Академический Документы
Профессиональный Документы
Культура Документы
(a) The following diagram represents the gel electrophoretic profiles of both the PCR amplified APC
DNA (top panel) and APC protein (bottom panel) isolated from white blood cells (WBCs) and colon
cancer cells of two individual patients. (A profile of the APC DNA and APC protein in a normal individual is
provided as a reference. Please note the intensity of the bands while answering this question).
Individuals Normal #1 #2 MW
Low
i. Explain why in the normal individual, the APC protein is detected only in colon cells
even though the APC DNA is present in both colon cells and WBCs.
All somatic cells in an individual have the same DNA and hence the same set of genes. However, each cell
type in an individual expresses only specific set of genes which regulate their shape, size and functions.
ii. One of these two individuals does not have FAP but still develops colon cancer. Given
Lower
the data above, which individual would this be? Explain how this individualMW got colon
cancer.
Individual #2 does not have FAP but sporadically develops colon cancer. This individual undergoes a
spontaneous somatic mutation of both alleles of APC genes in colon cells producing a non-functional APC
protein that leads to colon cancer.
iii. Complete the following table based on the information provided in the gel profile above.
(Use the symbols + to represent the wild-type allele of the APC gene, - to represent the loss of
function mutation and M to represent the gain of function mutation. The genotype of the APC
gene in a normal individual is provided as a reference).
Question 1 continued
(b) Vincristine is an inhibitor of microtubule assembly and is used as an important chemotherapeutic
drug. Explain how the disruption of microtubule assembly may prevent cancer cell growth.
Microtubules are required for the formation of spindle fibers during cell division that are required to pull the
sister chromatids towards the two poles. If these are disrupted the sister chromatids fail to separate properly thus
inhbiting cell division and making the cell non-viable. Thus the growth of tumor will be inhibited.
(c) During drug screening you identify two compounds A and B that have the potential to kill colon
cancer cells and normal cells as shown by the following graph.
50%
#1 #2 #3 #4
Compound concentration
Which of these two compounds is a better candidate for colon cancer treatment? Explain why.
Compound A will be a better choice since it has a larger therapeutic index i.e. The effective concentration of
compound A that is required to kill the cancer cells is far less compared to the concentration needed to kill the
normal cells.
(d) Many patients show signs of severe anemia as a side effect of chemotherapy and are prescribed
erythropoietin (EPO). EPO is a secreted protein, produced by the kidney, which binds to its receptor on
erythroid precursor cells and stimulates the formation of red blood cells (RBCs). Four different
mutations are described below. For each mutation, list whether the RBC production would increase,
decrease or not change in an individual that was homozygous for this mutation as compared to the
wild-type situation. Briefly explain your reasoning for each mutation.
i. A mutation in the EPO gene, which results in deletion of the signal sequence of the EPO
protein.
EPO will not be secreted by the kidney cells. RBC production will decrease.
ii. A mutation in the EPO receptor, which results in the deletion of its transmembrane
domain.
EPO receptors will not be expressed on the surface of erythroid precursor cells and will therefore not available
to bind to the EPO secreted by kidney. RBC production will decrease.
iii. A mutation in the EPO receptor that results in the deletion of its cytoplasmic domain.
EPO receptor will bind to the EPO. However in the absence of the cytoplasmic domain the signal will not be
propagated to the other component in the erythroid precursor cells that are required to promote cell
proliferation. RBC production will decrease.
iv. A mutation that results in a constitutively active promoter for the EPO gene.
EPO will be always be produced and available to bind to the EPO receptors on erythroid precursor cells to
increase RBC production.
Question 2
You are studying two characteristics in a plant; growth (slow or fast) and seed size (small or large). You
cross a true-breeding plant with large seeds and slow growth to a true-breeding plant with small seeds
and fast growth. All of the resulting F1 plants have small seeds and grow slowly.
(a) What are the genotypes of the true breeding parental plants? Use the nomenclature outlined below.
In each case, use the uppercase letter for the allele associated with the dominant phenotype and the
lowercase letter for the allele associated with the recessive phenotype.
For the seed size (i.e. large or small) use D or d to designate the alleles.
For the growth (i.e. slow or fast) use G or g to designate the alleles.
Parents Genotypes
Large seeds and slow growth ddGG
Small seeds and fast growth DDgg
(b) You then cross two of the F1 plants that have small seeds and grow slowly. If these two genes are
unlinked, about how many total offspring will you need to obtain 100 plants that have large seeds and
are fast growing?
1600
(c) You find that the two genes are linked, and plan to determine the map distance between the gene
that regulates seed size and the gene that regulates plant growth rate. You test cross an F1 plant to a
plant with large seeds that is fast growing. What are the genotypes and phenotypes associated with the
non-recombinant and recombinant progeny?
Question 3
(a) For the pedigree below, identify the most likely mode of inheritance and state the genotypes of the
numbered individuals in the following tables. (Note: The filled squares or circles represent the abnormal
phenotype. Assume that the unaffected people marrying into the family are homozygous for the wild type allele of
the gene. Use the letter A for the allele associated with the dominant phenotype, a for the allele associated
with the recessive phenotype. Assume complete penetrance).
1 2
Mode of inheritance:
Individuals Genotypes
#1 AA
#2 aa
#3 Aa
(b) Individual #4 in the pedigree below has an intestinal disease that shows an autosomal recessive
mode of inheritance. He marries a woman (#5) who develops Huntingtons disease that has an
autosomal dominant mode of inheritance. Their son (#6) had Huntingtons disease but not the
intestinal disorder. Furthermore, the gene that regulates the intestinal disorder is linked to the gene
involved in Huntingtons disease. (Note: Individuals with Huntingtons disease are shaded grey in the
pedigree below; stripes are used to represent the individuals affected by the intestinal disorder. Assume complete
penetrance).
4 5
6 7
? 8
i. Write the genotypes of the following individuals for both the disorders (Note: Use the
letters H or h to designate the alleles for the Huntingtons disease gene and the letters B or b to
designate the alleles of the gene associated with the intestinal disorder. In each case use the
uppercase letter for the dominant phenotype and lowercase letter for the recessive phenotype).
Individuals Genotypes
#6 HhBb
#7 hhbb
ii. What is the probability that Individual #8 is affected by both disorders, if the genetic
distance between the two genes is 10cM?
5%
Question 4
Her-2 is a gene that encodes a glycoprotein that is a member of the family of Epidermal growth factor
(EGF) receptor tyrosine kinases. Her-2 gene amplification is observed in 30% of breast cancers.
(a) In a breast cancer patient that over-expresses Her-2 gene, would you characterize the gene
encoding Her-2 protein as an oncogene, tumor suppressor gene or a proto-oncogene? Explain.
(b) From the choices given below, circle the molecule(s) that may be present in Her-2 receptor
glycoprotein.
(c) Breast cancer patients that show the amplification of the Her-2 gene can be effectively treated with
Herceptin, a monoclonal antibody that specifically binds to and prevents the dimerization of Her-2
receptors.
i. Based on your knowledge of immunology, each Herceptin antibody molecule can
potentially bind to how many Her-2 receptor molecules?
It has two antigen binding sites per molecule.
ii. The heavy and the light chains of the Herceptin antibody should join together to form an
intact functional antibody. Name the strongest type of interaction/bond that holds the
chains together to form an antibody.
Disulphide bond
(d) The following schematic represents the binding of Herceptin to the extracellular domain of the
Her-2 receptor. For simplicity only the side- chains of the important amino acids in the binding site are shown.
The C of each amino acids is indicated with an *.
NH3+ O-
Glu558
Arg50 * O
C * Her-2 receptor
Herceptin
O=C
OH CH
* Thr593
H N
103 H
Ser
* CH2-OH
CH3
Question 4 continued
Circle the strongest interaction that exists between
(e) The Glu558 of Her-2 protein is encoded by 5GAA3 codon. Write down the t-RNA anti-codon for
Glu558 and label its 5 and 3 ends.
3CUU5.
(f) You come across the following mutations of Glu558 in the Her-2 gene. For each mutation, explain
whether the binding of Herceptin with Her-2 protein will be disrupted. (Note: A table of 20 essential
amino acids and a codon chart is provided on the last two pages of this exam).
(g) Below are three different options for a hypothetical linear stretch of amino acids present in the
Her-2 receptor. For each option, the amino acids in Region 1 could represent a part of the
transmembrane domain that spans the lipid bilayer, and the amino acids in Region 2 represent a part of
the cytoplasmic kinase domain.
Region 1 Region 2
Option 1: lys-cys-gly-ala-val-trp-glu-lys-arg..
Option 2: leu-ala-gly-cys-ala-val-lys-tyr-glu..
Option 3: .gly-thr-tyr-ser-ala-glu-ala-his-met.
i. Which option(s) most likely includes a stretch of Her-2 receptor that spans the lipid
bilayer? Explain in one sentence why you selected this option.
Options 1 and 2 contain a stretch of amino acids stretch that comprises a part of the transmembrane domain
is comprised of only the hydrophobic amino acids that can span the hydrophobic lipid bilayer.
ii. Which option most likely includes a stretch of Her-2 receptor that can be
phosphorylated? Explain in one sentence why you selected this option.
Option 2 since it has tyrosine (in the cytosolic domain) that has a side-chain OH group where a
phosphate group can be added.
Question 5
Consider the following signal transduction pathway that is activated by the binding of EGF ligand to
its specific membrane receptor.
EGF ligand binds to the EGF receptor.
Ligand bound EGF receptors become active through phosphorylation and dimerization.
Active EGF receptor causes Ras to exchange its bound GDP for GTP and become active.
Active Ras activates the kinase cascade (RAF, MEK and MAPK) through phosphorylation.
This increases the expression of c-myc gene which promotes cell proliferation.
EGF Receptor EGF
RAS-GTP
Cytosol
RAF P
Plasma membrane
MAPK P MEK P
c-mycMAP
transcription
K Nucleus
Cell proliferation MAPK P
(a) Consider the following cells that have mutations in different components of the EGF signal
transduction pathway.
Mutant 1 (m1): Ras protein that continues to stay in its GDP bound form.
Mutant 2 (m2): RAF protein that lacks its kinase domain.
Mutant 3 (m3): EGF receptor that lacks its extracellular domain.
Mutant 4 (m4): MAPK that is constitutively phosphorylated at its active site.
Mutant 5 (m5): c-myc gene that has a constitutively active promoter.
Complete the table for each of the following cells. Indicate whether c-myc is expressed and state the
change in cell proliferation relative to wild type cells in the presence of EGF.
G2 G1
Phospho-Rb Rb
S
What two classes of enzymes can control the phosphorylation of the Rb protein?
Kinases and phosphatases. If a student writes cyclin/cdk or oncoproteins or GF that is worth partial credit.
(c) You construct a conditional mutant allele of Gene R (Rts), which is active at a low growth
temperature but is inactivated by higher (non-permissive) temperature. Using the cells with the Rts
mutation, you grow a synchronized cell culture (all cells are growing at same stage of cell cycle and at
exactly the same pace) and monitor the DNA content per cell over time, with the following results:
DNA 2
content
per cell (n)
1
S G2 M G1
*
0
Time
(i) On the diagram above, draw a box around one complete cell division cycle at the permissive
temperature.
(ii) Within the box you have drawn, draw vertical lines to separate the phases of the cell cycle,
and label each phase using the abbreviations: M, S, G1 and G2.
(iii) Draw a star within the appropriate box marking the phase of the cell cycle in which DNA
replication occurs.
(iv) The vertical arrow on the diagram above indicates the time at which you shifted the cells to
the non-permissive temperature. In what phase of the cell cycle is the activity of Gene R
required?
Either G1 or G1 to S transition phase
Question 6
The functional state of G proteins such as Ras depends on their binding to GTP or GDP. The schematic
below represents a GTP molecule. GTP is also used to build nucleic acids and as an energy source
equivalent to ATP.
*
*
*
(a) Circle the part(s) of this molecule that associates with and activates G proteins.
(b) Draw a box around all the parts of this molecule that are added to the growing chain of nucleic
acid.
(c) Make a triangle around the reactive group that forms a covalent bond with the incoming base of a
growing nucleic acid polymer.
(d) Name the molecule(s) that are produced from GTP if it is used as an energy source.
GDP+Pi
(e) Star the atom(s) that can form a hydrogen bond with the complementary nucleotide.
(f) Put an arrow(s) next to the part of this molecule that you would alter if it were to be used as a chain
terminator during DNA sequencing. For each arrow, indicate the change you would make.
The OH groups at 2 and 3 carbon position of the ribose sugar of GTP should be changed to deoxy
groups.
(g) The molecule represented in the schematic above can be a direct precursor of
Circle all that apply.
Carbohydrates Amino acids Proteins Cholesterol DNA
mRNA tRNA rRNA Phospholipids micro-RNA
(h) The following diagram represents a complex three-dimensional conformation of a micro RNA
(miRNA) molecule.
Top region
5
3
Region 2 Bottom region
Region 1
miRNA
Question 6 continued
i. Within Region 2, what bonds/interactions are primarily involved in stabilizing the
RNA structure?
Hydrogen bonds.
ii. In Region 1, if the sequence of the top region is AUGGCUAA, can you predict the % of
bases i.e. %A, %U %C and %G of the bottom region? Explain. (Note: Your choices are Yes/
No).
No since there is no complementary base pairing.
iii. In the Region 2, if the sequence of the top region is AUGGCUAA, can you predict the %
of bases i.e. %A, %U %C and %G of the bottom region? Explain. (Note: Your choices are
Yes/ No).
There is hydrogen bond formation between complementary bases, so we can predict the
% of bases as 3/8%U, %A, %C, 1/%G.
Question 7
Oncogenic mutations can result from DNA rearrangements or duplications. Below is a partial sequence
of two different genes. Gene 1 encodes a protein that is always expressed at high levels. Gene 2
encodes a growth stimulating protein that is only expressed when the cell has received growth
promoting signals. On occasion, Gene 2 gets positioned near the promoter for Gene 1. Some of these
DNA rearrangements allow an increase in expression of the growth-promoting Gene 2. This can result
in uncontrolled cell division. The direction of transcription is shown by an arrow.
Gene 1: expressed at high levels. A Partial sequence of gene 1 is shown below. The italicized and
underlined sequence represents the promoter.
1 10 20 30 40 50 60 70
I--------I---------I---------I---------I---------I---------I---------I
5 ATCGGTCTCGGCTACTACGTAAACGCGCGCATATATCGATATCTAGCTAGCTATCGGTCTCGGCTACTAC
3 TAGCCAGAGCCGATGATGCATTTGCGCGCGTATATAGCTATAGATCGATCGATAGCCAGAGCCGATGATG
80 90 100 110 120 130 140
---------I---------I---------I---------I---------I---------I---------I
5 GCATGTATCGATATAATCTAGCTAGCTTCTCTTCTCTCTCTCCCCCGCGGGGGCTAGTACTATGTATGGT
3 CGTACATAGCTATATTAGATCGATCGAAGAGAAGAGAGAGAGGGGGCGCCCCCGATCATGATACATACCA
150 160 170 180 190 200 210
---------I---------I---------I---------I---------I---------I---------I
5 CGTCTCGGCTACTACGTAAACGCGCGCATATATCGATATCTAGCTAGCTATCGGTCTCGGCTACTACGTA
3 GCAGAGCCGATGATGCATTTGCGCGCGTATATAGCTATAGATCGATCGATAGCCAGAGCCGATGATGCAT
Gene 2: growth stimulating protein. The following is the portion of gene 2 that is inserted near Gene 1;
the bases of one codon are underlined to indicate the reading frame.
5 TCTCGGCTACTACGTAAACGCGCGCATATATCGATATCTAGCTACTATCGGTCTCGGCTACTACGTAAAC
3 AGAGCCGATGATGCATTTGCGCGCGTATATAGCTATAGATCGATCATAGCCAGAGCCGATGATGCATTTG
Question 8
In nature, the influenza A virus has persisted in wild aquatic birds for millions of years and does not
typically produce harmful effects. This is a single (-) stranded, segmented, RNA virus that does not
replicate via a DNA intermediate. Its genome is comprised of 8 distinct RNA strands that together
encode 10 different proteins. The following is a schematic of the influenza virus.
Hemagglutinin
Neuraminidase
Matrix Protein
Lipid Bilayer
Nucleoprotein
RNA
(a) Influenza virus is unable to make more viral RNA genome within the host cells using exclusively
the host cell proteins.
i. Explain why that is so.
This being a negative(-) stranded RNA virus can not be converted by the host cell machinery to a
positive (+) RNA that has the same polarity as mRNA and is needed for translation.
ii. Explain how the virus overcomes this issue and replicates its genome in the host.
It solves this problem by bringing along its own RNA dependant RNA polymerase enzyme at the time of
infection. Also RNA is less stable than DNA due to the presence of extra OH group at 2C position of ribose
sugar.
(b) Explain why the influenza A virus can rapidly mutate to produce new variants.
The RNA dependant RNA polymerase has no proofreading activity thus increasing the frequency of
mutation that leads to the production of new strains.
(c) You decide to generate vaccine against Influenza A virus using either a live-attenuated form of the
virus or heatkilled viral particles.
i. Which of these two vaccine strategies produces both antibody and Tc mediated immune
responses? Explain why.
Live-attenuated form of virus will produce both the responses. The virus is still replicating although at a very
slow pace and hence the viral proteins can presented on the surface of infected cells through MHC1
leading to a Tc mediated cell killing or through MHC-II by Antigen presenting cells leading to a TH and B
cell mediated humoral immune response.
ii. If the vaccine generated against the virus leads to a cell mediated immune response,
name the proteins/enzymes (secreted by the cytotoxic T cells) that cause the killing of
virus infected cells and propose a mechanism through which they do so.
Perforins that kill the virus infected cells by creating holes and making it leaky.
Granzymes that promote apoptosis of virus infected cells
iii. If the vaccine generated results only in a humoral response and production of
antibodies.
Identify the most likely components of the virus, from the diagram provided at the
beginning of this question, to which the raised antibodies will bind.
Hemagglutinin (HA) and neuraminidase (NA) since these are exposed at the viral surface.
Question 8 continued
Propose a mechanism through which the secreted antibodies can counteract the
viral infection.
The secreted antibodies can bind to antigens located at the viral surface. Thus the virus gets coated by the
antibodies and in this form it can be engulfed and digested by macrophage. This process is also called
opsonization.
(d) If an individual is exposed a second time to same strain of Influenza A virus, the secondary immune
response observed is much faster and stronger than the primary response. Propose an explanation for
an increase in the rate and strength of the secondary immune response.
The individual already has the memory TH and memory B cells that were produced during the primary
exposure. These cells can proliferate to produce more memory cells and the plasma cells that produce and secrete
antibodies which lead to humoral immune response.
(e) Pigs can be infected both by the avian and human forms of the Influenza virus. This allows them to
act as virus mixing bowls in which the two viral strains can readily exchange RNA strands. Thus the
virus that emerges from such double-infected species can represent a unique assortment of genes,
generating new strains of virus. The HIN1 virus that causes Swine flu is one such example. Why is a
newly emerged virus considered a threat that is significant enough to cause a global pandemic,
compared to a seasonal viral strain?
Newly emerged virus may have surface antigens which have never been encountered by the
immune system of the human population. This may therefore cause a global pandemic.
(f) You come across a patient who is suffering from a mysterious illness that kills the brain cells. You
grind the damaged brain cells and treat them separately in vitro with DNAse, RNAse, proteases and
UV. You use the treated samples to infect normal mice. You observe that all these samples, except the
one treated with proteases, can cause the same illness in infected mice. Based on the data provided,
what is the most likely cause of this illness?
This disease is caused by an infectious protein particle that are often called prions.
Question 9
You have started up a company to produce a vaccine against a particular DNA virus that causes
disease in humans. To begin with, you want to screen the viral genes to identify those which encode
proteins that can be used as potential antigens to create this vaccine.
(a) Why would you make a viral genomic library, rather than a cDNA library, to screen for viral genes?
The cDNA library is prepared from mature mRNA (that have no introns but only exons) and is used to look for
those genes that are specifically expressed in a cell. However, this is not required in the viruses since they have no
introns. Their mRNA can be directly translated into proteins or polyproteins without any need for splicing. A
cDNA library made from a virus infected cell is a library of genes expressed in the cell will include not only viral
genes but also cellular genes (and a lot more cellular genes than viral ones) and would therefore be useless in
trying to make a viral DNA library.
(b) Shown below are the restriction sites for four restriction enzymes. Cutting sites are indicated by a slash
(/).
Usually, fragments cut with different restriction enzymes cannot be ligated together. However, DNA
fragments cut with enzyme X and enzyme Y can be ligated together.
i. Based on the sequences given above, write the 6-base pair sequence of the double-
stranded DNA molecule at the site of ligation of an X-cut DNA fragment to a Y-cut DNA
fragment. Be sure to indicate the 5 and 3 ends of each DNA strand.
5CCCGGA3 or 5TCCGGG3
3GGGCCT5 3AGGCCC5
ii. Will the resulting sequence be cut by circle Yes or No for each:
Question 9 continued
(c) You will use one of the three plasmids shown in the schematic below as the cloning vector to make
your library. Assume that you would clone fragments of the viral DNA into the restriction site X. You
plan to select the transformed bacteria on Tetracycline media. Circle the best choice of vector for your
experiment. Explain Xwhy you selected this option.
Tetr Tetr Tetr
Bacterial
Bacterial promoter
promoter
X X Ampr
Ampr
Bacterial Bacterial
Origin Origin
The plasmid needs a bacterial origin of replication so that it can replicate in bacteria (this feature is absent in
plasmid #3). It also needs the Tetracyclin resistant gene that has no recognition site for the restriction
enzyme X (unlike that observed in plasmid #1). Therefore plasmid #2 is the best option.
(d) After you have transformed E. coli cells with your library, you grow them on media containing
Tetracycline to select for the bacterial cells that have been transformed. What additional selective media
would you replica-plate these colonies onto to identify the clones that contain viral DNA?
(e) After various DNA based assays, you identify one colony that contains a gene which encodes a viral
protein to use as the basis of your vaccine. You decide to express it in the milk of transgenic cows in
order to produce it in large quantities. You need to fuse the viral gene to a cow-specific promoter so it
will be expressed in the cow cells. For the promoter you choose, under what condition(s) and in what
cell type(s) should the promoter be active? Explain.
You would select a mammary gland specific which is active (expresses protein) in the mammary gland
constitutively, so that the protein will be expressed in the cows milk and will always be produced.
(f) You transfer the viral gene into a new plasmid vector to introduce it into cow cells. From the choices
below
Bacterial Ampr Ampr Ampr
promoter
Cow Cow
R R R
promoter promoter
Y Y Y
Tetr Tetr
Tetr
Bacterial
Cow Cow Origin
Origin Origin
Question 9 continued
ii. One way to make your transgenic cow is to have the viral gene insert into the cow
genome. If you are employing this approach and do not want the original plasmid
vector to be maintained in the cow, which vector could you use? #6
(g) You introduce the recombinant vector into embryonic cow cells in culture. Before you start growing
up transgenic cows, you decide to check the sequence of the transgene in the cells to make sure it is
correct. You will first PCR amplify your gene of interest, then sequence the PCR product. You have
three primers which anneal to your DNA construct as diagrammed below:
Promoter
3
5 3
3 Viral Gene 5
1 2
From the list below, check each item to indicate which reaction(s), if any, it should be added to.
(h) Finally, you use specific antibodies to purify the viral protein from the cows milk. Circle the part(s)
of the antibody which will bind to the viral protein.
Question 10
An important set of neural connections is between motor neurons of the spinal cord and their target
muscles in the limbs. Lateral neurons express the transcription factor LIM-1 and the receptor tyrosine
kinase EPH-4, and innervate (grow towards and create synapses with) dorsal limb muscles. In contrast,
medial neurons express the transcription factor ISL-1, do not express EPH-4, and innervate the ventral
limb muscles. Both dorsal and ventral limb muscles express and secrete ephrin-4, the ligand for the
EPH-4 receptor.
(a) In order to ask whether LIM-1 and ISL-1 play a role in axonal pathfinding, researchers introduced a
LIM-1 expressing construct into developing medial neurons. The resulting neurons expressed EPH-4
and innervated dorsal limb muscle rather than ventral. Conversely, expressing ISL-1 in lateral neurons
prevented LIM-1 and EPH-4 expression, and the resulting neurons innervated ventral muscle, rather
than dorsal muscle. Diagram the regulatory relationships between EPH-4, LIM-1, ISL-1, and dorsal
muscle innervation that you can derive from these results. In your diagram, use an to indicate
that it activates and a to indicate inhibition.
(b) Axon pathfinding takes place in immature neurons. Once axons find their targets on the muscle,
chemical synapses form to create the neuromuscular junctions. In the term chemical synapse, to what
class of molecules does chemical refer?
Neurotransmitter.
Pre-synapatic
neuron
Ach
vesicles
Axon terminus
Ca++ Ca++
Synaptic cleft
Ach
Receptors
(c) In Myasthenia gravis, that targets the Ach receptor, muscles fail to contract, leading to profound
weakness. Explain one type of change in Ach receptor that could cause this disorder, and why.
Any loss of function (i.e. blocking Ach receptor binding site, conformation change etc) in the gene encoding for
the Ach receptor can cause this disorder by preventing muscle from receiving the signal (from pre-synaptic
neuron) so that it can contract.
(d) Lambert-Eaton syndrome is associated with the production of antibodies to pre-synaptic voltage-
gated calcium channels. Explain why such antibodies cause a decrease in muscle contraction in affected
individuals relative to normal individuals.
The antibodies will prevent calcium influx through voltage gated calcium channels that will cause the failure of
vesicles to fuse with the plasma membrane and release the Ach in the synaptic cleft leading to decreased
or no muscle contraction.
(e) Botulism is an illness caused by Botulinum toxin, produced by the bacterium Clostridium
botulinum. The toxin inactivates synaptobrevin, a membrane protein of synaptic vesicles, required for
exocytosis. Would the frequency of muscle contraction increase or decrease in patients with Botulism
relative to unaffected individuals? Explain.
The muscle contraction will decrease since exocytosis of vesicles is required for the release of Ach in
the synaptic cleft which binds to its specific Ach receptors located on muscles to trigger muscle contraction
(f) Dementia with Lewy Bodies (DLB) is a major cause of senile dementia, similar to Alzheimers. The
disorder can be treated with Acetylcholinesterase, and Ach receptors are normal in these patients.
What is the most likely cause of DLB?
It is either an increased release of Ach by the presynaptic neurons or a defective acetylcholinesterase
enzyme that fails to digest the Ach that has been released in the synaptic cleft.
Endothelial cells
Kupffer cells
Hepatocytes
Sinusoids
HepaHope is a bioengineering company that is testing a hybrid liver. This consists of a suspension of
single hepatocytes on a synthetic support. It works like a kidney dialysis machine, filtering the patients
blood to remove ammonia and detoxify wastes. One issue with this device is that the hepatocytes
constantly need replenishing, as they stop functioning about 24 hours after being added to the device.
(a) In general what structural aspect of the normal liver is missing from the HepaHope device?
The complex 3D-conformation and the surrounding niche is missing.
(b) You consult with the company and suggest that hepatocyte function may be prolonged by addition
of signaling molecules. You decide to test ligands from four major signaling pathways to see if they
prolong liver cell function. These ligands are Fgf3, Delta, Wnt8 and BMP4. Factors are tested in
combination, with the encouraging results below.
Factor Hepatocyte Function (hours)
No factors 24
All four factors 72
BMP+Wnt8+Fgf 72
BMP+Fgf+Delta 24
Wnt8+Fgf+Delta 72
i. Which ligand(s) is most important in prolonging the liver function? What next factor
combination(s) would you assay to test the ligands that you identified?
Wnt 8 appears to be essential either alone or in combination with Fgf. One may assay wnt8 alone, compred with
wnt8+Fgf, to determine whether Fgf is required.
(c) Hepatocytes have a half-life (time of survival) of about 10 days. BrdU is a thymine analog that is
incorporated normally into DNA, but is used in a pulse/chase assay to distinguish DNA synthesized
during the pulse. Describe a pulse/chase experiment with BrdU that would measure hepatocyte half-
life.
(d) Damaged liver can regenerate well, suggesting the involvement of liver stem cells. Some evidence
suggests that that Kupfer cells are liver stem cells. How would you test whether Kupfer cells are stem
cells, using a transplant approach? Note: Carbon tetrachloride treatment can be used to specifically destroy
the liver.
Destroy the liver cells of a mouse using carbon tetrachloride. Transplant Kupfer cells from a healthy liver into the
mouse. If the Kupfer cells are stem cells, liver will be able to regenerate and mouse will be OK.
(e) The sinusoids are tubes that arise from single cells that associate to form a sheet which eventually
forms a tube. What is the term for conversion of single cells to cell sheets?
(f) What changes will the following perturbations have on single cells versus cell sheets? Your options
are: death; adhesion; movement; shape; no change. For each perturbation, select the most likely option(s)
and explain your choice.
No change Adhesion These are involved in holding the epithelial cells of the
Tight junction sheet together.
disruption
liver
(b) Hepatocytes are differentiated liver cells. HNF4a is a hepatocyte-specific transcription factor
necessary for activation of all liver differentiation genes, including albumin. In order to understand
the mechanism by which HNF4a acts, you express HNF4a in the developing pancreas, which is also
derived from endoderm. In this case, expression of albumin and other liver-specific genes is not
activated. Explain this observation.
HNF-4 is functional only in the cells that are committed to become liver cells. It does not activate albumin in
pancreatic cells. It is also possible that the developing pancreas expresses a protein that acts as an inhibitor of
HNF-4.
(c) DNMT is a DNA methylase, expressed throughout development, which adds methyl groups to
cytosine. You decide to regenerate animals by SCNT using the nuclei either from adult hepatocytes, 40
hour embryonic hepatocytes, or 40 hour hepatocytes treated with an inhibitor of the DNA methlyase
DNMT. Which of the three nuclei would be the best choice? Explain why you would prefer one over
the other.
40 hour hepatocytes treated with an inhibitor of the DNA methlyase DNMT will be the best choice. Since
the methylation pattern are important for proper gene regulation and should be as close to the early
embryonic state as possible for successful regeneration of animals by SCNT.