracin de protones de un cido dbil se utiliza la
siguiente frmula

+
[H ]= KaN AcH
ecuacin 6.36
.
Con el valor de la concentracin de protones, luego se calcula el pH con la frmula habitual.

6.14.4. Base dbil

es una base que capta parcialmente protones, es decir que los protones captados pueden ser liberados
nuevamente, siendo su grado de disociacin () menor que 1.
Como consecuencia de no captar en un 100 % los protones, la estructura que resulta de captar un
protn tiene capacidad de ceder nuevamente el protn y se dice que es un cido conjugado fuerte. La
base dbil ms comunes en los procesos biolgicos es el NH3 (amonaco) o el grupo amino (-NH2).
Ejemplo:
NH3 + H+ NH4+
base dbil cido conjugada fuerte

Es decir que el NH 4+ es un cido conjugado fuerte, por provenir de una base dbil y por lo tanto
ceder protones, denominndose tambin como catin cido.
Las bases dbiles presentan un equilibrio de disociacin entre la forma sin disociar (bsica) y la forma
disociada (cido conjugado). El desplazamiento hacia la derecha de este equilibrio (es decir la
disociacin de la base) viene dado por el valor de la constante de disociacin o Kb. Para el equilibrio
anterior la expresin de la constante de equilibrio se puede escribir

+
[ NH 4 ]
Kb=
[ NH 3][H + ]
ecuacin 6.37
.
Se puede utilizar el pKb, este es menos el logaritmo del valor de la Kb.

82
EQUILIBRIO QUMICO

pKb=log Kb
ecuacin 6.38

Es importante notar que cuanto mayor sea el valor de Kb, ms desplazado se hallar el equilibrio de
captacin de protones hacia la derechay menor ser el valor de pKb.
Una base dbil puede ser ms o menos fuerte cuando se la compara con otras bases dbiles. Se dice
que una base dbil es ms fuerte cuando:
* mas disociada se encuentra.
* mas grande es el
* mas grande es la Kb
* menor es el pKb
* mas baja es la concentracin de protones.
* mas alto es el pH
* mas dbil es su cido conjugado.
Cuando las soluciones son diluidas, para una base dbil la concentracin de oxhidrilos se calcula con la
siguiente frmula.

[OH - ]= KbN base


ecuacin 6.39
.
Luego se calcula el pOH y con este el pH con las ecuaciones ya conocidas.

6.14.5. Acidos poliprticos

Los cidos poliprticos son cidos que pueden ceder ms de un protn. Un ejemplo de este tipo de
cidos es el cido sulfrico (H2SO4) , porque tiene dos protones que puede ceder. Para ver un video
sobre cidos poliprticos haga click en el siguiente link: https://youtu.be/VIu6LoGD4K0?t=87
El cido carbnico H2CO3, tiene dos hidrgenos para ceder pero es un cido poliprtico dbil. Por ser
un cido dbil tiene constante cida, pero como tiene dos hidrgenos tiene dos constantes: Ka1 y Ka2.
Otro ejemplo comn es el cido fosfrico, H3PO4; que por tener tres hidrgenos tiene tres constantes de
disociacin: Ka1, Ka2 y Ka3.
Estos cidos se disocian en etapas. El cido carbnico en una primera reaccin cede un protn,
generando bicarbonato (HCO3-)

83
EQUILIBRIO QUMICO

H2CO3 HCO3- + H+
Para este equilibrio su constante de equilibrio se escribe

+ -
[ H ][ HCO3 ]
Ka1=
[ H 2 CO 3 ]
ecuacin 6.40
.

luego el bicarbonato puede ceder su otro protn, segn la siguiente reaccin

HCO3- CO3= + H+
y su constante de equilibrio se escribe

+ =
[ H ][CO 3 ]
Ka2=
[HCO-3 ]
ecuacin 6.41
.
En los cidos poliprticos se ceden con mayor facilidad los primeros protones que los segundos y los
terceros, en caso de tenerlos. La explicacin es sencilla, al cederse el primer protn, se debe alejar una
carga positiva del protn del anin que se forma. En cambio al ceder el segundo protn, se debe alejar
la carga positiva de una anin que tiene dos cargas negativas y por ende es ms difcil de lograr. Esto se
refleja en los valores de las constantes de equilibrio. En general entre cada Ka en un cido poliprtico
hay una relacin de 10000 - 100000.
Por ejemplo para el cido carbnico sus pKa tienen los siguientes valores
pKa1= 6,35
pKa2= 10,32
Si calculamos Ka1

Ka1=10 pKa=106,35=4,4610-7
.

si calculamos Ka2
pKa2 10,32 -11
Ka2=10 =10 =4,7810
.
si calculamos la relacin entre las constantes
Ka1/Ka2 = 4,46*10-7 / 4,78*10-11 = 9348
Esto quiere decir que la fuerza del cido la ceder el primer protn es 9348 veces mayor que la del
segundo protn.

84
EQUILIBRIO QUMICO

No siempre se mantiene esta relacin entre los diferentes Ka de un cido poliprtico. En el caso de
sustancias biolgicas como los aminocidos con hasta tres grupos cidos, la fuerza de los grupos cidos
pueden ser muy similares.
Como buena aproximacin para calcular la concentracin de protones de un cido poliprtico se puede
utilizar la primer constante de disociacin y la molaridad, como si fuera un cido dbil con un solo
protn. Es decir que en el clculo se omite el uso de las otras constantes.

+
[H ]= Ka1M
Ejemplo
El cido glutmico tiene tres grupos cidos cuyos pKa tienen los siguientes valores: pKa1= 2, pKa2= 3
y pKa3= 9. Calcular el pH de una solucin de este cido en una solucin de concentracin 0,01 M.
Resolucin
Por tener tres valores de pKa, se trata de un cido poliprtico. Para el clculo necesitamos la Ka1 y la
M.
como pKa = - log Ka, podemos despejar la Ka aplicando la frmula
Ka1 = 10 pKa = 10 -2
con el valor de Ka1 y la M aplicamos la frmula de clculo de concentracin de protones para un cido
poliprtico

[H + ]= Ka1M

[H + ]= 10- 20,01=0,01
Luego con este valor calculamos el pH
pH = -log (0,01) = 2

Como se mencion anteriormente, en los organismos vivos existen muchos cidos poliprticos. Los
aminocidos son ejemplos de estas molculas. Si bien los aminocidos tienen un grupo carboxilo
(cido) y un grupo amino (bsico), pueden tener en su cadena carbonada grupos cidos adicionales.
El tratamiento de los grupos cidos en los compuestos biolgicos suele ser ligeramente diferente al que
se utiliza en otros ambientes de la qumica. El grupo cido ms comn en los compuestos biolgicos es
el grupo carboxilo, con valores de pKa que pueden variar dentro de un amplio rango. Sin embargo
podemos tomar un valor de pKa= 3 como una buena aproximacin promedio. Como la mayora de los
fluidos en los organismos vivos tienen un pH cercano a 7, la mayora de estos grupos estarn
disociados en un valor cercano al 100%, por lo que se hallaran al estado de bases conjugadas. A pesar
de esto son considerados como grupos cidos.
Por su parte los grupos amino, tienen comportamiento bsico, con valores de pKb promedio de 5. Esto

85
EQUILIBRIO QUMICO

indica que a los valores de pOH fisiolgico, aproximadamente de 7, estas bases se hallaran
largamente protonizadas, al estado de cido conjugado. Por esta razn los grupos aminos suelen
indicarse en los compuestos biolgicos como si fueran cidos, haciendo referencia a los cidos
conjugados. En el caso del grupo amino (-NH 2) su cidos conjugado es el amonio (-NH3+). Se puede
calcular el pKa de un acido conjugado utilizando la ecuacin

pKa=14pKb
Por lo tanto para los grupos amino el pKa rondara el valor de 9.
De esta manera en una molcula biolgica como podra ser el aminocido glicina, que tiene un grupo
amino y un carboxilo, se suelen indicar dos valores de pKa, uno para el carboxilo de aproximadamente
3 y otro para el amino de aproximadamente 9. Dado que el pH fisiolgico es cercano a 7, el grupo
carboxilo se hallar disociado y el grupo amino no.

6.14.6. Anfolitos

Los anfolitos son sustancias que se pueden comportar como cidos y bases, es decir que tiene la
capacidad de captar y ceder protones.Para ver un vdeo sobre anfolitos haga click en el siguiente link:
https://youtu.be/VIu6LoGD4K0?t=369
Algunos anfolitos tiene cargas negativa adems de protones en sus molculas. Los casos ms comunes
dentro de los iones inorgnicos son: HCO3- (bicarbonato); H2PO4- (fosfato dicido) y HPO4= (fosfato
monocido). Veamos a modo de ejemplo, el bicarbonato. Este anin puede actuar como cido
cediendo un hidrgeno y generando carbonato y protn. Adems puede actuar como bse captando un
protn y generando cido carbnico. Ambas reacciones se detallan a continuacin
HCO3- CO3= + H+ acta como cido
HCO3- + H+ H2CO3 acta como base
Podemos hacer el razonamiento anterior utilizando un razonamiento alternativo. Sabemos que en un
medio cido la concentracin de protones es mayor que la de oxhidrilos, por lo que podemos pensar
que el protn llevar la accin predominante y es quien reaccionar con el anfolito, quien en esta
situacin se comportar como base. Contrariamente en una solucin alcalina la concentracin de
oxhidrilos predomina sobre la de protones, lo que nos habilita a razona que los oxhidrilos son los que
reaccionarn con el bicarbonato, el que se comportar como cido. Este razonamiento lo podemos
representar en las siguiente reacciones, planteadas para el bicarbonato
HCO3- + H+ H2CO3 acta como base
HCO3- + OH- CO3= + H2O acta como cido
Por lo tanto podemos concluir que un anfolito tendr una propiedad amortiguadora sobre los cambios
de pH, ya que tender a consumir protones cuando estos abunden o a neutralizar los oxhidrilos cuanto
stos se hallen en alta concentracin.
Dentro de las molculas biolgicas, los aminocidos son anfolitos. El grupo carboxilo se comporta
como un cido y el amino como un grupo bsico. La Figura 6.6 muestra este comportamiento para un
aminocido. Si bien en la imagen se muestra como ejemplo el aminocido asparagina, el
comportamiento es el mismo para cualquier otro aminocido. En algunos aminocidos, que en su

86
EQUILIBRIO QUMICO

cadena lateral tengan otro grupo amino (como el caso de la lisina, arginina o histidina) o un grupo
carboxilo adicional (como el caso del cido glutmico y asprtico), la capacidad amortiguadora ser
mayor.

Figura 6.6

En las protenas es conocido que los grupos amino y carboxilos del aminocido se hallan formando
parte de las uniones peptdicas y por lo tanto pierden esta capacidad amortiguadora, sin embargo los
grupos amino y carboxilos que se hallen en sus cadenas laterales o en los extremos la seguirn
manteniendo. Por esta razn las protenas tienen una gran capacidad amortiguadora del pH en
organismos vivos. Como se ver ms adelante las protenas pueden tener centenas de aminocidos y
por lo tanto esta propiedad se multiplica en una protena.
Como vemos en los casos anteriores, los anfolitos involucran en sus equilibrios a un cido poliprtico.
Por ejemplo, en el caso del bicarbonato, el cido carbonico (H 2CO3) es parte de los equilibrios. este
cido tiene dos protones para ceder, por lo tanto dos constantes cidas: Ka1 y Ka2. En soluciones
diluidas el pH se puede calcular con la frmula
+
[ H ]= Ka1Ka 2
Siempre se utilizarn las dos constantes que involucran en sus equilibrios a la especie en estudio.
Supongamos que estamos analizando el anin H2PO4-. Esta sustancia es un anfolito, ya que como
vemos en su estructura tiene hidrgenos para dar y por tener carga negativa y provenir de un cido
dbil (cido ortofosfrico) es una base conjugada fuerte. Sin embargo el cido ortofosfrico tiene tres
constantes de disociacin que vemos en los tres equilibrios siguientes
H3PO4 H2PO4- + H+ Ka1= 10-2
H2PO4- HPO4= + H+ Ka2= 10-7
HPO4= PO4 + H+ Ka3= 10-12

87
EQUILIBRIO QUMICO

Como vemos en los equilibrios la especie en cuestin (H 2PO4-) est involucrada en los equilibrios
cuyas constantes son Ka1 y Ka2. Por lo tanto la concentracin de protones ser:

[ H ]= 10 10 =3,1610
+ -2 -7 5

pH = - log 3,16*10-5 = 4,5

6.14.7. Sales

Las sales al disolverse en agua pueden producir un medio alcalino, neutro o cido, dependiendo de los
iones que la forman. Para ver un vdeo sobre la estimacin del pH de soluciones que contienen sales
haga click en el siguiente link: https://youtu.be/9JGlw2e1EHI
En las sales no calcularemos el pH sino que lo estimaremos; deduciendo si el medio es alcalino, neutro
o cido. Por supuesto que el valor de pH de una solucin que contiene una sal puede calcularse, pero
excede los lmite de este libro. Veamos algunos ejemplos de estimacin de pH en soluciones de sales.
NaCl 0,1 M: Esta sal se disocia en Na+ y Cl-.
El Na+ es un cido conjugado dbil porque proviene de una base fuerte.
El Cl- es una base conjugada dbil porque proviene de un cido fuerte.
Por lo tanto en la solucin existen dos especies (el sodio y el cloruro), que son conjugados dbiles o
neutras, resultando un pH igual a 7. Se puede concluir que las sales originadas a partir de un cido
fuerte y una base fuerte tienen pH=7.
Podramos razonar de esta manera el problema. El Cl- y el Na+ se disociarn en agua y se recubrirn de
molculas de agua. Cul podra ser la reaccin de cada una de ellas con el agua? El Cl- podra sacarle
un protn al agua para formar cido clorhdrico, segn la siguiente reaccin. Sin embargo esta reaccin
estar prcticamente un 100% desplazada hacia la izquierda, ya que entre los productos tenemos HCl
que es un cido fuerte y por lo tanto cede sus protones por facilidad. En conclusin, el Cl- no puede
campar un protn, por lo que tampoco generar los oxhidrilos que se hallan entre los productos. Por
ello decimos que el cloruro es una base conjugada dbil y ms apropiado es el nombre de anin neutro,
ya que su presencia no modificar la concentracin de protones y oxhidrilos del agua.
Cl- + H2O HCl + OH-

Por su parte el catin sodio en el agua lo que podra hacer es deplazar un protn del agua y unirse al
oxhidrilo, segn la siguiente reaccin
Na+ + H2O NaOH + H+
Pero la reaccin estar prcticamente un 100% desplazada hacia la izquierda ya que el NaOH es una
base fuerte y tender a reaccionar con mucha facilidad con el protn generado. Como conclusin
decimos entonces que el catin sodio no puede generar protones y por ende es un cido conjutado
dbil, aunque le cabe mejor la calificacin de catin neutro.
En conclusin al colocar NaCl de sodio en agua, la sal al disociarse genera un catin y un anin neutro,
siendo el pH = 7.
Analicemos el caso del acetato de sodio. Supongamos una solucin de NaAc 0,1 M: esta sal se disocia
dando Na+ y Ac-.

88
EQUILIBRIO QUMICO

El Na+ como ya vimos es una cido conjugado dbil, mientras que el Ac- es una base conjugada fuerte,
por originarse a partir del HAc (cido actico) que es un cido dbil. Por lo tanto en la solucin existe
un cido conjugado dbil y una base conjugada fuerte. La fuerza de la base predomina sobre el cido y
el pH de la solucin es mayor que 7. Como conclusin se puede decir que toda sal que se origine a
partir de un cido dbil y una base fuerte tendr pH alcalino.
Veamos ahora el caso de una solucin de NH4Cl 0,1M: esta sal se disocia dando NH4+ y Cl-. El NH4+
es una cido conjugado fuerte por originarse a partir del NH 3 que es una base dbil. El Cl- es una base
conjugada dbil por que se origin a partir del HCl, que es un cido fuerte. Es decir que en la solucin
de NH4Cl, existe un cido conjugado fuerte y una base conjugada dbil, predominando por lo tanto la
fuerza del cido conjugado y el pH de la solucin ser menor que 7. Se puede generalizar entonces
diciendo que toda solucin de una sal que se origina a partir de una base dbil y un cido fuerte tiene
pH menor que 7.

Podemos plantear un algoritmo de estimacin de pH para sales.


1- Disociamos la sal en anin y catin.
2- observamos el catin y deducimos de que base se origin.
Si se origin de una base fuerte, es un catin neutro que no afectar el pH
Si se origin de una base debil es un cido conjugado fuerte es decir un catin cido, que
producir un descenso del pH respecto del valor 7
3- observamos el anin y deducimos de que cido se origin
Si se origin de un cido fuerte, es un anin neutro y no afectar el pH
Si se origin de un cido dbil, es una base conjugada fuerte es decir un anin bsico, que
producir un aumento del pH respecto del valor 7

6.14.8. Buffer

Los buffers son mezclas que se oponen a la variacin de pH cuando se les agrega un cido o una base.
A los buffers se los denomina tambin soluciones amortiguadoras de pH, soluciones reguladoras de pH
o tampones. Una solucin reguladora de pH cumple con dicha funcin debido a que en su composicin
cuenta con una sustancia cida que en parte puede neutralizar el ingreso de una base y otra sustancia
con caractersticas bsicas que en parte puede neutralizar el ingreso de un cido. Para ver un vdeo
sobre el tema haga click en el siguiente link: https://youtu.be/SzeQEf7DEKY
Para comprender el funcionamiento de un buffer retomemos el tema referido a cidos dbiles. Estos
son sustancias que pueden ceder un protn, sin embargo esta cesin no se produce en un 100% y la
sustancia que se origina de haber perdido el protn es una base conjugada fuerte. Por ende, esta ltima
tiene la capacidad de captar protones. Veamos el equilibrio de disociacin del cido lctico
HLac Lac- + H+
Si a una solucin donde se encuentre este equilibrio se le agrega un cido, al aumentar la concentracin
de protones, el equilibrio se desplazar hacia la izquierda, consumindolos y evitando un gran descenso
de pH. Contrariamente, si a la solucin ingresara una base, sta consumira protones, produciendo un
desplazamiento del equilibrio de disociacin hacia la derecha, aportando de esta manera protones y
evitando as un gran aumento del pH. Si la solucin contuviera adems una sal del mismo cido, por

89
EQUILIBRIO QUMICO

ejemplo Lactato de sodio (NaLac), ste se disociara y aumentara la concentracin de Lac - en la


solucin, que podra actuar captando protones como se explic anteriormente. Esta sal (NaLac) se dice
que es una sal de un cido dbil (el cido lctico) y una base fuerte (el NaOH). Existen dos tipos de
buffer, aquellos que son mezclas de un cido dbil y su sal con base fuerte y otras no tan comunes que
son mezclas de una base dbil y su sal con cido fuerte.
Veamos como se forman estas soluciones y como las interpretamos. Supongamos que en una solucin
tenemos HLac 0,1 M y NaLac 0,1 M. El HLac es un cido dbil cuya Ka es aproximadamente 10 -5.
Este valor de la constante indica que la concentracin de Lac - y H+ son 10000 veces menores que la
concentracin de HLac, por lo tanto podemos simplificar el razonamiento pensando que todo el HLac
se encuentra sin disociar. Por otra parte el NaLac es una sal que se encuadra dentro de los electrolitos
fuertes. Se llama as a las sales que se disocian completamente al disolverse en agua. Por lo tanto si la
concentracin del NaLac es 0,1 M y ste es un electrolito fuerte, en la solucin la concentracin de
NaLac ser aproximadamente 0 M mientras que la concentracin de Na+ y Lac- sern 0,1 M. De esta
manera en la solucin en realidad tenemos 0,1 M de HLac, 0,1 M de Na+ y 0,1 M de Lac-. Como el Na+
deriva del NaOH que es una base fuerte, este catin es neutro y no participa de equilibrios cido base.
Contrariamente el Lac- al derivar del HLac que es un cido dbil, es una base conjugada dbil y tiene
la capacidad de captar protones.
Las explicaciones de funcionamiento de una buffer las daremos sobre soluciones formadas por un
cido dbil y su sal. Si tenemos una mezcla de un cido dbil y su sal con base fuerte, en la solucin
tendremos: el cido dbil, el catin y el anin de la sal. El cido dbil se encuentra en gran parte sin
disociar (por ser dbil). El catin de la sal, que por provenir de una base fuerte es un cido conjugado
dbil o catin neutro, no tendr posibilidad de ceder protones. El anin de la sal, que por provenir del
cido dbil es una base conjugada fuerte, que si tendr tendencia a captar protones. Es decir que
existir una especie con capacidad de ceder protones: el cido sin disociar; se dice que es la reserva
cida y por otro lado una especie con capacidad de captar protones, el anin de la sal o base conjugada
fuerte; la cual se llama reserva bsica. Por comodidad a la reserva bsica se la llama directamente sal,
pero es importante tener en cuenta que es el anin de la sal el que se comporta como reserva bsica.
Cuando a una mezcla de estas caractersticas se agregue un cido fuerte, los protones cedidos por ste
sern captados por la reserva bsica, impidiendo de esta manera que el pH disminuya mucho. De
manera contraria si a la mezcla se adiciona una base fuerte, la reserva cida ceder protones,
neutralizando la base e impidiendo que el pH aumente mucho. Es importante notar que el buffer
impide grandes variaciones, es decir que el pH vara ante el agregado de cidos y bases, pero estas
variaciones son mnimas.
El clculo de pH de un buffer formado por un cido dbil y su sal se realiza mediante la ecuacin de
Henderson y Hasselbach

[sal]
pH= pKa+ log
[cido]
.
Esa ecuacin se obtiene a partir de aplicar logaritmo a la ecuacin de la Ka del cido y reordenarla,
como vemos simplificadamente a continuacin.

90
EQUILIBRIO QUMICO

+
[sal ][H ]
Ka=
[cido]
.
aplicamos logaritmo a ambos miembros y cambiamos de signo

[sal]
log Ka=log[H + ]log
[cido]
.

Como -log Ka= pKa y -log[H+] = pH, cambiando formas de expresin

[ sal]
pKa= pHlog
[cido]
.
reordenando obtenemos la ecuacin de Henderson y Hasselbach.

[sal]
pH= pKa+ log
[cido]
.
Esta frmula puede utilizarse con datos de concentracin o cantidad. Por comodidad y seguridad es
aconsejable resolver los problemas con la cantidad de sus componentes en el volumen que se est
trabajando. Note la diferencia, ya que en todos los clculos anteriores de pH, se utilizaba siempre la
concentracin expresada en equivalentes por litro.
Ejemplo: se tiene una solucion de 200 ml de AcH 0,1M y KAc 0,2 M, cuyo pKa es 4,74. Calcular el
valor del pH.
Resolucin: Primero se calculan las cantidades de los componentes:
1000 ml ...... 0,1 mol AcH 1000 ml ....... 0,2 mol KAc
200 ml ...... x= 0,02 mol 200 ml ....... x= 0,04 mol

Luego se reemplazan los valores en la ecuacin de Henderson y Hasselbach

0,04
pH=4,74 +log =5,04
0,02
.
0,2 M y 0,1 M se denominan concentraciones absolutas, es decir que es la concentracin real que tiene
cada uno de los componentes del buffer.
El cociente 0,04/0,02 = 2. Este valor 2 es la concentracin relativa, es decir la relacin entre las
concentraciones absolutas o cantidades.
El pH de una mezcla reguladora depende de dos factores: el pKa y la concentracin relativa, no de las

91
EQUILIBRIO QUMICO

concentraciones absolutas.
Por ejemplo si el buffer anterior tuviera AcH 0,2 y KAc 0,4, es decir el doble de concentraciones
absolutas, la concentracin relativa valdra igual que en el caso anterior 2 y el pH de la mezcla sera el
mismo. A continuacin se muestran los clculos para este buffer
1000 ml ...... 0,2 mol AcH 1000 ml ....... 0,4 mol KAc
200 ml ...... x= 0,04 mol 200 ml ....... x= 0,08 mol

0,08
pH=4,74 +log =5,04
0,04
.

Reaccin de un buffer ante agregados de cidos y bases


Ante el agregado de x equivalentes de un cido, se gastar la reserva bsica, la cual al captar el protn
se transformar en reserva cida; es decir que se tendr menos sal y mas cido. Por esto para calcular el
pH se aplica la misma frmula pero modificando las cantidades de sal y cido

salx
pH= pKa+ log
cido+ x
.
Si se agregara una base, se gastara reserva cida y se formara reserva bsica, por lo tanto para calcular
el pH la frmula queda:

sal+ x
pH= pKa+ log
cidox
.
Ejemplo: A un buffer de pKa=5 contiene 0,2 moles de acetato y 0,1 mol de cido acetico se le agregan
0,02 moles de un cido fuerte. Que ocurrir con el equilibrio y cual ser la variacin de pH.
En el buffer el equilibrio que existe es
AcH Ac- + H +
Al agregar un cido, aumentar la concentracin de protones y el equilibrio se desplazar hacia la
izquierda
AcH Ac- + H +
produciendo un aumento de la concentracin de AcH y disminucin de Ac-
AcH Ac- + H +
El pH inicial de la solucin es

0,2
pH=5+ log =5,3
0,1
.
al agregar el cido como vimos el equilibrio se desplaz a la izquierda aumentando el cido y bajando
la reserva bsica

92
EQUILIBRIO QUMICO

(0,20,02)
pH=5+ log =5,18
(0,1+ 0,02)
.
Como podemos observar el pH disminuy ante el agregado de cido, pero el cambio ha sido pequeo
si se lo compara con el cambio que hubiera ocurrido ante el mismo agregado de cido en agua o a una
solucin que no contiene un buffer

Eficacia de un Buffer
La eficacia de un buffer es la capacidad de amortiguar el cambio de pH ante el ingreso a la solucin de
una determinada cantidad de cido o base. La eficacia se calcula como el cociente entre la cantidad de
equivalentes de cido o base agregados y el cambio de pH que sufre la solucin.

equivalentes cido o base agregada


Eficacia=
pH
.
Cuanto menos cambie el pH ante el ingreso de un determinado nmero de moles de un cido o una
base, ms eficaz ser la solucin amortiguadora.
Como regla general un buffer es ms eficaz cuando:
* mas grandes son las concentraciones absolutas.
* mas cercano es el pH al pKa.
* la concentracin relativa es ms cercana a 1.
* el logaritmo de la concentracin relativa es ms cercano a 0.
* mas parecidas son las concentraciones de reserva bsica y cida.
Ejemplos: seleccionemos entre las siguientes mezclas cul es buffer y dentro de ellos cul tendr mejor
capacidad reguladora a pH 7,4.
a- HCl 1 M/ NaCl 1M
b- AcH 1 M/ KAc 1 M pKa= 4,7
c- HF 0,02 M/ NaF 0,03 M pKa= 3
d- HCN 2 M/ NaCN 2 M pKa 10
e- NaH2PO4 0,1 M/ Na2HPO4 0,1 M pKa=7
f- NaH2PO4 1 M/ Na2HPO4 1 M pKa=7
El a no es buffer por estar formado por una mezcla de un cido fuerte y su sal.
El b si bien es un buffer ya que el cido actico es dbil, en presencia de su sal y con alta concentracin
absoluta y concentracin relativa igual a 1, su pKa esta lejos de pH 7,4, no tiene por lo tanto buena
capacidad reguladora, a pH 7,4.
El c es un buffer pero tiene varios factores en contra, baja concentraciones absolutas, concentracin de
sal y cido diferentes y pKa muy diferente al pH a regular.
El buffer d tiene dos cosas a favor: elevadas concentraciones absolutas y concentracin relativa de 1,
pero su pKa es muy diferente al pH.

93
EQUILIBRIO QUMICO

El e y f son buenos buffers para el caso ya que ambos tienen concentraciones de sal y cido iguales, es
decir concentracin relativa de 1, pKa muy parecido al pH. Es ms conveniente el f ya que las
concentraciones absolutas son ms altas.
Ejemplo: para tener una idea del mecanismo de accin de un buffer y su eficacia, calculemos el pH
de las siguientes soluciones, antes y despus de agregar 0,01 equivalente de HCl:
a- 1 litro de agua
b- 1 litro de solucin 0,1 M AcH y 0,1 M KAc, pKa=4,74
c- 1 litro de solucin 1 M AcH y 1 M KAc, pKa= 4,74.
d- 1 litro de solucin 0,02 M AcH y 0,04 M KAc, pKa= 4,74

Las variaciones de pH para cada caso sern:


a- pH inicial= 7. Por ser agua sin ningn soluto
al agregar 0,01 eq de HCl como en los 1000 ml quedarn disueltos los 0,01 eq de HCl, por ser una
solucin de un cido fuerte (esto no es un buffer),
[H+]= 0,01 eq/l y por lo tanto
pH= - log 0,01 = 2
por lo tanto pH = 7 - 2 = 5 unidades de pH

b-

0,1
pH inicial =4,74 +log =4,74
0,1
.
al agregar 0,01 eq de HCl

( 0,10,01)
pH final =4,74+ log =4,65
( 0,1+0,01)
.

por lo tanto pH = 4,74 - 4,65 = 0,09 unidades de pH

c-

1
pH inicial =4,74 +log =4,74
1
.
al agregar 0,01 eq de HCl

94
EQUILIBRIO QUMICO

(10,01)
pH final=4,74+ log =4,73
(1+ 0,01)
.
por lo tanto pH = 4,74 - 4,73 = 0,01 unidades de pH

d-

0,04
pH inicial =4,74 +log =5,04
0,02
.
al agregar 0,01 eq de HCl

( 0,040,01)
pH final =4,74+ log =4,74
(0,02+0,01)
.
pH final = 4,74 + log 0,04 - 0,01/0,02 + 0,01 = 4,74.
por lo tanto pH = 5,04 - 4,74 = 0,3 unidades de pH

Como lo demuestra el clculo del tem a, el agua tuvo una gran variacin por no ser buffer. Pero dentro
de los tres buffer el c es el que tuvo menor variacin como consecuencia de tener una concentracin
relativa de 1 y elevadas concentraciones absolutas. En cambio el D es el que tuvo mayor variacin
debido a tener concentracin relativa diferente a 1 adems de tener bajas concentraciones absolutas.
Podramos calcular la Eficacia en amortiguar el pH en los cuatro casos precedentes:

0,01
a- Eficacia= =0,002
5
.

0,01
b- Eficacia= =0,11
0,09
.

0,01
c- Eficacia= =1
0,01
.

0,01
d- Eficacia= =0,033
0,3
.
El clculo de la eficacia reitera la mayor capacidad amortiguadora del pH de la solucin c.

95
EQUILIBRIO QUMICO

Los buffers o soluciones amortiguadoras de pH son soluciones que contienen un cido dbil y su sal
con una base fuerte y, si bien no impiden el cambio de pH ante el ingreso de un cido o una base,
logran que ese cambio sea pequeo, dentro de ciertas situaciones experimentales. En los organismos
vivos el pH juega un rol importante en el cumplimiento de las funciones y por ello los organismos
vivos contienen una gran cantidad de buffers en sus diferentes compartimientos. El ser humano no es
un excepcin y es nuestro inters centrarnos en los buffers de los humanos.

6.15. Buffers fisiolgicos

Se denominan as a sistemas compuestos por un cido dbil y su sal, pero que cumplen su papel dentro
del organismo, en los diferentes fluidos: intracelular, extracelular: intercelular y plasma. Trataremos en
ms detalle los buffers fisiolgicos de la sangre, es decir aquellas soluciones reguladoras de pH que se
hallan en el plasma y en los glbulos rojos. Para ver un vdeo sobre el tema haga click en los
siguientes links: https://youtu.be/PcbiGC1nbJ0 , https://youtu.be/KWVAsfp6WgE
A continuacin vemos las diferentes formas en que se puede representar un buffer, usando como
ejemplo el buffer cido carbnico-bicarbonato de sodio.
Los componentes de este buffer son: H2 CO3 y NaHCO3
que tambin lo podemos escribir:
H2 CO3 y HCO3-
y, a ambas sustancias las podemos escribir formando parte de una reaccin que consiste en un
equilibrio qumico
H2 CO3 HCO3- + H+

A nivel fisiolgico centraremos la atencin en los siguientes buffers:


cido carbnico-bicarbonato: H2 CO3 y NaHCO3
buffer de los fosfatos: NaH2 PO4 y Na2 HPO4 (fosfato dicido-fosfato monocido).
buffer hemoglobina desoxigenada: HbH+ - Hb.
Buffer hemoglobina oxigenada: HbO2H+ y HbO2.
buffer protenas: PrH+ y Pr.
A estos buffers los escribiremos:

H2CO3 HCO3- + H+
cido carbnico bicarbonato
H2 PO4- HPO4= + H+
fosfato dicido fosfato monocido
HbH +
Hb + H+
hemoglobina desoxigenada hemoglobinato desoxigenada
HbO2 H+ HbO2 + H+

96
EQUILIBRIO QUMICO

hemoglobina oxigenada hemoglobinato oxigenado


PrH+ Pr + H+
protenas proteinatos
Las sustancias de la izquierda de cada equilibrio qumico son los cidos dbiles, reservas cidas o
simplemente los cidos que componen cada buffer. A la derecha de la reaccin hallamos las sales o
bases conjugadas fuerte de cada cido o simplemente las reservas bsicas.
Entre los cido de los buffers podemos hallar dos tipos de cidos: los cidos fijos y los cidos voltiles.
Un cido es voltil cuando puede pasar de estado de soluto disuelto en la solucin a estado gaseoso. El
H2CO3 se dice que es un cido voltil, porque est en equilibrio qumico con el CO 2, reaccin
catalizada por la enzima anhidrasa carbnica.
CO2 + H2 O H2 CO3

Esta caracterstica del cido carbnico de poder disminuir su concentracin por poder transformarse en
dixido de carbono o aumentarla por la combinacin entre el dixido de carbono con agua, le da al
buffer el nombre de buffer abierto. Esta caracterstica es importante para este buffer ya que le permite
modificar la cantidad de cido y base que lo componen.
Los otros cidos: H2PO4-, HbH+, HbO2H+, PrH+, se denominan cidos fijos. A todos ellos los
agruparemos bajo la expresin HBuf. No tienen estos cidos la posibilidad de transformarse en
especies voltiles, y por lo tanto si bien pueden cambiar las concentraciones absolutas de cidos y
bases no pueden cambiar el nmero de moles totales de ambos, por ello se dice que estos son buffers
cerrados.
Todas las bases buffer de las ecuaciones anteriores se denominan bases buffer, reservas bsicas o
aniones pH dependientes. Estos aniones se pueden dividir en dos grupos : La base buffer bicarbonato:
HCO3- a la que representaremos con las siglas BBB correspondientes a la primer letra de las
palabras :Base Buffer Bicarbonato o bien BBHCO3-
Las especies: HPO4=, Hb, HbO2, Pr, se denominan bases buffer no bicarbonato: BBnoB o Buf - o
BBnoHCO3-.
En la Figura 6.7 se observan los equilibrios planteados anteriormente y las definiciones y
simplificaciones explicadas en los prrafos anteriores

97
EQUILIBRIO QUMICO

Figura 6.7: En azul cido carbnico o cido voltil, en rosa bicarbonato o base buffer
bicarbonato, en rojo bases buffer no bicarbonato, en verde cidos fijos.

La suma de las BBB y las BBnoB constituye lo que se denominan las bases buffer reales o totales:

BBR =BBB + BBnoB


ecuacin 6.42

Definimos una variable: exceso de base (EB) que se calcula mediante la resta entre la base buffer real y
la base buffer normal (BBN)

EB=BBR+ BBN
ecuacin 6.43
Se define como base buffer normal a la cantidad de bases buffer de un individuo cuando el pH es 7,4,
la pCO2 es 40 mm de Hg y la temperatura 37 C.
Resumiendo, para estudiar el estado cido base de un paciente utilizaremos los siguientes equilibrios y
frmulas:
CO2 + H2O H2CO3 HCO3- + H+

98
EQUILIBRIO QUMICO

H2PO4- HPO4= + H+

HbH+ Hb + H+

HbO2H+ HbO2 + H+

PrH+ Pr + H+

cuyos significados explicamos y que de una manera simplificada en base a los trminos definidos
anteriormente podemos escribir

CO2 + H2O H2CO3 HCO3- + H+

HBuf Buf- + H+

En funcin de las definiciones establecidas renombramos algunas de ellas como


BBB = [HCO3-]
BBnoB = HPO4= + Hb + HbO2 + Pr
y definimos BBR y EB como

BBR = BBB + BBnoB

EB = BBR - BBN

Dado que todos los buffers se hallan en el mismo compartimiento el pH es el mismo para todos ellos,
por ende para calcular el pH podemos utilizar cualquiera de ellos. Por simplicidad en la forma de
medicin se elige el buffer cido carbnico bicarbonado, quedando la ecuacin de Henderson y
Hasselbach como
-
[HCO3 ]
pH = pKa+log
[ H 2 CO 3 ]

Podemos incorporar la ley de Henry que estable que la concentracin de una sustancia gaseosa en
solucin es directamente proporcional a la presin parcial de dicha sustancia gaseosa, ley que se puede
expresar matemticamente como

99
EQUILIBRIO QUMICO

[]=presin parcial
.
aplicada al CO2 y el cido carbnico la ley de Henry resulta

[H 2 CO 3]=pCO 2
.
reemplazando el cido carbnico en la ecuacin de Henderson y Hasselbach resulta
-
[HCO3 ]
pH = pKa+log
pCO2

CO2= 0,03 meq/l.mm de Hg


de esta manera es que se reemplaza [H2CO3] obtenindose la ecuacin
-
[HCO3 ]
pH = pKa+log
0,03pCO2

Dadas las unidades de coeficiente de solubilidad (), cuando se utilice la ecuacin, la concentracin de
bicarbonato debe utilizarse en meq/L y la presin de dixido de carbono en mm de Hg.
Ejemplo: calcular el pH sanguneo sabiendo que la [HCO 3-] = 24 meq/L y la pCO2 = 40 mm de Hg.
pKa= 6,1.
Reemplazamos los valores del problema y omitimos las unidades para simplicidad.

24
pH =6.1+log =7,40
0,0340

Ubicacin de los buffer fisiolgicos:


El buffer cido carbnico/bicarbonato tiene ubicacin tanto en plasma como en el espacio intracelular,
el Hb y Hb oxigenada es solo de ubicacin intracelular (glbulo rojo exclusivamente). El buffer de los
fosfatos es de ubicacin predominantemente intracelular aunque existe en el espacio extracelular. El
buffer de las protenas tiene ambas ubicaciones.

Eficacia de los buffer fisiolgicos: Los buffer fisiolgicos tienen una eficacia que en cada caso
depende de diferentes factores.
En el buffer bicarbonato tiene pKa=6,1; si bien el pKa es diferente al pH a regular (7,4), es eficaz por
ser un buffer abierto.
El buffer de los fosfatos: es eficaz por tener un pKa prximo al pH a regular, a pesar de su baja concen-
tracin absoluta.

100
EQUILIBRIO QUMICO

El de las protenas tiene un pKa muy prximo al pH a regular, dado que en las protenas el
comportamiento de buffer lo da el aminocido histidina, cuyo pKa es muy prximo al fisiolgico.
Los buffers dependientes de la Hb, son eficaces por poder cambiar su pKa de acuerdo al pH del medio,
figura 1. El cido del buffer hemoglobina oxigenada (HbO2H+) es mas fuerte que el de la Hb desoxi-
genada (HbH+), por lo tanto esta ltima tiene una base conjugada mas fuerte. Cuando la Hb oxigenada
llega a los tejido cede sus oxgenos y se transforma en Hb, que es una base conjugada mas fuerte,
captar los protones generados por la disociacin del cido carbnico, abundante en esta regin por
provenir de los tejidos, donde hay elevada presin de dixido de carbono. Cuando la HbH + llega al
pulmn donde la presin parcial de oxgeno es elevada, se transforma en HbO2H+, este ltimo es un
cido mas fuerte, cede el hidrogenin. El hidrogenin se combina con el bicarbonato, para la
formacin de cido carbnico, que se deshidrata, dando dixido de carbono, que difunde hacia el
alvolo donde la presin de dixido de carbono es menor.

Figura 6.8: transporte de oxgeno y regulacin del pH


Estado cido base ante diferentes desequilibrios
Ejemplo 1: supongamos una situacin en la cual entra al organismo un cido, ya sea por ingesta o por
produccin a travs de rutas metablicas. Un ejemplo clsico de ingesta de cido podra ser la bebida
de gaseosas acidificadas con cidos fijos, como bebidas cola de marca reconocida o bien jugos en
polvo. Tambin sera un ejemplo la ingesta de alimentos preparados con agregado de vinagre o
fermentados con produccin de cidos como podra ser el yogurt. Entre los procesos que producen
cidos por vas metablicas el caso ms conocido es el metabolismo muscular anaerbico de la glucosa
cuyo producto final es el cido lctico, que se produce en casos de ejercicios de alta potencia. Otro

101
EQUILIBRIO QUMICO

caso es la cetognesis cuyos productos finales son los cidos acetoacticos y -OH-butrico.
Para el anlisis de los equilibrios utilizaremos el siguiente cdigo: la perturbacin primaria la
representaremos con una flecha roja ascendente o descendente ( , ), el desplazamiento de equilibrio
con una flecha negra hacia la derecha o izquierda segn corresponda (,) y la modificacin de los
compuestos del equilibrio como consecuencia de dicho desplazamiento lo marcaremos con una flecha
azul ascendente o descendente, segun la concentracin aumento o disminuya ( , )
Entonces, cuando ingresa un cido se produce un aumento de la concentracin de protones como
consecuencia de la disociacin del cido recin ingresado (), lo cual produce desplazamiento de los
equilibrios de disociacin del cido carbnico y de los cidos fijos hacia la izquierda, que trae como
consecuencia una disminucin de las BBB y BBnoB, las que al captar los protones se transforman en
cidos, produciendo aumento de cido carbnico y cidos fijos.
CO2 + H2O H2CO3 HCO3- + H+

HBuf Buf- + H+
El aumento del cido carbnico, llevar a que el equilibrio se desplace hacia la izquierda, transformado
cido carbnico en dixido de carbono y agua; el dixido de carbono permanece constante debido al
intercambio de gases a nivel alveolar.
Observando los equilibrios se puede deducir que las variables relacionadas con el estado cido base
quedarn de la siguiente manera:

BBB
BBnoB
BBR = BBB + BBnoB
EB = BBR - BBN = resultado negativo
pH
cidos voltiles
cidos fijos
Al quedar con BBR disminuidas, que conduce a un exceso de base negativo, con pH disminuido y
aumento de las reservas cidas voltiles y no voltiles, se dice que se trata de una ACIDOSIS, cuya
causa no es de origen respiratorio, por lo tanto se dice que se trata de una acidosis metablica.
Ejemplo 2: Si se tratara de un paciente con alguna dificultad respiratoria, la cual causa retencin de
dixido de carbono; lo que observaramos sera un aumento del dixido de carbono que desplazara el
equilibrio de hidratacin del dixido de carbono hacia la derecha, aumentando la concentracin de
cido carbnico, este aumento produce un desplazamiento del equilibrio de disociacin de dicho cido
hacia la derecha, que como consecuencia aumenta las concentraciones de bicarbonato y protones. Por
el principio de isohdria, los protones participan en ambos equilibrios, lo que determinar que el
segundo equilibrio, al haber aumento de los protones, se desplace hacia la izquierda, consumiendo las
BBnoB, y aumente los cidos fijos. Observando los equilibrios

CO2 + H2 O H2CO3 HCO3- + H+

102
EQUILIBRIO QUMICO

HBuf Buf- + H+

Observando los equilibrios se puede deducir que las variables relacionadas con el estado cido base
quedarn de la siguiente manera:

BBB
BBnoB
BBR = BBB + BBnoB = aproximadamente constantes
EB = BBR - BBN = aproximadamente igual a cero
pH

En este caso se trata de una acidosis respiratoria. Asignamos el nombre de acidosis debido a un
aumento de las reservas cidas y la tendencia a bajar del pH. Como el origen del desequilibrio fue la
modificacin de la presin de dixido de carbono decimos que la causa fue respiratoria.
Se habla de acidosis cuando en el organismo queda un exceso de cidos: carbnico y HBuf, situacin
en la cual generalmente hay EB negativo y pH disminuido. Cuando esta situacin se origin a partir de
alguna perturbacin que no involucra al dixido de carbono se dice que es metablica, en caso de que
sea la causa el dixido de carbono se dice que es respiratoria.
Alcalosis: es cuando la situacin esta acompaada de aumento de las bases buffer y disminucin de
cidos, generalmente acompaada de pH aumentado y EB positivo. De igual manera que en las
acidosis, las alcalosis pueden ser respiratorias o metablicas.

Concentracin relativa de las reservas cidos y bsicas de una buffer: Cuando interesa conocer la
concentracin relativa de un buffer, se debe conocer el pH adems del pKa. Por ejemplo si nos
interesara dicho valor para el buffer de los fosfatos en plasma, donde el pH es 7,4 y el pKa= 7,
tendramos:

=
[HPO4 ]
pH = pKa+log -
[ H 2 PO 4 ]

=
[HPO 4 ]
7.4=7.0+ log -
[H2 PO4 ]

103
EQUILIBRIO QUMICO

despejando obtenemos

=
[HPO4 ]
-
=2.5
[H 2 PO 4 ]

Lo que indica que en plasma el buffer de fosfatos tiene 2,5 veces mas de reserva bsica que cida,
siendo por esto mas eficiente ante el agregado de cidos.
Es conocido que los fosfato por ser solutos de bajo peso molecular, filtran libremente a nivel de
glomrulo renal, encontrndose en orina.
Si quisiramos calcular su concentracin relativa en orina donde el pKa sigue valiendo 7 pero el pH
puede tomar diferentes valores dependiendo de la dieta y el estado cido base del paciente. Suponga-
mos que el pH de la orina es 6, el clculo se realiza de la misma manera
=
[HPO 4 ]
6=7.0+ log -
[H2 PO4 ]

despejando obtenemos

=
[HPO4 ]
-
=0,1
[H 2 PO 4 ]

En este caso vemos que la concentracin relativa es 0,1, esto significa que existe 10 veces menos
reserva bsica que cida.

Recuperacin renal de bases buffer: en los casos de acidosis, cuando ha entrado al organismo un
cido y las bases buffer se han visto disminuidas, el rin tiene tres mecanismos mediante los cuales
puede recuperar bases buffer bicarbonato y deshacerse de protones, excretando cidos.
Recuperacin de bicarbonato: En la Figura 6.1, se representa la luz del tbulo contorneado proximal,
una clula del mismo y el intersticio. En la luz del tbulo se encuentra bicarbonato de sodio, ya que el
mismo es de bajo peso molecular y filtra libremente en el glomrulo renal. Es importante destacar que
tambin existen otros solutos que no se representan en el esquema. Si se est en un estado de acidosis,
este bicarbonato debe ser recuperado, ya que se trata de una base buffer. La clula produce a partir del
metabolismo dixido de carbono, que se hidrata, reaccin catalizada por la anhidrasa carbnica,

104
EQUILIBRIO QUMICO

formado cido carbnico. El cido carbnico se disocia dando un protn y bicarbonato, el protn se
contratransporta con el Na+ que se encuentra en la luz, que pasa a favor de gradiente, ya que el interior
de la clula es negativa y la concentracin de sodio intracelular es menor que en la luz. Luego este
sodio es bombeado hacia el intersticio, acompaado por el bicarbonato, de esta manera se reabsorbi el
bicarbonato de sodio que haba filtrado. En la luz el protn que fue bombeado, se une al bicarbonato
(que es anfolito y se puede comportar como base) dando cido carbnico, el cual se deshidrata dando
dixido de carbono que puede difundir hacia el interior de la clula.

Figura 6.9: Reabsorcin renal de bicarbonato

Acidificacin urinaria por fosfato dicido: En la Figura 6.10 se representan los mismo comparti-
mientos que en el caso anterior. En la luz del tbulo, luego de filtrar libremente en el glomrulo, se
encuentra predominantemente fosfato monocido de sodio (recordar que la relacin sal/acido de este
buffer en plasma es 2,5). Las clulas tubulares produce a partir del metabolismo, dixido de carbono,
que se hidrata dando cido carbnico en la reaccin catalizada por la anhidrasa carbnica. El cido
carbnico se disocia dando un protn y bicarbonato, el protn se contratransporta con uno de los Na +
que se encuentra en la luz, que pasa a favor de gradiente, ya que el interior de la clula es negativa y la
concentracin de sodio intracelular es menor que en la luz. Luego este sodio es bombeado hacia el
intersticio, acompaado por el bicarbonato, de esta manera se reabsorbi bicarbonato, que si bien no
haba filtrado, contribuir a elevar las BBR, en estado de acidosis. En la luz el protn que fue
bombeado, se une al fosfato monocido (que es un anfolito y se puede comportar como base) dando
fosfato dicido, el cual se une al Na+ dando fosfato dicido de sodio, que es la forma cida,no pudiendo
reabsorberse, pero se excretar por orina, llevndose los protones que estn en exceso durante un
estado de acidosis.

105
EQUILIBRIO QUMICO

Figura 6.10. Excrecin de protones

Acidificacin urinaria por amonio: En la Figura 6.11 se representan los mismo compartimientos que
en el anterior. En la luz del tbulo aparece cloruro de sodio, ya que el mismo es de bajo peso molecular
y filtra libremente en el glomrulo renal. Las clula tubulares producen a partir del metabolismo
dixido de carbono, este se hidrata catalizada por la anhidrasa carbnica, formado cido carbnico. El
cido carbnico se disocia dando un protn y bicarbonato, el protn se contratransporta con uno de los
Na+ que se encuentra en la luz, que pasa a favor de gradiente, ya que el interior de la clula es negativa
y la concentracin de sodio intracelular es menor que en la luz. Luego este sodio es bombeado hacia el
intersticio, acompaado por el bicarbonato, de esta manera se reabsorbi bicarbonato, que si bien no
haba filtrado, contribuir a elevar las BBR, en estado de acidosis. En la luz el protn que fue
bombeado, se une al amonaco, que se form a partir de la glutamina en la clula tubular, este
amonaco al captar el protn genera NH4+ , que es la forma cida y con carga, lo que impedir su
reabsorcin, por ende se excretar por orina, llevndose los protones que estn en exceso durante un
estado de acidosis.

106
EQUILIBRIO QUMICO

Figura 6.11: Excrecin de amonio

6.16. Efecto del pH sobre la solubilidad de sustancias

Como desarrollamos anteriormente el pKa de una sustancia es el valor del pH al cual una sustancia
cida se halla disociada en un 50%. Por ejemplo para el cido actico, cuyo pKa = 4,75, si el pH =
4,75, el 50% de las molculas estarn como AcH y el 50% como Ac-.
El cido actico participa del equilibrio
AcH Ac- + H +
Si el pH es menor que el pKa, podemos interpretarlo tambin como un aumento de protones, por lo que
podemos pensar que el equilibrio se desplazar hacia la izquierda aumentando la concentracin de AcH
por sobre la de Ac-. Contrariamente a un pH > 4.75, lo interpretamos como una disminucin de la
concentracin de protones, que desplaza el equilibrio hacia la derecha aumentando la concentracin de
Ac- por sobre la de HAc.
Para sustancias con ms de un grupo cido es un poco ms complejo. Supongamos la molcula de
glicina. Esta molcula tiene dos grupos cidos: el grupo carboxilo (-COOH) que puede disociarse
dando un carboxilato ionizado (-COO-) y el grupo amino (-NH3+) que puede disociarse cediendo un

107
EQUILIBRIO QUMICO

protn y generar un grupo amino disociado, pero no ionizado (-NH 2). Como ya hemos explicado cada
grupo cido se halla mayoritariamente disociado si el pH>pKa de dicho cido. Para el caso de la
glicina los valores de pKa son: 2,31 (del grupo carboxilo) y 9,29 (del grupo amino). En la Figura 6.12
vemos los equilibrios de disociacin de la glicina. A pH inferior a 2.31 predominar la forma catinica
de la izquierda de la figura. A pH > 2.31 pero inferiror a 9.29 predominar la forma que contiene
disociado el carboxilo pero sin disociar el amino. Por ltimo a pH mayor a 9.29 predominar la forma
aninica, es decir la forma de la derecha de la figura. Si nuestra pregunta es que frma predomina a
pH= 7 solo tenemos que ver que relacin mantiene el pH en cuestin con los pKa de la molcula.
Como pH = 7 es superior a 2,31 pero inferior a 9,29, la forma que predominar ser estructrua del
centro con carga positiva y negativa.

Figura 6.12

6.17. Variacin del comportamiento hidroflico-hidrofbico con el pH

Para ver un vdeo sobre este tema haga click en el siguiente link: https://youtu.be/6H2gKle9Gsg
La molcula de agua esta formada por dos hidrgenos unidos a oxgeno. Por la geometra de la
molcula la polaridad de los enlaces entre el H y el O determina que la molcula sea polar y por lo
tanto decimos que es un dipolo permanente. Es decir que mantiene una densidad de carga positiva y
negativa sobre diferentes partes de la molcula (Figura 6.13). Por esta razn si analizamos la

108
EQUILIBRIO QUMICO

molcula de glicina esta interactuar con el agua con estructuras diferentes dependiendo del pH. El
grupo carboxilo interactur ms con el extremo positivo del dipolo del agua cuando est con carga
negativa asi como el amino con carga positiva lo har mejor con el extremo negativo del dipolo del
agua.

Figura 6.13

Si una molcula interactua mejor con el agua, tendr mayor solubilidad en ella.
Si analizamos nuevamente la molcula de glicina y nos preguntamos a que pH interactur mejor
con el agua, surge que lo har a un pH que esta comprendido entre 2.31 y 9.29, ya que en ese rango
de pH tendr carga negativa en el grupo carboxilo y positiva en el grupo amino.

109
EQUILIBRIO QUMICO

Figura 6.14

Este cambio en la afinidad con el agua influir en diversas propiedades, entre ellas el pasaje a travs
de las membranas.
En general si una molcula se mueve por difusin simple lo hace ms facilmente cuanto menor es
su peso molecular y cuanto ms hidrofbica es la misma. Para una dada molcula hemos visto que
el carcter hidroflico aumenta al ganar carga, cosa que ocurre al disociarse un grupo carboxilo.
Contrariamente una molcula pierde carga y por ende carcter hidroflico cuando se disocia un
grupo amino.
Si una molcula gana carga, ganar carcter hidroflico y por ende disminuir su posiblidad de paso
por una membrana por difusin simple. Contrariamente al perder carga, su carcter hidrofbico
aumenta y por ende aumenta su posibilidad de difusin. Es de capital importancia conocer el
comportamiento cido base de las molculas y fundamentalemente los frmacos, para poder
interpretar su absorcin, especialmente a lo largo del aparato digestivo donde los cambios de pH
son importantes al pasar de un compartimiento a otro.
Analicemos el caso de la aspirina que tiene un grupo carboxilo con pKa= 3,4. No podemos
preguntar como ser la absorcin de la aspirina a nivel del estmago, donde el pH puede llegar a
valores cercanos a 2 y en el intestino donde son ms cercanos a 7. La Figura 6.15 muestra las
posibles estructuras de la aspirina a pH<3.4 y mayor a ste. Como se desprende de la figura a pH <
3.4, por ejemplo a pH=6 predominar la forma disociada e ionizada que podr interactuar ms con
el agua y a pH<3.4 predominar la no disociada, menos hidroflica.

110
EQUILIBRIO QUMICO

Figura 6.15

Se desprende de la figura que en el estmago con pH=2, por ejemplo, predominar la forma no
disociada, ms hidrofbica y habra una mejor absorcin por difusin simple que en el duodeno
donde el pH es cercano a 7, donde predominar la forma disociada de la aspirina con mayor
solubilidad en agua. Por supuesto que el razonamiento realizado no siempre se puede extrapolar
linealmente ya que si bien en el intestino la solubilidad en agua es mayor y habra menor absorcin
por difusin simple, esta disminucin podra verse contrarrestada por la presencia de
especializacione de la mucosa que favorezcan la absorcin como son la vellosidades y
microvellosidades intestinales.
Reglas generales:
1- Una sustancia que tenga un grupo carboxilo tendr pKa cercano a 3.
2- Una sustancia que tenga un grupo amino tendr pKa cercano a 9
3- Las sustancias con grupo carboxilo son ms solubles en agua a pH>3 (por estar
predominantemente disociada e ionizada) y por ende se absorben mejor por difusin simple a pH<3
4- Las sustancias con grupo amino son ms soluble en agua a pH<9 (por estar predominantemente
no disociada e ionizada) y por ende se absorbern mejor por difusin simple si el pH>9.

6.18. Prctica

1) Hacia dnde se desplaza la reaccin siguiente al aumentar la concentracin de NADH y qu


ocurrir con la concentracin de lactato?
lactato + NAD+ piruvato + NADH + H+
2) Hacia dnde se desplaza la reaccin siguiente al disminuir el pH?
lactato + NAD+ piruvato + NADH + H+
Qu ocurrir con la concentracion de NADH?

111
EQUILIBRIO QUMICO

3)Dada la siguiente reaccin:


G-3-P + NAD+ + P 1,3-diPG + NADH + H+
Hacia dnde se desplaza al aumentar el pH y qu ocurre con [NADH]?
4) Dada la siguiente reaccin:
G-3-P + NAD+ + P 1,3-diPG + NADH + H+
Hacia dnde se desplaza al aumentar la concentracin de NAD+ y qu ocurre con [1,3diPG]?
5) Dada la siguiente reaccin:
ATP + 3-PG ADP + 1,3-diPG
Hacia dnde se desplaza la reaccin al aumentar la concentracin de ATP y qu ocurre con [1,3-
diPG]?
6) Dada la siguiente reaccin:
ATP + 3-PG ADP + 1,3-diPG
Hacia dnde se desplaza la reaccin al disminuir la concentracin de ADP y qu ocurre con [3-PG]?
7) Se disuelven 3 g de hidrxido de sodio en 500 ml de solucin. Calcular el pH de la solucin.
8) Calcular el pH de una solucin 0,0017 N de HCl.
9) Se dispone de 300 ml de HCl 0,00013 N. Calcular el pH de esta solucin
10) Calcular el pH de 169 ml de una solucin 0,038 M de H2SO4.
11) Calcular el pH de 59 ml de una solucin 0,0018 N de HNO3.
12) Calcular el pH de una solucin 0,013 g% de HCl (PM 36,5).
13) Se disuelven 0,365 g de HCl (PM 36,5) en 2445 ml de solucin :
a- Calcular el pH de la solucin
b- Indicar si el pH aumentar o disminuir al agregar agua a la solucin anterior.
c- Calcular el pOH de 100 ml de la solucin anterior.
14) Calcular el pH de una solucin 0,013 N de HCl.
15) En 250 ml de solucin se disuelven 72 g de H 2SO4. A esta solucin se le agrega agua hasta 5400
ml. Calcular el pH de esta ltima solucin.
16) Se disuelven 0,0365 gramos de HCl (PM 36,5) en 345 ml de solucin :
a- Calcular el pH de la solucin
b- Calcular el pH de 100 ml de la solucin anterior.
17) Se disuelven 0,014 moles de HCl (PM 36,5) en 1345 ml de solucin:
a- Calcular el pH de la solucin.
b- Indicar si el medio es cido o bsico.
c- Calcular el pH de 100 ml de la solucin anterior.
18) En 3453 ml de solucin se disuelven 3,7 g de H2SO4. De esta solucin se toman 540 ml. Calcular
el pH de esta ltima solucin.

112
EQUILIBRIO QUMICO

19) Se disuelven 0,365 gramos de HCl (PM 36,5) en 500 ml de solucin


a- Calcular el pH de la solucin
b- Calcular el pH despus de agregarle a la solucin 500 ml de agua.
20) Calcular el pH de una solucin en la que se han disuelto 40 g de hidrxido de sodio en 10 litros de
solucin.
21) Se disuelven 0,5 moles de HCl en 10 litros de agua:
a- Dar el nombre del solvente de la solucin.
b- Calcular la concentracin de la solucin expresada en M.
c- Indicar qu tipo de sistema es el HCl disuelto en agua.
d- Calcular el pH de la solucin.
22) Se disuelven 0,5 moles de cido sulfrico en 7000 ml de agua:
a- Calcular el peso molecular del cido sulfrico.
b- Calcular la normalidad de la solucin.
c- Calcular el pH de la solucin
d- Indicar nmero de fases y componentes de la solucin del cido.
23) Se disuelven 0,5 moles de HCl en 1 litro de agua:
a- Dar el nombre del soluto de la solucin.
b- Calcular la concentracin de la solucin expresada en % P/V.
c- Indicar qu tipo de sistema es el HCl disuelto en agua.
d- Calcular el pH de la solucin.
24) Se disuelven 3 g de NaOH (peso molecular 40) en 100 ml de agua. Calcular el pH de la solucin.
25) Se dispone de una solucin 0,015 M de HCl (PM 36,5) que contiene 2,5 g de este cido:
a- Qu volumen tiene la solucin?
b- Calcular su pH.
26) Se disuelven 7 g de cido clorhdrico formndose una solucin de 7345 ml. De esta solucin se
toman 540 ml:
a- Calcular el pH de esta ltima solucin.
b- Cul es la concentracin de oxhidrilos de la solucin madre?
27) Hallar el pH de una solucin de cido clorhdrico 0,01 M
28) Calcular el pH de una solucin de cido clorhdrico que contiene 3 gramos en 100 ml de solucin.
29) Calcular el pH de una solucin de cido ntrico que posee 0,4 eq. g por litro de solucin.
30) Calcular el pH de una solucin de cido ntrico 0,1 M.
31) Calcular la concentracin de protones y la molaridad de una solucin acuosa de cido clorhdrico
de pH 2,8.
32) Calcular la [OH-] de una solucin de hidrxido de potasio 0,01 M.

113
EQUILIBRIO QUMICO

33) Calcular el pOH de una solucin 0,2 N de hidrxido de calcio.

34- Indicar si el pH de las siguientes soluciones ser neutro, cido o bsico


a- HCl 0,01 M
b- HNO2 0,03 M
c- KCl 0.2 g/L
d- H3PO4 0,01 N
e- NaNO2 1 %P/V
f- KNO3 0,2 g/L
g- cido piroglutmico 0,1 g/l

35- Indicar si el pH de las siguientes soluciones ser neutro, cido o bsico


a- HCl 1 M
b- HNO2 0,01 M
c- H3PO4 0,01 N
d- cido piroglutmico 0,1 g/l

36- Indicar si las siguientes sustancias son cidos mono o poliprticos


a- HCl
b- HNO3
c- H4P2O7
d- cido sulfhdrico
e- cido sulfuroso

37- Calcular el pH de una solucin de cido carbnico 0,1 M. Ka1 = 4,46*10-7 , Ka2= 4,78*10-11
38- Calcular el pH de una solucin de cido asprtico 0,01 M, pKa1= 4, pKa2= 5, pKa3= 9
39- Calcular el pH de una solucin 0,01 M de HF y 0,02 M de NaF. Ka: 7*10-4
40- Calcular el pH de una solucin que en 200 ml contiene 0,2 moles de cido cetico y 0,08 moles de
acetato de sodio. pKa = 4,7

6.18.1. Respuestas

1- izquierda, aumenta.

114
EQUILIBRIO QUMICO

2- izquierda, disminuye.
3- derecha, aumenta.
4- derecha, aumenta.
5- derecha, aumenta.
6- derecha, disminuye.
7- 13,18
8- 2,77
9- 3,89
10- 1,12
11- 2,74
12- 2,45
13- a- 2,39. b- aumentar. c- 11,61
14- 1,89
15- 0,56
16- a- 2,54. b- 2,54
17- a- 1,98. b- cido. c- 1,98
18- 1,66
19- a- 1,70. b- 2
20- 13
21- a- agua. b- 0,05 M. c- homogneo. d- 1,30
22- a- 98. b- 0,143. c- 0,85. d- una fase, dos componentes
23- a- HCl. b- 1,825 % P/V. c- homogneo. d- 0,30
24- 13,88
25- a- 4566 ml. b- 1,82
26- a- 1,58 b- 3,82x10-13 eq/litro.
27- 2
28- 0,085
29- 0,4
30- 1
31- 1,58x10-3 eq/l. 1,58x10-3 M.
32- 0,01 eq/l
33- 0,70
34- a-cido, b-bsico, c-neutro, d-cido, e-bsico
35- a-cido, b-bsico, c-cido, d-cido

115
EQUILIBRIO QUMICO

36- a- monoprtico, b- monoprtico, c- poliprtico, d-poliprtico, e-poliprtico


37- 3,68
38- 3
39- 3,45
40- 4,3

116
ESTRUCTURA ATMICA

7. ESTRUCTURA ATMICA

El tomo es la menor porcin de la materia que puede participar en una reaccin qumica. En un
modelo sencillo, el tomo est formado por tres tipos de partculas subatmicas: neutrones (n),
protones (p+) y electrones (e-).
Existen diferentes modelos que explican la estructura de los tomos; estudiaremos superficialmente el
modelo de Rutherford. Este modelo consiste en un tomo compuesto por un ncleo y rbitas o niveles
de energa. Las rbitas se numeran desde el ncleo hacia afuera: 1, 2, 3, etc o bien con las letras K, L,
M, N, etc (Figura 7.1).
Puede obtener ms informacin en el siguiente link: https://youtu.be/BTrGZax8sBs

5 6 7
4
3
2
1

K
L
M
NO
PQ

Figura 7.1

En el ncleo del tomo se encuentran dos partculas subatmicas de importancia por su masa y carga:
los neutrones: n (sin carga) y los protones: p+ (con carga positiva), ambas con masa similar
(aproximadamente 1 unidad de masa atmica: uma). En las rbitas se encuentran los electrones: e -
(con carga negativa). Los electrones son 1800 veces mas livianos que los neutrones y protones.
Un tomo tiene igual cantidad de protones que de electrones. Cuando un tomo tiene ms electrones
que protones se dice que es un anin, tendr carga negativa y pertenecer al grupo de los iones.
Contrariamente si un tomo tiene ms protones que electrones, se dice que es un catin, tendr carga
positiva y tambin pertenece al grupo de los iones.
El tomo se puede hallar bsicamente en dos estados: fundamental y excitado.
Estado fundamental
El estado fundamental es el: estado en el cual el tomo tiene todos los electrones en su menor estado de
energa.
Estado excitado

117
ESTRUCTURA ATMICA

Un tomo esta en estado excitado cuando al menos algn electrn se encuentra en estado de mayor
energa. Al recibir energa un electrn se excita, aumentando su contenido energtico y alejndose del
ncleo, hacia niveles ms alejados del K. Cuando un tomo se desexcita, el electrn regresa a niveles
energticos ms cercanos al ncleo y libera energa. La energa liberada ser mayor cuanto ms
diferencia haya entre los niveles energticos de salida y llegada del electrn (Figura 7.2)

Figura 7.2: A la izquierda, proceso de excitacin de un tomo. A la derecha: proceso de


desexcitacin. A mayor salto del electrn mayor la energa liberada. El tamao de la flecha hace
referencia a la magnitud de la energa liberada o absorbida.

En un tomo en estado fundamental o excitado, la cantidad de electrones es igual a la de protones,


determinando que el tomo en este estado es neutro.
Todo tomo se reconoce bsicamente por dos nmero, el nmero atmico y el nmero msico
Nmero atmico
El nmero atmico se identifica con la letra Z; indica la cantidad de protones o electrones que tiene un
tomo neutro, en el caso de tomos ionizados solo indica la cantidad de protones. El Z se ubica como
subndice adelante o detrs del smbolo del elemento, por ejemplo 6C, indica que el Z del carbono es 6.
Nmero msico
El nmero msico se identifica con la letra A, e indica el nmero de neutrones mas protones del tomo.
El A se ubica como superndice a la derecha del smbolo del tomo, por ejemplo C 12, indica que el
tomo tiene entre protones y neutrones un total de 12 partculas. Neutrones y protones se conocen con
el nombre genrico de nucleones por hallarse en el ncleo del tomo.
Ejemplos:
El 11Na23, tiene Z=11, A=23. Tiene 11 protones 11 electrones y 12 neutrones.
En el caso del catin Na+, Z=11 y A=23 (los nmeros no cambian en un ion) tendr 11 p + y 10 e- ya
que al tener una carga positiva, indica que ha perdido un electrn; esto corresponde a una ionizacin.
Para el caso de 17Cl35, Z=17 y A= 35; por lo tanto tiene 17 p+ y 17 e-, adems de 18 n.
En el caso del anin cloruro (Cl-) , Z=17 y A=35, pero en este caso tendr 17 p + y 18 e-, adems de 18

118
ESTRUCTURA ATMICA

n. En este caso tambin estamos en presencia de una ionizacin, pero en la cual se form un anin por
haber ganado un electrn.

7.1.1. Catin

Estructura qumica con carga positiva. En el caso de tomos, un catin tiene siempre ms protones que
electrones. La diferencia entre el nmero de protones y electrones da la carga del catin y viceversa.
Por ejemplo en el catin Ca++, la cantidad de electrones es Z-2.

7.1.2. Anin

Estructura qumica con carga negativa. En el caso de tomos, un anin siempre tiene ms electrones
que protones. La diferencia entre los electrones y los protones da la carga del anin y viceversa. Por
ejemplo el anin I-, tiene una carga negativa, por lo tanto el nmero de electrones es igual a Z+1.

Figura 7.3. tomo neutro de Z=3 y A =7. A la derecha arriba: anin, el mismo tomo que gan un
electrn. Debajo a la derecha: catin: el mismo tomo que perdi un electrn

119
ESTRUCTURA ATMICA

7.2. Relaciones entre tomos

de comparar Z y A de dos tomos surgen algunas definiciones

7.2.1. Istopos

Los istopos son tomos de igual Z pero diferente A. por ejemplo 6C12 (Z=6, A=12) y 6 C14 (Z=6 ,
A=14). Estos dos tomos tienen igual cantidad de protones y electrones pero difieren en el nmero de
neutrones. Tambin se dice que dos istopos son tomos de igual cantidad de protones pero diferente
masa.

7.2.2. Istonos

Los istonos son tomos de igual cantidad de neutrones. Por ejemplo 8 O15, tiene 7 n y el 7N14 tiene 7
neutrones.

7.2.3. Isbaros

Dos tomos son isbaros si tienen igual A. Por ejemplo 7N14 y el 6C14, tienen la misma masa: 14.

7.2.4. Ismeros

Los ismeros son tomos de igual A y Z pero que se diferencian en el estado energtico.
Habitualmente se representa el tomo con mayor contenido de energa con la letra m delante del
nmero A, que se coloca como superndice del smbolo.
Por ejemplo es muy comn en medicina el uso de un ismero del Tc 99, que por tener mayor contenido
energtico se llama Tc99m. "m" significa metaestable o inestable.
No se debe confundir con el trmino "ismeros" utilizado para referirse a dos compuestos compuestos
por el mismo nmero y tipo de tomos, pero con diferente distribucin. Ya veremos este tema ms
adelante.

7.2.5. Catin

Estructura qumica con carga positiva. En el caso de tomos, un catin tiene siempre ms protones que
electrones. La diferencia entre el nmero de protones y electrones da la carga del catin y viceversa.
Por ejemplo en el catin Ca++, la cantidad de electrones es Z-2.

7.2.6. Anin

Estructura qumica con carga negativa. En el caso de tomos, un anin siempre tiene ms electrones
que protones. La diferencia entre los electrones y los protones da la carga del anin y viceversa. Por

120
ESTRUCTURA ATMICA

ejemplo el anin I-, tiene una carga negativa, por lo tanto el nmero de electrones es igual a Z+1.

7.2.7. Nclido

La palabra nclido o nucleido la utilizamos cuando hacemos referencia al tomo de un elemento en


particular sin compararlo con otro. Ejemplos:
El Ca45 es un nucleido radioactivo.
Un tomo o nucledo de I al ganar un electrn se transforma en un anin.
Un nclido de oxgeno y nucleido de N son istonos, por tener igual nmero de neutrones.
Si dos nucledos son ismeros, quiere decir que tienen igual Z y A pero difieren en su nivel energtico.

7.2.8. Nclidos estables e inestables

Los nclidos estables son tomos de un elemento que permanecen como tal a lo largo del tiempo. En
cambio, los nclidos o tomos inestables, tambin conocidos como tomos o elementos radioactivos
son aquellos en que su ncleo sufre cambios en el nmero de neutrones y protones, tranformndose en
otros tomos. A este proceso que no se estudia dentro de la qumica, se la conoce como desintegracin
radiactiva y el fenmeno que producen se conoce como radiactividad. La radiactividad y sus efectos
son de extrema importancia en las ciencias biomdicas tanto por sus efectos adversos como
beneficiosos.

7.3. Distribucin electrnica

Los electrones se encuentran fuera del ncleo del tomo, lo que llamamos comnmente periferia. La
periferia est dividida en niveles energticos, subniveles energticos y orbitales.
En un tomo existen niveles energticos numerados de 1 en adelante y se los nombra con la letra n = 1,
2, etc.
Dentro de cada nivel existen subniveles. El nmero de subniveles dentro de cada nivel es igual al
nmero del nivel energtico. Por ejemplo en el nivel 1 hay un subnivel, se llama s, en el nivel dos hay
dos subniveles, se llaman s y p, en el nivel 3 hay 3 subniveles y se llaman s, p y d.
Cada subnivel a su vez tiene orbitales, la cantidad de orbitales en los diferentes subniveles es: en el s: 1
orbital, en el p: tres orbitales, en el d: 5 orbitales.
La distribucin de los electrones, en niveles, subniveles y orbitales, sigue las siguientes reglas:
1- Regla de mnima energa: cuando un electrn entra a un tomo lo hace en el nivel, subnivel y orbital
de menor energa.
2- Principio de exclusin de Pauli: en un orbital no puede haber ms de dos electrones y ellos tiene que
tener spin opuesto.
3- Regla de mxima multiplicidad: cuando varios electrones entran en un nivel energtico, lo hacen
ocupando el mayor nmero de orbitales de igual energa.
Ejemplo de distribucin de los electrones siguiendo las tres reglas antes mencionadas:
11 Na23, tiene 11 electrones. stos se ubicarn en el tomo de la siguiente manera. Primero completarn

121
ESTRUCTURA ATMICA

el nivel 1, donde hay un subnivel (s) con un solo orbital, en un orbital no entrarn ms de dos
electrones
11 Na23: 1s2
han quedado dos electrones en el orbital s del nivel 1. Con esto se complet el primer nivel. Los
prximos electrones pasarn a ocupar el segundo nivel, dnde hay dos subniveles (el s con un orbital y
el p con tres orbitales), donde podrn entrar ocho electrones. Se ocupar primero el subnivel s por ser
de menor energa
11 Na23: 1s2 2s2
los otros seis electrones irn ingresando de manera que ocupan el mayor nmero de orbitales, como en
este caso tenemos seis electrones disponibles se llenar cada orbital p con dos electrones.
11 Na23: 1s2 2s2 2p2 2p2 2p2
De esta manera se complet el nivel dos. Nos queda un electrn, el cual entrar en el nivel 3, subnivel
s. El electrn del 3s es un electrn desapareado (no forma par), en cambio los otros son electrones
apareados, por encontrarse de a pares en cada orbital.
11 Na23: 1s2 2s2 2p2 2p2 2p2 3s1
En el caso del carbono: 6C12, tiene 6 electrones, la distribucin es igual hasta el orbital 2s, en los cuales
entran 4 electrones. Los dos electrones restantes entrarn en el subnivel p, pero como hay tres orbitales
de igual energa (degenerados), se ubicarn uno en cada uno de los orbitales p.
6C12: 1s2 2s2 2p1 2p1

En casos de mayor nmero electrnico suele ser difcil hacer el llenado electrnico. Para lo cual se
puede seguir el esquema de la Figura 7.4. En este esquema comenzando desde la flecha oblicua
superior y luego de finalizada la misma continuando con la flecha inmediata inferior se puede
identificar el nivel, subnivel y orbital a llenar.

122
ESTRUCTURA ATMICA

Figura 7.4: esquema para el llenado de la configuracin electrnica. Se indican los nombres de los
subniveles en cada nivel y la cantidad de orbitales en cada subnivel, as como el nmero mximo
de electrones que puede tener cada subnivel.

Veamos un ejemplo. Supongamos que queremos escribir la configuracin electrnica del hierro. En la
tabla peridica hallamos que el hierro tiene Z=26
Siguiendo es esquema nos queda
Fe26 : 1s2 2s2 2p2 p2 p2 3s2 3p2 p2 p2 4s2 3d2 d1 d1 d1 d1

123
ESTRUCTURA ATMICA

7.4. Ubicacin de los elementos en la tabla peridica

La tabla peridica est dividida en perodos (horizontalmente) y en grupos (verticalmente). En se


muestra una parte de la tabla peridica

Figura 7.5: parte de la tabla peridica de los elementos. En rojo indicado un grupo, en verde un
perodo. Sobre los grupos se indica su nmero y a la izquierda del perodo se muestra su
denominacin.

Un elemento ocupa en la tabla peridica el perodo indicado por su mayor nivel electrnico con
electrones y el grupo por el nmero de electrones en su ltimo nivel.
Veamos tres ejemplos
11 Na: 1s2 2s2 2p2 2p2 2p2 3s1
ltimo nivel: 3 perodo III
nmero de electrones en ltimo nivel: 1 grupo 1A
6C : 1s2 2s2 2p1 2p1
ltimo nivel: 2 perodo II
nmero de electrones en ltimo nivel: 4 grupo 4A
De manera similar se analizan los ejemplos siguientes.
26 Fe : 1s2 2s2 2p2 p2 p2 3s2 3p2 p2 p2 4s2 3d2 d1 d1 d1 d1
ltimo nivel: 4 perodo IV
nmero de electrones en ltimo nivel: 1 grupo 1A
10 Ne : 1s2 2s2 2p2 p2 p2
perodo 2 , grupo VIII

124
ESTRUCTURA ATMICA

Electrones de valencia: Se denominan


electrones de valencia a aquellos electrones
que se encuentran en el ltimo nivel. Estos
Na t o m o d e s o d io Na
electrones son los que les dan las propiedades
qumicas a los elementos. El nmero de
electrones de valencia de un tomo se obtiene +
+ Na
realizando la configuracin electrnica o bien Na c a t i n s o d io
conociendo el grupo al que pertenece el tomo
en la tabla peridica. En el caso del sodio, por
Cl t o m o d e c lo r o Cl
la configuracin electrnica encontramos que
es slo un electrn, el ubicado en el 3s 1. En la
tabla peridica el sodio pertenece al grupo I A. -
Por pertenecer al grupo I tiene 1 electrn en su Cl- a n i n c lo r u r o Cl
ltimo nivel. En el carbono, como surge de su
configuracin electrnica, son 4 los electrones Figura 7.6
de valencia 2s2 2p1 2p1. Adems en la tabla
peridica el C pertenece al grupo IV A.
De acuerdo al nmero de electrones se combinarn con otros tomos formando diferentes tipos de
compuestos y enlaces qumicos.
Se acostumbra a representar a los tomos por su smbolo y su electrones de valencia por puntos,
cruces, cuadrados, etc.
Veamos en la Figura 7.6, las representaciones del tomo de sodio, catin sodio, tomo de cloro y anin
cloruro, cuyas configuraciones electrnicas son:

tomo de sodio 11 Na23: 1s2 2s2 2p2 2p2 2p2 3s1

catin sodio 11 Na+: 1s2 2s2 2p2 2p2 2p2

tomo de cloro 17 Cl35: 1s2 2s2 2p2 2p2 2p2 3s2 3p2 3p2 3p1

anin cloruro 17 Cl-: 1s2 2s2 2p2 2p2 2p2 3s2 3p2 3p2 3p2

7.5. Propiedades peridicas

Las propiedades peridicas son propiedades de los tomos que dependen de su nmero atmico y
por lo tanto pueden analizarse con cierta facilidad.

7.5.1. Carga nuclear y radio atmico

En un perodo de la tabla peridica el nmero atmico aumenta de izquierda a derecha y por ende la
cantidad de protones. Sin embargo, los electrones que se agregan lo hacen en un mismo nivel. De

125
ESTRUCTURA ATMICA

esta manera hay mayor cantidad de cargas positivas en el ncleo con mayor cantidad de electrones
en un nivel, existiendo mayor fuerza de atraccin y como consecuencias menor radio atmico.
Comparemos algunos elementos del perodo II
3Li : 1s2 2s1
4Be : 1s2 2s2
5B : 1s2 2s2 2p1
6C : 1s2 2s2 2p1 2p1
7N : 1s2 2s2 2p1 2p1 2p1
8O : 1s2 2s2 2p2 2p1 2p1
9F : 1s2 2s2 2p2 2p2 2p1
10 Ne: 1s2 2s2 2p2 2p2 2p2
En un perodo, se van agregando protones en el ncleo a medida que aumenta Z (de izquierda a
derecha) y por ende electrones que entran en el mismo nivel de energa. Al aumentar la carga nuclear
positiva y el nmero de electrones, se produce ms atraccin lo que produce una disminucin del radio
atmico a medida que aumenta Z. Es decir que en un perodo el radio disminuye a medida que
aumenta el valor de Z (Figura 7.7).

126
ESTRUCTURA ATMICA

Figura 7.7. En crculos rojos se muestra la variacin del radio atmico a lo largo de un perodo.
Explicacin en el texto.

En un grupo, a medida que aumenta Z se van agregando protones en el ncleo y simultneamente


electrones en la periferia. Sin embargo estos electrones al pasar de un perodo a otro se agregan en un
nivel siguiente ms alejado del ncleo, por lo tanto aunque la carga nuclear y el nmero de electrones
aumento, produciendo mayor fuerza, el radio se incrementa (Figura 7.8).

127
ESTRUCTURA ATMICA

Figura 7.8: los crculos rojos muestran la variacin del radio atmico en un grupo al aumentar Z.
Explicacin en el texto.

7.5.2. Electronegatividad

La electronegatividad es una propiedad que mide la afinidad que tiene un tomo por electrones. Es
fcilmente entendible si se analiza a la luz de lo aprendido para el radio atmico. En un perodo
como se ha visto, el radio disminuye a medida que aumenta Z, es decir de izquierda a derecha. Es
decir que en un perodo los electrones de la capa de valencia cada vez estn ms cerca del ncleo
que a su vez tiene mayor carga positiva, debido al incremento del nmero de protones. En
consecuencia los electrones que estn o puedan entrar al ltimo nivel de energa sern ms atrados
cuanto mas a la derecha se halle en un perodo un dado elemento. Por lo tanto se dice que la
electronegatividad de los tomos aumenta de izquierda a derecha en un perodo. Por otra parte en un
grupo, a medida que bajamos en el mismo, el ltimo nivel de energa se halla ms lejos y por ende
menos retenido. De esta manera, un electrn que est o ingrese al ltimo nivel ser atrado con
menos fuerza cuanto ms se baja en un grupo. Es decir a medida que aumenta Z en un grupo
disminuye la electronegatividad.
Por ejemplo, si comparamos el tomo de sodio que tiene en el nivel 3 un electrn y en el ncleo 11
protones, con el Cl que tiene en el mismo nivel 7 electrones y en el ncleo 17 protones, los electrones
del cloro sern ms atrados, presentando el Cl mayor electronegatividad que el Na.

128
ESTRUCTURA ATMICA

En cambio si comparamos el 11Na23 con el 19K39, ambos tienen un electrn en su ltimo nivel pero el
sodio lo tiene en el nivel 3, y el potasio en el nivel 4. A pesar de que el potasio tiene mayor carga
nuclear (19 protones), al estar el electrn ms alejado del ncleo lo retiene con menor fuerza,
presentando el K menor electronegatividad.

7.5.3. Potencial de ionizacin

El potencial de ionizacin es la energa necesaria para arrancar de un tomo el electrn ms


dbilmente retenido. Es razonable que cuanto mayor sea la electronegatividad, mayor ser tambin
la energa requerida para sacar un electrn. Por lo tanto, el potencial de ionizacin aumenta de la
misma manera que aumenta la electronegatividad.

7.6. Enlace qumico

Cuando un tomo se aproxima a otro se unir, en la mayora de los casos cumpliendo con la regla del
octeto, esto es tratando de completar ocho electrones en su capa de valencia o ltima capa electrnica.
Los tomo parecen adquirir estabilidad cuando tiene 8 electrones en su ltimo nivel, aunque existe
excepciones. Existen bsicamente dos tipos de enlaces entre tomos para formar un compuesto: enlace
inico y enlace covalente
Enlace inico: Se presenta en los casos que la unin se produce por atraccin de dos estructuras de
carga contraria. Estos enlace son fuertes, pero en general, ms dbiles que los covalentes. Este tipo de
enlace se produce entre tomos de diferente electronegatividad, donde uno de ellos tiene poca
tendencia a retener los electrones y el otro mucha tendencia a ganarlos. En este tipo de enlace un
tomo ganar electrones y otro los perder. El proceso de ganar electrones se conoce como reduccin y
el proceso de perder electrones se conoce como oxidacin.
Para entender este tipo de enlace, supongamos el caso de los tomos de Na y Cl. Analizando las
configuraciones electrnicas. Los tomos segn sus Z tienen la siguiente configuracin electrnica
11Na23: 1s2 2s2 2p2 2p2 2p2 3s1
17 Cl35: 1s2 2s2 2p2 2p2 2p2 3s2 3p2 3p2 3p1
se observa que el sodio tiene un solo electrn en su capa de valencia, debera ganar 7 para alcanzar el
octeto; este fenmeno es improbable ya que incorporar 7 cargas negativas sera imposible por la
repulsin que se producira entre las mismas. Sin embargo si pierde el nico electrn del 3s, quedar
con 8 electrones en su ltimo nivel, transformndose en un catin monovalente (con una carga
positiva). Por otra parte el Cl tiene 7 electrones en su ltimo nivel, ganando 1 electrn completara su
octeto, formando un anin por haber ganado una carga negativa. De esta manera el electrn perdido
por el sodio es ganado por el cloro, formando cloruro. El catin Na + y el anin Cl- tienen cargas
opuestas y se atraern formando un enlace inico.
La formacin de la molcula de NaCl se representa en la Figura 7.9.

129
ESTRUCTURA ATMICA

+
Na Na
_
_
1e + Cl
Na
_

Cl Cl

Figura 7.9
La frmula del NaCl tal como se la muestra en la Figura 7.9, se denomina estructura de Lewis, en las
cuales se muestran los electrones de la ltima capa de cada tomo que forma la molcula.
En todo enlace inico un tomo perder uno o ms electrones, mientras que otro los ganar, se
formarn de esta manera un par inico que se atraern por fuerzas elctrica entre cargas de signo
contrario.

7.6.1. Enlace covalente

Este tipo de enlace se produce entre tomos de semejante electronegatividad. Dado que ambos tomos
tiene fuerzas similares a atraer los electrones, se torna improbable que uno los gane y otros los pierda.
Por ende en este enlace se produce la comparticin de electrones.
Analicemos el caso en que dos tomos de cloro, se unen para formar una molcula de Cl2.
La configuracin electrnica del cloro es
17 Cl35: 1s2 2s2 2p2 2p2 2p2 3s2 3p2 3p2 3p1
Los dos tomos tendrn esta configuracin. A los dos tomos les falta un electrn para completar su
octeto o bien deben perder 7, para quedar con el nivel anterior con ocho electrones. En este caso
ninguno de los tomos gana o pierde totalmente los electrones, sino que comparten un par de
electrones, aportados uno por cada tomo. De esta manera cada tomo tendr sus 7 electrones, ms el
que comparte, es decir que en su ltimo nivel tendrn ocho electrones.
La molcula de cloro queda representada en la Figura 7.10, a travs de su estructura de Lewis.

Cl Cl

Cl Cl

Cl Cl

Figura 7.10

130
ESTRUCTURA ATMICA

7.6.2. Tipos de enlaces covalentes

Enlace covalente simple: es cuando dos tomos comparten dos electrones, aportados uno por cada
tomo. Es un enlace que requiere mucha energa para destruirse, por lo que se considera un enlace
fuerte. Como en el caso de la molcula de cloro, discutido anteriormente. Un enlace covalente simple
(un par de electrones compartidos) se representa por una lnea, ver figura 7.4.
Enlace covalente doble: cuando dos tomos comparten cuatro electrones, aportados dos por cada
tomo.
Estudiemos el caso cuando se unen dos tomo de oxgeno. La configuracin electrnica del oxgeno es
8 O16: 1s2 2s2 2p2 2p1 2p1
A cada tomo de oxgeno le faltan dos electrnes para completar el octeto. El octeto se alcanza
compartiendo cuatro electrones, aportados dos por cada tomo. De esta manera cada oxgeno alcazan 8
electrones en su ltimo nivel energtico: seis electrones que posee y dos que recibe de otro tomo de
oxgeno. Se puede representar un enlace covalente doble (dos pares de electrones compartido) por dos
lneas, ver Figura 7.11.

O O

O O

O O

Figura 7.11

Enlace covalente triple: Es cuando dos tomos comparten seis electrones, aportados, tres por cada uno
de los tomos involucrados en el enlace.
Este es el caso cuando se unen dos tomos de nitrgeno para formar una molcula de nitrgeno. El N
tiene la siguiente configuracin electrnica:

7N14: 1s2 2s2 2p1 2p1 2p1

En su ltimo nivel energtico vemos que tiene 5 electrones. Para completar su octeto debera perder 5
electrones o bien ganar 3 electrones. Perder 5 electrones lo dejara con el nivel 2 completo, pero
implicara extraer cinco carga negativas, alejndolas de una estructura con carga positiva cada vez
mayor. Al unirse dos tomos de N, ambos tienen la misma fuerza para retener electrones, por lo que es
improbable que uno de ellos pierda electrones. Por lo tanto deben compartir 3 pares de electrones, de
esta manera cada tomo de nitrgeno quedar con 8 electrones en su ltimo nivel: 5 electrones que le
pertenecen y 3 prestados por el otro tomo, Figura 7.12.

131
ESTRUCTURA ATMICA

N N

N N

N N

Figura 7.12
Todos los enlaces covalentes son fuertes y tanto ms fuertes cuanto mayor es su multiplicidad (simple,
doble o triple). Adems cuanto mayor es su multiplicidad, ms corta es la longitud del enlace. Por
ejemplo un enlace C-C es ms largo y ms dbil que un C=C.

7.6.3. Polaridad del enlace covalente

Dado que en el enlace covalente se comparten electrones, stos quedan entre ambos tomos, sin existir
transferencia de electrones como ocurre en el enlace inico. Cuando la electronegatividad de un tomo
supera a la del otro, los electrones se desplazarn hacia el tomo mas electronegativo, producindose
un enlace covalente polar. En este caso el enlace quedar con una pequea cantidad de carga negativa
(-) sobre el tomo mas electronegativo y una pequea densidad de carga positiva (+) sobre el tomo
menos electronegativo. Se conoce como enlace covalente polar y lo que se ha formado es un dipolo
permanente, ya que siempre existir una densidad de carga positiva y negativa en su estructura (+ y
-), figura 7.7, dibujo superior. En estos enlaces se determina el momento dipolar (), este es una
medida del desplazamiento electrnico en el enlace y por lo tanto de la acumulacin de cargas de
signos contrarios en los extremos del dipolo. Un dipolo tiene ms separacin de carga cuanto mayor es
el momento dipolar.

+ -

D IP O L O P E R M A N E N T E

+ -

D IP O L O IN S T A N T A N E O

Figura 7.13

Cuando dos tomos iguales forman un enlace covalente, dado que la electronegatividad es la misma
para ambos tomos,los electrones del enlace sern atrados con la misma fuerza por ambos tomos. En
este caso no existe desplazamiento de los electrones del enlace. Se trata de un enlace covalente apolar.
Estos enlaces covalentes apolares pueden tener temporariamente (por azar) pequeas acumulaciones de
cargas positivas y negativas, constituyendo lo que se llaman dipolos instantneos e inducidos, Figura
7.13 , dibujo inferior.

132
ESTRUCTURA ATMICA

7.6.4. Polaridad de enlaces y de molculas

Como vimos en el inciso anterior, si dos tomos diferentes se unen por enlace covalente, dado que
la electronegatividad de los tomos es diferente, el enlace ser de tipo polar. Adems, la polaridad
del enlace ser mayor cuanto mayor sea la diferencia de electronegatividad. Ahora bien, estos
enlaces polares pueden compensarse o no entre si generando molculas polares o apolares. El
conocimiento si una molcula es polar o no es de gran importancia en las ciencias biomdicas para
analizar el comportamiento de las sustancias frente a diferentes eventos biolgicos.
Para analizar la polaridad de una molcula es importante en primer lugar determinar si un
compuesto es inico o covalente. Como regla sencilla podemos decir que un compuesto es inico si
tiene un metal y un no metal. En general

7.6.5. Diferencias entre los compuestos inicos y covalentes

En general los compuestos inicos son:


1) Solubles en agua
2) De alto punto de fusin
3) Conducen la electricidad fundidos o en solucin
4) Tienen estado cristalino
Los compuestos covalentes
1) Son insolubles en agua
2) Tienen bajo punto de fusin
3) No conducen la electricidad fundidos o en solucin
4) No se asocian a estado cristalino

7.7. Prctica

Ejercitacin sobre estructura atmica en el siguiente link


https://docs.google.com/forms/d/e/1FAIpQLSc5c4Oy3LNVy-
_APJS6gQtZQ3kyWTMIVAh4tAVHWeTFw4H9nA/viewform?usp=sf_link
Sus respuestas
https://docs.google.com/forms/d/e/1FAIpQLSc5c4Oy3LNVy-
_APJS6gQtZQ3kyWTMIVAh4tAVHWeTFw4H9nA/viewform?
usp=pp_url&entry.1247999669=tiene+Z+mayor+que+el+n
%C3%BAmero+de+electrones&entry.1071298463=es+igual+al+n
%C3%BAmero+del+nivel&entry.910533481=que+un+electr%C3%B3n+absorba+energ
%C3%ADa&entry.788088112=1s2+2s2+2p1+p1+p1&entry.1151974095=ambos+elementos+perten
ecen+al+mismo+per%C3%ADodo+de+la+tabla+peri%C3%B3dica&entry.1903136022=P
%C3%A9rez,+Ju%C3%A1n&entry.2083936902=25741258

1) Escribir la configuracin electrnica de los siguientes elementos:

133
ESTRUCTURA ATMICA

a- K
b- He
c- F
d- Sr
e- Fe
2) Indicar y demostrar si la unin entre los pares de elementos que se dan a continuacin ser inica o
covalente (en este ltimo caso indicar si sera simple, doble o triple)
a- O - O
b- Na - F
c- N - N
d- Ca - S
e- Cl - Cl
3) Escribir la estructura de Lewis de los siguientes compuestos e indicar las caractersticas de cada
enlace (covalente, inico, etc)
a- cido clorhdrico
b- cido sulfrico
c- pentxido de difsforo

4) a- Indicar nmero atmico del sodio.


b- Hacer su configuracin electrnica.
c- Indicar si tendr ms probabilidad de formar enlace inico o covalente.
5) a- Indicar nmero atmico del flor.
b- Hacer su configuracin electrnica.
c- Indicar si tendr ms probabilidad de establecer un enlace qumico covalente o inico.
6) Escribir la configuracin electrnica del 20Ca, e indicar si tendr ms probabilidad de formar enlace
inico o covalente al combinarse con el 9F.
7) a- Escribir la configuracin electrnica del 26Fe.
b- Indicar que tipo de enlace (inico o covalente) se producir al unirse un tomo de K con un tomo
de F.

7.7.1. Respuestas

1- a- 19K: 1s2 2s2 2p2 2p2 2p2 3s2 3p2 3p2 3p2 4s1
b- 2He: 1s2
c- 9F: 1s2 2s2 2p2 2p2 2p1
d- 38Sr: 1s2 2s2 2p2 2p2 2p2 3s2 3p2 3p2 3p2 4s2 3d2 3d2 3d2 3d2 3d2 4p2 4p2 4p2 5s2

134
ESTRUCTURA ATMICA

e- 26Fe: 1s2 2s2 2p2 2p2 2p2 3s2 3p2 3p2 3p2 4s2 3d2 3d1 3d1 3d1 3d1
2- a- covalente doble
b- inico
c- covalente triple
d- inico
e- covalente simple
3- a- covalente, b- covalente, c- covalente
4- a- 23. b- 11Na: 1s2 2s2 2p2 2p2 2p2 3s1. c- inico
5- a- 9. b- 9F: 1s2 2s2 2p2 2p2 2p1. c- inico con elementos metlicos y covalentes con no metlicos.
6- 20Ca: 1s2 2s2 2p2 2p2 2p2 3s2 3p2 3p2 3p2 4s2. inico
7- a- 26Fe: 1s2 2s2 2p2 2p2 2p2 3s2 3p2 3p2 3p2 4s2 3d2 3d1 3d1 3d1 3d1. inico.

135
QUMICA ORGNICA

8. QUMICA ORGNICA

Definimos a la qumica orgnica como la rama de la qumica que estudia los compuestos del
carbono. En general nos referimos como "compuestos del carbono" a aquellas estructuras qumicas
que adems de contener carbono, ste se halla unido consigo mismo formando cadenas carbonadas.
Bajo esta definicin quedan excluidos de la qumica orgnica, compuestos como los carbonatos,
bicarbonatos, dixido de carbono y otros menos comunes como los tiocianatos, cianatos y cianuros
que continen carbono, pero no unidos con otros tomos del mismo elemento.

8.1. Grupos funcionales

Se define como grupo funcional a un grupo de tomos que se presenta siempre con la misma
estructura, y le confiere a la molcula en la que se halla caractersticas fisicoqumicas definidas. Por
ejemplo el grupo funcional oxhidrilo: -OH, cuando se liga a metales, le confiere a las molculas ciertas
caractersticas qumicas, como por ejemplo presentar un pH superior a 7, cuando se disuelven en agua.
Dentro de los compuestos orgnicos existen agrupaciones de tomos o grupos funcionales
caractersticos, cuya presencia determinar el tipo y comportamiento del compuesto.
Las cadenas carbonadas son uniones de varios tomos de carbono. Los tomos se pueden unir por
simple (C-C), doble (C=C) o triple ligadura carbono carbono. Para ver un video sobre este tema haga
click en el siguiente link: https://youtu.be/MSoijIWD770?t=33. Los compuesto con simples ligaduras
se llaman saturados y los que poseen dobles o triples se llaman insaturados; la representacin puede
hacerse a travs de la frmulas taquigrficas, dnde cada lnea indica un enlace carbono-carbono, no
dibujndose los smbolos de C e H pero s los de otros elementos como ser el O, el Cl, y los grupos
funcionales.
En la Figura 8.1 se muestran tres cadenas carbonadas con su correspondiente frmula taquigrfica.

C H 3- C H = C H - C H = C H - C = C H

CH 3 CH 3

Cl
CH C CH CHCl
3 3
3 3

CH CH
2

COOH CH
COOH 2

Figura 8.1
En la Figura 8.2 se presentan los grupos funcionales de mayor importancia en los compuesto
orgnicos y especialmente en molculas de inters biolgico.

136
QUMICA ORGNICA

Figura 8.2.
De la combinacin de cadenas carbonadas y grupos funcionales surgen los diferentes compuestos
orgnicos.

8.2. Hidrocarburos

Alcanos
Los tomos de carbono tienen la particularidad que pueden unirse entre s formado prcticamente
cualquier forma de molcula imaginable. Cuando todos los tomos de carbono se unen entre s por
simple enlaces se dice que la molcula es saturada. Haga click en el siguiente link para ver vdeo sobre
el tema: https://youtu.be/MSoijIWD770?t=458.
Estas cadenas pueden ser lineales, ramificadas y cclicas, adems pueden presentarse molculas que
estn compuestas por la combinacin de los tres tipos de cadenas.
Cadenas carbonadas lineales: se est en presencia de estas estructuras cuando cada tomo de carbono
est unido a dos tomos de carbono, salvo los de los extremos que slo estn unido a un tomo de
carbono. En la Figura 8.3, la cadena est formada por 5 tomos. Aquellos tomos que estn unidos a
dos carbonos, se llaman carbonos secundarios, mientras que los de los extremos por estar unidos solo
a un carbono se llaman carbonos primarios.

Figura 8.3.

Numeracin de la cadena: para las estructuras lineales, siempre el carbono nmero 1 es uno de los
tomos de carbono de los extremos de la cadena. El carbono nmero 2 es el siguiente al carbono
nmero 1, y as sucesivamente con el carbono 3, etc. Es indistinto tomar uno u otro extremo como
carbono 1, Figura 8.3.
En la Figura 8.4, se muestran cadenas lineales posibles. La primer estructura slo tiene un carbono, el

137
QUMICA ORGNICA

nombre que se le da es metano, la segunda estructura, con dos carbonos se denomina etano, la tercera,
con 3 carbonos se denomina propano y la cuarta con 4, butano. Cuando las cadenas carbonadas tienen
ms de 4 carbonos se le dan los nombre de pentano, cuando tiene 5 tomos de carbono; hexano: para el
compuesto de 6 tomos de carbono; heptano para 7 y as sucesivamente.

H H H H H H

H C H H C C H H C C C H

H H H H H H

METANO ETANO PROPANO

H H H H H H H H H

H C C C C H H C C C C C H

H H H H H H H H H

BUTANO PENTANO

H H H H H H

H C C C C C C H

H H H H H H

HEXANO

Figura 8.4

El nombre de las cadenas carbonadas saturadas lineales, comienza con un prefijo que indica el nmero
de tomos de carbono de la molcula con la terminacin ano, con excepcin de los cuatro primeros
compuestos.
Radicales: Se da el nombre de radical a una cadena carbonada, que ha perdido un hidrgeno,
presentando una valencia libre, que le permitir unirse a otra cadena carbonada. Como se observa en la
Figura 8.5, cualquier molcula orgnica puede perder un hidrgeno y transformarse en un radical; para
los ejemplos ya vistos en la Figura 8.4. Si se trata del metano el que perdi el hidrgeno, el radical que
se obtiene es el metilo. Si es el etano, el radical es el etilo, para el propano, propilo y as sucesivamente.
Un radical tendr el mismo nombre que la molcula que le dio origen, pero terminado en ilo.
Numeracin del radical: El carbono 1 es aquel que ha perdido el hidrgeno y se halla ligado a otra
cadena. Ver ejemplo del hexilo en la Figura 8.5.
H H H H H H

1 1
H C H C C H C C C

H H H H H H

METILO ETILO PROPILO

H H H H H H H H H

1 1
H C C C C H C C C C C

H H H H H H H H H

BUTILO PENTILO

H H H H H H

6 5 4 3 2 1
H C C C C C C

H H H H H H

HEXILO

Figura 8.5

138
QUMICA ORGNICA

Cadenas carbonadas ramificadas: Una cadena es ramificada cuando, presenta una cadena lineal a la
que se unen radicales. La estructura carbonada de la Figura 8.6, presenta un metilo unido a la cadena
principal. Se elige como cadena principal aquella cadena lineal ms larga independientemente de que
presente ngulos. Como se observa en la Figura 8.6, esta molcula tiene carbonos primarios,
secundarios y uno terciario, que es aquel en el que se inserta la ramificacin, y est unido a tres
carbonos.

CH
3

CH CH CH CH 2-METIL PENTANO
3 2 2
CH
3

5
CADENA PRINCIPAL
CH
1 2 3 4 3

CH CH CH CH
3 2 2
FORMULA TAQUIGRAFICA
CH
3

Figura 8.6
Numeracin de la cadena en compuestos ramificados: una vez elegida la cadena principal, se asigna el
nmero 1 al carbono del extremo ms cercano a la ramificacin. Si todos los enlaces
son simples, el compuesto es saturado y su terminacin ser ano.
En el ejemplo de la Figura 8.6, la cadena mas larga tiene 5 carbonos, por lo tanto el compuesto es un
pentano, pero tiene un metilo, esto obliga a numerar la cadena desde el extremo ms cercano al este
grupo, de esta manera el metilo queda ubicado en la posicin 2; con estos elementos podemos nombrar
al compuesto como 2-metil pentano.
Intentemos el ejercicio a la inversa, escribamos el compuesto cuyo nombre el 3-etil-4-metil-decano.
Este compuesto es saturado, por su terminacin ano, adems tiene 10 C en su cadena principal (deca).
3-etil, significa que tiene un radical etilo en la posicin 3 respecto de uno de los extremos de la cadena.
4-metil significa que tiene un metilo en la posicin 4 respecto del mismo extremo. La estructura que
resulta es la que vemos en la Figura 8.7. En la misma figura se muestra la correspondiente frmula
taquigrfica.

139
QUMICA ORGNICA

CH
3
CH CH CH CH CH CH CH CH CH CH
3 2 2 2 2 2 2 3

C H
2

CH
3

FORMULA TAQUIGRAFICA

Figura 8.7
Cadenas carbonadas cclicas: una cadena es cclica cuando no presenta extremos, es decir que el
carbono de un extremo se une con el carbono del otro extremo. Haga click para ver vdeo sobre este
tema en: https://youtu.be/MSoijIWD770?t=1166.
En la Figura 8.8, el primer compuesto tiene 5 carbonos, formando una estructura cerrada. Tiene
simples ligaduras, es saturado y su terminacin ser ano. Como tiene 5 carbonos su nombre es
pentano, pero por tratarse de un compuesto cclico, su nombre es ciclopentano. La segunda estructura,
es un compuesto similar, pero que tiene unido un radical metilo, su nombre es metil ciclo pentano.
Demos la nomenclatura del tercer compuesto de la Figura 8.8. Se trata de un ciclo de seis carbonos, su
nombre ser ciclohexano, pero por presentar dos grupos metilos unido al ciclo su nombre completo es
dimetil ciclohexano. Se debe numerar tomando como carbono 1, el correspondiente a algn metilo. El
nombre completo sera 1,2-dimetil ciclohexano. En la misma figura se muestran las frmulas
taquigrficas.
C H C H C H
2 2 2

C H C H C H C H C H 3 C H C H C H 3
2 2 2 2

CH CH CH C H C H C H C H
2 2 2 2 2 3

C H
2

Figura 8.8

Alquenos
Son cadenas carbonadas con dobles ligaduras. Para ver vdeo haga click en:
https://youtu.be/MSoijIWD770?t=768. Cuando las estructuras tienen doble o triples ligaduras, se trata
de compuestos insaturados. La presencia de una doble ligadura modifica muy poco el nombre respecto

140
QUMICA ORGNICA

de los compuesto saturados. En la figura 8.9 se presenta la estructura del pentano (un alcano). La otra
estructura es similar al pentano con la diferencia que tiene una doble ligadura entre el carbono 2 y 3, el
compuesto se llamar 2-penteno (es un alqueno). En el caso de estas cadenas, se usa el mismo prefijo
que para los alcanos, para indicar el nmero de carbonos de la cadena, indicando el carbono donde
comienza el doble enlace y terminando el nombre con eno.
C H C H C H C H C H
3 2 2 2 3

PENTANO

C H C H C H C H C H
3 2 3

2-PENTENO

C H
3

C H C H C C H C H C H C H
3 2 2 2 3

3-METIL-2-HEPTENO

Figura 8.9

Ejemplo: escribamos la frmula de 3-metil-2-hepteno: este nombre nos da las siguientes pistas:
Terminacin "eno": tiene un doble enlace
2-hepteno: indica dos cosas. Por un lado que el doble enlace esta entre el carbono 2 y 3 y la palabra
hepteno indica que tiene 7 carbonos.
3- metil: indica que el compuesto tiene un grupo metilo en el carbono 3.
La frmula correspondiente a este compuesto es la tercera de la Figura 8.9.

Alquinos
Son cadenas carbonadas con triples ligaduras. Es similar al caso con dobles ligaduras, con la diferencia
que la terminacin de los nombres ser ino. Para ver vdeo haga click en:
https://youtu.be/MSoijIWD770?t=953.
Observe la estructura de la Figura 8.10. sta tiene una cadena principal de 10 C con una triple ligadura
entre los carbonos 4 y 5, por lo tanto su nombre es 4-decino. La presencia de dos grupos metilos, uno
en el C 2 y otro en el C 6, determinan que el nombre definitivo sea 2,6-dimetil-4-decino

141
QUMICA ORGNICA

C H C H
3 3

C H C H C H C C C H C H C H C H C H
3 2 2 2 2 3

Figura 8.10

8.3. Compuestos aromticos

Se denomina a una estructura aromtica cuando, tiene dobles ligaduras conjugadas, Figura 8.11, es
decir dobles ligaduras separadas por simple ligaduras. Dentro de los compuestos con estructura
aromtica el ms importante es el benceno, tambin conocido como anillo bencnico, anillo aromtico
o ncleo bencnico, Figura 8.11. Esta estructura se puede escribir en la forma convencional, pero lo
mas comn es representarla en forma taquigrfica, o mas aun utilizando una forma taquigrfica en la
que no se representan los dobles enlaces, sino que se dibuja en el interior del ciclo un crculo que los
representa, Figura 8.11. Para ver vdeo haga click en: https://youtu.be/MSoijIWD770?t=1224

C H C H C H C H C H C H C H C H
3 3

C H

C H C H

C H C H

C H

Figura 8.11

8.4. Grupos funcionales

Llamamos grupo funcional a una estructura qumica formada por tomos definidos que se repite en
los diferentes compuestos. Se asocia a dicha estructura un comportamiento qumico definido, es

142
QUMICA ORGNICA

decir que dichos grupos funcionales permitirn a la molcula que los contiene establecer ciertos
enlaces y hacer determinadas reacciones qumica. En funcin del grupo funcional presente, el
compuesto pertenece a determinada familia. Por ejemplo un oxhidrilo unido a un carbono que solo
tiene unido otros carbonos e hidrgenos permite que a dicha molcula la clasifiquemos como un
alcohol.

8.4.1. Alcoholes

Tienen un oxhidrilo como grupo funcional, el que est compuesto por un O y un H. Puede ver el
desarrollo de este tema en el siguiente link: https://youtu.be/5viUo5r1U3g?t=119
Este grupo funcional se puede presentar de diferentes maneras. Estamos en presencia de alcoholes
primarios, secundarios o terciarios, segn el oxhidrilo est ligado a un carbono primario, secundario o
terciario, Figura 8.12.
CH OH ALCOHOLPRIMARIO
2
CH OH ALCOHOLSECUNDARIO

CH C OH
3 ALCOHOLTERCIARIO

CH
3

CH CH OH
3 2
CH OH CH OH

CH CH OH
2 2
CH
3 1,2,3PROPANOTRIOL
GLICEROL
2BUTANOLOALCOHOLBUTLICO GLICERINA

Figura 8.12
Cuando slo se encuentre este grupo funcional en la molcula, se dice que el compuesto es un alcohol.
La nomenclatura de los alcoholes se forma con el nombre del hidrocarburo del cual proviene,
terminado en ol. Tambin se pueden nombrar utilizando la palabra alcohol, seguida del nombre del
hidrocarburo que le dio origen terminado en lico. Es muy comn la utilizacin de una nomenclatura
que no responde a las reglas anteriores y que utiliza nombres llamados de fantasa. Por ejemplo, en la
Figura 8.12, se dan dos frmulas, la primera de ella corresponde al alcohol denominado 2-butanol (2
por la posicin del oxhidrilo y butano por tener cuatro carbonos, la terminacin ol por ser un alcohol).
Tambin se podra llamar a este compuesto alcohol 2-butlico. El segundo ejemplo corresponde al
1,2,3-propanotriol (1,2,3 por la posicin de sus tres grupos oxhidrilos, propano por tener tres carbonos,
triol por ser una molcula con tres grupos oxhidrilos). Esta molcula se conoce tambin con el nombre
de glicerol o glicerina, que es su nombre de fantasa y que de hecho es el mas utilizado.
Los grupos oxhidrilos, como poseen el enlace O-H que es covalente polar, le confieren polaridad a la
molcula en la que se encuentran. Esta polaridad se manifiesta fundamentalmente como afinidad por el
agua, dado que tienen la posibilidad de establecer puente de hidrgeno. Cuanto ms cantidad de grupos
oxhidrilos tenga una molcula, ms soluble ser en el agua. Por otra parte cuanto ms corta sea la
cadena carbonada tambin ser ms soluble en agua, dado que la cadena carbonada le da a la molcula
caractersticas hidrofbicas.
Este grupo no es ionizable a pH fisiolgico. Su pKa es muy alto, cercano a 14, por lo tanto es
imposible encontrarlo disociado al pH habitual de los fluidos corporales. En el caso particular que un

143
QUMICA ORGNICA

oxhidrilo se encuentre sobre un anillo aromtico, el comportamiento es diferente, pudiendo disociarse a


pH ms bajo, por lo que pueden existir alcoholes unidos a ncleos aromticos (llamados fenoles) en
forma ionizada, confirindole a la molcula una carga negativa.
En los compuestos biolgicos los alcoholes son grupos funcionales de extrema importancia y ellos
participan predominantemente en la formacin de uniones ster con cidos. Los principales steres se
producen con los cidos grasos y con el cido fosfrico.

8.4.2. Aminas

Se denominana aminas a aquellas molculas que tienen el grupo funcional amina. Para ver un video
sobre el tema haga click en este link https://youtu.be/5viUo5r1U3g?t=280. El grupo amina se compone
de un nitrgeno terciario, dnde una de sus valencias se encuentra unida a un carbono. Las otras
valencias se pueden unir a H o radicales carbonados. La nomenclatura de las aminas se forma con el
nombre del hidrocarburo al que se encuentra unido el grupo amina, seguido de la palabra amina. En la
Figura 8.13, se muestra la estructura de la 1-butilamina.
CH CH CH CH NH BUTILAMINA
3 2 2 2 2

CH
3
CH CH N DIMETILETILAMINA
3 2
CH
3

H O

CH CH CH CH N C CH
3 2 2 2 3

N-ACETIL-BUTILAMINA

Figura 8.13
El nmero 1 indica que el grupo amina se encuentra ubicado en el C 1 de la cadena. Butil, indica que la
cadena tiene 4 carbonos (radical que proviene del butano). En la segunda estructura se muestra la
dimetil etilamina, en este compuesto la cadena principal es el etano, de all el nombre etil amina, y
dimetil por tener los dos hidrgenos de la amina, sustituidos por dos metilos. Observando las
estructuras se observa que en el caso de la 1-butilamina, el grupo amina se halla unido slo a un
carbono, es una amina primaria, en cambio en el caso de la dimetil etilamina, la amina tiene tres
carbonos ligados, es por lo tanto una amina terciaria.
En algunos casos especiales se suele reemplazar un hidrgeno del grupo amina por otro grupo (en los
compuestos biolgicos es comn el acetilo). En la Figura 8.13, se muestra el N-acetil butilamina.
Butilamina, ya que la cadena tiene cuatro carbonos, con un grupo amina. Como el grupo acetilo se
encuentra unido al nitrgeno se le antepone la letra N.
A semejanza del grupo oxhidrilo, el grupo amina tiene la particularidad de poder establecer uniones
puente de hidrgeno con el agua, debido a que la unin N-H es muy polar. Por lo tanto cuanto mayor
sea la cantidad de grupos amina de una molcula y menor sea el largo de la cadena carbonada, ms
soluble en agua ser el compuesto.
Otra particularidad del grupo amina es su capacidad de ionizacin. Si se realiza la estructura de Lewis
del grupo se puede observar que tiene un par de electrones libre, en los cuales puede unirse un protn

144
QUMICA ORGNICA

(H+), es decir que se puede comportar como base, Figura 8.14. Al captar el protn adquiere carga
positiva. Como toda base al captar un protn se transforma en un cido conjugado, el pKa de este cido
es cercano a 9, dependiendo del entorno molecular, lo que significa que perder el hidrgeno si el pH
supera a 9. De lo anterior se deduce que a pH fisiolgico los grupos amina se encontrarn con el protn
unido y por lo tanto con carga positiva, lo que le otorga mayor solubilidad en agua.
Cuando el grupo amina se encuentra con el protn ligado (protonizado), la nomenclatura cambia
ligeramente. En la Figura 8.14, se muestra la etilamina, luego de ganar el protn adquiere carga
positiva y pasa a llamarse etilamonio. Por tener carga positiva, debe ir acompaada de un anin, por
ejemplo cloruro, entonces el nombre completo ser cloruro de etil amonio.

H H
+ +
H N H + H H N H

+ +
C H C H N H + H C H C H N H
3 2 2 3 2 3

DISOCIADO NO DISOCIADO
FORMA BASICA FORMA ACIDA
NO IONIZADA IONIZADA

Figura 8.14

Es comn en la prctica no discriminar entre el amino ionizado o no, haciendo referencia slo a grupo
amina. Por ejemplo en la Figura 8.14, se suele llamar etilamina est o no ionizado.
Otro detalle importante es que el grupo amina al ganar el protn se ioniza, (reaccin desplazada hacia
la derecha, de la Figura 8.14) mientras que al disociarse (reaccin hacia la izquierda) pierde la
ionizacin: Conclusin: si el grupo amina est ionizado no est disociado. Note ms adelante la
diferencia con el grupo carboxilo.
En los compuestos biolgicos las aminas juegan un rol importante, hallndose presente en diversos
compuestos. Los aminocidos son los principales exponentes, siendo estas molculas las constituyentes
de las protenas.
Cuando el nitrgeno est unido a cuatro grupos alquilo se dice que es un compuesto de amonio o
catin de amonio cuaternario. En este caso se nombran como una sal, Figura 8.15

Figura 8.15

145
QUMICA ORGNICA

8.4.3. Aldehdos y cetonas

Los compuestos conocidos como aldehdos y cetonas son compuesto orgnicos que se clasifican junto
con otros compuestos como compuestos carbonlicos. Para ver un video sobre este tema haga clik en
este link: https://youtu.be/5viUo5r1U3g?t=723. Un compuesto carbonlico es aquel que contiene en su
estructura un grupo carbonilo. El grupo ceto o carbonilo consisten en la unin a travs de doble
ligadura entre un C y un O. Este grupo si se encuentra sobre un carbono sin un oxhidrilo o amina en el
mismo carbono, forma compuestos que se llaman aldehdos y cetonas, dependiendo que el carbono sea
primario o secundario, respectivamente. La nomenclatura de estos compuestos se forma con el nombre
del hidrocarburo del cual deriva, con la terminacin al en el caso de ser aldehdo (es el caso en que el
carbonilo est en carbono primario) o terminacin ona si es una cetona (en el caso que el grupo est
en carbono secundario). En la Figura 8.16, se presenta la estructura del propanal, terminacin al del
compuesto es por tener el carbonilo en un carbono primario y propan por tener 3 carbonos. La segunda
estructura es la propanona. El trmino propan indica que tiene tres carbonos, pero en este caso con
terminacin ona por estar el carbonilo en el carbono secundario. Note en la Figura 8.16, que las
frmulas pueden escribirse destacando los enlaces de estos grupos funcionales o bien en forma
condensada (frmulas de la derecha). Es importante observar cuidadosamente las frmulas, ya que en
las estructuras condensadas podra confundirse un aldehdo con un alcohol.

CH CH C H = CH CH C OH
3 2 3 2

PROPANAL

CH C CH = CH C O CH
3 3 3 3

PROPANONA

Figura 8.16

Estos grupos le dan solubilidad en agua a las molculas en las que se encuentran, ya que pueden
establecer puentes de hidrgenos entre los H de la molcula de agua y el O del carbonilo.

8.4.4. Acidos carboxlicos

Los cidos carboxlicos son compuestos que tiene un grupo carboxilo. Un grupo carboxilo est
formado por un carbonilo y un oxhidrilo en el mismo carbono. Haga click en el siguiente link para ver
un video sobre el tema: https://youtu.be/5viUo5r1U3g?t=905. Este grupo funcional siempre lo
encontraremos en un carbono primario, Figura 8.17. La nomenclatura de los compuestos que tienen
este grupo se forma con el nombre del hidrocarburo del cual provienene por su largo de cadena,
anteponindole la palabra cido y la terminacin oico. Es muy comn tambin en este caso la
utilizacin de nombres de fantasa. En la Figura 8.17, se muestra el cido etanoico o cido actico. Se
llam etanoico, por tener dos carbonos y considerarse derivado del etano. El nombre actico, no

146
QUMICA ORGNICA

responde a reglas estrictas, estos nombres se aprenden con el uso cotidiano. En la Figura 8.17, se
puede ver un radical de un cido. Por ejemplo si al cido actico se le retira el oxhidrilo de su carboxilo
queda el radical que se llama acetil, acetilo o acetoilo.

O
C = COOH CARBOXILO
OH

O
ACIDOACETICO O
CH C
3 ACIDOETANOICO
OH

O
RADICAL ACETILO
CH C
3

- +
R COOH R CO O + H

NO DISOCIADO DISOCIADO
NO IONIZADO IONIZADO
FORMA ACIDA FORMA BASICA

Figura 8.17

El grupo carboxilo tiene un pKa cercano a 3, dependiendo del entorno molecular. Si el pH supera a 3,
se encontrar en mayor proporcin en forma disociado, con carga neta negativa. Por su pKa se deduce
que a pH fisiolgico se encontrar con carga negativa. Este grupo tiene la particularidad de poder
establecer puentes de hidrgeno con el agua, lo que dar solubilidad a las molculas en las que se
encuentre, pero tambin su carga contribuir a la solubilidad. Los compuestos que tienen carboxilos
son ms solubles en agua cuando se encuentran disociados.
Los grupos carboxilos, por tener carga tienen la particularidad que podrn producir atraccin
electrosttica con grupos como el amino, que tiene carga positiva. Por otra parte el grupo carboxilo
ionizado puede establecer repulsin electrosttica con otros grupos carboxilos o estructuras que tengan
carga negativa, como los fosfatos.
Cuando el grupo carboxilo pierde un hidrgeno y adquiere carga negativa se dice que se transform en
un carboxilato, Figura 8.18

Figura 8.18

147
QUMICA ORGNICA

8.4.5. Grupo sulfhidrilo

Este grupo est formado por un azufre unido a un hidrgeno, Figura 8.19. Para ver un vdeo sobre este
tema haga click en el siguiente link: https://youtu.be/m6_229jZbBY?t=219. Se llama tambin tiol. Este
grupo toma importancia en cierto tipo de estructuras, como ser la protenas por poder formar uniones
covalentes llamadas puente disulfuro que discutiremos a continuacin. Este grupo tiene un pKa de
aproximadamente 9, por lo que a pH fisiolgico no confiere carga a las molculas. Por la polaridad del
enlace S-H se pueden llegar a establecer puentes de hidrgeno con el agua o bien interacciones dipolo-
dipolo, lo que favorece la solubilidad de los compuestos en agua. En general son raros los compuestos
que tienen solo grupos sulfhidrilos por lo que no estudiaremos su nomenclatura. Es comn que se halle
en molculas con otros grupos funcionales y se utilicen nmbres de fantasa. A modo de ejemplos, son
molculas con grupos sulfhidrilos: cistena y glutatin. En algunos casos cuando el grupo sulfhidrilo
forma parte de una molcula que tiene otro grupo, el sulfhidrilo se resalta en la nomenclatura por la
palabra mercapto. Por ejemplo si un etanol tiene en su estructura un grupo sulfhidrilo se llama
mercaptoetanol.

8.4.6. Puente disulfuro

Se forma por la unin de dos grupos sulfhidrilos. Ambos sulfhidrilos deben sufrir una oxidacin para
poder formar esta unin qumica, que es de tipo covalente. Existen puentes disulfuro intercatenarios, e
intracatenarios, dependiendo que se establezcan entre dos sulfhidrilos de diferente o de la misma
molcula, Figura 8.19.

SH GRUPO SULFHIDRILO

S H

MOLECULA S H H S MOLECULA MOLECULA

S H

OXIDACION OXIDACION

MOLECULA S S MOLECULA MOLECULA

PUENTE DISULFURO PUENTE DISULFURO


INTERMOLECULAR INTRAMOLECULAR

Figura 8.19

8.4.7. steres

Los steres son compuestos orgnicos que tienen en su estructura qumica la unin ster. Para ver un
vdeo sobre el tema haga click en el siguiente link: https://youtu.be/m6_229jZbBY?t=327. Esta unin
es un enlace covalente que se produce entre un grupo cido y un alcohol, con prdida de una molcula
de agua, Figura 8.20. Cuando un alcohol se liga a una molcula a travs de una unin ster se dice que

148
QUMICA ORGNICA

est esterificado.

CH O C
FORMACION 2

C H OH

O CH OH
2
R C OH H O R ESTER ENTRE ALCOHOL Y CARBOXILO

H O OH
2 -
CH O P O CH O P
2 2

O C H OH O = C H OH

R C O R C H OH C H OH
2 2

ENLACE ESTER ESTER FOSFORICO

R CH O P O CH R
2 2

FOSFODIESTER

Figura 8.20

El cido que participa en la unin ster puede ser un carboxilo o un cido fosfrico (o fosfato). En el
caso de ser un carboxilo, se menciona como enlace ster; por ejemplo en una molcula de triglicrido,
un cido graso forma un ster con el glicerol. En este enlace participan el carboxilo del cido graso y el
alcohol del glicerol, figura 8.18. Cuando el ster es entre un alcohol y un cido fosfrico, se denomina
ster fosfrico. Por ejemplo en el caso de la formacin de un ster entre el glicerol y el cido fosfrico,
se dice que se ha formado un ster fosfrico. Al formarse el enlace entre el grupo carboxilo y el
alcohol, el primero pierde la capacidad de ionizarse, pero el grupo funcional (ster) por poseer dos
oxgenos es un grupo polar, que dar solubilidad en agua a la molcula. Por supuesto el hecho de
perder la carga del grupo carboxilo, hace que el compuesto que tena el grupo cido sea menos soluble
que antes.
En el caso de los steres fosfricos, dado que el cido fosfrico tiene otro grupo ionizable con un pKa
cercano a 7, a pH fisiolgico, al formarse el enlace ster la molcula quedar con carga negativa sobre
el fosfato. Este es un detalle importante, dado que las molculas que tengan esterificado un fosfato
tendrn siempre en esa porcin de la molcula carga negativa, figura 8.18. Para simplificar los fosfatos
unidos por uniones ster a una estructura orgnica se representan slo con un P dentro de un crculo,
recordando que a pH fisiolgico tendrn carga negativa.
El cido fosfrico puede formar enlaces ster con dos oxhidrilos simultneamente, estos enlaces se
llaman fosfodister, Figura 8.20. Este tipo de enlace es caracterstico de los cidos nucleicos y de
ciertos lpidos.

8.4.8. Amidas

Las amidas son compuestos que contienen en su estructura una unin amida. Para ver un vdeo sobre
amidas haga click en el siguiente link: https://youtu.be/m6_229jZbBY?t=583.La unin amida es un
grupo funcional que resulta de la unin covalente entre un grupo carboxilo y un grupo amina, con
prdida de una molcula de agua, Figura 8.21.

149
QUMICA ORGNICA

O H

R C OH H N R

CA
RBOX
ILO A
M INA

H O
2

O H

R C N R

A
M ID
A

Figura 8.21
Este enlace le quita la capacidad de ionizacin al grupo carboxilo y al grupo amina. Este enlace es
caracterstico de las protenas, dnde lleva el nombre particular de unin peptdica.

Enlaces de alta energa o macrorgico


La mayora de los enlaces liberan energa al formarse y requieren energa para romperse. Un tipo
especial de enlaces llevan el nombre de enlaces de alta energa o macrorgico. Estos enlaces tienen la
particularidad que liberan energa al romperse y requieren energa al formarse. La energa involucrada
en ambos procesos es la misma, adems de tener la particularidad de no ser grandes valores
energticos. Esta particularidad hace que estos enlaces sean relativamente fciles de formar y degradar
permitiendo canalizar la energa en una clula viva. Dentro de los enlaces macrorgicos tenemos las
uniones anhdridos entre dos cidos fosfricos o entre un cido fosfrico y un grupo carboxilo y las
uniones entre un grupo carboxilo y un grupo sulfhidrilo, conocido como enlaces tioster. Siempre que
exista un enlace macrorgico se lo representar con un enlace ondulado, figura 8.20 y 8.21.

8.4.9. Unin tioster

Es un enlace covalente entre un grupo carboxilo y un grupo sulfhidrilo, con prdida de una molcula
de agua, Figura 8.22. Para ver un vdeo sobre el tema tioster haga click sobre el siguiente link:
https://youtu.be/m6_229jZbBY?t=654. En este tipo de enlace el carboxilo pierde la capacidad de
ionizacin, por lo que el efecto que tiene la formacin de este enlace sobre la solubilidad de la
molcula es similar a lo analizado en el enlace ster. El tioster es un tipo de enlace que se clasifica
como de alta energa o macrorgico. Se lo conoce tambin como tiolster.

150
QUMICA ORGNICA

R C OH H S R

H O
2

O O

C S R = C
R R S R

ENLACETIOESTER ENLACETIOESTER

Figura 8.22

8.4.10. Unin anhdrido

Es un enlace covalente entre dos grupos cidos. Para ver un vdeo sobre anhdridos haga click en el
link siguiente: https://youtu.be/m6_229jZbBY?t=728. Pueden ser dos cidos carboxilos, lo cual no es
comn dentro de los compuestos biolgicos. Los ms comunes son los que se establecen entre un
grupo carboxilo y un cido fosfrico o bien entre dos cidos fosfricos, Figura 8.23. La unin de dos
cidos fosfricos a travs de un enlace anhdrido lleva el nombre de pirofosfato, se suele representar en
forma simplificada como PP.
O O
O O
R C OH H O P OH
OH P O H H O P OH

OH
OH OH
H O
2 H O
2

O O O O

R C O P OH OH P O P OH

OH OH OH

O O O O

R C P OH OH P P OH

OH OH OH

Figura 8.23

8.4.11. Derivados halogenados

La sustitucin de un hidrgeno en un hidrocarburo por un halgeno genera este tipo de compuestos.


Para ver un vdeo sobre derivados halogenados haga click en el link siguiente:

151
QUMICA ORGNICA

https://youtu.be/m6_229jZbBY?t=915. Si bien no se hallan presente en las molculas sintetizadas por


los organismos vivos, si son de importancia en muchas molculas sintticas utilizadas como frmacos.
La nomenclatura lleva el nombre del hidrocarburo con el nombre del halgeno indicando la ubicacin
en la cadena (Figura 8.24, Figura 8.25).

CH 3CH 2Cl
Figura 8.24: cloroetano

CH 3CH ClCH 3
Figura 8.25: 2-cloro propano

8.5. Isomera

Se entiende por isomera al fenmeno por el cual dos molculas con igual frmula molecular
pueden diferir en su frmula estructural. As, definimos ismeros a dos molculas con igual frmula
molecular y diferente estructura. Para ver un vdeo sobre el tema haga click en el siguiente link:
https://youtu.be/gy4pxXH69Vw.
Existen diferentes tipos de ismeros que bsicamente podemos clasificar en dos grupos
Ismeros estructurales
Ismeros espaciales o esteroismeros.
Dos molculas son ismeros estructurales si difieren en la ubicacin de sus sustituyentes, la forma
de la cadena carbonada o el grupo funcional. Son por su parte ismeros espaciales si tienen los
mismos grupos pero difieren en la orientacin de los mismos en el espacio.
Los ismeros estructurales se pueden subdividir en:
ismeros de cadena
ismeros de posicin
ismeros de grupo funcional.

8.5.1. Ismeros estructurales

Ismeros de cadena
Dos molculas son ismeros de cadena si tienen diferencias en la longitud o distribucin de la
cadena carbonada.
Veamos la estructura del cido-3,4-dimetil nonanoico, cuya frmula molecular es C 11H22O2 y su
frmula estructura se ve en la Figura 8.26

152
QUMICA ORGNICA

Figura 8.26

Si la comparamos con el cido-4-etil nonanoico, cuya frmula molecular es C 11H22O2 y su frmula


estructura vemos en la Figura 8.27

Figura 8.27

Vemos que si bien las frmulas estructurales son diferentes su frmulas moleculares son las
mismas, es decir el tipo y cantidad de tomos de cada tipo no difieren. Como la diferencia se halla
fundamentalmente en la cadena carbonada, decimos que entre si que el cido-3,4-dimetil
nonanoico es un ismero del cido-4-etil nonanoico.

Ismeros de grupo funcional


Dos molculas son ismeros estructurales de grupo funcional si difieren fundamentalmente en el
grupo funcional que poseen, mientras que su frmula molecular es la misma.
Veamos el ejemplo del cido nonanoico, cuya frmula molecular es C9H18O2 y su frmula
estructural vemos en la Figura 8.28

Figura 8.28

Comparemos al cido nonanoico con 1-hidroxi-3-nonanona, cuya frmula molecular es C9H18O2 y


su frmula estructural vemos en la Figura 8.29

153
QUMICA ORGNICA

Figura 8.29
Ambas estructuras tiene la misma frmula molecular (C 9H18O2), sin embargo la frmula estructura
difiere fundamentalmente en el grupo funcional. Mientra el cido nonanoico tiene una funcin
carboxilo, el 1-hidroxi-3-nonanona, tiene una funcin cetona y un alcohol. Se dice que entre ellas
son ismeros de grupo funcional.

Ismeros de posicin
Se conocen como ismeros de posicin a dos molculas que teniendo la misma frmula molecular
difieren en la posicin de sus sustituyentes.
Veamos la comparacin del compuesto cido-3,4-dimetil nonanoico, cuya frmula molecular es
C11H22O2 y su frmula estructural vemos en la Figura 8.30

Figura 8.30

El compuesto cido-3,7-dimetil nonanoico que vemos en la Figura 8.31,tiene la frmula molecular


C11H22O2, que es la misma que el compuesto de la Figura 8.30. Por lo tanto por tener igual frmula
molecular pero diferir en la frmula estructural, solo por la posicin de sus grupos metilos, decimos
que son ismeros de posicin.

Figura 8.31

8.5.2. Esteroismeros

Carbono asimtrico
Un carbono es asimtrico o quiral cuando tiene sus cuatro valencias unidas a grupos diferentes. En
la Figura 8.32, el carbono 3 y el carbono 7 son carbonos asimtricos.

154
QUMICA ORGNICA

Figura 8.32
No lo son los carbonos: 2,4,5,6,8 y 9. Estos tienen al menos 2 hidrgenos, lo que hace que no sean
carbonos asimtricos.
Cuando dos molculas tienen un carbono asimtrico pueden presentar dos esteroismeros conocidos
como enantimeros

Ismeros pticos
Dos molculas son ismeros pticos cuando tienen la propiedad de desviar el plano de la luz
polarizada en diferente grado. Existen diferentes tipos de ismeros pticos, entre ellos los
enantimeros.

Enantimeros
Son ismeros pticos que rotan la luz polarizada en igual ngulo pero en sentido contrario. Ambos
son imgenes especulares no superponibles, es decir que podemos considerar que uno es la imagen
en un espejo del otro. A pesar que los grupos unidos al carbono asimtrico son los mismos no se
pueden superponer y por ende son diferentes. La nica diferencia fsica es la rotacin del plano de
la luz polarizada en sentidos contrario e igual magnitud. Esta propiedad es de poca importancia en
la qumica biolgica. Sin embargo, son muy importantes sus propiedades qumicas. Dentro de los
organismos vivos un enantimero pueden realizar ciertas reacciones y el otro no.
Veamos el 1-cloro etanol. Esta molcula tiene el carbono 1 que es asimtrico y por lo tanto puede
existir en dos formas espaciales que se identifican con la letra L y D. La asignacin de las letras L y
D excede a los lmites de este desarrollo. Cabe resaltar que L y D no es sinnimo de levgiro y
dextrgiro. Por otra parte los dos enantimeros tiene la propiedad de rotar la luz polarizada en
sentidos contrarios. Al ismero que rota la luz hacia la derecha se lo llama dextrgiro o (+) y al que
rota hacia la izquierda levgiro o (-). Es importante tener en cuenta que existen todas las
combinaciones posibles de L-D y (+) y (-), no necesariamente tener que ser el ismero L la forma
(-) y el ismero D la forma (+). La Figura 8.33ilustra este tipo de isomera con el compuesto 1-cloro
etanol.

155
QUMICA ORGNICA

Figura 8.33
Si bien asignar a los enantimeros las clasificaciones L y D, la forma R-S es ms sencilla y es la que
est siendo utilizada debido a su falta de ambigedad. Para caracterizar cada forma, se selecciona le
carbono asimtrico y se analiza el peso atmico de los tomos unidos al cabono quiral, luego se
coloca hacia atrs el tomo de menor peso molecular, de manera que solo veamos el los tres enlaces
restantes. Finalmente se sigue el sentido de los tomos unidos de mayor a menor peso atmico. Si el
sentido es horario, se le asigna la denominacin R y si es en sentido antihorario, la denominacin S.
En la Figura 8.34 ejemplificamos lo antedicho. A la izquierda vemos uno de los enantimeros de 1-
cloro etanol en un formato pseudotridimensional. El H es el tomo de menor peso, por ello giramos
la molcula hacia la izquierda de manera que el H quede detrs del tomo de C representado por la
esfera celeste. En esta distribucin vemos que si seguimos el orden de peso atmico decreciente de
tomos unidos al carbono asimtrico: Cl, O, C, este sentido indicado por la flecha de la figura
inferior izquierda es en sentido contrario a las agujas del reloj, de all su configuracin S y su
nombre S-1-cloro etanol. Con el mismo razonamiento se llega al R-1-cloro etanol.

156
QUMICA ORGNICA

Figura 8.34

Ismeros geomtricos
Se denomina as a la isomera que surge como consecuencia de la presencia de dobles enlaces y la
unin de dos grupos qumicos diferentes en cada carbono de la doble ligadura. Como consecuencia
que el doble enlace no puede rotar, la posicin de los grupos no puede cambiar. De esta manera se
presentarn dos distribuciones: cis y trans. Se considera trans cuando los grupos iguales estn a
ambos lados del doble enlace y cis si estn del mismo lado.

Figura 8.35 cis-3-hepteno


La Figura 8.35 muestra el compuesto 3-hepteno, cuya frmula molecular es C 7H14. Por otra parte
la Figura 8.36 muestra otra estructura cuyo nombre tambin es 3-hepteno y coincide en frmula
molecular

157
QUMICA ORGNICA

Figura 8.36: trans-3-hepteno


Si se observan ambas figuras, difieren en la distribucin de los grupos en torno al doble enlace,
siendo la estructura que tiene los grupos iguales al mismo lado el ismero cis y la que los tiene en
lados contrarios, el ismero trans

Isomera conformacional
Se llaman confrmeros a las diferentes formas que puede tomar una molcula como consecuencia de la
posibilidad de rotacin de los enlaces simples. Los diferentes confrmeros son interconvertibles con
escaso aporte de energa.

8.5.3. Prctica

Para realizar ejercitacin sobre alcanos, alquenos, alquinos, compuestos cclicos y aromticos, haga
click en el siguiente link: https://docs.google.com/forms/d/e/1FAIpQLSfUnsP17-z-
507xaGZKSVFQvVjdqUkAYYRsnC1YQau2e5OY2A/viewform?usp=sf_link
Para corregir sus respuestas haga click en: https://docs.google.com/forms/d/e/1FAIpQLSfUnsP17-z-
507xaGZKSVFQvVjdqUkAYYRsnC1YQau2e5OY2A/viewform?
usp=pp_url&entry.1215623910=al+compuesto+1-penteno&entry.1613540313=CH3-CH2-CH2-CH2-
CH2-CH3&entry.799143291=tienen+doble+enlace&entry.173818=es+un+compuesto+arom
%C3%A1tico&entry.1354507965=de+f%C3%B3rmula+C5H10&entry.334206841=Perez,
+Juan&entry.1948969234=14258963

1) Escribir las frmulas estructurales, taquigrfica y molecular de los siguientes compuestos:


a- butano
b- 2-metilbutano
c- 2,2-dimetil butano
d- 2-metil-1-buteno
e- 2-octanol
f- hexanal
g- cido-3-metil decanoico
h- propanodial
i- 1,2,3-propanotriol

158
QUMICA ORGNICA

j- 3,3,4,4-tetrametil-1-octen-5-ol
k- metil-ciclohexano
l- 3-metilciclohexeno
m- 2-metil-2-hidroxi-3-heptanona
n- 3-pentenal
o- dimetilamina
p- propanamida
q- 3-flor hexano
r- dimetilpropano
s- cido-2-ceto butanodioico
t- etino
u- 1,3-ciclohexadieno
v- cido-2-hidroxi-4-decenoico
w- 2,3,4-decanotriol
x- ciclopropano
y- butanodiona
z- ciclopentanol

Respuestas
Respuestas
a- CH3 CH2 CH2 CH3
b- CH3 CH2 (CH3) CH2 CH3
c- CH3 CH2 (CH3)2 CH2 CH3
d- CH2= CH (CH3) CH2 CH3
e- CH3 CH(OH) CH2 CH2CH2CH2 CH2 CH3
f- CH3 CH2 CH2 CH2CH2 CHO
g- CH3 CH2 CH2 CH2CH2CH2 CH2 CH(CH3) CH2 COOH
h- CHO CH2 CHO
i- CH2(OH)CH(OH) CH2(OH)

j-

159
QUMICA ORGNICA

k-

l-

m-

n-

o-

p-

q-

160
QUMICA ORGNICA

161
TERMODINMICA

9. TERMODINMICA

La termodinmica estudia la energa y sus transformaciones, como as tambin los cambios de un


sistema permitiendo determinar si esos ocurrirn o no, independientemente de la velocidad a la cual se
produzcan los mismos.
Sistema: es toda porcin del universo separada del resto, a travs de lmites reales o imaginarios
(frontera), para sus estudio.
Universo: es todo lo que nos rodea, compuesto por materia y energa.
Medio ambiente: es la porcin del universo, externa al sistema que interactua con este ltimo.

9.1. Tipos de sistemas

Los sistemas se pueden clasificar en abiertos, cerrados y aislados. Existen otros tipos de sistemas
menos comunes.
Sistema abierto: es aquel que intercambia materia y energa a travs de la frontera.
Sistema cerrado: es todo sistema que solo intercambia energa, permaneciendo constante la materia del
mismo.
Sistema aislado: es aquel sistema que no intercambia materia ni energa. El nico sistema aislado que
existe es el universo, ya que este no podra intercambiar materia y energa con otro. En la prctica se
puede lograr sistemas aproximadamente aislados.
Ejemplos: Qu tipo de sistema es un animal de experimentacin? La respuesta es depende donde se
fije la frontera.
Si la frontera del sistema es la piel de animal, a travs de la piel habr intercambio de calor, a travs de
respiracin entrar oxgeno y saldr dixido de carbono, adems el animal incorporar alimentos y
eliminara orina y materia fecal, es decir que en el sistema (el animal) entrara y saldr materia y energa;
se trata en este caso de un sistema abierto.
Si el animal lo consideramos dentro de un frasco cerrado, tomando en este caso la pared del frasco
como frontera, el animal respirar, comer los alimento que le hemos colocado dentro del recipiente,
pero no entrar ni saldr materia a travs de las fronteras (el vidrio). En cambio s intercambiar
energa, entrar luz y saldr calor producido por el animal. En este caso el sistema (frasco con rata) se
comporta como un sistema cerrado.
Si la rata estuviera dentro de un termo de buena calidad y poder aislante, tomando las paredes del
termo como frontera, a travs de estas paredes no pasa materia ni energa (al menos en tiempos cortos),
por lo tanto el sistema termo-rata se comporta aproximadamente como aislado. Es decir que un mismo
sistema en combinacin con otros puede ser considerado de diferentes maneras, de acuerdo donde
estn las fronteras.
Calor: Es energa que pasa de un sistema a otro cuando entre ellos hay una diferencia de temperatura.
No es energa que se pueda almacenar; no se puede decir que un sistema tenga una determinada
cantidad de calor. Se dice que es energa en trnsito y solo se manifiesta cuando hay una diferencia de
temperatura. Representaremos al calor con la letra Q. Las unidades mas comunes del calor son
calorias, Kcal, Joule o ergio.
Por ejemplo si tenemos dos sistemas uno a 25 C y otro a 300 C, el segundo tiene mas temperatura

162
TERMODINMICA

que el primero. Es incorrecto decir que tiene mas calor. Al interactuar ambos sistemas se producir un
pasaje de calor desde el sistema a 300 C hacia el de 25C. Este pasaje de calor puede hacerse por
conduccin, cuando ambos sistemas estn en contacto, por ejemplo cuando toco un cuerpo a elevada
temperatura pasa calor del cuerpo a mi mano por conduccin.
Si los dos cuerpo no estn en contacto, pero hay un tercer cuerpo que esta entre los dos y se mueve
llevando el calor de uno a otro se dice que se produjo un pasaje por conveccin. Por ejemplo el aire
fresco que se mueve desde un acondicionador de aire (cuerpo fro) hasta nuestro cuerpo (cuerpo a
mayor temperatura).
Cuando el calor pasa sin necesidad de que exista un contacto fsico o un tercer sistema, se dice que el
pasaje se realizo por radiacin. Este es el caso por el cual no llega calor del sol. Las radiaciones que
llevan calor son las radiaciones infrarrojas y microondas.
Cuando un sistema gana o pierde calor, cambia su temperatura (T). Este cambio de temperatura no
solo depende del calor intercambiado sino tambin de la masa (m) y del calor especfico (Cesp) del
sistema. Estas magnitudes estan relacionadas por la ecuacin

Q=Cespm T
ecuacin 9.1
El Cesp es una constante e indica la cantidad de calor necesaria para cambiar la temperatura de 1 Kg o
1 g de sistema en un 1C. Por ejemplo para el agua lquida el Cesp= 1 cal/g.C, esto quiere decir que
para elevar en 1C la temperatura de 1 gramo de agua se requiere 1 cal.
Convencionalmente se considera que si un sistema libera calor, tiene signo negativo y se dice que el
proceso es exotrmico; en caso que el sistema absorba calor, se le dar signo positivo y se dice que el
proceso es endotrmico.
Si nuestro sistema es una vela encendida, este sistema evoluciona mediante un proceso exotrmico, ya
que libera calor. En cambio un lata de cerveza recin sacada de la heladera, ira absorbiendo calor, por
lo tanto se trata de un proceso endotrmico.
Trabajo: Otra forma de intercambia energa es a travs del trabajo. Cuando durante la evolucin se
produce cambio en la posicin de cuerpos del medio ambiente o cambio de la posici de las fronteras
del sistema, se dice que se ha realizado o recibido trabajo. Convencionalmente el trabajo es negativo,
cuando es realizado por el sistema y positivo cuando se realiza trabajo sobre el sistema a travs del
medio ambiente. Representaremos al trabajo con la letra W. Las unidades mas comunes del trabajo
son: calorias, Kcal, Joule, ergio.
Existen diferentes formas de trabajo. En todos los casos el trabajo se calcula multiplicando la fuerda
por la distancia

W =Fd
ecuacin 9.2
Un caso especial de trabajo es cuadno se levanta o baja un cuerpo en este caso la fuerza es el peso del
cuerpo (P) que se puede calcular con la ecuacin 2

P=mg
ecuacin 9.3
donde m es la masa del cuerpo y g la aceleracin de la gravedad: 9,8 m/seg2. El trabajo se calcula

163
TERMODINMICA

entonces con la ecuacin 9.4

W =mgh
ecuacin 9.4
donde h es la altura vertical que se desplaz el cuerpo.
Potencia: es la velocidad a la que se realiza el trabajo. Se calcula con la ecuacin 9.5

W
Pot=
t
ecuacin 9.5
La unidad mas comn de potencia es Joule/seg que se denomina Watt.
Energa interna: Es la energa que tiene almacenada un sistema bajo todas las formas, salvo aquellas
que depende de la posicin y ubicacin del sistema, por ejemplo forma parte de la energa interna
aquella almacenada en los enlaces qumicos. Representaremos a la energa interna con la letra E.
Se puede calcular en un sistema el valor de la variacin de energa interna: E. Esta variacin se
calcula de manera diferente si se trata de un sistema abierto o cerrado.
Para un sistema cerrado:

E=Q+W
ecuacin 9.6
Este es el enunciado matemtico de la primer ley de la termodinmica.
Esta ley se puede enunciar de la siguiente manera: La energa de un sistema y el medio ambiente
pueden cambiar de una forma a otra, pero no se puede crear ni destruir energa. Esto equivale a decir
que una forma de energa, por ejemplo qumica, puede desaparecer, pero debe aparecer
simultneamente la misma cantidad de energa de otra forma, por ejemplo calor.
Como toda variacin E, puede ser cero, positiva o negativa. Como se calcula restando la Efinal
menos la E inicial. Resulta que si E es positivo, el sistema tendr mas energa al final, si fuera
negativa tendra menos energa al final, es decir el sistema perdi energa y de valer cero la diferencia,
ambas energa son iguales.
Para un sistema abierto, que intercambia materia (m), al entrar o salir materia, est entrando o
saliendo energa qumica, por lo tanto en este caso, para calcular la variacin de energa interna:

E=Q+W + m
ecuacin 9.7

Para un sistema vivo la energa se almacena como energa qumica, por lo tanto el E en el hombre es
energa alamacenada como macromolculas. Si E es positivo quiere decir que se ha almacenado
energa qumica, esto se refleja en aumento de peso. Si E es negativo perder peso. Por ejemplo si
E= -900 Kcal, significa que perdi energa que equivale a 100 g de lpidos ya que cada gramo de
estos equivalen a 9 Kcal.
Segunda principio de la Termodinmica: cuando se transforma energa de una forma en otra, siempre
una parte de la energa se transforma en calor.

164
TERMODINMICA

Como consecuencia de este segundo principio, nunca se puede transformar en trabajo toda la energa
producida. La eficiencia expresa cuanta de la energa producida se transforma en trabajo

trabajo realizado
eficiencia= 100
energa producida
ecuacin 9.8

Ejemplo: un hombre de 80 Kg sube las escaleras de un edificio de 100 m en 4 minutos. Para ello
genera 300000 Joules. Calcular W, Pot y eficiencia.
W= m.g.h= 80 Kg.9,8 m/seg2 . 100 m = 78400 J.

Pot = W/ t = 78400 J/240 seg = 327 Watt

Eficiencia= W.100/energia producida= 78400 J x 100/300000 J= 26%


Significa que del 100% de energa producida solo el 26% fue utilizada para trabajo, por lo tanto el resto
se libera como calor.
Entalpa: La representaremos con la letra H. Matemticamente se define: H = E + P.V; donde E es
energa interna, P la presin y V el volumen. Esta definicin no tiene un significado fsico claro. No es
posible calcular un valor para la entalpa de un sistema en una dada situacin, pero si se puede calcular
la variacin de entalpa durante un cambio o evolucin: H.
Cuando la evolucin que sufre el sistema es a presin constante, la variacin de entalpa es igual al
calor intercambiado por el sistema.

H=Q
ecuacin 9.9
H= 0, Hfinal = Hinicial, no hay absorcin ni liberacin de calor
H> 0, Hfinal > Hinicial, y el proceso es endotrmico.
H<0, Hfinal < Hinicial, y el proceso es exotrmico.
En el caso de los sistemas vivos, la situacin mas comn es estudiar evoluciones a presin constante,
por lo tanto el valor del H, nos estar indicando el signo del calor y por lo tanto si el proceso que
presenciamos es exo o endotrmico.
Entropa: Se define como el calor intercambiado dividido la temperatura del sistema.

Q
S=
T
ecuacin 9.10

El significado fsico no es claro. Se puede calcular la variacin de entropa de un sistema durante un


cambio: S. Esta variacin de entropa esta relacionada con el grado de orden o desorden molecular de

165
TERMODINMICA

un sistema. Si:
S= 0, Sfinal = Sinicial, no hay cambio en el orden del sistema.
S> 0, Sfinal > Sinicial, en este caso el sistema se desorden.
S< 0, Sfinal < Sinicial, y el sistema se orden durante el proceso.
Si consideramos al sistema junto con el universo, es decir tomamos el universo para estudio, se puede
calcular el S del mismo, el signo de este indica la espontaneidad del proceso que estamos
presenciando. Si:
S(del universo) = 0, Sfinal = Sinicial, esta en equilibrio
S(del universo) > 0, Sfinal > Sinicial, en este caso se trata de un proceso espontneo. Todo proceso
espontneo cursa con aumento de la entropa del universo, es decir que la suma de la variacin de
entropa del sistema y el medio ambiente dan un resultado positivo. Dicho de otra manera podemos
tener un proceso con una variacin de entropa negativa (se ordeno) pero la variacin de entropa del
medio ambiente es positiva, de tal manera que la suma de ambas es positiva, entonces este proceso es
espontneo.
S< 0, Sfinal < Sinicial, el universo se orden durante el
proceso; este no es proceso que pueda ocurrir espontneamente. Es decir que todo proceso que
conduzca a un aumento del orden del universo (sistema + medio ambiente) no ocurrir
espontneamente.
Es muy importante tener presente que el D28S de por si no indica la espontaneidad de un proceso. Por
ejemplo la sntesis de un protena es un proceso espontneo dentro de una clula, sin embargo es claro
que formar una protena a partir de sus aminocidos es un proceso con clara disminucin de la
entropa, es decir aumento del orden dentro de la clula. Sin embargo si se calcula la variacin de
entropa de la clula y su medio ambiente, se ver que la suma de ambas dar un valor positivo. Es
decir que la entropa del universo aumento.
Energa libre: La representaremos con la letra G o F. Se calcula como con las otras variables de estado
(E, H y S) su variacin durante un proceso: G. Como toda variacin puede ser positiva, negativa o
cero. Su signo, cuando estamos a presin y temperatura constante, indica la espontaneidad de un
proceso. Si:
G = 0, el sistema est en equilibrio.
G > 0, el sistema gan energa, lo que equivale a decir que es un proceso endergnico o no
espontneo. Es decir que todo proceso donde la variacin de energa libre del sistema sea positiva no
ocurrir espontneamente, para que ocurrir deber aportarse energa con otro proceso exergnico. La
energa del proceso exergnico debe ser mayor que la del endergnico. Por ejemplo si el proceso
endergnico requiere 8 Kcal, el exergnico que la provea podria tener por ejemplo -10 Kcal; 2 Kcal se
liberarn como calor. Siempre se perder una parte como calor, como lo establece el segundo principio
de la termodinmica
G < 0, el sistema perdi energa y se dice que es un proceso exergnico o espontneo.
La variacin de energa libre de un proceso se puede calcular conociendo los valores de la variacin de
entropa y entalpa adems de la temperatura (ecuacin 9.11), si esta es constante al igual que la
presin.

166
TERMODINMICA

G= HT S
ecuacin 9.11

9.2. Termodinmica en los seres vivos

Veamos como podemos considerar a los sistemas vivos. Tomemos como sistema un hombre, se
sobrentiende que todo lo que lo rodea ser el medio ambiente. Se trata de un sistema abierto ya que
intercambia materia (alimentos que ingiere, orina que excreta, sudor, dixido de carbono que espira,
etc) y energa (recibe calor a travs de radiaciones y libera calor producido por sus reacciones
qumicas, realiza trabajo). Si cambiamos las fronteras, por ejemplo consideramos al hombre dentro de
una habitacin y esta es el lmite de nuestro sistema, si la habitacin est cerrada, se tratar de un
sistema cerrado, ya que solo energa ser intercambiada, posiblemente como calor (radiacin) a travs
de los cristales de las ventanas, pero no materia si las ventanas y puertas estn cerradas. Si en cambio
nuestro sistema es el hombre junto al universo se tratar de un sistema aislado.
Un ser vivo es un sistema que tiende al ordenamiento, es decir que la variacin de entropa es negativa.
Este ordenamiento se logra con aporte de energa, esta energa el organismo la obtiene a partir de los
enlaces qumicos de los alimentos, especialmente a partir de los glcidos y lpidos. Los organismos
vivos no pueden utilizar como fuente energtica al calor. Existen organismo como los vegetales que
pueden utilizar la luz solar como fuente energtica.

9.2.1. Estado de equilibrio

Se dice que un sistema esta en equilibrio cuando mantiene su composicin constante sin intercambio
de energa, es decir que su G= 0. Un ejemplo de este tipo de sistema seria un termo ideal con agua a
60C. El termo mantendra la cantidad de agua y su temperatura sin necesidad de aportar energia.

9.2.2. Estado estacionario

un sistema se encuentra en este estado cuando mantiene su composicin constante pero el G no es


cero. Es decir que gasta energa para mantener su composicin. Por ejemplo una cafetera que mantiene
el caf a temperatura constante, para lograrlo necesita gastar energa.
Los seres vivos son sistema en estado estacionario, dado que mantienen su estructura gracias al aporte
de energa externa. Cuando un organismo vivo muere, deja de existir aporte de energa y comienza la
desorganizacin de sus estructuras, tendiendo al estado de equilibrio.
Por lo tanto se deduce que el estado de equilibrio no es compatible con la vida, en cambio si lo es el
estado estacionario.
Unidades: El cuadro siguiente muestra las unidades de las magnitudes que hemos visto segn el
sistema en el que se trabaja:

magnitud cgs SI equivalencia


calor: Q ergio: erg joule: J calora:Cal 1J=107 erg
1Cal= 4,2 J

167
TERMODINMICA

Trabajo: W ergio: erg joule: J calora:Cal 1J=107 erg


1Cal= 4,2 J

E ergio: erg joule: J calora:Cal 1J=107 erg


1Cal= 4,2 J
H ergio: erg joule: J calora:Cal 1J=107 erg
1Cal= 4,2 J
G ergio: erg joule: J calora:Cal 1J=107 erg
1Cal= 4,2 J
S ergio/K joule/K calora/K

Como se puede ver las unidades son sencillas; Q, W, E, H y G son todas formas de energa. Entropa
solo tiene unidades diferentes.

168
COMPLEJIDAD DE LOS ORGANISMOS VIVOS

10. COMPLEJIDAD DE LOS ORGANISMOS VIVOS

10.1. Complejidad de los organismos vivos

Caractersticas principales de stos y qu los diferencian del resto de los sistemas materiales.
Diferentes molculas y macromolculas que los componen.
Los organismos vivos son sistemas materiales, obviamente heterogneos. Las principales diferencias
con cualquier otro sistema material son:
* Complejidad.
* Capacidad de autogenerar uno o ms sistemas iguales.
A continuacin se muestran dos esquemas; en primer lugar un sistema material inanimado (Figura
10.1)

N
2
vapor agua

Fe

Solucin NaCl

Figura 10.1
y en segunda lugar una clula de un islote de Langerhans del pncreas (Figura 10.2).

169
COMPLEJIDAD DE LOS ORGANISMOS VIVOS

ANTAGONISTA AGONISTA

Gi Gs

GDP + P GDP + P
Gi Gs
GTP GTP LECITINA
GTP Gi Gs GTP
AC CO AA ASCI-FLA2
ATP AMPc PG
R AMPc R C LO
++ ATP
Ca LISOLECITINA
Vmax ATP CAM ++
+ Ca HETE
Km
H PK AMPc C
+
Na +
Na
ATP + PK CAMCa
K SECRECION INSULINA
Vmax
Km
++ ++ ++
++ Ca Vmax ++
Ca Ca
CAM PK CK Vmax ++
Ca
Ca Km Km
Ca

CAM CK
ATP
+ ++
IP3 IP2 IP I
GLUCOSA K Ca
CK FLC CDP
PIP2
DAG
PIP2 PIP
IP
DAG
GDP + P GP
GTP DAG CDP
GP
GTP
R
+ ++
GLUCOSA K Ca

Figura 10.2
En el segundo caso slo se muestra una parte del sistema vivo, en lo que se refiere a la secrecin de
insulina. De la comparacin de ambos esquemas surge la complejidad de los organismos vivos.
Por otro lado los organismo vivos son capaces de crecer y reproducirse obteniendo su energa y los
recursos materiales del medio exterior.
En el siguiente esquema se muestra algunas interrelaciones (en forma simple) entre el medio interno y
externo de los organismos vivos (Figura 10.3).

N U T R IE N T E S
M EM BRANAS

M O N O S O C A R ID O S
A C ID O S G R A S O S
A M IN O A C ID O S
V IT A M IN A S

C O E N Z IM A S ORGAN ELAS

C A T A B O L IS M O E N Z IM A S A N A B O L IS M O

RESER VAS
D ESEC H O S E N E R G IA L IP ID O S
G L U C ID O
T R A B A JO P R O T E IN A S S
ADN ARN

Figura 10.3

170
COMPLEJIDAD DE LOS ORGANISMOS VIVOS

Los organismos vivos estn aislados del medio exterior por una membrana plasmtica. A travs de ella
se producen complejas interacciones: absorcin de nutrientes, salida de desechos, movimiento,
conocimiento de cambios en el medio circundante.
Los nutrientes bsicos de los organismos vivos son los glcidos, lpidos, protenas y ciertas molculas
llamadas vitaminas. Por supuesto que muchos elementos ms tambin son indispensables, como los
iones y el agua.
Dentro de los glcidos las molculas ms pequeas son los monosacridos. Las protenas estn
formadas por unidades de menor tamao llamadas aminocidos y los lpidos contienen en su estructura
casi como una constante a los cidos grasos. A partir de monosacridos, cidos grasos y aminocidos
se producen reacciones qumicas llamadas en conjunto catabolismo cuyo producto principal es la
energa, obtenindose adems productos de desecho que sern excretados al medio exterior a travs de
la membrana plasmtica.
Los monosacridos, aminocidos y cidos grasos pueden participar tambin en un gran nmero de
reacciones llamadas anabolismo. Para estos procesos se utiliza la energa aportada por el catabolismo y
el proceso es acelerado por la presencia de molculas especficas llamadas enzimas. Estas ltimas en
ciertos casos requieren de la presencia de coenzimas que se originan de las vitaminas. Como producto
del anabolismo se producen lpidos y glcidos que pueden cumplir funcin de reserva o formar parte
de organelas o las membranas. Tambin se formarn en el anabolismo protenas, cuya secuencia se
encuentra codifica en el ADN (cido nucleico).

171
ENZIMAS

11. ENZIMAS

Las enzimas son catalizadores biolgicos. (Para ver un video sobre el tema haga click aqu)
1- Catalizadores: sustancias que aumentan la velocidad de reaccin.
2- Biolgicos: son nicamente producidos por los organismo vivos.
Funcin y caractersticas: La enzima participa en una reaccin, acelerando el proceso de paso de
reactivos (sustrato) a productos.
La enzima tiene un sitio (sitio activo) dnde se ubica el sustrato y dentro del cual se produce el paso a
producto. Las condiciones de la reaccin son favorables dentro de este sitio, por lo que la reaccin
cursa a mayor velocidad.
Toda reaccin tiene una variacin de energa libre (G), que es la diferencia entre la energa de los
productos (Gp) y la energa de los reactivos (Gr) (ver captulo 11).
Para que los reactivos se transformen en productos los reactivos tienen que ganar energa hasta
alcanzar el estado activado (CA), esta energa es la energa de activacin (Eac), figura 10.1

Figura 10.1

Cuando una reaccin se lleva a cabo en presencia de una enzima, disminuye la energa de activacin,
de esta manera existe ms probabilidad de que los reactivos se transformen en productos por lo tanto la
velocidad de reaccin ser mayor. Las enzimas no modifican la variacin de energa libre de la
reaccin (G).

11.1.1. Caractersticas de las enzimas:

1- Catalizadores.

172
ENZIMAS

2- Estructura proteica.
3- Elevado peso molecular.
4- Termolbiles (se destruyen por accin de las elevadas temperaturas).
5- Especficas: actan catalizando un tipo especial de reacciones. Dicho de otra manera, cada enzima
cataliza una o un nmero reducido de reacciones. Esta propiedad se debe a su sitio activo, que permite
slo la interaccin con un nmero reducido de sustratos.
6- Alta actividad: con poca cantidad de enzima se producen grandes efectos.
7- Se recuperan inalteradas al final del proceso de catlisis.
8- Pueden requerir la participacin de estructuras no proteicas. Cuando una enzima est formada por
una parte proteica y una no proteica se llama holoenzima. La parte proteica se llama apoenzima y la
parte no proteica coenzima.

11.1.2. Coenzimas y vitaminas

Las coenzimas acompaan habitualmente a las enzimas. Las caractersticas de las coenzimas son:
1- Estructura no proteica.
2- Bajo peso molecular comparado con las enzimas.
3- Termoestables: resisten la accin de elevadas temperaturas.
4- Son inespecficas: una coenzima puede participar en muchas reacciones diferentes.
5- Se alteran durante el proceso de catlisis.
6- Habitualmente derivan de vitaminas.
De acuerdo a la fuerza que liga la coenzima con la apoenzima, las coenzimas se pueden clasificar en:
Coenzimas propiamente dichas (CoE): cuando la unin es dbil (no covalente)
Grupo prosttico (GP): cuando la unin apo-coenzima es covalente
En la tabla siguiente se detallan las coenzimas ms comunes, si son coenzimas (CoE) o grupos
prostticos (GP) y las vitaminas que le dan origen
coenzima vitamina
NAD+/ NADH CoE cido nicotnico (vitamina B8)
NADP+/NADPH CoE cido nicotnico (vitamina B8)
FAD/FADH2 GP riboflavina (vitamina B2)
Coenzima A (CoA) CoE cido pantotnico (vitamina B5)
Pirofosfato de tiamina GP Tiamina (vitamina B1)
Piridoxal fosfato GP Piridoxamina (vitamina complejo B6)
Biotina GP Biotina (Vitamina del complejo B)
Las coenzimas mencionadas participan catalizando reacciones especficas, junto con las enzimas. El
siguiente cuadro resume las principales reacciones donde participan las coenzimas
Coenzima reaccin enzimas

173
ENZIMAS

NAD+/ NADH oxidorreduccin deshidrogenasas


NADP+/NADPH oxidorreduccin deshidrogenasas y reductasas
FAD/FADH2 oxidorreduccin deshidrogenasas
Coenzima A (CoA) transferencia de aldehdos deshidrogenasas - tioquinasas
Pirofosfato de tiamina) descarboxilacin descarboxilasas
Piridoxal fosfato transaminacin-descarboxilacin transaminasas- descarboxilasas
Biotina carboxilacin carboxilasas

11.1.3. Actividad enzimtica

La velocidad de la reaccin o actividad enzimtica puede ser afectada por diferentes factores.
1- Concentracin de sustrato (reactivo de la reaccin), cuando aumenta la concentracin de sustrato
aumenta la velocidad, figura 10.2.

Figura 10.2

2- Temperatura: en general las enzimas son mas activas cuando la temperatura est entre 20 y 40 C. A
temperaturas superiores e inferiores la actividad decrece, ya que la estructura proteica se altera o la
energa cintica de las molculas decrece, respectivamente. Ambos factores disminuyen la velocidad de
la reaccin.
3- pH. Las enzimas tienen un pH ptimo al cual la actividad es mxima, para pH mayor o menor la
actividad decrece; debido a que la estructura proteica se altera.
4- Presencia de inhibidores. Disminuyen la actividad de la reaccin.
5- Disponibilidad de coenzimas. La falta de vitaminas y coenzimas disminuye la actividad de reaccin.

174
ENZIMAS

Parmetros enzimticos: Una medida importante de las enzimas es el Km (Constante de Michaelis


Menten), su valor es inversamente proporcional a la afinidad entre la enzima y el sustrato. Por ejemplo
si una enzima tiene un Km alto, indica que el sustrato tiene poca tendencia a unirse al sitio activo y por
lo tanto transformarse en producto. Otro parmetro enzimtico importante es la Vmax (velocidad
mxima), que es la velocidad de la reaccin cuando la concentracin de sustrato es muy alta y la
enzima est saturada por el sustrato, figura 10.2. (Para ver un vdeo sobre el tema haga click aqu)

11.1.4. Inhibidores y reguladores enzimticos

Inhibidores enzimticos
Existen diferentes tipos de inhibidores
1- Reversibles: inhiben la enzima, pero si se retira el inhibidor, la enzima retoma la actividad.
2- Irreversibles: la enzima no recupera la actividad aun cuando se retire el inhibidor.
3- Competitivos: el inhibidor entra al sitio activo, compite por este sitio con el sustrato, disminuyendo
la afinidad de la enzima por su sustrato natural. La presencia del inhibidor aumenta el valor de Km de
la enzima, pero no modifica la Vmax.
4- No competitivo: el inhibidor se une a un sitio distinto al activo, La presencia del inhibidor no cambia
la afinidad y por lo tanto no cambia el valor de Km de la enzima. Estos inhibidores disminuyen el
valor de la Vmax.
Reguladores enzimticos alostricos
Existen sustancias originadas en las propias clulas que modifican la actividad enzimtica. Pueden
existir reguladores positivos (que activan las enzimas) y negativos (que inhiben las enzimas). Estos
reguladores realizan mecanismos de retroalimentacin negativa o feedback.

11.2. Nomenclatura de enzimas

La nomenclatura de enzimas es un tema de gran dificultad por la variedad de formas en que se puede
encontrar el nombre de ellas. Si bien existen formas internacionalmente aceptadas para nombrar las
enzimas, basadas en letras y nmeros, que designan una enzima sin ambigedad, se siguen utilizando
nombres que hacen referencias a sustratos, productos o procesos en los que la enzima participa.
A continuacin se dan reglas generales para el nombre de las enzimas ms comunes del metabolismo
intermedio.
1- quinasas: estas enzimas catalizan reacciones en las que un sustrato S, se fosforila dando como
producto S-P y el ATP es el dador de P. Estas reacciones pueden o no ser reversibles

S + ATP S-P + ADP

Independientemente del sentido en que se produce la reaccin la enzima que cataliza la reaccin lleva
el nombre del S seguido de la palabra quinasa: S quinasa
Ejemplo 1:

175
ENZIMAS

fosfoenolpiruvato + ADP piruvato + ATP


la enzima se llama piruvato quinasa.
Note que el nombre del sustrato que se coloca en la enzima es el del compuesto que tiene menos
fsforo independientemente que est a la derecha o la izquierda de la reaccin. En algunos casos la
enzima puede sufrir modificaciones a su nombre para mejor pronunciacin o bien por incerteza en el
nombre del sustrato
Ejemplo 2:
fructosa-6-P + ATP fructosa-1,6-diP + ADP
la enzima se debera llamar fructosa-6-P quinasa pero es comn hallarla como fosfofructoquinasa.
Ejemplo 3:
glucosa + ATP glucosa-6-P + ATP
la enzima se debera llama glucosa quinasa. La isoenzima que slo acta sobre la glucosa se llama
glucoquinasa y la que acta sobre fructosa y galactosa adems de la glucosa se llama hexoquinasa dado
que sus sustratos son todos hexosas.

2- Deshidrogenasas: estas enzimas catalizan reacciones en las que un S se oxida utilizando como
coenzima NAD+, NADP+ o FAD o bien un sustrato se reduce utilizando como coenzima NADH o
FADH2. Puede en la reaccin participar algn otro tipo de compuestos como P, CO 2, CoA, etc. En
general estas reacciones se escriben

S + NADH P + NAD+
Independientemente del sentido en que ocurra esta reaccin la enzima lleva el nombre del compuesto
ms reducido (siempre es la sustancia que reacciona con la coenzima oxidada, o sea la que est en la
reaccin del lado de NAD+, NADP+ o FAD) seguido de la palabra deshidrogenasa. Para el caso
genrico planteado la enzima se llamara P deshidrogenasa o P dehidrogenasa.

Ejemplo:
piruvato + NADH lactato + NAD+

la enzima se llama lactato deshidrogenasa.


Todas las deshidrogenasas NAD+ o NADP+ dependientes dependen del aporte de vitamina B8
(cido nicotnico) en la dieta, mientras que las FAD dependientes dependen del aporte de
riboflavina o B2.

3- Fosfatasas: estas enzimas participan en el proceso de eliminacin de un grupo fosfato de una


molcula por hidrlisis de un enlaces ster. El reactivo es un sustrato que tiene fosfato, el cual se
pierde al medio durante el proceso como fsforo inorgnico

S-P S + P

176
ENZIMAS

Estas reacciones ocurren en el sentido escrito y las enzimas se nombran con la nomenclatura del
sustrato (molcula con ms P) seguido de la palabra fosfatasa. Para el caso genrico sera S-P
fosfatasa. En algunos casos se suelen acortar o comprimir los nombres para su mejor pronunciacin.
Ejemplo.
glucosa-6-P glucosa + P
la enzima se llama glucosa-6-fosfato fosfatasa o bien glucosa-6-fosfatasa

4- Carboxilasas: estas enzimas catalizan el agregado de un carboxilo a una molcula y utilizan


como grupo prosttico a la biotina, por lo que su actividad depende del correcto aporte de vitamina
B. Adems utilizan una molcula de ATP que se hidroliza a ADP y P, aportando la energa necesaria.
En general la reaccin se puede escribir

S + CO2 + ATP Producto + ADP + P

Siempre el producto tiene un carbono ms que el sustrato. La enzima se nombra con nomenclatura
del sustrato (compuesto con menor nmero de C) seguido de la palabra carboxilasa.
Ejemplo:

piruvato + CO2 + ATP oxalacetato + ADP + P


la enzima se llama piruvato carboxilasa.

5- Reductasas: estas enzimas producen la reduccin de un sustrato utilizando como coenzima el


NADPH. En general la reaccin se puede escribir

S + NADPH Producto + NADP+


para nombrar la enzima se utiliza el nombre del sustrato oxidado (sustancia que est del mismo lado
que el NADPH) seguido de la palabra reductasa. Al utilizar NADPH son enzimas dependientes del
aporte de vitamina B8 o cido nicotnico.
Ejemplo

HMGCoA + NADPH cido mevalnico + NADP+

la enzima se llama HMGCoA reductasa.

6- Sintetasas o sintasas: estas enzimas en general catalizan procesos en que dos sustratos (A y B)
dan origen a una tercer sustancia (C). En general la reaccin es

177
ENZIMAS

A + B C
la enzima se nombra con el nombre del producto seguido de sintetasa o sintasa. En general C
sintetasa.
Ejemplo

acetil-CoA + oxalacetato citrato + CoA


La enzima se llama citrato sintetasa.

7- Liasas: estas enzimas catalizan habitualmente pasos en que una sustancia que se form (S) a
partr de dos sustancias (A y B) vuelve a regenerar stas por otra reaccin diferente. En general
podemos escribir la reaccin

S A + B
La enzima en general se llama S liasa. Estas reacciones pueden o no utilizar ATP.
Ejemplo
citrato + ATP oxalacetato + acetil-CoA + ADP + P
La enzima se llama citrato liasa.

8- Mutasas: estas enzimas en general cambian la posicin de un grupo P. Se utiliza un nombre


genrico de los dos compuesto involucrados seguidos de la palabra mutasa. Puede existir
contraccin del nombre.
Ejemplo1:

3-P-glicerato 2-P-glicerato
Ambos compuestos son P-gliceratos. La enzima se llama Pglicerato mutasa.

Ejemplo 2:
Glucosa-6-P Glucosa-1-P
la enzima se podra llamar glucosa-P mutasa, pero el nombre ms comn es fosfoglucomutasa.

9- Isomerasas: en general transforman un sustrato en su ismero ya sea de cadena o geomtrico. Se


utiliza el nombre genrico del sustrato seguido de la palabra isomerasa.
ejemplo
gliceraldehdo-3-P fosfato de dihidroxiacetona

178
ENZIMAS

como ambos compuestos son triosas fosfato, la enzima se llama triosa fosfato isomerasa.

11.3. Enzimas en la clnica

Las enzimas son de importancia en medicina ya que la concentracin de las mismas en plasma
permiten obtener informacin del funcionamiento del metabolismo celular. Las enzimas plasmticas se
clasifican como:
1- Plasmo especficas: estn siempre presentes en el plasma de un individuo y cumplen su funcin en
l. Por ejemplo las enzimas de la coagulacin, fibrinolisis y complemento.
2- Plasmo inespecficas: estn en plasma en baja concentracin, ya que pertenecen al interior celular.
Su concentracin aumenta (en la mayora de los casos) o disminuye cuando se produce una alteracin
de los tejidos a los cuales pertenece. Ejemplos de este grupo son las enzimas conocidas como:
LDH: aumenta en infarto de miocardio
CPK: aumenta en infarto de miocardio y problemas musculares.
GOT o ASAT o transaminasa: aumenta en problemas hepticos e infarto de miocardio.
GPT O ALAT o transaminasa: aumenta en problemas hepticos e infarto de miocardio.
FOSFATASA ALCALINA: su valor vara en enfermedades seas y hepticas.
FOSFATASA CIDA: su valor vara cuando se presentan problemas de prstata.

11.4. Prctica

En esta prctica encontrar diferentes tipos de ejercicios


1- definiciones
2- multiple choice: En este caso slo una respuesta es correcta. Por ejemplo
Las enzimas
a- son afectas por el calor.
b- son afectadas por pH extremos.
c- no son protenas.
d- a + b.
e- todas son correctas.
En este caso la respuesta es d, ya que a y b son correctas.
3- Causa consecuencia: en estas preguntas existen dos proposiciones separadas por un porque. Las
respuestas son las siguientes letras segn el grado de verdad de las proposiciones:
A- cuando la primera y la segunda proposicin son correctas y la segunda es la causa de la primera
B- cuando ambas proposiciones son correctas pero la segunda no es la causa de la primera.
C- cuando la primera es verdadera y la segunda falsa.
D- cuando la primera es falsa y la segunda verdadera.

179
ENZIMAS

E- cuando ambas proposiciones son falsas.


Por ejemplo
....B.... Las enzimas aumentan la velocidad de reaccin porque son especficas.
Las dos proposiciones son correctas, pero la segunda no es la causa de la primera. Por lo tanto la
respuesta es B.
4- Prrafos a completar: en algunos casos se dan las palabras a utilizar pudiendo sobrar palabras. En
otros no se dan las palabras.

1). Definir catalizador.


2). Definir enzima.
3). Definir Coenzima.
4). Explicar el concepto: "especificidad enzimtica"
5). Qu significa que las enzimas son termolbiles?
6). Una enzima:
a- Tiene estructura proteica.
b- Siempre necesita de una coenzima.
c- No son afectadas por las altas temperaturas.
d- a + b.
e- Todas las anteriores.
7). Una enzima:
a- Disminuye la energa de activacin de las reacciones.
b- Son consumidas durante la reaccin.
c- Se recuperan intactas al final de la reaccin.
d- a + c.
e- Ninguna de las anteriores.
8). Una enzima:
a- Es un catalizador.
b- No forman parte de los productos de la reaccin.
c- Son de estructura proteica.
d- a + b.
e- Todas las anteriores.
9). Una enzima:
a- Disminuye la velocidad de reaccin.
b- Forma parte de los productos de la reaccin.
c- Disminuye la energa de activacin de la reaccin.

180
ENZIMAS

d- a + b.
e- Todas las anteriores.

10). La actividad de una enzima:


a- Es afectada por temperaturas de 100 C.
b- No depende del pH en el que se encuentra la enzima.
c- Es disminuida por pH extremos.
d- a + c.
e- Todas son correctas.

11). ..... La actividad de una enzima disminuye si la reaccin se lleva a cabo a un pH que no es el
ptimo porque a pH muy bajos los enlaces covalentes que ligan coenzima-apoenzima se destruyen.
12). ..... Las enzimas aumentan la velocidad de las reacciones porque las enzimas aumentan la energa
de activacin de las reacciones que catalizan.
13). ..... Las enzimas son catalizadores biolgicos termoestables porque las elevadas temperaturas no
afectan su actividad.
14). ..... Las enzimas son termolbiles porque las coenzimas que generalmente acompaan a las
apoenzimas son termolbiles.
15). ..... Las enzimas modifican su actividad si a la solucin en la que se encuentran se le agrega una
base de manera de hacer su pH muy alto (por ejemplo 13) porque las enzimas por ser protenas se
desnaturalizan a pH extremos.
16). La especificidad de una enzima:
a- Depende de la estructura de su sitio activo.
b- Depende del Km.
c- Depende de la presencia de inhibidores competitivos.
d- a + b.
e- Ninguna de las anteriores.
17). La afinidad de una enzima por su sustrato:
a- Es la mitad de su Vmax.
b- Es directamente proporcional a la especificidad.
c- Es mayor cuanto mayor es el Km.
d- Todas son correctas.
e- Ninguna es correcta.
18). ..... Una enzima que tiene alta afinidad por su sustrato tendr siempre alta especificidad porque
cuanto ms afinidad tiene una enzima por su sustrato, menor es su Km.
19). ..... Las enzimas plasmoespecficas son aquellas que se encuentran en plasma en muy baja
concentracin porque estas enzimas cumplen su funcin en un sitio que no es el plasma.

181
ENZIMAS

20). ..... Las enzimas plasmo inespecficas se encuentran habitualmente en plasma en baja
concentracin porque su concentracin aumenta al producirse dao del tejido en que se originan.
21) Dibujar una grfica de actividad enzimtica en funcin de la concentracin de sustrato, e indicar las
unidades de las variables de ambos ejes.
22) Dibujar una grfica de actividad enzimtica en funcin de la concentracin de sustrato y marcar en
ella la velocidad mxima. Definir esta ltima variable.
23) Dibujar una grfica de actividad enzimtica en funcin de la concentracin de sustrato y marcar el
Km. Definir esta variable.
24) Dibujar una grfica de actividad enzimtica en funcin de la concentracin de sustrato. Realizar en
la misma grfica la que correspondera en presencia de un inhibidor competitivo.
25). Definir Km, dar las unidades en las que se mide e indicar que informacin provee respecto de las
enzimas.
26). Definir Vmax, indicar sus unidades y de qu depende.
27). Dar dos caractersticas de un inhibidor competitivo y realizar una grfica de actividad enzimtica
en funcin de la concentracin de sustrato, con y sin el agregado del inhibidor.
28). Dar dos caractersticas de un inhibidor no competitivo y realizar una grfica de actividad
enzimtica en funcin de la concentracin de sustrato, con y sin el agregado del inhibidor.
29). Un sustrato se hizo reaccionar en presencia de una enzima obtenindose un valor de Vmax= 56
mmol/min y un Km de 78 mM.
a- Proponga valores para ambos parmetros cuando se realice la misma reaccin en presencia de un
inhibidor competitivo.
b- Dibuje las grfica de actividad enzimtica en funcin de la concentracin de sustrato con y sin
agregado del inhibidor competitivo.
c- Si el 13G' de la reaccin que cataliza la enzima es -3,4 Kcal/mol, cunto vale la Kc en presencia
de la enzima.
d- Conteste verdadero o falso y justifique:
V - F. Una enzima aumenta la velocidad de reaccin, por lo tanto aumenta la liberacin de energa por
parte de la reaccin.
30). .... Las enzimas aumentan la velocidad de reaccin porque aumentan la energa de activacin.
31). .... Las enzimas disminuyen la velocidad de reaccin porque disminuyen la energa de activacin.
32). Qu significa que una enzima es un catalizador biolgico?
33). Qu efecto tiene una enzima sobre la velocidad de una reaccin?
34). Una enzima:
a- Aumenta la velocidad de reaccin.
b- Disminuye la velocidad de reaccin.
c- Disminuye la energa de activacin.
d- a + c.
e- Todas son correctas.

182
ENZIMAS

f- Ninguna es correcta.
35). La tabla siguiente muestra la velocidad de la reaccin catalizada por la enzima hexoquinasa,para
diferentes concentraciones de glucosa.

concentracin de gluco- velocidad: m-


sa, mM mol/min
0 0
2 4
5 10
15 30
20 35
30 36
40 37
50 37

a- Indicar la velocidad mxima de la reaccin.


b- Calcular el Km de la enzima.
c- Cmo ser la afinidad de esta enzima comparada con otra cuyo Km vale 200 mM?
36). Una enzima
a- Aumenta la energa de activacin.
b- Aumenta la velocidad de reaccin.
c- Disminuye la velocidad de reaccin.
d- a + b.
e- Todas son correctas.
f- Ninguna es correcta.
37) Completar con una palabra sobre las lneas de puntos: Las enzimas son catalizadores
biolgicos. La ................ de las enzimas se debe a que presentan un sitio activo especfico para cada
sustrato. Algunas enzimas requieren de la presencia de ................, las cuales derivan de
las .................. Las enzimas conocidas como deshidrogenasas tiene como coenzima NADH o
FADH2 que derivan de las vitaminas .................. y .......... respectivamente, que pertenecen al
complejo .......
38) Colocar en las lneas de puntos las palabras faltantes. Elegir de la lista que se da a continuacin
INHIBIDORES NO COMPETITIVOS - CATALIZADOR - COENZIMAS - AUMENTAN
-PROTEICA - AFINIDAD
Una enzima es un ................. de las reacciones biolgicas, es decir que las enzimas .............. la

183
ENZIMAS

velocidad de las reacciones. El Km de una enzima es una constante que mide la ........... de la enzima
por su sustrato. La velocidad mxima es el valor mximo de velocidad que puede alcanzar una
reaccin, la Vmax disminuir en presencia de ..................... Las enzimas tienen una
estructura ................ , pero pueden requerir para su accin de sustancias no proteicas
llamadas .........
39). Las enzimas:
a- Aumentan la velocidad de la reaccin.
b- Son especficas.
c- Su estructura est formada por protenas.
d- a + c.
e- a + b.
f- Todas las anteriores.
40) Tachar las palabras incorrectas dentro de cada parntesis, de manera que el prrafo tenga
sentido.
Una enzima es un (CATALIZADOR - INHIBIDOR - SUSTRATO) de las reacciones biolgicas, es
decir que las enzimas (AUMENTAN - DISMINUYEN - NO CAMBIAN) la velocidad de las
reacciones. El Km de una enzima es una constante que mide la (ESPECIFICIDAD - AFINIDAD -
VELOCIDAD ) de la enzima por su sustrato. La velocidad mxima es el valor mximo de
velocidad que puede alcanzar una reaccin, la Vmax disminuir en presencia de (INHIBIDORES
COMPETITIVOS - INHIBIDORES ALOSTERICOS - INHIBIDORES NO COMPETITIVOS)
41) Colocar en las lneas de puntos las palabras faltantes. Elegir de la lista que se da a continuacin
(sobran 2)
INHIBIDORES - CATALIZADOR - DISMINUYEN - COENZIMAS - AUMENTAN
-PROTEICA - AFINIDAD - VITAMINA -
Una enzima es un ................. de las reacciones biolgicas, es decir que las enzimas .............. la
velocidad de las reacciones. El Km de una enzima es una constante que mide la ........... de la enzima
por su sustrato. La velocidad mxima (Vmax) es el mayor valor que puede alcanzar la velocidad de
una reaccin, la Vmax no cambiar en presencia de ............... competitivos
Las enzimas tienen una estructura ................ , pero pueden requerir para su accin de sustancias no
proteicas llamadas .........

11.4.1. Respuestas

6- a
7-d
8-e
9-c
10-d
11-C
12-C

184
ENZIMAS

13-E
14-C
15-A
16-a
17-e
18- D
19- E
20-B
21- v: mmol/min, [S]; mM;
22- Velocidad de la reaccin cuando la enzima est saturada por el sustrato;
23- [S] con la cual se alcanza la mitad de la Vmax.
30- C
31- D
32- que aumenta la velocidad de reacciones que ocurren en las clulas
33- la aumenta
34- d
35- a) Vmax 37; b) Km aproximadamente 10; c) mayor;
36- b.
37- especificidad-coenzimas-vitaminas-cido nicotnico-riboflavina-B
38- catalizador-aumentan-afinidad-inhibidores no competitivos-proteica-coenzimas
39- f
40- correctas: catalizador-aumentan-afinidad-inhibidores no competitivos
41- catalizador-aumentan-afinidad-inhibidores-proteica-coenzimas

185
HIDRATOS DE CARBONO

12. HIDRATOS DE CARBONO

12.1. Estructura de hidratos de carbono

Los glcidos son polihidroxialdehdos o polihidroxicetonas, es decir que son molculas que contienen
un grupo aldehdo y varios oxhidrilos o un grupo cetona y varios oxhidrilos. Debido a sus grupos
funcionales son compuestos altamente hidroflicos. Es importante remarcar que si bien los glcidos
tienen grupos cetona y aldehdo, stos no estn presente en la frmula con la estructura habitual sino
que se encuentran formado parte de uniones hemicetlicas y hemiacetlicas, respectivamente.
Los glcidos se dividen en2:
1- Monosacridos
2- Disacridos: formados por dos monosacridos ligado por una unin glucosdica.
3- Oligosacridos: formados por 3-10 monosacridos
4- Polisacridos: formados por ms de 10 monosacridos ligados por unin glucosdica.

12.1.1. Monosacridos

El monosacrido ms importante es la glucosa, tambin llamada dextrosa. En solucin acuosa existe un


equilibrio entre la forma lineal y cclica, que para la glucosa, la ms comn es un ciclo de 6 tomos,
que lleva el nombre de ciclo piranosa. Los carbonos se numeran del 1 al 6, comenzando por el carbono
que se encuentra ms a la derecha tambin llamado carbono anomrico. Esta molcula puede existir en
dos formas, alfa glucosa y beta glucosa. Es alfa cuando el oxhidrilo del carbono anomrico se
encuentra hacia abajo con respecto al plano del anillo (Figura 12.1). En cambio es beta cuando se
encuentra para arriba del mencionado plano (Figura 12.2). El carbono 1 y el 5 se encuentran ligado por
un enlace hemiacetlico. Este enlace a pesar de ser covalente es lbil en solucin acuosa, razn por la
cual se puede abrir, permitiendo que la molcula exista en ambas formas y .

Figura 12.1 -Glucosa

2 Link a video sobre estructura de glcidos: https://www.youtube.com/watch?v=zPxD-zruyGs

186
HIDRATOS DE CARBONO

Figura 12.2 -Glucosa

La fructosa (Figura 12.3) tambin en un monosacrido de seis carbonos pero se encuentra en forma de
un ciclo de 5 tomos. Se suele decir que es una cetohexosa. A semejanza de la glucosa la fructosa
puede ser alfa o beta de acuerdo a la ubicacin del oxhidrilo del carbono anomrico.

Figura 12.3. -fructosa


La galactosa es un monosacrido de seis carbonos cuya diferencia con la glucosa es la ubicacin del
oxhidrilo del carbono 4 con respecto al plano del anillo piranosa (figura 12.4).

Figura 12.4 -galactosa


Los monosacridos nombrados: glucosa, fructosa y galactosa son hexosas por poseer 6 carbonos. La
glucosa y galactosa son aldosas porque poseen un grupo aldehdo. En cambio la fructosa es una cetosa
porque posee un grupo cetona. Cuando las molculas se encuentran en forma cclica (como las de las
Figura 12.1 a Figura 12.4), los grupos aldehdo y cetona no se ven ya que estn formado parte de la
estructura cclica (el oxgeno del ciclo). Las frmulas cclicas de 5 tomos (como la fructosa y la
ribosa) tiene estructura que se denomina furanosa; en cambio la glucosa y la galactosa que tienen ciclos
de 6 tomos se dice que presentan estructura piranosa.
El gliceraldehdo es un glcido de tres carbonos. Este compuesto no puede existir en forma cclica. Se
dice que es una aldotriosa por tener tres carbonos y un grupo aldehdo (Figura 12.5).

187
HIDRATOS DE CARBONO

Figura 12.5 gliceraldehdo

La ribosa es una aldopentosa (posee un grupo aldehdo y cinco carbono) puede existir en forma cclica
(Figura 12.6).

Figura 12.6 -ribosa


La eritrosa es una aldotetrosa, por tener cuatro carbonos y un grupo aldehdo (Figura 12.7).

Figura 12.7 eritrosa-4-P

steres fosfricos de monosacridos: Es habitual hallar a los glcidos en forma fosforilada, es decir
con uno ms fosfatos ligados por enlace ster a algn oxhidrilo. En el caso de la eritrosa se puede ver
que tiene un fsforo en el cuarto carbono. En este caso el nombre del monosacrido lleva el agregado
de la posicin donde se encuentra el fosfato. El nombre en este caso es eritrosa-4-fosfato (Figura 12.7).
Es comn escribirlo como eritrosa-4-P. Cuando un glcido tiene un fosfato en su molcula es comn
decir que tiene fsforo. No se debe perder de vista que este fsforo est siempre en la forma de
ortofosfato. El fosfato le confiere a la molcula carga negativa cuando la molcula se halla a pH
fisiolgico (cercano a 7).

188
HIDRATOS DE CARBONO

Desoxiazcares: Son molculas en las que se ha perdido un oxgeno de un oxhidrilo. En la figura 12.8
se muestra la frmula de la 2-desoxiglucosa que ha perdida un oxgeno del carbono 2. Por tener menos
oxgeno en su estructura se dice que este glcido se halla parcialmente reducido. En la molcula de
cidos desoxirribonucleicos se encuentra 2-desoxirribosa.

Figura 12.8 2-desoxiglucosa

minoazcares: Son monosacridos en los que se ha reemplazado un oxhidrilo por un grupo amino.
Cuando en la glucosa se sustituye un oxhidrilo por un grupo amino, se obtiene la 2-glucosamina
(Figura 12.9) Es importante tener en cuenta que este compuesto podr tener carga positiva sobre el
grupo amino.

Figura 12.9. -glucosamina

cidos urnicos: Son monosacridos en los que el ltimo carbono se oxida formando un grupo
carboxilo. Al nombre del monosacrido del cual deriva se le agrega la palabra cido y la terminacin
urnico. En el caso que se da en la Figura 12.10, el cido urnico deriva de la glucosa, por lo tanto el
compuesto se denomina cido glucurnico.

189
HIDRATOS DE CARBONO

Figura 12.10. cido glucurnico

12.1.2. Disacridos

Cuando dos monosacridos se unen entre s, se forma un disacrido. En el caso de la maltosa, son dos
molculas de glucosa las que se ligan (Figura 12.11). Como se puede ver se han unido por los
oxhidrilos de los carbonos 1 de la glucosa de la izquierda con el carbono 4 de la molcula de la
derecha. Como la glucosa que aporta el oxhidrilo del carbono 1 se encuentra hacia abajo del plano del
anillo piransico, se dice que la unin formada es una unin glucosdica 1-4.

Figura 12.11. maltosa

En el caso de la lactosa la unin formada es del tipo 1-4, ya que la molcula de galactosa, que aporta
el carbono 1, presenta el oxhidrilo hacia arriba (Figura 12.12).

Figura 12.12. lactosa

En la sacarosa, se unen una molcula de glucosa que aporta a la unin glucosdica su oxhidrilo de
posicin 1 en forma alfa, mientras que la fructosa aporta el oxhidrilo del carbono 2 en posicin beta,
por lo tanto la unin glucosdica formada es 1-2 (Figura 12.13).

190
HIDRATOS DE CARBONO

Figura 12.13. sacarosa

12.1.3. Polisacridos

En los polisacridos son glcidos formados por la unin de muchas unidades de monosacridos por
enlaces glucosdicos. Dentro de los polisacridos se describen dos grupos: los homopolisacridos y los
heteropolisacridos.
Homopolisacridos: estn constituidos por un slo tipo de monosacrido unidos por enlaces
glucosdicos. El monosacrido se repite miles de veces. Slo estudiaremos los glucanos o dextranos,
cuyo nombre deriva de ser polisacridos formados nicamente por molculas de glucosa. La amilosa
es un componente del almidn (sustancia de reserva vegetal). El enlace que liga las glucosa es del tipo
1-4 (Figura 12.14).

Figura 12.14. Amilosa

La celulosa (sustancia vegetal de sostn, que forma las fibras de nuestra alimentacin) est compuesta
por glucosas unidas por enlace es 1-4 (Figura 12.15).

191
HIDRATOS DE CARBONO

Figura 12.15. celulosa

Es importante notar que el slo cambio del enlace glucosdico produce grandes cambios de
propiedades y de posibilidades de digestin. Mientras la amilosa es un compuesto blanco pulvurulento,
capaz de aportar energa al ser humano por ser degradado en el tracto digestivo, la celulosa no es
degradada por lo que no aporta energa en el hombre. Por otro lado la celulosa tiene una estructura
fibrosa, es la base de la madera y el papel.
La amilopectina (sustancia de reserva vegetal, parte del almidn) y el glucgeno (sustancia de reserva
en el hombre) son homopolisacridos que tienen uniones del tipo 1-4 y ramificaciones que se ligan
por uniones 1-6. La diferencia entre la amilopectina y el glucgeno radica fundamentalmente en su
origen y en que el glucgeno tiene ms ramificaciones que la amilopectina (Figura 12.16).

Figura 12.16. amilopectina - glucgeno


Heteropolisacridos: Estan formados por muchos monosacridos modificados como ser cidos
urnicos y aminoazcares. Estos compuesto pueden tener cargas negativas por los grupos carboxilo de
los glcidos cidos, adems es comn que tengan ligados grupos sulfatos que le confieren tambin
carga negativa. La presencia de aminoazcares le da la posibilidad de tener carga positiva.
La heparina es un heteropolisacrido donde las unidades que forma la molcula son glucosamina
ligada cido glucurnico ligados por enlaces 1-4 y 1-4. Ambas molculas tiene ligado sulfato
(Figura 12.17).

Figura 12.17. heparina


El cido hialurnico es otro heteropolisacrido formado por cido glucurnico ligado por enlace 1-3 y
1-4 con una molcula de N-acetil glucosamina. Es uno de los constituyentes del tejido conectivo

192
HIDRATOS DE CARBONO

(Figura 12.18).

Figura 12.18. cido hialurnico


El condroitn sulfato tambin es parte del tejido conectivo, est formado por una molcula de cido
glucurnico ligado por enlace 1-3 y 1-4 a otra molcula de N-acetilgalactosamina (Figura 12.19)

. Figura 12.19. condroitnsulfato

Otros ejemplos
A continuacin se detallarn algunos derivados de los glcidos que han sido nombrados. La unin de
un fosfato en la posicin 6 de la glucosa produce la glucosa-6-fosfato (Figura 12.20).

Figura 12.20. glucosa-6-P


El reemplazo de los oxhidrilos de las posiciones 1 y 6 de la fructosa produce un compuesto conocido
como fructosa-1,6-bisfosfato (Figura 12.21). Es importante recordar que el fosfato tiene un pKa que le
confiere carga negativa al pH fisiolgico, a diferencia del glcido del cual derivan, que es neutro.

193
HIDRATOS DE CARBONO

Figura 12.21. fructosa-1,6-bisfosfato

Si el grupo aldehdo del gliceraldehdo se reduce a alcohol, la molcula se transforma en glicerol o


glicerina (Figura 12.22).

Figura 12.22. Glicerol


En cambio si se oxida el grupo aldehdo se transforma en carboxilo produciendo glicerato. Si se le une
un fosfato en el carbono 2, se obtiene el 2-fosfoglicerato (Figura 12.23).
Estos compuesto unidos al fosfato son sustratos y productos de rutas metablicas relacionadas con el
metabolismo de los glcidos.

Figura 12.23. fosfoglicerato

12.2. Metabolismo de glcidos

Se entiende por metabolismo de glcidos el conjunto de todas las reacciones en que participan
glcidos. Para ver un video general sobre el tema haga click
Estas reacciones estn encadenas formando rutas metablicas. Es decir que el o los productos de una

194
HIDRATOS DE CARBONO

reaccin pasa a ser sustrato de la siguiente reaccin.


La dieta contiene glcidos de diferentes tipos y orgenes, pero la mayor parte de estos glcidos estn
representados por el almidn, la lactosa y la sacarosa (Figura 12.24). En la boca comienza la digestin
del almidn (para ver un video haga click) por accin de la amilasa salival. Esta enzima produce la
degradacin de los enlaces 1-4 de las molculas de amilosa y amilopectina. Dado que el tiempo de
accin de la enzima es reducido y el paso del bolo alimenticio al estmago donde el pH es cido
inactiva la enzima, la degradacin no llega a ser total obtenindose como productos oligosacridos y
monosacridos. La sacarosa y lactosa no sufren hidrlisis en la boca. El estmago es un sitio donde los
glcidos no sufren hidrlisis.
En intestino acta la amilasa pancretica que es una 1-4 glucosidasa que junto con la accin de la
1-6 glucosidasa que hidroliza las ramificaciones de la amilopectina, el almidn es reducido a
molculas de glucosa y algunas maltosas. Esta ltima es hidrolizada a glucosa por accin de la enzima
maltasa. Por otro lado la sacarosa es hidrolizada a glucosa y fructosa por accin de la enzima sacarasa.
La lactosa por su lado es hidrolizada a galactosa y glucosa por accin de la lactasa (para ms detalles
de digestin de glcidos vea el video haciendo click). En definitiva, en intestino, todos los glcidos son
transformados en los monosacridos: glucosa, fructosa y galactosa. Estos monosacridos son
absorbidos en la mucosa intestinal cotransportados con sodio. Pasan a circulacin y por vena porta
alcanzan el hgado. En este rgano fructosa y galactosa son convertidos a glucosa.
D IE T A BOCA H E P A T O C IT O

a l m id o n l a c t o s a s a c a r o s a g l u c o g e n o t r ig l ic r id o s
C O 2 , a gu a y e n e rga
A m il a s a
s a l iv a l
m o n o s a c r id o s
o l ig o s a c r id o s
ESTO M AG O
fr u c t o s a g a l a c t o s a glu c o sa c id o l c t ic o

IN T E S T IN O E N T E R O C IT O T E J ID O A D IP O S O

t r ig l ic r id o s
m o n o s c a r id o s
o l ig o s a c r id o s
la c to sa sa c a ro sa glu c o sa

sa c a ra sa
sa c ara sa M U S C U L O E S Q U E L E T IC O
fr u c t o s a fr u c t o s a fr u c t o s a c i d o l c t ic o
ga la c to sa ga la c to sa ga la c to sa
A m il a s a glu c o sa C O 2 , agu a y
e n e rga
p a n c r e t ic a

glu c o sa glu c o sa C O 2 , agu a y


glu c o sa glu c o sa e n e rga

CELULAS EN
SANG R E GENERAL

Figura 12.24. Digestin, distribucin y metabolismo de glcidos


En el hepatocito la glucosa puede seguir diferentes caminos: por un lado puede ser transformada en
dixido de carbono, agua y energa. En este proceso intervienen rutas metablicas conocidas como
gluclisis, ciclo de Krebs y cadena respiratoria. Otro camino metablico puede conducir la glucosa
hasta la formacin de triglicridos, los cuales sern luego transportados por las lipoprotenas

195
HIDRATOS DE CARBONO

plasmticas para su almacenamiento en tejido adiposo. Un tercer proceso metablico puede


transformar la glucosa en glucgeno, que es un compuesto de reserva. La glucosa tambin puede ser
utilizada por las clulas en general donde es oxidada hasta CO 2 para producir energa. En el caso del
msculo esqueltico, existe una ruta metablica que puede transformar la glucosa en cido lctico,
produciendo grandes cantidades de energa, pero de muy corta duracin. Este proceso se conoce como
gluclisis anaerbica y participa en procesos donde el requerimiento de energa es mximo, siendo por
lo tanto de duracin limitada (unos minutos). El cido lctico producido por la gluclisis anaerbica
sale del miocito a sangre y es captado por el hgado, donde vuelve a transformarse en glucosa por una
ruta metablica conocida como gluconeognesis. La transferencia del lactato por va sangunea desde
el msculo al hgado donde es reconvertido a glucosa, para luego volver a ser utilizado por el msculo,
lleva el nombre de ciclo de Cori.
A continuacin se describirn sintticamente las rutas metablicas mas importantes que involucran
glcidos (para ver un video haga click).
1- Gluclisis
Conjunto de reacciones que ocurren en el citosol de clulas eucariotas, cuyo fin fundamental es
comenzar el catabolismo de las molculas de glucosa (figura 12.25). Comienza con la glucosa y sus
productos finales pueden ser diferentes dependiendo si hay o no aporte suficiente de oxgeno. Cuando
hay dficit de oxgeno el producto es lactato, mientras que en presencia de oxgeno suficiente, el
producto final es piruvato, que pasa al interior de la mitocondria donde forma acetil-CoA.

Figura 12.25

La primer reaccin es catalizada por las enzimas glucoquinasa (en hgado) y hexoquinasa (en hgado y
dems tejidos). En esta reaccin se forma glucosa-6-P, y se requiere ATP que aporta energa para el
proceso y fosfato para formar el producto, que al tener fosfato se torna impermeable a la membrana, no

196
HIDRATOS DE CARBONO

pudiendo escaparse de la clula (para ampliar detalles con video haga click, para ampliar material
escrito haga click). La glucosa-6-P es transformada en fructosa-6-P por la accin de la enzima glucosa-
6-fosfato isomerasa. La fructosa-6-P es luego fosforilada en la posicin 1, catalizada por la enzima
fosfofructoquinasa, que utiliza ATP como fuente de energa y fosfato. La fructosa-1,6-difosfato
obtenida en la reaccin anterior es escindida en dos triosas fosfato por la accin cataltica de la enzima
aldolasa. Como productos de esta reaccin se obtienen el gliceraldehdo-3-fosfato y el fosfato de
dihidroxiacetona. Esta ltima triosa no puede continuar en la va metablica, sin embargo por accin
de la enzima triosa fosfato isomerasa es transformada en gliceraldehdo-3-fosfato, el cual es utilizado
como sustrato de la prxima reaccin. La enzima gliceraldehdo-3-fosfato deshidrogenasa cataliza la
oxidacin del gliceraldehdo-3-fosfato a 1,3-difosfoglicerato, reaccin en la que acta como oxidante el
NAD+. En esta reaccin se incorpora un fosfato del medio, el cual se une a la molcula por un enlace
anhdrido (macrorgico). En la prxima reaccin este enlace macrorgico se hidroliza, en una reaccin
catalizada por la enzima fosfoglicerato quinasa, en la que participa ADP, formndose ATP y 3-
fosfoglicerato. Este proceso se denomina fosforilacin a nivel de sustrato y constituye uno de los pasos
en que conserva la energa almacenada en la molcula de glucosa. El 3-fosfoglicerato luego es
transformado en 2-fosfoglicerato en una reaccin catalizada por la enzima fosfoglicerato mutasa. En la
reaccin siguiente la accin de la enzima enolasa, transforma al 2-fosfoglicerato en fosfoenolpiruvato.
En esta transformacin el fosfato que estaba en la posicin 2, unido por enlace ster, pasa a formar
parte un un enlace macrorgico. En la reaccin siguiente este enlace se hidroliza, catalizando el
proceso la enzima piruvato quinasa, y con la energa liberada se forma una segunda molcula de ATP
(segunda fosforilacin a nivel de sustrato). Si no existe oxgeno el piruvato es reducido a lactato,
utilizando NADH. La lactato deshidrogenasa cataliza esta reduccin. En el caso de existir oxgeno el
piruvato es oxidado a acetil-CoA por accin del complejo multienzimtico piruvato deshidrogenasa.
Este complejo esta formado por tres enzimas: piruvato descarboxilasa, dihidrolipoil transacetilasa y
dihidrolipoil deshidrogenasa. Participan en este complejo adems cinco coenzimas: NADH, FAD,
pirofosfato de tiamina, CoA y cido lipoico. Para ms detalles sobre descarboxilacin oxidativa puede
ver un video haciendo click
2- Gluconeognesis
Conjunto de reacciones que conducen a la formacin de glucosa, partiendo de diferentes molculas,
como ser lactato, glicerol y aminocidos. Esta ruta metablica ocurre principalmente en el citosol, pero
las dos primeras reacciones ocurren en la matriz mitocondrial. Las enzimas de la gluconeognesis son
las mismas que las de la gluclisis, salvo algunas que catalizan pasos no comunes a ambas rutas. En la
figura 12.26 se puede observa que son cuatro las reacciones no comunes con la gluclisis.
Partiendo de lactato, ste es oxidado a piruvato por la misma enzima que la gluclisis: lactato
deshidrogenasa. Esta reaccin ocurre en este sentido cuanto la concentracin de NADH es baja.
Situacin contraria a la encontrada en la gluclisis en ausencia de oxgeno. El piruvato formado es
carboxilado a oxalacetato en el interior de la mitocondria por accin de la enzima piruvato carboxilasa.
Esta enzima requiere del grupo prosttico biotina adems del aporte de energa por parte de ATP. En el
esquema no se muestra, sin embargo el oxalacetato para salir de la mitocondria debe transformarse en
malato y luego nuevamente en oxalacetato. La enzima fosfoenolpiruvato carboxiquinasa utilizando
GTP y liberando un mol de dixido de carbono tranforma el oxalacetato en fosfoenolpiruvato. Desde
este ltimo compuesto las enzimas que catalizan los pasos son las mismas que la gluclisis. La enzima
enolasa transforma el fosfoenolpiruvato en 2-fosfoglicerato, este ltimo es trasformado en 3-
fosfoglicerato por la enzima fosfoglicerato mutasa y luego catalizada por la fosfoglicerato quinasa se
obtiene 1,3-difosfoglicerato. La enzima gliceraldehdo-3-fosfato deshidrogenasa reduce el 1,3-
fosfoglicerato a gliceraldehdo-3-fosfato.

197
HIDRATOS DE CARBONO

Figura 12.26 - gluconeognesis

Una molcula de gliceraldehdo-3-fosfato es isomerizada a fosfato de dihidroxiacetona en presencia de


la enzima triosafosfato isomerasa. A continuacin una molcula de dihidroxiacetona fosfato y una de
gliceraldehdo-3-fosfato son transformadas en una molcula de fructosa-1,6-difosfato por accin de la
enzima aldolasa. La enzima fructosa-1,6-difosfato fosfatasa, hidroliza el ster fosfrico de la posicin 1
de la fructosa generando fructosa-6-fosfato, que es luego isomerizada a glucosa-6-fosfato por la accin
de la enzima glucosa-6-fosfato isomerasa. La glucosa-6-fosfato es transformada en glucosa por la
accin de la enzima glucosa-6-fosfatasa. Esta ltima enzima no se encuentra en todos los tejidos. Slo
est en concentraciones apreciables en hgado y rin, por lo que estos rganos son los nicos que
podran liberar glucosa a la sangre.

3- Glucogenolisis y glucogenognesis
Estas rutas son citoslica y producen la degradacin y formacin del glucgeno (figura 12.27).
En la glucogenolisis, el proceso comienza por la accin de la enzima fosforilasa, que agregando un
fosfato rompe el enlace 1-4 del glucgeno, liberando glucosa-1-fosfato. La accin de la enzima
desramificante produce la hidrlisis de los enlaces 1-6, liberando glucosa libre. La glucosa-1-fosfato
formada es transformada en glucosa-6-fosfato, proceso catalizado por la enzima fosfoglucomutasa. La
glucosa-6-fosfato ser transformada en glucosa en aquellos rganos que contengan la enzima glucosa-
6-fosfatasa. Esto ocurre fundamentalmente en el hgado. Sin embargo en msculo donde tambin se
produce la glucogenolisis, al carecer este tejido de la enzima glucosa-6-fosfatasa, la glucosa-6-fosfato
continuar la va glucoltica hasta su transformacin en piruvato (detalles de la degradacin de enlaces
video)
La glucogenognesis es un conjunto de reacciones que conduce a la formacin de glucgeno. La

198
HIDRATOS DE CARBONO

transformacin de glucosa-6-fosfato en glucosa-1-fosfato es catalizada por la misma enzima


fosfoglucomutasa. La glucosa-1-fosfato luego es activada por la unin a UDP, utilizando UTP y
catalizada por la enzima UDP-glucosa pirofosforilasa. Finalmente la UDP-glucosa es incorporada a la
molcula de glucgeno, ligndose por un enlace 1-4, proceso catalizado por la enzima glucgeno
sintetasa. Cuando las cadenas de glucosas tienen largo suficiente, la enzima ramificante, transfiere una
cadena formando un enlace 1-6.

Figura 12.27 - Glucogenolisis y glucogenognesis

5- Va de las pentosas
Esta ruta tiene importancia porque provee a la clula de dos compuesto de suma importancia:
1- NADPH necesario para la sntesis de colesterol y cidos grasos.
2- Ribosa-5-fosfato necesario para la sntesis de nucletidos. Esta ruta metablica ocurre en el citosol
de las clulas y comienza utilizando como sustrato a la glucosa-6-P, la cual es oxidada a 6-
fosfogluconato por la enzima glucosa-6-fosfato deshidrogenasa, produciendo NADPH, la reaccin
siguiente tambin produce NADPH. Luego la ruta consiste en una serie de reacciones que terminan
originando intermediarios de la gluclisis.

6- Ciclo de Krebs
Esta ruta es comn al metabolismo de glcidos, lpidos y aminocidos. Es una ruta de ubicacin
mitocondrial y su funcin es extraer electrones, produciendo la oxidacin completa de los sustrato. En
este ltimo proceso los carbonos de los sustrato se transforman en dixido de carbono (figura 12.28).
La va comienza con la unin de un acetil-CoA con una molcula de oxalacetato. En esta reaccin se
utiliza la energa de la unin tioster del acetil-CoA y la reaccin es catalizada por la enzima citrato
sintetasa. Como producto de esta reaccin se forma citrato, que es un cido tricarboxlico. Por esta
razn a esta ruta tambin se la denomina ciclo del cido ctrico o de los cidos tricarboxlicos.

199
HIDRATOS DE CARBONO

El citrato formado en el paso anterior se isomeriza a isocitrato, cambiando de posicin un grupo


oxhidrilo, reaccin que es catalizada por la enzima aconitasa. Luego el isocitrato es oxidado a -
cetoglutarato por la enzima isocitrato deshidrogenasa, que produce una molcula de NADH y CO2. En
el paso siguiente el -cetoglutarato es oxidado a succinil-CoA, generando NADH, reaccin que es
catalizada por el complejo enzimtico alfacetoglutarato deshidrogenasa. Este complejo est formado
por tres enzimas: -cetoglutarato descarboxilasa, dihidrolipoil transacetilasa y dihidrolipoil
deshidrogenasa. Adems participan cinco coenzimas: NADH, FAD, cido lipoico, pirofosfato de
tiamina y coenzima A. El succinil-CoA es transformado luego en succinato, en la reaccin catalizada
por la enzima succinil-CoA sintetasa. En esta reaccin se utiliza la energa del enlace tioster del
succinil-CoA para formar una molcula de GTP a partir de GDP y P. Esta reaccin constituye una
fosforilacin a nivel de sustrato.
El succinato formado es oxidado por una deshidrogenasa FAD dependiente, la enzima succinato
deshidrogenasa que genera como producto fumarato, un cido dicarboxlico insaturado. Este ltimo se
hidrata, catalizado por la enzima fumarasa, generando como producto malato.
La ltima enzima de la ruta, la malato deshidrogenasa, transforma el malato en oxalacetato, es decir
regenera el compuesto para la unin a una nueva molcula de acetil- CoA. La malato deshidrogenasa
es una deshidrogenasa NAD dependiente, que genera como producto NADH adems de oxalacetato.
Energtica del Ciclo de Krebs: en la ruta se forman 3 molculas de NADH, 1 de FADH 2 y un GTP.
Cada NADH genera 3 ATP al oxidarse en la cadena respiratoria y el FADH2 genera 2 ATP. Por lo tanto
por cada molcula de acetil-CoA que es oxidada hasta CO 2 en esta ruta se generan 12 molculas de
ATP, 11 por fosforilacin oxidativa y 1 por fosforilacin a nivel de sustrato.

200
HIDRATOS DE CARBONO

Figura 12.28 - Ciclo de Krebs

Energtica de la oxidacin de glucosa


Cuando se metaboliza una molcula de glucosa hasta dixido de carbono y agua se produce gasto y
ganancia de ATP. Inicialmente se gastan 2 ATP en la glucolisis, en las reacciones catalizadas por la
enzimas hexoquinasa y fosfofructoquinasa. Se generan por accin e la aldolasa fosfato de
dihidroxiacetona y gliceraldehdo-3-fosfato. El primero es transformado en gliceraldehdo-3-fosfato,
por lo tanto dos molculas de este ltimo continuarn el metabolismo. Por accin de la enzima
gliceraldehdo-3-fosfato deshidrogenasa se forman 2 NADH (6 ATP). Luego se forman 2 ATP por la
enzima P-gliceratoquinasa y finalmente al formarse piruvato se forman otros 2 ATP. Las dos molculas
de piruvato forman dos acetil-CoA, en este paso se producen 2 NADH (6 ATP). Finalmente cada
acetil-CoA formar 12 ATP en el ciclo de Krebs. Sumando todos los ATP y restando los dos utilizados
al comienzo, se obtiene un balance total de 38 moles de ATP por mol de glucosa en condiciones
aerbicas.

12.3. Prctica

Estructura de glcidos
1) Un aminoazcar se forma por:

201
HIDRATOS DE CARBONO

a- Prdida de oxgeno de uno de los grupos alcohlicos


b- Sustitucin de un grupo hidroxilo por un grupo amino.
c- Ninguna es correcta.

2) La fructosa:
a- Es una cetohexosa.
b- Es una aldohexosa.
c- Es un disacrido.
d- b + c.
e- c + a.

3) El glucgeno:
a- Es el nico polisacrido de reserva energtica en los animales.
b- su estructura presenta uniones 1-4 y 1-3.
c- es un homopolisacrido.
d- a + b.
e- a+ b + c.
f- a + c.

4) La sacarosa est formada por:


a- 2 glucosas de igual anmero.
b- 1 glucosa y otra .
c- 1 glucosa y una fructosa .
d- Ninguna es correcta.

5) Un glcido:
a- Puede ser un polihidroxialdehdo.
b- Puede ser uns polihidroxicetona.
c- Tiene varias funciones alcohlicas.
d- Tiene principalmente funcin energtica.
e- Todas son correctas.

6) ..... El almidn es un heteropolisacrido porque est formado por la amilosa y la amilopectina.

202
HIDRATOS DE CARBONO

7) La fructosa-1,6-difosfato tiene:
a- Un P en el C-1 y uno en el C-6.
b- Dos P en el C-1 y dos en el C-6.
c- Tiene carga positiva.
d- Tiene carga negativa.
e- a + c.
f- a + d.

8) La 2-glucosamina presenta en su C nmero 2:


a- Un grupo fosfato.
b- Un grupo amina.
c- Prdida de O del grupo oxhidrilo.
d- Ninguna es correcta.

9) La fructosa-1,6-difosfato:
a- Tiene dos fosfatos en C-1 y dos en el C-6.
b- Tiene entre uno y seis fosfatos en su estructura.
c- Tiene un fosfato en C-1 y otro en el C-6.
d- Tiene dos fosfatos en el carbono 6.
e- Ninguna es correcta.

10) ..... La glucosa es una protena porque presenta un grupo cargado negativamente.

11) ..... Un disacrido puede estar compuesto por una glucosa y una galactosa porque ambos son
monosacridos.

12) El glucgeno es un:


a- Polisacrido.
b- Disacrido.
c- Monosacrido.
d- Oligosacrido.

13) ..... La sacarosa es un disacrido porque est formado por glucosa y fructosa.

14) El almidn:

203
HIDRATOS DE CARBONO

a- Es un monosacrido.
b- Est formado por amilosa y amilopectina.
c- Es un polisacrido.
d- b + c.
e- Ninguna de las anteriores.

15) La celulosa:
a- Es un polisacrido.
b- Es un monosacrido.
c- Es un disacrido.
d- Tiene enlaces glucosdicos 1-4.
e- Tiene enlaces glucosdicos 1-5.
f- a + e.

16) El glucgeno es:


a- Un homopolisacrido.
b- Un heteropolisacrido.
c- Un monosacrido.
d- b + c.

17) Los grupos amina y desoxi generalmente los encontramos en Carbono:


a- 1.
b- 6.
c- 4.
d- 2.
e- Ninguna es correcta.

18) Una -2-desoxiglucosa va a presentar:


a- Prdida de O.
b- Oxidacin.
c- Aumento del poder oxidante.
d- Disminucin del poder reductor.
e- Ninguna de las anteriores.

204
HIDRATOS DE CARBONO

19) La amilosa:
a- Tiene estructura lineal.
b- Est formada por glucosas unidas entre si por enlaces a1-4.
c- Forma parte del almidn.
d- Todas son correctas.
e- Ninguna es correcta.

20) La galactosa es:


a- Un disacrido.
b- Reductor.
c- Un monosacrido.
d- b + c.
e- Todas son incorrectas.

21) El almidn es:


a- Un monosacrido.
b- Est formado por amilosa y amilopectina.
c- Es un glucosaminoglicano.
d- Es un polisacrido.
e- b + d.
f- Todas son correctas.

22) V - F. La glucosa unido a la galactosa da como producto lactosa, si en la unin glucosdica est
comprometido el carbono 1 de la -galactosa y el C-4 de la glucosa.

23) V - F. Por lo general los grupos amino estn unidos al segundo carbono de las aldohexosas.

24) En la estructura de la derecha:


a- Indicar si se trata de la forma alfa o beta
b- Indicar si es una triosa, tetrosa, pentosa o hexosa.
c- Marcar en la molcula el oxhidrilo del carbono 5.

25) A continuacin se dan tres monosacridos


14 15 16

205
HIDRATOS DE CARBONO

Unir a travs de un enlace glucosdico el carbono 1 del primer monosacrido, con el carbono 4 del
segundo monosacrido y el carbono 1 del monosacrido del medio con el carbono 3 del monosacrido
de la derecha. Indicar los tipos de enlaces establecidos.

26) En la estructura de la derecha:


Indicar el tipo de enlace glucosdico.

27) A continuacin se dan dos monosacridos


a- Unirlos a travs de un enlace glucosdico, que comprometa los carbonos 1 del glcido de la
izquierda y el 3 del glcido de la derecha.
b- Marcar con un crculo la unin glucosdica e indicar si la misma es forma alfa o beta

28) A continuacin se dan tres estructuras


a- Indicar si la primera de ellas tiene forma piranosa o furanosa.
b- Indicar si la segunda es una triosa, tetrosa, pentosa o hexosa.
c- Indicar si la tercera es forma alfa o beta.
d- Unirlas de manera que entre la primera y la segunda se forme un enlace glucosdico 1-4 y
entre la segunda y la tercera un 1-3.

CH2OH

O
H
OH

OH OH
OH H

H H

206
HIDRATOS DE CARBONO

Metabolismo de glucidos

1) Nombre tres enzimas, que pertenezcan a la va glucoltica y catalicen reacciones en las que
participan molculas de 6 carbonos.

2) ..... Cuando se metaboliza glucosa en ausencia de oxgeno se forma lactato porque el lactato es un
cido de 3 carbonos.

3) Las enzimas hexoquinasa y enolasa pertenecen a:


a- Glucogenolisis.
b- Glucogenognesis.
c- Gluclisis.
d- Ciclo de Krebs.
e- Gluconeognesis.

4) Nombre tres enzimas, que pertenezcan a la va glucoltica y catalicen reacciones en las que
participan molculas de 3 carbonos.

5) ..... Cuando se metaboliza glucosa en ausencia de oxgeno se forma acetil-CoA porque el


acetil-CoA tiene 2 carbonos menos que el piruvato.

6) Las enzimas piruvatocarboxilasa y glucosa-6-fosfatasa pertenecen a:


a- Glucogenolisis.
b- GLucogenognesis.
c- Gluclisis.
d- Ciclo de Krebs.
e- Gluconeognesis.

7) Nombre tres sustratos de la va glucoltica que pertenezcan a la fase de esta va en la cual se


incorpora fosfato a las molculas.

8) .... Cuando se metaboliza glucosa en presencia de oxgeno se forma lactato porque el piruvato se
oxida a lactato

9) Las enzimas fosforilasa y fosfoglucomutasa pertenecen a:


a- Glucogenolisis.

207
HIDRATOS DE CARBONO

b- Glucogenognesis.
c- Gluclisis.
d- Ciclo de Krebs.
e- Gluconeognesis.

10) Nombre tres sustratos de la va glucoltica que pertenezcan a la fase de esta va en la cual se
producen fosforilacin a nivel de sustrato.

11) .... Cuando se metaboliza glucosa en presencia de oxgeno se forma acetil-CoA porque el
acetil-CoA se forma por oxidacin del piruvato.

12) Las enzimas citrato sintetasa y fumarasa pertenecen a:


a- Glucogenolisis.
b- Glucogenognesis.
c- Gluclisis.
d- Ciclo de Krebs.
e- Gluconeognesis.

13) ..... La fosforilacin de la glucosa en el carbono 6 le confiere carga positiva porque la hexoquinasa
cataliza la reaccin.

14) ..... La fosforilacin de la glucosa en el carbono 6 le confiere carga negativa porque la hexoquinasa
cataliza la reaccin.

15) ..... La fosforilacin de la glucosa en el carbono 6 le confiere carga negativa porque la


fosfofructoquinasa cataliza la reaccin.

16) ..... La fosforilacin de la glucosa en el carbono 6 le confiere carga positiva porque la glucoquinasa
cataliza la reaccin.

17) El metabolismo de la glucosa en presencia de oxgeno termina en:


a- Dixido de carbono
b- Agua
c- a + b.
d- Ninguno

208
HIDRATOS DE CARBONO

18) El metabolismo de la glucosa en presencia de oxgeno termina en:


a- Dixido de carbono
b- Piruvato
c- cido lctico.
d- Todos
e- Ninguno

19) El metabolismo de la glucosa en ausencia de oxgeno termina en:


a- Dixido de carbono
b- Agua
c- cido lctico.
d- Todos
e- Ninguno

20) El metabolismo de la glucosa en ausencia de oxgeno termina en:


a- Dixido de carbono
b- Agua
c- Citrato.
d- Todos
e- Ninguno

21) El gliceraldehdo-3-P se transforma en 1,3-diPglicerato por accin de la


enzima .................................

22) El 1,3-diPglicerato se transforma en 3-P-glicerato por accin de la enzima ...................................

23) La enzima fosfofructoquinasa:


a- Pertenece a la glucogenolisis.
b- Pertenece a la oxidacin.
c- Cataliza una reaccin reversible.
d- Ser activada por ATP.
e- Ninguna de las anteriores.

24) ..... La enzima gliceraldehdo3-P deshidrogenasa requiere NAD + como coenzima porque es una
descarboxilasa.

209
HIDRATOS DE CARBONO

25) El ............... es una sustancia que puede transformarse en acetoacetil-CoA y citrato.

26) ..... La enzima 3-P-glicerato quinasa requiere NAD + como coenzima porque es una
deshidrogenasa.

27) El ............... es una sustancia que puede transformarse en lactato y acetil- CoA.

28) El ............... es una sustancia que puede transformarse en oxalacetato y acetil CoA.

29) Completar con la o las palabras faltantes. La gluconeognesis es una ruta metablica en la que se
forma ........... La ruta comienza a partir del ............. La enzima que cataliza el paso de .............
a .............. se denomina lactato deshidrogenasa. La coenzima que utiliza esta enzima depende del
aporte de vitamina del complejo B llamada ................. Si se produce un dficit en la actividad de la
enzima fructosa-1,6-difosfato fosfatasa se producir acumulacin de .................. y disminucin
de ............... Un aumento de actividad de la 3-Pglicerato quinasa producir aumento de ............. y
disminucin de ................

30) Completar con la o las palabras faltantes: La gluclisis es una va metablica en la cual se
metaboliza la ........... Cuando el aporte de oxgeno es suficiente el producto final es ............; en este
ltimo caso el acetil-CoA producido se metaboliza en el Ciclo de Krebs, produciendo ....... y ........ Estas
dos sustancias entregan los electrones a la ....................... Si se produce una inhibicin de la
enzima ..................... se producir un aumento de 1,3-difosfoglicerato y una disminucin de 3-
fosfoglicerato. Mientras que si la enzima glucosa quinasa esta activada se producir una disminucin
de la concentracin de .......... y un aumento de ................ La insulina acta sobre la gluclisis, en
presencia de la hormona la gluclisis est ............

31) Completar sobre las lneas de puntos con la o las palabras faltantes: La glucogenolisis es una va
metablica en la que se degrada .................. El glucgeno es un polisacrido que posee uniones
glucosdicas ......... y ........... Es particularmente abundante en ................ y constituye una forma de
reserva energtica. La enzima fosforilasa transforma el glucgeno en ................... y la
enzima ................ transforma la glucosa-1-P en glucosa-6-P. Si esta enzima se encuentra activada la
concentracin de glucosa1-P estar ................
La glucogenognesis es la va de sntesis de glucgeno. Si se encuentra inhibida la enzima
glucoquinasa la concentracin de .......... se encontrar aumentada y la de ............. disminuida.

32) Completar sobre las lneas de puntos con las siguientes palabras: fructosa-6-fosfato, anaerbica,
glucogenosintetasa , glucosaquinasa, piruvatoquinasa, fosforilasa , acetil-CoA, sustrato,
glucogenognesis. Cuando la glucosa se metaboliza en forma ......... el producto final es lactato,
mientras que cuando se metaboliza en forma aerbica el producto es ............ La primer reaccin de la
gluclisis es catalizada por la enzima ............... En la va glucoltica existen dos fosforilaciones a nivel
de ............., una catalizada por la fosfogliceratoquinasa y otra catalizada por la ................ Cuando se

210
HIDRATOS DE CARBONO

a- Indicar con la letra "A" la reaccin


catalizada por la -cetoglutarato
deshidrogenasa e indicar el agente
oxidante. GDP+P
GTP
NADH
SUCCINIL.COA
FAD SUCCINATO

CO2
NAD

FADH2 ALFACETOGLUTARATO
NADH
FUMARATO CO2
H2O

NAD

ISOCITRATO
MALATO

NAD

NADH OXALACETATO CITRATO

ACETIL CoA

b- Indicar como quedar la concentracin de succinil-CoA cuando se encuentre inhibida la enzima


malato deshidrogenasa.
c- Dar el nombre de la enzima que cataliza la transformacin de succinato a fumarato.
d- Cuntos moles de ATP produce un mol de acetil-CoA que es degradado en el ciclo de Krebs?
e- Nombrar la enzima que se inhibir ante la falta de cido pantotnico.
f- Qu ocurrir con la concentracin de succinato cuando exista un dficit de riboflavina?
g- Indicar que ocurrir con la concentracin de malato cuando se encuentra inhibida la enzima
malato deshidrogenasa.
h- Qu reacciones se vern afectadas cuando exista una dieta deficiente en vitamina B8 (cido
nicotnico)?
i- Qu reacciones se vern afectadas cuando exista una dieta deficiente en vitamina B2 o

211
HIDRATOS DE CARBONO

riboflavina?
j- Identificar si en esta ruta metablica existe una quinasa.
k- La enzima que cataliza el paso de isocitrato a -cetoglutarato es la isocitrato deshidrogenasa,
considerando que el ciclo de Krebs es una ruta catablica, el ADP actuara como regulador
alostrico:
k1- positivo de la enzima.
k2- negativo de la enzima.

34) En el siguiente esquema

GLUCOSA
P
ATP

ADP

GLUCOSA-6-P

UDP-GLUCOSA
GLUCOSA1-P

UTP PP

P GLUCOGENO

a- Indicar con la letra "A" la reaccin catalizada por una fosfatasa.


b- Identificar si en esta ruta metablica existe una quinasa.
c- En caso de existir colocar el nombre de la misma.
d- Con la letra "B" indicar la reaccin catalizada por la glucoquinasa
e- Que ocurrir con la concentracin de glucgeno en una clula que tiene un dficit congnito de
la enzima glucoquinasa.
f- Indicar con la letra "C" la reaccin catalizada por la glucosa-6-fosfato fosfatasa
g- Indicar con la letra "D" la reaccin catalizada por la glucogenofosforilasa.

35) Completar sobre las lneas de puntos con las siguientes palabras: fosfogliceratoquinasa,
glucosa-6-fosfato fosfatasa, glucogenognesis, gluclisis, acetil-CoA, ramificante, anablicas.
Las siguientes vas metablicas: ...................., glucogenolisis, glucogenognesis y gluconeognesis

212
HIDRATOS DE CARBONO

son reacciones relacionadas al metabolismo de los glcidos. Las dos primeras son rutas catablicas
mientras que las dos ltimas son ......................
Cuando la gluclisis se realiza en forma anaerbica el producto final de la va metablica es lactato,
mientras que cuando se metaboliza la glucosa en forma aerbica el producto es .................. La
primer reaccin de la gluclisis es catalizada por la enzima glucoquinasa que requiere el aporte de
ATP. En la va glucoltica existen dos fosforilaciones a nivel de sustrato, una catalizada por
la .................... y otra catalizada por la piruvato quinasa. Cuando se forma glucosa a partir de lactato
participan tres enzimas que no participan en la gluclisis: piruvatocarboxilasa, fructosa-1,6-
difosfatofosfatasa y ...................... que catalizan el paso de piruvato a oxalacetato, fructosa-1,6-
difosfato a fructosa-6-fosfato y glucosa-6-fosfato a glucosa, respectivamente.La formacin de
glucgeno a partir de glucosa se denomina .................. , en esta va se requiere UTP y la participa-
cin de la enzima glucogenosintetasa que forma los enlaces 1-4 y ..................... que forma los
enlaces 1-6. Durante la glucogenolisis participa la fosforilasa que hidroliza los enlaces 1-4 y la
enzima desramificante que degrada los enlaces 1-6.

12.3.1. Respuestas

Estructura de glcidos
1- b
2- a
3- f
4- c
5- e
6- D
7- f
8- b
9- c
10- E
11- B
12- a
13- A
14- d
15- a
16- a
17- d
18- a
19- d
20- d

213
HIDRATOS DE CARBONO

21- e
22- V
23- V.
24- a- alfa, b- pentosa
25- -1-4, 1-3.
26- 1-4.
27- a- 1-3, b-
28- a- piranosa, b- hexosa, alfa.

Metabolismo de glcidos
1- hexoquinasa, glucosa-6-fosfato isomerasa, fosfofructoquinasa
2- B
3- c
4- gliceraldehdo-3-P deshidrogenasa, enolasa, piruvato quinasa
5- E
6- e
7- glucosa, glucosa-6-P, fructosa-6-P
8- E
9- a
10- gliceraldehdo-3-P, fosfoenolpiruvato, piruvato
11- A
12- d
13- D
14- B
15- C
16- D
17- c
18- a
19- c
20- e
21- Gliceraldehdo-3-P-deshidrogenasa
22- fosfoglicerato quinasa
23- e
24- C

214
HIDRATOS DE CARBONO

25- acetil-CoA
26- E
27- Piruvato
28- Piruvato
29- glucosa, lactato, lactato, piruvato, cido nicotnico, fructosa-1,6-difosfato, fructosa-6-P, 1,3-
diPglicerato, 3-P-glicerato.
30- glucosa, acetil-CoA, NADH, FADH2, cadena respiratoria, fosfoglicerato quinasa, glucosa, glucosa-
6-P, activada
31- glucgeno, 1-4, 1-6, hgado o msculo, glucosa-1-P, fosfoglucomutasa, disminuida, glucosa,
glucosa-6-P
32- anaerbica, acetil-CoA, glucoquinasa, sustrato, piruvatoquinasa, fructosa-6-P, glucogenognesis,
glucogenosintetasa, fosforilasa
33- a- -cetoglutarato a succinil-CoA, NAD. b- aumentado, c- succinato deshidrogenasa, d- 12, e-
-cetoglutaratodeshidrogenasa, f- aumentar, g- aumentar, h- catalizadas por isocitrato
deshidrogenasa, -cetoglutarato deshidrogenasa y malato deshidrogenasa, i- la que utilizan FADH 2:
succinato deshidrogenasa, -cetoglutarato deshidrogenasa, j- no, k- k1,
34- a- glucosa-6-P a glucosa, b- si, c- hexoquinasa, d- glucosa a glucosa-6-P, e- disminuir, f-
glucosa-6-P a glucosa, g- glucgeno a glucosa-1-P
35- gluclisis, anablicas, acetil-CoA, fosfogliceratoquinasa, glucosa-6-fosfato fosfatasa,
glucogenognesis, ramificante.

215
LPIDOS

13. LPIDOS

13.1. Estructura de lpidos

Los lpidos son estructuras caracterizadas por su alto contenido en carbonos e hidrgenos. Son
molculas altamente hidrofbicas (rechazan el agua o tiene afinidad por otros lpidos: liposolubles). En
algunos casos tiene carcter anfiptico (carcter hidroflico en una porcin de la molcula e
hidrofbico en otra). Para ver un vdeo sobre el tema haga click aqu.

13.2. Clasificacin de los lpidos

Esta clasificacin se basa en la presencia de enlaces hidrolizables en medio cido o alcalino, como ser
ster o amida. Los lpidos simples no poseen estos enlaces mientras que si estn presentes en los
complejos.

1- Lpidos simples:
1.1- cidos grasos: Saturados
Insaturados: Monoinsaturados.
Poli-insaturados.
1.2- Terpenos
1.3- Esteroides: Esteroles
Hormonas corticoadrenales
cidos biliares
Hormonas sexuales: Andrgenos
Estrgenos
1.4- Prostaglandinas.

2- Lpidos compuestos:
2.1- Acilgliceroles: Monoacilgliceroles
Diacilgliceroles
Triacilgliceroles
2.2- Fosfoglicridos: cidos fosfatdicos
Lecitinas
Cefalinas
Cardiolipinas
Fosfatidilinositoles

216
LPIDOS

2.3- Esfingolpidos: Ceramidas


Esfingomielinas
Cerebrsidos
Ganglisidos

13.2.1. cidos grasos saturados

Estas molculas tienen un grupo carboxilo y una cadena carbonada sin dobles ligaduras. La cadena
tiene por lo general nmero par de tomos de carbono y es una cadena lineal. Los ms comunes son:
cido palmtico (16 carbonos) o cido hexadecanoico (figura 13.1), cido esterico (18 carbonos) o
cido octadecanoico (figura 13.2).

Figura 13.1

Figura 13.2
Se los puede identificar con smbolos, por ejemplo el palmtico por tener 16 carbonos y ningn doble
enlace se representa 16:0. El cido esterico se representa 18:0 .

13.2.2. cidos grasos insaturados

Estas molculas tienen un grupo carboxilo y una cadena carbonada con dobles ligaduras C-C. La
cadena tiene por lo general nmero par de tomos de carbono y es una cadena lineal. Tienen diferente
nomenclatura y representacin por ejemplo si tiene 18 carbonos y una insaturacin en el carbono 9
contando desde el carboxilo se lo representa 18:19 , tambin se lo llama un cido -9, dado que el
doble enlace est ubicado a 9 carbonos del extremo que no tiene el carboxilo.
Dentro de los cidos grasos monoinsaturados el ms importante es el cido oleico (18 carbonos, con
una insaturacin) llamado cido-9-octadecenoico, que se puede representar: 18:19. es un cido -9
(figura 13.3).

Figura 13.3
Dentro de los cido grasos poliinsaturados (con ms de una doble ligadura) los ms importantes son:
1- cido linoleico (18 carbonos, 2 insaturaciones) o cido-9,12-octadecanodienoico o 18:29,12, es un

217
LPIDOS

cido -6 (figura 13.4).

Figura 13.4

2- cido linolnico (18 carbonos, 3 insaturaciones) o cido-9,12,15-octadecanotrienoico o 18:39,12,15 ,


es un cido -3 (figura 13.5).

Figura 13.5

3- cido araquidnico (20 carbonos, 4 insaturaciones) o cido-5,8,11,14-eicosanotetraenoico o


20:35,8,11,14 , es un cido -6 (figura 13.6)

Figura 13.6

Punto de fusin de los cidos grasos


El punto de fusin de los cidos grasos es dependiente del nmero de dobles ligaduras y de la cantidad
de carbono del compuesto. Cuanto menos carbonos tiene un cido graso y mayor cantidad de dobles
ligaduras menor es el punto de fusin, por lo tanto es ms fluido. Por ejemplo si se compara el punto de
fusin de los cidos linolnico 18:39,12,15
y oleico 18:19, el punto de fusin de este ltimo es mayor por tener menor cantidad de dobles enlaces.
Si se compara el cido esterico: 18:0, con el cido palmtico: 16:0, ste ltimo tiene menor punto
de fusin por tener menor cantidad de carbonos. Esta propiedad de los cidos grasos se transfiere a los
compuestos que contengan cidos grasos en su estructura.
Isomera geomtrica de los cidos grasos insaturados
Los dobles enlaces de los cidos grasos saturados que forman parte de las membranas o se hallan
almacenados son del tipo cis. Mientras que por procesos industriales o bien durante ciertas etapas del
metabolismo pueden originarse cidos grasos insaturados con isomera trans. La isomera geomtrica
del tipo cis-trans, es una tipo de isomera que se presenta cuando hay una doble ligadura y hay dos
grupos diferentes unidos a cada uno de los carbonos del doble enlace. La Figura 13.1 muestra dos
cidos grasos.

218
LPIDOS

Figura 13.1
El cido graso superior presenta isomera del tipo cis. Vemos que los dos enlaces que se dirigen a los
carbonos que estn ligados al doble enlace, se dirigen hacia el mismo lado de un plano delimitado por
el doble enlace. En cambio en la figura inferior, el cido graso tiene isomera trans. En este caso los
enlaces desde los carbonos del doble enlace se dirigen hacia semiplanos distintos. (Para ver un vdeo
sobre el tema haga click aqu)

13.2.3. Acilgliceroles

Estos lpidos constan de una molcula de glicerol en la que se esterifican (unin por enlace ster)
cidos grasos. Su funcin es reserva energtica.
Monoacilgliceroles: Tiene un cido graso, que puede estar esterificado en alguno de los carbonos
nmero 1 del glicerol (1-monoacilglicerol) o en el carbono secundario del glicerol (2-monoacilglicerol)
Diacilglicerol: tienen dos cidos grasos esterificados. En el caso que los dos cidos grasos se
encuentren en los carbono 1 y 2, se dice que es un 1,2-diacilglicerol (figura 13.7). Cuando los dos
cidos grasos se encuentran en el carbono 1 y 3 se llama 1,3-diacilglicerol.

Figura 13.7

Triglicridos o triacilgliceridos: en estos compuestos los tres oxhidrilos del glicerol estn esterificados
con cidos grasos (figura 13.8). Se conocen como grasas neutras y son los constituyentes de la grasa
animal, los aceites comestibles y la margarina.

219
LPIDOS

Figura 13.8

Nomenclatura: por ejemplo si un triacilglicerol tiene esterificado en posicin 1 y 2 dos cidos


estericos y en la posicin 3, un cido olico se llamar: 1,2-diestaril-3-oleilglicrido.

13.2.4. Fosfoglicridos

Estos lpidos tiene en su estructura glicerol, cidos grasos y fosfato. Pueden tener otras estructuras
unidas al fosfato. Estos compuestos al tener fosfato en su molcula tienen carga negativa lo que hace
que una parte de la molcula sea hidroflica y la correspondiente a los cidos graso es hidrofbica. Por
lo tanto estas molculas son anfipticas.
Su funcin principal es constituir las estructuras de la bicapa lipdica de las membranas biolgicas.
Existen diferentes tipos.

1- cido fosfatdico: contiene glicerol, con dos cidos grasos esterificados en carbonos 1 y 2, en el
carbono 3 tiene esterificado un fosfato (figura 13.9).

Figura 13.9

2- Lecitina: tiene la misma estructura que el cido fosfatdico con la diferencia que en el fosfato tiene

220
LPIDOS

unido una base nitrogenada conocida como colina (figura 13.10). Se conoce tambin con el nombre de
fosfatidilcolina.

Figura 13.10

3- Cefalinas: es un cido fosfatdico con un etanolamina unida al fosfato (figura 13.11). Sinnimo
fosfatidiletanolamina.

Figura 13.11

4- Fosfatidilinositol: es un cido fosfatdico que tiene unido al fosfato una molcula conocida como
inositol (figura 13.12).

Figura 13.12

221
LPIDOS

5- Cardiolipina: son dos cido fosfatdicos ligados por una molcula de glicerol (figura 13.13).

Figura 13.13

13.2.5. Esfingolpidos

Son lpidos compuestos por una molcula de esfingol o esfingosina (un alcohol con un grupo amino y
una cadena carbonada). Son lpidos cuya funcin es constituir membranas. Dentro de esta familia se
encuentran:

1- Ceramidas: tiene un esfingol con un cidos graso unido al grupo amino por una unin amida (figura
13.14).

Figura 13.14

2- Esfingomielinas: es una ceramida con un fosfato esterificado en el oxhidrilo del esfingol. Unido al
fosfato se puede encontrar una molcula de colina o etanolamina (figura 13.15).

222
LPIDOS

Figura 13.15

3- Cerebrsidos: es una ceramida con un monosacrido unido al oxhidrilo del esfingol (figura 13.16).

Figura 13.16

4- Ganglisidos: son similares a los cerebrsidos con la diferencia que en lugar de un monosacridos
tiene un oligosacrido.

13.2.6. Esteroides

Son lpidos que se caracterizan por poseer un ciclopentanoperhidrofenantreno.


Este ciclo tiene una numeracin especial de sus carbonos (figura 13.17).

223
LPIDOS

Figura 13.17
De acuerdo al grupo sustituyente del carbono 17 los esteroides pueden ser:
1- Esteroles: tiene una cadena carbonada ramificada, como por ejemplo el colesterol (figura 13.18).

Figura 13.18

2- cidos biliares: tiene una cadena carbonada con un carboxilo.


3- Hormonas sexuales: estrogenos y andrgenos tiene en oxhidrilo o cetona en el carbono 17. Ejemplo
de estrogenos: estradiol, ejemplo de andrgenos: testosterona.
4- Hormonas corticoadrenales: tienen un grupo cetona y oxhidrilo en el carbono 17. Ejemplo:
aldosterona, progesterona.
Prostaglandinas: derivan del cido araquidnico por ciclacin entre carbonos 8 y 12 (figura 13.19).
Tienen un grupo carboxilo y dos cadenas carbonadas. Su funcin es regular la funcin celular.
Pertenecen a una familia conocida como eicosanoides (20 carbonos) entre los que se encuentran
adems los tromboxanos, leucotrinenos y prostaciclinas

Figura 13.19

224
LPIDOS

13.3. Metabolismo de lpidos

Los lpidos son parte importante de nuestra dieta. Los triacilgliceroles constituyen los aceites y las
grasas ms comunes en nuestra dieta. Los triglicridos no sufren degradacin en boca y estmago en
forma apreciable. Sin embargo a nivel intestinal se produce su degradacin, reaccin que es catalizada
principalmente por la enzima lipasa de origen pancretico, que hidroliza los enlaces ster entre los
cidos grasos y los oxhidrilos de las posiciones 1 y 3 del glicerol. El enlace de la posicin 2 debe ser
primero trasladado a las posiciones 1 por una isomerasa para luego ser hidrolizado. Como producto
final de la hidrlisis se obtiene glicerol y cidos grasos que son absorbidos e nivel de la mucosa
intestinal (figura 13.20).

D IE T A BOCA H E P A T O C IT O

tr ia c ilg lic e r o le s g l c id o s C O 2 , a g u a y e n e r g a

A c e til C o A c id o g r a s o tr ig lic r id o s VLDL


ESTO M AG O
tr ia c ilg lic e r o le s p ir u v a to

IN T E S T IN O g l c id o s T E J ID O A D IP O S O

g l c id o s
c id o g r a s o TAG
PANCREAS
tr ia c ilg lic e r o le s
g lu c o s a
c id o s b ilia r e s
lip a sa E EN NT TE ER RO OC CI TI TO O
M U S C U L O E S Q U E L E T IC O
c id o g r a s o
m o n o a c ilg lic e r o l f r u c t o gs la c i d o s g l c id o s
c id o g r a s o g a la c to s a
C O 2 , a g u a y e n e r g a
d ia c ilg lic e r o le s
c id o g r a s o
g lic e r o l c id o g r a s o
g lu c o s a
g lic e r o l tr ig lic r id o s c id o g r a s o
tr ia c ilg lic e r o le s Q U IL O M IC R O N E S

SANGRE

Figura 13.20 metabolismo de los lpidos

En el proceso de hidrlisis participan los cidos biliares de origen heptico, que son aportados a la luz
del intestino con la bilis. Estos compuesto esteroideos anfipticos participan en el proceso de digestin
favoreciendo la emulsificacin de los triglicridos, de esta manera la accin de la lipasa es ms
eficiente. Para ver un vdeo sobre digestin y distribucin de lpidos haga click aqu.
Los cidos grasos y el glicerol en la clula de la mucosa intestinal resintetizan triglicridos que son
transportados en sangre por los quilomicrones (lipoprotenas) al tejido adiposo donde son acumulados
como sustancias de reserva.

225
LPIDOS

Los glcidos de la dieta, luego del proceso de digestin en tracto digestivo, llegan al hgado por va
sangunea donde pueden ser fuente de energa o ser transformados en cidos grasos, con los cuales se
forman triglicridos (endgenos). Estos triglicridos son transportados a tejido adiposo a travs de las
lipoprotenas de muy baja densidad o VLDL.
Los triglicridos depositados en tejido adiposo sern hidrolizados, generando cidos grasos cuando las
necesidades energticas lo requieran. Estos cidos grasos sern transportados en sangre por la albmina
hasta los tejidos donde son oxidados hasta dixido de carbono, proporcionando energa (figura 13.20).
Para ver un vdeo sobre metabolismo de lpidos haga click aqu.

13.3.1. Degradacin y sntesis intracelular de acilgliceroles

Los triacilgliceroles se degradan por accin de la lipasa sensible a hormonas (enzima intracelular: no
confundir con lipasa pancretica) que los transforma en cidos grasos y glicerol. Los cidos grasos
luego sern activados por la enzima tiokinasa a acil-CoA y metabolizados en la -oxidacin. El
glicerol puede ser utilizado nuevamente para la sntesis de triacilgliceroles al ser transformado en
glicerol fosfato. Un destino posible del glicerol fosfato es formar fosfato de dihidroxiacetona y
participar as del metabolismo de los glcidos (figura 13.21).
La sntesis de triglicridos tiene lugar a partir del glicerol-P o de la dihidroxiacetonafosfato que forman
monoacilglicerol-P por adicin de un acil-CoA. La adicin de un segundo cido graso produce
diacilglicerol-P ambos pasos catalizados por la enzima aciltransferasa que utiliza acil-CoA como dador
de grupos acilos. Luego se elimina el fosfato dando diacilglicerol y finalmente se le agrega otro cido
graso para dar triglicrido. Este proceso como se ha visto ocurre en enterocito, hepatocito y adipocito
(figura 13.21).

Figura 13.21

226
LPIDOS

13.3.2. -oxidacin

Es una ruta metablica por la cual las clulas degradan cidos grasos. Esta ruta metablica se realiza en
el interior de la mitocondria. El sustrato inicial es el acil-CoA que se origina en el exterior de la
mitocondria por accin de la enzima tiokinasa. En esta reaccin se utiliza ATP que se hidroliza hasta
AMP, gastando el equivalente a dos ATP (figura 13.21). El acil-CoA para ingresar a la mitocondria
requiere de la presencia de carnitina que permite el paso a travs de la membrana interna mitocondrial,
dado que todo compuesto ligado a CoA es impermeable a esta membrana. Una vez el acil-CoA en el
interior de la mitocondria, ste sufre una oxidacin FAD dependiente catalizada por la enzima acil-
CoA deshidrogenasa, formndose como producto enoil-CoA (un cido graso insaturado unido a la
CoA). El enoil-CoA, luego es hidratado por la enzima enoil-CoA hidratasa o crotonasa para dar OH-
acil-CoA que es oxidado a cetoacil-CoA por accin de una deshidrogenasa NAD + dependiente, la
enzima OH-acil-CoA deshidrogensa. Finalmente el cetoacil-CoA es escindido en acetil-CoA
(compuesto de 2 carbonos, que ser oxidado en el ciclo de Krebs hasta dixido de carbono) y un acil-
CoA de dos carbonos menos que el que inici la secuencia. Este nuevo acil-CoA reiniciar el ciclo de
degradacin en la -oxidacin.

Bioenergtica de la -oxidacin
Cada ciclo de reacciones de la -oxidacin produce un NADH y un FADH2 . Cada NADH produce a
travs de fosforilacin oxidativa 3 ATP mientras que el FADH 2 produce por el mismo proceso 2 ATP,
en total 5 ATP por ciclo de la -oxidacin .
Teniendo en cuenta estos datos, por ejemplo un cido graso de 16 carbonos saturados rinde 129 ATP. Si
el cido graso tiene 16 carbonos son necesario 7 ciclos de reacciones de la -oxidacin, como en cada
ciclo se forman 5 ATP, tendremos un total de 35 ATP. Adems a partir de los 16 carbonos se forman 8
acetil-CoA que forman 12 ATP a nivel de ciclo de Krebs, tendremos por este lado un total de 96 ATP.
Contanto los ATP de -oxidacin y ciclo de Krebs: 131 ATP. A este nmero se deben restar 2 ATP que
son gastados en el proceso de activacin del cido graso por la tiokinasa. En suma a partir de un cido
palmtico se obtienen 129 ATP.

13.3.3. Sntesis de cidos grasos

La sntesis de cidos grasos ocurre en el citosol de las clulas, sin embargo el sustrato es acetil-CoA
que se encuentra en la matriz mitocondrial.. El acetil-CoA es impermeable a la membrana
mitocondrial. Para salir forma citrato por condensacin con oxalacetato, reaccin catalizada por la
enzima citrato sintetasa (Ciclo de Krebs). El citrato permeable a la membrana mencionada, luego es
escindido en el citosol para dar acetil-CoA y oxalacetato, utilizando un mol de ATP y la enzima citrato
liasa. A partir del acetil-CoA se forma malonil-CoA, utilizando ATP y CO 2, esta reaccin es catalizada
por la enzima acetil-CoA carboxilasa, enzima que requiere a la biotina (vitamina del complejo B) como
grupo prosttico.
La sntesis de cidos grasos es llevada a cabo por la enzima cido graso sintetasa (figura 13.21). El
proceso se inicia con un acetilo y un malonilo. La cadena en crecimiento se halla unida a un compuesto
de caractersticas semejantes a la CoA, el PTA (protena transportadora de acilos, dependiente de cido
pantotnico). Es un proceso cclico similar a la -oxidacin, pero ocurre en sentido contrario,
adicionando 2 carbonos por cada ciclo, razn por la cual los cidos grasos son de nmero par de

227
LPIDOS

tomos de carbono. En el primer ciclo a un acetilo se le adicionan 2 carbonos a partir del malonilo,
formando cetoacil-PTA, reaccin catalizada por la enzima condensante. El cetoacil-PTA luego es
reducido a OH-acil-PTA, utilizando NADPH, reaccin catalizada por la enzima cetoacil-PTA
reductasa. El OH-acil-PTA formado, es deshidratado dando enoil-PTA que es reducido por la enoil-
PTAreductasa dependiente del aporte de NADPH. En este ltimo proceso se forma acil-PTA de dos
carbonos ms que el inicial. Este acil-PTA reiniciar el proceso cclico, creciendo de a dos carbonos
por ciclo de reacciones. Cuando el cido graso llega a 16 carbonos se libera formando el cido graso
libre que ser luego activado a acil-CoA para ser utilizado en la sntesis de triacilgliceroles.
Si la necesidad de la clula es de cidos grasos de cadena mas larga que 16 carbonos o que contengan
insaturaciones, la clula dispone de mecanismos enzimticos de elongacin e insaturacin de la
cadena. La elongacin se lleva a cabo en el citosol por accin de un conjunto de enzimas similares a las
descriptas para la sntesis de cido palmtico (require malonil-CoA y NADPH). Tambin puede un
cido graso elongarse en la matriz mitocondrial por accin de enzimas de la -oxidacin pero en
sentido contrario utilizando acetil-CoA y NADPH.

13.3.4. Metabolismo de los cuerpos cetnicos

Cuando el aporte de acetil-CoA proveniente de la -oxidacin es excesivo, superando la capacidad de


oxidacin en el ciclo de Krebs, el acetato activo es derivado hacia la formacin de compuestos
conocidos como cuerpos cetnicos (figura 13.22). Las condiciones metablicas para este proceso se
dan en el hgado en condiciones como el ayuno o la diabetes, situaciones en que est aumentada la
gluconeognesis, que depleta los niveles de oxalacetato. Dado que este ltimo compuesto es
indispensable para la formacin de citrato, se acumula acetil-CoA. Los cuerpos cetnicos son el -OH-
butirato, acetona y acetoacetato. En hgado a partir de dos molculas de acetil-CoA se forma
acetoacetil-CoA. Este compuesto por dos reacciones distintas puede dar acetoacetato: perdiendo la
CoA (catalizada por la enzima deacilasa) o transfomndose en -OH-metilglutaril-CoA (HMGCoA)
utilizando las enzimas HMGCoA sintetasa y HMGCoA liasa. Luego el acetoacetato puede ser
reducido por la enzima -OH-butirato deshidrogenasa a -OH-butirato o descarboxilado a acetona.
Estos cuerpos cetnicos no pueden ser utilizados por el hgado y son enviados al plasma. Tejidos como
el muscular los utilizan. El -OH-butirato es oxidado a acetoacetato el que sale a sangre y es captado
por tejidos como el muscular. En msculo el acetoacetato es activando por accin de la enzima
tioforasa que transformalo en acetoacetil-CoA. Este ltimo por accin de la tiolasa da acetil-CoA que
es oxidado en este tejido hasta CO2.
En condiciones normales existe produccin de cuerpos cetnicos que permanecen en niveles bajos en
sangre y orina. En condiciones como el ayuno o la diabetes pueden aumentar las concentraciones en
estos fluidos como consecuencia que la produccin heptica supera el consumo tisular. En este casos se
habla de una cetosis, con aumenta de la cetonemia (aumento de cuerpos cetnicos en sangre) y
cetonuria positiva (presencia de cuerpos cetnicos en orina)

13.3.5. Metabolismo del colesterol

El colesterol se sintetiza a partir del acetil-CoA (figura 13.22). El paso clave de su sntesis es el paso de
-hidroximetilglutaril-CoA (HMGCoA) a cido mevalnico, catalizado por la enzima HMGCoA
reductasa. Esta enzima es regulada en forma negativa por los niveles de colesterol, es decir que su
actividad decrece cuando los niveles celulares de colesterol son elevado, produciendo freno en su

228
LPIDOS

sntesis. Esta enzima es el foco de accin de drogas conocidad como estatinas, utilizadas en el control
de la colesterolemia. Para ver un video sobre sntesis de colesterol haga click aqu.
El proceso de sntesis de colesterol es extremadamente complejo, involucra reacciones en las que se
van condensando carbonos hasta formar un terpeno ramificado: el escualeno. Este ltimo se cicla
formando el lanosterol, que es el primer esteroide (posee ciclopentanoperhidrofenantreno). Luego
procesos de reduccin y descarboxilacin concluyen formando la molcula de colesterol.

Figura 13.22

Lipoprotenas
Las lipoprotenas son protenas conjugadas que transportan lpidos en sangre. Sus caractersticas estn
dadas en el siguiente cuadro. Para ver un vdeo sobre lipoprotenas haga click aqu.

lipoproteina origen lipido transportado


quilomicrones intestino Triglicridos exgenos
VLDL hgado Triglicridos endgenos
IDL VLDL Fosfolpidos y colesterol
LDL IDL Fosfolpidos y colesterol
HDL higado fosfolpidos y colesterol

229
LPIDOS

y su complejo metabolismo se detalla en el la figura 13.23.


Los triacilgliceroles (TAG) absorbidos en intestino son transportados por los quilomicrones, partcula
formada por lpidos y por dos apoprotenas: ApoA y ApoB48. Esta lipoprotena recibe apoprotenas de
las HDL (lipoprotenas de muy alta densidad). La ms importante es la Apo C, que actuar como un
activador de la LPL (lipoproten lipasa) del endotelio capilar. Esta enzima hidroliza los triacilgliceroles,
determinando que los cidos graso (AG) pasen al interior del tejido adiposo donde pueden oxidarse
hasta CO2 o formar TAG nuevamente. El quilomicrn sin TAG, llamado quilomicrn remanente ser
eliminado del plasma por el hgado que tiene receptores para ApoB48, apoprotena presente en la
partcula lipoproteica.
Por otro lado el hgado sintetiza TAG fundamentalmente a partir de glcidos. Estos TAG endgenos,
junto con el colesterol (C) , fosfolpidos (FL) y ApoB100 forman la lipoprotena de muy baja densidad
(VLDL) que recibe ApoC y ApoE . La apoC acta como activador de LPL, enzima que disminuye el
contenido de TAG de la VLDL, aumentando as su densidad. Este cambio conduce a que la VLDL se
transforme en una lipoprotena de densidad intermedia (IDL). La IDL puede ser retirada de circulacin
por el hgado al interactuar con el receptor para ApoE. Por otro lado si la IDL pierde la ApoE no podr
ser reconocida por hgado, la partcula se transforma en lipoprotena de baja densidad o LDL y ser
captada por tejidos perifricos que contienen receptores para apoB100. Dado que estas protenas
llevan colesterol hacia los tejidos, y cuando aumenta su valor produce depsito de colesterol en arterias
produciendo arterioesclerosis, al colesterol ligado a las LDL se lo llama "colesterol malo".

Figura 13.23
El hgado produce las HDL que en su origen contiene fosfolpidos formando una bicapa lipdica.
Adems contiene ApoA, C, E, D y una enzima, la LCAT: lecitin colesterol aciltransferasa. Esta enzima
cataliza la transferencia de un cido graso de la posicin 2 de la lecitina al oxhidrilo 3 del colesterol,

230
LPIDOS

formando lisolecitina y colesterol esterificado (CE). Al esterificarse el colesterol se hace mas


hidrofbico por lo que ubica en el centro de la molcula de HDL, de esta manera la HDL produce un
efecto de "limpieza" de colesterol de los tejidos. El CE es llevado al hgado donde es transformado en
cidos biliares y finalmente es eliminado por va biliar. Por esta razn el colesterol ligado a las HDL se
lo llama "colesterol bueno". Por su lado el colesterol ligado a las LDL
Alteraciones del metabolismo de las lipoprotenas: Cuando falta un receptor de alguna apoprotena o
bien la apoprotena, se producir acumulacin de lpidos en sangre produciendo patologas conocido
como dislipemias. Por ejemplo si existe un dficit de ApoC, no sern hidrolizados por la LPL los TAG,
determinando un aumento en sangre de los quilomicrones y VLDL, lo que determinar depsitos
irregulares de lpidos en lugares no deseados.
La placa de ateroma es tambin una consecuencia de alteraciones en el metabolismo normal de las
lipoproteinas. Para ver un video sobre el tema haga click aqu

13.4. Membranas biolgicas

Las membranas biolgicas son estructuras formadas por lpidos, protenas e hidratos de carbono. La
funcin de la membranas biolgicas es mantener separados dos compartimientos permitiendo un
intercambio selectivo de molculas entre un medio y el otro. Consulte el siguiente vdeo sobre el
tema: https://youtu.be/TAQHKX93BTw.
Las membranas estn mayoritariamente compuestas por fosfolpidos y colesterol, dentro de los
lpidos y contienen protenas de diversos tipos y funciones. Las protenas pueden ser extrnsecas o
intrnsecas. Las primeras se hallan unidas lxamente a las estructura lipdica mientras que las
intrnsecas pueden atravesar de un lado al otro la membrana. Las funciones de las protenas son
diversas: receptores, molculas de reconocimiento y adhesin, enzimas, protenas involucradas en la
transduccin de seales, estructurales, etc.
En la constitucin de la membrana participan lpidos de diferente tipo predominando los
fosfolpidos que son lpidos anfipticos cuya caracterstica es la presencia de cidos grasos
insaturados. Estos ltimos le confieren a la estructura de la membrana un comportamiento fluido,
permitiendo la movilidad de las protenas y la deformacin de la estructura. El contenido de lpidos
y los tipos pueden variar mucho de una membrana a otra.
Debemos entender a la membrana no solo como un medio de separacin, sino tambin como un
sitio de realizacin de procesos bioqumicos de extrema importancia para la vida de la clula. Entre
estos procesos mencionamos a modo de ejemplo: cadena respiratoria, fosforilacin oxidativa,
sntesis de protenas, transportes activos y pasivos de molculas, conduccin del impulso nervioso,
entre otros.

13.4.1. Mecanismos de transporte a travs de membranas

Los solutos y el agua pueden atravesar la membrana de manera selectiva y modificable por la accin de
hormonas o mediadores intracelulares. Para consultar un vdeo sobre el tema haga click en el siguiente
link: https://youtu.be/TAQHKX93BTw?t=815.
El transporte a travs de membranas se puede realizar desde el punto de vista energtico de dos
maneras:

231
LPIDOS

1- pasivo: no requiere energa y es a favor de gradiente electroqumico. Los transportes pasivos


conducen a la sustancia a alcanzar el equilibrio. Dentro de los transportes pasivos hallamos dos
mecanismos:
1.a- difusin simple: la sustancia atraviesa sin necesidad de ninguna estructura y lo hace a travs de la
bicapa lipdica. Utilizan difusin simple molculas pequeas y en general de estructura hidrofbica. La
urea, el oxgeno y el dixido de carbono son buenos ejemplos de estos mecanismos.
1.b- difusin facilitada: la sustancia atraviesa le membrana utilizando estructuras protecas que se
llaman habitualmente canales. Son ejemplos de este mecanismo los canales de sodio, potasio y calcio.
2- transporte activo: se producen utilizando energa y se realizan en contra de un gradiente
electroqumico. El funcionamiento de estos transporte tiende a llevar a la sustancia a un estado
estacionario. Segn el mecanismo se pueden dividir en diferentes tipos.
2.a- bombas: transportan sustancias utilizando energa producida por la hidrlisis del ATP. Ejemplo de
este mecanismo es la bomba sodio/potasio.
2.b- cotransporte: la sustancia que se transporta de forma activa utiliza energa liberada por otra
sustancia que atraviesa la membrana en el mismo sentido pero a favor de un gradiente electroqumico.
Ejemplo de este mecanismo es el cotransporte sodio/glucosa en diversos epitelidos del organismo
como el intestinal y renal.
2.c- contratansporte: la sustancia que se transporta de forma activa utiliza la energa liberada por otra
sustancia que atraviesa en forma pasiva pero en sentido contrario liberando energa. Es ejemplo de este
mecanismo el contratransporte sodio/protn.
Para ampliar conceptos sobre transporte a travs de membrana consulte el siguiente link:
http://hdl.handle.net/2133/7329
Se suele utilizar el nombre transporte mediado para aquellos mecanismos de transporte que requieren
alguna estructura adems de la bicapa lipdica. Asi, la difusin facilitada y los mecanismos activos se
clasifican como mediados. Los transportes mediados pueden ser pasivos o activos y presentan solo en
comn que requieren una o ms estructura de membrana de la familia de las protenas. Son ejemplos
de estos mecanismos el pasaje de calcio, de magnesio, la cadena respiratoria, entre otros. Para ampliar
el tema vea el siguiente vdeo: http://youtu.be/oMxPgNyK6_8.
Los sistemas de lanzaderas de NADH citoslico al interior de la mitocondria son mecanismos de
transporte que involucran numerosas enzimas y transportadores. Estos sistemas permiten a las
molculas de NADH generadas en los procesos oxidativos que ocurren en el citosol, ingresar a la
mitocondria para poder ser oxidados en la cadena respiratoria con el consumo de oxgeno. Existen dos
lanzaderas: la lanzadera del glicerofosfato que cada molcula de NADH del citosol es transportada y
transformada en una molcula de FADH, y la lanzadera del malato que cada molcula de NADH,
ingresa como tal. Para ver un vdeo sobre el tema haga click en el siguiente link:
http://youtu.be/89p9MMUXZ08.

232
LPIDOS

13.5. Prctica

1- En la estructura que se da a continuacin marque:

a- un fosfato
b- Un grupo que pueda tener carga positiva.
c- Un glicerol.
d- Una cadena carbonada alifatica.
e- Un ster.
f- Un ster fosfrico.
g- Un grupo con carga negativa.
h- La parte ms apolar de la molcula.
i- Un enlace C-C saturado.
j- Un carboxilo.
k- Una amina.
l- La parte ms polar de la molcula.
m- Dibuje la molcula utilizando un modelo de bloques.
n- Dibuje la molcula taquigrficamente.
o- Dibuje la molcula lo ms esquemticamente posible.
p- En que lugar de la clula se encuentra esta molcula de acuerdo a su estructura?
q- Clasifique a esta molcula como:
Fosfoglicrido.
Esfingolpido.
Glicerolpido
Prostaglandina
Cerebrsido
cido graso esencial
cido graso

233
LPIDOS

Fosfolpido
Lpido anfiptico
Esteroide.
Esfingomielina

2). El colesterol:
a- Es un esteroide.
b- Tiene en el carbono 17 una cadena carbonada ramificada
c- Es un acilglicerol
d- a + b.
e- Ninguna de las respuestas es correcta.

3) a- Identificar que sustancia es la estructura siguiente

.
b- Marcar con un crculo una cadena carbonada ramificada.
c- Marcar con una flecha un grupo que pueda formar puente de hidrgeno.
d- Marcar con un circulo un doble enlace.

4)a- Indicar que sustancia es la siguiente estructura.

b- Marcar con un crculo un enlace ster fosfrico.


c- Marcar con una flecha un grupo que pueda tener carga negativa.

234
LPIDOS

d- Indicar en que sitio celular se la puede encontrar.

5).
a- Colocar el nombre de la siguiente estructura.

b- Indicar encerrando con un crculo la zona de la molcula con caractersticas hidroflicas.


c- Con una flecha marcar un enlace ster.
d- Indicar en que lugar de la clula se encuentran este tipo de molculas.

6). En la siguiente estructura

a- Marcar con una flecha un enlace ster


b- Marcar con un crculo la porcin hidrofbica
c- La sustancia de la figura es: ........

7). Los cidos biliares:


a- Son esteroides.
b- Tiene en el carbono 17 una cadena carbonada ramificada.
c- Son acilgliceroles.
d- a + b.
e- Ninguna de las respuestas es correcta.

235
LPIDOS

8).
a- Identificar si la siguiente estructura es hidrofbica, hidroflica o anfiptica.

b- Indicar la zona hidrofbica de la molcula.


c- Marcar un ster fosfrico.
d- Nombrar un sitio celular donde se encuentren estas molculas.

9)a- Indicar a partir de que compuesto se origina la siguiente estructura.

b- Dar el nombre de la estructura.


c- Marcar con un circulo el grupo que dar a la molcula carga negativa.
d- Marcar un grupo cetona.
e- Marcar un doble enlace cis y un doble enlace trans.

10). El colesterol:
a- Tiene un ciclo pentanoperhidrofenantreno.
b- Tiene en el carbono 17 una grupo carboxilo.
c- Es un acilglicerol.
d- a + b.
e- Ninguna de las respuestas es correcta.

11) Completar con HDL, LPL, IDL, COLESTEROL, VLDL, APO E, APO C, APO B100
TRIGLICERIDOS, LDL, APOB48 (sobran algunas). Los quilomicrones transportan ...........................

236
LPIDOS

desde intestino a tejidos. La APO C estimula la enzima .........................., que se encuentra en los
endotelios de los capilares, produciendo la degradacin de los triglicridos. Las VLDL llevan
triglicridos intrnsecos y poseen en su estructura ........................, mientras que las ..................... llevan
colesterol al hgado que las reconoce ya que estas lipoprotenas poseen .............................

12). Ordenar los pasos de la sntesis de cidos grasos, colocando delante de cada proceso el nmero
que le corresponde en la secuencia de reacciones:
a- ....... Formacin de un compuesto de 2 carbonos mas que el anterior.
b- ....... Salida del acetil CoA de la mitocondria.
c-....... Formacin de malonil CoA .
d-....... Reduccin NADPH dependiente.
e- ....... Reduccin catalizada por la enzima enoil-PTA reductasa.
f- ....... Deshidratacin.

13). Completar los espacios en blanco utilizando las palabras que se dan a continuacin
colesterol; acetil-CoA; NADPH; acetoacetil-CoA; reguladora; escualeno
La sntesis del colesterol ocurre a partir de .................. En el primer paso dos moleculas de acetil-CoA
se unen formando .............................. , luego ste se transforma en HMGCoA. El HMGCoA se
transforma en mevalonato, reaccin que requiere ........................ . Esta reaccin es catalizada por la
enzima HMGCoA reductasa que es la enzima ............................... del proceso. Esta enzima es inhibida
cuando las concentraciones de ...................... son elevadas. El mevalonato sigue una larga serie de
reacciones hasta llegar a colesterol. Uno de los intermediarios de esta secuencia de reacciones es
el ..........................

14) Cuando un paciente tenga dficit de la lipoprotein lipasa (LPL) los niveles de triglicridos
circulantes en plasma despus de una comida sern:
a- Altos
b- Bajos
c- Normales
d- No tendr triglicridos en plasma.

15). Marcar la opcin correcta: La oxidacin de cidos grasos:


a- Requiere CoA y NADH.
b- Requiere CoA y NADPH.
c- Ocurre en la citosol y requiere NADPH.
d- Es un proceso que adiciona 2 carbonos por ciclo.

237
LPIDOS

16) Las lipoprotenas circulan en .................................. y su papel es transportar lpidos. Como stos
son insolubles en agua se unen a ................................ lo que aumenta su solubilidad en agua.
Los ......................... transportan triglicridos desde el intestino a los tejidos y contienen entre otras la
apoprotena ......................... que activa la lipoproten lipasa. Las VLDL transportan lpidos desde
el ............................. a los tejidos, el producto residual de stas es reconocido por el hgado por poseer
apoprotena ....... La porcin no reconocida por el hgado se transforma en LDL que es captada por lo
tejidos que tiene receptor para apoprotena ..............................
Las .................................. son lipoprotenas que intercambian apoprotenas con las lipoprotenas
nombradas anteriormente. Un dficit de receptores de la apoprotena ....................... determinar un
aumento LDL en plasma y por lo tanto de colesterol

17) Completar con la o las palabras faltantes. La sntesis de ............................ y cuerpos cetnicos
comienza a partir del acetil-CoA Dos molculas de este ltimo se unen para dar ......................... A
partir de ste se pueden formar los cuerpos cetnicos y el colesterol. Para la sntesis de colesterol se
debe formar ................................. proceso catalizado por la enzima HMGCoA reductasa. Esta enzima
cataliza la etapa reguladora de la sntesis del colesterol, el que ejerce una
retroalimentacin ................................... El colesterol es transportado en plasma fundamentalmente por
las LDL hacia los ...................... donde son reconocidas por los receptores de APO ........................ y por
las ............................. de los tejidos al hgado, donde son reconocidas por los receptores de
APO ............................. El colesterol unido a las primeras se lo llama colesterol malo y al transportada
por las lipoprotenas de alta densidad colesterol bueno.

18) Completar con la o las palabras faltantes: La degradacin de los triglicridos da como producto
cidos grasos y glicerol. Los cidos grasos se degradan en un proceso llamado -oxidacin. Este
proceso comienza con la activacin extramitocondrial en la que se forma ............................., luego este
compuesto reacciona con la .................................. para poder entrar a la mitocondria. Dentro de la
mitocondria hay dos reacciones de oxidacin, una catalizada por la enzima..................................... que
produce FADH2 y otra catalizada por la enzima OH-acil-CoA deshidrogenasa que
produce ............................. Esta ltima reaccin se ver afectada por falta de la
vitamina ............................

19) Completar con las siguientes palabras: HDL, IDL, COLESTEROL, VLDL, APO E, APO C,
QUILOMICRONES, LPL (sobran algunas). Los ................................. transportan triglicridos desde
intestino a tejidos, la ........................ estimula la LPL, produciendo la degradacin de los triglicridos.
Las ........................ llevan triglicridos intrnsecos, mientras que las ......................... llevan colesterol al
hgado que es reconocida por poseer ............

20) a) Indicar el nombre de la enzima que cataliza el paso de acetoacetato a -OH-butirato:


b) Indicar como sern los niveles de acetoacetato cuando esta enzima se encuentre inhibida.
c) A qu va metabolica pertenece esta enzima?
d) En qu condiciones se activa esta va metablica?

238
LPIDOS

13.5.1. Respuestas

1- q- Fosfoglicrido, glicerolpido, fosfolpido, lpido anfptico,


2- d
3- a- Esteroide, colesterol
4- a- cido fosfatdico, d- constituyente de membranas
5- a- Fosfatidilcolina, d- membranas
6- c- Triacilglicerol
7- a
8- a- Anfiptica, d- Membranas
9- a- cido araquidnico, b- prostaglandina
10- a
11- Triglicridos, LPL, APO B100, HDL, APO E
12- b, c, a, d, f, e
13- acetil-CoA, acetoacetil-CoA, NADPH, reguladora, colesterol, escualeno
14- a
15- a
16- sangre, apoproteinas, quilomicrones, C, hgado, E, B100, HDL, B100
17- colesterol, acetoacetilCoA, cido mevalnico, negativa, tejidos, B100, HDL, E,
18- acil-CoA, carnitina, acil-CoA deshidrogenasa, NADH, B8 o cido nicotnico
19- quilomicrones, APO C, VLDL, HDL, Apo E
20- a- -OH-butirato deshidrogenasa, b- aumentados, c- cetognesis, d-ayuno o diabetes

239
AMINOCIDOS Y PROTENAS

14. AMINOCIDOS Y PROTENAS

14.1. Estructura de aminocidos

Los aminocidos son compuestos qumicos que contienen al menos un grupo carboxilo y un grupo
amino. Un conjunto de estos compuesto tienen ambos grupos unidos a un mismo carbono llamado
carbono alfa. A estas estructuras se las conoce como -aminocidos, y son las molculas que por
polimerizacin forman las protenas. Puede obtener informacin sobre estructura de aminocidos en el
siguiente vdeo: https://www.youtube.com/watch?v=7mb-Wp6lZOQ
Los -aminocidos pueden clasificarse segn diferentes criterios. Teniendo en cuenta la posibilidad
que tienen los seres humanos de sintetizarlos o no, se clasifican en esenciales y no esenciales.
Aminacidos esenciales Aminoacidos no esenciales
arginina glutamato
histidina aspartato
lisina glutamina
leucina asparragina
isoleucina prolina
valina glicina
treonina serina
triptofano alanina
fenilalanina tirosina
metionina cistena
Algunos de ellos en ciertas circunstancias pueden no ser esenciales, ya que la pequea produccin que
existe en las clulas puede llegar a ser suficiente.
Segn su cadena lateral se pueden clasificar en:
apolares: valina, isoleucina, leucina, triptofano, prolina, metionina, fenilalanina, glicina, alanina.
polares sin carga: glutamina, asparragina, treonina, serina, cistena, tirosina.
polares con carga positiva tambin llamados bsicos o diaminomonocarboxlicos: lisina, arginina,
histidina.
polares con carga negativa o cidos o monoaminodicarboxlicos: glutamato, aspartato.
Las estructuras de los aminocidos se dan a continuacin

240
AMINOCIDOS Y PROTENAS

Figura 14.1 - alanina

Figura 14.2 - arginina

Figura 14.3 cisteina

Figura 14.4 - asparragina

Figura 14.5 - glicina

241
AMINOCIDOS Y PROTENAS

Figura 14.6 - cido glutmico

Figura 14.7 - cido asprtico

Figura 14.8 - isoleucina

Figura 14.9 - histidina

242
AMINOCIDOS Y PROTENAS

Figura 14.10 - fenilalanina

Figura 14.11 - leucina

Figura 14.12 - glutamina

Figura 14.13 - metionina

Figura 14.15 - lisina

243
AMINOCIDOS Y PROTENAS

Figura 14.16 - prolina

Figura 14.17 - serina

Figura 14.18 - treonina

Figura 14.19 - tirosina

Figura 14.20 - valina

244
AMINOCIDOS Y PROTENAS

ESTRUCTURA DE PROTENAS Y PPTIDOS

14.1.1. Unin peptdica

Cuando dos aminacido se unen a travs de su grupo amino y carboxilo se forma la unin peptdica y
se produce la prdida de una molcula de agua. En esta circunstancia se ha formado un dipptido
(figura 14.21).

Figura 14.21. Formacin de la unin peptidica

Cuando se unen mas de dos aminocidos se forma un oligopptidos (3-10 aminocidos), polipptido
(de 10 a 50 aminocidos) o una protena cuando tiene mas de 50 aminocidos. En los pptidos, siempre
existe un extremo llamado N-terminal (extremo aminoterminal), que es el que tiene el grupo amino
libre y un extremo C-terminal (extremo carboxilo terminal) que es el que tiene el grupo carboxilo libre.

14.1.2. Nomenclatura de los pptidos

Los pptidos se nombran con el nombre de cada aminocido comenzando desde el extremo N-
terminal. En el caso del oligopptido de la figura 14.22 el nombre es : Serin-glicil-cistein-leucin-serin-
lisina.

245
AMINOCIDOS Y PROTENAS

Figura 14.22

14.1.3. Enlaces que pueden establecer los aminocidos

Estas molculas pueden establecer enlaces qumicos de acuerdo a los grupos funcionales que
presentan. Es importante tener presente nuevamente la estructura para poder deducir el tipo de enlance
en el que participar el aminocidos.

Unin peptdica
Es la unin ms importante que dos aminocidos establecen entre s combinando el carboxilo de una
molcula con el amino de la otra, con prdida de una molcula de agua (figura 14.21). Esta unin es
del tipo covalente y como consecuencia es un enlace muy fuerte. Esta reaccin corresponde a una
sustitucin nucleoflica en la que el grupo amino desplaza al oxhidrilo del carboxilo.
Cuando un aminocido se encuentra formando parte de una protena, sus grupos amino y carboxilo del
carbono se hallan involucrados en uniones peptdicas, pero los dems grupos funcionales, presente
en la cadena lateral pueden interactuar qumicamente, formando otro tipo de enlaces.

Enlaces electrostticos
1- Atraccin electrosttica: esta unin se establecer entre aminocidos que tengan una carga positiva
en su cadena lateral con otro aminocido que tenga carga negativa en la misma. Este enlace slo podr
establecerse entre aminocidos bsicos y cidos (figura 14.23).
2- Repulsin electrosttica: es cuando interactan dos grupos de igual carga existiendo un rechazo de
los mismos (figura 14.23).

246
AMINOCIDOS Y PROTENAS

Figura 14.23

Enlace puente de hidrgeno


El puente de hidrgeno se establece entre un hidrgeno unido a un O o N con otro O o N. Por lo tanto
podrn formar puente de hidrgeno a travs de sus cadenas laterales aquellos aminocidos que tengan
en las mismas grupos aminos, carboxilos u oxhidrilos (figura 14.24). Tambin se pueden formar p-
uentes de hidrgeno entre los oxgenos de los grupos carbonilos de la unines peptdicas con los
hidrgenos unidos a los nitrgenos de las mismas.
Este enlace es mas dbil que el peptdico, ya que se trata de una interaccin no covalente.

Figura 14.24

Puente disulfuro
Se establece por oxidacin de dos sulfhidrilos (figura 14.25). Lo forman dos cistenas. Cuando dos
cistenas se unen a travs de un puente disulfuro, ambas pasan a formar una estructura llamada cistina.
Se trata de un enlace covalente y por lo tanto es muy fuerte.

247
AMINOCIDOS Y PROTENAS

Figura 14.25

Interacciones hidrofbicas
Se establecen entre estructuras apolares o hidrofbicas (figura 14.26). Estas interacciones son ms
fuertes cuanto ms grandes son las estructuras que interaccionan. Se debe a la formacin de dipolos
instantneos e inducidos que hacen que la molcula tenga temporariamente cierta asimetra de carga,
permitiendo la atraccin entre estas estructuras. Se conocen tambin como fuerzas de dispersin de
London

Figura 14.26

Otros enlaces
Tambin los aminocidos pueden reaccionar de una manera no tan comn formando steres, a travs
de sus carboxilos con alcoholes y prdida de agua. Este tipo de enlace se presenta en la activacin de
los aminocidos con los RNA de transferencia (figura 14.27).

248
AMINOCIDOS Y PROTENAS

Figura 14.27
Pueden formar ster fosfricos entre un alcohol y un fosfato con prdida de una molcula de agua
(figura 14.28). Este enlace es caracterstico de la fosforilacin de protenas, proceso qumico reversible
que produce la modificacin de la actividad enzimtica y as controla la actividad celular.
La unin amida es un enlace que puede presentarse entre su grupo amina y un grupo carboxilo, como
en la conjugacin de glicina con el cido clico para formar cido glicoclico.

Figura 14.28

14.1.4. Protenas

Estn compuestas por ms de 50 aminocidos unidos por uniones peptdicas. Estas molculas pueden
ser simples cuando slo estn compuestas por aminocidos y conjugadas cuando adems de
aminocidos tienen una estructura no aminoacdica, conocida como grupo prosttico.
Puede obtener informacin sobre protenas en el siguiente vdeo: https://www.youtube.com/watch?
v=7mb-Wp6lZOQ
Las protenas tiene diferentes estructuras:
1- Primaria: hace referencia al orden de los aminocidos. Se conoce tambin como secuencia de

249
AMINOCIDOS Y PROTENAS

aminocidos. Este orden est codificado en el ADN de cada clula.


2- Secundaria: es como se distribuye en el espacio la secuencia. Existen tres ordenamientos posibles:
-hlice, lamina- y enrollamiento al azar.
3- Terciaria: es la distribucin tridimensional de la estructura secundaria, adoptando forma globular o
fibrosa.
4- Cuaternaria: es la unin de diferentes cadenas polipeptdicas para formar una protena compuesta
por varias subunidades.

Desnaturalizacin e hidrlisis
La desnaturalizacin es el proceso por el cual una protena pierde su estructura secundaria, terciaria y
cuaternaria. Este proceso conduce a la prdida de la actividad biolgica. La desnaturalizacin puede
ser producida por cambios extremos de pH, aumento o disminucin de temperatura, agregado de
metales pesados como cromo, plomo, mercurio, presin extrema, radiaciones, etc. Durante la
desnaturalizacin no se altera la estructura primaria.
La hidrlisis consiste en la rotura de las uniones peptdicas por el agua, fenmeno que ocurre
catalizado por la presencia de cidos o bases. En este proceso se pierden las cuatro estructuras de la
protena y por supuesto su funcin o actividad biolgica.

14.2. Metabolismo de aminocidos

La degradacin de los aminocidos es un proceso que comienza con la eliminacin del grupo amino
por la accin de enzimas llamadas transaminasas (figura 14.29). Puede ver el metabolismo de
aminocidos en el siguiente vdeo: http://www.youtube.com/watch?v=LC24HuPySXM

250
AMINOCIDOS Y PROTENAS

Figura 14.29

Estas enzimas tienen como grupo prosttico al fosfato de piridoxal, que se origina a partir de la
piridoxamina o vitamina B6. El grupo amino eliminado del aminocido es captado por el -
cetoglutarato que se transforma en glutamato, simultneamente se obtiene un cetocido. El glutamato
luego actua como sustrato de la enzima glutamato deshidrogenasa, que utiliza NAD + y produce
NADH y NH3. El amonaco producido en la reaccin anterior se combina con CO 2 utilizando energa
aportada por dos molculas de ATP. Como producto de la reaccin se obtiene carbamil fosfato,
reaccin catalizada por la enzima carbamilfosfato sintetasa, de esta manera se evita la toxicidad del
NH3. El carbamil fosfato se une a una molcula de enzima orinitina formando citrulina, reaccin
catalizada por la ornitintranscarbamilasa. La citrulina sale de la mitocondria y se condensa con un
aspartato que aporta un segundo tomo de N. En esta reaccin se gasta un ATP que se hidroliza hasta
AMP (equivalente a 2 ATP). La reaccin es catalizada por la enzima arginosuccinato sintetasa. La
enzima siguiente, arginosuccinato liasa produce arginina y fumarato a partir del arginosuccinato
formado en el paso anterior. El fumarato utilizando enzimas pertenecientes al ciclo de los cidos
tricarboxlicos regenera oxalacetato y luego por transaminacion forma aspartato, que ser utilizado
como sustrato por la enzima arginosuccinato sintetasa. Por otro lado la arginina en la ltima reaccin
del ciclo forma ornitina y urea, reaccin catalizada por la enzima arginasa. La urea es un producto
pequeo, muy soluble en agua que atraviesa fcilmente las membranas. La urea pasa a sangre y ser
depurada del plasma por filtracin a nivel renal.

Energtica del ciclo de la urea: Para sintetizar un mol de urea se utilizan 2 ATP en la reaccin

251
AMINOCIDOS Y PROTENAS

catalizada por la carbamilfosfato sintetasa y 2 ATP en la reaccin catalizada por la enzima


arginosuccinatosintetasa. En la regeneracin del fumarato a aspartato se produce un NADH que
produce 3 ATP en la cadena respiratoria. Por lo tanto por cada mol de urea se gastan 4 ATP. Si se
considera la regeneracin del fumarato el gasto se reduce a un solo mol de ATP, ya que en paso de
malato a oxalacetato se forma una molcula de NADH.

Dficit enzimticos del ciclo de la urea: En general el dficit de cualquier enzima del ciclo de la urea
llevar a la acumulacin de amonaco en el organismo, cuya toxicidad es extrema especialmente para
clulas del sistema nervioso. La toxicidad del amonaco se debe a que se une al -cetoglutarato
formando glutamato, impidiendo el correcto funcionamiento del ciclo de Krebs. De all que su
toxicidad afecte especialmente a las clulas nerviosas que dependen casi exclusivamente del ciclo del
cido ctrico para la provisin de energa.

14.2.1. Otros metabolitos nitrogenados

Son innumerables los compuestos que tienen nitrgeno en su estructura: adrenalina, hemoglobina,
creatina, nucletidos, histamina, serotonina, etc. En orina se encuentran muchos de estos productos que
son desechos de molculas. Como se detall la urea es el producto del catabolismo de los aminocidos.
Como consecuencia la excrecin urinaria de urea aumentar en el caso de ingerirse dietas
hiperproteicas y disminuir con dietas pobres en protenas. Otro producto nitrogenado de la orina es el
cido rico, este compuesto deriva del catabolismo de las bases pricas de los cidos nucleicos. Su
excrecin no es modificada significativamente por la ingesta de protenas. Lo mismo sucede con la
excrecin urinaria de creatinina, metabolito nitrogenado que deriva de la fosfocreatina muscular. La
fosfocreatina es un depsito de energa que aporta sta en procesos de muy corta duracin.

14.3. Digestin y absorcin de protena

14.3.1. Digestin de protenas

Las protenas son uno de los macronutrientes junto con los lpidos y los carbohidratos. Las protenas
no sufren digestin en la boca, pero si en estmago e intestino. En el estmago se produce la
digestin por la accin de enzimas como la pepsina, favorecida su accin por el pH bajo del medio
que produce la desnaturalizacin. La accin de la pepsina genera pptidos de menor tamao que son
degradados en intestino por accin de las proteasas de origen pancretico como la tripsina,
quimiotripsina, carboxipeptidasa, colagenasa, elastasa, etc. Algunas enzimas del epitelio duodenal
como las dipeptidasas conduce a que todas las protenas finalicen al estado de aminocidos libres.
Para ver un vdeo sobre el tema haga click en el siguiente link: http://youtu.be/-mu-FQTLmK0.

14.3.2. Absorcin intestinal y transporte de aminocidos

Puede tener informacin sobre este tema en el vdeo: http://www.youtube.com/watch?


v=ouOgCpqzHUk

252
AMINOCIDOS Y PROTENAS

14.4. Prctica

14.4.1. Estructura de aminocidos y protenas

1). Los aminocidos que forman las protenas:


a- Son aproximadamente 20 distintos.
b- Tienen por lo menos un carboxilo
c- Pueden tener carga negativa
d- Pueden tener carga positiva.
e- Todas son correctas.
f- Todas son incorrectas.
2). Los aminocidos que forman las protenas:
a- Son aproximadamente 200 distintos.
b- Tienen por lo menos un carboxilo
c- Pueden tener carga negativa
d- No pueden tener carga positiva.
e- b + c
f- Todas incorrectas.
3). .... Los aminocidos pueden tener carga positiva o negativa porque pueden tener cadenas
carbonadas en su cadena lateral.
4). .... En las protenas puede haber 20 aminocidos diferentes porque algunos aminocidos pueden
tener carga negativa.
5). Nombrar el grupo funcional que puede dar carga negativa a un aminocido.
6). Nombrar el grupo funcional que puede dar carga positiva a un aminocido.
7). Qu grupos de los aminocidos participan en la unin peptdica?
8). Qu tipo de enlace se puede establecer entre un carboxilo y un amino?
9) Construya un oligopptido con la siguiente estructura primaria:
ISOLEUCIL-GLICIL-CISTEIL-TREONIN-SERIN-CISTEIL-GLUTAMATO
a- Indicar el nmero de residuos de aminocidos.
b- Cuntas uniones peptdicas tiene el oligopptido.
c- Marcar el extremo C-terminal.
d- Marcar el extremo N-terminal.
e- Marcar un residuo de aminocidos que pueda establecer puentes de hidrgeno.
f- Entre qu residuos podra establecer un puente disulfuro intracatenario?
g- Qu residuo puede formar un ster fosfrico (fosforilarse)?

253
AMINOCIDOS Y PROTENAS

h- Entre qu residuos podra establecerse un puente de hidrgeno intracaternario?


i- Indicar los residuos que podran establecer enlaces salinos intra e intercatenarios.
j- Qu productos obtendra al realizar una hidrlisis del oligopptido?
k- Marcar un aminocido con cadena lateral apolar. Qu tipo de fuerzas pueden ligar a esta cadena
con otra similar?
10). a- En la estructura que se da a la derecha marcar un grupo que pueda tener carga positiva.
b- Marcar el grupo que puede reaccionar con un grupo amino para dar una unin peptdica.
c- Qu enlace establecer a travs de su cadena lateral?
d- Identificar si el aminocido es hidroflico o hidrofbico en funcin de su cadena lateral.
e- Indicar un grupo que pueda tener carga negativa.
f- Qu tipo de enlace establecer este aminocido a travs de su grupo amino?
g- Marcar en la estructura de la derecha la zona hidrofbica.
h- Marcar un carbono asimtrico.
11). En la estructura de la derecha:
a- Marcar con un crculo el grupo que pueda tener carga a pH 10.
b- Marcar con una flecha el grupo que participar en un enlace peptdico si este aminocido ocupa el
extremo C- terminal.
c- Qu tipo de enlace establecer este aminocido a travs de su cadena lateral?
12).a- Escribir la estructura del siguiente dipptido: alanin - serina
b- Marcar el extremo N-terminal.
c- Marcar el o los grupos podrn establecer puente de hidrgeno.
13) Las protenas pueden perder su actividad biolgica por:
a- Desnaturalizacin.
b- Accin del calor.
c- Sales en elevada concentracin.
d- a + b.
e- Todas las anteriores.
14). La desnaturalizacin de las protenas implica:
a- Prdida de su actividad biolgica
b- Hidrlisis de las uniones peptdicas.
c- Alteracin de la estructura primaria.
d- a + c.
e- a + b.
f- Todas las anteriores.
15). Al desnaturalizarse una protena se:

254
AMINOCIDOS Y PROTENAS

a- Pierde la actividad biolgica.


b- Se rompen las uniones peptdicas.
c- Se pueden romper enlaces inicos.
d- a + c.
16). a- Escribir la estructura del siguiente dipptido:
cistein - aspartato
b- Marcar el extremo C-terminal.
c- Marcar con una flecha un grupo que puede establecer puente de hidrgeno.
d- Encerrar con un crculo un grupo que pueda establecer puente disulfuro.
e- Encerrar en un recuadro un grupo que pueda establecer enlace electrosttico o inico.
17). Las protenas pueden perder su actividad biolgica por:
a- Calentamiento a 100C.
b- Hidrlisis.
c- Agregado de sales en elevada concentracin.
d- a + b.
e- Todas las anteriores.
18). Las protenas pueden perder su actividad biolgica por:
a- Desnaturalizacin.
b- Acin del calor.
c- Sales en baja concentracin.
d- a + b.
e- Todas las anteriores.

14.4.2. Metabolismo de aminocidos

1). Nombre el sustrato y la enzima de una reaccin de la sntesis de la urea en la cual se utilice ATP.
2). ..... La transaminacin es un proceso irreversible porque las enzimas que catalizan la reaccin
utilizan fosfato de piridoxal como coenzima.
3). La transaminacin requiere:
a- Un aminocido y pirofosfato de tiamina.
b- Un aminocido y un cetocido.
c- Un cetocido y biotina.
d- a + b.
e- Ninguna de las anteriores.
4). Nombre el sustrato y una enzima de una reaccin de la sntesis de la urea en la cual se utilice
dixido de carbono.

255
AMINOCIDOS Y PROTENAS

5). ..... La transaminacin requiere de la presencia de un cetocido como sustrato porque el grupo
amino del cetocido es transferido al aminocido.
6). La sntesis de urea necesita:
a- Glutamato y ATP.
b- Aspartato y glucosa.
c- ATP y urea.
d- a + b
e- Todas las anteriores.
7). Nombre el producto y la enzima de una reaccin de la sntesis de la urea en la cual se utilice
ornitina.
8). ..... La transaminacin requiere de la presencia de un aminocido como sustrato porque el grupo
amino es transferido desde el cetocido al aminocido.
9). El ciclo de la urea necesita:
a- Fosfato de piridoxal.
b- ATP y ureasa.
c- ATP y aspartato.
d- a + b.
e- Todas las anteriores.
10). Nombre el producto y la enzima de una reaccin de la sntesis de la urea en la cual se utilice
aspartato.
11). ..... La transaminacin requiere de la presencia de biotina porque la biotina es la coenzima de las
transaminasas.
12). La sntesis de urea requiere:
a- ATP y carbamil fosfato.
b- ATP y aspartato.
c- ATP y ornitina.
d- a + b.
e- todas las anteriores.
13). Nombre el sustrato y la enzima de una reaccin de la sntesis de la urea en la cual se produce urea.
14). ..... La transaminacin es un proceso reversible porque las enzimas que catalizan la reaccin
utilizan pirofosfato de tiamina como coenzima.
15). La transaminacin requiere:
a- Un cetocido y fosfato de piridoxal.
b- Un aminocido y pirofosfato de tiamina.
c- Un cetocido y biotina.
d- a + b.

256
AMINOCIDOS Y PROTENAS

e- Ninguna de las anteriores.


16). Cul es la va de excrecin de la urea y del metabolismo de qu compuestos depende?
17) ..... La urea se sintetiza en el hgado porque el amonaco es ms txico.
18). Depende fundamentalmente de la ingesta de protenas:
a- Excrecin urinaria de creatinina.
b- Excrecin urinaria de urea.
c- Excrecin urinaria de cido rico.
d- a + b.
e- a + c.
19). Cul es la va de excrecin de la creatinina y de qu compuesto deriva?
20). ..... La creatinina tiene nitrgeno en su estructura porque se forma como producto de la hidrlisis
de la arginina por la arginasa.
21). No est estrictamente relacionada con la ingesta la:
a- Excrecin urinaria de creatinina.
b- Excrecin urinaria de urea.
c- Excrecin urinaria de cido rico.
d- a + b.
e- a + c
22). Cul es la va de excrecin del cido rico y del metabolismo de qu compuestos deriva?
23). ..... El cido rico es metabolito de la fosfocreatina muscular porque la fosfocreatina no se puede
metabolizar por otra va.
24). La excrecin urinaria de urea depende de:
a- La ingesta de protenas.
b- La ingesta de lpidos.
c- La ingesta de aminocidos.
d- a + b.
e- a + c.
25). Qu rgano produce la urea y en qu situaciones se encuentra mayor excrecin urinaria?
26). ..... Cuando aumenta la ingesta proteica aumenta la excrecin de urea por orina porque la urea es el
producto final del metabolismo de las cadenas carbonadas de los aminocidos.
27). La excrecin de urea por orina no est relacionada con:
a- El metabolismo del grupo amino de los aminocidos.
b- El metabolismo de las bases pricas.
c- El metabolismo de la creatina fosfato.
d- a + b.

257
AMINOCIDOS Y PROTENAS

e- b + c.
28). De qu tejido proviene la creatinina y a partir de que sustancia se origina?
29). ..... La urea se excreta por orina porque se sintetiza utilizando el nitrgeno de las bases pricas.
30). Contienen nitrgeno en su estructura:
a- Urea y glucosa.
b- Acilgliceroles y creatinina.
c- cido rico y urea.
d- Creatinina y colesterol.
e- Urea y colesterol.
31). ..... El grupo amino de los aminocidos se excreta como urea porque antes de ingresar al ciclo de
la urea el grupo amino debe ser transferido al a-cetoglutarato.
32). ..... El -cetoglutarato recibe los grupos amino de la mayora de los aminocidos porque el -
cetoglutarato se transforma en glutamato.
33). ..... Las transaminasas transfieren el grupo amino de los aminocidos al -cetoglutarato porque
estas enzimas tienen al pirofosfato de tiamina como coenzima.

34). El ciclo de la urea:


a- Forma una molcula de urea cada dos aminocidos.
b- Ocurre en la mitocondria.
c- Ocurre en el citosol.
d- Ocurre en el hgado.
e- Todas son correctas.
35). El ciclo de la urea:
a- Necesita el aporte de ATP.
b- Recibe nitrgenos a partir del carbamil fosfato.
c- Ocurre en el hgado.
d- a + b.
e- Todas son correctas.
36). El ciclo de la urea produce una molcula de urea:
a- Cada dos aminocidos que se transaminan.
b- Requiere ATP.
c- Tiene arginina como intermediario.
d- a + b.
e- Todas.
37). La inhibicin de la enzima ................ producir acumulacin de arginosuccinato y disminucin de

258
AMINOCIDOS Y PROTENAS

los niveles de ...........


38). La inhibicin de arginasa producir acumulacin de ......... y disminucin de los niveles de .............
39). La inhibicin de la ...................del ciclo de la urea producir aumento de la concentracin
de................. y disminucin de los niveles de citrulina.
40). ...... Un dficit de la enzima ornitintranscarbamilasa produce acumulacin de urea porque esta
enzima cataliza la reaccin de arginina a urea.
41). ..... Un dficit congnito de la enzima carbamilfosfato sintetasa producir acumulacin de
amonaco porque esta enzima produce la transformacin de ornitina en citrulina.
42). ..... Un dficit de la enzima arginasa producir acumulacin de arginina porque esta enzima
cataliza la transformacin de citrulina en arginina.
43). El ciclo de la urea:
a) Tiene parte de sus enzimas en la matriz mitocondrial .
b) Tiene parte la las enzimas en el citosol.
c) a + b
d) ninguna.
44). ..... Durante la transaminacin se forma urea porque las transaminasas utilizan como coenzima el
pirofosfato de tiamina.

45). V - F. La urea es un compuesto insoluble en agua.

14.4.3. Respuestas:

Estructura de aminocidos y protenas


1- e
2- e
3- B
4- B
5- Carboxilo
6- Amino
7- Amino y carboxilo
8- Enlace peptdico
9- a- 7, b- 6, c- glutamato, d- isoleucil, e-serina y treonina, f- cistenas, g- serina y treonina, h- treonina
y glutamato, i- glutamato, j- aminocidos, k- isoleucina, enlace hidrofbico.
10- a- Grupo amino, b- grupo carboxilo, c- interaccin hidrofbica, d- hidrofbico, e- grupo carboxilo,
f- peptdico, g- ncleo aromtico, h- el carbono alfa.
11- a- carboxilo, b- grupo amino, c- hidrofbica
12- b- alanin, c- cadena lateral de la serina

259
AMINOCIDOS Y PROTENAS

13- e
14- a
15- d
16- b- aspartato, c- cadena lateral del aspartato y unin peptdica, d- cistena, e- cadena lateral del
aspartato y extremos N y C terminal.
17- e
18- d

Metabolismo de aminocidos
1- Citrulina, arginosuccinato sintetasa
2- D
3- b
4- amonio, dixido de carbono, ATP, carbamilfosfato sintetasa
5- C
6- a
7- citrulina, ornitin transcarbamilasa
8- C
9- c
10- arginosuccinato, arginosuccinato sintetasa
11- E
12- e
13- arginina, arginasa
14- C
15- a
16- urinaria, aminocidos
17- B
18- b
19- urinaria, bases pricas
20- C
21- e
22- urinaria, creatina
23- E
24- e
25- hgado, dieta hiperproteica
26- C

260
AMINOCIDOS Y PROTENAS

27- e
28- muscular, creatinafosfato.
29- C
30- c
31- B
32- B
33- C
34- e
35- e
36- e
37- arginosuccinato liasa, arginina
38- arginina, urea y ornitina
39- ornitintranscarbamilasa, ornitina y carbamil fosfato
40- E
41- C
42- C
43- c
44- D 45- F.

261
CIDOS NUCLEICOS

15. CIDOS NUCLEICOS

Los cidos nucleicos son biomolculas que se hallan en las clulas y estn encargadas de almacenar,
expresar y transmitir la informacin gentica. Los cidos nucleicos se hallan formados por nucletidos,
por lo que se los define como biopolmeros de nucletidos (para ver video sobre estructura de
nucletidos y cidos nucleicos haga click).

15.1. Estructura de nucletidos

Los nucletidos son las unidades estructurales de los cidos nucleicos. Si bien estos ltimos son
molculas de grandes dimensiones, estn compuestos por repeticin de un nmero reducido de
molculas.
Un nucletido est compuesto por una aldopentosa: Ribosa (R), Figura 15.1, en el caso de los
nucletidos y cidos ribonucleicos (ARN o ARN) y desoxirribosa (dR), figura 15.2, en el caso de los
desoxinucletidos y los cidos desoxirribonucleicos (ADN o ADN).

Figura 15.1

Figura 15.2 -desoxirribosa


Adems de la desoxirribosa o ribosa, en la estructura existen bases nitrogenadas. Dentro de estos
compuestos existen dos tipos: las bases pricas (purinas) y las pirimdicas (pirimidinas).
Dentro de las bases pricas se encuentran la Adenina (A, ver figura 15,3) y la guanina (G, figura 15.4)

262
CIDOS NUCLEICOS

Figura 15.3 -
adenina

Figura 15.4 -
guanina

Dentro de las bases pirimdicas se encuentran la Citosina (C, figura 15.5), Timina (T, figura 15.6) y
Uracilo (U, figura 15.7)

Figura 15.5 -
uracilo

263
CIDOS NUCLEICOS

Figura 15.6 - citosina

Figura 15.7.timina

La unin de una base nitrogenada con una de las pentosas, se produce a travs de un enlace que
involucra el carbono 1' del glcido en posicin . Estos compuestos llevan el nombre de nuclesido.
Su nomenclatura deriva de la base nitrogenada que le da origen. En el ejemplo se muestra la unin de
ribosa con adenina, el nuclesido en tal caso se denomina adenosina.

Figura 15.8 - adenosina

En el caso que el nuclesido se ligue a una o ms molculas de cido fosfrico (o fosfato) se obtendrn
nucletidos mono, di o trifosfato, dependiendo de que las molculas de fosfato sean 1, 2 o 3
respectivamente. El primer fosfato se une por unin ster en el oxhidrilo del carbono 5' de la pentosa.
Los otros fosfatos se unen al fosfato mencionado por enlace anhdrido, que es un enlace macrorgico.

264
CIDOS NUCLEICOS

En el caso que a la adenosina se le una un fosfato se obtendr el adenosin monofosfato o AMP (figura
15.9).

Figura 15.9 - AMP

Si se unen 2 fosfato se forma un nucletido llamado adenosin difosfato o ADP (figura 15.10). En caso
que sean tres los fosfato unidos se forma el adenosin trifosfato a ATP (figura 15.11).

Figura 15.10

Figura 15.11

En el caso que sea una ribosa unida a dos fosfatos y un uracilo el nucletido se llamara uridindifosfato
y se simboliza UDP.
Si el glcido es desoxirribosa, la base citosina y un fosfato el nucletido se denomina
desoxicitosinamonofosfato o dCMP.

265
CIDOS NUCLEICOS

15.1.1. Enlace fosfodister

Este enlace es el caracterstico de la unin de dos nucletidos en estructuras como los polinucletidos
y los cidos nucleicos. Para producirse esta unin se hidroliza la unin entre el primer y el segundo
fosfato del nucletido, producindose la unin de este ltimo al oxhidrilo del la posicin 3' de otro
nucletido. El enlace formado se conoce como 3'- 5' -fosfodister (figura 15.12).

Figura 15.12

A travs de estos enlaces se unen gran cantidad de nucletidos para dar origen a los cidos
desoxirribonucleicos (ADN) y los cidos ribonucleicos (ARN). Independientemente de la cantidad de
nucletidos, en un extremo quedar libre el carbono 5' de la pentosa, este es el extremo 5'. En el otro
extremo de la cadena de nucletidos permanecer sin combinarse el carbono 3' del glcido, este
extremo se llama 3'.

15.2. estructura del ADN

En la estructura del ADN intervienen desoxinucletidos formados por desoxirribosa, fosfato, adenina,
guanina, citosina y timina, pero no tiene ribosa ni uracilo en su estructura. El ADN consiste de dos
cadenas de gran cantidad de nucletidos. Estas cadenas se enfrentan y presentan lo que se llama
complementariedad de bases. Esto significa que mientras que en una cadena existe C, en la otra existe
G. Cuando existe A en la otra se complementa con T. Adems las cadenas son antiparalelas, esto
significa que el extremos 3' de una cadena se enfrenta al extremo 5'de la otra. El siguiente esquema
representa una porcin de una molcula de ADN

266
CIDOS NUCLEICOS

3' A A T T T C C G T G T A T C C C C G G T A 5'
5' T T A A A G G CA C A T A G G G G C C A T 3'

En esta estructura a un conjunto de tres bases se las denomina codn o triplete. Por ejemplo en la
cadena inferior, comenzado por el extremo 5' encontramos el triplete TTA.
En el ADN se encuentra codificada la informacin para construir la estructura de las protenas. Cada
triplete codifica uno de los 20 aminocidos. La porcin del ADN que codifica una protena se
denomina gen. Los genes tienen porciones que codifican protenas llamadas exones y porciones no
codificantes llamadas intrones. Tambin existen porciones con las cuales interactan factores y
enzimas encargadas de copiar ARN utilizando como molde el ADN. Estas porciones se denominan
promotores.
La doble hebra del ADN adopta una forma helicoidal, de all su nombre de doble hlice. Esta doble
hlice luego se liga a protenas conocidas como histonas constituyendo as estructuras mas complejas
conocidas como nucleosomas. Estas estructuras constituyen la cromatina.

15.2.1. Genoma humano

A fin de tener una idea de la dimensin de la molcula de ADN se suministran algunos nmero
relacionados a la estructura del ADN surgida fundamentalmente de conocimiento del genoma humano
publicado en el ao 2001. La secuencias completa del genoma conocido en el 2001 tiene
aproximadamente 3.000.000.000 de nucletidos de A, C, G y T. Solamente del 1,1 al 1,5 % codifica
para protenas. Un 40-46% del genoma son regiones repetidas y desiertas no codificantes. Existe un
99,9 % de homologa de un individuo a otro, sin embargo geno y fenotpicamente somos diferentes.

15.2.2. Estructura del ARN

Existen diferentes tipos de ARN, pero todos estn formados por los mismos componentes. Tiene
ribosa, fosfato, A, G, C y U, pero no tienen desoxirribosa ni timina en su estructura.
Existen diferentes tipos de ARN:
1- ARNm (ARN mensajero) es una sola cadena de nucletidos, en el extremo 5' tiene una estructura
llamada "cap", en el extremo 3' tiene una sucesin de nucletidos de adenina, llamada poliA. Es la
molcula que lleva el mensaje del ncleo al citosol para la sntesis proteica en los ribosomas.
2- ARNt (ARN de trasferencia) es una sola cadena con porciones que son complementarias en la
misma cadena, determinando que tenga una estructura de cuatro brazos. Cada brazo cumple una dada
funcin: unin del aminocido, unin a ribosoma, unin de enzimas, unin al ARNm. Es la molcula
que traduce el mensaje del ARNm, codificado en tripletes de nucletidos a un cdigo de aminocidos.
3- ARNr (ARN ribosomal) son molculas de ARN que se ligan a protenas formando los ribosomas.
4- ARNnh (ARN heterogneo nuclear): es la molcula de ARN monohebra transcripta de un gen, esta
contiene exones e intrones y no tiene "cap"ni poli A. En procesos postranscripcionales se le agrega el
"cap", el poli A y se eliminan los intrones.

267
CIDOS NUCLEICOS

15.2.3. Duplicacin o replicacin del ADN:

Generalidades: El proceso de duplicacin o replicacin del ADN ocurre durante la fase S del ciclo
celular, previo a la realizacin de la mitosis. Se trata de un proceso extremadamente complejo en el que
participan una gran cantidad de factores y enzimas. Se dar una descripcin muy simplificada del
proceso. (Para ver un video sobre el tema duplicacin click aqu y aqu)
Las enzimas que participan en el proceso de copia del ADN tienen la particularidad que se desplazan
sobre la hebra que utilizan como molde, en el sentido 3' a 5'. Como consecuencia van sintetizando una
hebra complementaria en el sentido 5' a 3'. En el proceso de sntesis se copia una hebra nueva sobre
una de las hebras de la molcula madre. Al final del proceso cada nueva molcula de ADN tiene la
mitad de la molcula que le dio origen. Por lo anterior se dice que la duplicacin es semiconservativa.
Descripcin del proceso: se irn describiendo los pasos representados en la figura siguiente. En el
primer paso la molcula de ADN se separa gracias a la accin de la protena desenrolladora o helicasa.
Esta enzima inestabiliza los enlaces puente de hidrgeno entre las bases nitrogenadas produciendo la
separacin de las hebras y formando de esta manera una burbuja o ampolla de duplicacin en la que
quedan expuestas las bases nitrogenadas.

ADN 5'
3' 3' 5'
5' 3'
5' 3'
HELICASA

3' 5' 3' 5'


5' 3' 5'
3' 5' 3'
5' 3'
PRIMASA ADN
POLIMERASA

3' 5' 3' 5' 3'


5' 3' 5' 3'
5'
ADN LIGASA

3' 5' 3' 5'


5' 3 '5 ' 3'
3'
ADN POLIMERASA
5'

3' 3' 5' 3' 5'


5'
5' 3'
5' 3' 5' 3' 5'
3'
5' 3'

Luego de la accin de la helicasa comienza a actuar la primasa o ARN polimerasa, enzima que cataliza
la formacin de ARN. Como se mencion anteriormente esta enzima lee la hebra utilizada como molde
en el sentido 3' a 5' y sintetiza una cadena en el sentido 5' a 3'. Utiliza como sustratos nucletidos
trifosfato (ATP, CTP, UTP y GTP) incorporando nucletidos monofosfato y liberando pirofosfato. Por

268
CIDOS NUCLEICOS

cada nucletido que se incorpora se gastan por lo tanto 2 enlaces macrorgicos. Esta enzima sintetiza
una porcin de ARN llamado "primer" o cebador.
Luego de la sntesis del "primer", la enzima primasa da lugar a la ADN polimerasa, enzima que a
continuacin del "primer" sintetizar ADN, en el mismo sentido que lo vena haciendo la primasa. Esta
enzima utiliza desoxinucletidos trifosfato (dATP, dCTP, dTTP y dGTP), incorporando
desoxinucletidos monofosfato a la cadena en formacin, ligndolos por enlace 3'-5' fosfodister. Esta
enzima sintetiza ADN hasta completar la burbuja de duplicacin. Se necesita luego la accin
nuevamente de la helicasa que amplia la burbuja de duplicacin. De esta manera la ADN polimerasa
puede continuar la sntesis en el sentido que lo vena haciendo.
Para completar los extremos 3' de la burbuja se necesita la accin nuevamente de la primasa que forma
un primer, a continuacin del cual una nueva molcula de ADN polimerasa completa con ADN la
porcin restante. De esta manera sobre una hebra, utilizada como molde, a partir del sitio en que se
inici la duplicacin se producen dos procesos: en el sentido 3' a 5' la ADN sintetiza ADN en forma
continua, esta es la hebra conductora, adelantada o gua. En el sentido 5' a 3' se sintetiza de a porciones
compuestas por un "primer" y luego ADN, llamadas fragmentos de Okasaki. La porcin de ARN de
estos fragmentos es luego eliminada por la accin de una nueva ADN polimerasa que posee dos
actividades enzimticas: ribonucleasa que hidroliza ARN y ADN polimerasa que sintetiza en su lugar
ADN. Luego de la accin de esta enzima cada hebra de la molcula madre queda copiada , salvo que
quedan algunos enlaces 3'-5' fosfodister por formar entre los fragmentos. La accin de una enzima
llamada ADN ligasa cataliza la formacin de estos enlaces completando la copia del sector.
Este proceso continua desde el punto de iniciacin ampliando la burbuja de duplicacin hasta
completar el proceso y tener as dos molculas idnticas a la que le dio origen. Para ms detalle de las
enzimas involucradas en el proceso de duplicacin haga click ac

15.2.4. Transcripcin

Es el proceso de sntesis de ARN a partir de ADN. En el procesos se forman tres tipos de ARN
fundamentales: ARNt, ARNr y ARNm. En el proceso intervienen diferentes enzimas ARNpolimerasas
y numerosos factores proteicos. Para ver vdeo sobre el tema de manera sencilla haga click aqu. Para
ver detalles del proceso haga click aqu y ms detalles del mecanismo de control de la transcripcin
haga click aqu
En el proceso de transcripcin se debe desplegar el ADN, producindose la separacin entre ADN e
histonas, que forman los nucleosomas. Este proceso es favorecido por cambio en las propiedades de las
histonas gracias a la accin de las enzimas histona deacetilasa, en esta circunstancia las histonas
pierden grupos acetilo, adquieren carga positiva y el ADN no puede ser transcripto ya que la cromatina
se condensa. Contrariamente, cuando actan las enzimas histona acetil transferasa, las histonas se
acetilan, pierden parte de su carga positiva, disminuyendo la interaccin del ADN con las histonas y de
esta manera la cromatina pasa a su forma laxa. Para ms detalle del proceso de control de la
transcripcin haga click aqu

15.2.5. Sntesis proteica o traduccin

En este proceso se forman las protenas utilizando la informacin contenida en ADN, la que
previamente fue transcripta a una molcula de ARN. Para ver un video sobre el tema haga click aqu.
El ARNm que porta el mensaje tiene un triplete de iniciacin prximo al extremo 5 ' (el codn AUG).
Cada aminocido que se incorpora a la sntesis de la protena debe estar unido a una molcula de

269
CIDOS NUCLEICOS

ARNt, en este proceso se gastan dos enlaces macrorgicos provenientes de una molcula de ATP. Este
proceso de activacin del aminocidos es catalizado por la enzima ARNt-aminoacil sintetasa.

AUG AA AA AA AA AA AA AA AA PROTEINA
CAP Poli A
AA
AA
GTP + AA
AMP ATP
AA

CAP Poli A

CAP Poli A

P AA A

CAP Poli A
AA
+ AA
GTP AMP ATP
AA AA AA AA AA AA AA AA
AA AA
AA
CAP Poli A UAA
CAP Poli A
FORMACION
UNION PEPTIDICA
AA
AA
AA
CAP Poli A
AA AA

GTP TRASLOCACION CAP Poli A


GTP
AA
AA
AA
+ AA
CAP Poli A AMP ATP

Figura 15.14 - Sntesis de protenas

El proceso de sntesis proteica se inicia con la unin de un ARNt portando el primer aminocido
(metionina o formilmetionina) al triplete AUG y la subunidad menor del ribosoma. En este proceso se
gasta un GTP. Luego se une la subunidad mayor y queda conformado el complejo de iniciacin (figura
15.14).
El ribosoma tiene dos sitios uno para el pptido en sntesis (sitio P) y otro para cada nuevo aminocido
que ingresa o sitio A. En el sitio A ingresa un nuevo aminocidos unido a su ARNt, que tiene un
anticodn complementario al codn del ARN. Se produce la unin peptdica entre el aminocido del
sitio P y el del sitio A, quedando el pptido unido al ARNt del sitio A. En un paso siguiente con energa
del GTP se produce la traslocacin del ribosoma, es decir se corre hacia el extremo 3' colocando en el
sitio A el nuevo triplete en el que entrar un nuevo ARNt con su aminocido correspondiente.
En adelante se repite el proceso mencionado: unin peptdica del pptido en sitio P al aminocido en el
sitio A, traslocacin y entrada del nuevo aminocido. El proceso continuar hasta que se llegue al
ltimo triplete del mensaje, el codn de finalizalizacin. Este codn puede ser UAA, UAG o UGA, que
son tripletes mudos, para los cuales no existe ARNt. En este caso se producir la liberacin de la
protena sintetizada, del ARNm y las subunidades ribosomales.
El ARNm y subunidades ribosomales pueden iniciar nuevamente el proceso. El proceso puede
iniciarse aun cuando el primer ribosoma no ha llegado al triplete de finalizacin. Es decir que una
molcula de ARNm puede ser leda por varios ribosomas simultneamente.

270
CIDOS NUCLEICOS

La protena sintetizada si es necesario sufrir tratamientos postraduccionales como pueden ser:


formacin de puentes disulfuro, ensamblado de mas de una subunidad, agregado de lpidos, glcidos,
cofactores, grupos prostticos, etc.

15.3. Prctica

15.3.1. Estructura de nucletidos y cidos nucleicos

1). En el esquema de la derecha se tiene una O

estructura qumica:
a- Identificar si es un
HN

Nuclesido. O

Desoxinucletido difosfato. N

Nucletido monofosfato. P P P CH
2

Nucletido difosfato. H H

H H

Desoxinuclesido.
OH OH

Nucletido trifosfato.
Desoxinucletido trifosfato.
Desoxinucletido monofosfato.
b- Marcar un fosfato.
c- Marcar un enlace anhdrido fosfrico.
d- Identificar el azcar.
e- Identificar la base nitrogenada.
f- Marcar en la molcula un nuclesido.
g- Marcar en la molcula un pirofosfato.
h- Marcar los enlaces macrorgicos.
i- Marcar la zona molecular polar con carga.
j- Marcar la zona polar sin carga.
k- Escribir la molcula que resultara de hidrolizar el enlace entre el fosfato y el azcar.
l- Escribir la estructura de esta molcula en forma simplificada.
2). Utilizando las estructuras de las hojas anteriores escribir las frmulas de los siguientes nucletidos:
a- dGTP
b- CTP
d- dUMP

271
CIDOS NUCLEICOS

3) Unir los nucletidos GTP, UTP, CTP y ATP en el orden en que se encuentran, siendo el GTP el
extremo 5' y el ATP el 3'.
4). A continuacin se da la secuencia de bases de una de las cadenas de una hebra de ADN. Escribir la
secuencia de bases de la hebra complementaria.
5' GCGCTCATATAG 3'
5) Nombrar 2 semejanzas entre el ADN y el ARN.
6) La secuencia de bases de una molcula de ADN es
5' ACCGCTTAAACGCAC 3'
Escribir la estructura de la molecula de ARNm transcripta a partir de esta porcin de la molcula.
7) a- Dibujar la estructura del GDP
b- Indicar una diferencia con el ADP ..........................
8) Nombrar 2 diferencias entre una molcula de ADN y una de ARN.
9) La secuencia de bases de una molcula de ARNm es
3' UGGCGAAUUUGCGUG 5'
Escribir la estructura de la molecula de ADN a partir de la cual fue transcripta esta molcula.
10 La secuencia de la hebra con sentido del ADN es 5'AAACCCGCGGGCTTAAAAAAATGGG3'
sabiendo que las secuencias GCGGGC y AAAAAAA son dos intrones:
a- Escribir la secuencia de bases del ARNm de dicho porcin de ADN.
b- Cuntos aminocidos tendr la porcin de protena codificada por este sector del ADN?

15.3.2. Metabolismo de cidos nucleicos

1) Completar los espacios en blanco utilizando las palabras que se dan a continuacin
ARN; replicacin; ADNpolimerasa; helicasa; ADN; ADNligasa
La duplicacin o ...............del ADN, es el proceso de sntesis de una nueva molcula de ADN. Este
proceso comienza por la accin de la enzima ............., que desenrollan las dos hebras de la molcula.
Luego entra la primasa, que sintetiza una porcin de ........, llamado "primer". A continuacin de este
"primer" se sintetiza una hebra de ADN por accin de la .......... . La accin de la helica sa, primasa y
ADN polimerasa se repite varias veces hasta copiar las dos hebras. Luego entra otra ADN polimerasa
que tiene la capacidad de hidrolizar los trozos de ARN y sintetizar ......... en lugar del ARN hidrolizado.
Finalmente entra una .........., que une los trozos de ADN sintetizados.

15.3.3. Sntesis proteica

1) Ordenar los pasos de la sntesis proteica


a- ........ Rraslocacin.
b- ....... Unin de la subunidad menor del ribosoma, ARNm y primer ARNt.
c- ........ Entrada del 2do aminocido.

272
CIDOS NUCLEICOS

d- ........ Unin de los dos aminocidos por unin peptdica.


e- ........ Entrada del tercer aminocido.
f- ........ Unin de la subunidad mayor del ribosoma.
g-....... Separacin de la proteina, ribosoma y ARNm.
h-....... Llegada al codn de finalizacin.
2) Completar sobre las lneas de puntos con la o las palabras faltantes: La sntesis de protenas
comienza con la union del ........ , la subunidad menor del ............... y el ARNm. Luego se adosa la
subunidad mayor del ribosoma. Los aminocidos entran al ribosoma junto con el ....... que los
transporta y se unen al .............. complementario. Luego se forma la unin .............. y finalmente se
trasloca, para dar lugar a la entrada de otro aminocido. El proceso se repite hasta llegar al codn
de ............

15.3.4. Respuestas

Estructura de nucletidos y cidos nucleicos


1- a- nucletido trifosfato, d- ribosa, e- uracilo, l- UTP
4- 3'CGCGAGTATATC 5'
6- 3'UGGCGAAUUUGCUG 5'
9- 5' ACCGCTTAAACGCAC 3'
10- a- 5' AAACCCUUUGGG 3' b- 4

Metabolismo de acidos nucleicos


1- Replicacin, helicasa, ARN, ADN polimerasa, ADN, ADN ligasa
Sntesis proteica
1- b, f, c, d, a, e, h, g
2- ARNt-aminocido, ribosoma, ARNt, codn, peptdica, finalizacin.

273
SISTEMA ENDOCRINO

16. SISTEMA ENDOCRINO

16.1. Hormonas liberadoras hipotalmicas

Las hormonas liberadoras hipotalmicas son un conjunto de pptidos y protenas generados por el
hipotlamo que actan estimulando (y en algunos casos) inhibiendo la liberacin de hormonas por
parte de la adenohipfisis. Para ampliar el tema haga click en el siguiente link:
http://hdl.handle.net/2133/7305
Como sabemos la hipfisis es una glndula endcrina ubicada en la silla turca del esfenoides, en
la base del crneo. Se comunica con el hipotlamo a travs del tallo pituitario (la hipfisis tambin
se llama pituitaria). Esta glndula tiene tres partes:
1- lbulo anterior o adenohipfisis
2- lbulo intermedio o pars intermedia
3- lbulo posterior o neurohipfisis.
La adenohipfisis est compuesta por un conjunto de clulas epiteliales rodeadas por capilares
sinusoides y fenestrados a los cuales estas clulas vuelcan sus secreciones. Las clulas se clasifican
en cinco grupos:
1- somatotropas
2- mamotropas
3- corticotropas
5- gonadotropas
6- tirotropas.

La adenohipfisis secreta una serie de hormonas trpicas que tienen accin sobre otras glndulas
endocrinas:
1- ACTH o adenocorticotropina: hormona que tiene accin sobre la corteza suprarrenal
2- TSH: hormona estimulante de tiroides o tirotropina: estimulante de tiroides
3- Hormona de crecimiento, somatotropina, STH o GH: estimulante directo del crecimiento o de la
formacin de IGF-1
4- Prolactina u hormona luteotrpica: hormona que estimula la produccin de leche
5- gonadotropinas hipofisiarias: hormonas que regulan acciones a nivel de las gnadas. Estas
son la LH (hormona luteinizante) y FSH (hormona folculo estimulante)
La pars intermedia, produce la hormona melanocito estimulante.

La neurohipfisis libera a sangre, oxitocina y hormona antidiurtica o vasopresina.

La liberacin de estas hormonas es estimulada o inhibida por factores hipotalmicos:


1- Hormona liberadora de corticotropina. CRH
2- Hormona liberadora de tirotropina: TRH
3- Hormona liberadora de gonadotropinas: GNRH
4- Hormonas liberadora de prolactina: PrRH
5- Hormona inhibidora de prolactina: PrIH
6- hormona liberadora de GH: GHRH
7- hormona inhibitoria de GH: GHIH o somastatina
8- hormona estimuladora de hormona melanocito estimulante: MSHRH
9- hormona inhibitoria de hormona melanocito estimulante: MSHIH

274
SISTEMA ENDOCRINO

Todas estas hormonas tiene la particularidad de ser hidrosolubles, de estructura polipeptdica y


actuar sobre las clulas blanco a travs de receptores de 7 dominios transmembrana,
generalmente asociados a protenas Gs, fosfolipasa C y fosfolipasa A si son hormonas
estimulatorias o ligados a protenas Gi si son hormonas inhibitorias.

16.2. Hormonas de la neurohipfisis

Para ampliar el tema consulte el siguiente link: http://hdl.handle.net/2133/7306

16.2.1. Vasopresina u hormona antidiurtica

La vasopresina tiene efecto directo sobre rin y produce vasoconstriccin perifrica


La secrecin es inhibida por la activacin de receptores opiodes kappa del nucleo supraptico.
Mientras que es estimulada por baroreceptores y receptores de la osmolaridad.
Su secuencia de aminocidos es cis-tir-fen-gln-asn-cis-pro-arg-glicinamida.
Presenta en los tejidos blanco diferentes tipos de receptores:
Receptores V2: mediados por Gs, involucrada en absorcin renal de agua. La unin de ADH al
receptor AVPR2 , produce la expresin de Aqp2 en membrana aplical del tbulo colector y la
absorcin de agua.V1a: Asociado a protena G asociadas a FLC, se lo vincula a comportamientos
sociales, como receptividad negativa de hembras, comportamiento maternal y contraccin muscular
vascular
Receptores V1b: asociado a Gq y FLC, regula vasoconstriccin y regulacin de la presin
sangunea..
Regulacin de la secrecin y efectos
La secrecin es estimulada por calor, vmitos, aumento de la osmolaridad del LEC y disminucin
de la volemia. Contrariamente, el fro y el etanol inhiben su secrecin, Figura 16.1

275
SISTEMA ENDOCRINO

Figura 16.1

16.2.2. Oxitocina

La oxitocina produce la contraccin del msculo liso de tero y glndula mamaria. Es un


nonapptido de la siguiente secuencia Cis-tir-ile-gln-asn-cis-pro-leu-gli. Acta en las clulas blanco
a travs de receptores asociados a protenas Gq y FLC.
Regulacin de la secrecin y efectos
Estimula su secrecin: succin del pezn y distensin vaginal. Su efecto es la contraccin de la
musculatura lisa uterina y de las clulas mioepiteliales de la glndula mamaria, Figura 16.2.

276
SISTEMA ENDOCRINO

Figura 16.2

16.3. Hormonas tiroideas

Las hormonas tiroideas son hormonas pertenecientes al grupo de aminocidos modificados. Son
producidos por la glndula tiroides y se conocen como T4, tetrayodotironina o tiroxina y T3 o
triyodotironina. Las hormonas se pueden considerar derivados de la tironina, Figura 16.3. Para ver
un vdeo sobre el tema haga click en el siguiente link: https://youtu.be/bPd1Qj34QFY

277
SISTEMA ENDOCRINO

Figura 16.3

Estas hormonas se sintetizan sobre una protena conocida como tiroglobulina, dentro del coloide de
la tiroide folicular con el aporte de ioduro y perxido de hidrgeno generado por la enzima dual
oxigenadasa 2 (DUOX2) y la peroxidasa tiroidea. Ante el estmulo de TSH (tirotrofina) se hidroliza
la tiroglobulina generando estructuras derivadas de la tirosina con 1, 2, 3 y 4 ioduros llamados
MIT, DIT, T3 y T4, respectivamente. DIT y MIT son desyodados en la clula folicular por una
enzima desyodasa, mientras que T3 y T4 salen a circulacin y se unen a varias protenas de
transporte: transtirretina, Tiroxine binding globulin (TBG) y tiroxine binding prealbumin (TBPA).
La afinidad de T4 por estas protenas es mayor, lo que determina que la T3 libre sea mayor
atribuyndoles a esta hormona un mayor efecto biolgico, Figura 16.4.

278
SISTEMA ENDOCRINO

Figura 16.4

Tanto T3 como T4 se unen a receptores tisulares de tiroides (TR) : alfa en todos los tejidos y beta
preferentemente en hipfisis. La unin de las hormonas a TRbeta produce retroalimentacin
negativa sobre la produccin de TSH, hormona trfica que hace su efecto sobre tiroides por unin al
receptor TSHR de membrana en tiroides asociados a protenas Gs y Gq. A nivel tisular las
hormonas tiroideas se unen a receptores preferentemente alfa, induciendo cambios relacionados a
aumento de sntesis proteca, catabolismo de lpidos y glcidos, aumento del consumo energtico y
crecimiento.
Las hormonas T3 y T4 se inactivan formando diversos compuestos. Por accin de enzimas
descarboxilasas y desaminasas formando acido tetrayodotiroactico (tetrac) y cido
triyodotiroactico (TRIAC), de menor actividad y productos de excrecin. Tambin pueden
conjugarse con sulfato y glucuronato, por accin de enzimas sulfotransferasas y glucuronil
transferasas, que forman productos solubles facilmente excretables por orina y bilis. La accin de
una enzima 5' desyodasa al actuar sobre T4 forma T3 y aumenta su funcin, mientras que la accin
de la 5-desyodasa, genera a partir de T4 la hormona T3r de menor actividad, Figura 16.5.

279
SISTEMA ENDOCRINO

Figura 16.5
El tratamiento del hipotiroidismo podr realizarse de diferentes maneras dependiendo su origen. El
hipertiroidismo puede ser tratado bsicamente administrando inhibidores de la sntesis de hormonas
que actuan sobre la peroxidasa tioridea o la enzima 5' desyodasa. Estos productos son derivados del
tiamazol: metimazol, carbimazol o de la urea y tiouracilo: metil tiouracilo, fenil tiouracilo. Estas
sustancias disminuyen la produccin de T3 y T4 as como la transformacin de T4 en T3, ms
activa. La hipofuncin generalmente es tratada por administracin de levotiroxina un ismero
ptico de la tiroxina o dextrotiroxina, que tiene mayor vida media .

280
QUMICA DE LOS ESTEROIDES

17. QUMICA DE LOS ESTEROIDES

17.1. Hormonas esteroideas

Las hormonas esteroideas constituyen un grupo de hormonas de estructura lipdica derivadas del
colesterol. Podemos clasificarlas en pocos grupos
1-glucocorticoides
2-andrgenos suprarrenales
3-mineralocorticoides
4-andrgenos gonadales
5-estrgenos
6-progesterona
Para entender su mecanismo de sntesis y la nomenclatura de los productos y de las enzimas
intervinientes es imprescindible conocer la numeracin de los carbonos del colesterol, que se
muestra la Figura 17.1. El colesterol est formado por el ciclopentano perhidrofenantreno: C1 a
C17, con ramificaciones C18 C27.

Figura 17.1

La sntesis de las hormonas esteroideas ocurre en corteza suprarrenal, ovario y testculo. Cada uno
de estos rganos o sectores de ellos producen diferentes hormonas dependiendo de la expresin de
sus enzimas.

281
QUMICA DE LOS ESTEROIDES

Si bien el mecanimo de sntesis es muy complejo, puede sintetizarse de la siguiente manera y pasos
1- el colesterol es transformado en pregnenolona por la enzima 20,22 desmolasa (o enzima cortante
de la cadena lateral del colesterol)
2- la pregnenolona por la enzima bifuncional 3-hidroxiesteroide deshidrogenasa 4,5 isomerasa (3-
HSD) genera el gestano, progesterona. Luego por la accin de la enzima
3- a partir de progesterona y pregnenolona se forman los esteroides de 21 carbonos (pregnanos:
gluco y mineralocorticoides), los esteroides de 19 carbonos (androstanos: andrgenos) y los
esteroides de 18 carbonos (estranos: estrgenos).
4- las hidroxilaciones de progesterona en C21, C11 y C19 dan aldosterona
5- la hidroxilaiciones de progesterona en C17 y C11 dan cortisol
6- la hidroxilacin de pregnenolona en C17 y la rotura del enlace 17,20 generan andrgeno
suprarrenal dehidroepiandrosterona
7- La reduccin del carbono 17 y la deshidrogenacin del OH 3 dan testosterona.
8- la prdida del carbono 19 y aromatizacin del primer anillo del ciclopentanoperhidrofenantreno
forman estradiol.
La Figura 17.2 siguiente muestra lo explicado en los puntos anteriores, simplificando el esquema
anterior

282
QUMICA DE LOS ESTEROIDES

Figura 17.2

17.2. Acidos biliares

Los cidos biliares son compuestos derivados del colesterol, caracterizados por tener un
comportamiento anfiptico. Para ver un vdeo sobre el tema haga click en el siguiente link:
http://www.youtube.com/watch?v=uBWwDZcuhGQ. La funcin de los cidos biliares se
desempea en el intestino delgado y tienen accin emulsionante de los lpidos permitiendo as la
accin hidroltica de enzimas digestivas que actan sobre los triacilgliceroles, fundamentalmente.
La estructura anfiptica de los cidos biliares determina que su extremo hidrofbico se una a la
estructura lipdica quedando la parte hidroflica con carga negativa hacia el agua. De esta manera
disminuye la tensin superficial y esto permite que los lpidos se dividan en pequeas gotas
cubiertas de cidos grasos conocidas como miscelas.
La figura siguiente muestra la participacin de los cidos biliares. Producidos por el hgado son
volcados al duodeno donde participan en la hidrlisis de triacilgliceroles a cidos grasos y glicerol,
produciendo la emulsin y permitiendo la accin de la lipasa pancretica

283
QUMICA DE LOS ESTEROIDES

Figura 17.3
Los cidos biliares se clasifican en dos grupos: primarios y secundarios. Los cidos biliares
primarios son aquellos sintetizados por el hgado y enviados por las vas biliares al duodeno donde
cumplen su funcin emulsionante. En el duodeno puede ser deshidroxilados y desconjugados,
pasando a formar lo que se conoce como cidos biliares secundarios.
La figura siguiente muestra el proceso de sntesis de los cidos biliares. Esta va metablica
comienza a partir del colesterol y la primer enzima es la 7-alfa hidroxilasa (colesterol-7-alfa
monooxigenasa (P22680). Esta enzima pertenece al grupo de las enzima con citocromo P450 y
cataliza el paso limitante del proceso y es una reaccin importante en la excrecin y homeostasis del
colesterol, formando 7-hidroxi colesterol La reaccin ocurre en la membrana del retculo
endoplasmtico. Esta enzima es upregulated por glucosa y colestiramina y downregulated por
quenodesoxicolato. La colestiramina es una resina de intercambio aninico constituda por cloruro
de poliesterine trimetil tribencil amonio

284
QUMICA DE LOS ESTEROIDES

Figura 17.4

Luego enzimas del tipo hidroxilasas cortan la cadena carbonada ubicada en el carbono 17 del
ciclopentano perhidrofenantreno generando cidos carboxlicos que se conjugan con acetil coA. Asi
a partir del 7-hidroxicolesterol pueden formarse el colil-CoA y el quenodesoxicolil-CoA. Ambos
compuestos pueden conjugarse con aminocidos como la glicina y la taurina, formando compuestos
como el tauro/glico colato y tauro/glicoquenodesoxicolato. Estos compuestos se denomian cidos
biliares primarios, que en el intestino pueden ser desconjugados y deshidroxilados en la posicin 7,
generando cido desoxicolico (a partir de tauro/glico colato) o litoclico (a partir de tauro/glico
quenodesoxicolato). Estos ltimos compuestos se conocen como cidos biliares secundarios. Estos
pueden sufrir reabsorcin y circulacin enteroheptica. La colestiramina es una resina de
intercambio aninico que puede secuestrar los cidos biliares, impidiendo su reabsorcin y por ende
favoreciendo la eliminacin de colesterol.

285
PROCESOS BIOQUMICOS MULTIORGNICOS

18. PROCESOS BIOQUMICOS MULTIORGNICOS

18.1. Sntesis y degradacin del grupo Hemo

El grupo hemo es un grupo prosttico que se halla presente en muchas protenas como
hemoglobina, mioglobina, citocromos, vitamina B12, entre otros. Para ver un vdeo con detalles de
la sntesis, degradacin y patologas asociadas al grupo hemo haga click en el siguiente link:
http://youtu.be/9N1GLaEvWiU.
En nuestro organismo el grupo hemo es sintetizado a partir de compuestos no esenciales como son
la glicina y el succinil CoA.
El esquema de la Figura 18.1 muestra la sntesis del grupo hemo

Figura 18.1

Como muestra la imagen una molcula de succinil CoA y una de glicina forman una de cido
deltaaminolevulnico. Luego dos molculas de cido delta aminolevulnico forman un pirrol,
llamado porfobilingeno (PBG). La unin de cuatro PBG forman el primer tetrapirrol conocido
como uroporfiringeno III. Sucesivas oxidorreducciones y descarboxilaciones, con la adicin final
de Fe++, generan el grupo Hemo, el que se unir a diversas protenas para dar origen a las protenas
mencionadas.
Sin duda la sntesis del grupo hemo es ms compleja como lo muestra la Figura 18.2 en que la
simplificacin anterior es ampliada y mostrada con estructuras qumicas. En esta figura se se
muestran adems las enzimas y las enfermedades congnitas ms comunes (en recuadro rojo)

286
PROCESOS BIOQUMICOS MULTIORGNICOS

originadas por alteraciones genticas.

Figura 18.2

La hemoglobina es una protena que se halla en el interior de los glbulos rojos, protena de la que
existen diferentes tipos segn la etapa de la vida: hemoglobinas embrionarias, hemoglobina fetal y
hemoglobina del adulto. Estas hemoglobinas se diferencian en las cadenas proteicas pero no en el
grupo prosttico.
El glbulo rojo es una clula anucleada encargada del transporte de oxgeno y dixido de carbono
en el organismo, gracias a la presencia de hemoglobina. La hemoglobina puede cumplir otros roles
como son la regulacin del pH de una manera muy efectiva, favorecida por el cambio del pKa de
sus grupos cidos con la ganancia o prdida de oxgeno. Adems es capaz de responder de manera
diversas a la liberacin de oxgeno dependiendo de otros factores fisicoqumicos: temperatura, pH y
pCO2, 2,3-bisfosfoglicerato.
El glbulo rojo no posee ADN por lo que no puede realizar transcripcin y por lo tanto no puede
formar nuevas protenas, lo que determina que los cambios en sus estructuras no pueden ser
reparados y la clula sufre un envejecimiento que es detectado por clulas del sistema monoctico
macrofgico que lleva a su destruccin. La vida media promedio de un glbulo rojo humano normal
se ha estimado en 120 das, valor que se modifica si existen hemoglobinas anormales o cambios en
alguna protena de la estructura del glbulo. La destruccin prematura del glbulo rojo por causas
diversas conduce a enfermedades conocidas como anemias hemolticas.
En condiciones normales el glbulo rojo es destruido y la hemoglobina desdoblada en globina y
grupo hemo. Aqu comienza la degradacin de este producto.

287
PROCESOS BIOQUMICOS MULTIORGNICOS

En la Figura 18.3 se muestra a grandes rasgos las degradacin del grupo hemo hasta el
diglucurnido de bilirrubina, compuesto que ser excretado por bilis para su excrecin

Figura 18.3

El diglucurnido de bilirrubina es desconjugado por la enzima beta-glucuronidasa y


simultneamente reducido a D-urobilingeno. Este ltimo puede ser oxidado no enzimticamente a
D-urobilina o bien reducido a mesobilirubingeno o I-urobilingeno. El mesobilirubingeno tiene
dos caminos: se puede oxidar en presencia de oxgeno, dando agua e I-urobilina o bien reducirse a
estercobilingeno (o L-urobilingeno), el que en presencia de oxgeno genera en forma no
enzimtica agua y L-estercobilina.

288
BIOQUMICA DE SISTEMAS

19. BIOQUMICA DE SISTEMAS

19.1. Sistema inmunolgico

El medio interno de una clula o de un individuo pluricelular mantiene una composicin constante
de sus constituyentes. Los procesos involucrados en este fenmeno se conocen como homeostasis.
Participan en la homeostasis de un individuo pluricelular una gran cantidad de fenmenos y
sistemas. Los sistemas ms importantes en los referente a la homeostasis son los sistemas:
a- endocrino
b- nervioso
c- inmunolgico.
El sistema inmunolgico participa en procesos de defensa, junto con otros procesos. Existen
respuestas inespecficas y especficas de defensa del sistema inmunolgico.

19.1.1. Respuesta inespecfica

Dentro de las respuestas inespecficas tenemos a las barreras anatmicas, como la piel y las
mucosas. La piel con su estrato keratinizado, la melanina y la produccin de sus glndulas ofrece
resistencia a la invasin por agentes externos fsicos, qumicos y microbiolgicos. Las mucosas
secretan sustancias con accin bactericida (como la enzima lisozima), producen moco, presentan
cilias, secretan cidos que disminuyen el pH, como ocurre en el estmago y la vagina. Tanto en la
piel como en las mucosas existen microorganismos normales que tambin participan en la defensa
contra agresores externos. Otro mecanismo de defensa inespecfico es la respuesta inflamatoria, que
puede ser local o sistmica. En la respuesta local a un agresor se produce luego de la lesin,
liberacin de histamina por clulas polimorfonucleares. Como consecuencia se produce
vasodilatacin, que conduce a aumento del flujo sanguneo local, enrojecimiento y aumento de la
temperatura. Aumenta la permeabilidad vascular, conduciendo a edema. Otro fenmeno es la
quimiotaxis que atrae al sitio de inflamacin leucocitos polimorfonucleares que actan
fagocticamente. Tambin la salida de los vasos de los monocitos es un fenmeno que acompaa a
la inflamacin. Los macrfagos produce interleukinas que actan induciendo y estimulado una
respuesta especfica. Si la inflamacin se hace sistmica, se produce un aumento de la sntesis de
protenas hepticas, fiebre y aumento de los glucocorticoides. Se conoce al fenmeno como
respuesta de fase aguda.

19.2. Respuesta inmune

La respuesta inmune es especfica o adaptativa. En ella participan clulas especficas y protenas.


De alguna manera todas las clulas del organismo participan en esta respuesta:
1- clulas somticas
2- Linfocitos T (LT)
3- Linfocitos B (LB)

289
BIOQUMICA DE SISTEMAS

4- Clulas presentadoras de antgenos (CPA)


5- Clulas NK
Con respecto a las protenas:
1- Antgenos (Ag)
2- Anticuerpos o inmunoglobulinas (Ac)
3- Citoquinas
4- Protenas del complemento
5- Protenas del complejo mayor de histocompatibilidad (CMH)
6- Receptores.

Clulas somticas
Las clulas nucleadas tiene en su membrana protenas del sistema mayor de histocompatibilidad
clase I (CMH I). Estas clulas a travs de CMH I indicarn a las clulas del sistema inmune si su
estructura ha cambiado o la clula ha sido invadida.

Linfocitos T
Los linfocitos T presentan un receptor (TCR) que se asocia a protenas (CD3) y participa en el
reconocimiento de antgenos. Existen diferentes poblaciones: linfocitos T colaboradores o helper,
conocidos como clulas Th, los linfocitos T citotxicos o Tc, y los linfocitos T supresores o clulas
Ts. Los Th se caracterizan por tener en su membrana la protena CD4, por lo que se dice que son
CD4 +. Las clulas Th se dividen en Th1 y Th2, mientras las primeras participan en la activacin de
macrfagos y la respuesta inflamatoria, los Th2 estimulan a los linfocitos B y la respuesta humoral.
Los Ts y Tc tiene la protena CD8, son CD8 +. Las clulas Ts tienen un efecto inhibitorio de la
respuesta inmune luego que la agresin desapareci.
Estas clulas se originan en la etapa embrionaria a partir de clulas precursoras en la mdula sea,
migran al timo donde son seleccionadas y sufren diferenciacin a Th1, Th2, Tc y Ts.

Linfocitos B
Estas clulas tienen en su membrana inmunoglobulinas de tipo D (IgD) y M (IgM). Adems
producen IgM e IgG soluble como respuesta a la entrada de una antgeno. Los linfocitos B se
originan en mdula sea a partir de precursores linfoides, durante su diferenciacin sufre
reordenamiento del ADN que les permite expresar en su membrana un nico tipo de IgD o IgM.
Luego migran a sangre y se alojan en ganglios, amgdalas, placas de Peyer, bazo y apndice.

Clulas presentadoras de antgenos


Estas clulas presentan en su membrana protenas del complejo mayor de histocompatibilidad tipo
II (CMH II). Pertenecen a este grupo los macrfagos, las clulas dendrticas y los linfocitos B.

Clulas NK
Constituyen el 15% de los linfocitos circulantes. No son Linfocitos B ni T. Participan en una
respuesta celular eliminando clulas agresores.

290
BIOQUMICA DE SISTEMAS

Antgenos
Son molculas que en general son diferentes a las molculas de un individuo. Pueden actuar como
antgeno las protenas, lpidos, cidos nucleicos y carbohidratos. Dentro de una molcula son
reconocidas ciertas partes que se conocen como eptopes.
Un antgeno puede ser tambin una molcula del propio individuo que sea expuesta al sistema. En
ambos casos para que un antgeno sea reconocido debe ser presentado a los linfocitos T. Este
proceso se lleva a cabo por las clulas somticas y presentadoras de antgenos, que exponen al
antgeno junto a las protenas del CMH.

Anticuerpos
Los anticuerpos o inmunoglobulinas estn constituidos por un monmero bsico cuyo peso
molecular es aproximadamente 150KDa. Se lo llama monmero pero en realidad esta molcula est
compuesto por dos cadenas polipeptdicas pesadas (H) y dos cadenas livianas (L). Aunque esta
protena tiene estructura cuaternaria, se la llama monmero, ya que la misma puede hallarse como
dmero o pentmero en algunos isotipos de las inmunoglobulinas.
Las cadenas pesadas y livianas tiene puentes disulfuro intracatenarios. A su vez estn unidas entre s
por puentes disulfuros intercatenarios.
Existen cinco isotipos conocidos como IgA, IgD, IgE, IgG e IgM. Las cadenas livianas pueden ser
de dos tipos (kappa: y lambda: ), independiente del isotipo. Por otro lado las cadenas pesadas
pueden ser de cinco tipos (alfa:, delta: , psilon: , gama: , mu:). y son las que caracterizan al
isotipo. La tabla siguiente muestra el isotipo, la cadena pesada y la localizacin de cada
inmunoglobulina
isotipo cadena ubicacin
pesada
IgA circulante, secreciones
IgD membrana LB
IgE alergia
IgG circulante, respuesta secundaria.
IgM circulante. respuesta primaria. membrana LB

Tanto las cadenas livianas como las pesadas poseen zonas variables y zonas constantes. Las zonas
variables son regiones de la protena que difieren de una inmunoglobulina a otra, aun dentro del
mismo isotipo.
En cambio las regiones constantes son iguales dentro de un isotipo. Las zonas variables de las
cadenas pesadas y constantes se representan como VH y VL. Las zonas constantes de las cadenas
livianas se representan con CL, por otra parte las cadenas pesadas tambin tiene zonas constantes
que se representan con CH1, CH2, y CH3 (Figura 19.1).

291
BIOQUMICA DE SISTEMAS

VH1
CH1 Fab
VL
CL -S-S-

CH2
Fc
CH3

Figura 19.1

La inmunoglobulina se divide en tres regiones: Fab, Fc y regin bisagra.


El Fab contiene las zonas VL, VH, CL y CH1 . En las zonas variable de la regin Fab se encuentra el
sitio de reconocimiento del antgeno y se lo conoce como paratope. El Fc es la zona de unin a
membrana o a protenas del complemento y contiene las regiones C H2 y CH3 de las cadenas pesadas.
La regin bisagra es el nexo entre Fab y Fc.
Este monmero bsico da origen a los diferentes isotipos (Figura 19.2).

292
BIOQUMICA DE SISTEMAS

IgA IgDmIgE IgG


-S-S- -S-S- -S-S- -S-S-

IgAs dominio union a membrana

IgM
-S-S-

-S-S-

J
-S

-S
-S

-S
-

-S-S-
J
-
-S
-S

-
-S
-S

Figura 19.2

Las IgA son inmunoglobulinas que se encuentra circulantes en sangre al estado monomrico y en
las secreciones de mucosas al estado dimrico (IgAs). Las dos molculas se unen por un pptido J.
Es una molcula divalente.
Las IgD se encuentran unidas a la membrana del LB y presentan en su regin Fc un dominio de
unin a membrana (IgDm).
Las IgE son monomricas, al igual que las IgG.
Por otra parte las IgM son pentamricas, presentando cinco unidades del monmero ligadas por su
regin Fc a travs de un pptido J.

19.2.1. Complejo mayor de histocompatibilidad


Son protenas producidas por varios genes, cada uno con un gran nmero de alelos. Adems existe
elevado polimorfismo de los mismo lo que determina que slo puedan existir protenas iguales en
los gemelos. Las protenas del CMH son como huellas dactilares.
Existen dos complejos: el CMH I que se encuentra en todas las clulas nucleadas del organismo y
el CMH II que se encuentra en LB y clulas presentadoras de antgeno.
El CMH I es un grupo de protenas de membrana que presenta un sitio en que se unen pptidos que
surgen del procesamiento de protenas extraas a las clulas y que sirve para presentar estas
protenas a las clulas Tc. El CMH I est formado por dos cadenas polipeptdicas: cadena alfa y

293
BIOQUMICA DE SISTEMAS

beta-2-microglobulina.
El CMH II est formado por dos cadenas: alfa y beta y presenta un sitio en que son presentado a las
clulas Th los pptidos provenientes de la degradacin de antgenos que interactuaron con Ig de
membrana de los linfocitos B o fueron fagocitados por las CPA.

Respuesta primaria a un antgeno soluble


Cuando un antgeno ingresa por primera vez, se une las IgM o IgD de la membrana de linfocitos B,
Figura 19.3.

Ag
LB

CMH II CMH II

CD3 LT
CD3 FAGOCITOSIS
COMPLEMENTO
CD4 CD4

PLASMOCITO

CELULA DE MEMORIA
Figura 19.3

En este proceso slo responder el tipo de linfocitos cuyos anticuerpos de membrana reacciona
con el antgeno. Los linfocitos B tienen en su membrana protenas del CMH II, el antgeno ser
expuesto junto a estas protenas. El linfocito Th2 que expresa en su membrana CD4, CD3 y TCR se
unir al CMH II y el antgeno. Esta interaccin determina que el linfocito T produzca citoquinas que
favorecern la transformacin del linfocito B en plasmocito.
El plasmocito comenzar a producir gran cantidad de anticuerpos solubles, primero de tipo IgM y
luego IgG. Estas inmunoglobulinas se comienzan a detectar a partir de la semana del ingreso del
antgeno. Estos anticuerpos reaccionarn con el antgeno produciendo su aglutinacin y
opsonizacin, procesos que conducirn a su fagocitosis y/o la activacin del complemento. A su vez
la interaccin del antgeno con el linfocito B, determina que ste se diferencia a clulas de memoria,
cuya vida es ms prolongada que el linfocito B.

294
BIOQUMICA DE SISTEMAS

Respuesta secundaria al antgeno soluble


Luego de la respuesta primaria, permanecen en circulacin clulas de memoria inmunolgica
(Figura 19.4).

Ag

CMH II CMH II

CELULA DE MEMORIA
FAGOCITOSIS
COMPLEMENTO

PLASMOCITO

Figura 19.4
Si el antgeno ingresa por segunda vez, estas clulas se activarn y diferenciarn a plasmocito
produciendo en este caso poca cantidad de IgM y gran cantidad de IgG, en un perodo de tiempo
ms corto que la respuesta primaria. Las inmunoglobulinas se detectan a partir del segundo da de
ingreso del antgeno.

Respuesta a un antgeno fagocitado


Cuando un antgeno ingresa a nuestro organismo puede ser fagocitado por clulas presentadoras de
antgenos (CPA), Figura 19.5.

295
BIOQUMICA DE SISTEMAS

FAGOCITOSIS Ag
CPA

CMH II CMH II

CD3 CD3 LTh

CMH II CD4
CD4

interleukinas macrofagos, NK, Tc respuesta celular

respuesta humoral
LB Ig
Figura 19.5

A este grupo de clulas pertenecen los macrfagos, clulas dendrticas y linfocitos B. Los antgenos
son procesados por proteolisis, generando pptidos que se exponen en la superficie externa junto a
las protenas del CMH II. Los linfocitos Th se unen a la clula presentadora de antgeno, por
interaccin entre el receptor TCR, las protenas CD4 y CD3 del linfocito con el CMH II de la CPA.
La clula T se activa y produce citoquinas que activarn a linfocitos B, de manera que estos
producirn anticuerpos, iniciando una respuesta humoral contra el antgeno. Por otro lado las
citoquinas estimulan a los macrfagos, clulas NK y clulas T citotxicas. Las clulas mencionadas
iniciarn contra el antgeno un respuesta celular.

Respuesta a una clula infectada por virus


Cuando una clula somtica es infectada por un virus o sufre cambios en sus protenas. Se produce
procesamiento de las protenas virales o de las protenas de la propia clula, luego los pptidos
provenientes de la hidrlisis son expuestos junto a las protenas de CMH I (Figura 19.6). El
linfocito T citotxico reconoce estas protenas por su receptor TCR y CD3.

296
BIOQUMICA DE SISTEMAS

celula virus, bacteria


somatica

CMH I CMH I

CD3 LTc
CD3

CD8 CD8
CD3
LTc memoria
CD8
perforina
granzima citoquinas
fragmentina lisis

fagocitosis macrofagos

Figura 19.6
Esta interaccin determina que se originen clulas Tc de memoria que actuarn en futuras
infecciones y que adems produzca citoquinas y protenas. Las protenas producidas son: perforina,
granzima y fragmentina. La perforina se adhieren a la clula infectada produciendo un poro en su
membrana, por el que ingresan electrolitos y agua. La granzima y fragmentina producen hidrlisis
de protenas, determinando de esta manera la lisis celular.
Por otro lado las citoquinas actuarn sobre macrfagos, atrayndolos de manera que se produce la
fagocitosis de los restos celulares.

Sistema del complemento


Este sistema consiste en un gran nmero de protenas con actividad enzimtica, que se hallan al
estado de zimgenos. Las enzimas pueden activarse por dos vas, pero ambas conducirn a que se
produzca un poro en la membrana celular de microorganismo invasores, de manera que se produzca
la lisis de los mismos.
El sistema del complemento se puede activar por dos vas: clsica y alternativa. La va clsica se
produce por unin de inmunoglobulinas de tipo IgG o IgM a antgenos de la membrana del
microorganismo. La regin Fc de la inmunoglobulina se une a componentes de este sistema
produciendo una activacin de las dems protenas que culminan formando un poro sobre la
membrana del microorganismo, por el que ingresa agua y electrolitos, produciendo la lisis. La va
alternativa se activa por interaccin con macromolculas extraas, el resultado final es el mismo, la
lisis de la clula agresora.

297