Вы находитесь на странице: 1из 97

Marcadores moleculares

Raul Blas, 2010


Facultad de agronomia
Dpto. Fitotecnia
rblas@lamolina.edu.pe
Marcador
Que marca (seal que se pone a una persona o cosa para
reconocerla), marca registrada

Marker (Cambridge, 2002)


a sign wich shows where something is.
an action which is understood to represent or show a
characteristic of a person or thing or feeling.
Qu es un marcador?
Un marcador es considerado como un
carcter cuyo patrn de herencia puede
definirse en un nivel morfolgico (fenotpico),
bioqumico o molecular.
Se asocian marcadores con caracteres, para
esclarecer la probabilidad de relacin entre
un locus genticos y un carcter determinado
Marcadores moleculares

Desde el punto de vista de un anlisis de


relacin gentica los marcadores moleculares
son:

Puntos especficos fijados a un cromosoma

La herencia es completamente Mendeliana


Gentica
Primera ley de Mendel?

En un diploide los dos


Alelos de un gen segregan en los
gametos con igual frecuencia

individuo: Aa gametos: A 50%, a 50%


Primera ley de Mendel y frecuencias F2?
F1 F1: Aa Aa

gametos f1 macho
gametos f1

1/2A 1/2a
hembra

1/2A 1/4AA 1/4Aa


1/2a 1/4Aa 1/4aa

F2:
1/4AA 2/4Aa 1/4aa (codominante)
3/4A- 1/4aa (A dominante)
F2: AA 1/4 Aa 2/4 aa 1/4 (codominante)
A- 3/4 aa 1/4 (A dominante)

No se puede distinguir AA o Aa

Como se interpreta esto con marcadores moleculares:

AA Aa aa AA Aa aa

Dominante Co-dominante
Tipos de marcadores genticos
1. Marcadores morfolgicos (Efecto combinado de
muchos genes y el ambiente).

Caracteres morfolgicos son los ms antiguos y


ampliamente usados.
Son profundamente afectados por fluctuaciones
ambientales y por las etapas de desarrollo de la planta,
as como por el vasto nmero de individuos a analizar.
Marcador morfolgico
Visualizacin de los
Fragmentos Amplificados

1 2 M 1 2 M

Polimorfismo
Marcadores moleculares
Cualquier seal o traza molecular que nos permite estudiar un caracter
(Fenotipo) o gen (Genotipo) asociado a este, y de herencia mendeliana
(Marcador Gentico) y detectada como secuencias de ADN o protenas
Deteccin de variabilidad a nivel de secuencias de ADN.
Fuentes de origen de MM
1. ADN cromosmico (genmico)
ADN codificante
ADN no codificante
ADN altamente repetido
2. ADN extracromosmico
ADN mitocondrial
ADN de cloroplastos
AFLP RAPD SSR
Procedimientos Generales en el uso de MM:

1. Extraccin de DNA
2. Generacin de polimorfismo
Enzimas de restriccin
Reaccin PCR
Combinacin de los 2 anteriores (enzimas de
restriccin y PCR)
3. Electroforesis (horizontal, y/o vertical)
4. Deteccin de los fragmentos
Sondas marcadas
Bromuro de etidio, UV
Quimioluminiscencia
tincion en plata
5. Autoradiografa y/o fotografia
6. Evaluacin de los fragmentos
7. Anlisis estadstico
Aislamiento de DNA
Moler hojas
+ cloroformo Transferir sobrenadante

Eliminar isopropanol,
Disolver en H20, TE
DNA

Proteina/polisacaridos
CTAB

Marcos Malosetti, 2007 Wageningen University


Conceptos

Enzimas de restriccin (Endonucleasas): Son protenas


que reconocen secuencias cortas de nucletidos
especficas y cortan ADN en esas zonas.

Pst I

ADN
Iniciadores (Primers): Es una secuencia corta de cido
desoxirribonucletido (ADN) que se ancla a una hebra del
ADN molde. El cual se requiere para la sntesis de ADN in
vitro (reaccin de polimerizacin), ya que la ADN polimerasa
solo no es capaz de iniciar la polimerizacin de ADN .
RAPD 10-mer Set A RAPD 10-mer Set B
Tube A-01 5'-CAGGCCCTTC-3' Tube B-01 5'-GTTTCGCTCC-3'
Tube A-02 5'-TGCCGAGCTG-3' Tube B-02 5'-TGATCCCTGG-3'
Tube A-03 5'-AGTCAGCCAC-3' Tube B-03 5'-CATCCCCCTG-3'
Tube A-04 5'-AATCGGGCTG-3' Tube B-04 5'-GGACTGGAGT-3'
Tube A-05 5'-AGGGGTCTTG-3' Tube B-05 5'-TGCGCCCTTC-3'
Tube A-06 5'-GGTCCCTGAC-3' Tube B-06 5'-TGCTCTGCCC-3'
Tube A-07 5'-GAAACGGGTG-3' Tube B-07 5'-GGTGACGCAG-3'
Tube A-08 5'-GTGACGTAGG-3' Tube B-08 5'-GTCCACACGG-3'
Tube A-09 5'-GGGTAACGCC-3' Tube B-09 5'-TGGGGGACTC-3'
Tube A-10 5'-GTGATCGCAG-3' Tube B-10 5'-CTGCTGGGAC-3'
Tube A-11 5'-CAATCGCCGT-3' Tube B-11 5'-GTAGACCCGT-3'
Tube A-12 5'-TCGGCGATAG-3' Tube B-12 5'-CCTTGACGCA-3'
Tube A-13 5'-CAGCACCCAC-3' Tube B-13 5'-TTCCCCCGCT-3'
Tube A-14 5'-TCTGTGCTGG-3' Tube B-14 5'-TCCGCTCTGG-3'
Tube A-15 5'-TTCCGAACCC-3' Tube B-15 5'-GGAGGGTGTT-3'
Tube A-16 5'-AGCCAGCGAA-3' Tube B-16 5'-TTTGCCCGGA-3'
Tube A-17 5'-GACCGCTTGT-3' Tube B-17 5'-AGGGAACGAG-3'
Tube A-18 5'-AGGTGACCGT-3' Tube B-18 5'-CCACAGCAGT-3'
Tube A-19 5'-CAAACGTCGG-3' Tube B-19 5'-ACCCCCGAAG-3'
Tube A-20 5'-GTTGCGATCC-3' Tube B-20 5'-GGACCCTTAC-3'
La reaccin en cadena de la Polimerasa (Polymerase
Chain Reaction - PCR): Es una tcnica in vitro de
amplificacin enzimtica del ADN. Mediante el cual
se obtiene millones de copias de secuencias
especficas del genoma de un organismo.
ciclos, consta de 3 pasos:
1. Denaturacin: es una denaturacin termal de la
muestra de ADN, a 94- 95C.
2. Anclaje de iniciadores (Renaturacin): la
temperatura de la mezcla es enfriada hasta los 35-
60C.
3. Sntesis (polimerizacin): La temperatura es elevada
a 70 - 85 C, la temperatura ptima (72C)
Los componentes de amplificacin para la reaccin
PCR son:
primers sintticos, que son regiones
complementarias a las cadenas opuestas
que flanquean a la regin de ADN blanco
que se desea amplificar.
Una secuencia blanco en una muestra de
ADN
Una enzima, la ADN Polimerasa
termoestable que pueda resistir altas
temperaturas de calentamiento (95 C a
ms).
Los cuatro deoxiribonucletidos (dNTPs).
Un buffer para darle las condiciones
adecuadas al sistema en conjunto.
2x-2x, x= nmero ciclos
Preparacin de gel para electroforesis
Electroforesis: Es el movimiento de una partcula cargada
(ion) en un campo elctrico. El movimiento se realiza en
medio lquido que est sostenida por sustancia slida inerte,
como papel o gel semislido.
Sistema de marcadores DNA
probe
*******
Basados en hibridacin DNA

RFLP, VNTR,
oligonucleotide fingerprinting

Basados en amplificacin DNA


RAPD, DAF, AFLP, SSR,
MP-PCR, ISSR, IRAP, REMAP,
STS, SCAR, CAPS

ATTAGTCTTACCTAGGAATCGATT
Basados en secuenciamiento TAATCAGAATGGATCCTTAGCTAA
EST, SNP,
DNA microarray

Gupta et al., 1999


Tipo de polimorfismo

Alta resolucion:
Al nivel de par de bases

Baja resolucion:
Al nivel de fragmentos
de restriccion o
fragmentos amplificados
RFLP
RAPD
AFLP
SCAR
CAPS
SSR
i-SSR
RFLP
DNA genmico

+ Enzimas de restriccin = digestin

Papel toalla
Electroforesis en
geles de agarosa Membrana
Gel

Esponja

Southern Blot

Perfil de polimorfismo
obtenido Hibridacin Membrana con
con sonda DNA transferido
RFLP
Esta tcnica se vale de la capacidad que tienen las enzimas de restriccin para
poder reconocer secuencias especificas a lo largo del genoma, de modo que una
mutacin puntual dentro del sitio de restriccin resultar en la prdida o ganancia
de una secuencia de reconocimiento, dando origen a un fragmento de restriccin
de diferente longitud a la del original.
Las mutaciones causadas por una insercin, delecin o inversiones en el DNA
tambin llevan a variacin en la longitud de los fragmentos de restriccin.
Los fragmentos del genoma generados por las enzimas de restriccin son
separados en un gel de agarosa para luego ser transferidos a un soporte slido
que puede ser una membrana de nylon o nitrocelulosa.
La transferencia de los fragmentos de DNA desde la matriz de agarosa hasta la
membrana se realiza por capilaridad.
Una vez que se encuentran en el soporte slido, el DNA digerido y separado,
puede ser hibridizado con una sonda (DNA de una sola hebra) que debe estar
marcada para su fcil deteccin.
La sonda se hibridar en el lugar donde encuentre la zona complementaria a su
secuencia. Para hacer visible el lugar donde se ha hibridado la sonda, sta debe
tener algn tipo de seal (marcaje)
Obtencin de marcadores
RFLP.
RAPD
Random Amplified
Polymorphic DNA

Amplificacin de ADN annimo con


cebadores de secuencia arbitraria
RAPD: iniciaodores unicos , cortos y aleaoritos

Temperatura de Hibridizacion: 36-42C


Consiste en la amplificacin mediante PCR de un ADN annimo,
utilizando para ello un cebador de secuencia arbitraria
Normalmente se usa un solo iniciador de 10 nucletidos de longitud
RAPD:AMPLIFICA MULTIPLES REGIONES
(MULTILOCI)
Correspondencia entre fragmentos
amplificados y bandas en un gel
_

+
Los RAPDs son marcadores dominantes
A A 1 2 3
1

A a
2 AA Aa aa

a a
3
Ventajas
Requiere baja cantidad de DNA
Facil de obtener
Aplicabilidad a cualquier genoma
Bajo costo
Desventajas
Problemas de reproducibilidad
Presencia de homoplasia en las bandas
Nivel de informacin limitada debido a su
naturaleza dominante (no se puede diferenciar un
heterocigoto de un homocigoto, el locus se reduce
a un solo alelo)
RAPD (Random Amplified Polymorphic DNA)

Reaccion PCR
Primers deben encontrar
secuencias
complementarias entre
200 2500 pb
Tincion (bromuro de
etidium)
RAPD
Reaccion PCR

Electroforesis
Tincin y visualizacin de los fragmentos de amplificaci

Polimorfismo con la
tcnica RAPD
AFLPs
Amplified Fragment
Length Polymorphism
Metodologa de obtencin de Marcadores AFLP
ADN Genmico
Eco RI Mse I

Digestin
Eco adapter Mse adapter

Ligacin
Eco primer
N
PCR1:Preamplificacin
N
Mse primer

Eco primer
Pcr2:Amplificacin NNN

selectiva
NNN
Mse primer

Electroforesis

Autoradiografa
Tincin Nitrato de plata
Principios de la tcnica AFLP
GAATTC TTAA
1. Digestin del
ADN Genmico
CTTAAG AATT
Eco RI Mse I

AATTC T Liberacin de fragmentos con


terminales Eco RI y Mse I
G AAT
2. Ligacin con
TA adaptadores de
TTAA secuencia conocida
Adaptador Eco RI Adaptador Mse I
Adaptador EcoRI: 5-CTCGTAGACTGCGTACC Adaptador Msel: 5-GACGATGAGTCCTGAG
CATCTGACGCATGGTTAA-5 TACTCAGGACTCAT-5

AATTCN NTTA
TTAAGN NAAT
Primer EcoRI+1(E+1): 5-GACTGCGTACCAATTCN Primer Msel+1 (M+1): 5-GATGAGTCCTGAGTAAN

5 T 3. Amplificacin preselectiva
AATTCN NTTA
TTAAGN NAAT
G 5

AATTCTNN NNCTTA
TTAAGANN NNGAAT
4. Amplificacin selectiva
5 TTG
AATTCTNN NNCTTA
TTAAGANN NNGAAT
AGG 5

AATTCTTG TCCTTA
TTAAGAAC AGGAAT

Electroforesis en geles de poliacrylamida


Obtencin de
marcadores AFLP

Polimorfismo en
Arracacha, segn la
combiancin de los
iniciadres E-AAC/M-CTT.
Ventajas
Reproducibles
Elevado nmero de bandas obtenidas por gel
No se necesita informacin previa para su
desarrollo (sondas o iniciadores especficos)

Desventajas

Presencia de homoplasia en las bandas


Nivel de informacin limitada debido a su
naturaleza dominante
Raul Blas
SSR
Simple Sequence Repeat
Sinnimos

Microsatlites
STR - Short Tandem Repeat
STMS - Sequence Tagged Microsatelite Site
SSLP - Simple Sequence Length Polymorphism
Que son microsatlites?
Fragmentos de ADN formados por unidades repetitivas
de secuencia simple.
Estas unidades o motivos se componen de 1 a 6 pares
de bases y su grado de repeticin es relativamente bajo.
Se utilizan un par de iniciadores (20 pb aprox) para su
amplificacin

TTTTTTTTTT = T10 Mononucleotido


AGAGAGAGAGAG = AG6 Dinuclotido
CATCATCATCATCATCAT = CAT6 Trinucleotido
TAGTTAGTTAGTTAGTTAGTTAGT = TAGT6 Tetranucleotido
(TC)14
ADN
genmico

Microsatlite
......CAGCCCGTAAATGTATCCATCATTAGCTTTCGATAAAGACCATCT C TCTCTCTC TCT CTC TCTCTC T CT CTGTGAAACCCAGTTGAATTAGAATTTTGAATTT......
......GTCGGGCATTTACATAGGTAGTAATCGAAAGCTATTTCTGGTAGAGAGAGAGAGAGAGAGAGAGAGAGAGACACTTTGGGTCAACTTAATCTTAAAACTTAAA......
OBTENCION DE MICROSATELITES
http://www.personal.psu.edu/faculty/j/e/jec16/Image02.htm
Tipos de SSR
n, m y r = nmero de
Perfectos: (CA)n repeticiones del
Imperfectos: (CA)n CCA (CA)m motivo
Compuestas: (CA)n (TG)m
Compuesta interrumpido: (CA)n TG-(TG)m
Compleja: (CA)n TG-(TG)m (TA)r

GTn los mas extendidos en genoma de mamferos


Atn la mas extendida en genoma de vegetales
GAn mas abundante en cebada y arroz
Marcadores microsatlite 2. Electroforesis en geles
Etapas de la tcnica SSR incluyen: Poliacrilamida o agarosa (casos
muy limitados)

1000 pb

1. Reaccin
PCR, con dos 100 pb
iniciadores F1 F2 F3 F4 F5
M P1 P2 1 2 3 4 5 6
stop 1 2 3

especificos para
4 5 6
7 8 9
Gene Amp enter 0 ce

IBT

un locus SSR

I I
I
II II
II
Huamani, 2008 III III
III
PCR en P1, 3 y 6 PCR en P2, 2 y 5 PCR en 1 y 4
DNA individuo 1 AT12
ATATATATATATATATATATATAT

Regin
Regin
conservada
Conservada
Iniciador 1
Iniciador 2

ATATATATATATATATAT
DNA individuo 2 AT9
Los SSR son marcadores codominantes

1
1 2 3 4 5

5
Extrategias de desarrollo de iniciadores SSR

1. Clonamiento, secuenciamiento y diseo de iniciadores


2. Identificacin de primers microsatlite a partir de
marcadores ISSR
3. Bsqueda de marcadores SSR en la base de datos del
Genbank.
4. Transferibilidad de otras especies afines (empleo de
iniciadores disponibles)
Ventajas
Poseen alta variabilidad en sus loci, apropiado
para los anlisis de diversidad gentica.
Se encuentran distribuidos por todo el genoma
permitiendo hacer un buen muestreo gentico
del material en estudio.
Desventajas
Su caractierizacion es especifica por especie
Su identificacion(descubrimiento) y hacerlo
usable es costoso. Requiere secuenciamiento de
librerias de DNA
Aplicacion de marcadores moleculares
Analisis de la diversidad genetica
Herencia y mapeo
Genes candidatos
Herramienta de seleccion: Seleccion
asisitida por marcadores moleculares (MAS)

Raul Blas, 2010


Fases sucesivas en la creacin de una
nueva variedad
1. Gestion de recursos
2. Cambios en los genotipos
3. Seleccin (seleccin estabilizadora),
4. Multiplicacin del genotipo mejorado
Mejoramiento genetico de plantas

Idiotipo
Biologia
Tecnologia
Mtodos de
Tiempo mejoramiento
Materiales Objetivos
Presupuesto
Contexto:
Agronomico
Industrial
Ganancia
Alimenticio
gentica
Poblaciones naturales, social
variedades nativas,
Fases sucesivas en la creacin de una
nueva variedad
1. Gestion de recursos genticos
2. Cambios en los genotipos
3. Seleccin (seleccin estabilizadora),
4. Multiplicacin del genotipo mejorado
Seleccin asistida por marcadores moleculares
Molecular assisted selection (MAS)
Es la seleccin indirecta por la presencia o
ausencia de un fenotipo o componente fenotpico
deseado, basado en la secuencia o patrones de
banda de los marcadores moleculares ubicadas
dentro o cerca de genes que controlan el fenotipo.
La secuencia polimorfico o patron de banda del
marcador molecular es indicativo de la presencia o
ausencia de un gen especfico o segmento
cromosomal que es conocido y que lleva un alelo
deseado.
Capel et al. (2000)
Molecular assisted selection (MAS)
Es la posibilidad de disponer de marcadores
ligadas a los genes implicados en la variacion de
los caracteres seleccionados.
MAS tiene los siguientes objetivos:
Dirigir las recombinaciones para acumular en
un mismo genotipo los genes o segmentos
cromosomicos favorables
Facilitar la seleccin (seleccin eficaz)
Aspectos a considerar en MAS

Distancia gentica (Mapas de ligamiento)


Marcadores asociados con caracteres de interes (<
5cM) (Kelly, 1995)
En algunos cultivos existen mapas bien definidos y
densos : Arroz, maiz, trigo, tomate, papa
Modo de herencia (Calidad marcador)
Codominantes (capacidad de identificar los genotipos)
Tipo de marcador
Material gentico
Generacin de un mapa gentico

Mapa gentico: Representacion de marcadores/


genes en los cromosomas (orden + distancias)
Requisitos:
poblaciones segregantes
Determinacin de los genotipos de los marcadores
Estimacin de las frecuencias de recombinacin entre
todos los pares de marcadores
Determinacin de grupos asociados
Determinacin el orden por grupo de asociacin
Tamao de la poblacin

Determinado por el numero de semillas y de marcadores


disponibles, es importante establecer el numero minimo de
individuos a utilizar para conocer la precision del calculo de las
frecuencias de recombinacion que permitan construir un mapa
fiable.
Usualmente la progenie a evaluar se cosntitule de >100 individuos
a fin de reducir el error estandar
Otros autores consideran suficiente un numero de 50 individuos
Poblacion de mapeo

Los descendientes mas usados tienen como punto de partida dos


parentales homocigotas, esto por cruzmiento produce f1 todos
identicos y heterocigotas para todo los locus que han sido fijados
alelos diferentes en los parentales
Se debe buscar parentales geneticamente bien alejadas para que el
numero de locus polimorficas no sean limitantes
Tres tipos principales de poblacion de cartografia pueden ser
derivados de estos cruzamientos
Tipos de poblaciones para mapeo
AA x BB

F1 AB
X duplicacion
X
F1xBB X X
X
X

BC1F1 F2 RIL DH

AB, BB AA, AB, BB AA, AB? BB AA, BB

Retrocruza: BC1F1
Poblacion segregante filial 2: F2
Lineas endogamicas recombinantes: RILs
Lineas de haploides duplicados: DH
Determinacin del orden
Ejemplo: Par Frecuencia de
Recombinacin
---- -------------
A-B 0.1
B-C 0.1
A-C 0.2
A B C
+----------+----------+
<- 0.1 -> <- 0.1 ->
<- 0.2 ->

No es posible otro orden!!!


Tres marcadores
Ejemplo con tres marcadores
0 Marcador 1

Tabla de conteo de recombinaciones


Marcador 1 <> Marcador 2 = 30
Marcador 1 <> Marcador 3 = 15
14 Marcador 3
Marcador 2 <> Marcador 3 = 20

Cules son las posibilidades?


15 30 20

M1 M2 M3 M1 M3 M2 M2 M1 M3
33 Marcador 2

30 20 15 20 30 15
Gebhart (2004)
Determinacion de sexo en
plantas

Phoenix dactylifera L
Ubicacion taxonomica:
Family:Palmaceae
Sub-family: Coryphyoideae
Tribe:Phoeniceae
Genus: Phoenix
El genero Phoenix, presenta ~ 12 especies, incluida
CONVERTIR LOS MARCADORES AFLP A SCAR
Secuenciar el fragmento y elaborar iniciadores especificos
SCAR
Sequence-characterized amplified regions

Aplicaciones
Bsqueda de co-dominancia
Seleccin asistida
Anlisis de asociacin
Aplicabilidad de marcadores PVY-LB
para mejoramiento
Objectivos:
Identificacin de clones con el gen Ry adg y Rysto para
inmunidad a PVY.
Identificacin de clones con genes R dem o R blb o QTLs (que
gobiernen un alto porcentaje de la resistencia observada) para
resistencia rancha (tizn).
Material vegetal
Se analiz en total 61 clones, mas 5 controles:
36 clones avanzados resistentes y/o
tolerantes a TT y PVY:
poblacin B3
poblacin LTVR
hibridos somaticos

25 cultivares nativos (Huanuco) de adg, gon y


phu:
14 clones resistentes a LB
11 clones susceptibles a LB
Mtodos:
Se utilizaron marcadores alelo-especficos (iniciadores-
SCARs, CAPs) seleccionados en CIP and Max Plant
Institute:
Identificacin de clones con resistencia a PVY
Se han identificado y validado 4 iniciadores:
Adg: RYSC3
stolon (M5, M6 y M17)
Primers and its sequences used in genotipes screening

Marker Ry-linked Primer Sequence


polymorphism name
RYSC3 3.3.3S 5-ATA CAC TCA TCT AAA TTT GAT GG-3
Adg23R 5-AGG ATA TAC GGC ATC ATT TTT CCG A-3
M5 MseI, Tru M5-m GCT GTT CAC AAT GGG AAC ATG G
M5-p CAT ACA AAC TAC TTC TAC CAC G
M6 Rsa I M6Rsa TCC GAA ATG TTT GGG CTG ACA TC
M6Taq AAG GGA TCC AAA AAG GTG GTT CA
M17 Pst I M17-m GAC TGC TTT CTC TCC ACG TGG C
M17-1 GAT CAC AGA TGT TTT ACC TTC GAT G
Resultados
Tamizado para PVY
Perfil de amplificacin para 14 clones (primer M5)
M M M

M= marcador de peso molecular (cada 100pb), la


flecha indica el marcador con un peso molecular de
400bp
... Tamizado para PVY
Perfil de amplificacin para 18 clones (primer M17)
Identificacion de genes para
resistencia a la rancha
Estrategia de trabajo para mapeo genetico

S. circaeifolium
S. phureja
Clon 618
x CIP-761030
(6b.25; 6b.39)

F1

plantulas (~300)

Analisis fenotipico Analisis molecular


selected
clones
AFLP SSR
92
invernadero campo

Analisis de datos, mapeo


Procedimiento para la aplicacion de MM en la
seleccion: MAS

Extraccion de DNA
PCR (amplificacion del marcador de interes)
Electroforesis
Visualizacion de DNA
Evaluacion de polimorfismo (lectura de geles)

Descarte de individuos sin alelo de interes


Plantas seleccionadas
Identificacin de progenies hibridas
MM como herramienta en Mejoramiento
Confiabilidad y repetibilidad
Marcadores con estrecho ligamiento a genes de
caracteristicas importantes
Muy importante para caracteristicas dificiles (aquellas
que no pueden ser facil o confiablemente medidos
usando metodologias tradicionales (e.g. resistencia a
nematodes)
Otros pueden no ser visibles o solo detectados en
plantas maduras
Otros son muy dificiles o costosas para el tamizado
La posibilidad de manejar poblaciones de
mejoramiento de gran tamao (en espacio reducido)
Limitaciones de la Tecnica MAS
Mapa genetico denso para el cultivo
Marcador ligado al gen (<5 cM)
Equipamiento
Tecnicos calificados para lab.
Produccin de semillas y uso de marcadores
moleculares

Caracterizacin de cultivares
Pureza gentica de cultivares
Identificacin de variedades

Dos cultivares de soya


Pureza gentica
Conclusion:
Marcadores moleculares pueden tener numerosas aplicaciones en
los diferentes fases de la seleccion:
Optimizacion de la conservacion de recursos geneticos
Seleccion de los parentales
Identificacion de alelos interesantes
Construccion de genotipos acumulando alelos interesantes
Finalmente, los MM dispone al mejorador para gestionar y
valorizar la variabilidad gentica
Consideracin

La seleccin asistida por marcadores y la


seleccin fenotpica tradicional no son estrategias
excluyentes y los programas de mejoramiento
gentico de mayor eficiencia se logran mediante
una combinacin de ambas estrategias.