1) Ploidy of PEN is triploid.

2) Explant is transfer (living cells, tissues, or organs) from animals or plants to a nutrient medium.
3) Alexander Oparin's and J. B. S. Haldane's hypothesis that putative conditions on the primitive Earth favoured chemical
reactions that synthesized more complex organic compounds from simpler inorganic precursors.
4) Restriction enzymes are molecular scissors that cut DNAinto pieces.
5) 5 ATGCATGCATGCATGCATGC 3
6) Sertoli And Leydig Cells
7) Histones are a family of basic proteins that associate with DNA in the nucleus and help condense it into
chromatin. Nuclear DNA does not appear in free linear strands; it is highly condensed and wrapped
around histones in order to fit inside of the nucleus.
8) Inbreeding depression is the reduced biological fitness in a given population as a result of inbreeding, or
breeding of related individuals. Factors reducing inbreeding depression :-
Selection of heterozygosity,
Polyploidy
Purging selection
9) Key elements in this search for ecological understanding relate to measuring and characterizing different patterns
of population fluctuation, theoretical modeling of hypothetical processes and mechanisms that can cause cycles
or other patterns of population fluctuation
10) Primary productivity of organic oceans is very low as the availability of light, mineral nutrients pose a great
challenge to the productivity of oceans and even though it constitutes 70% of the earths surface, it is less
productive than land
11) A fertilized egg is called a zygote until it divides into 16 cells, forming a ball-shaped structure called a morula. The
events during the zygote stage involve the integration of both parents' DNA into the cell nucleus and the
beginning of rapid cell division, or cleavage. In humans, it takes about four days for a zygote to become a morula
and another three days until the embryo attaches itself to the mothers uterine wall.

12)

12)

14)

15)
16)

18)

19) Decomposition of dead remains or matter of animal and plant is carried out by microorganisms like bacteria, fungi,
etc. The soil pH affects the composition of acidophilic and basophilic microorganisms.
Decomposition is largely an oxygen requiring process. In the presence of oxygen, complete degradation of
substance occurs while in the absence of oxygen, there will be an incomplete degradation. Similarly, temperature
and soil moisture are important as warm and moist environment favour decomposition whereas low temperature
and anaerobiosis inhibit decomposition resulting in build up of organic materials.

20) The five breeding systems are:

(1) Random mating,

(2) Phenotypic assortive mating,

(3) Phenotypic dissortive mating,

(4) Genetic assortive mating and

(5) Genetic dissortive mating.

21)

(1)